Diagnosis of cancer on the basis of small non-coding RNA methylation status

EP4680767A1Pending Publication Date: 2026-01-21HUMMINGBIRD DIAGNOSTICS GMBH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
EP2024708223
Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-03-15
Filing Date
2024-03-05
Publication Date
2026-01-21

AI Technical Summary

Technical Problem

Current molecular cancer diagnostics lack effective methods for early-stage cancer detection, particularly using the methylation status of small non-coding RNA in biological samples.

Method used

A method utilizing a combination of 5' and 3' adapters capable of forming stem-loop structures to determine the methylation status of small non-coding RNA in biological samples, specifically using Dumbbell PCR and reverse transcription under limiting conditions to differentiate between cancerous and healthy samples.

Benefits of technology

Enables the discrimination of cancerous biological samples from healthy ones by quantifying methylation status, allowing for the diagnosis of early-stage cancer, particularly through the analysis of peripheral blood samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure EP2024055699_19092024_PF_FP_ABST
    Figure EP2024055699_19092024_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to the use of a methylation status of small non-coding RNA to diagnose cancer in a patient / to determine whether a patient suffers from cancer. In addition, the present invention relates to a method for diagnosing cancer in a patient / determining whether a patient suffers from cancer by determining a methylation status of small non-coding RNA in a biological sample.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] DIAGNOSIS OF CANCER ON THE BASIS OF SMALL NON-CODING RNA

[0002] METHYLATION STATUS

[0003] The present invention relates to the use of a methylation status of small non-coding RNA to diagnose cancer in a patient / to determine whether a patient suffers from cancer. In addition, the present invention relates to a method for diagnosing cancer in a patient / determining whether a patient suffers from cancer by determining a methylation status of small non-coding RNA in a biological sample.

[0004] BACKGROUND OF THE INVENTION

[0005] Molecular diagnostics has increasingly gained in importance. It has found an entry into the clinical diagnosis of diseases (inter alia detection of infectious pathogens, detection of mutations of the genome, detection of diseased cells and identification of risk factors for predisposition to a disease). In particular, through the determination of gene expression in biological samples such as body fluids and tissues, nucleic acid analysis opens up very promising new possibilities in the study and diagnosis of diseases.

[0006] Nucleic acids of interest to be detected in molecular diagnostics include small non-coding RNAs. Small non-coding RNAs, particularly with a length of between 18 to 50 nucleotides (nt), are found intracellularly and in extracellular environments, including body fluids such as blood.

[0007] A subclass of small non-coding RNAs, so called microRNAs (miRNAs) or their variants having specific terminal sequences (isomiRs), possess regulatory functions such as gene expression regulation of protein-encoding messenger RNAs (mRNAs).

[0008] In the last two decades, other short non-coding RNAs with regulatory functions were described, such as fragments of ribosomal RNA (rRNA), transfer RNA (tRNA), small nucleolar RNA (snoRNA), and others. A plethora of short RNA fragments with no described regulatory function can be readily found in biological RNA samples. This is likely the result of (active or passive) fragmentation of longer precursor RNAs.

[0009] The determination of the level of small non-coding RNAs such as miRNAs in a biological sample obtained from a patient in order to diagnose cancer is known in the art. However, there is still a need to develop new diagnostic methods to improve molecular cancer diagnostics.

[0010] RNAs can be post-transcriptionally edited by chemical modifications such as methylation (m), oxidation, pseudouridylation, etc., which can target a nucleotide base (e.g. methyl-6-adenine, pseudouridine) or a ribose ring (2 ’-ortho-methylation, 2'-O-m). Especially, rRNA is known to contain many pseudouridylation and 2'-O-m sites and these modifications contribute to the folding, stability, and RNase resistance of the ribosome. It has been previously shown that the 2'-O-m sites are modified to various extents (40-100% stoichiometry).

[0011] Several prior works have investigated methylation profiles on tissue or liquid biopsy samples. However, no one has investigated whether the methylation status of small non-coding RNA of tissue or liquid biopsy samples can be used for cancer detection.

[0012] Some time ago, the present inventors have developed a Dumbbell PCR (DB PCR) based method, which exploits the ability of a double stranded RNA ligase, particularly RNA ligase 2 (Rnl2), to specifically join the nicks in a hybridized double stranded RNA molecule. Only correctly hybridized adaptors both to the 5’ and the 3 ’end of the target RNA such as miRNAs or isomiRs enable the formation of the ligated RNA that can be used as template for cDNA synthesis. This method is able to specifically and efficiently determine and quantify the expression of target RNA (e.g. miRNA) as well as of target RNA variants having specific terminal sequences (e.g. isomiR).

[0013] Previously, the present inventors have adapted this method to limiting reverse transcription (RT) conditions and used it for the detection of the methylation status of small non-coding RNA.

[0014] The present inventors have now found that the determination of the methylation status of small non-coding RNA allows to discriminate biological samples of cancer patients from biological samples of non-cancer, i.e. healthy, control subjects. Specifically, the present inventors have now found that the determination of the methylation status of small non-coding RNA extracted from a biological sample such as peripheral blood allows to diagnose cancer such as early-stage cancer in a patient.

[0015] SUMMARY OF THE INVENTION

[0016] In a first aspect, the present invention relates to the use of a methylation status of small non-coding RNA (in a biological sample) to diagnose cancer in a patient / to determine whether a patient suffers from cancer. In a preferred embodiment, a combination of

[0017] (i) a 5 ’adapter capable of forming a stem-loop structure containing a loop and a double stranded stem, and

[0018] (ii) a 3 ’adapter capable of forming a stem-loop structure containing a loop and a double stranded stem is used for determining the methylation status of small non-coding RNA (in a biological sample) to diagnose cancer in a patient / to determine whether a patient suffers from cancer.

[0019] In a second aspect, the present invention relates to a method for diagnosing cancer in a patient / for determining whether a patient suffers from cancer comprising the step of: determining a methylation status of small non-coding RNA in a biological sample obtained from a patient.

[0020] This summary of the invention does not necessarily describe all features of the present invention. Other embodiments will become apparent from a review of the ensuing detailed description.

[0021] DETAILED DESCRIPTION OF THE INVENTION

[0022] Definitions

[0023] Before the present invention is described in detail below, it is to be understood that this invention is not limited to the particular methodology, protocols and reagents described herein as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

[0024] Preferably, the terms used herein are defined as described in “A multilingual glossary of biotechnological terms: (IUPAC Recommendations)”, Leuenberger, H.G.W, Nagel, B. and Kolbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland).

[0025] Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, GenBank Accession Number sequence submissions etc.), whether supra or infra, is hereby incorporated by reference in its entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. In the event of a conflict between the definitions or teachings of such incorporated references and definitions or teachings recited in the present specification, the text of the present specification takes precedence.

[0026] The term “comprise” or variations such as “comprises” or “comprising” according to the present invention means the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers. The term “consisting essentially of’ according to the present invention means the inclusion of a stated integer or group of integers, while excluding modifications or other integers which would materially affect or alter the stated integer. The term “consisting of’ or variations such as “consists of’ according to the present invention means the inclusion of a stated integer or group of integers and the exclusion of any other integer or group of integers. The terms “a” and “an” and “the” and similar reference used in the context of describing the invention (especially in the context of the claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0027] As used herein, the term “about” indicates a certain variation from the quantitative value it precedes. In particular, the term “about” allows a ±5% variation from the quantitative value it precedes, unless otherwise indicated or inferred. The use of the term “about” also includes the specific quantitative value itself, unless explicitly stated otherwise. For example, the expression “about 80°C” allows a variation of ±4°C, thus referring to range from 76°C to 84°C.

[0028] Molecular diagnostics has increasingly gained in importance. Nucleic acids of interest to be detected in molecular cancer diagnostics include RNA.

[0029] The term “target RNA”, as used herein, refers to a ribonucleotide sequence that is sought to be detected. The target RNA may be obtained from any source and may comprise any number of different compositional components. For example, the target RNA is isolated from organisms, tissues, cells, or body fluids such as blood. Specifically, the target RNA encompasses non-coding RNA.

[0030] Preferably, the target RNA is small non-coding RNA. Particularly, the small non-coding RNA has a length of < 200 ribonucleotides, more particularly a length of between 10 and < 200 ribonucleotides, even more particularly a length of between 10 and 100 ribonucleotides, and still even more particularly a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38,

[0031] 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64,

[0032] 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90,

[0033] 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112,

[0034] 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131,

[0035] 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150,

[0036] 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169,

[0037] 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188,

[0038] 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides.

[0039] More preferably, the small non-coding RNA is a miRNA, a miRNA isoform (an isomiR), a ribosomal RNA fragment (rRNA fragment), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment.

[0040] Further, it will be appreciated that the term “target RNA” may refer to the target RNA itself as well as to surrogates thereof, for example, amplification products (e.g. cDNA derived therefrom) and native sequences. In certain embodiments, the target RNA lacks a poly-A tail. The target RNA described herein may be derived from any number of sources, including without limitation, humans and animals. These sources may include, but are not limited to, whole blood, a tissue biopsy, lymph, bone marrow, amniotic fluid, hair, skin, semen, biowarfare agents, anal secretions, vaginal secretions, perspiration, saliva, or buccal swabs. However, various environmental samples (for example, agricultural, water, and soil), research samples generally, purified samples generally, cultured cells and lysed cells may also be used as samples.

[0041] Furthermore, it will be appreciated that target RNAs may be isolated from samples using any of a variety of procedures known in the art, for example, the Applied Biosystems ABI Prism® 6100 Nucleic Acid PrepStation (Life Technologies, Foster City, CA) and the ABI Prism® 6700 Automated Nucleic Acid Workstation (Life Technologies, Foster City, CA), Ambion® mirVana™ RNA isolation kit (Life Technologies, Austin, TX), and the like.

[0042] The term “small non-coding RNA”, as used herein, refers to functional RNA that is not translated into protein. Small non-coding RNA has diverse functionally important roles, which involve, particularly in conjunction with other molecules, gene regulation through RNA interference, RNA modification, or spliceosome involvement.

[0043] Preferably, the small non-coding RNA has a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125,

[0044] 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144,

[0045] 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163,

[0046] 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182,

[0047] 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. Most preferably, the (above-mentioned) small non-coding RNA is a miRNA, a miRNA isoform (an isomiR), a ribosomal RNA fragment (rRNA fragment), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment and similar. The rRNA fragment is particularly favoured.

[0048] The term “miRNA” (the designation “microRNA” is also possible), as used herein, refers to a single-stranded RNA.

[0049] Preferably, the miRNA has a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,

[0050] 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58,

[0051] 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84,

[0052] 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107,

[0053] 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126,

[0054] 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145,

[0055] 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164,

[0056] 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183,

[0057] 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. The miRNAs regulate gene expression and are encoded by genes from whose DNA they are transcribed but miRNAs are not translated into protein (i.e. miRNAs are non-coding RNAs). The genes encoding miRNAs are longer than the processed mature miRNA molecules. The miRNA is initially transcribed as a longer precursor molecule (>1000 nucleotides long) called a primary miRNA transcript (pri-miRNA). Pri-miRNAs have hairpin structures that are processed by the Drosha enzyme (as part of the microprocessor complex). After Drosha processing, the pri-miRNAs are only 60-100 nucleotides long, and are called precursor miRNAs (pre-miRNAs). At this point, the pre-miRNA is exported to the cytoplasm, where it encounters the Dicer enzyme. Dicer cuts the miRNA in two, resulting in duplexed miRNA strands. Traditionally, only one of these miRNA arms was considered important in gene regulation: the arm that is destined to be loaded into the RNA-induced silencing complex (RISC), and occurs at a higher concentration in the cell. This is often called the “guide” strand and is designated as miR. The other arm is called the “minor miRNA” or “passenger miRNA”, and is often designated as miR*. It was thought that passenger miRNAs were completely degraded, but deep sequencing studies have found that some minor miRNAs persist and in fact have a functional role in gene regulation. Due to these developments, the naming convention has shifted. Instead of the miR / miR* name scheme, a miR-5p / miR-3p nomenclature has been adopted. By the new system, the 5’ arm of the miRNA is always designated miR-5p and the 3’ arm is miR-3p. The present nomenclature is as follows: The prefix “miR” is followed by a dash and a number, the latter often indicating order of naming. For example, hsa- miR-16 was named and likely discovered prior to hsa-miR-342. A capitalized “miR-” refers to the mature forms of the miRNA (e.g. hsa-miR-16-5p and hsa-miR-16-3p), while the uncapitalized “mir-” refers to the pre-miRNA and the pri-miRNA (e.g. hsa-mir-16), and “MIR” refers to the gene that encodes them. However, as this is a recent change, literature will often refer to the original miR / miR* names. After processing, the duplexed miRNA strands are loaded onto an Argonaute (AGO) protein to form a precursor to the RISC. The complex causes the duplex to unwind, and the passenger RNA strand is discarded, leaving behind a mature RISC carrying the mature, single stranded miRNA. The miRNA remains part of the RISC as it silences the expression of its target genes. While this is the canonical pathway for miRNA biogenesis, a variety of others have been discovered. These include Drosha-independent pathways (such as the mirtron pathway, snoRNA-derived pathway, and shRNA-derived pathway) and Dicer-independent pathways (such as one that relies on AGO for cleavage, and another which is dependent on tRNaseZ).

[0058] The term “miRBase”, as used herein, refers to a well-established repository of validated miRNAs. The miRBase (www.mirbase.org) is a searchable database of published miRNA sequences and annotation. Each entry in the miRBase Sequence database represents a predicted hairpin portion of a miRNA transcript (termed mir in the database), with information on the location and sequence of the mature miRNA sequence (termed miR). Both hairpin and mature sequences are available for searching and browsing, and entries can also be retrieved by name, keyword, references and annotation. All sequence and annotation data are also available for download. In October 2018, miRbase version 22.1 was released. This is the current version.

[0059] The term “isomiR” (or “miRNA isoform”), as used herein, refers to a miRNA that varies slightly in sequence, which results from variations in the cleavage site during miRNA biogenesis or by processes which affect the mature miRNA after the biogenesis has occurred, such as oligouridylation. In particular, imprecise cleavage of Drosha and Dicer or the turnover of miRNAs can result in miRNAs that are heterogeneous in length and / or sequence. IsomiRs (miRNA isoforms) can be divided into three main categories: 3' isomiRs (trimmed or addition of one or more nucleotides at the 3' position), 5' isomiRs (trimmed or addition of one or more nucleotides at the 5' position), and polymorphic isomiRs (some nucleotides within the sequence are different from the wild type mature miRNA sequence). It could be envisioned that the increased expression of miRNA variants, or individual isomiRs, lead to the loss or weakening of the function of the corresponding wild-type mature miRNA or result in the regulation of a different transcriptome. Recent studies suggest that isomiRs probably play vital roles in a variety of cancers, tissues, and cell types. The detection of miRNAs as well as isomiRs is, thus, absolutely required to accurately reflect the underlying biological situation and to make the right decisions.

[0060] The term “ribosomal RNA fragment (rRNA fragment)”, as used herein, refers to a fragment derived from a ribosomal RNA (rRNA). Ribosomal RNAs (rRNAs) form a group that includes four (5S, 5.8S, 18S, 28S) rRNAs encoded by the human nuclear genome and two (12S, 16S) by the mitochondrial genome. rRNAs constitute the most abundant RNA type in eukaryotic cells. Preferably, the rRNA fragment has a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126,

[0061] 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145,

[0062] 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164,

[0063] 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183,

[0064] 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides.

[0065] The term “transfer RNA fragment (tRF)”, as used herein, refers to a fragment derived from a transfer RNA. A transfer RNA (tRNA) is a ribonucleic acid which mediates the correct amino acid to the corresponding codon on the mRNA during translation. Transfer RNAs (tRFs) are produced from pre-tRNAs or mature tRNAs. Based on the incision loci, tRFs are classified into several types: tRF-1, tRF-2, tRF-3, tRF-5, and i-tRF. Some tRFs participate in posttranscriptional regulation through microRNA-like actions or by displacing RNA binding proteins and regulating protein translation by promoting ribosome biogenesis or interfering with translation initiation. Other tRFs prevent cell apoptosis by binding to cytochrome c or promoting virus replication.

[0066] Preferably, the tRNA fragment has a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,

[0067] 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58,

[0068] 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84,

[0069] 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107,

[0070] 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126,

[0071] 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145,

[0072] 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164,

[0073] 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183,

[0074] 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides.

[0075] The term “small nucleolar RNA (snorRNA) fragment”, as used herein, refers to a fragment derived from a small nucleolar RNA. Small nucleolar RNA molecules are a class of small RNA molecules that primarily guide chemical modifications of other RNAs, mainly ribosomal RNA, transfer RNA, and small nuclear RNAs. There are two main classes of snoRNA, the C / D box snoRNAs and the H / ACA box snoRNAs. The C / D box snoRNAs are associated with methylation. SnoRNAs are commonly referred to as guide RNAs but should not be confused with the guide RNAs that direct RNA editing in trypanosomes. Preferably, the snorRNA fragment has a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,

[0076] 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58,

[0077] 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84,

[0078] 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107,

[0079] 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126,

[0080] 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145,

[0081] 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164,

[0082] 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183,

[0083] 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides.

[0084] The term “disease”, as used herein, refers to an abnormal condition that affects the body of an individual. A disease is often construed as a medical condition associated with specific symptoms and signs. In humans, the term “disease” is often used more broadly to refer to any condition that causes pain, dysfunction, distress, social problems, or death to the individual afflicted, or similar problems for those in contact with the individual. In this broader sense, it sometimes includes injuries, disabilities, disorders, syndromes, infections, deviant behaviors, and atypical variations of structure and function, while in other contexts and for other purposes these may be considered distinguishable categories. Diseases usually affect individuals not only physically, but also emotionally, as contracting and living with many diseases can alter one’s perspective on life, and one’s personality. One form of a disease is cancer.

[0085] The present inventors surprisingly found that the methylation status of small non-coding RNA can be used / allows to diagnose cancer in a patient / to determine whether a patient suffers from cancer.

[0086] The term “cancer”, as used herein, refers to or describes a physiological condition in a patient that is typically characterized by unregulated cell growth. Specifically, abnormal cells grow uncontrolled anywhere in the body of the patient and form a mass of cancer cells. The abnormal cells are termed cancer cells, malignant cells, or tumor cells. The term “cancer”, as used herein, also encompasses cancer metastases.

[0087] It is preferred that the cancer is early-stage cancer such as cancer of stage I. It is more preferred that the cancer is early-stage lung cancer such as lung cancer of stage I.

[0088] Alternatively, it is preferred that the cancer is lung cancer. It is more preferred that the lung cancer is early stage lung cancer such as lung cancer of stage I. The term “early stage cancer”, as used herein, refers to cancer that is early in its growth. It has not grown deeply into nearby tissues. In addition, it has not spread to other parts of the body of a patient. No metastasis has been formed. Specifically, early stage cancer is cancer of stage I.

[0089] Preferably, the cancer is lung cancer. The term “lung cancer”, as used herein, refers to a disease which consists of uncontrolled cell growth in tissues of the lung. This growth may lead to metastasis, which is the invasion of adjacent tissue and infiltration beyond the lungs. The vast majority of primary lung cancers are carcinomas of the lung, derived from epithelial cells. Lung cancer is the most common cause of cancer-related death in men and women. The most common symptoms are shortness of breath, coughing (including coughing up blood), and weight loss.

[0090] Lung cancer can occur in stages I, II, III, or IV. Specifically, lung cancer can be staged as follows:

[0091] Stage / means that the cancer is small. It has not grown deeply into nearby tissues. It hasn’t spread to the lymph nodes or other distant organs. Stage I can also be designated as early lung cancer. Stage I can be divided into IA and IB.

[0092] Stage IA means the cancer is 3 cm or smaller.

[0093] Stage IB means the cancer is between 3 cm and 4 cm. It might also be growing into structures such as: the main airway of the lung (main bronchus) or the membrane covering the lung (visceral pleura).

[0094] Stage II means that the cancer is still small. However, it has grown more deeply into nearby tissues and perhaps the lymph nodes, but not into other parts of the body. Stage II can be divided into stage IIA and IIB. Part of the affected lung might have collapsed.

[0095] Stage IIA means that the cancer is between 4 cm and 5 cm in size but there are no cancer cells in any lymph nodes.

[0096] Stage IIB means that the cancer is up to 5 cm in size and there are cancer cells in the lymph nodes close to the affected lung. Alternatively, it is between 5 cm and 7 cm but there are no cancer cells in any lymph nodes. Alternatively, the cancer is not in any lymph nodes but has spread into one or more of the following areas: the chest wall (ribs, muscle or skin), the nerve close to the lung (the phrenic nerve), or the layers that cover the heart (mediastinal pleura and parietal pericardium). Alternatively, the cancer is less than 7 cm but there is more than one tumor in the same lobe of the lung.

[0097] Stage III can be divided into stage III A, IIIB and IIIC. It is sometimes called locally advanced lung cancer.

[0098] In stage III A, the cancer is up to 5cm in size and has spread to the lymph nodes in the center of the chest on the same side as the tumor. Alternatively, the cancer it is between 5 cm and 7 cm and there is more than one tumor in the same lobe of the lung. Alternatively, the cancer has spread into one or more of the following areas just outsi de the lung: the chest wall (ribs, muscle or skin), the nerve close to the lung (the phrenic nerve), the layers that cover the heart (mediastinal pleura and parietal pericardium), or lymph nodes in the lung or close to the lung. Alternatively, the cancer is larger than 7 cm. It hasn't spread into lymph nodes but has spread into one or more of the following areas: the muscle under the lung (diaphragm), the center area of the chest (mediastinum), the heart, a main blood vessel, the wind pipe (trachea), the nerve that goes to the voice box (larynx), the food pipe (oesophagus), a spinal bone, or the area where the wind pipe divides (the carina). Alternatively, the cancer is in more than one lobe of the same lung and there might also be cancer cells in lymph nodes close to the affected lung.

[0099] Stage IIIB can also mean different things. The cancer is less than 5 cm and has spread into lymph nodes in one of these places: the opposite side of the chest from the affected lung, the neck, or above the collarbone. Alternatively, the cancer is between 5 cm to 7 cm and has spread into lymph nodes in the center of the chest. Alternatively, the cancer is any size, has spread into lymph nodes in the center of the chest, and has spread into one or more of the following areas: the chest wall, the muscle under the lung (diaphragm), or the layers that cover the heart (mediastinal pleura and parietal pericardium). Alternatively, the cancer has spread into the lymph nodes in the center of the chest. The lung tumor is more than 7 cm or it has spread into a major structure in your chest such as: the heart, the wind pipe (trachea), the food pipe (oesophagus), or a main blood vessel.

[0100] Stage IIIC means the cancer is between 5c m and 7 cm in size or has spread into one or more of the following: the nerve close to the lung (phrenic nerve) or the covering of the heart (parietal pericardium) and it has spread into lymph nodes: in the center of the chest on the opposite side from the affected lung or at the top of the lung on the same side or opposite side or above the collar bone. Alternatively, there is more than one tumor in a different lobe of the same lung. Alternatively, stage IIIC can mean the cancer is bigger than 7 cm or it has spread into one of the following: the muscle under the lung (the diaphragm), the center of the chest (mediastinum), the heart, a major blood vessel, the wind pipe (trachea), the nerve going to the voice box (the recurrent l aryngeal nerve), the food pipe (oesophagus), a spinal bone, or the area where the windpipe di vides (the carina) and it has spread into lymph nodes: in the center of the chest on the opposite side from the affected lung or at the top of the lung on the same side or opposite side or above the collar bone. Alternatively, there are tumors in more than one lobe of the lung.

