Small molecule vgsc inhibitors, pharmaceutical composition comprising said small molecules, therapeutic use thereof
Patent Information
- Authority / Receiving Office
- EP · EP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-05-10
- Publication Date
- 2026-03-18
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Medullary thyroid cancer (MTC) is challenging to treat, with standard therapies being ineffective, and there is a need for compounds that can target voltage-gated sodium channels (VGSCs) to address its metastatic and therapeutic limitations.
Development of small molecule VGSC inhibitors with specific chemical structures that target the Nav1.7 subtype, formulated into pharmaceutical compositions for administration to treat MTC and other diseases by inhibiting VGSC activity.
The VGSC inhibitors effectively reduce cancer cell viability, migration, and invasion, offering a potential therapeutic approach for MTC and related conditions by specifically targeting the overexpressed Nav1.7 channels in MTC cells.
Smart Images

Figure US2024028817_21112024_PF_FP_ABST
Abstract
Description
Attorney Docket No.222120-2030 SMALL MOLECULE VGSC INHIBITORS, PHARMACEUTICAL COMPOSITION COMPRISING SAID SMALL MOLECULES, THERAPEUTIC USE THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims priority to U.S. provisional application entitled “Nav1.7 Blockers for the Treatment of Metastatic Medullary Thyroid Cancer” having serial number 63 / 501,764 filed on May 12, 2023 and to U.S. provisional application entitled “SMALL MOLECULE VGSC INHIBITORS, PHARMACEUTICAL COMPOSITION COMPRISING SAID SMALL MOLECULES, THERAPEUTIC USE THEREOF” having serial number 63 / 520,685 filed on August 21, 2023, both of which are entirely incorporated herein by reference. STATEMENT ON FUNDING PROVIDED BY THE U.S. GOVERNMENT
[0002] This invention was made with Government support under contract R21CA226491 awarded by the National Institutes of Health. The Government has certain rights in the invention. BACKGROUND
[0003] Medullary thyroid cancer (MTC) is a type of neuroendocrine tumor (NET) evolving from neural crest-derived calcitonin-producing parafollicular C cells which in turn are responsiblefor controlling Ca2+levels in the blood stream. MTC accounts for approximately 4% of allthyroid cancer cases but disproportionally accounts for 13% of thyroid cancer related deaths. This subtype within the thyroid cancer is particularly challenging to treat as it doesn’t respond to standard-of-care treatments. Surgery is the only curative treatment for MTC. Although there are targeted agents to treat metastatic disease, none have shown an effect on overall survival. MTC remains an understudied cancer type and continues to disproportionately contribute to thyroid cancer related mortality. Therefore, there is an unmet need to identify compounds and pharmaceutical compositions that can be used in the treatment of MTC. SUMMARY
[0004] In accordance with the purpose(s) of the present disclosure, as embodied and broadly described herein, the disclosure, in one aspect, relates to compounds that are voltage-gated sodium channel (VGSC) inhibitors, pharmaceutical compositions including VGSC inhibitors, methods of use of the VGSC inhibitors and the pharmaceutical compositions, methods of making VGSC inhibitors, and the like. Compounds and pharmaceutical compositions of the present disclosure can be used in combination with one or more other therapeutic agents for treating metastatic cancers, medullary thyroid cancer, metastatic medullary thyroid cancer, chronic pain, and other diseases.Attorney Docket No.222120-2030
[0005] In an aspect, the present disclosure pertains to compounds having a formula represented by the following structure:wherein: R1is hydrogen, a primary amine, a secondary amine, a tertiary amine, a substituted or unsubstituted cycloalkyl group, a substituted or unsubstituted heterocycloalkyl group, a substituted or unsubstituted aryl group, or a substituted or unsubstituted heteroaryl group; m and n are independently an integer from 0 to 5; R2a, R2b, R2c, R2d, R2e, and R2fare independently selected from hydrogen, a hydroxyalkyl group, an ether, or a carboxyl group; each R3are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group; R4is hydrogen, an alkyl group, or a substituted or unsubstituted aryl group; Y is nitrogen or CH; and X is NH or C(Z)H, wherein Z is NH or O.
[0006] In a further aspect, the present disclosure pertains to pharmaceutical compositions comprising a disclosed compound or a pharmaceutically acceptable salt thereof and a pharmaceutically-acceptable carrier, formulated for administering to a subject.
[0007] In a further aspect, the present disclosure pertains to methods for treating a disease, comprising administering to a subject in need thereof, a pharmaceutical composition, wherein the pharmaceutical composition comprises a therapeutically effective amount of the composition comprising a disclosed compound or a therapeutically effective amount of a disclosed compound, or a pharmaceutically acceptable salt thereof.
[0008] Other systems, methods, features, and advantages of the present disclosure will be or become apparent to one with skill in the art upon examination of the following drawings and detailed description. It is intended that all such additional systems, methods, features, and advantages be included within this description, be within the scope of the present disclosure, and be protected by the accompanying claims. In addition, all optional and preferred features and modifications of the described embodiments are usable in all aspects of the disclosure taught herein. Furthermore, the individual features of the dependent claims, as well as all optional and preferred features and modifications of the described embodiments are combinable and interchangeable with one another.Attorney Docket No.222120-2030 BRIEF DESCRIPTION OF THE DRAWINGS
[0009] Many aspects of the present disclosure can be better understood with reference to the following drawings. The components in the drawings are not necessarily to scale, emphasis instead being placed upon clearly illustrating the principles of the present disclosure. Moreover, in the drawings, like reference numerals designate corresponding parts throughout the several views.
[0010] FIGS. 1A-1B illustrate a schematic structure of the voltage-gated sodium channel subtype NaV1.7 (PDB 6j8j)
[0042] with ^-subunits and tetrodotoxin (TTX), with a side view (FIG. 1A) showing NaV1.7 transmembrane segments S1–S6, with S1-S4 in cyan and S5-S6 shown in green, TTX binding site is circled, and local anesthetic binding site is indicated by an oval; and a bottom view (FIG.1B) of NaV1.7 with TTX bound.
[0011] FIG.1C illustrates a proposed mechanism for the involvement of VGSCs in cancer cell motility, VGSC is colocalized with NHE1 and NCX. The activity of VGSC facilitates cancer cell motility by increasing acidity of extracellular matrix (ECM) environment, inducing ECM protease secretion, and increasing the concentration of Ca2+in intracellular fluid which supports invadopodia formation by cancer cells.
[0012] FIG.2A shows the mRNA expression of Nav1.5, Nav1.6, and Nav1.7 in various cell lines. The mRNA expression of NaV1.7 in was conserved in MTC cell lines, MZ-CRC-1 and TT compared to pancreatic cancer cell line, BON and lung cancer cell line, H727. There was a significant difference on NaV1.5, NaV1.6, and NaV1.7 expression among NET cell lines as determine by one-way ANOVA; NaV1.5 F(DFn, DFd), F(3,6) = 19.3, p = 0.0017; MZ-CRC-1 (56.52 ± 7.90), TT (0.10 ± 0.00), BON (3.90 ± 0.24), H727 (1.00 ± 0.05), NaV1.6 F(DFn, DFd), F(3,7) = 116.3, p < 0.0001; MZ-CRC-1 (897.70 ± 15.25), TT (75.13 ± 15.71), BON (212.34 ± 36.40), H727 (206.79 ± 31.41), and NaV1.7 F(DFn, DFd), F(3,7) = 151.5, p < 0.0001; MZ- CRC-1 (22457.28 ± 2259.25), TT (9740.63 ± 501.42), BON (12.29 ± 3.74), H727 (744.14 ± 93.56).
[0013] FIG. 2B shows that normal thyroid cell lines, Nyth-ori3-1 and Htori-3, the papillary thyroid carcinoma cell line TPC-1, and the anaplastic thyroid carcinoma cell line Hth7 did not show detectable expression of NaV1.7 while the MZ-CRC-1 (15.18 ± 1.59) showed high NaV1.7 expression as determined by a one-way ANOVA F (DFn, DFd), F(4,10) = 298.6, p < 0.0001.