[0101] Stage IV means that the lung cancer has spread. It can be designated as advanced lung cancer. It is divided into stage IVA and IVB.

[0102] Stage IVA can mean any of the following: there is cancer in both lungs, the cancer is in the covering of the lung (the pl eura) or the covering of the heart (pericardium), or there is fluid around the lungs or the heart that contains cancer cells. Alternatively, it can mean that there is a single area of cancer that has spread outside the chest to a lymph node or to an organ such as the liver or bone.

[0103] Stage IVB means that the cancer has spread to several areas in one or more organs.

[0104] In case cancer of stage II is treatable by means of surgery, cancer of stage II can also be assigned to the category of “early stage cancer”. Thus, “early stage cancer” can encompass both cancer of stage I and II. Preferably, the early stage cancer is lung cancer. More preferably, the early stage cancer is lung cancer of stage I and / or stage II.

[0105] The term “diagnosing cancer”, as used herein, means determining whether a patient shows signs of or suffers from cancer.

[0106] It is preferred that the cancer is early-stage cancer such as cancer of stage I. It is more preferred that the cancer is early-stage lung cancer such as lung cancer of stage I.

[0107] Alternatively, it is preferred that the cancer is lung cancer. It is more preferred that the lung cancer is early stage lung cancer such as lung cancer of stage I and / or stage II.

[0108] The term “patient”, as used herein, refers to any subject for whom it is desired to know whether she or he suffers from cancer. In particular, the term “patient”, as used herein, refers to a subject suspected to be affected by cancer. The patient may be diagnosed to be affected by cancer, i.e. diseased, or may be diagnosed to be not affected by cancer, i.e. healthy. Further, the term “patient”, as used herein, refers to a subject which is affected by cancer, i.e. diseased. The subject may be re-tested for cancer and may be diagnosed as still having cancer or as having no cancer anymore.

[0109] It should be noted that a patient that is diagnosed as being healthy, i.e. not suffering from cancer, may possibly suffer from another disease or condition not tested / known.

[0110] The patient may be any mammal, including both a human and another mammal, e.g. an animal such as a rabbit, mouse, rat, or monkey. Human patients specifically males are particularly preferred.

[0111] The term “(control) subject”, as used herein, refers to a subject known to be not affected by cancer (negative control), i.e. healthy.

[0112] It should be noted that a (control) subject which is known to be healthy, i.e. not suffering from cancer, may possibly suffer from another disease or condition not tested / known.

[0113] The (control) subject may be any mammal, including both a human and another mammal, e.g. an animal such as a rabbit, mouse, rat, or monkey.

[0114] The term “methylated small non-coding RNA”, as used herein, refers to RNA which has been post-transcriptionally edited or modified by methylation. The methylation can occur at a base (e.g. methyl-6-adenine, pseudouridine) and / or ribose ring (2'-ortho-methylated nucleotide (2'-O- m)). The methylation of small non-coding RNA occurring at a base is preferably selected from the group consisting of 6-methyl adenosine (m6A), 5-methylcytidine (m5C), 5-methyluridine (m5U), 3 -methyluridine (m3U), 1 -methyladenosine (nkA), and 1 -methyl guanosine (m'G), or is a combination thereof.

[0115] The 2'-O-methylation of the backbone ribose is the most common and conserved type of small non-coding RNA modification. The methylation of small non-coding RNA occurring at a ribose ring is preferably selected from the group consisting of 3 '-end 2'-O-methyladenosine (Am), 2'-O- methyluridine (Um), 2'-O-methylguanosine (Gm), and 2 '-O-methyl cytidine (Cm), or is a combination thereof.

[0116] The present inventors surprisingly found that the methylation status of small non-coding RNA can be used / allows to diagnose cancer in a patient / to determine whether a patient suffers from cancer. The present inventors observed that the methylation status of small non-coding RNA in a biological sample varies between patients suffering from cancer and healthy control subjects. Specifically, they found that the methylation status of small non-coding RNA in a biological sample varies between patients suffering from lung cancer, particularly lung cancer of stage I, and healthy control subjects. Based on the above, the present inventors concluded that a lower methylation status of small non-coding RNA in a biological sample obtained from a patient compared to the methylation status of the small non-coding RNA in a biological sample obtained from healthy control subjects is indicative for lung cancer, particularly lung cancer of stage I.

[0117] The present inventors have exemplarily analyzed herein the 28 S ribosomal RNA (rRNA) fragment having a nucleotide sequence of 5’ GCCGCCGGUGAAAUACCACUAC 3’ (SEQ ID NO: 16). This rRNA fragment has two methylations sites, namely G (also designated as Gm4020) and C (also designated as Cm4032). While Gm4020 is a variable methylation site, Cm4032 shows a high degree of non-variable methylation. The methylation status of Gm4020 has been calculated / determined herein. A variation of this methylation status (in a 28S ribosomal RNA (rRNA) fragment population) is indicative for the presence of cancer, specifically lung cancer.

[0118] The term “methylation status”, as used herein, refers to the percentage of small non-coding RNA that is methylated in a biological sample. Specifically, the term “methylation status”, as used herein, refers to the percentage of small non-coding RNA molecules that are methylated in a biological sample. The biological sample may be from a patient to be tested or from one or more control subjects. Specifically, the methylation status of small non-coding RNA (molecules) ranges between 100% (i.e. fully methylated, or all detected RNA entities are fully methylated) and 0% (i.e. not methylated, or all detected RNA entities are not methylated). In other words, the methylation status of a population of small non-coding RNA (molecules) ranges between 100% (i.e. fully methylated, or all detected RNA entities in the population are fully methylated) and 0% (i.e. not methylated, or all detected RNA entities in the population are not methylated). Particularly, the percentage of small non-coding RNA (molecules) that is (are) methylated in a biological sample is 0, 1, 2, 3, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22,

[0119] 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48,

[0120] 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74,

[0121] 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or

[0122] 100% . The methylation status of 2’-o-m residues on intact full-length ribosomal RNAs in a biological sample usually varies between 40 and 100%.

[0123] The present inventors have exemplarily shown herein that the afore-mentioned 28 S ribosomal RNA (rRNA) fragment extracted from peripheral blood of a patient suffering from lung cancer has a methylation status which is lower than the methylation status of the same rRNA fragment extracted from peripheral blood of control subjects being healthy, i.e. not suffering from lung cancer. Thus, a methylation status of the afore-mentioned 28 S ribosomal RNA (rRNA) fragment extracted from peripheral blood of a patient which is lower than the methylation status of the same rRNA fragment extracted from peripheral blood of control subjects being healthy, i.e. not suffering from lung cancer, is indicative for lung cancer in the patient and, thus, allows the diagnosis of lung cancer in said patient.

[0124] As mentioned above, the methylation status of Gm4020 of the afore-mentioned 28 S ribosomal RNA (rRNA) has been calculated / determined herein. Accordingly, the methylation status of Gm4020 of the afore-mentioned 28 S ribosomal RNA (rRNA) extracted from peripheral blood of a patient which is lower than the methylation status of Gm4020 of the same rRNA fragment extracted from peripheral blood of control subjects being healthy, i.e. not suffering from lung cancer, is indicative for lung cancer in the patient and, thus, allows the diagnosis of lung cancer in said patient.

[0125] The term “nucleotide”, as used herein, refers to an organic molecule consisting of a nucleoside and a phosphate. In particular, a nucleotide is composed of three subunit molecules: a nucleobase, a five-carbon sugar (ribose or deoxyribose), and a phosphate group consisting of one to three phosphates. The four nucleobases in DNA are guanine, adenine, cytosine and thymine; in RNA, uracil is used in place of thymine. The nucleotide serves as monomeric unit of nucleic acid polymers, such as deoxyribonucleotide acid (DNA) or ribonucleotide acid (RNA). Thus, the nucleotide is a molecular building-block of DNA and RNA.

[0126] The term “nucleoside”, as used herein, refers to a glycosylamine that can be thought of as nucleotide without a phosphate group. A nucleoside consists simply of a nucleobase (also termed a nitrogenous base) and a five-carbon sugar (ribose or 2'-deoxyribose) whereas a nucleotide is composed of a nucleobase, a five-carbon sugar, and one or more phosphate groups. In a nucleoside, the anomeric carbon is linked through a glycosidic bond to the N9 of a purine or the N1 of a pyrimindine.

[0127] The terms “nucleotide sequence” or “polynucleotide” are interchangeably used herein and refer to single-stranded and double-stranded polymers of nucleotide monomers, including without limitation, 2'-deoxyribonucleotides (DNA) and ribonucleotides (RNA) linked by internucleotide phosphodiester bond linkages, or internucleotide analogs, and associated counter ions, e.g., H+, NH4+, trialkylammonium, Mg2+, Na+, and the like. A nucleotide sequence or polynucleotide may be composed entirely of deoxyribonucleotides, entirely of ribonucleotides, or chimeric mixtures thereof and may include nucleotide analogs. The nucleotide monomer units may comprise any of the nucleotides described herein, including, but not limited to, nucleotides and / or nucleotide analogs.

[0128] The term “analog”, as used herein, includes synthetic analogs having modified base moieties, modified sugar moieties, and / or modified phosphate ester moieties. Phosphate analogs generally comprise analogs of phosphate wherein the phosphorous atom is in the +5 oxidation state and one or more of the oxygen atoms is replaced with a non-oxygen moiety, e.g. sulfur. Exemplary phosphate analogs include: phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, boronophosphates, including associated counterions, e.g. H+, NH4+, Na+. Exemplary base analogs include: 2,6-diaminopurine, hypoxanthine, pseudouridine, C-5-propyne, isocytosine, isoguanine, 2-thiopyrimidine. Exemplary sugar analogs include: 2’- or 3’- modifications where the 2’- or 3 ’-position is hydrogen, hydroxy, alkoxy, e.g., methoxy, ethoxy, allyloxy, isopropoxy, butoxy, isobutoxy and phenoxy, azido, amino or alkylamino, fluoro, chloro, and bromo.

[0129] In one embodiment, modified ribonucleotides are present in / part of the adapters described herein. In one preferred embodiment, the modified ribonucleotides are 2’-o-methyl ribonucleotides.

[0130] In the present invention, a combination of a 5 ’adapter and 3 ’adapter is used for determining the methylation status of small non-coding RNA (in a biological sample) to diagnose cancer in a patient / to determine whether a patient suffers from cancer.

[0131] In the context of the present invention, the term “adapter” refers to a polynucleotide that can be ligated to the 5 ’end of small non-coding RNA (i.e. “5 ’adapter”) or to the 3 ’end of small non-coding RNA (i.e. “3’adapter”). The nucleotides of the 5’adapter and the 3’adapter may be standard or natural (i.e. adenosine, guanosine, cytidine, thymidine, and uridine) as well as nonstandard nucleotides. Non-limiting examples of non-standard nucleotides include inosine, xanthosine, isoguanosine, isocytidine, diaminopyrimidine and deoxyuridine. The adapters may comprise modified or derivatized nucleotides. Non-limiting examples of modifications in the ribose or base moieties include the addition, or removal, of acetyl groups, amino groups, carboxyl groups, carboxymethyl groups, hydroxyl groups, methyl groups, phosphoryl groups and thiol groups. In particular, included are 2’-0-methyl and locked nucleic acids (LNA) nucleotides. Suitable examples of derivatized nucleotides include those with covalently attached dyes, such as fluorescent dyes or quenching dyes, or other molecules such as biotin, digoxygenin, or magnetic particles or microspheres. The adapters may also comprise synthetic nucleotide analogs such as morpholinos or peptide nucleic acids (PNA). Phosphodiester bonds or phosphothioate bonds may link the nucleotides or nucleotide analogs of the linkers.

[0132] The length of the 5’ and 3 ’adapter can vary depending upon, for example, the desired length of the ligation product and the desired features of the adapter. In general, the 5 ’adapter or 3 ’adapter may range from 15 to 60, e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60, nucleotides in length.

[0133] The 5’adapter as described herein comprises a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, (random) deoxynucleotides, wherein said 6 to 15 (random) deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA. In addition, the 3 ’adapter as described herein comprises a 3 ’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, (random) deoxynucleotides, wherein said 6 to 15 (random) deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA.

[0134] The 5’adapter and the 3’adapter can be present as linear polynucleotide, e.g. after denaturation / when denatured. In this form, the 5’adapter and the 3’adapter is single-stranded. This primary structure may be converted into a secondary structure. In particular, the 5’adapter and the 3’adapter is further capable of forming a stem-loop structure. Thus, the 5’adapter and the 3’adapter can also have a stem-loop structure, e.g. after re-naturation / when re-natured.

[0135] Generally, the term “stem-loop structure” refers to a pattern that can occur in single-stranded RNA. The structure is also known as a “hairpin” or “hairpin loop”. It occurs when two regions of the same strand, usually complementary in nucleotide sequence when read in opposite directions, base-pair to form a double helix that ends in an unpaired loop.

[0136] In particular, the 5’adapter and the 3’adapter that is capable of forming a stem-loop structure comprises a 5 ’positioned first stem sequence and a 3 ’positioned second stem sequence that are reverse complementary to each other. The first stem sequence and the second stem sequence form the “double-stranded region” or “double-stranded stem” of the stem-loop adaptor. In one embodiment, the stem is between 5 and 20, e.g. 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, nucleotides in length. In one preferred embodiment, the stem is between 5 and 10, e.g. 5, 6, 7, 8, 9, or 10, nucleotides in length.

[0137] It should be noted that a portion of a primer may be encoded in the stem. As a general matter, in those embodiments in which a portion of a primer is encoded in the stem, the stem may be longer. In those embodiments in which a portion of a primer is not encoded in the stem, the stem may be shorter.

[0138] As used herein, the term “loop” refers to the single-stranded region of the stem-loop structure. In particular, the loop is located between the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence. In other words, the loop is located between the two reverse complementary strands of the stem and typically the loop comprises single-stranded nucleotides, although other moieties such as modified DNA or RNA molecules are also possible. In one embodiment, the loop sequence comprises between 10 and 40 nucleotides, e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides. In one preferred embodiment, the loop sequence comprises between 12 and 20 nucleotides, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides. The nucleotides of the loop structure are preferably deoxynucleotides but also ribonucleotides are possible.

[0139] It should be noted that a portion of a primer may be encoded in the loop. As a general matter, in those embodiments in which a primer is encoded in the loop, the loop may be longer. In those embodiments in which a primer is not encoded in the loop, the loop may be shorter.

[0140] In addition, it should be noted that the 5 ’adapter as described herein comprises a 5 ’-terminal sequence that is configured such that it forms a single stranded 5’protrusion after formation of the stem-loop structure. Moreover, it should be noted that the 3 ’adapter as described herein comprises a 3 ’-terminal sequence that is configured such that it forms a single stranded 3 ’protrusion after formation of the stem-loop structure.

[0141] The adapter, e.g. 5’adapter and / or 3 ’adapter, may comprise one or more blocking nucleotides. The term “blocking nucleotide”, as used herein, refers to a nucleotide comprising a chemical moiety which prevents or minimizes nucleotide addition by a DNA polymerase. For example, by adding a blocking group to the terminal 3 ’-OH, the nucleotide is no longer able to participate in phosphodiester bond formation catalyzed by the DNA polymerase. Some non-limiting examples include, an alkyl group, non-nucleotide linkers, phosphorothioate, alkane-diol residues, PNA, LNA, nucleotide analogs comprising a 3 ’-amino group in place of the 3 ’-OH group, nucleotide analogs comprising a 5‘-OH group in place of the 5 ’-phosphate group, nucleotide derivatives lacking a 3 ’-OH group, or biotin. These nucleotides are generally not chain extendable. Other examples of non-extendable nucleotides that can be used include nucleotides that have modified ribose moieties. In certain embodiments, ribonucleotides may serve as non-extendable nucleotides because oligonucleotides terminating in ribonucleotides cannot be extended by certain DNA polymerases. The ribose can be modified to include 3 '-deoxy derivatives including those in which the 3 '-hydroxy is replaced by a functional group other than hydrogen, for example, as an azide group. In certain embodiments, a non-extendible nucleotide comprises a dideoxynucleotide (ddN), for example but not limited to, a dideoxyadenosine (ddA), a dideoxycytosine (ddC), a dideoxyguanosine (ddG), a dideoxythymidine (ddT), or a dideoxyuridine (ddU).

[0142] In particular, the adapter, e.g. 5’adapter and / or 3’adapter, may comprise locked nucleic acids (LNAs). The term “locked nucleic acids (LNAs)”, as used herein, refers to modified nucleotides, specifically ribonucleotides, in which the 2’-0 and 4’-C atoms of the ribose are joined through a methylene bridge. This additional bridge limits the flexibility normally associated with the ring, essentially locking the structure into a rigid conformation. These nucleic acid analogs are also referred to in some circles as “inaccessible ribonucleotides”. LNA nucleotides can be mixed with DNA or RNA residues in the polynucleotide, in effect hybridizing with DNA or RNA according to Watson-Crick base-pairing rules. The inflexible nature of these molecules greatly enhances hybridization stability. Further, polynucleotides containing LNAs offer tremendous discriminatory power, allowing these molecules to distinguish between exact match and mismatched complementary target sequences with very little difficulty. In one embodiment, the 5’adapter and / or the 3’adapter comprise(s) locked nucleotides, in particular ribonucleotides. In one preferred embodiment, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence of the 5’adapter is (are) LNA enhanced. In one another preferred embodiment, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence of the 3’adapter is (are) LNA enhanced.

[0143] The 3’adapter may comprise a 3 ’inverted deoxynucleotide. The term “inverted deoxynucleotide”, as used herein, refers to a deoxynucleotide creating a 3 ’-3’ linkage and, thus, prevents undesired nucleotide synthesis from the 3 ’end of the adapter, e.g. during reverse transcriptase (RT) PCR. In addition, the 3 ’inverted deoxynucleotide protects the sequence from 3’ exonuclease cleavage. In one embodiment, the 3’adapter comprises a 3’inverted deoxynucleotide. In one preferred embodiment, the 3’adapter comprises a 3’inverted deoxynucleotide, wherein the deoxynucleotide is inverted dT, dA, dC, or dG.

[0144] The 5’adapter may further comprise in the loop a base lacking spacer, specifically at the 5’-end of the loop. The term “base lacking spacer”, as used herein, refers to a moiety allowing the termination of the reverse transcription in a subsequent step. In particular, the reaction terminates at the nucleotide preceding the base lacking spacer in the loop region of the 5’adapter, which prevents the reaction from continuing to the end of the 5’adapter and, thus, generating highly structured cDNAs, which may impair subsequent PCR steps. Particularly, the base lacking spacer is a 2 ’-dideoxyribose spacer. More particularly, the base lacking spacer is a 1’2’ -dideoxyribose spacer. In one embodiment, the 5 ’adapter comprises in the loop a base lacking spacer, preferably at the 5’-end of the loop. In one preferred embodiment, the 5’adapter comprises in the loop a 2’- dideoxyribose spacer, preferably at the 5’-end of the loop.

[0145] In one more preferred embodiment, a 5’adaper, wherein the 5 ’positioned first stem sequence and / or the 3’positioned second stem sequence of the 5’adapter is (are) LNA enhanced and a 3 ’adapter, wherein the 5 ’positioned first stem sequence and / or the 3’positioned second stem sequence of the 3 ’adapter is (are) LNA enhanced are combined / part of a combination.

[0146] In one even more preferred embodiment, a 5’adaper, wherein the 5 ’positioned first stem sequence and / or the 3’positioned second stem sequence of the 5’adapter is (are) LNA enhanced and a 3 ’adapter, wherein the 5 ’positioned first stem sequence and / or the 3’positioned second stem sequence of the 3 ’adapter is (are) LNA enhanced and wherein the the 3 ’adapter comprises a 3 ’inverted deoxynucleotide, e.g. inverted dT, dA, dC, or dG, are combined / part of a combination.

[0147] The present inventors surprisingly found that the methylation status of small non-coding RNA can be used / allows to diagnose cancer in a patient / to determine whether a patient suffers from cancer. The present inventors provide a method for diagnosing cancer in a patient or for determining whether a patient suffers from cancer. In said method, the methylation status of small non-coding RNA in a biological sample obtained / isolated from a patient is determined. Said method encompasses the step of annealing and ligating adapters to small non-coding RNA present in the biological sample obtained / isolated from a patient.

[0148] First, the adapters, in particular 5’ and 3 ’adapters, are annealed to the small non-coding RNA. Before the adapters, in particular 5’ and 3 ’adapters, are annealed to the small non-coding RNA, the small non-coding RNA is denatured. In addition, the adapters, in particular 5’ and 3 ’adapters, are denatured and subsequently renatured.

[0149] The term “annealing”, as used herein, refers to a process of heating and cooling two single-stranded polynucleotides with complementary sequences. Heat breaks all hydrogen bonds and cooling allows new bonds to form between the sequences. During this process, the adapters, in particular 5’ and 3 ’adapters, attach to the small non-coding RNA, and form their characteristic stem-loop structure. In particular, the 5’adapter attaches to the 5 ’end of the small non-coding RNA and the 3 ’adapter attaches to the 3 ’end of the small non-coding RNA.

[0150] In this respect, it should be noted that the denaturation / renaturation of the adapters, in particular 5’ and 3 ’adapters, preferably takes place separately and in the absence of the small non-coding RNA. Second, the adapters, in particular 5’ and 3 ’adapters, are then ligated to the small noncoding RNA, using / with a double stranded RNA ligase, thereby producing a ligation product. As used herein, the term “ligation product” refers to a (DNA / RNA) hybrid molecule comprising at least one adapter and small non-coding RNA. For example, the ligation product may comprise a 5 ’adapter and small non-coding RNA. Further, the ligation product may comprise a 3 ’adapter and small non-coding RNA. Furthermore, the ligation produced may comprise a 5 ’adapter, a 3 ’adapter and small non-coding RNA.

[0151] Specifically, the annealing of the 5 ’adapter with the small non-coding RNA, generates a double-stranded (DNA / RNA) hybrid containing a nick of RNA-OH-375’-P-RNA between the 3 ’end of the adapter and the 5 ’end of the small non-coding RNA. This is an efficient substrate for ligation by a double-stranded RNA ligase. In addition, the annealing of the 3’adpater with the small non-coding RNA generates a double-stranded (DNA / RNA) hybrid containing a nick of RNA-OH-375’-P-RNA between the 3 ’end of the small non-coding RNA, and the 5 ’end of the adapter. This is also an efficient substrate for ligation by a double-stranded RNA ligase. Generally, any double stranded RNA ligase capable of ligating double stranded RNA nicks / RNA structures may be used for this purpose. In one preferred embodiment, the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2), a Kodl ligase or RtcB ligase. In one more preferred embodiment, the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2).

[0152] The conditions of the ligation reaction are typically adjusted so that the ligase functions near its optimal activity level. A buffering agent may be used to adjust and maintain the pH at the desired level. Representative examples of suitable buffers include, but are not limited to, MOPS, HEPES, TAPS, Bicine, Tricine, TES, PIPES, MES, sodium acetate and Tris buffer.

[0153] As used herein, the term “extension reaction” refers to an elongation reaction in which the 3 ’adapter ligated to the 3 ’end of the small non-coding RNA is extended, in particular in 5’ to 3’ direction, to form an “extension reaction product” comprising a strand reverse complementary to the small non-coding RNA. In the context of the present invention, the extension reaction can also be designated as “reverse transcription”. In some embodiments, the small non-coding RNA is a miRNA, and the extension reaction is a reverse transcription reaction comprising a reverse transcriptase, whereby a DNA (in particular cDNA) copy of the ligation product is made. In certain embodiments, the extension reaction is a reverse transcription reaction comprising a polymerase, such as a reverse transcriptase.

[0154] The term “reverse transcriptase”, as used herein, refers to any enzyme having reverse transcriptase activity. In particular, the term “reverse transcriptase”, as used herein, refers to an enzyme used to generate DNA (cDNA) from an RNA template in a process termed reverse transcription. The reverse transcriptase has an RNA-dependent DNA polymerase activity. By means of this activity, a hybrid double strand of RNA and DNA is first built up after presentation of a single-stranded RNA by linking complementary paired DNA building blocks (deoxyribonucleotides). Afterwards, its RNA portion is largely degraded by means of an RNase H activity of a special section of the protein. The remaining DNA single strand is finally completed to the DNA double strand, catalyzed by an additional inherent DNA-dependent DNA polymerase activity of reverse transcriptase. To initiate reverse transcription, the reverse transcriptase requires a primer which serves as a starting point for the reverse transcriptase to synthesize a new strand. This primer is also called RT-primer sequence. The RT-primer depends on the 3’ adapter sequence. The RT-primer is reverse complementary to said sequence. In one preferred embodiment, the reverse transcriptase (RT) is Maxima H-RT, Tth polymerase, Protoscript II RT, Luna RT, AMV, or M-MuLV, or any other enzymes derived from these. In one more preferred embodiment, the reverse transcriptase is Maxima H-RT or Luna RT.

[0155] To determine the methylation status of small non-coding RNA in a biological sample obtained / isolated from a patient in the method of the present invention, the reverse transcription of the ligation product is conducted under limiting conditions (test reaction) as well as under nonlimiting conditions (control reaction).

[0156] In the context of the present invention, the reverse transcription of the ligation product “under limiting conditions” means performing the reverse transcription (RT) with a desoxynucleosidetriphosphate (dNTP) concentration which is lower than “under non-limiting (normal) conditions”.

[0157] Preferably, said reverse transcription of the ligation product is conducted with a desoxynucleosidetriphosphate (dNTP) concentration which is 1 / 10 or less, e.g. 1 / 10, 1 / 11, 1 / 12, 1 / 13, 1 / 14, 1 / 15, 1 / 16, 1 / 17, 1 / 18, 1 / 19, 1 / 20, 1 / 21, 1 / 22, 1 / 23, 1 / 24, 1 / 25, 1 / 26, 1 / 27, 1 / 28, 1 / 29,

[0158] 1 / 30, 1 / 31, 1 / 32, 1 / 33, 1 / 34, 1 / 35, 1 / 36, 1 / 37, 1 / 38, 1 / 39, 1 / 40, 1 / 41, 1 / 42, 1 / 43, 1 / 44, 1 / 45, 1 / 46,

[0159] 1 / 47, 1 / 48, 1 / 49, 1 / 50, or less, of the dNTP concentration under non-limiting (normal) conditions. More preferably, said reverse transcription of the ligation product is conducted with a dNTP concentration which is between 1 / 10 and 1 / 50, e.g. 1 / 10, 1 / 11, 1 / 12, 1 / 13, 1 / 14, 1 / 15, 1 / 16, 1 / 17,

[0160] 1 / 18, 1 / 19, 1 / 20, 1 / 21, 1 / 22, 1 / 23, 1 / 24, 1 / 25, 1 / 26, 1 / 27, 1 / 28, 1 / 29, 1 / 30, 1 / 31, 1 / 32, 1 / 33, 1 / 34,

[0161] 1 / 35, 1 / 36, 1 / 37, 1 / 38, 1 / 39, 1 / 40, 1 / 41, 1 / 42, 1 / 43, 1 / 44, 1 / 45, 1 / 46, 1 / 47, 1 / 48, 1 / 49, or 1 / 50, of the dNTP concentration under non-limiting (normal) conditions.

[0162] Even more preferably, said reverse transcription of the ligation product is conducted with between 0.25 mM and 50 mM dNTPs, e.g. with 0.25, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mM dNTPs. Still even more preferably, said reverse transcription of the ligation product is conducted with between 0.25 mM and 25 mM dNTPs, e.g. with 0.25, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 mM dNTPs.

[0163] Most preferably, said reverse transcription of the ligation product is conducted with 1 mM dNTPs. In contrast thereto, the reverse transcription of the ligation product “under non-limiting (normal) conditions” is preferably conducted with between 2.5 mM and 500 mM dNTPs, more preferably with between 2.5 mM and 250 mM dNTPs, and even more preferably with 10 mM dNTPs.

[0164] Thus, the reverse transcription reaction under limiting conditions (test reaction) is specifically performed with 1 mM dNTPs and the reverse transcription reaction under non-limiting (normal) conditions (control reaction) is specifically performed with 10 mM dNTPs.

[0165] In the above embodiment, the reverse transcriptase (RT) is preferably Maxima RT or Luna RT.

[0166] In this respect, it should be noted that methylated nucleotides such as 2'-O-methylated nucleotides induce reverse transcription stops / pauses at low concentrations of desoxynucleosidetriphosphates (dNTPs) (i.e. under limiting conditions), while at high dNTP concentrations (i.e. under nonlimiting conditions) reverse transcriptase can bypass methylated sites such as 2'-O-methylated sites. It appears that the methylated group such as 2'-O-methyl group acts as a conformational “bump” which hinders the passage of the reverse transcriptase, whose effect is minimized at high dNTP concentrations (i.e. under non-limiting conditions).

[0167] A difference between the cDNA products produced via reverse transcription under limiting conditions (i.e. at low concentrations of dNTPs) and the cDNA products produced via reverse transcription under non-limiting conditions (i.e. high concentrations of dNTPs) indicates small non-coding RNA methylation in the biological sample.

[0168] According to the method of the present invention, the cDNA product produced with the reverse transcription under limiting conditions (i.e. at low dNTP concentrations) is designated as first cDNA product. In addition, the cDNA product produced with said reverse transcription under nonlimiting conditions (i.e. at high dNTP concentrations) is designated as second cDNA product.

[0169] In order to determine the methylation status of small non-coding RNA in a biological sample obtained / isolated from a patient, the cDNA product (and consequently the small noncoding RNA based thereon) is further detected.

[0170] Described herein is an amplification method to detect the cDNA product (and consequently the methylated small non-coding RNA based thereon). In particular, the amplification is carried out using a polymerase chain reaction (PCR). The PCR may be selected from the group consisting of digital PCR, real-time PCR (quantitative PCR or qPCR), preferably Taq-man qPCR, multiplex PCR, nested PCR, high fidelity PR, fast PCR, hot start PCR, and GC-rich PCR. Preferably, the digital PCR is digital droplet PCR or digital partition PCR. The terms “amplicon” and “amplification product”, as used herein, generally refer to the product of an amplification reaction. An amplicon may be double-stranded or single-stranded, and may include the separated component strands obtained by denaturing a double-stranded amplification product. In certain embodiments, the amplicon of one amplification cycle can serve as a template in a subsequent amplification cycle.

[0171] The term “amplifying”, as used herein, refers to any means by which at least a part of the small non-coding RNA, small non-coding RNA surrogate, or combinations thereof, is reproduced, typically in a template-dependent manner, including without limitation, a broad range of techniques for amplifying nucleic acid sequences, either linearly or exponentially. Any of several methods can be used to amplify the target polynucleotide. Any in vitro means for multiplying the copies of a target sequence of nucleic acid can be utilized. These include linear, logarithmic, or other amplification methods. Exemplary methods include polymerase chain reaction (PCR), isothermal procedures (using one or more RNA polymerases, strand displacement, partial destruction of primer molecules, ligase chain reaction (LCR), Q RNA replicase systems, RNA transcription- based systems (e.g., TAS, 3 SR), or rolling circle amplification (RCA).

[0172] A difference between the cDNA products produced via reverse transcription under limiting conditions (i.e. at low concentrations of dNTPs) and the cDNA products produced via reverse transcription under non-limiting conditions (i.e. high concentrations of dNTPs) indicates small non-coding RNA methylation in the biological sample.

[0173] If there is no (significant) difference, the small non-coding RNA is not methylated. A significant difference in this respect preferably means that the experiment is conducted three times and that in all three experiments, a difference could be detected.

[0174] The difference may reside in different levels of the cDNA products.

[0175] The term “level”, as used herein, refers to an amount (measured for example in grams, mole, or ion counts) or concentration (e.g. absolute or relative concentration, e.g. reads per million (RPM), NGS counts, copies per pl, or cycle thresholds) of the small non-coding RNA or cDNA product derived therefrom. The term “level”, as used herein, also comprises scaled, normalized, or scaled and normalized amounts or values (e.g. RPM). Particularly, the level of the small non-coding RNA or cDNA product derived therefrom is determined by sequencing, preferably next generation sequencing (e.g. ABI SOLID, Illumina Genome Analyzer, Roche 454 GS FL, BGISEQ), nucleic acid hybridization (e.g. microarray or beads), nucleic acid amplification (e.g. polymerase chain reaction (PCR)), polymerase extension, mass spectrometry, flow cytometry (e.g. LUMINEX), or any combination thereof. More particularly, the PCR is selected from the group consisting of digital PCR, real-time PCR (quantitative PCR or qPCR), preferably TaqMan qPCR, multiplex PCR, nested PCR, high fidelity PR, fast PCR, hot start PCR, and GC-rich PCR. The digital PCR may be digital droplet PCR or digital partition PCR.

[0176] Specifically, the difference between the cDNA products produced via reverse transcription is based on a difference in expression levels determined by

[0177] (i) cycle thresholds in case of semiquantitative PCR reaction, or

[0178] (ii) copies per pl in case of digital PCR such as digital droplet PCR or digital partition PCR. Finally, the methylation status is calculated and compared to a reference methylation status.

[0179] This comparison allows to determine whether the patient suffers from cancer or not. Particularly, the reference methylation status is the methylation status of the small non-coding RNA determined empirically by measuring a number of reference biological samples from healthy subjects / subjects known to not suffer from cancer.

[0180] Preferably, the methylation status is calculated as follows: methylation status (%) = (1- (copies first cDNA product under limiting conditions / copies second cDNA product under non-limiting conditions)) * 100, and / or the reference methylation status is calculated as follows: reference methylation status (%) = (1- (copies first cDNA product under limiting conditions / copies second cDNA product under nonlimiting conditions)) * 100.

[0181] More preferably, the methylation status is calculated as follows: methylation status (%) = (1- (copies first cDNA product per pl at a dNTP concentration under limiting conditions / copies second cDNA product per pl at a dNTP concentration under non-limiting conditions)) * 100, and / or the reference methylation status is calculated as follows: reference methylation status (%) = (1- (copies first cDNA product per pl at a dNTP concentration under limiting conditions / copies second cDNA product per pl at a dNTP concentration under non-limiting conditions)) * 100.

[0182] Especially, the dNTP concentration under limiting conditions is 1 / 10 or less, e.g. 1 / 10, 1 / 11, 1 / 12, 1 / 13, 1 / 14, 1 / 15, 1 / 16, 1 / 17, 1 / 18, 1 / 19, 1 / 20, 1 / 21, 1 / 22, 1 / 23, 1 / 24, 1 / 25, 1 / 26, 1 / 27, 1 / 28, 1 / 29, 1 / 30, 1 / 31, 1 / 32, 1 / 33, 1 / 34, 1 / 35, 1 / 36, 1 / 37, 1 / 38, 1 / 39, 1 / 40, 1 / 41, 1 / 42, 1 / 43, 1 / 44, 1 / 45, 1 / 46, 1 / 47, 1 / 48, 1 / 49, 1 / 50, or less, of the dNTP concentration under non-limiting (normal) conditions. For example, the methylation status of small non-coding RNA (molecules) in % can be calculated according to the following formula: methylation status (%) = (1- (copies first cDNA product per pl at 1 mM dNTP / copies second cDNA product per pl at 10 mM dNTP)) * 100.

[0183] For example, the reference methylation status of the small non-coding RNA (molecules) in % can also be calculated according to the following formula: reference methylation status (%) = (1- (copies first cDNA product per pl at 1 mM dNTP / copies second cDNA product per pl at 10 mM dNTP)) * 100.

[0184] Even more preferably, a methylation status which is lower than the reference methylation status indicates that the patient suffers from cancer.

[0185] The term “Dumbbell PCR (DB-PCR)”, as used herein, refers to an efficient and convenient method to distinctively quantify specific individual small RNA such as miRNA as well as specific individual small RNA variants such as isomiRs. In Db-PCR, 5’- and 3’ adapters are specifically hybridized and ligated to the 5’- and 3 ’-ends of target small non-coding RNAs, respectively, by a double stranded RNA ligase, e.g. T4 RNA ligase 2 (Rnl2). The resultant ligation products with ‘dumbbell-like’ structures are subsequently quantified, e.g. by TaqMan RT-PCR. The present inventors found that the use of the proprietary 5’ and 3 ’adapters as described herein as well as high specificity of Rnl2 ligation and TaqMan RT-PCR toward target small non-coding RNAs assured both 5’- and 3 ’-terminal sequences of target small non-coding RNAs with single nucleotide resolution so that Db-PCR specifically detected target small non-coding RNAs but not their corresponding terminal variants. Db-PCR described herein has broad applicability for the quantification of various small RNAs in different cell types. Therefore, Db-PCR provides a much- needed simple method for analyzing RNA terminal heterogeneity.

[0186] Residues in two or more polynucleotides are said to “correspond” to each other if the residues occupy an analogous position in the polynucleotide structures. It is well known in the art that analogous positions in two or more polynucleotides can be determined by aligning the polynucleotide sequences based on nucleic acid sequence or structural similarities. Such alignment tools are well known to the person skilled in the art and can be, for example, obtained on the World Wide Web, for example, ClustalW or Align using standard settings, preferably for Align EMBOSS: rneedle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5.

[0187] The term “sample”, as used herein, refers to any sample comprising small non-coding RNA. Said sample is specifically derived from the body of a subject. Said sample specifically comprises small non-coding RNA isolated from organisms, tissues, cells, or body fluids such as blood. Thus, the sample is particularly a biological sample. The sample may also be a processed sample which is originated from a biological sample. In other words, the sample may also be a processed sample which has its origin in a biological sample.

[0188] The term “biological sample”, as used herein, refers to any sample having a biological origin and / or comprising biological material. The biological sample may also be a processed sample with biological origin. The biological sample may be a body fluid sample, e.g. a blood sample or urine sample, or a tissue sample, e.g. a tissue biopsy sample. Biological samples may be mixed or pooled, e.g. a sample may be a mixture of a blood sample and a urine sample. The term “body fluid sample”, as used herein, refers to any liquid sample comprising small non-coding RNA. Said sample is specifically derived from the body of a patient / subject. Said body fluid sample may be a urine sample, blood sample, sputum sample, breast milk sample, cerebrospinal fluid (CSF) sample, cerumen (earwax) sample, gastric juice sample, mucus sample, lymph sample, endolymph fluid sample, perilymph fluid sample, peritoneal fluid sample, pleural fluid sample, saliva sample, sebum (skin oil) sample, semen sample, sweat sample, tears sample, cheek swab, vaginal secretion sample, liquid biopsy, or vomit sample including components or fractions thereof. The term “body fluid sample” also encompasses body fluid fractions, e.g. blood fractions, urine fractions or sputum fractions. Body fluid samples may be mixed or pooled. Thus, a body fluid sample may be a mixture of a blood and a urine sample or a mixture of a blood and cerebrospinal fluid sample.

[0189] The term “blood sample”, as used herein, encompasses whole blood or a blood fraction. Preferably, the blood fraction is selected from the group consisting of a blood cell fraction, plasma, and serum. In particular the blood fraction is selected from the group consisting of a blood cell fraction and plasma or serum. For example, the blood cell fraction encompasses erythrocytes, leukocytes, and / or thrombocytes.

[0190] The whole blood sample may be collected by means of a blood collection tube. It is, for example, collected in a PAXgene Blood RNA tube, in a Tempus Blood RNA tube, in an EDTA-tube, in a Na-citrate tube, Heparin-tube, or in an ACD-tube (Acid citrate dextrose).

[0191] The whole blood sample may also be collected by means of a bloodspot technique, e.g. using a Mitra Microsampling Device. This technique requires smaller sample volumes, typically 45-60 pl for humans or less. For example, the whole blood may be extracted from the patient via a finger prick with a needle or lancet. Thus, the whole blood sample may have the form of a blood drop. Said blood drop is then placed on an absorbent probe, e.g. a hydrophilic polymeric material such as cellulose, which is capable of absorbing the whole blood. Once sampling is complete, the blood spot is dried in air before transferring or mailing to labs for processing. Because the blood is dried, it is not considered hazardous. Thus, no special precautions need be taken in handling or shipping. Once at the analysis site, the desired components, e.g. miRNAs, are extracted from the dried blood spots into a supernatant which is then further analyzed.

[0192] Embodiments of the invention

[0193] The present invention will now be further described. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous, unless clearly indicated to the contrary.

[0194] Some time ago, the present inventors have developed a Dumbbell PCR (DB PCR) based method, which exploits the ability of a double stranded RNA ligase, particularly RNA ligase 2 (Rnl2), to specifically join the nicks in a hybridized double stranded RNA molecule. Only correctly hybridized adaptors both to the 5’ and the 3 ’end of the target RNA such as miRNAs or isomiRs enable the formation of the ligated RNA that can be used as template for cDNA synthesis. This method is able to specifically and efficiently determine and quantify the expression of target RNA (e.g. miRNA) as well as of target RNA variants having specific terminal sequences (e.g. isomiR).

[0195] Previously, the present inventors have adapted this method to limiting reverse transcription (RT) conditions and used it for the detection of the methylation status of small non-coding RNA.

[0196] The present inventors have now found that the determination of the methylation status of small non-coding RNA allows to discriminate biological samples of cancer patients from biological samples of non-cancer, i.e. healthy, control subjects. Specifically, the present inventors have now found that the determination of the methylation status of small non-coding RNA extracted from a biological sample such as peripheral blood allows to diagnose cancer such as early-stage cancer in a patient.

[0197] Thus, in a first aspect, the present invention relates to the (in vitro / ex vivo) use of a methylation status of small non-coding RNA (in a biological sample) to diagnose cancer in a patient / to determine whether a patient suffers from cancer.

[0198] The first aspect may alternatively be formulated as follows: (In vitro! Ex vivo) use of a methylation status of a small non-coding RNA population (in a biological sample) to diagnose cancer in a patient / to determine whether a patient suffers from cancer.

[0199] It is advantageous to specifically use a combination of

[0200] (i) a 5 ’adapter capable of forming a stem-loop structure containing a loop and a double stranded stem, and

[0201] (ii) a 3 ’adapter capable of forming a stem-loop structure containing a loop and a double stranded stem for determining the methylation status of small non-coding RNA to diagnose cancer in a patient / to determine whether a patient suffers from cancer.

[0202] Preferably, the small non-coding RNA has a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122,

[0203] 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141,

[0204] 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160,

[0205] 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179,

[0206] 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. Most preferably, the (above-mentioned) small non-coding RNA is a ribosomal RNA fragment (rRNA fragment), a miRNA, a miRNA isoform (an isomiR), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment. The rRNA fragment is particularly favoured.

[0207] In one embodiment, the 5’adapter comprises in the following order from 5’ to 3’ :

[0208] (i) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA, and

[0209] (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2, e.g. 2, 3, or 4, nucleotides at its 3 ’end are ribonucleotides or modified ribonucleotides and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced.

[0210] Preferably, the LNA enhanced sequence comprises between 1 to 10, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, more preferably 3, locked nucleotides, specifically ribonucleotides.

[0211] In particular, the nucleotide sequence of the 5’ adapter comprises deoxynucleotides and ribonucleotides.

[0212] The 5’adapter may range from 15 to 60, e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60, nucleotides in length.

[0213] The 5’adapter may be present as linear polynucleotide, particularly in single- stranded form, e.g. after denaturation / when denatured. The 5’adapter is a polynucleotide that can be attached / ligated to the 5 ’end of small non-coding RNA. When attached / ligated to the 5 ’end of small non-coding RNA, the 5’adapter has a stem-loop structure. The attachment / ligation is possible as the 5’adapter comprises between 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to a 5’-terminal sequence of small non-coding RNA.

[0214] In one preferred embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. Thus, the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence can form the double stranded stem.

[0215] The double stranded stem may have a length of between 5 and 20, e.g. 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, nucleotides.

[0216] Preferably, each one of the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence has a length of between 5 to 10, e.g. 5, 6, 7, 8, 9, or 10, nucleotides. Particularly, the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence have the same length, e.g. a length of 5, 6, 7, 8, 9, or 10 nucleotides.

[0217] More preferably, the 5 ’positioned first stem sequence and / or the 3 ’positioned second stem sequence is (are) LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Even more preferably, the 5’positioned first stem sequence is LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Specifically, every, every second, or every third nucleotide may be LNA enhanced in the 5’positioned first stem sequence and / or the 3’positioned second stem sequence.

[0218] Thus, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise (a mixture of) deoxynucleotides and ribonucleotides (e.g. LNA-enhanced) or the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise ribonucleotides. Said ribonucleotides include ribonucleotides which are LNA-enhanced.

[0219] In one further embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. The loop sequence may comprise between 10 and 40, e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, nucleotides. Preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20, nucleotides, e.g. deoxynucleotides and / or ribonucleotides. More preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20, deoxynucleotides.

[0220] In one preferred embodiment, the nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem comprises deoxynucleotides with the exception of the at least two nucleotides at its 3 ’end which are ribonucleotides or modified ribonucleotides, preferably 2’-o-methyl ribonucleotides, and the locked ribonucleotides. In one another embodiment, the 5 ’-terminal sequence is configured such that it forms a single stranded 5 ’protrusion after formation of the stem-loop structure.

[0221] In one preferred embodiment, the 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to the 5 ’-terminal sequence of small noncoding RNA encompass G and C but not more than 4, e.g. 1, 2, 3, or 4, in a row.

[0222] As mentioned above, a preferred 5 ’adapter comprises in the following order from 5’ to 3’:

[0223] (i) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA, and

[0224] (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2, e.g. 2, 3, or 4, nucleotides at its 3 ’end are ribonucleotides or modified ribonucleotides and wherein the nucleotide sequence is locked nucleotide- (LNA-) enhanced.

[0225] Alternatively or additionally to (ii) said 6 to 15 deoxynucleotides in (i) which are reverse complementary to a 5’-terminal sequence of small non-coding RNA comprise one or more locked nucleotide- (LNA-) enhanced and / or other modified nucleotide(s).

[0226] Thus, in one example, the above described 5 ’adapter comprises in the following order from 5’ to 3’:

[0227] (ia) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced, or

[0228] (ib) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA and wherein one or more of them are otherwise modified (than LNA-enhanced), or

[0229] (ic) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced and otherwise modified, and

[0230] (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2, e.g. 2, 3, or 4, nucleotides at its 3 ’end are ribonucleotides or modified ribonucleotides.

[0231] Thus, in one another example, the above described 5 ’adapter comprises in the following order from 5’ to 3’ : (ia) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced, or

[0232] (ib) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA and wherein one or more of them are otherwise modified (than LNA-enhanced), or

[0233] (ic) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced and otherwise modified, and

[0234] (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2, e.g. 2, 3, or 4, nucleotides at its 3 ’end are ribonucleotides or modified ribonucleotide and wherein the nucleotide sequence is locked nucleotide- (LNA-) enhanced.