[0014] FIG.2C shows that the expression of NaV1.7 is significantly higher in metastatic MTC cell line, MZ-CRC-1 (1.05 ± 0.17) compared to TT cell line derived from primary tumor (0.40 ± 0.01) as determined by one-way ANOVA F(DFn, DFd), F(15, 32) = 201.1, p < 0.0001. MTC (cancerous) tissues showed higher expression of NaV1.7 than their normal counterparts with significant difference; TH64 normal (0.0021 ± 0.0014) and TH64 tumor (0.5258 ± 0.0360), p =Attorney Docket No.222120-2030 0.0001, TH79 normal (0.0355 ± 0.0007) and TH79 tumor (1) (1.4749 ± 0.0430) and TH79 tumor (2) (3.3186 ± 0.0346), p < 0.0001, TH46 normal (0.0112 ± 0.0017) and TH46 tumor (0.8688 ± 0.0694), p < 0.0001. Normal counterparts for MTC TH35, 59, 47, 42, 77, 89 and 86 was not available for comparison. Target gene expression was normalized to the housekeeping gene, ribosomal protein S27.
[0015] FIG.3A shows an immunoblot where NaV1.7 was detected in human MTC cell lines, MZ-CRC-1 and TT, transgenic MTC mouse cell lines compared to normal human thyroid cell lines, Nthy-ori3-1 and Htori-3, which showed no detectable expression of NaV1.7.
[0016] FIG.3B shows an immunoblot where four out of six MTC patient tissues showed the expression of NaV1.7 while it was not detected in normal thyroid tissue.
[0017] FIG.3C shows immunoblots and comparison of SSTR2 expression (neuroendocrine cancer biomarker) with NaV1.7 expression in normal tissues and MTC patient tissues. SSTR2 expression exhibited matched trends with Nav1.7 expression in 3 out of 4 MTC patient tissues that had NaV1.7 expression.
[0018] FIG.4A shows tissue microarrays (TMAs) in MTC patient tissues. MZ-CRC-1 thyroid cancer cells are positive for NaV1.7 and Nthy-ori3-1 normal thyroid cells are negative for NaV1.7 expression. The cell pellets for NaV1.7 Ab validation were created for MTC patients tissue staining.
[0019] FIG.4B shows TMAs that consisted of paraffin-embedded cores of MTC from nine patients positive for NaV1.7 (cores in triplicates), and six normal thyroid specimens negative for NaV1.7.
[0020] FIG.4C shows an automated quantification of NaV1.7 expression in MTC TMAs.
[0021] FIG.4D shows an automated quantification with custom MATLAB® (The Mathworks, Inc., Natick, Massachusetts) code identifying 70.73% of samples (n = 29 / 41) with ^50% expression of NaV1.7; data are normally distributed, with mean at 60-70 % expression of NaV1.7.
[0022] FIG.4E shows a percentage of NaV1.7 expression by mean in each TMA compared to normal thyroid tissue, the error bars show the standard error of the mean (SEM), N = number of cores; normal thyroid tissue 15.04 ± 4.45 (N = 10), MTC TMA556.57 ± 5.53 (N = 18). TMA6A 47.29 ± 3.17 (N = 34), TMA6B 61.80 ± 2.12 (N = 30), and TMA754.42 ± 4.04 (N = 43). There was statistically significant difference between normal thyroid samples and MTC TMAs as determined by one-way ANOVA F(DFn, DFd), F(4, 128) = 10.07, p < 0.0001.
[0023] FIG. 4F shows TMA quantification from 133 tissue cores including normal thyroid, primary MTC and metastatic MTC (MTC subjects, N = 41 and total no. of subjects, N total =Attorney Docket No.222120-2030 45). There was a statistically significant difference between normal thyroid samples: 15.04 ± 4.45 vs primary MTC: 56.24 ± 2.82 and metastatic MTC: 52.28 ± 2.88 as determined by one- way ANOVA F(DFn, DFd), F(2, 130) = 15.37, p < 0.0001. However, the expression level of NaV1.7 on cancerous tissues in both primary and metastatic MTC showed no significant difference, p = 0.5754.
[0024] FIG.5A shows a cytotoxicity screening of the inhibitors using MZ-CRC-1 cells in an MTT assay; SV188 IC50= 9.00 ± 1.92 μM, Compound 4 IC50= 14.53 ± 2.81 μM and WJB-133 IC50= 8.04 ± 0.47 μM.
[0025] FIG. 5B shows mRNA expression of different genes, NaV1.7 (SCN9A) and NHE1 (SLC9A), in MZ-CRC-1cells after treatment with 5 PM of Compound 4, SV188, and WJB-133 for 24 h. SV188 treatment significantly decreased the expression of NaV1.7 (p <0.05, control: 1.01 ± 0.08, SV188: 0.18 ± 0.05), and NHE1 (p <0.01, control: 1.09 ± 0.31, SV188: 0.15 ± 0.06). Target gene expression was normalized to the housekeeping gene, ribosomal protein S27.
[0026] FIGS.6A-6C show mRNA expression of NaV1.5 (SCN5A) (FIG.6A), NaV1.6 (SCN8A) (FIG.6B), and NaV1.7 (SCN9A) (FIG.6C) in MZ-CRC-1 cells after treatment with 5 PM of SV188 for 48 h. SV188 treatment significantly decreased the expression of NaV1.7 (Unpaired t-test, t (3) = 8.17, p = 0.0038) control: 1.00 ± 0.03, SV188: 0.75 ± 0.01, and increased the expression of NaV1.5 (Unpaired t-test, t (4) = 5.50, p = 0.0053) control: 1.01 ± 0.11, SV188: 1.73 ± 0.06, with no significant effect on the expression of NaV1.6 (Unpaired t-test, t (4) = 0.6467, p = 0.5530) control: 1.06 ± 0.27, SV188: 1.26 ± 0.15. Target gene expression was normalized to GAPDH.
[0027] FIG. 7A shows representative recordings showing stationary blockade of NaV1.7 currents by increasing concentrations of SV188 in μM. Whole-cell patch-clamp recordings were made from NaV1.7 channels transiently expressed in a HEK-293 cell. Sodium currents (INa) were evoked by voltage steps to -10 mV from a holding potential (HP) of -120 mV applied every 10 s. Traces are the average of three consecutive recordings under the indicated experimental conditions. The black dotted line represents the zero current level.
[0028] FIG.7B shows a time course of NaV1.7 current blockade by SV188. Data from the same cell shown in A. Current recovery was incomplete in most cells; on average, 74 ± 3% of current was recovered after extensive wash out of SV188.
[0029] FIG. 7C shows a dose-response relationship of the effect of SV188 on NaV1.7 channels. Fraction of the blocked current was calculated from peak current measurements from step voltages to -10 mV in the presence of several SV188 concentrations (n = 3-16 cells). Data points (mean ± SEM) were fitted using a Hill equation (smooth line); the correspondingAttorney Docket No.222120-2030 IC50and Hill slope (nH) parameters are shown in the graph. Points indicated with arrows display the corresponding fraction of current blocked by 3 μM and 10 μM of SV188 when using a HP = -80 mV.
[0030] FIG.8A shows representative families of sodium currents obtained before (Control), during, and after (Recovery) exposure to 5 μM of SV188. Currents were recorded in response to 16-PV^GHSRODUL]LQJ^SXOVHV^IURP^í^^^WR^^^^^^P9^LQ^^^-mV steps applied every 5 s from a +3^RI^í^^^^P9^^
[0031] FIG.8B shows current-voltage relationships of NaV1.7 channels obtained under the indicated experimental conditions. Peak INaamplitudes were normalized to the Cmvalue of each cell, averaged, and plotted as a function of the depolarizing potential (Vm; n = 13 cells). Note that outward currents are practically absent in the presence of SV188.
[0032] FIG.8C shows voltage-dependence of sodium conductance measured in the same cells as in FIG.8B. Smooth lines are fit to a Boltzmann function with the following parameters: Control, V1 / 2^í^^^^^^^^^^^P9^DQG^k = 8.0 ± 0.5 mV; SV188, V1 / 2^í^^^^^^^^^^^P9^^^DQG^k = ^^^^^^^^^^P9^^^^^^6WDWLVWLFDOO\^GLIIHUHQW^IURP^FRQWURO^FRQGLWLRQ^^p < 0.01).
[0033] FIG. 8D shows sodium currents evoked by test pulses to -10 mV after 200 ms prepulses to potentials from -120 to -50 mV in 5 mV steps. For comparison, the current recorded at -10 mV after the -90 mV prepulse is indicated by an arrow for both experimental conditions.