[0235] The above-mentioned one or more otherwise modified (than LNA-enhanced) nucleotides are preferably 2 ’-ortho-methylated ribonucleotides.

[0236] Thus, in one particular example, the above described 5 ’adapter comprises in the following order from 5’ to 3’ :

[0237] (ia) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced, or

[0238] (ib) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA and wherein one or more of them are replaced by a 2 ’-ortho-methylated ribonucleotide, or

[0239] (ic) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced and replaced by a 2’-ortho-methylated ribonucleotide, and

[0240] (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2, e.g. 2, 3, or 4, nucleotides at its 3 ’end are ribonucleotides or modified ribonucleotides. Thus, in one another particular example, the above described 5’adapter comprises in the following order from 5’ to 3’ :

[0241] (ia) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced, or

[0242] (ib) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA and wherein one or more of them are are replaced by a 2’-ortho-methylated ribonucleotide, or

[0243] (ic) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA and wherein one or more of them are LNA-enhanced and replaced by a 2’-ortho-methylated ribonucleotide, and

[0244] (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2, e.g. 2, 3, or 4, nucleotides at its 3 ’end are ribonucleotides or modified ribonucleotide and wherein the nucleotide sequence is locked nucleotide- (LNA-) enhanced.

[0245] Specifically, the one or more 2 ’-ortho-methylated ribonucleotides are located at a position (in said nucleotide sequence) corresponding to a position in the non-coding small RNA (molecule) that is presumed to be methylated. Alternatively, the one or more 2 ’-ortho-methylated ribonucleotides are located at a position (in said nucleotide sequence) base-pairing with a position in the noncoding small RNA (molecule) that is presumed to be methylated.

[0246] In one more preferred embodiment, the 5’adapter has the following sequence from 5’ to 3’ :

[0247] (6- 15x)NCGTGGCGTGGAGTGTGTGCTTTGCC ArCrG (SEQ ID NO: 1), wherein “r” stands for ribonucleotide, wherein “(6-15x)N” designates the sequence reverse complementary to a 5’terminal sequence of small non-coding RNA, and wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double underlined portion are optionally LNA enhanced, or is a variant of this sequence.

[0248] For example, every, every second, or every third nucleotide may be LNA enhanced in the underlined portion and / or in the double underlined portion specified above.

[0249] In one even more preferred embodiment, the 5’adapter has the following sequence from 5’ to 3’ : (6-15x)NCGTGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 1), wherein “r” stands for ribonucleotide, wherein “(6-15x)N” designates the sequence reverse complementary to a 5 ’terminal sequence of small non-coding RNA, and wherein one or more (e.g. 1, 2, or 3) of the nucleotides in bold letters are LNA enhanced, or is a variant of this sequence.

[0250] Specifically, the LNA enhanced nucleotides are ribonucleotides.

[0251] The 5 ’adapter variant as described above has a sequence having at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, and still even more preferably 99%, e.g. 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 1. Such a 5 ’adapter variant still comprises the at least 2 nucleotides at its 3 ’end which are ribonucleotides or modified ribonucleotides. In addition, such a 5’ adapter variant is still LNA enhanced (if this is not an optional feature). Moreover, such a 5 ’adapter variant is still capable of forming a stem-loop structure containing a loop and a double stranded stem. The skilled person can readily assess whether a 5 ’adapter variant is still capable of forming a stem-loop structure containing a loop and a double stranded stem. For example, the experimental section provides sufficient information in this respect.

[0252] In one particular embodiment, the 5 ’adapter as described above comprises a base-lacking spacer (e.g. a base-lacking 1’, 2 ’-dideoxyribose spacer) in the loop region. A 5’adapter having a base-lacking spacer in the loop region has preferably the following sequence from 5’ to 3’ : (6- 15x)NCGTGGCG / idSp / TGGAGTGTGTGCTTTGCC ArCrG (SEQ ID NO: 6), wherein “r” stands for ribonucleotide, wherein “(6-15x)N” designates the sequence reverse complementary to a 5 ’terminal sequence of small non-coding RNA, wherein “idSp” stands for base lacking spacer, and wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double underlined portion are optionally LNA enhanced, or is a variant of this sequence.

[0253] Specifically, the LNA enhanced nucleotides are ribonucleotides.

[0254] In one more particular embodiment, the 5’adapter comprising a base-lacking spacer (e.g. a base-lacking 1’, 2’-dideoxyribose spacer) in the loop region has the following sequence from 5’ to 3’ : (6-15x)NCGTGGCG / idSp / TGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 6), wherein “r” stands for ribonucleotide, wherein “(6-15x)N” designates the sequence reverse complementary to a 5 ’terminal sequence of small non-coding RNA, wherein “idSp” stands for base lacking spacer, and wherein one or more (e.g. 1, 2, or 3) of the nucleotides in bold letters are LNA enhanced, or is a variant of this sequence. Alternatively, the 5 ’adapter having a base-lacking spacer has preferably the following sequence from 5’ to 3’ : (6- 15x)NCG / idSp / TGGCGTGGAGTGTGTGCTTTGCC ArCrG (SEQ ID NO: 12), wherein “r” stands for ribonucleotide, wherein “(6-15x)N” designates the sequence reverse complementary to a 5 ’terminal sequence of small non-coding RNA, wherein “idSp” stands for base lacking spacer, and wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double underlined portion are optionally LNA enhanced, or is a variant of this sequence.

[0255] Specifically, the LNA enhanced nucleotides are ribonucleotides.

[0256] The 5 ’adapter variant as described above has a sequence having at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, and still even more preferably 99%, e.g. 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 6 or SEQ ID NO: 12. Such a 5’adapter variant still comprises the at least 2 nucleotides at its 3 ’end which are ribonucleotides or modified ribonucleotides. Further, such a 5’ adapter variant is still LNA enhanced (if this is not an optional feature). Furthermore, such a 5’adapter still comprises a base lacking spacer. In addition, such a 5’adapter variant is still capable of forming a stem-loop structure containing a loop and a double stranded stem. The skilled person can readily assess whether a 5’adapter variant is still capable of forming a stem-loop structure containing a loop and a double stranded stem. For example, the experimental section provides sufficient information in this respect.

[0257] In one another particular embodiment, the 5’adapter as described above does not comprise a base-lacking spacer (e.g. a base-lacking 1’, 2’-dideoxyribose spacer) in the loop region.

[0258] It is preferred that, in the 5’adapter having a nucleotide sequence according to SEQ ID NO: 1, 6, or 12 as described above, one or more of the 6 to 15 deoxynucleotides which are reverse complementary to a 5’-terminal sequence of small non-coding RNA are LNA-enhanced and / or replaced by a 2 ’-ortho-methylated ribonucleotide.

[0259] The 5’adapter as described above can bind to any small non-coding RNA target (specifically to the 5’end of any small non-coding RNA target) just by exchanging the variable protrusions. In particular, the 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides in the 5 ’terminal nucleotide sequence of the 5’adapter have only to be selected in a way that they are reverse complementary to the small non-coding RNA target (specifically to the 5’end of the small non-coding RNA target) to be detected. The 5’adapter is especially used jointly with the 3 ’adapter. The 5’ adapter as described above may be present in denatured or renatured form.

[0260] The present inventors have exemplarily analyzed the 28 S ribosomal RNA (rRNA) fragment having a nucleotide sequence of 5’ GCCGCCGGUGAAAUACCACUAC 3’ (SEQ ID NO: 16). This rRNA fragment has two methylations sites, namely G (also designated as Gm4020) and C (also designated as Cm4032). While Gm4020 is a variable methylation site, Cm4032 shows a high degree of non-variable methylation. The methylation status of Gm4020 has been calculated / determined herein. A variation of this methylation status is indicative for the presence of cancer, specifically lung cancer.

[0261] Specifically, the 5 ’adapter having the following sequence from 5’ to 3’ :

[0262] CACCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 13), or the 5’adapter having the following sequence from 5’ to 3’ :

[0263] CACmCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 14) allows to determine the methylation status of Gm4020 (“G”) of the 28 S ribosomal RNA (rRNA) fragment having a nucleotide sequence of 5’ GCCGCCGGUGAAAUACCACUAC 3’ (SEQ ID NO: 16).

[0264] In one embodiment, the 3’adapter comprises in the following order from 5’ to 3’ :

[0265] (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5 ’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced, and

[0266] (ii) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide.

[0267] Preferably, the LNA enhanced sequence comprises between 1 to 10, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, more preferably 3, locked nucleotides, specifically ribonucleotides.

[0268] In particular, the nucleotide sequence of the 3’ adapter comprises deoxynucleotides and ribonucleotides.

[0269] The 3’adapter may range from about 15 to about 60, e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60, nucleotides in length.

[0270] The 3’adapter may be present as linear polynucleotide, particularly in single- stranded form, e.g. after denaturation / when denatured. The 3’adapter is a polynucleotide that can be attached / ligated to the 3 ’end of small non-coding RNA. When attached / ligated to the 3 ’end of small non-coding RNA, the 3’adapter has a stem-loop structure. The attachment / ligation is possible as the 3’adapter comprises between 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to a 3’-terminal sequence of small non-coding RNA. The small non-coding RNA is preferably a miRNA or isomiR comprised in miRbase version

[0271] 22.1.

[0272] In one embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5 ’positioned first stem sequence and a 3 ’positioned second stem sequence that are reverse complementary to each other. Thus, the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence can form the double stranded stem.

[0273] The double stranded stem may have a length of between 5 and 20, e.g. 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, nucleotides.

[0274] Preferably, each one of the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence has a length of between 5 to 10, e.g. 5, 6, 7, 8, 9, or 10, nucleotides. Particularly, the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence have the same length, e.g. a length of 5, 6, 7, 8, 9, or 10 nucleotides.

[0275] More preferably, the 5 ’positioned first stem sequence and / or the 3 ’positioned second stem sequence is (are) LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Even more preferably, the 3 ’positioned second stem sequence is LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Specifically, every, every second, or every third nucleotide may be LNA enhanced in the 5’positioned first stem sequence and / or the 3’positioned second stem sequence.

[0276] Thus, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise (a mixture of) deoxynucleotides and ribonucleotides (e.g. LNA-enhanced) or the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise ribonucleotides. Said ribonucleotides include ribonucleotides which are LNA-enhanced.

[0277] In one further embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. The loop sequence may comprise between 10 and 40, e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, nucleotides. Preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides, e.g. deoxynucleotides and / or ribonucleotides. More preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20, deoxynucleotides. In one another embodiment, the 3 ’-terminal sequence is configured such that it forms a single stranded 3 ’protrusion after formation of the stem-loop structure.

[0278] In one preferred embodiment, the 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to the 3 ’-terminal sequence of small noncoding RNA encompass G and C but not more than 4, e.g. 1, 2, 3, or 4, in a row.

[0279] In one another preferred embodiment, the inverted deoxynucleotide is inverted dT, dA, dC, or dG. In this respect, it should be noted that the 3 ’inverted deoxynucleotide creates a 3 ’-3’ linkage and, thus, prevents undesired nucleotide synthesis from the 3 ’end of the adapter, e.g. during RT- PCR. In addition, the 3 ’inverted deoxynucleotide protects the sequence from 3’ exonuclease cleavage.

[0280] As mentioned above, a preferred 3 ’adapter comprises in the following order from 5’ to 3’:

[0281] (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5 ’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is locked nucleotide- (LNA-) enhanced, and

[0282] (ii) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide.

[0283] Alternatively or additionally to (i) said 6 to 15 deoxynucleotides which are reverse complementary to a 5’-terminal sequence of small non-coding RNA comprise one or more locked nucleotide- (LNA-) enhanced and / or other modified nucleotides.

[0284] Thus, in one example, the above described 3 ’adapter comprises in the following order from 5’ to 3’:

[0285] (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5’-terminal nucleotide is phosphorylated, and

[0286] (iia) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or

[0287] (iib) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA, wherein one or more of them are otherwise modified (than LNA-enhanced), and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or (iic) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced and otherwise modified, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide.

[0288] Thus, in one another example, the above described 3 ’adapter comprises in the following order from 5’ to 3’ :

[0289] (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5 ’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is locked nucleotide- (LNA-) enhanced, and

[0290] (iia) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or

[0291] (iib) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA, wherein one or more of them are otherwise modified (than LNA-enhanced), and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or

[0292] (iic) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced and otherwise modified, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide.

[0293] The above-mentioned one or more otherwise modified (than LNA-enhanced) nucleotides are preferably 2 ’-ortho-methylated ribonucleotides.

[0294] Thus, in one particular example, the above described 3 ’adapter comprises in the following order from 5’ to 3’ :

[0295] (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5’-terminal nucleotide is phosphorylated, and

[0296] (iia) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced, and wherein the 3 ’terminal deoxynucleotide is an inverted deoxynucleotide, or

[0297] (iib) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA, wherein one or more of them are replaced by a 2’-ortho-methylated ribonucleotide, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or

[0298] (iic) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced and replaced by a 2’-ortho-methylated ribonucleotide, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide.

[0299] Thus, in one another particular example, the above described 3 ’adapter comprises in the following order from 5’ to 3’ :

[0300] (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5 ’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is locked nucleotide- (LNA-) enhanced, and

[0301] (iia) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or

[0302] (iib) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA, wherein one or more of them are replaced by a 2’-ortho-methylated ribonucleotide, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide, or

[0303] (iic) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA, wherein one or more of them are LNA-enhanced and replaced by a 2’-ortho-methylated ribonucleotide, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide.

[0304] Specifically, the one or more 2 ’-ortho-methylated ribonucleotides are located at a position (in said nucleotide sequence) corresponding to a position in the non-coding small RNA (molecule) that is presumed to be methylated. Alternatively, the one or more 2 ’-ortho-methylated ribonucleotides are located at a position (in said nucleotide sequence) base-pairing with a position in the noncoding small RNA (molecule) that is presumed to be methylated.

[0305] In one more preferred embodiment, the 3 ’adapter has the following sequence from 5’ to 3’: / 5Phos / CTC AGTGC AGGGTCCGAGGT ATTCGC ACTGAG / 6- 15xW3InvdT / (SEQ ID NO: 2), wherein “ / 5Phos / ” indicates that the 5’-terminal nucleotide is phosphorylated, wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double underlined portion are optionally LNA enhanced, wherein “(6-15x)N” designates the sequence reverse complementary to a 3 ’terminal sequence of small non-coding RNA, and wherein “ / 3InvdT / ” stands for 3 ’inverted deoxynucleotide, or is a variant of this sequence.

[0306] For example, every, every second, or every third nucleotide may be LNA enhanced in the underlined portion and / or in the double underlined portion specified above.

[0307] In one even more preferred embodiment, the 3 ’adapter has the following sequence from 5’ to 3’ : / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAG(6-15x)N / 3InvdT / (SEQ ID NO: 2), wherein “ / 5Phos / ” indicates that the 5 ’-terminal nucleotide is phosphorylated, wherein one or more (e.g. 1, 2, or 3) of the nucleotides in bold letters are LNA enhanced, wherein “(6-15x)N” designates the sequence reverse complementary to a 3 ’terminal sequence of small non-coding RNA, and wherein “ / 3InvdT / ” stands for 3 ’inverted deoxynucleotide, or is a variant of this sequence.

[0308] Specifically, the LNA enhanced nucleotides are ribonucleotides.

[0309] The 3 ’adapter variant as described above has a sequence having at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, still even more preferably 99%, e.g. 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 2. Such a 3’ adapter variant is still LNA enhanced (if this is not an optional feature). Further, the 5’-terminal nucleotide is still phosphorylated in such a 3 ’adapter variant. Furthermore, the 3 ’terminal deoxynucleotide is still an inverted deoxynucleotide in such a 3 ’adapter variant. Moreover, such a 3 ’adapter variant is still capable of forming a stemloop structure containing a loop and a double stranded stem. The skilled person can readily assess whether a 3 ’adapter variant is still capable of forming a stem-loop structure containing a loop and a double stranded stem. For example, the experimental section provides sufficient information in this respect.

[0310] It is preferred that, in the 3’adapter having a nucleotide sequence according to SEQ ID NO: 2 as described above, one or more of the 6 to 15 deoxynucleotides which are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA are LNA-enhanced and / or replaced by a 2 ’-ortho-methylated ribonucleotide.

[0311] The 3 ’adapter as described above can bind to any small non-coding RNA target (specifically to the 3 ’end of any small non-coding RNA target) just by exchanging the variable protrusions. In particular, the 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides in the 3 ’terminal nucleotide sequence of the 3 ’adapter have only to be selected in a way that they are reverse complementary to the small non-coding RNA target (specifically to the 3 ’end of the small non-coding RNA target) to be detected. The 3 ’adapter is especially used jointly with the 5 ’adapter. The 3’ adapter as described above may be present in denatured or renatured form.

[0312] Usually, methylated small non-coding RNA is RNA which has been post-transcriptionally edited or modified by methylation. The methylation can occur at a base (e.g. methyl-6-adenine, pseudouridine) and / or ribose ring (2'-O-methylated nucleotide (2'-O-m)).

[0313] The methylation of small non-coding RNA occurring at a base is preferably selected from the group consisting of 6-methyladenosine (m6A), 5-methylcytidine (m5C), 5-methyluridine (m5U), 3 -methyluridine (m3U), 1 -methyladenosine (mJA), and 1 -methyl uanosine (nfG), or is a combination thereof.

[0314] The 2'-O-methylation of the backbone ribose is the most common and conserved type of small non-coding RNA modification.

[0315] The methylation of small non-coding RNA occurring at a ribose ring is preferably selected from the group consisting of 3 '-end 2'-O-methyladenosine (Am), 2'-O-methyluridine (Um), 2'-O- methylguanosine (Gm), and 2'-O-methylcytidine (Cm), or is a combination thereof.

[0316] In the first aspect of the present invention, the cancer is preferably early-stage cancer such as cancer of stage I. More preferably, the cancer is early-stage lung cancer such as lung cancer of stage I.

[0317] Alternatively, the cancer is preferably lung cancer. More preferably, the lung cancer is early stage lung cancer such as lung cancer of stage I and / or stage II.

[0318] Preferably, the methylation status of small non-coding RNA in a biological sample is used in the first aspect of the present invention to diagnose cancer in a patient / to determine whether a patient suffers from cancer.

[0319] The biological sample may be any sample having a biological origin. Thus, the sample may also be a processed biological sample. For example, the biological sample may be a body fluid sample, e.g. a blood sample or urine sample, or a tissue sample, e.g. a tissue (biopsy) sample. Biological samples may be mixed or pooled, e.g. a sample may be a mixture of a blood sample and a urine sample. The body fluid sample may be a urine sample, blood sample, sputum sample, breast milk sample, cerebrospinal fluid (CSF) sample, cerumen (earwax) sample, gastric juice sample, mucus sample, lymph sample, endolymph fluid sample, perilymph fluid sample, peritoneal fluid sample, pleural fluid sample, saliva sample, sebum (skin oil) sample, semen sample, sweat sample, tears sample, cheek swab, vaginal secretion sample, liquid biopsy, or vomit sample including components or fractions thereof. The term “body fluid sample” also encompasses body fluid fractions, e.g. blood fractions, urine fractions or sputum fractions. Body fluid samples may be mixed or pooled. Thus, a body fluid sample may be a mixture of a blood and a urine sample or a mixture of a blood and cerebrospinal fluid sample.

[0320] Particularly, the body fluid sample is a blood sample or the tissue (biopsy) sample is a cancer tissue (biopsy) sample. More particularly, the blood sample is a whole blood or a blood fraction, preferably blood cells (e.g. erythrocytes, leukocytes, and / or thrombocytes), serum, or plasma. For example, the blood cell fraction encompasses erythrocytes, leukocytes, and / or thrombocytes. The whole blood sample may be collected by means of a blood collection tube. It is, for example, collected in a PAXgene Blood RNA tube, in a Tempus Blood RNA tube, in an EDTA-tube, in a Na-citrate tube, Heparin-tube, or in an ACD-tube (Acid citrate dextrose). The whole blood sample may also be collected by means of a bloodspot technique, e.g. using a Mitra Microsampling Device. This technique requires smaller sample volumes, typically 45-60 pl for humans or less. For example, the whole blood may be extracted from a subject via a finger prick with a needle or lancet. Thus, the whole blood sample may have the form of a blood drop. Said blood drop is then placed on an absorbent probe, e.g. a hydrophilic polymeric material such as cellulose, which is capable of absorbing the whole blood. Once sampling is complete, the blood spot is dried in air before transferring or mailing to labs for processing. Because the blood is dried, it is not considered hazardous. Thus, no special precautions need be taken in handling or shipping. Once at the analysis site, the desired components, e.g. miRNAs, are extracted from the dried blood spots into a supernatant which is then further analyzed.

[0321] In the first aspect of the present invention, the sample may also be a sample containing total RNA. Particularly, total RNA includes RNA having a length of < 200 nucleotides such as a miRNA or a miRNA isoform (an isomiR). Specifically, the sample used in the first aspect of the present invention contains cellular total RNA. Particularly, cellular total RNA includes RNA having a length of < 200 nucleotides such as a miRNA or a miRNA isoform (an isomiR). The cellular total RNA may be obtained from blood cells, e.g. erythrocytes, leukocytes, and / or thrombocytes.

[0322] With regard to the first aspect, the present inventors have exemplarily analyzed the 28 S ribosomal RNA (rRNA) fragment having a nucleotide sequence of 5’ GCCGCCGGUGAAAUACCACUAC 3’ (SEQ ID NO: 16). This rRNA fragment has two methylations sites, namely G (also designated as Gm4020) and C (also designated as Cm4032). While Gm4020 is a variable methylation site, Cm4032 shows a high degree of non-variable methylation. The methylation status of Gm4020 has been calculated / determined herein. A variation of this methylation status is indicative for the presence of cancer, specifically lung cancer. Specifically, the 3’adapter having the following sequence from 5’ to 3’ : / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAGGTAGTGGTA / 3InvdT / (SEQ ID NO: 15) allows to determine the methylation status of Gm4020 (“G”) of the 28 S ribosomal RNA (rRNA) fragment having a nucleotide sequence of 5’ GCCGCCGGUGAAAUACCACUAC 3’ (SEQ ID NO: 16).

[0323] The 5’adapter as described above and the 3’adapter as described above can bind / anneal to any small non-coding RNA. After the ligation of the adapters to the small non-coding RNA, they allow the generation of a cDNA product of said small non-coding RNA via reverse transcription. When a small non-coding RNA is methylated, a limited number of cDNA products is produced compared to small non-coding RNA which is not methylated. In this way, the adapters allow the determination of methylation of small non-coding RNA and / or the quantification of the methylation status of small non-coding RNA.

[0324] Especially, the combination of said adapters is used for determining the methylation status of small non-coding RNA (in a biological sample) to diagnose cancer in a patient / to determine whether a patient suffers from cancer.

[0325] Specifically, the 5’adapter having the following sequence from 5’ to 3’ : CACCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 13), or the 5’adapter having the following sequence from 5’ to 3’ :

[0326] CACmCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 14) in combination with the 3’adapter having the following sequence from 5’ to 3’ : / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAGGTAGTGGTA / 3InvdT / (SEQ ID NO: 15) allows to determine the methylation status of Gm4020 (“G”) of the 28 S ribosomal RNA (rRNA) fragment having a nucleotide sequence of 5’ GCCGCCGGUGAAAUACCACUAC 3’ (SEQ ID NO: 16). As mentioned above, the methylation status of small non-coding RNA is used to diagnose cancer in a patient / to determine whether a patient suffers from cancer.