[0034] FIG.8E shows steady-state inactivation curves. Data points were obtained by plotting the normalized peak INaat -10 mV against the prepulse potential in each condition (n = 8 cells). Each data set was fit to a Boltzmann function (smooth lines) with the following parameters (V1 / 2and k YDOXHV^^^&RQWURO^^í^^^^^^^^^^^P9^^^^^^^^^^^^P9^^69^^^^^í^^^^^^^^^^^P9^^^^^^^^^^^^ mV. These parameters were not statistically different (P > 0.05, unpaired t-tests).
[0035] FIGS.9A-9B show use-dependent blockade of NaV1.7 channels by SV188. NaV1.7 currents were activated at 10-s intervals by 16-ms voltage steps to -10 mV applied from a HP of -120 mV. After recording currents in control saline, the cell was superfused with 5 μM of SV188 (FIG.9A) for 5 min or 25 nM TTX for 2.5 min (FIG.9B) in the absence of voltage steps. Depolarizing steps were then resumed (p1) in the continued presence of the respective blockers, until the stationary blockade was reached (pn). Finally, the blockers were washed out from the recoding chamber with saline control. INaamplitudes are plotted against time.
[0036] FIG.9C shows the fraction of INablocked by SV188 (p1 and pn on the left) or TTX (p1 and pn on the right) recorded at the first pulse after resumption of step depolarizations (p1)Attorney Docket No.222120-2030 and after stationary blockade was reached (pn) is plotted against Control (black bars). n = 4 cells for each compound.
[0037] FIG.9D shows a time course plot of use-dependent blockade of NaV1.7 channels in the absence and the presence of 5 μM of SV188. A train of 40 pulses to -10 mV at a frequency of 40 Hz was applied under each experimental condition. The peak of each pulse was normalized to the peak of the first pulse for each experimental condition, and the averaged values (n = 4 cells) plotted against test pulse number (Episode). The blockade of NaV1.7 channels is increased by around 50 % when the channel is activated at 40 Hz in comparison when the channels are activated every 10 s (0.1 Hz; Episode 1, 5 μM of SV188 points).
[0038] FIGS.10A-10B show inhibition of cell viability of MTC cells MZ-CRC-1 (FIG.10A) and TT (FIG.10B) by SV188 treatment. Inhibition of cell viability of MTC cells were measured in a MTT assay, MZ-CRC-1 IC50= 8.47 r 0.75 PM and TT IC50= 9.32 r 0.44 PM.
[0039] FIGS.10B-10C show inhibition of cell migration of MTC cells MZ-CRC-1 (FIG.10B) and TT (FIG.10C) by SV188 treatment. Treatment of SV188 reduced cells migration in both MZ-CRC-1 and TT cells. Cell migration effects were calculated based on the normalized fold change migration from three experiments, each experiment was carried out in quadruplicate for each group. Effect on cell migration with MZ-CRC1 control:1.00 ± 0.09, 3PM SV188: mean ± SEM, 0.73 ± 0.02 (p <0.05), 6PM SV188: mean ± SEM, 0.58 ± 0.06 (p <0.001). Effect on cell migration with TT control: 1.00 ± 0.12, 3PM SV188: 0.43 ± 0.08 (p <0.01), 6PM SV188: 0.47 ± 0.11 (p <0.01).
[0040] FIGS.10D-10E show inhibition of cell invasion of MTC cells MZ-CRC-1 (FIG.10D) and TT (FIG. 10E) by SV188 treatment. Cell invasion effects were calculated based on the normalized fold change invasion from three experiments, each experiment was carried out in quadruplicate for each group. Effect on cell invasion with MZ-CRC-1 control: 1.00 ± 0.08, 3PM SV188: 0.65 ± 0.09 (p <0.05), 6PM SV188: 0.48 ± 0.07 (p <0.001) and E. Effect on cell invasion with TT showed no significant differences, p = 0.974 and 0.983 from the treatment with 3PM and 6PM SV188 respectively.
[0041] FIG 11A shows a cell cycle analysis from a single experiment representing G0 / G1 phase, S phase and G2 phase, the data was indicated in percentage of cells on a scatter plot.
[0042] FIG.11B shows a quantification of cell cycle analysis in response to SV188 treatments at 3, 6 and 9 μM after 48 h from 3 experiments, G0 / G1 phase: Control (54.30 ± 3.33), 3 μM (64.17 ± 3.01, p = 0.0370), 6 μM (68.13 ± 2.18, p = 0.0024), 9 μM (68.97 ± 2.84, p = 0.0013), S phase: Control (7.33 ± 0.77), 3 μM (6.05 ± 0.14, p = 0.9814), 6 μM (5.24 ± 1.39, p = 0.9263), 9 μM (4.63 ± 1.47, p = 0.8569), G2 phase: Control (34.13 ± 4.63), 3 μM (26.17 ± 2.15, p =Attorney Docket No.222120-2030 0.1169), 6 μM (24.03 ± 1.03, p = 0.0318), 9 μM (23.10 ± 2.10, p = 0.0171). The significant GLIIHUHQFH^LQ^HDFK^SKDVH^ZDV^GHWHUPLQHG^E\^7XUNH\¶V^PXOWLSOH^FRPSDULVRQV^WHVW^ZKLFK^^^S^^^ ^^^^^DQG^^^^S^^^^^^^^^FRPSDUHG^ZLWK^FRUUHVSRQGLQJ^FRQWUROV^ A significant increase of G0 / G1 phase and a significant decrease of G2 phase was observed after the treatments with SV188 up to 9 μM for 48 h.
[0043] FIG.12 shows a correlations plot between %NaV1.7 expression and patient disease status (0 = normal thyroid, 1 = primary and 2 = metastases). There was a positive correlation between %NaV1.7 expression and patient disease status (normal thyroid, primary and metastatic) with linear regression equation; Y = 8.198X + 39.89 and R2= 0.04518.
[0044] FIGS. 13A-13C show representative families of NaV1.7 sodium currents obtained before (FIG.13A), during (FIG.13B), and after (FIG.13C) exposure to 5 μM of SV188 (left panels) or 25 nM TTX (right panels). Currents were recorded in response to 16-ms GHSRODUL]LQJ^SXOVHV^IURP^í^^^WR^^^^^P9^LQ^^^-P9^VWHSV^DSSOLHG^HYHU\^^^V^IURP^D^+3^RI^í^^^^ mV. Note that in the presence of SV188 outward currents are strongly blocked, in comparison with those recorded in the presence of TTX.
[0045] FIGS.14A-14B illustrate the creation of liver metastasis in mouse preclinical model and quantitative 3D Magnetic Resonance Imaging (MRI).
[0046] FIG.15 shows a schematic illustrating the effect of SV188 treatment on MTC cells colonization and liver metastasis development.
[0047] FIGS.16A-16B show quantitative MRI imaging of mice, a control group (FIG.16A) and a SV188 treated group (FIG. 16B) implanted with MZ cells for liver metastasis development. For the control group (FIG.16A), representative 2 out of 7 control mice with multiple liver metastases detected 8 weeks after MZ cells implantation. Importantly, hepatic nodules were not detected in these mice 4 weeks after cells injection. For the SV188 treated group (FIG.16B), representative 2 out of 9 SV188 treated mice with no hepatic metastases in any timepoint of MRI imaging.
[0048] Additional advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or can be learned by practice of the invention. The advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. DETAILED DESCRIPTIONAttorney Docket No.222120-2030
[0049] This disclosure is not limited to particular embodiments described, and as such may, of course, vary. The terminology used herein serves the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims.
[0050] Where a range of values is provided, each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.
[0051] Embodiments of the present disclosure will employ, unless otherwise indicated, techniques of medicine, organic chemistry, biochemistry, molecular biology, pharmacology, and the like, which are within the skill of the art. Such techniques are explained fully in the literature.
[0052] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to perform the methods and use the compositions and compounds disclosed and claimed herein. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in °C, and pressure is at or near atmospheric. Standard temperature and pressure are defined as 20 °C and 1 atmosphere.
[0053] Before the embodiments of the present disclosure are described in detail, it is to be understood that, unless otherwise indicated, the present disclosure is not limited to particular materials, reagents, reaction materials, manufacturing processes, dimensions, frequency ranges, applications, or the like, as such can vary. It is also to be understood that the terminology used herein is for the purposes of describing particular embodiments only, and is not intended to be limiting. It is also possible in the present disclosure that steps can be executed in different sequence, where this is logically possible. It is also possible that the embodiments of the present disclosure can be applied to additional embodiments involving measurements beyond the examples described herein, which are not intended to be limiting. It is furthermore possible that the embodiments of the present disclosure can be combined or integrated with other measurement techniques beyond the examples described herein, which are not intended to be limiting.Attorney Docket No.222120-2030
[0054] It should be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a support” includes a plurality of supports. In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings unless a contrary intention is apparent.
[0055] It should be noted that ratios, concentrations, amounts, and other numerical data may be expressed herein in a range format. It is to be understood that such a range format is used for convenience and brevity, and thus, should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. To illustrate, a concentration range of “about 0.1 percent to about 5 percent” should be interpreted to include not only the explicitly recited concentration of about 0.1 weight percent to about 5 weight percent but also include individual concentrations (e.g., 1 percent, 2 percent, 3 percent, and 4 percent) and the sub- ranges (e.g., 0.5 percent, 1.1 percent, 2.2 percent, 3.3 percent, and 4.4 percent) within the indicated range. The term “about” can include traditional rounding according to significant figures of the numerical value. In addition, the phrase “about ‘x’ to ‘y’” includes “about ‘x’ to about ‘y’”.
[0056] Furthermore, the terms “about”, “approximate”, “at or about”, and “substantially” as used herein mean that the amount or value in question can be the exact value or a value that provides equivalent results or effects as recited in the claims or taught herein. That is, it is understood that amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and / or larger or smaller, as desired, reflecting tolerances, conversion factors, rounding off, measurement error and the like, and other factors known to those of skill in the art such that equivalent results or effects are obtained. In some circumstances, the value that provides equivalent results or effects cannot be reasonably determined. In such cases, it is generally understood, as used herein, that “about” and “at or about” mean the nominal value indicated ±10% variation unless otherwise indicated or inferred. In general, an amount, size, formulation, parameter or other quantity or characteristic is “about,” “approximate,” or “at or about” whether or not expressly stated to be such. It is understood that where “about,” “approximate,” or “at or about” is used before a quantitative value, the parameter also includes the specific quantitative value itself, unless specifically stated otherwise.
[0057] Each of the applications and patents cited in this text, as well as each document or reference cited in each of the applications and patents (including during the prosecution of each issued patent; “application cited documents”), and each of the PCT and foreignAttorney Docket No.222120-2030 applications or patents corresponding to and / or claiming priority from any of these applications and patents, and each of the documents cited or referenced in each of the application cited documents, are hereby expressly incorporated herein by reference. Further, documents or references cited in this text, in a Reference List before the claims, or in the text itself; and each of these documents or references (“herein cited references”), as well as each document or reference cited in each of the herein-cited references (including any manufacturer’s specifications, instructions, etc.) are hereby expressly incorporated herein by reference.
[0058] Prior to describing the various embodiments, the following definitions are provided and should be used unless otherwise indicated. Definitions
[0059] It is understood that “substitution” or “substituted” includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, i.e., a compound that does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc.
[0060] It will be understood by those skilled in the art that the moieties substituted can themselves be substituted, if appropriate. For instance, the substituents of a substituted alkyl may include halogen, hydroxy, nitro, thiol, amino, azido, imino, amido, phosphoryl (including phosphonate and phosphinate), sulfonyl (including sulfate, sulfonamido, sulfamoyl and sulfonate), and silyl groups, as well as ethers, alkylthios, carbonyls (including ketones, aldehydes, carboxylates, and esters), -CF3, -CN and the like. Cycloalkyls can be substituted in the same manner.
[0061] The term "acyl" as used herein, alone or in combination, means a carbonyl or thiocarbonyl group bonded to a radical selected from, for example, optionally substituted, hydrido, alkyl (e.g. haloalkyl), alkenyl, alkynyl, alkoxy ("acyloxy" including acetyloxy, butyryloxy, iso-valeryloxy, phenylacetyloxy, benzoyloxy, p-methoxybenzoyloxy, and substituted acyloxy such as alkoxyalkyl and haloalkoxy), aryl, halo, heterocyclyl, heteroaryl, sulfonyl (e.g. allylsulfinylalkyl), sulfonyl (e.g. alkylsulfonylalkyl), cycloalkyl, cycloalkenyl, thioalkyl, thioaryl, amino (e.g alkylamino or dialkylamino), and aralkoxy. Illustrative examples of "acyl" radicals are formyl, acetyl, 2-chloroacetyl, 2-bromacetyl, benzoyl, trifluoroacetyl, phthaloyl, malonyl, nicotinyl, and the like. The term "acyl" as used herein refers to a group - C(O)R26, where R26is hydrogen, alkyl, cycloalkyl, cycloheteroalkyl, aryl, arylalkyl, heteroalkyl, heteroaryl, and heteroarylalkyl. Examples include, but are not limited to formyl, acetyl, cyclohexylcarbonyl, cyclohexylmethylcarbonyl, benzoyl, benzylcarbonyl and the like.Attorney Docket No.222120-2030
[0062] The terms “administering” and “administration” as used herein refer to introducing a composition (e.g., a vaccine, adjuvant, or immunogenic composition) of the present disclosure into a subject. As used herein, “administering” can refer to an administration that is oral, topical, intravenous, subcutaneous, transcutaneous, transdermal, intramuscular, intra-joint, parenteral, intra-arteriole, intradermal, intraventricular, intraosseous, intraocular, intracranial, intraperitoneal, intralesional, intranasal, intracardiac, intraarticular, intracavernous, intrathecal, intravireal, intracerebral, and intracerebroventricular, intratympanic, intracochlear, rectal, vaginal, by inhalation, by catheters, stents or via an implanted reservoir or other device that administers, either actively or passively (e.g. by diffusion) a composition the perivascular space and adventitia. A preferred route of administration of the vaccine composition is intravenous.
[0063] The term "alkyl", either alone or within other terms such as "thioalkyl" and "arylalkyl", as used herein, means a monovalent, saturated hydrocarbon radical which may be a straight chain (i.e. linear) or a branched chain. The term “hydroxyalkyl” specifically refers to an alkyl group that is substituted with one or more hydroxy groups. When “alkyl” is used in one instance and a specific term such as “hydroxyalkyl” is used in another, it is not meant to imply that the term “alkyl” does not also refer to specific terms such as “hydroxyalkyl” and the like. An alkyl radical for use in the present disclosure generally comprises from about 1 to 20 carbon atoms, particularly from about 1 to 10, 1 to 8 or 1 to 7, more particularly about 1 to 6 carbon atoms, or 3 to 6. Illustrative alkyl radicals include methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, isopropyl, isobutyl, isopentyl, amyl, sec-butyl, tert-butyl, tert-pentyl, n-heptyl, n-actyl, n-nonyl, n-decyl, undecyl, n-dodecyl, n-tetradecyl, pentadecyl, n-hexadecyl, heptadecyl, n-octadecyl, nonadecyl, eicosyl, dosyl, n-tetracosyl, and the like, along with branched variations thereof. In certain aspects of the disclosure an alkyl radical is a C1-C6lower alkyl comprising or selected from the group consisting of methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, isopropyl, isobutyl, isopentyl, amyl, tributyl, sec-butyl, tert-butyl, tert-pentyl, and n-hexyl. An alkyl radical may be optionally substituted with substituents as defined herein at positions that do not significantly interfere with the preparation of compounds of the disclosure and do not significantly reduce the efficacy of the compounds. In certain aspects of the disclosure, an alkyl radical is substituted with one to five substituents including halo, lower alkoxy, lower aliphatic, a substituted lower aliphatic, hydroxy, cyano, nitro, thio, amino, keto, aldehyde, ester, amide, substituted amino, carboxyl, sulfonyl, sulfuryl, sulfenyl, sulfate, sulfoxide, substituted carboxyl, halogenated lower alkyl (e.g. CF3), halogenated lower alkoxy, hydroxycarbonyl, lower alkoxycarbonyl, lower alkylcarbonyloxy, lower alkylcarbonylamino, cycloaliphatic, substituted cycloaliphatic, or aryl (e.g., phenylmethyl benzyl)), heteroaryl (e.g., pyridyl), andAttorney Docket No.222120-2030 heterocyclic (e.g., piperidinyl, morpholinyl). Substituents on an alkyl group may themselves be substituted.