[0327] The present inventors have found that a methylation status of small non-coding RNA which is lower than the reference methylation status of the small non-coding RNA determined empirically by measuring a number of reference biological samples from healthy subjects / subjects known to not suffer from cancer indicates that the patient suffers from cancer.

[0328] Specifically, the present inventors have exemplarily shown herein that the 28S ribosomal RNA (rRNA) fragment extracted from peripheral blood of a patient suffering from lung cancer has a methylation status which is lower than the methylation status of the same rRNA fragment extracted from peripheral blood of control subjects being healthy, i.e. not suffering from lung cancer. Thus, a methylation status of the 28 S ribosomal RNA (rRNA) fragment extracted from peripheral blood of a patient which is lower than the methylation status of the same rRNA fragment extracted from peripheral blood of control subjects being healthy, i.e. not suffering from lung cancer, is indicative for lung cancer in the patient and, thus, allows the diagnosis of lung cancer in said patient.

[0329] As aforementioned, the methylation status of Gm4020 has been calculated / determined herein. Accordingly, the methylation status of Gm4020 of the afore-mentioned 28S ribosomal RNA (rRNA) extracted from peripheral blood of a patient which is lower than the methylation status of Gm4020 of the same rRNA fragment extracted from peripheral blood of control subjects being healthy, i.e. not suffering from lung cancer, is indicative for lung cancer in the patient and, thus, allows the diagnosis of lung cancer in said patient.

[0330] As to the determination / calculation of the methylation status of small non-coding RNA present in a biological sample, it is further referred to the second aspect of the present invention.

[0331] In a second aspect, the present invention relates to a (an in vitro) method for diagnosing cancer in a patient / for determining whether a patient suffers from cancer comprising the step of: determining a methylation status of small non-coding RNA in a biological sample obtained from a patient.

[0332] The second aspect may alternatively be formulated as follows: (In vitro) method for diagnosing cancer in a patient / for determining whether a patient suffers from cancer comprising the step of: determining a methylation status of a small non-coding RNA population in a biological sample obtained from a patient.

[0333] The methylation status indicates whether the patient suffers from cancer or not.

[0334] Preferably, the methylation status of small non-coding RNA in a biological sample obtained from a patient is compared to a reference methylation status. Thus, in one particular embodiment, the present invention relates to a (an in vitro) method for diagnosing cancer in a patient / for determining whether a patient suffers from cancer comprising the steps of:

[0335] (a) determining a methylation status of small non-coding RNA / a small non-coding RNA population in a biological sample obtained from a patient, and

[0336] (b) comparing the methylation status of small non-coding RNA / a small non-coding RNA population in a biological sample obtained from a patient to a reference methylation status (of the small non-coding RNA / of the small non-coding RNA population).

[0337] This comparison allows to determine whether the patient suffers from cancer or not.

[0338] More preferably, the reference methylation status is the methylation status of the small non-coding RNA determined empirically by measuring a number of reference biological samples from healthy subjects / subjects known to not suffer from cancer, and / or from subjects known to suffer from cancer.

[0339] Even more preferably, the reference methylation status is the methylation status of the small non-coding RNA determined empirically by measuring a number of reference biological samples from healthy subjects / subjects known to not suffer from cancer and wherein a methylation status which is lower than this reference methylation status indicates that the patient suffers from cancer.

[0340] For example, the reference methylation status is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000 at least 5000 reference biological samples from healthy subjects / subjects known to not suffer from cancer, and / or the reference methylation is determined from at least 2, at least 10, at least 50, at least 100, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 1500, at least 2000 at least 5000 reference biological samples from subjects having cancer / known to have cancer.

[0341] Specifically, the reference methylation status is an average reference methylation status. It is determined by measuring reference methylation statuses of control subjects (e.g. healthy subjects or subjects having cancer / known to have cancer) and calculating the “average” value (e.g. mean, median or modal value) thereof. It is preferred that the reference biological samples are from the same source (e.g. blood cells, serum, or plasma) than the biological sample isolated from the patient to be tested. It is further preferred that the reference methylation status is obtained from control subjects (e.g. healthy subjects or subjects having cancer / known to have cancer) of the same gender (e.g. female or male) and / or of a similar age / phase of life (e.g. adults or elderly) than the patient to be tested. In one embodiment, the determination of the methylation status of small non-coding RNA (in the biological sample) comprises the steps of:

[0342] (i) providing a ligation product comprising small non-coding RNA to which the 5 ’adapter as defined in the first aspect and the 3 ’adapter as defined in the first aspect are ligated,

[0343] (ii) reverse transcribing the ligation product under limiting conditions, thereby obtaining a first cDNA product and reverse transcribing the ligation product under non-limiting conditions, thereby obtaining a second cDNA product,

[0344] (iii) amplifying the first cDNA product and the second cDNA product, and

[0345] (iv) calculating the methylation status as follows: methylation status (%) = (1- (copies first cDNA product under limiting conditions / copies second cDNA product under non-limiting conditions)) * 100.

[0346] Likewise, the reference methylation status of the small non-coding RNA (in the reference biological sample) is determined. In one embodiment, the determination of the reference methylation status of the small non-coding RNA (in the reference biological sample) comprises the steps of:

[0347] (i) providing a ligation product comprising small non-coding RNA to which the 5 ’adapter as defined in the first aspect and the 3 ’adapter as defined in the first aspect are ligated,

[0348] (ii) reverse transcribing the ligation product under limiting conditions, thereby obtaining a first cDNA product and reverse transcribing the ligation product under non-limiting conditions, thereby obtaining a second cDNA product,

[0349] (iii) amplifying the first cDNA product and the second cDNA product, and

[0350] (iv) calculating the reference methylation status as follows: reference methylation status (%) = (1- (copies first cDNA product under limiting conditions / copies second cDNA product under non-limiting conditions)) * 100.

[0351] Methylated small non-coding RNA is RNA which has been post-transcriptionally edited or modified by methylation. The methylation can occur at a base (e.g. methyl-6-adenine, pseudouridine) and / or ribose ring (2'-O-methylated nucleotide (2'-O-m)).

[0352] The methylation of small non-coding RNA occurring at a base is preferably selected from the group consisting of 6-methyladenosine (m6A), 5-methylcytidine (m5C), 5 -methyluridine (m5U), 3 -methyluridine (m3U), 1 -methyladenosine (m'A), and 1 -methyl guanosine (m]G), or is a combination thereof.

[0353] The 2'-O-methylation of the backbone ribose is the most common and conserved type of small non-coding RNA modification. The methylation of small non-coding RNA occurring at a ribose ring is preferably selected from the group consisting of 3 '-end 2'-O-methyladenosine (Am), 2'-O-methyluridine (Um), 2'-O- methylguanosine (Gm), and 2'-O-methylcytidine (Cm), or is a combination thereof.

[0354] The determination of the small non-coding RNA methylation status / reference methylation status encompassed the generation of a ligation product comprising the small non-coding RNA to which the 5 ’adapter as defined in the first aspect and the 3 ’adapter as defined in the first aspect are ligated.

[0355] In step (i) for determining the small non-coding RNA methylation status / reference methylation status, a ligation product is provided comprising small non-coding RNA to which the 5 ’adapter as defined in the first aspect and the 3 ’adapter as defined in the first aspect are ligated. Said ligation product is preferably produced by

[0356] (i) providing a composition comprising denatured small non-coding RNA, the renatured 5 ’adapter as defined in the first aspect, and the renatured 3 ’adapter as defined in the first aspect, wherein the 5 ’adapter and the 3 ’adapter are annealed to the small non-coding RNA, and

[0357] (ii) ligating the 5 ’adapter and the 3 ’adapter to the small non-coding RNA using / with a double stranded RNA ligase.

[0358] The annealing of the adapters, in particular 5’ and 3 ’adapters, to the small non-coding RNA requires that the small non-coding RNA is present in denatured form.

[0359] In one embodiment, the denatured small non-coding RNA is produced by heating the small noncoding RNA at between 65°C and 75°C, e.g. 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or 75°C, preferably at 70°C, for between 1 to 3 minutes, e.g. 1, 2, or 3, minutes, preferably for 2 minutes. For example, the denatured small non-coding RNA is produced by heating the small non-coding RNA at 70°C for 2 minutes.

[0360] It is preferred that the small non-coding RNA is immediately placed on ice after denaturation. For the denaturation step, the small non-coding RNA is preferably given to an aqueous solution, e.g. water, or to a buffer solution. It is particularly preferred that the small non-coding RNA is treated after the denaturation with a polynucleotide kinase (to restore or introduce the 5’ phosphate).

[0361] As to the adapters, in particular 5’ and 3 ’adapters, a denaturation and a renaturation step is required so that they can from a stem-loop structure which allows annealing to the small noncoding RNA. Annealing is a process of heating and cooling adapters with complementary sequences. Heat breaks all hydrogen bonds and cooling allows new bonds to form between the sequences. During this process, the adapters, in particular 5’ and 3 ’adapters, attach to the denatured small non-coding RNA and form their characteristic stem-loop structure. In particular, the 5 ’adapter attaches to the 5 ’end of the small non-coding RNA and the 3 ’adapter attaches to the 3’end ofthe small non-coding RNA. It is preferred that the adapters, in particular s’ and 3 ’adapters, are denatured and renatured together, i.e. in a common reaction vessel. It is further preferred that the denaturation / renaturation of the adapters, in particular 5’ and 3 ’adapters, takes place separately and in the absence of the small non-coding RNA.

[0362] In one embodiment, the renatured 5 ’adapter is produced by denaturing the 5’adapter at between 75°C and 85°C, e.g. 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or 85°C, preferably at 82°C, for between 1 to 3 minutes, e.g. 1, 2, or 3 minutes, preferably for 2 minutes, and renaturing the 5’adapter by cooling down to 4°C, preferably at a rate of 0. l°C / s.

[0363] For example, the renatured 5’adapter is produced by denaturing the 5’adapter at 82°C for 2 minutes and by renaturing the 5’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s.

[0364] In one additional or alternative embodiment, the renatured 3 ’adapter is produced by denaturing the 3’adapter at between 75°C and 85°C, e.g. 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, or 85°C, preferably at 82°C, for between 1 to 3 minutes, e.g. 1, 2, or 3 minutes, preferably for 2 minutes, and renaturing the 3’adapter by cooling down to 4°C, preferably at a rate of 0. l°C / s.

[0365] For example, the renatured 3’adapter is produced by denaturing the 3’adapter at 82°C for 2 minutes, and by renaturing the 3’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s. For the denaturation and renaturation step, the adapters, in particular 5’ and 3 ’adapters, are preferably given to an aqueous buffer, e.g. TNE annealing buffer. In other words, the denaturing and renaturing of the adapters, in particular 5’ and 3 ’adapters, is preferably carried out in an aqueous buffer, e.g. TNE annealing buffer.

[0366] The above-mentioned composition, i.e. the composition comprising denatured small noncoding RNA, the renatured 5’adapter as defined in the first aspect, and the renatured 3’adapter as defined in the first aspect, wherein the 5’adapter and the 3’adapter are annealed to the small noncoding RNA, is preferably produced by mixing the denatured small non-coding RNA, the renatured 5’adapter as defined in the first aspect, and the renatured 3’adapter as defined in the first aspect with each other, thereby annealing the 5’adapter and the 3’adapter to the small non-coding RNA.

[0367] The annealing of the 5’adapter with the small non-coding RNA particularly generates a double-stranded (DNA / RNA) hybrid containing a nick of RNA-OH-375’-P-RNA between the 3’end of the adapter and the 5 ’end of the small non-coding RNA. This is an efficient substrate for ligation by a double stranded RNA ligase. In addition, the annealing of the 3’adpater with the small non-coding RNA particularly generates a double-stranded (DNA / RNA) hybrid containing a nick of RNA-OH-375’-P-RNA between the 3’end of the small non-coding RNA and the 5’end of the adapter. This is a substrate for ligation by a double stranded RNA ligase.

[0368] The ligation, to produce the ligation product provided in step (i) of the method of the second aspect, is usually carried out in a ligation buffer. An exemplarily ligation buffers is described in the experimental section of the present patent application. In one preferred embodiment, the ligation buffer comprises polyethylene glycol (PEG), e.g. PEG 8000 (5%), and / or adenosine triphosphate (ATP), e.g. 1 mM ATP. The present inventors have noted that PEG had the effect on the ligation reaction such that it functions as molecular crowding agent and / or ATP had the effect on the ligation reaction such that increased concentrations facilitate the ligation reactions.

[0369] In one embodiment, the ligation is carried out between 36°C and 38°C, e.g. 36, 37, or 38°C, preferably at 37°C, for between 30 minutes and 1.5 hours, e.g. 30, 35, 40, 45, 50, 55 minutes, 1, 1.25, or 1.5 hour(s), preferably for 1 hour.

[0370] For example, the ligation is carried out at 37°C for 1 hour.

[0371] The double stranded RNA ligase can be any ligase capable of ligating double stranded RNA nicks / RNA structures. Preferably, the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2), a Kodl ligase or a RtcB ligase.

[0372] In this respect, it should be noted that only a perfectly hybridized molecule provides a substrate for the double stranded RNA ligase, in particular Rnl2. Also, in case of protrusion of either strand or a gap that is 2 nucleotides or longer, the Rnl2 will ligate the molecule with much lower efficiency. The adapters, in particular 5’ and 3 ’adapters, described herein provide a dsRNA context with a 6 to 15 nucleotide protrusion that hybridizes to the small non-coding RNA. Finally, a 5’ phosphate moiety on the small non-coding RNA is also of advantage for efficient ligation by Rnl2. By ligating the adapters, in particular 5’ and 3 ’adapters, to the small non-coding RNA using / with a double stranded RNA ligase, a ligation product is produced. The ligation product can be described as a (DNA / RNA) hybrid molecule comprising at least one adapter and small non-coding RNA. For example, the ligation product may comprise a 5 ’adapter and small non-coding RNA such as miRNA or isomiR. The ligation product may comprise a 3 ’adapter and small non-coding RNA such as miRNA or isomiR. In addition, the ligation produced may comprise a 5 ’adapter, a 3 ’adapter and small non-coding RNA such as miRNA or isomiR.

[0373] Methylated small non-coding RNA such as 2'-O-methylated small non-coding RNA induce reverse transcription stops / pauses at low concentrations of desoxynucleosidetriphosphates (dNTPs) (i.e. under limiting conditions), while at high dNTP concentrations (i.e. under nonlimiting conditions) reverse transcriptase can bypass methylated sites such as 2'-O-methylated sites. It appears that the methylated group such as 2'-O-methyl group acts as a conformational “bump” which hinders the passage of the reverse transcriptase, whose effect is minimized at high dNTP concentrations (i.e. under non-limiting conditions).

[0374] Thus, in step (ii) for determining the small non-coding RNA methylation status / reference methylation status, the ligation product is reverse transcribed under limiting conditions, thereby obtaining a first cDNA product. In addition, the (same) ligation product is reverse transcribed under non-limiting conditions, thereby obtaining a second cDNA product. In both cases, the reverse transcription of the ligation product is preferably carried out by

[0375] (iia) annealing a primer for reverse transcription (RT-primer) with the ligation product, and

[0376] (iib) reverse transcribing the ligation product by using a reverse transcriptase (RT).

[0377] In one preferred embodiment, said annealing of a primer for reverse transcription (RT- primer) with the ligation product in step (iia) is carried out at between 60°C and 80°C, e.g. 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80°C, preferably at 65°C or 75°C, for between 2 and 7 minutes, e.g. 2, 3, 4, 5, 6, or 7 minutes, preferably 3 or 5 minutes.

[0378] For example, said annealing is carried out at 65°C for between 2 and 7 minutes, e.g. 2, 3, 4, 5, 6, or 7 minutes, preferably 5 minutes. Alternatively, said annealing is carried out at 75°C for between 2 and 7 minutes, e.g. 2, 3, 4, 5, 6, or 7 minutes, preferably 3 minutes.

[0379] In one (additional or alternative) preferred embodiment, said reverse transcribing of the ligation product by using a reverse transcriptase (RT) in step (iib) is carried out at between 40°C and 65°C, e.g. 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, or 65°C, preferably at 50°C, 55°C, 58°C, or 62°C, for between 10 and 60 minutes, e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 minutes, preferably 15 or 60 minutes, and subsequently at between 70°C and 90°C, e.g. 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90°C, preferably at 70°C or 85°C, for between 2 and 20 minutes, e.g. 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 minutes, preferably 15 minutes.

[0380] Specifically, the reverse transcriptase (RT) is a Maxima H-RT, Tth polymerase, Protoscript II RT, Luna RT, AMV, or M-MuLV, or any other enzymes derived from these. More specifically, the reverse transcriptase (RT) is a Maxima H-RT or Luna RT.

[0381] In the reverse transcription reaction, the 3 ’adapter ligated to the 3 ’end of the small noncoding RNA is extended, in particular in 5’ to 3’ direction, to form a strand reverse complementary to the small non-coding RNA. Especially, a cDNA copy of the ligation product is produced in the reverse transcription reaction. For this process, the reverse transcriptase (RT) requires a RT primer. The RT-primer is particularly reverse complementary to the nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem of the 3 ’adapter. Thus, the RT-primer sequence depends on the 3’ adapter sequence.

[0382] In one particular embodiment, the RT-primer has the following sequence from 5’ to 3’: CTCAGTGCGAATACCTCGGACCCTGCACTGAGGTAGT (SEQ ID NO: 3) or is a variant of this sequence. The RT-primer is, thus, reverse complementary to at least a part of the 3’adpater sequence as described above. In particular, the RT-primer is reverse complementary to nucleotides in the 3’positioned second stem sequence and / or in the loop sequence.

[0383] As mentioned above, the 3 ’adapter sequence is preferably the following from 5’ to 3’: / 5Phos / CTC AGTGC AGGGTCCGAGGT ATTCGC ACTGAG / 6- 15x)N / 3InvdTZ (SEQ ID NO: 2), wherein “ / 5Phos / ” indicates that the 5’-terminal nucleotide is phosphorylated, wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double underlined portion are optionally LNA enhanced, wherein (6-15x)N designates the sequence reverse complementary to a 3 ’terminal sequence of a target RNA, and wherein “ / 3InvdT / ” stands for 3 ’inverted deoxynucleotide. Specifically, the LNA enhanced nucleotides are ribonucleotides.

[0384] The RT-primer variant has a sequence having at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, still even more preferably 99%, e.g. 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 3. Such a RT-primer variant is still capable of binding the 3 ’adapter sequence and allowing reverse transcription which is performed by a reverse transcriptase (RT), e.g. Maxima H-RT, Tth polymerase, Protoscript II RT, Luna RT, AMV, or M-MuLV, or any other enzymes derived from these. The skilled person can readily assess whether a RT primer variant is still capable of binding the 3 ’adapter sequence and allowing reverse transcription. For example, the experimental section provides sufficient information in this respect.

[0385] Preferably, said reverse transcribing of the ligation product under limiting conditions means performing the reverse transcription with a desoxynucleosidetriphosphate (dNTP) concentration which is 1 / 10 or less, e.g. 1 / 10, 1 / 11, 1 / 12, 1 / 13, 1 / 14, 1 / 15, 1 / 16, 1 / 17, 1 / 18, 1 / 19, 1 / 20, 1 / 21, 1 / 22, 1 / 23, 1 / 24, 1 / 25, 1 / 26, 1 / 27, 1 / 28, 1 / 29, 1 / 30, 1 / 31, 1 / 32, 1 / 33, 1 / 34, 1 / 35, 1 / 36, 1 / 37, 1 / 38, 1 / 39, 1 / 40, 1 / 41, 1 / 42, 1 / 43, 1 / 44, 1 / 45, 1 / 46, 1 / 47, 1 / 48, 1 / 49, 1 / 50, or less, of the dNTP concentration under non-limiting conditions.

[0386] More preferably, said reverse transcription of the ligation product is conducted with a dNTP concentration which is between 1 / 10 and 1 / 50, e.g. 1 / 10, 1 / 11, 1 / 12, 1 / 13, 1 / 14, 1 / 15, 1 / 16, 1 / 17,

[0387] 1 / 18, 1 / 19, 1 / 20, 1 / 21, 1 / 22, 1 / 23, 1 / 24, 1 / 25, 1 / 26, 1 / 27, 1 / 28, 1 / 29, 1 / 30, 1 / 31, 1 / 32, 1 / 33, 1 / 34,

[0388] 1 / 35, 1 / 36, 1 / 37, 1 / 38, 1 / 39, 1 / 40, 1 / 41, 1 / 42, 1 / 43, 1 / 44, 1 / 45, 1 / 46, 1 / 47, 1 / 48, 1 / 49, or 1 / 50, of the dNTP concentration under non-limiting conditions. Even more preferably, said reverse transcription of the ligation product is conducted with between 0.25 mM and 50 mM dNTPs, e.g. with 0.25, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 mM dNTPs.

[0389] Still even more preferably, said reverse transcription of the ligation product is conducted with between 0.25 mM and 25 mM dNTPs, e.g. with 0.25, 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 mM dNTPs.

[0390] Most preferably, said reverse transcription of the ligation product is conducted with 1 mM dNTPs. In contrast thereto, the reverse transcription of the ligation product “under non-limiting (normal) conditions” is preferably conducted with between 2.5 mM and 500 mM dNTPs, more preferably with between 2.5 mM and 250 mM dNTPs, and even more preferably with 10 mM dNTPs.

[0391] Thus, the reverse transcription reaction under limiting conditions (test reaction) is specifically performed with 1 mM dNTPs and the reverse transcription reaction under non-limiting (normal) conditions (control reaction) is specifically performed with 10 mM dNTPs.

[0392] For determining the small non-coding RNA methylation status / reference methylation status, the cDNA products derived therefrom have to be amplified in step (iii).

[0393] The amplification requires a DNA polymerase, e.g. a Taq polymerase. The cDNA is preferably diluted for the PCR, specifically digital PCR, e.g. 1 : 10.

[0394] In one particular embodiment, the amplification reaction, is carried out with a Forward primer having the following sequence from 5’ to 3’: TGGAGTGTGTGCTTTGCCACG (SEQ ID NO: 4) or with a variant of this sequence and a Reverse primer having the following sequence from 5’ to 3’ : GTGCGAATACCTCGGACC (SEQ ID NO: 5) or with a variant of this sequence (see above).

[0395] Any amplification method may be used.

[0396] Specifically, the amplification is carried out using a polymerase chain reaction (PCR).

[0397] More specifically, the PCR is selected from the group consisting of digital PCR, real-time PCR (quantitative PCR or qPCR), preferably Taq-man qPCR, multiplex PCR, nested PCR, high fidelity PR, fast PCR, hot start PCR, and GC-rich PCR. The digital PCR is preferably a digital droplet PCR or a digital partition PCR.

[0398] Even more specifically, the digital PCR or the TaqMan qPCR is carried out with a Forward primer having the following sequence from 5’ to 3’: TGGAGTGTGTGCTTTGCCACG (SEQ ID NO: 4) or with a variant of this sequence and a Reverse primer having the following sequence from 5’ to 3’ : GTGCGAATACCTCGGACC (SEQ ID NO: 5) or with a variant of this sequence. While the forward primer is derived from the 5 ’adapter, the reverse primer is derived from the 3 ’adapter. These primer designs render the amplification completely dependent on ligation of both the 5’ and 3 ’adapters to exclusively amplify the ligation product. The amplification using a Taq- man qPCR may be carried out as follows: 95°C for 20 seconds, followed by 40 cycles at 95°C for 1 second and 60°C for 20 seconds. The amplification sample is subsequently hold at 4°C.