[0064] The term “cycloalkyl” as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms. Examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, norbornyl, and the like. The term “heterocycloalkyl” is a type of cycloalkyl group as defined above and is included within the meaning of the term “cycloalkyl,” where at least one of the carbon atoms of the ring is replaced with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkyl group and heterocycloalkyl group can be substituted or unsubstituted. The cycloalkyl group and heterocycloalkyl group can be substituted with one or more groups including, but not limited to, alkyl, cycloalkyl, alkoxy, amino, ether, halide, hydroxy, nitro, silyl, sulfo-oxo, or thiol as described herein.
[0065] The terms “alkoxy” and “alkoxyl” as used herein refer to an alkyl or cycloalkyl group bonded through an ether linkage; that is, an “alkoxy” group can be defined as —OA1where A1is alkyl or cycloalkyl as defined above. “Alkoxy” also includes polymers of alkoxy groups as just described; that is, an alkoxy can be a polyether such as —OA1—OA2or —OA1—(OA2)a— OA3, where “a” is an integer of from 1 to 200 and A1, A2, and A3are alkyl and / or cycloalkyl groups.
[0066] The term “alkenyl” as used herein is a hydrocarbon group of from 2 to 24 carbon atoms or 2 to 8 carbon atoms or 2 to 6 carbon atoms with a structural formula containing at least one carbon-carbon double bond. Asymmetric structures such as (R1R2)C=C(R3R4) are intended to include both the E and Z isomers. This can be presumed in structural formulae herein wherein an asymmetric alkene is present, or it can be explicitly indicated by the bond symbol C=C. The alkenyl group can be substituted with one or more groups including, but not limited to, alkyl, cycloalkyl, alkoxy, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, azide, nitro, silyl, sulfo-oxo, or thiol, as described herein.
[0067] The term “cycloalkenyl” as used herein is a non-aromatic carbon-based ring composed of at least three carbon atoms and containing at least one carbon-carbon double bound, i.e., C=C. Examples of cycloalkenyl groups include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclopentadienyl, cyclohexenyl, cyclohexadienyl, norbornenyl, and the like. The term “heterocycloalkenyl” is a type of cycloalkenyl group as defined above and is included within the meaning of the term “cycloalkenyl,” where at least one of the carbon atoms of the ring is replaced with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkenyl group and heterocycloalkenyl group can beAttorney Docket No.222120-2030 substituted or unsubstituted. The cycloalkenyl group and heterocycloalkenyl group can be substituted with one or more groups including, but not limited to, alkyl, cycloalkyl, alkoxy, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, azide, nitro, silyl, sulfo-oxo, or thiol as described herein.
[0068] As used herein, "alkynyl" or “alkynyl group” refers to straight or branched chain hydrocarbon groups having 2 to 40, 2 to 20, 2 to 10, or 2 to 5 carbon atoms and at least one triple carbon to carbon bond, such as ethynyl. Reference to "alkynyl" or “alkynyl group” includes unsubstituted and substituted forms of the hydrocarbon moiety.
[0069] The term “cycloalkynyl” as used herein is a non-aromatic carbon-based ring composed of at least seven carbon atoms and containing at least one carbon-carbon triple bound. Examples of cycloalkynyl groups include, but are not limited to, cyclooctynyl, cyclononynyl, and the like. The term “heterocycloalkynyl” is a type of cycloalkenyl group as defined above and is included within the meaning of the term “cycloalkynyl,” where at least one of the carbon atoms of the ring is replaced with a heteroatom such as, but not limited to, nitrogen, oxygen, sulfur, or phosphorus. The cycloalkynyl group and heterocycloalkynyl group can be substituted or unsubstituted. The cycloalkynyl group and heterocycloalkynyl group can be substituted with one or more groups including, but not limited to, alkyl, cycloalkyl, alkoxy, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, heteroaryl, aldehyde, amino, carboxylic acid, ester, ether, halide, hydroxy, ketone, azide, nitro, silyl, sulfo-oxo, or thiol as described herein.
[0070] The Ar (e.g., Ar1, Ar2, etc) group is an aromatic system or group such as an aryl group. “Aryl”, as used herein, refers to C5-C20-membered aromatic, heterocyclic, fused aromatic, fused heterocyclic, biaromatic, or bihetereocyclic ring systems. In an aspect, “aryl”, can include 5-, 6-, 7-, 8-, 9-, and 10-membered single-ring aromatic groups that may include from zero to four heteroatoms, for example, functional groups that correspond to benzene, pyrrole, furan, thiophene, imidazole, oxazole, thiazole, triazole, pyrazole, pyridine, pyrazine, pyridazine and pyrimidine, and the like. Those aryl groups having heteroatoms in the ring structure may also be referred to as “aryl heterocycles”, “heteroaromatics”, or “heteroaryl groups”. The aromatic ring can be substituted at one or more ring positions with one or more substituents including, but not limited to, halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxyl, amino (or quaternized amino), nitro, sulfhydryl, imino, amido, phosphonate, phosphinate, carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl, sulfonamido, ketone, aldehyde, ester, heterocyclyl, aromatic or heteroaromatic moieties, -CF3, -CN; and combinations thereof.
[0071] The term “aryl” also includes polycyclic ring systems (C5-C30) having two or more cyclic rings in which two or more carbons are common to two adjoining rings (i.e., “fused rings”) wherein at least one of the rings is aromatic, e.g., the other cyclic ring or rings can beAttorney Docket No.222120-2030 cycloalkyls, cycloalkenyls, cycloalkynyls, aryls and / or heterocycles. Examples of heterocyclic rings include, but are not limited to, benzimidazolyl, benzofuranyl, benzothiofuranyl, benzothiophenyl, benzoxazolyl, benzoxazolinyl, benzthiazolyl, benztriazolyl, benztetrazolyl, benzisoxazolyl, benzisothiazolyl, benzimidazolinyl, carbazolyl, 4aH carbazolyl, carbolinyl, chromanyl, chromenyl, cinnolinyl, decahydroquinolinyl, 2H,6H-1,5,2-dithiazinyl, dihydrofuro[2,3 b]tetrahydrofuran, furanyl, furazanyl, imidazolidinyl, imidazolinyl, imidazolyl, 1H-indazolyl, indolenyl, indolinyl, indolizinyl, indolyl, 3H-indolyl, isatinoyl, isobenzofuranyl, isochromanyl, isoindazolyl, isoindolinyl, isoindolyl, isoquinolinyl, isothiazolyl, isoxazolyl, methylenedioxyphenyl, morpholinyl, naphthyridinyl, octahydroisoquinolinyl, oxadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-oxadiazolyl, 1,2,5-oxadiazolyl, 1,3,4-oxadiazolyl, oxazolidinyl, oxazolyl, oxindolyl, pyrimidinyl, phenanthridinyl, phenanthrolinyl, phenazinyl, phenothiazinyl, phenoxathinyl, phenoxazinyl, phthalazinyl, piperazinyl, piperidinyl, piperidonyl, 4-piperidonyl, piperonyl, pteridinyl, purinyl, pyranyl, pyrazinyl, pyrazolidinyl, pyrazolinyl, pyrazolyl, pyridazinyl, pyridooxazole, pyridoimidazole, pyridothiazole, pyridinyl, pyridyl, pyrimidinyl, pyrrolidinyl, pyrrolinyl, 2H-pyrrolyl, pyrrolyl, quinazolinyl, quinolinyl, 4H-quinolizinyl, quinoxalinyl, quinuclidinyl, tetrahydrofuranyl, tetrahydroisoquinolinyl, tetrahydroquinolinyl, tetrazolyl, 6H-1,2,5-thiadiazinyl, 1,2,3-thiadiazolyl, 1,2,4-thiadiazolyl, 1,2,5-thiadiazolyl, 1,3,4- thiadiazolyl, thianthrenyl, thiazolyl, thienyl, thienothiazolyl, thienooxazolyl, thienoimidazolyl, thiophenyl and xanthenyl. One or more of the rings can be substituted as defined above for “aryl”.