[0399] The Forward primer variant as described above has a sequence having at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, still even more preferably 99%, e.g. 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 4. Such a Forward primer variant is still capable of binding the DNA product produced from the 5 ’adapter in the reverse transcription reaction. In other words, the Forward primer variant must have at least in part, e.g. over a length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or of 21 nucleotides, the same sequence as the 5’adapter. In particular, the sequences are identical, e.g. over a length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or of 21 nucleotides, in the loop region and in the 3 ’positioned second stem sequence of the 5’adapter. The skilled person can readily assess whether a Forward primer variant is still capable binding the DNA product produced from the 5’adapter in the reverse transcription reaction. For example, the experimental section provides sufficient information in this respect.

[0400] In addition, the Reverse primer variant as described above has a sequence having at least 80%, preferably 85%, more preferably 90%, even more preferably 95%, still even more preferably 99%, e.g. 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the sequence according to SEQ ID NO: 5. Such a Reverse primer variant is still capable of binding the 3 ’adapter sequence and allowing cDNA preamplification / amplification. The skilled person can readily assess whether a Reverse primer variant is still capable of binding the 3 ’adapter sequence and allowing cDNA preamplification / amplification. For example, the experimental section provides sufficient information in this respect.

[0401] Still even more specifically, the TaqMan qPCR is carried out in the presence of a TaqMan probe. The sequence of the TaqMan probe depends on the sequence of the RNA target. The TaqMan probe is a hydrolysis probe that is designed to increase the specificity of quantitative PCR. In general, the TaqMan probe principle relies on the 5 ’-3’ exonuclease activity of the Taq polymerase to cleave a dual-labeled probe during hybridization to the complementary target sequence and fluorophore-based detection. As in other quantitative PCR methods, the resulting fluorescence signal permits quantitative measurements of the accumulation of the product during the exponential stages of the PCR. However, the TaqMan probe significantly increases the specificity of the detection. Preferably, the TaqMan probe has the following sequence: 16- FAM / TGAGGTAGTGGT ATTTCACCGGCGGCCGT / BHQ-1 / (SEQ ID NO: 7).

[0402] A difference between the cDNA products produced via reverse transcription under limiting conditions (i.e. at low concentrations of dNTPs) and the cDNA products produced via reverse transcription under non-limiting conditions (i.e. high concentrations of dNTPs) indicates small non-coding RNA methylation in the biological sample.

[0403] If there is no (significant) difference, the small non-coding RNA is not methylated. A significant difference in this respect preferably means that the experiment is conducted three times and that in all three experiments, a difference could be detected.

[0404] The difference may reside in different levels of the cDNA products.

[0405] Particularly, the level of the small non-coding RNA or cDNA product derived therefrom is determined by sequencing, preferably next generation sequencing (e.g. ABI SOLID, Illumina Genome Analyzer, Roche 454 GS FL, BGISEQ), nucleic acid hybridization (e.g. microarray or beads), nucleic acid amplification (e.g. polymerase chain reaction (PCR)), polymerase extension, mass spectrometry, flow cytometry (e.g. LUMINEX), or any combination thereof. More particularly, the PCR is selected from the group consisting of digital PCR, real-time PCR (quantitative PCR or qPCR), preferably TaqMan qPCR, multiplex PCR, nested PCR, high fidelity PR, fast PCR, hot start PCR, and GC-rich PCR. The digital PCR may be digital droplet PCR or digital partition PCR.

[0406] Specifically, the difference between the cDNA products produced via reverse transcription is based on a difference in expression levels determined by

[0407] (i) cycle thresholds in case of semiquantitative PCR reaction, or

[0408] (ii) copies per pl in case of digital PCR such as digital droplet PCR or digital partition PCR.

[0409] In step (iv) for determining the small non-coding RNA methylation status / reference methylation status, the methylation status / reference methylation status is calculated.

[0410] Preferably, the methylation status is calculated as follows: methylation status (%) = (1- (copies first cDNA product under limiting conditions / copies second cDNA product under non-limiting conditions)) * 100, and / or the reference methylation status is calculated as follows: reference methylation status (%) = (1- (copies first cDNA product under limiting conditions / copies second cDNA product under nonlimiting conditions)) * 100.

[0411] More preferably, the methylation status is calculated as follows: methylation status (%) = (1- (copies first cDNA product per pl at a dNTP concentration under limiting conditions / copies second cDNA product per pl at a dNTP concentration under non-limiting conditions)) * 100, and / or the reference methylation status is calculated as follows: reference methylation status (%) = (1- (copies first cDNA product per pl at a dNTP concentration under limiting conditions / copies second cDNA product per pl at a dNTP concentration under non-limiting conditions)) * 100. Especially, the dNTP concentration under limiting conditions is 1 / 10 or less, e.g. 1 / 10, 1 / 11, 1 / 12, 1 / 13, 1 / 14, 1 / 15, 1 / 16, 1 / 17, 1 / 18, 1 / 19, 1 / 20, 1 / 21, 1 / 22, 1 / 23, 1 / 24, 1 / 25, 1 / 26, 1 / 27, 1 / 28, 1 / 29, 1 / 30, 1 / 31, 1 / 32, 1 / 33, 1 / 34, 1 / 35, 1 / 36, 1 / 37, 1 / 38, 1 / 39, 1 / 40, 1 / 41, 1 / 42, 1 / 43, 1 / 44, 1 / 45, 1 / 46, 1 / 47, 1 / 48, 1 / 49, 1 / 50, or less, of the dNTP concentration under non-limiting (normal) conditions. For example, the methylation status of small non-coding RNA (molecules) in % can be calculated according to the following formula: methylation status (%) = (1- (copies first cDNA product per pl at 1 mM dNTP / copies second cDNA product per pl at 10 mM dNTP)) * 100.

[0412] For example, the reference methylation status of the small non-coding RNA (molecules) in % can also be calculated according to the following formula: reference methylation status (%) = (1- (copies first cDNA product per pl at 1 m dNTP / copies second cDNA product per pl at 10 mM dNTP)) * 100.

[0413] Even more preferably, a methylation status which is lower than the reference methylation status indicates that the patient suffers from cancer.

[0414] The biological sample analysed in the method of the second aspect may be any sample having a biological origin. Thus, the sample may also be a processed biological sample. For example, the biological sample may be a body fluid sample, e.g. a blood sample or urine sample, or a tissue sample, e.g. a tissue (biopsy) sample. Biological samples may be mixed or pooled, e.g. a sample may be a mixture of a blood sample and a urine sample.

[0415] The body fluid sample may be a urine sample, blood sample, sputum sample, breast milk sample, cerebrospinal fluid (CSF) sample, cerumen (earwax) sample, gastric juice sample, mucus sample, lymph sample, endolymph fluid sample, perilymph fluid sample, peritoneal fluid sample, pleural fluid sample, saliva sample, sebum (skin oil) sample, semen sample, sweat sample, tears sample, cheek swab, vaginal secretion sample, liquid biopsy, or vomit sample including components or fractions thereof. The term “body fluid sample” also encompasses body fluid fractions, e.g. blood fractions, urine fractions or sputum fractions. Body fluid samples may be mixed or pooled. Thus, a body fluid sample may be a mixture of a blood and a urine sample or a mixture of a blood and cerebrospinal fluid sample.

[0416] Particularly, the body fluid sample is a blood sample or the tissue (biopsy) sample is a cancer tissue (biopsy) sample. More particularly, the blood sample is a whole blood or a blood fraction, preferably blood cells (e.g. erythrocytes, leukocytes, and / or thrombocytes), serum, or plasma. For example, the blood cell fraction encompasses erythrocytes, leukocytes, and / or thrombocytes. The whole blood sample may be collected by means of a blood collection tube. It is, for example, collected in a PAXgene Blood RNA tube, in a Tempus Blood RNA tube, in an EDTA-tube, in a Na-citrate tube, Heparin-tube, or in an ACD-tube (Acid citrate dextrose). The whole blood sample may also be collected by means of a bloodspot technique, e.g. using a Mitra Microsampling Device. This technique requires smaller sample volumes, typically 45-60 pl for humans or less. For example, the whole blood may be extracted from a subject via a finger prick with a needle or lancet. Thus, the whole blood sample may have the form of a blood drop. Said blood drop is then placed on an absorbent probe, e.g. a hydrophilic polymeric material such as cellulose, which is capable of absorbing the whole blood. Once sampling is complete, the blood spot is dried in air before transferring or mailing to labs for processing. Because the blood is dried, it is not considered hazardous. Thus, no special precautions need be taken in handling or shipping. Once at the analysis site, the desired components, e.g. miRNAs, are extracted from the dried blood spots into a supernatant which is then further analyzed.

[0417] In the second aspect of the present invention, the biological sample may also be a biological sample containing total RNA. Particularly, total RNA includes RNA having a length of < 200 nucleotides such as a miRNA or a miRNA isoform (an isomiR). Specifically, the biological sample analysed in the second aspect of the present invention contains cellular total RNA. Particularly, cellular total RNA includes RNA having a length of < 200 nucleotides such as a miRNA or a miRNA isoform (an isomiR). The cellular total RNA may be obtained from blood cells, e.g. erythrocytes, leukocytes, and / or thrombocytes.

[0418] In the second aspect of the present invention, the cancer is preferably early-stage cancer such as cancer of stage I. More preferably, the cancer is early-stage lung cancer such as lung cancer of stage I.

[0419] Alternatively, the cancer is preferably lung cancer. More preferably, the lung cancer is early stage lung cancer such as lung cancer of stage I and / or stage II.

[0420] The small non-coding RNA analyzed in the biological sample in the second aspect of the present invention has preferably a length of < 200 ribonucleotides, more preferably a length of between 10 and < 200 ribonucleotides, even more preferably a length of between 10 and 100 ribonucleotides, and still even more preferably a length of between 18 and 50 ribonucleotides, e.g. a length of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32,

[0421] 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58,

[0422] 59, 60, 61 ,62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84,

[0423] 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107,

[0424] 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126,

[0425] 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145,

[0426] 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164,

[0427] 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183,

[0428] 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, or 199 ribonucleotides. Most preferably, the (above-mentioned) small non-coding RNA is a miRNA, a miRNA isoform (an isomiR), a ribosomal RNA fragment (rRNA fragment), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment.

[0429] With regard to the second aspect, the present inventors have exemplarily analyzed the 28 S ribosomal RNA (rRNA) fragment having a nucleotide sequence of 5’ GCCGCCGGUGAAAUACCACUAC 3’ (SEQ ID NO: 16). This rRNA fragment has two methylations sites, namely G (also designated as Gm4020) and C (also designated as Cm4032). While Gm4020 is a variable methylation site, Cm4032 shows a high degree of non-variable methylation. The methylation status of Gm4020 has been calculated / determined herein. A variation of this methylation status is indicative for the presence of cancer, specifically lung cancer. Specifically, the 5’adapter having the following sequence from 5’ to 3’ : CACCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 13), or the 5’adapter having the following sequence from 5’ to 3’ : CACmCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 14) in combination with the 3’adapter having the following sequence from 5’ to 3’ : / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAGGTAGTGGTA / 3InvdT / (SEQ ID NO: 15) allows to determine the methylation status of Gm4020 (“G”) of the 28 S ribosomal RNA (rRNA) fragment having a nucleotide sequence of 5’ GCCGCCGGUGAAAUACCACUAC 3’ (SEQ ID NO: 16).

[0430] The present inventors have also exemplarily shown that the 28S ribosomal RNA (rRNA) extracted from peripheral blood of a patient suffering from lung cancer has a methylation status which is lower than the methylation status of the same rRNA fragment extracted from peripheral blood of control subjects being healthy, i.e. not suffering from lung cancer. Thus, a methylation status of the 28S ribosomal RNA (rRNA) fragment extracted from peripheral blood of a patient which is lower than the methylation status of the same rRNA fragment extracted from peripheral blood of control subjects being healthy, i.e. not suffering from lung cancer, is indicative for lung cancer in the patient and, thus, allows the diagnosis of lung cancer in said patient.

[0431] As aforementioned, the methylation status of Gm4020 has been calculated / determined herein. Accordingly, the methylation status of Gm4020 of the afore-mentioned 28S ribosomal RNA (rRNA) extracted from peripheral blood of a patient which is lower (about 78.7 %) than the methylation status (about 82.7%) of Gm4020 of the same rRNA fragment extracted from peripheral blood of control subjects being healthy, i.e. not suffering from lung cancer, is indicative for lung cancer in the patient and, thus, allows the diagnosis of lung cancer in said patient.

[0432] In view of the above, in one more preferred embodiment, the present invention relates to a (an in vitro) method for diagnosing lung cancer such as early-stage lung cancer in a patient / for determining whether a patient suffers from lung cancer such as early-stage lung cancer comprising the steps of:

[0433] (a) determining a methylation status of a small non-coding RNA population in a blood sample, such as whole blood sample, obtained from a patient, and

[0434] (b) comparing the methylation status of a small non-coding RNA population in a blood sample, such as whole blood sample, obtained from a patient to a reference methylation status of the small non-coding RNA population.

[0435] This comparison allows to determine whether the patient suffers from lung cancer such as lung early-stage lung cancer.

[0436] Particularly, the reference methylation status is the methylation status of the small non-coding RNA population determined empirically by measuring a number of reference biological samples from healthy subjects / subjects known to not suffer from lung cancer such as early-stage lung cancer.

[0437] More particularly, the methylation status which is lower than this reference methylation status indicates that the patient suffers from lung cancer such as early-stage lung cancer.

[0438] In one even more preferred embodiment, the present invention relates to a (an in vitro) method for diagnosing lung cancer such as early-stage lung cancer in a patient / for determining whether a patient suffers from lung cancer such as early-stage lung cancer comprising the steps of

[0439] (a) determining a methylation status of a 28 S ribosomal RNA (rRNA) fragment population in a blood sample, such as whole blood sample, obtained from a patient, and

[0440] (b) comparing the methylation status of a 28 S ribosomal RNA (rRNA) fragment population in a blood sample, such as whole blood sample, obtained from a patient to a reference methylation status of the 28 S ribosomal RNA (rRNA) fragment population.

[0441] This comparison allows to determine whether the patient suffers from lung cancer such as lung early-stage lung cancer.

[0442] Particularly, the reference methylation status is the methylation status of the 28S ribosomal RNA (rRNA) fragment population determined empirically by measuring a number of reference biological samples from healthy subjects / subjects known to not suffer from lung cancer such as early-stage lung cancer. More particularly, the methylation status which is lower than this reference methylation status indicates that the patient suffers from lung cancer such as early-stage lung cancer.

[0443] In one still even more preferred embodiment, the present invention relates to a (an in vitro) method for diagnosing lung cancer such as early-stage lung cancer in a patient / for determining whether a patient suffers from lung cancer such as early-stage lung cancer comprising the steps of

[0444] (a) determining the methylation status of Gm4020 of a 28 S ribosomal RNA (rRNA) fragment population in a blood sample, such as whole blood sample, obtained from a patient, and

[0445] (b) comparing the methylation status of Gm4020 of a 28 S ribosomal RNA (rRNA) fragment population in a blood sample, such as whole blood sample, obtained from a patient to a reference methylation status of Gm4020 of the 28 S ribosomal RNA (rRNA) fragment population.

[0446] This comparison allows to determine whether the patient suffers from lung cancer such as lung early-stage lung cancer.

[0447] Particularly, the reference methylation status is the methylation status of Gm4020 of the 28 S ribosomal RNA (rRNA) fragment population determined empirically by measuring a number of reference biological samples from healthy subjects / subjects known to not suffer from lung cancer such as early-stage lung cancer, specifically early-stage lung cancer of stages I and / or II.

[0448] More particularly, the methylation status which is lower (about 78.7 %) than this reference methylation status (about 82.7%) indicates that the patient suffers from lung cancer such as early- stage lung cancer.

[0449] Herein, the 28 S ribosomal RNA (rRNA) fragment having a nucleotide sequence according to SEQ ID NO: 16 is disclosed. Also covered by the present invention, with respect to the first and second aspect, is (the determination of a methylation of) a variant thereof.

[0450] Preferably, said variant has

[0451] (i) a nucleotide sequence that is a fragment of the nucleotide sequence according to SEQ ID NO: 16, preferably, a nucleotide sequence that is a fragment which is between 1 and 6, more preferably between 1 and 4, and most preferably between 1 and 2, e.g. 1, 2, 3, 4, 5, or 6, nucleotides shorter than the nucleotide sequence according to SEQ ID NO: 16, or

[0452] (ii) a nucleotide sequence that has at least 80%, preferably at least 85%, more preferably at least 90%, and most preferably at least 95% or 99%, e.g. at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, sequence identity to the nucleotide sequence according to (i). In this respect, it should be noted that the methylation sites Gm4020 and / or Cm4032 are excluded from the nucleotide sequence modification. More preferably, the methylation site Gm4020 is excluded from the nucleotide sequence modification.

[0453] As mentioned above, the second aspect relates to a method for diagnosing lung cancer such as early-stage lung cancer in a patient / for determining whether a patient suffers from lung cancer such as early-stage lung cancer.

[0454] In one specific example (see also experimental section) of the second aspect of the present invention, the methylation status of Gm4020 of a 28 S ribosomal RNA (rRNA) fragment population in a blood sample, such as whole blood sample, obtained from a patient is determined. This methylation status is compared to a reference methylation status which is the methylation status of the 28 S ribosomal RNA (rRNA) fragment population determined empirically by measuring a number of reference blood samples, such as whole blood samples, from healthy subjects / subjects known to not suffer from lung cancer such as early-stage lung cancer.

[0455] In this method, a ligation product is provided comprising the 28S ribosomal RNA (rRNA) fragment of a 28S ribosomal RNA (rRNA) fragment population to which a 5’adapter having a nucleotide sequence according to SEQ ID NO: 13 or having a nucleotide sequence according to SEQ ID NO: 14 and a 3’adapter having a nucleotide sequence according to SEQ ID NO: 15 are ligated.

[0456] Then, the reverse transcription of the ligation product is carried out under limiting conditions, thereby obtaining a first cDNA product and the reverse transcription of the ligation product is carried out under non-limiting conditions, thereby obtaining a second cDNA product. For the reverse transcription, a RT primer having a nucleotide sequence according to SEQ ID NO: 3 is used.

[0457] Subsequently, the first cDNA product and the second cDNA product is amplified in a digital PCR (dPCR) reaction using a Forward primer having a nucleotide sequence according to SEQ ID NO: 4 and a Reverse primer having a nucleotide sequence according to SEQ ID NO: 5. As dPCR probe (TaqMan probe), a nucleotide sequence according to SEQ ID NO: 7 is used.

[0458] In the above method, the reverse transcription reaction under limiting conditions (test reaction) is ideally performed with 1 mM dNTPs and the reverse transcription reaction under non-limiting (normal) conditions (control reaction) is ideally performed with 10 mM dNTPs.

[0459] The 28 S ribosomal RNA (rRNA) fragment measured above has a nucleotide sequence according to SEQ ID NO: 16 or is a variant thereof.

[0460] The methylation status is calculated as follows: methylation status (%) = (1- (copies first cDNA product under limiting conditions / copies second cDNA product under non-limiting conditions)) * 100. The reference methylation status is calculated as follows: reference methylation status (%) = (1- (copies first cDNA product under limiting conditions / copies second cDNA product under non-limiting conditions)) * 100.

[0461] Preferably, the methylation status and the reference methylation status are compared. A methylation status which is lower than the reference methylation status indicates that the patient suffers from cancer such as early-stage lung cancer.

[0462] The early stage lung cancer is specifically lung cancer of stage I and / or stage II.

[0463] In a third aspect, the present invention relates to a 5’adapter comprising in the following order from 5’ to 3’ :

[0464] (i) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA, and wherein at least one of said 6 to 15 deoxynucleotides which are reverse complementary to the 5 ’-terminal sequence of small non-coding RNA is replaced by a 2’-ortho-methylated ribonucleotide, and

[0465] (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2 nucleotides, e.g. 2, 3, or 4, at its 3 ’end are ribonucleotides or modified ribonucleotides and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced.

[0466] Preferably, the LNA enhanced sequence comprises between 1 to 10, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, more preferably 3, locked nucleotides, specifically ribonucleotides.

[0467] In particular, the nucleotide sequence of the 5’ adapter comprises deoxynucleotides and ribonucleotides.

[0468] The 5’adapter may range from 15 to 60, e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60, nucleotides in length.

[0469] The 5’adapter may be present as linear polynucleotide, particularly in single-stranded form, e.g. after denaturation / when denatured. The 5’adapter is a polynucleotide that can be attached / ligated to the 5 ’end of small non-coding RNA. When attached / ligated to the 5 ’end of small non-coding RNA, the 5’adapter has a stem-loop structure. The attachment / ligation is possible as the 5’adapter comprises between 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to a 5’-terminal sequence of small non-coding RNA.

[0470] In one preferred embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. Thus, the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence can form the double stranded stem.

[0471] The double stranded stem may have a length of between 5 and 20, e.g. 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, nucleotides.

[0472] Preferably, each one of the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence has a length of between 5 to 10, e.g. 5, 6, 7, 8, 9, or 10, nucleotides. Particularly, the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence have the same length, e.g. a length of 5, 6, 7, 8, 9, or 10 nucleotides.

[0473] More preferably, the 5 ’positioned first stem sequence and / or the 3 ’positioned second stem sequence is (are) LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Even more preferably, the 5’positioned first stem sequence is LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Specifically, every, every second, or every third nucleotide may be LNA enhanced in the 5’positioned first stem sequence and / or the 3’positioned second stem sequence.

[0474] Thus, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise (a mixture of) deoxynucleotides and ribonucleotides (e.g. LNA-enhanced) or the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise ribonucleotides. Said ribonucleotides include ribonucleotides which are LNA-enhanced.

[0475] In one further embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. The loop sequence may comprise between 10 and 40, e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, nucleotides. Preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20, nucleotides, e.g. deoxynucleotides and / or ribonucleotides. More preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20, deoxynucleotides.

[0476] In one preferred embodiment, the nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem comprises deoxynucleotides with the exception of the at least two nucleotides at its 3 ’end which are ribonucleotides or modified ribonucleotides, preferably 2’-o-methyl ribonucleotides, and the locked ribonucleotides. In one another embodiment, the 5 ’-terminal sequence is configured such that it forms a single stranded 5 ’protrusion after formation of the stem-loop structure.

[0477] In one preferred embodiment, the 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to the 5 ’-terminal sequence of small noncoding RNA encompass G and C but not more than 4, e.g. 1, 2, 3, or 4, in a row.

[0478] In one embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5 ’positioned first stem sequence and a 3 ’positioned second stem sequence that are reverse complementary to each other.

[0479] In one more preferred embodiment, the one or more 2’-ortho-methylated ribonucleotide is located at a position (in said nucleotide sequence) corresponding to a position in the non-coding small RNA molecule that is presumed to be methylated. Alternatively, the one or more 2’-ortho- methylated ribonucleotide is located at a position (in said nucleotide sequence) base-pairing with a position in the non-coding small RNA molecule that is presumed to be methylated.

[0480] A preferred 5’ adapter (with methylation as well as specific for 28S ribosomal RNA (rRNA) fragment) has the following nucleotide sequence: CACmCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 14).

[0481] In one even more preferred embodiment, the 5’adapter as described above comprises a base-lacking spacer (e.g. a base-lacking 1’, 2’-dideoxyribose spacer) in the loop region.

[0482] In this specific case, the 5’adapter comprises, for example, in the following order from 5’ to 3’ :

[0483] (i) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA, and wherein at least one of said 6 to 15 deoxynucleotides which are reverse complementary to the 5 ’-terminal sequence of small non-coding RNA is replaced by a 2’-ortho-methylated ribonucleotide, and

[0484] (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2 nucleotides, e.g. 2, 3, or 4, at its 3 ’end are ribonucleotides or modified ribonucleotides, wherein the nucleotide sequence comprises a base-lacking spacer (e.g. a base-lacking 1’, 2’-dideoxyribose spacer), and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced.

[0485] In a fourth aspect, the present invention relates to a 3 ’adapter comprising in the following order from 5’ to 3’ :

[0486] (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5 ’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced, and (ii) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA, wherein at least one of said 6 to 15 deoxynucleotides which are reverse complementary to the 3’- terminal sequence of small non-coding RNA is replaced by a 2’-ortho-methylated ribonucleotide, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide.

[0487] Preferably, the LNA enhanced sequence comprises between 1 to 10, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, more preferably 3, locked nucleotides, specifically ribonucleotides.

[0488] In particular, the nucleotide sequence of the 3’ adapter comprises deoxynucleotides and ribonucleotides.

[0489] The 3’adapter may range from about 15 to about 60, e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60, nucleotides in length.

[0490] The 3’adapter may be present as linear polynucleotide, particularly in single- stranded form, e.g. after denaturation / when denatured. The 3’adapter is a polynucleotide that can be attached / ligated to the 3 ’end of small non-coding RNA. When attached / ligated to the 3 ’end of small non-coding RNA, the 3’adapter has a stem-loop structure. The attachment / ligation is possible as the 3’adapter comprises between 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to a 3’-terminal sequence of small non-coding RNA. The small non-coding RNA is preferably a miRNA or isomiR comprised in miRbase version 22.1.

[0491] In one embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5 ’positioned first stem sequence and a 3 ’positioned second stem sequence that are reverse complementary to each other. Thus, the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence can form the double stranded stem.

[0492] The double stranded stem may have a length of between 5 and 20, e.g. 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, nucleotides.

[0493] Preferably, each one of the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence has a length of between 5 to 10, e.g. 5, 6, 7, 8, 9, or 10, nucleotides. Particularly, the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence have the same length, e.g. a length of 5, 6, 7, 8, 9, or 10 nucleotides.

[0494] More preferably, the 5 ’positioned first stem sequence and / or the 3 ’positioned second stem sequence is (are) LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Even more preferably, the 3 ’positioned second stem sequence is LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Specifically, every, every second, or every third nucleotide may be LNA enhanced in the 5’positioned first stem sequence and / or the 3’positioned second stem sequence.

[0495] Thus, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise (a mixture of) deoxynucleotides and ribonucleotides (e.g. LNA-enhanced) or the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise ribonucleotides. Said ribonucleotides include ribonucleotides which are LNA-enhanced.

[0496] In one further embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. The loop sequence may comprise between 10 and 40, e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, nucleotides. Preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides, e.g. deoxynucleotides and / or ribonucleotides. More preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20, deoxynucleotides.

[0497] In one another embodiment, the 3 ’-terminal sequence is configured such that it forms a single stranded 3 ’protrusion after formation of the stem-loop structure.

[0498] In one preferred embodiment, the 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to the 3 ’-terminal sequence of small noncoding RNA encompass G and C but not more than 4, e.g. 1, 2, 3, or 4, in a row.

[0499] In one another preferred embodiment, the inverted deoxynucleotide is inverted dT, dA, dC, or dG. In this respect, it should be noted that the 3’inverted deoxynucleotide creates a 3’-3’ linkage and, thus, prevents undesired nucleotide synthesis from the 3 ’end of the adapter, e.g. during RT- PCR. In addition, the 3’inverted deoxynucleotide protects the sequence from 3’ exonuclease cleavage.

[0500] In one more preferred embodiment, the one or more 2’-ortho-methylated ribonucleotide is located at a position (in said nucleotide sequence) corresponding to a position in the non-coding small RNA molecule that is presumed to be methylated. Alternatively, the one or more 2’-ortho- methylated ribonucleotide is located at a position (in said nucleotide sequence) base-pairing with a position in the non-coding small RNA molecule that is presumed to be methylated. In a fifth aspect, the present invention relates to a combination of the 5 ’adapter of the third aspect and the 3 ’adapter of the fourth aspect.

[0501] In a sixth aspect, the present invention relates to a kit comprising the 5’adpater of the third aspect, the 3 ’adapter of the fourth aspect, and / or the combination of the fifth aspect.

[0502] The 5’adpater of the third aspect, the 3 ’adapter of the fourth aspect, and / or the combination of the fifth aspect can be used for determining the methylation status of small non-coding RNA to diagnose cancer in a patient / to determine whether a patient suffers from cancer (see first aspect of the present invention).

[0503] The 5’adpater of the third aspect, the 3 ’adapter of the fourth aspect, and / or the combination of the fifth aspect can also be used in a method for diagnosing cancer in a patient / for determining whether a patient suffers from cancer, wherein said method comprises the step of determining a methylation status of small non-coding RNA in a biological sample obtained from a patient (see second aspect of the present invention).

[0504] The cancer mentioned above is preferably lung cancer such as early stage lung cancer. The early stage lung cancer is specifically lung cancer of stage I and / or stage II.

[0505] In a seventh aspect, the present invention relates to a 5 ’adapter comprising in the following order from 5’ to 3’ :

[0506] (i) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA, and wherein at least one of said 6 to 15 deoxynucleotides which are reverse complementary to the 5 ’-terminal sequence of small non-coding RNA is LNA-enhanced, and

[0507] (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2 nucleotides, e.g. 2, 3, or 4, at its 3 ’end are ribonucleotides or modified ribonucleotides and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced.

[0508] Preferably, the LNA enhanced sequence comprises between 1 to 10, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, more preferably 3, locked nucleotides, specifically ribonucleotides.

[0509] In particular, the nucleotide sequence of the 5’ adapter comprises deoxynucleotides and ribonucleotides.

[0510] The 5’adapter may range from 15 to 60, e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60, nucleotides in length. The 5 ’adapter may be present as linear polynucleotide, particularly in single- stranded form, e.g. after denaturation / when denatured. The 5 ’adapter is a polynucleotide that can be attached / ligated to the 5 ’end of small non-coding RNA. When attached / ligated to the 5 ’end of small non-coding RNA, the 5 ’adapter has a stem-loop structure. The attachment / ligation is possible as the 5’adapter comprises between 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to a 5’-terminal sequence of small non-coding RNA.

[0511] In one preferred embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5’positioned first stem sequence and a 3’positioned second stem sequence that are reverse complementary to each other. Thus, the 5’positioned first stem sequence and the 3’positioned second stem sequence can form the double stranded stem.

[0512] The double stranded stem may have a length of between 5 and 20, e.g. 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, nucleotides.

[0513] Preferably, each one of the 5’positioned first stem sequence and the 3’positioned second stem sequence has a length of between 5 to 10, e.g. 5, 6, 7, 8, 9, or 10, nucleotides. Particularly, the 5’positioned first stem sequence and the 3’positioned second stem sequence have the same length, e.g. a length of 5, 6, 7, 8, 9, or 10 nucleotides.

[0514] More preferably, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence is (are) LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Even more preferably, the 5’positioned first stem sequence is LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Specifically, every, every second, or every third nucleotide may be LNA enhanced in the 5’positioned first stem sequence and / or the 3’positioned second stem sequence.

[0515] Thus, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise (a mixture of) deoxynucleotides and ribonucleotides (e.g. LNA-enhanced) or the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise ribonucleotides. Said ribonucleotides include ribonucleotides which are LNA-enhanced.

[0516] In one further embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. The loop sequence may comprise between 10 and 40, e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, nucleotides. Preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20, nucleotides, e.g. deoxynucleotides and / or ribonucleotides. More preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20, deoxynucleotides.

[0517] In one preferred embodiment, the nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem comprises deoxynucleotides with the exception of the at least two nucleotides at its 3 ’end which are ribonucleotides or modified ribonucleotides, preferably 2’-o-methyl ribonucleotides, and the locked ribonucleotides.

[0518] In one another embodiment, the 5 ’-terminal sequence is configured such that it forms a single stranded 5 ’protrusion after formation of the stem-loop structure.

[0519] In one preferred embodiment, the 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to the 5 ’-terminal sequence of small noncoding RNA encompass G and C but not more than 4, e.g. 1, 2, 3, or 4, in a row.

[0520] In one embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5 ’positioned first stem sequence and a 3 ’positioned second stem sequence that are reverse complementary to each other.

[0521] In one more preferred embodiment, the at least one 2’-ortho-methylated ribonucleotide is located at a position (in said nucleotide sequence) corresponding to a position in the non-coding small RNA (molecule) that is presumed to be methylated. Alternatively, the at least one 2’-ortho- methylated ribonucleotide is located at a position (in said nucleotide sequence) base-pairing with a position in the non-coding small RNA (molecule) that is presumed to be methylated.

[0522] In one even more preferred embodiment, the 5’adapter as described above comprises a base-lacking spacer (e.g. a base-lacking 1’, 2’-dideoxyribose spacer) in the loop region.

[0523] In this specific case, the 5’adapter comprises, for example, in the following order from 5’ to 3’ :

[0524] (i) a 5’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA, and wherein at least one of said 6 to 15 deoxynucleotides which are reverse complementary to the 5 ’-terminal sequence of small non-coding RNA is LNA-enhanced, and

[0525] (ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2 nucleotides, e.g. 2, 3, or 4, at its 3 ’end are ribonucleotides or modified ribonucleotides, wherein the nucleotide sequence comprises a base-lacking spacer (e.g. a base-lacking 1’, 2’-dideoxyribose spacer), and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced. In an eighth aspect, the present invention relates to a 3 ’adapter comprising in the following order from 5’ to 3’ :

[0526] (i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5 ’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced, and

[0527] (ii) a 3’terminal nucleotide sequence comprising 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides, deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA, wherein at least one of said 6 to 15 deoxynucleotides which are reverse complementary to the 3’- terminal sequence of small non-coding RNA is LNA-enhanced, and wherein the 3’terminal deoxynucleotide is an inverted deoxynucleotide.

[0528] Preferably, the LNA enhanced sequence comprises between 1 to 10, e.g. 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, more preferably 3, locked nucleotides, specifically ribonucleotides.

[0529] In particular, the nucleotide sequence of the 3’ adapter comprises deoxynucleotides and ribonucleotides.

[0530] The 3’adapter may range from about 15 to about 60, e.g. 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60, nucleotides in length.

[0531] The 3’adapter may be present as linear polynucleotide, particularly in single- stranded form, e.g. after denaturation / when denatured. The 3’adapter is a polynucleotide that can be attached / ligated to the 3 ’end of small non-coding RNA. When attached / ligated to the 3 ’end of small non-coding RNA, the 3’adapter has a stem-loop structure. The attachment / ligation is possible as the 3’adapter comprises between 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to a 3’-terminal sequence of small non-coding RNA. The small non-coding RNA is preferably a miRNA or isomiR comprised in miRbase version 22.1.

[0532] In one embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a 5 ’positioned first stem sequence and a 3 ’positioned second stem sequence that are reverse complementary to each other. Thus, the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence can form the double stranded stem.

[0533] The double stranded stem may have a length of between 5 and 20, e.g. 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20, nucleotides.

[0534] Preferably, each one of the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence has a length of between 5 to 10, e.g. 5, 6, 7, 8, 9, or 10, nucleotides. Particularly, the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence have the same length, e.g. a length of 5, 6, 7, 8, 9, or 10 nucleotides.

[0535] More preferably, the 5 ’positioned first stem sequence and / or the 3 ’positioned second stem sequence is (are) LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Even more preferably, the 3 ’positioned second stem sequence is LNA enhanced. Particularly, the LNA enhanced sequence comprises between 1 to 5, e.g. 1, 2, 3, 4, or 5, more particularly 3, locked nucleotides, specifically ribonucleotides. Examples of locked ribonucleotides are LNA-guanine, LNA-adenosine or LNA-cytosine. Specifically, every, every second, or every third nucleotide may be LNA enhanced in the 5’positioned first stem sequence and / or the 3’positioned second stem sequence.

[0536] Thus, the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise (a mixture of) deoxynucleotides and ribonucleotides (e.g. LNA-enhanced) or the 5’positioned first stem sequence and / or the 3’positioned second stem sequence may comprise ribonucleotides. Said ribonucleotides include ribonucleotides which are LNA-enhanced.

[0537] In one further embodiment, the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3’positioned second stem sequence. The loop sequence may comprise between 10 and 40, e.g. 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, nucleotides. Preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides, e.g. deoxynucleotides and / or ribonucleotides. More preferably, the loop sequence comprises between 12 and 20, e.g. 12, 13, 14, 15, 16, 17, 18, 19, or 20, deoxynucleotides.

[0538] In one another embodiment, the 3 ’-terminal sequence is configured such that it forms a single stranded 3 ’protrusion after formation of the stem-loop structure.

[0539] In one preferred embodiment, the 6 to 15, e.g. 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16, deoxynucleotides which are reverse complementary to the 3 ’-terminal sequence of small noncoding RNA encompass G and C but not more than 4, e.g. 1, 2, 3, or 4, in a row.

[0540] In one another preferred embodiment, the inverted deoxynucleotide is inverted dT, dA, dC, or dG. In this respect, it should be noted that the 3 ’inverted deoxynucleotide creates a 3 ’-3’ linkage and, thus, prevents undesired nucleotide synthesis from the 3 ’end of the adapter, e.g. during RT- PCR. In addition, the 3 ’inverted deoxynucleotide protects the sequence from 3’ exonuclease cleavage. In one more preferred embodiment, the one or more 2’-ortho-methylated ribonucleotide is located at a position (in said nucleotide sequence) corresponding to a position in the non-coding small RNA (molecule) that is presumed to be methylated. Alternatively, the one or more 2’-ortho- methylated ribonucleotide is located at a position (in said nucleotide sequence) base-pairing with a position in the non-coding small RNA (molecule) that is presumed to be methylated.

[0541] In a ninth aspect, the present invention relates to a combination of the 5 ’adapter of the seventh aspect and the 3 ’adapter of the eighth aspect.

[0542] In an tenths aspect, the present invention relates to a kit comprising the 5’adpater of the seventh aspect, the 3 ’adapter of the eighth aspect, and / or the combination of the ninth aspect.

[0543] The 5’adpater of the seventh aspect, the 3 ’adapter of the eighth aspect, and / or the combination of the ninth aspect can be used for determining the methylation status of small noncoding RNA to diagnose cancer in a patient / to determine whether a patient suffers from cancer (see first aspect of the present invention).

[0544] The 5’adpater of the seventh aspect, the 3 ’adapter of the eighth aspect, and / or the combination of the ninth aspect can also be used in a method for diagnosing cancer in a patient / for determining whether a patient suffers from cancer, wherein said method comprises the step of determining a methylation status of small non-coding RNA in a biological sample obtained from a patient (see second aspect of the present invention).

[0545] The cancer mentioned above is preferably lung cancer such as early stage lung cancer. The early stage lung cancer is specifically lung cancer of stage I and / or stage II.

[0546] As to preferred embodiments of the sample, it is referred to the first to third aspect of the present invention.

[0547] Various modifications and variations of the invention will be apparent to those skilled in the art without departing from the scope of invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the art in the relevant fields are intended to be covered by the present invention.

[0548] BRIEF DESCRIPTION OF THE FIGURES

[0549] The following Figures are merely illustrative of the present invention and should not be construed to limit the scope of the invention as indicated by the appended claims in any way. Figure 1: Shows the rRNA fragment of interest (underlined) in the context of the nucleotide sequence of the 28 S rRNA. Two 2-o-m sites are indicated.

[0550] Figure 2: Shows the assay specificity as measured on synthetic oligos. Unmethylated oligo percentage decreases in steps of 20%, while the Gm oligo percentage increases in the same way.

[0551] Figure 3: Shows a Gm4020 28 S rRNA methylation assays on clinical lung cancer samples compared to healthy controls. Controls represent non-cancer disease, whereas CaseLC represents a lung cancer group. P value of two-tailed t-test is indicated above.

[0552] Figure 4: Shows a Gm4020 28 S rRNA methylation assays on clinical early-stage lung cancer samples compared to healthy controls. Controls represent non-cancer disease, whereas stage la represents patients suffering from early-stage lung cancer. P value of two-tailed t-test is indicated above.

[0553] Figure 5: Shows linear regression illustrating the correlation between G4020 methylation and dNTP ratio. The X-axis represents the percentage of Gm4020, while the Y-axis displays the ratio of ImM to lOmM dNTPs. Serial dilutions of synthetic miLung#l were utilized to generate the data points, with each point representing a 10% increase in methylated G4020.

[0554] Figure 6: Shows miLung#l 1-D plot acquired from digital PCR (dPCR) analysis for two patients at two different dNTP concentrations (lOmM, ImM) and in duplicates (Rl, R2). Each dot represents an individual partition within the dPCR reaction, with positive partitions indicated in blue and negative partitions in grey. A threshold line is depicted, separating positive from negative partitions based on fluorescence intensity (RFU). A non-template control (NTC) was included.

[0555] Figure 7: Shows miLung#l Gm4020 2’-o-methylation in %, as measured by mer-idPCR. The p-value of Student’s t-test are indicated above respective group test against control group.

[0556] EXAMPLES

[0557] The examples given below are for illustrative purposes only and do not limit the invention described above in any way.

[0558] Previously, it has been shown by the present inventors that the measurement of the expression level of the 28 S rRNA fragment 5’-GCCGCCGGUGAAAUACCACUAC-3’ (SEQ ID NO: 16) (= fragment of interest, FOI) in a biological sample can be used for the detection of lung cancer in a patient. Interestingly, there are two 2-o-m sites within the 28S rRNA fragment, the Gm4020 and Cm4032 (see Figure 1). While Cm4032 shows a high degree of non- variable methylation (close to 100%), the Gm4020 site can be methylated with a variability (between 50-75%).

[0559] Here, the present inventors could show that the determination of the methylation status of this 28 S rRNA fragment allows lung cancer diagnosis, especially at early stages of lung cancer, e.g. lung cancer of stage I and / or stage II. Thereby, lung cancer diagnosis can be improved. Especially, the determination of the methylation status of this 28S rRNA fragment allows to distinguish between patients suffering from lung cancer, specifically early stages of lung cancer, e.g. lung cancer of stage I and / or stage II, and healthy control subjects.

[0560] Example 1:

[0561] A) Outline of the procedure

[0562] First, DB-PCR adapters are denatured and renatured such that they form required stem loop-like structures. The source RNA is denatured separately, treated with the polynucleotide kinase (to restore the 5’ phosphate), mixed with adapters and used for the ligation by T4 RNA ligase 2. Subsequently, RT primer aligning to the 3’ adapter is used for the cDNA production under limiting conditions. Next, diluted cDNA is used for the digital PCR with a reverse primer aligning to the 5’ end of first strand cDNA and forward primer complementary to the 3’ end of the first strand cDNA. Finally, a TaqMan probe is used for the detection of the specific signal in digital PCR. A ratio-based curve indicative of 2-o-m stoichiometry is calculated.

[0563] B) Protocol Details

[0564] 1. Adapter preparation

[0565] Adapter (100 pM) 5 pl lOxTNE annealing buffer 10 pl

[0566] Nuclease-free water _ 85 pl

[0567] Total 100 pl

[0568] Heat the mixture to 82°C for 2 min

[0569] - Ramp-down rate of 0. l°C / sec to 4°C Store at -20°C

[0570] 2. RNA denaturation Denature RNA for 2 min at 70°C

[0571] - Immediately place on ice PNK treatment of the RNA

[0572] Total 10 pl 3 pL / well

[0573] Incubate 20 min @37°C

[0574] Denature at 65°C for 10 min Ligation of the adapters to RNA

[0575] Total 20 pl 10 pL / well

[0576] - Incubate 1 hour at 37°C with the lid heated to 45°C

[0577] Store at -20°C Reverse transcription

[0578] Prepare the RT reaction at two different dNTP molarities (lOmM and ImM):

[0579] 1.5 1.5

[0580] Total 7.5 pl pL / well pL / well

[0581] Incubate 5 min at 65°C and cool immediately on ice Add following to the previous mixture

[0582] Total 12.5 pl 2.5 pl / well

[0583] - Incubate at 50°C for Ih min, followed by 15 min incubation at 70°C and store at 4°C Store at -20°C

[0584] 6. QIAcuity dPCR

[0585] - Dilute cDNA accordingly

[0586] - Prepare the following mixture for each per well

[0587] Total 10.8

[0588] Template (diluted) 1.2

[0589] Transfer 12pl to the 96-well-plate dPCR plate

[0590] C) Results:

[0591] To plot the methylation, we calculate the methylation status in % as such:

[0592] Methylation status (%) = (1- (copies per pl at ImM dNTP / copies per pl at lOmM dNTP))* 100

[0593] First, the specificity of the assay to measure the presence of methylation on the Gm4020 of the 28S rRNA fragment 5’-GCCGCCGGUGAAAUACCACUAC-3’ (SEQ ID NO: 16) (= fragment of interest, FOI), against an oligo with no Gm4020 methylation, was measured. For this purpose, an assay on synthetic RNAs was performed. The signal to be detected in the Gm oligo was expected, while no detection was expected in the oligo unmethylated at the Gm4020 position. Figure 2 shows the result of this experiment. Increasing percentage of the Gm oligo over the unmethylated oligo shows and increase in the methylation percentage. Based on the above, it was concluded that the assay is specific for the Gm and that the dynamic range of such assay is in the 0-88% range. Next, the Gm4020 methylation status was measured on the 28 S rRNA fragment 5’- GCCGCCGGUGAAAUACCACUAC-3’ (SEQ ID NO: 16) (= fragment of interest, FOI) in clinical samples. Peripheral blood from 7 lung cancer patients well as from 9 healthy controls was collected in the PAXgene Blood RNA tubes, respectively. The lung cancer group of 7 lung cancer patients covered a broad spectrum of lung cancer types and stages. The tubes were then used for RNA isolation using automated procedure on QIAsymphony liquid handling station. The RNA was used for the assays as described in the protocol details. A significant difference (t-test p-value 0.008) in the methylation status between healthy control subject (mean 82.7%) and lung cancer patient (mean 78.7%) RNA samples was determined (see Figure 3). This makes this assay amenable for the detection of (lung) cancer. In addition, a significant difference (t-test p-value 0.05) in the methylation status between healthy control subject (mean 82.7%) and early-stage lung cancer patient (mean 79.2%) RNA samples was determined (see Figure 4). Accordingly, this test can also be used for the detection of early-stage (lung) cancer.

[0594] D) Adapters and primer sequences (5’ -> 3’ orientation) used / described herein:

[0595] Previously, the methodology for the measurement of 2-o-m on small RNA fragments was reported. Similar adapters / primers were also used in the experiments described herein. The main difference is the usage of different primer for the reverse transcription, which facilitate the sensitivity of the assays towards Gm4020 and omits the Cm4032 site.