[0072] In one aspect, a structure of a compound can include a moiety that can be represented by a formula:, which is understood to be equivalent to a formula:, where n is typically an integer. That is, Rnis understood to represent five independent substituents, Rn(a), Rn(b), Rn(c), Rn(d), and Rn(e). By “independent substituents,” it is meant that each R substituent can be independently defined. For example, if in one instance Rn(a) is halogen, then Rn(b) is not necessarily halogen in that instance.Attorney Docket No.222120-2030
[0073] The term "carboxyl" as used herein, alone or in combination, refers to -C(O)OR25- or - C(-O)OR25wherein R25is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, amino, thiol, aryl, heteroaryl, thioalkyl, thioaryl, thioalkoxy, a heteroaryl, or a heterocyclic, which may optionally be substituted. In aspects of the disclosure, the carboxyl groups are in an esterified form and may contain as an esterifying group lower alkyl groups. In particular aspects of the disclosure, -C(O)OR25provides an ester or an amino acid derivative. An esterified form is also particularly referred to herein as a "carboxylic ester". In aspects of the disclosure a "carboxyl" may be substituted, in particular substituted with allyl which is optionally substituted with one or more of amino, amine, halo, alkylamino, aryl, carboxyl, or a heterocyclic. Examples of carboxyl groups are methoxycarbonyl, butoxycarbonyl, tert.alkoxycarbonyl such as tert- butoxycarbonyl, arylmethyoxycarbonyl having one or two aryl radicals including without limitation phenyl optionally substituted by for example lower alkyl, lower alkoxy, hydroxyl, halo, and / or nitro, such as benzyloxycarbonyl, methoxybenzyloxycarbonyl, diphenylmethoxycarbonyl, 2-bromoethoxycarbonyl, 2-iodoethoxycarbonyltert.butylcarborlyl, 4-nitrobenzyloxycarbonyl, diphenylmethoxy-carbonyl, benzhydroxycarbonyl, di-(4- methoxyphenyl-methoxycarbonyl, 2-bromoethoxycarbonyl, 2-iodoethoxycarbonyl, 2- trimethylsilylethoxycarbonyl, or 2-triphenylsilylethoxycarbonyl. Additional carboxyl groups in esterified form are silyloxycarbonyl groups including organic silyloxycarbonyl. The silicon substituent in such compounds may be substituted with lower alkyl (e.g. methyl), alkoxy (e.g. methoxy), and / or halo (e.g. chlorine). Examples of silicon substituents include trimethylsilyi and dimethyltert.butylsilyl. In aspects of the disclosure, the carboxyl group may be an alkoxy carbonyl, in particular methoxy carbonyl, ethoxy carbonyl, isopropoxy carbonyl, t- butoxycarbonyl, t-pentyloxycarbonyl, sir heptyloxy carbonyl, especially methoxy carbonyl or ethoxy carbonyl.
[0074] The term “ester” as used herein is represented by the formula -OC(O)A1or -C(O)OA1, where A1can be alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroaryl group as described herein.
[0075] The term “ether” as used herein is represented by the formula A1OA2, where A1and A2can be, independently, an alkyl (e.g., CH2or C2H4), cycloalkyl, alkenyl, cycloalkenyl, alkynyl, cycloalkynyl, aryl, or heteroaryl group described herein.
[0076] The term "composition" as used herein refers to a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts. Such a term in relation to a pharmaceutical composition is intended to encompass a product comprising the active ingredient(s), and the inert ingredient(s) that make up the carrier, as well as any product which results, directly or indirectly, from combination, complexation, or aggregation of any two orAttorney Docket No.222120-2030 more of the ingredients, or from dissociation of one or more of the ingredients, or from other types of reactions or interactions of one or more of the ingredients. Accordingly, the pharmaceutical compositions of the present disclosure encompass any composition made by admixing a compound of the present disclosure and a pharmaceutically acceptable carrier.
[0077] When a compound of the present disclosure is used contemporaneously with one or more other drugs, a pharmaceutical composition containing such other drugs in addition to the compound of the present disclosure is contemplated. Accordingly, the pharmaceutical compositions of the present disclosure include those that also contain one or more other active ingredients, in addition to a compound of the present disclosure. The weight ratio of the compound of the present disclosure to the second active ingredient may be varied and will depend upon the effective dose of each ingredient. Generally, an effective dose of each will be used. Thus, for example, but not intended to be limiting, when a compound of the present disclosure is combined with another agent, the weight ratio of the compound of the present disclosure to the other agent will generally range from about 1000:1 to about 1:1000, preferably about 200:1 to about 1:200. Combinations of a compound of the present disclosure and other active ingredients will generally also be within the aforementioned range, but in each case, an effective dose of each active ingredient should be used. In such combinations the compound of the present disclosure and other active agents may be administered separately or in conjunction. In addition, the administration of one element may be prior to, concurrent to, or subsequent to the administration of other agent(s).
[0078] A composition of the disclosure can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. The compositions can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulations can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Various delivery systems are known and can be used to administer a composition of the disclosure, e.g. encapsulation in liposomes, microparticles, microcapsules, and the like.
[0079] A therapeutic composition of the disclosure may comprise a carrier, such as one or more of a polymer, carbohydrate, peptide or derivative thereof, which may be directly or indirectly covalently attached to the compound. A carrier may be substituted with substituents described herein including without limitation one or more alkyl, amino, nitro, halogen, thiol, thioalkyl, sulfate, sulfonyl, sulfinyl, sulfoxide, hydroxyl groups. In aspects of the disclosure the carrier is an amino acid including alanine, glycine, praline, methionine, serine, threonine, asparagine, alanyl-alanyl, prolyl-methionyl, or glycyl-glycyl. A carrier can also include a molecule that targets a compound of the disclosure to a particular tissue or organ.Attorney Docket No.222120-2030
[0080] Compounds of the disclosure can be prepared using reactions and methods generally known to the person of ordinary skill in the art, having regard to that knowledge and the disclosure of this application including the Examples. The reactions are performed in solvent appropriate to the reagents and materials used and suitable for the reactions being effected. It will be understood by those skilled in the art of organic synthesis that the functionality present on the compounds should be consistent with the proposed reaction steps. This will sometimes require modification of the order of the synthetic steps or selection of one particular process scheme over another in order to obtain a desired compound of the disclosure. It will also be recognized that another major consideration in the development of a synthetic route is the selection of the protecting group used for protection of the reactive functional groups present in the compounds described in this disclosure. An authoritative account describing the many alternatives to the skilled artisan is Greene and Wuts (Protective Groups In Organic Synthesis, Wiley and Sons, 1991).
[0081] A compound of the disclosure of the disclosure may be formulated into a pharmaceutical composition for administration to a subject by appropriate methods known in the art. Pharmaceutical compositions of the present disclosure or fractions thereof comprise suitable pharmaceutically acceptable carriers, excipients, and vehicles selected based on the intended form of administration, and consistent with conventional pharmaceutical practices. Suitable pharmaceutical carriers, excipients, and vehicles are described in the standard text, Remington: The Science and Practice of Pharmacy (21.sup.st Edition. 2005, University of the Sciences in Philadelphia (Editor), Mack Publishing Company), and in The United States Pharmacopeia: The National Formulary (USP 24 NF19) published in 1999. By way of example for oral administration in the form of a capsule or tablet, the active components can be combined with an oral, non-toxic pharmaceutically acceptable inert carrier such as lactose, starch, sucrose, methyl cellulose, magnesium stearate, glucose, calcium sulfate, dicalcium phosphate, mannitol, sorbitol, and the like. For oral administration in a liquid form, the chug components may be combined with any oral, non-toxic, pharmaceutically, acceptable inert carrier such as ethanol, glycerol, water, and the like. Suitable binders (e.g., gelatin, starch, corn sweeteners, natural sugars including glucose; natural and synthetic gums, and waxes), lubricants (e.g. sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, and sodium chloride), disintegrating agents (e.g. starch, methyl cellulose, agar, bentonite, and xanthan gum), flavoring agents, and coloring agents may also be combined in the compositions or components thereof. Compositions as described herein can further comprise wetting or emulsifying agents, or pH buffering agents.