[0596] The list of oligos used for the experiments described herein or disclosed herein is as follows:

[0597] 5 ’Adapter: (6- 15x)NCGTGGCGTGGAGTGTGTGCTTTGCC ArCrG (SEQ ID NO: 1)

[0598] 5’ Adapter with idSP Version I: (6- 15x)NCGTGGCG / idSp / TGGAGTGTGTGCTTTGCC ArCrG (SEQ ID NO: 6)

[0599] 5 ’Adapter with idSP Version II: (6- 15x)NCG / idSp / TGGCGTGGAGTGTGTGCTTTGCC ArCrG (SEQ ID NO: 12)

[0600] 5’ adapter, without methylation, specific for 28 S ribosomal RNA (rRNA) fragment: CACCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 13)

[0601] 5’ adapter, with methylation, specific for 28S ribosomal RNA (rRNA) fragment: CACmCGGCGGCCG / idSp / TGGCGTGGAGTGTGTGCTTTGCC ArCrG (SEQ ID NO: 14) 3’Adapter: / 5Phos / CTC AGTGC AGGGTCCGAGGT ATTCGC ACTGAGI6- 15xW3InvdT / (SEQ ID NO: 2)

[0602] 3’ adapter, without methylation, specific for 28S ribosomal RNA (rRNA) fragment: / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAGGTAGTGGTA / 3InvdT / (SEQ ID NO: 15)

[0603] RT Primer: CTCAGTGCGAATACCTCGGACCCTGCACTGAGGTAGT (SEQ ID NO: 3)

[0604] Forward Primer: TGGAGTGTGTGCTTTGCCACG (SEQ ID NO: 4)

[0605] Reverse Primer: GTGCGAATACCTCGGACC (SEQ ID NO: 5)

[0606] TaqMan probe: FAM / TGAGGTAGTGGTATTTCACCGGCGGCCGT / BHQ-1 / (SEQ ID NO: 7)

[0607] “No methylation” synthetic RNA:

[0608] / 5Phos / rGrCrCrGrCrCrGrGrUrGrArArArUrArCrCrArCrUrArC (SEQ ID NO: 8)

[0609] “Gm” synthetic RNA (2’-o-methyl is bold):

[0610] / 5Phos / rGrCrCrGrCrCmGrGrUrGrArArArUrArCrCrArCrUrArC (SEQ ID NO: 9)

[0611] “Cm” synthetic RNA (2’-o-methyl is bold):

[0612] / 5Phos / rGrCrCrGrCrCrGrGrUrGrArArArUrArCrCrAmCrUrArC (SEQ ID NO: 10) “GmCm” Positive control synthetic RNA (2’-o-methyl is bold):

[0613] / 5Phos / rGrCrCrGrCrCmGrGrUrGrArArArUrArCrCrAmCrUrArC (SEQ ID NO: 11)

[0614] Sequence of the 28S ribosomal RNA (rRNA) of interest to be detected in a biological sample: GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 16) (SEQ ID NO: 16).

[0615] Example 2:

[0616] The method as described herein was applied to a set of clinical samples with the aim to discriminate between the control, non-cancerous patient samples, and samples coming from patients diagnosed with cancer. Specifically, early stages of lung cancer were detected with the method described herein. The patient characteristics (i.e. patient demographics and clinical information) are described below:

[0617] Controls Cancers

[0618] Patient Characteristic (n=231) (n= 150)

[0619] Female 81 (35. 1 ) 61 (40.7)

[0620] Male 150 (64.9) 89 (59.3) Age, y

[0621] Mean±SD 63.9 ± 5.2 64.9 ± 5.4

[0622] Median (range) 64 (55-74) 65 (55-74)

[0623] Smoking stai

[0624] Current

[0625] Former

[0626] Pack -years, mean ± SD 50.9 ± 20.5 54.1 ± 21.5

[0627] Pathologic stage, n (%) la 68 (45.3) lb 22 (14.7)

[0628] Ila 15 (10.0) lib 45 (30.0)

[0629] Next, the presence of 2 ’-ortho-methylated guanin on position 4020 as found on ribosomal RNA fragment circulating in peripheral blood was measured. To measure the methylation, peripheral blood was first collected in PAXgene RNA tubes. Then, RNA was extracted. Subsequently, the extracted RNA was used to measure the methylation by digital PCR (dPCR).

[0630] 1. Blood collection

[0631] For this method, PAXgene RNA whole blood tubes (PreAnalytiX, Hombrechtikon, Switzerland) were used, which facilitates prompt lysis of whole blood and preserves both cellular and extracellular RNA. Upon collection of venous blood, PAXgene blood samples were inverted 10 times, and then frozen at -20°C within a 2-hour timeframe. For extended preservation, the tubes were relocated to a temperature of -80°C.

[0632] 2, Blood extraction

[0633] PAXgene tubes were thawed overnight and RNA was extracted using the PAXgene Blood miRNA Kit (Qiagen, Venlo, Netherlands) on the QIAsymphony SP liquid handling station (Qiagen, Venlo,

[0634] Netherlands). Before the automated PAXgene extraction, custom artificial spike-in sequences were added to the resuspended pellets. The elution was performed at 72 °C for 10 min in 200 pl of elution buffer. The resulting RNA was divided into aliquots and preserved at a temperature of -80 °C for storage.

[0635] 3, Detection of the Gm4020 methylation on ribosomal RNA fragment

[0636] 3 , 1 Adapter preparation

[0637] Adapter (100 pM) 5 pl lOxTNE annealing buffer* 10 pl

[0638] Nuclease-free water _ 85 pl

[0639] Total 100 pl

[0640] Heat the mixture to 82°C for 2 min.

[0641] - Ramp-down rate of 0. l°C / sec to 4°C.

[0642] Store at -20°C.

[0643] *10xTNE annealing buffer composition: Tris-HCl pH=7.5 (100 mM), NaCl (500mM), EDTA (ImM)

[0644] 3.2 RNA denaturation

[0645] Denature RNA for 2 min at 70°C. Immediately place on ice.

[0646] 3,3 PNK treatment of the RNA

[0647] Total 8 pl 1.76 pL / well

[0648] Incubate 20 min at 37°C.

[0649] Denature at 65°C for 10 min.

[0650] 3,4 Ligation of the adapters to RNA

[0651] Total 14 pl 6 pL / well - Incubate 1 hour at 37°C with the lid heated to 45°C.

[0652] Store at -20°C

[0653] Typically, a single ligation for RNA sample was performed, followed by duplicated reverse transcription.

[0654] 3,5 Reverse transcription

[0655] Prepare the RT reaction at two different dNTP molarities (lOmM and ImM):

[0656] 1.5 1.5

[0657] Total 7.5 JJ.1 pL / well pL / well

[0658] - Incubate 5 min at 65°C and cool immediately on ice.

[0659] - Add following to the previous mixture.

[0660] Total 12.5 pl 5 pl / well

[0661] - Incubate at 50°C for Ih, followed by 15 min incubation at 70°C and store at 4°C. Store at -20°C.

[0662] 3,6 QIAcuity dPCR

[0663] - Dilute cDNA accordingly (1 :5 dilution for 96-well plate, or 1 : 10 for 24-well plate, QIAcuity digital PCR, QIAgene).

[0664] - Prepare the following mixture for each well. | Nuclease-free water | 6,6 | 760,32 |

[0665] Total 10.8

[0666] Template (diluted) 1.2

[0667] Transfer 12 pl to the 96-well-plate dPCR plate or 40pl for the 24-well plate.

[0668] Typically, a single measurement for each cDNA sample was performed.

[0669] Described below are the Adapter and primer sequences (5’ — > 3’ orientation) used in this example.

[0670] Sequence of the 28S ribosomal RNA (rRNA) of interest to be detected in the sample: GCCGCCGGUGAAAUACCACUAC (SEQ ID NO: 16).

[0671] 4, Results

[0672] A prerequisite for these experiments was a linearity of the assay using defined portions of the methylated synthetic rRNA fragment (see Figure 5). This established the slope (-0,013) and Y- intercept (1,498) values for the linear fit. Then, a linear regression model was used to calculate the methylation %. Due to the outlier value at 100% methylated synthetic oligo, some of the clinical sample values reaching above 100% methylation were observed. This was attributed to the unknown nature of the in vivo rRNA fragment, possibly additional chemical modifications. The Gm4020 methylation for 674 clinical samples was measured in total. The expected signal intensity in ID digital PCR plots was observed, while no signal was observed in non-template control (see Figure 6).

[0673] Using the same threshold for the whole dataset, the copies / pl values for miLung#l at lOrnM and ImM dNTPs were determined. Then, this formula was applied to calculate the methylation %: copies per uZ at ImM

[0674] % methylation = ( -;- - - — — — - — 1,489) / — 0,013 copies per pZ at 10 mM

[0675] The control group and the different stages were then grouped and the methylation status was compared using Student’ s t-test (Figure 7). A clear trend towards lower methylation was observed in cancer patients of stages I and II as compared to the control patients. Thus, the mer-idPCR of the miLung#l Gm4020 will enable more efficient early lung cancer detection and will be used as showcase for usage of epitranscriptomics features measurements in liquid biopsies.

Claims

CLAIMS1. Use of a methylation status of small non-coding RNA to diagnose cancer in a patient / to determine whether a patient suffers from cancer.

2. The use of claim 1, wherein a combination of(i) a 5 ’adapter capable of forming a stem-loop structure containing a loop and a double stranded stem, and(ii) a 3 ’adapter capable of forming a stem-loop structure containing a loop and a double stranded stem is used for determining the methylation status of small non-coding RNA to diagnose cancer in a patient / to determine whether a patient suffers from cancer.

3. The use of claims 1 or 2, wherein the small non-coding RNA has a length of < 200 ribonucleotides, preferably a length of between 10 and < 200 ribonucleotides, more preferably a length of between 10 and 100 ribonucleotides, and even more preferably a length of between 10 and 50 ribonucleotides.

4. The use of claim 3, wherein the small non-coding RNA is a miRNA, a miRNA isoform (an isomiR), a ribosomal RNA fragment (rRNA fragment), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment.

5. The use of any one of claims 2 to 4, wherein the 5’adapter comprises in the following order from 5’ to 3’ :(i) a 5 ’terminal nucleotide sequence comprising 6 to 15 deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 5 ’-terminal sequence of small non-coding RNA, and(ii) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein at least 2 nucleotides at its 3 ’end are ribonucleotides or modified ribonucleotides and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced.

6. The use of claim 5, wherein the nucleotide sequence capable of forming a stem-loop structure comprises a 5 ’positioned first stem sequence and a 3 ’positioned second stem sequence that are reverse complementary to each other.

7. The use of claim 6, wherein each one of the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence has a length of between 5 to 10 nucleotides.

8. The use of claim 7, wherein the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence have the same length.

9. The use of any one of claims 6 to 8, wherein the 5’positioned first stem sequence and / or the 3 ’positioned second stem sequence is (are) LNA enhanced.

10. The use of claim 9, wherein the LNA enhanced sequence comprises between 1 to 5, preferably 3, locked nucleotides.

11. The use of any one of claims 6 to 10, wherein the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3 ’positioned second stem sequence.

12. The use of claim 11, wherein the loop sequence comprises between 12 and 20 nucleotides.

13. The use of claim 12, wherein the nucleotides are deoxynucleotides.

14. The use of any one of claims 5 to 13, wherein the 5’-terminal sequence is configured such that it forms a single stranded 5 ’protrusion after formation of the stem-loop structure.

15. The use of any one of claims 5 to 14, wherein the 6 to 15 deoxynucleotides which are reverse complementary to the 5 ’-terminal sequence of small non-coding RNA encompass G and C but not more than 4 in a row.

16. The use of any one of claims 2 to 15, wherein the 5 ’adapter has the following sequence from 5’ to 3’: (6-15x)NCGTGGCGTGGAGTGTGTGCTTTGCCArCrG (SEQ ID NO: 1), wherein “r” stands for ribonucleotide, wherein “(6-15x)N” designates the sequence reverse complementary to a 5 ’terminal sequence of small non-coding RNA, and wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double underlined portion are optionally LNA enhanced.

17. The use of any one of claims 5 to 16, wherein one or more of said 6 to 15 deoxynucleotides which are reverse complementary to the 5 ’-terminal sequence of small non-coding RNA are replaced by a 2’-ortho-methylated ribonucleotide.

18. The use of any one of claims 2 to 17, wherein the 3’adapter comprises in the following order from 5’ to 3’ :(i) a nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem, wherein the 5’-terminal nucleotide is phosphorylated and wherein the nucleotide sequence is optionally locked nucleotide- (LNA-) enhanced, and(ii) a 3 ’terminal nucleotide sequence comprising 6 to 15 deoxynucleotides, wherein said 6 to 15 deoxynucleotides are reverse complementary to a 3 ’-terminal sequence of small non-coding RNA and wherein the 3 ’terminal deoxynucleotide is an inverted deoxynucleotide.

19. The use of claim 18, wherein the nucleotide sequence capable of forming a stem-loop structure comprises a 5 ’positioned first stem sequence and a 3 ’positioned second stem sequence that are reverse complementary to each other.

20. The use of claim 19, wherein each one of the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence has a length of between 5 to 10 nucleotides.

21. The use of claim 20, wherein the 5 ’positioned first stem sequence and the 3 ’positioned second stem sequence have the same length.

22. The use of any one of claims 18 to 21, wherein the 5’positioned first stem sequence and / or the 3 ’positioned second stem sequence is (are) LNA enhanced.

23. The use of claim 22, wherein the LNA enhanced sequence comprises between 1 to 5, preferably 3, locked nucleotides.

24. The use of any one of claims 19 to 23, wherein the nucleotide sequence capable of forming a stem-loop structure comprises a loop sequence which is located between the 5’positioned first stem sequence and the 3 ’positioned second stem sequence.

25. The use of claim 24, wherein the loop sequence comprises between 12 and 20 deoxynucleotides.

26. The use of any one of claims 18 to 25, wherein the 3 ’-terminal sequence is configured such that it forms a single stranded 3 ’protrusion after formation of the stem-loop structure.

27. The use of any one of claims 18 to 26, wherein the 6 to 15 deoxynucleotides which are reverse complementary to the 3 ’-terminal sequence of small non-coding RNA encompass G and C but not more than 4 in a row.

28. The use of any one of claims 18 to 27, wherein the inverted deoxynucleotide is inverted dT, dA, dC, or dG.

29. The use of any one of claims 2 to 28, wherein the 3 ’adapter has the following sequence from 5’ to 3’: / 5Phos / CTCAGTGCAGGGTCCGAGGTATTCGCACTGAG(6- 15x)N / 3InvdT / (SEQ ID NO: 2), wherein “ / 5Phos / ” indicates that the 5’-terminal nucleotide is phosphorylated, wherein one or more nucleotides in the underlined portion and / or one or more nucleotides in the double underlined portion are optionally LNA enhanced, wherein (6-15x)N designates the sequence reverse complementary to a 3 ’terminal sequence of small non-coding RNA, and wherein “ / 3InvdT / ” stands for 3 ’inverted deoxynucleotide.

30. The use of any one of claims 18 to 29, wherein one or more of said 6 to 15 deoxynucleotides which are reverse complementary to the 3 ’-terminal sequence of small non-coding RNA are replaced by a 2’-ortho-methylated ribonucleotide.

31. The use of any one of claims 1 to 29, wherein the cancer is early-stage cancer, preferably cancer of stage I.

32. The use of any one of claims 1 to 29, wherein the cancer is lung cancer, preferably early- stage lung cancer, and more preferably lung cancer of stage I.

33. A method for diagnosing cancer in a patient / for determining whether a patient suffers from cancer comprising the step of:determining a methylation status of small non-coding RNA in a biological sample obtained from a patient.

34. The method of claim 33, wherein the methylation status of small non-coding RNA in a biological sample obtained from a patient is compared to a reference methylation status.

35. The method of claim 34, wherein the reference methylation status is the methylation status of the small non-coding RNA determined empirically by measuring a number of reference biological samples from healthy subjects / subjects known to not suffer from cancer.

36. The method of claim 35, wherein a methylation status which is lower than the reference methylation status indicates that the patient suffers from cancer.

37. The method of any one of claims 33 to 36, wherein the determination of the methylation status of small non-coding RNA comprises the steps of:(i) providing a ligation product comprising small non-coding RNA to which the 5 ’adapter as defined in any one of claims 2 to 33 and the 3 ’adapter as defined in any one of claim 2 to 33 are ligated,(ii) reverse transcribing the ligation product under limiting conditions, thereby obtaining a first cDNA product and reverse transcribing the ligation product under non-limiting conditions, thereby obtaining a second cDNA product,(iii) amplifying the first cDNA product and the second cDNA product, and(iv) calculating the methylation status as follows: methylation status (%) = (1- (copies first cDNA product under limiting conditions / copies second cDNA product under non-limiting conditions)) * 100.

38. The method of any one of claims 34 to 37, wherein the determination of the reference methylation status of the small non-coding RNA comprises the steps of:(i) providing a ligation product comprising small non-coding RNA to which the 5 ’adapter as defined in any one of claims 2 to 33 and the 3 ’adapter as defined in any one of claim 2 to 33 are ligated,(ii) reverse transcribing the ligation product under limiting conditions, thereby obtaining a first cDNA product and reverse transcribing the ligation product under non-limiting conditions, thereby obtaining a second cDNA product,(iii) amplifying the first cDNA product and the second cDNA product, and(iv) calculating the reference methylation status as follows: reference methylation status (%) = (1- (copies first cDNA product under limiting conditions / copies second cDNA product under non-limiting conditions)) * 100.

39. The method of claims 37 or 38, wherein the ligation product is produced by(i) providing a composition comprising denatured small non-coding RNA, the renatured 5 ’adapter as defined in any one of claims 2 to 33, and the renatured 3 ’adapter as defined in any one of claims 2 to 33, wherein the 5 ’adapter and the 3 ’adapter are annealed to the small non-coding RNA, and(ii) ligating the 5 ’adapter and the 3 ’adapter to the small non-coding RNA using / with a double stranded RNA ligase.

40. The method of claim 39, wherein the denatured small non-coding RNA is produced by heating the small non-coding RNA at between 65°C and 75°C, preferably at 70°C, for between 1 to 3 minutes, preferably for 2 minutes.

41. The method of claim 40, wherein the small non-coding RNA is treated after the denaturation with a polynucleotide kinase (to restore or introduce the 5’ phosphate).

42. The method of any one of claims 39 to 41, wherein the renatured 5’adapter is produced by denaturing the 5’adapter at between 75°C and 85°C, preferably at 82°C, for between 1 to 3 minutes, preferably for 2 minutes, and renaturing the 5’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s.

43. The method of any one of claims 39 to 42, wherein the renatured 3’adapter is produced by denaturing the 3’adapter at between 75°C and 85°C, preferably at 82°C, for between 1 to 3 minutes, preferably for 2 minutes, and renaturing the 3’adapter by cooling down to 4°C, preferably at a rate of 0.1°C / s.

44. The method of any one of claims 39 to 43, wherein the renatured 5’ and 3’adapters are produced separately and in the absence of the small non-coding RNA.

45. The method of any one of claims 39 to 44, wherein the denaturing and renaturing is carried out in TNE annealing buffer.

46. The method of any one of claims 39 to 45, wherein the composition is produced by mixing the denatured small non-coding RNA, the renatured 5 ’adapter as defined in any one of claims 1 to 27, and the renatured 3 ’adapter as defined in any one of claims 1 to 27 with each other, thereby annealing the 5 ’adapter and the 3 ’adapter to the small non-coding RNA.

47. The method of any one of claims 39 to 46, wherein the ligation is carried out in a ligation buffer comprising polyethylene glycol (PEG).

48. The method of any one of claims 39 to 47, wherein the ligation is carried out between 36°C and 38°C, preferably at 37°C, for between 30 minutes and 1.5 hours, preferably for 1 hour.

49. The method of any one of claims 39 to 48, wherein the double stranded RNA ligase is a T4 RNA ligase 2 (Rnl2), a Kodl ligase, or a RtcB ligase.

50. The method of any one of claims 37 to 49, wherein the reverse transcription of the ligation product is carried out by(iia) annealing a primer for reverse transcription (RT-primer) with the ligation product, and(iib) reverse transcribing the ligation product by using a reverse transcriptase (RT).

51. The method of claim 50, wherein said annealing is carried out at between 60°C and 80°C, preferably at 65°C or at 75°C, for between 2 and 7 minutes, preferably for 3 or 5 minutes.

52. The method of any one of claims 37 to 51, wherein said reverse transcribing is carried out at between 40°C and 65°C, preferably at 50°C, 55°C, 58°C, or 62°C, for between 10 and 60 minutes, preferably 15 or 60 minutes, and subsequently at between 70°C and 90°C, preferably at 70°C or 85°C, for between 2 and 20 minutes, preferably 15 minutes.

53. The method of any one of claims 50 to 52, wherein the reverse transcriptase (RT) is a Maxima H-RT, Tth polymerase, Protoscript II RT, Luna RT, AMV, or M-MuLV, or any other enzymes derived from these.

54. The method of any one of claims 50 to 53, wherein the RT-primer is reverse complementary to the nucleotide sequence capable of forming a stem-loop structure containing a loop and a double stranded stem of the 3 ’adapter.

55. The method of any one of claims 50 to 54, wherein the RT-primer has the following sequence from 5’ to 3’: CTCAGTGCGAATACCTCGGACCCTGCACTGAGGTAGT (SEQ ID NO: 3).

56. The method of any one of claims 37 to 55, wherein said reverse transcribing of the ligation product under limiting conditions means performing the reverse transcription with a desoxynucleosidetriphosphate (dNTP) concentration which is 1 / 10 or less of the dNTP concentration under non-limiting conditions, preferably which is between 1 / 10 and 1 / 50 of the dNTP concentration under non-limiting conditions.

57. The method of claim 56, wherein said reverse transcribing of the ligation product under limiting conditions means performing the reverse transcription with 1 mM dNTPs.

58. The method of any one of claims 37 to 57, wherein said reverse transcribing of the ligation product under non-limiting conditions means performing the reverse transcription with 10 mM dNTPs.

59. The method of any one of claims 37 to 58, wherein the amplification is carried out using a polymerase chain reaction (PCR).

60. The method of claim 59, wherein the PCR is selected from the group consisting of digital PCR, real-time PCR (quantitative PCR or qPCR), preferably TaqMan qPCR, multiplex PCR, nested PCR, high fidelity PR, fast PCR, hot start PCR, and GC-rich PCR.

61. The method of claim 60, wherein the digital PCR or the TaqMan qPCR is carried out with a Forward primer having the following sequence from 5’ to 3’: TGGAGTGTGTGCTTTGCCACG (SEQ ID NO: 4) and a Reverse primer having the following sequence from 5’ to 3’ : GTGCGAATACCTCGGACC (SEQ ID NO: 5).

62. The method of claims 60 or 61, wherein the Taq-man qPCR is carried out in the presence of a TaqMan probe.

63. The method of any one of claims 33 to 62, wherein the small non-coding RNA has a length of < 200 ribonucleotides, preferably a length of between 10 and < 200 ribonucleotides, more preferably a length of between 10 and 100 ribonucleotides, and even more preferably a length of between 10 and 50 ribonucleotides.

64. The method of claim 63, wherein the small non-coding RNA is a miRNA, a miRNA isoform (an isomiR), a ribosomal RNA fragment (rRNA fragment), a transfer RNA fragment (tRF), or a small nucleolar RNA (snorRNA) fragment.

65. The method of any one of claims 33 to 64, wherein the biological sample is a body fluid sample or tissue sample.

66. The method of claim 65, wherein the body fluid sample is a blood sample or the tissue sample is a cancer tissue sample.

67. The method of claim 66, wherein the blood sample is whole blood or a blood fraction, preferably blood cells, serum, or plasma.

68. The method of any one of claims 33 to 67, wherein the biological sample contains total RNA.

69. The method of claim 68, wherein the sample contains cellular total RNA.

70. The method of any one of claims 33 to 69, wherein the cancer is early-stage cancer, preferably cancer of stage I.

71. The method of any one of claims 33 to 69, wherein the cancer is lung cancer, preferably early-stage lung cancer, and more preferably lung cancer of stage I.