[0082] The terms "subject", "individual", or "patient" as used herein are used interchangeably and refer to an animal preferably a warm-blooded animal such as a mammal. MammalAttorney Docket No.222120-2030 includes without limitation any members of the Mammalia. A mammal, as a subject or patient in the present disclosure, can be from the family of Primates, Carnivora, Proboscidea, Perissodactyla, Artiodactyla, Rodentia, and Lagomorpha. In a particular embodiment, the mammal is a human. In other embodiments, animals can be treated; the animals can be vertebrates, including both birds and mammals. In aspects of the disclosure, the terms include domestic animals bred for food or as pets, including equines, bovines, sheep, poultry, fish, porcines, canines, felines, and zoo animals, goats, apes (e.g. gorilla or chimpanzee), and rodents such as rats and mice.
[0083] The term "pharmaceutically acceptable carrier" as used herein refers to a diluent, adjuvant, excipient, or vehicle with which a probe of the disclosure is administered and which is approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. Such pharmaceutical carriers can be liquids, such as water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. The pharmaceutical carriers can be saline, gum acacia, gelatin, starch paste, talc, keratin, colloidal silica, urea, and the like. When administered to a patient, the probe and pharmaceutically acceptable carriers can be sterile. Water is a useful carrier when the probe is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical carriers also include excipients such as glucose, lactose, sucrose, glycerol monostearate, sodium chloride, glycerol, propylene, glycol, water, ethanol and the like. The present compositions, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. The present compositions advantageously may take the form of solutions, emulsion, sustained-release formulations, or any other form suitable for use.
[0084] The term "pharmaceutically acceptable" as used herein refers to those compounds, materials, compositions, and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.
[0085] The term “pharmaceutically acceptable salts” as used herein refers to salts of the active principal agents which are prepared with acids or bases that are tolerated by a biological system and / or tolerated by a subject when administered in a therapeutically effective amount. When compounds of the present disclosure contain relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent. Examples ofAttorney Docket No.222120-2030 pharmaceutically acceptable base addition salts include, but are not limited to; sodium, potassium, calcium, ammonium, organic amino, magnesium salt, lithium salt, strontium salt or a similar salt. When compounds of the present disclosure contain relatively basic functionalities, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable acid addition salts include, but are not limited to; those derived from inorganic acids like hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic, or phosphorous acids and the like, as well as the salts derived from relatively nontoxic organic acids like acetic, propionic, isobutyric, maleic, malonic, benzoic, succinic, suberic, fumaric, lactic, mandelic, phthalic, benzenesulfonic, p- tolylsulfonic, citric, tartaric, methanesulfonic, and the like. Also included are salts of amino acids such as arginate and the like, and salts of organic acids like glucuronic or galactunoric acids and the like.
[0086] The term “pharmaceutically acceptable prodrug” or “prodrug” represents those prodrugs of the compounds of the present disclosure which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit / risk ratio, and effective for their intended use. Prodrugs of the present disclosure can be rapidly transformed in vivo to a parent compound having a structure of a disclosed compound, for example, by hydrolysis in blood. A thorough discussion is provided in T. Higuchi and V. Stella, Pro-drugs as Novel Delivery Systems, V. 14 of the A.C.S. Symposium Series, and in Edward B. Roche, ed., Bioreversible Carriers in Drug Design, American Pharmaceutical Association and Pergamon Press (1987).
[0087] As used herein, the terms “effective amount” and “amount effective” refer to an amount that is sufficient to achieve the desired result or to have an effect on an undesired condition or prevention of a disease or condition or enhance and / or tune the immune system of the subject to the desirable responses for certain pathogens (e.g., virus). For example, a “therapeutically effective amount” refers to an amount that is sufficient to achieve the desired therapeutic result or to have an effect on undesired symptoms or prevention of a disease or condition and / or tune the immune system of the subject to the desirable responses for certain pathogens but is generally insufficient to cause adverse side effects. The specific therapeutically effective dose level for any particular patient will depend upon a variety of factors including; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration; the route of administration; the rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidentalAttorney Docket No.222120-2030 with the specific compound employed and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of a compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. If desired, the effective daily dose can be divided into multiple doses for purposes of administration. Consequently, single dose compositions can contain such amounts or submultiples thereof to make up the daily dose. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products.
[0088] As used herein, the terms "treating" and "treatment" can refer generally to obtaining a desired pharmacological and / or physiological effect. The effect can be, but does not necessarily have to be, prophylactic in terms of preventing or partially preventing a disease, symptom or condition thereof, such as infections and consequences thereof and / or tuning the immune system of the subject to the desirable responses for certain pathogens. The effect can be therapeutic in terms of a partial or complete cure of a disease, condition, symptom or adverse effect attributed to the disease, disorder, or condition. The term "treatment" as used herein can include any treatment of infections in a subject, particularly a human and can include any one or more of the following: (a) preventing the disease from occurring in a subject which may be predisposed to the disease or infection but has not yet been diagnosed as having it; (b) inhibiting the disease or infection, i.e., arresting its development; and (c) relieving the disease or infection i.e., mitigating or ameliorating the disease and / or its symptoms or conditions, (d) and / or tune the immune system of the subject to the desirable responses for certain pathogens. The term "treatment" as used herein can refer to both therapeutic treatment alone, prophylactic treatment alone, or both therapeutic and prophylactic treatment. Those in need of treatment (subjects in need thereof) can include those already with the disorder and / or those in which the disorder is to be prevented. As used herein, the term "treating", can include inhibiting the disease, disorder, or condition, e.g., impeding its progress; and relieving the disease, disorder, or condition, e.g., causing regression of the disease, disorder and / or condition. and / or tuning the immune system of the subject to the desirable responses for certain pathogens. Treating the disease, disorder, or condition can include ameliorating at least one symptom of the particular disease, disorder, or condition, even if the underlying pathophysiology is not affected, e.g., such as treating the pain of a subject by administration of an analgesic agent even though such agent does not treat the cause of the pain.
[0089] As used herein, “therapeutic” can refer to treating, healing, and / or ameliorating a disease, disorder, condition, or side effect, or to decreasing in the rate of advancement of aAttorney Docket No.222120-2030 disease, disorder, condition, or side effect and / or tuning the immune system of the subject to the desirable responses for certain pathogens.
[0090] The term “metastasis” refers to the spread of a cancer cells to a different part of the body from the initial cancerous site. This is a multistep process, including cancer cells infiltrating tissue adjacent to the initial site, migration of the cancer cells via the blood and / or lymphatic system, invasion of the cancer cells into a tissue distant from the initial site, and propagation of the cancer cells in the new site, possibly leading to the development of a tumor. The tumors formed from the metastasis process are referred to as a secondary or metastatic tumor. The cancer cells that form the metastatic tumor are characteristic of those of the original tumor. For example, if a thyroid cancer spreads (metastasizes) to the liver, any metastatic tumor formed will be comprised of thyroid cancer cells. List of Abbreviations
[0091] MTC (Medullary thyroid cancer)
[0092] NET (Neuroendocrine tumors)
[0093] VGSC (Voltage-gated sodium channels)
[0094] VGIC (Voltage-gated ion channels)
[0095] NHE1 (Na+ / H+ exchanger 1)
[0096] GAPDH (Glyceraldehyde-3-phosphate dehydrogenase)
[0097] PCR (Polymerase chain reaction)
[0098] TMA (Tissue microarray)
[0099] ANOVA (Analysis of Variance)
[0100] IHC (Immunohistochemistry)
[0101] HSV (Hue saturation value)
[0102] EDC (1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide)
[0103] DMAP (N,N-Dimethylaminopyridine) Discussion
[0104] The present disclosure provides for compounds including voltage-gated sodium channel (VGSC) inhibitors, pharmaceutical compositions including VGSC inhibitors, methods of use of the VGSC inhibitors and the pharmaceutical compositions, methods of making VGSC inhibitors, and the like. Compounds and pharmaceutical compositions of the present disclosure can be used in combination with one or more other therapeutic agents for treatingAttorney Docket No.222120-2030 metastatic cancers, medullary thyroid cancer, metastatic medullary thyroid cancer, cancer- related pain, chronic pain (e.g., inflammatory, neuropathic) and other diseases.
[0105] In one aspect, the VGSC inhibitor can have either one of the following structures:Structure II
[0106] In one aspect, R1can be hydrogen, a primary amine, a secondary amine, a tertiary amine, a substituted or unsubstituted cycloalkyl group, a substituted or unsubstituted heterocycloalkyl group, a substituted or unsubstituted aryl group, or a substituted or unsubstituted heteroaryl group. In another aspect, R1can be a heterocycloalkyl group with at least one heteroatom that is a nitrogen. In another aspect, R1can be a secondary or tertiary amine substituted with mono- or di-alkyl groups. In another aspect, R1can be selected from one of the following substituents:Attorney Docket No.222120-2030where R5aand R5bcan independently be a C1-C6 alkyl group. In another aspect, R5aand R5bcan independently be a C1-C3 alkyl group.
[0107] In one aspect, m and n can each independently be an integer from 0 to 5. In another aspect, m and n can each independently be an integer from 1 to 5. In another aspect, m and n can each independently be an integer from 1 to 3.
[0108] In one aspect, R2a, R2b, R2c, R2d, R2e, and R2fcan independently be hydrogen, a hydroxyalkyl group, an ether, or a carboxyl group. In another aspect, a single one of R2a, R2b, R2c, R2d, R2e, and R2fcan be hydrogen, a hydroxyalkyl group, an ether, or a carboxyl group, and the remaining R2a, R2b, R2c, R2d, R2e, and R2fsubstituents are hydrogen.
[0109] In one aspect, each R3can independently be hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group. In a further aspect, at least one of R3can be fluorine or chlorine and the remaining R3can be hydrogen.
[0110] In one aspect, each R4of Structure I can independently be hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group. In a further aspect, at least one of R4of Structure I can be fluorine or chlorine and the remaining R4can be hydrogen.
[0111] In one aspect, R4of Structure II can be hydrogen, an alkyl group, or a substituted or unsubstituted aryl group. In a further aspect, R4of Structure II can be hydrogen or a substituted or unsubstituted phenyl group. In another further aspect, R4of Structure II can have the following structure:Attorney Docket No.222120-2030 where each R6can be independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group. In another aspect, at least one of R6can be fluorine or chlorine and the remaining R6can be hydrogen.
[0112] In one aspect, Y can be nitrogen or CH. In one aspect, X can be NH or C(Z)H, where Z can be NH or O.
[0113] In one aspect, the present disclosure pertains to a VGSC inhibitor of Structure I or Structure II in any combination of the ranges of n and / or m in combination with any of the options for R1, R2a, R2b, R2c, R2d, R2e, R2f, R3, R4(of Structure I or Structure II, respectively), X, and Y and, optionally, in combination with any of the options for R5a, R5b, and R6(for Structure II). It is understood, the present disclosure provides that all options for the respective R groups of Structure I and Structure II and other like variables (i.e., R1, R2a, R2b, R2c, R2d, R2e, R2f, R3, R4, R5a, R5b, R6, X, and Y) can be combinable with one another.
[0114] In another aspect, the VGSC inhibitor can have either one of the following structures:Structure IV
[0115] In one aspect, R1can be hydrogen, a primary amine, a secondary amine, a tertiary amine, a substituted or unsubstituted cycloalkyl group, a substituted or unsubstituted heterocycloalkyl group, a substituted or unsubstituted aryl group, or a substituted or unsubstituted heteroaryl group. In another aspect, R1can be a heterocycloalkyl group with at least one heteroatom that is a nitrogen. In another aspect, R1can be a secondary or tertiaryAttorney Docket No.222120-2030 amine substituted with mono- or di-alkyl groups. In another aspect, R1can be selected from one of the following substituents:where R5aand R5bcan independently be a C1-C6 alkyl group. In another aspect, R5aand R5bcan independently be a C1-C3 alkyl group.
[0116] In one aspect, m and n can each independently be an integer from 0 to 5. In another aspect, m and n can each independently be an integer from 1 to 5. In another aspect, m and n can each independently be an integer from 1 to 3.
[0117] In one aspect, each R3can independently be hydrogen, hydroxy, a halide, a hydroxyalkyl group, an ether, or a carboxyl group. In another aspect, at least one of R3can be fluorine or chlorine and the remaining R3can be hydrogen.
[0118] In one aspect, each R4of Structure III can independently be hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group. In a further aspect, at least one of R4of Structure III can be fluorine or chlorine and the remaining R4can be hydrogen.
[0119] In one aspect, R4of Structure IV can be hydrogen, an alkyl group, or a substituted or unsubstituted aryl group. In a further aspect, R4of Structure IV can be hydrogen or a substituted or unsubstituted phenyl group. In another further aspect, R4of Structure IV can have the following structure:where each R6can be independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group. In another aspect, at least one of R6can be fluorine or chlorine and the remaining R6can be hydrogen.Attorney Docket No.222120-2030
[0120] In one aspect, the present disclosure pertains to a VGSC inhibitor of Structure III or Structure IV in any combination of the ranges of n and / or m in combination with any of the options for R1, R3, and R4(of Structure III or Structure IV, respectively) and, optionally, in combination with any of the options for R5a, R5b, and R6(for Structure II). It is understood, the present disclosure provides that all options for the respective R groups of Structure III and Structure IV (i.e., R1, R3, R4, R5a, R5b, and R6) can be combinable with one another.
[0121] In another aspect, the VGSC inhibitor can have either one of the following structures:Structure VI
[0122] In one aspect, each R3can independently be hydrogen, hydroxy, a halide, a hydroxyalkyl group, an ether, or a carboxyl group. In another aspect, each R3can independently be hydrogen, -C(O)OH, OH, or -CH2OR7, where R7is hydrogen, a substituted or unsubstituted alkyl group, or a substituted or unsubstituted heterocycloalkyl group. In another aspect, at least one of R3can be fluorine or chlorine and the remaining R3can be hydrogen.
[0123] In one aspect, each R4of Structure V can independently be hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group. In a further aspect, each R4of Structure V can independently be hydrogen, -C(O)OH, OH, or -CH2OR7, where R7is hydrogen, a substituted or unsubstituted alkyl group, or a substituted orAttorney Docket No.222120-2030 unsubstituted heterocycloalkyl group. In another further aspect, at least one of R4of Structure V can be fluorine or chlorine and the remaining R4can be hydrogen.
[0124] In one aspect, R4of Structure VI can be hydrogen, an alkyl group, or a substituted or unsubstituted aryl group. In a further aspect, R4of Structure VI can be hydrogen or a substituted or unsubstituted phenyl group. In another further aspect, R4of Structure VI can have the following structure:where each R6can be independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group. In another aspect, each R6can independently be hydrogen, -C(O)OH, OH, or -CH2OR7, where R7is hydrogen, a substituted or unsubstituted alkyl group, or a substituted or unsubstituted heterocycloalkyl group. In another aspect, at least one of R6can be fluorine or chlorine and the remaining R6can be hydrogen.
[0125] In one aspect, X of Structure VI can be CH2or O.
[0126] In one aspect, the present disclosure pertains to a VGSC inhibitor of Structure V or Structure VI in any combination of the ranges of n and / or m in combination with any of the options for R1, R3, and R4(of Structure V or Structure VI, respectively) and, optionally, in combination with any of the options for R5a, R5b, R6(for Structure II), and R7. It is understood, the present disclosure provides that all options for the respective R groups of Structure V and Structure VI (i.e., R1, R3, R4, R5a, R5b, R6, and R7) can be combinable with one another.
[0127] The disclosed VGSC inhibitor compounds can be used in the form of salts derived from inorganic or organic acids. Pharmaceutically acceptable salts include salts of acidic or basic groups present in the disclosed compounds. Suitable pharmaceutically acceptable salts include base addition salts, including alkali metal salts, e.g., sodium or potassium salts; alkaline earth metal salts, e.g., calcium or magnesium salts; and salts formed with suitable organic ligands, e.g., quaternary ammonium salts, which may be similarly prepared by reacting the drug compound with a suitable pharmaceutically acceptable base. The salts can be prepared in situ during the final isolation and purification of the compounds of the present disclosure; or following final isolation by reacting a free base function, such as a secondary or tertiary amine, of a disclosed compound with a suitable inorganic or organic acid; or reacting a free acid function, such as a carboxylic acid, of a disclosed compound with a suitable inorganic or organic base.Attorney Docket No.222120-2030
[0128] Acidic addition salts can be prepared in situ during the final isolation and purification of a disclosed compound, or separately by reacting moieties comprising one or more nitrogen groups with a suitable acid. In various aspects, acids which may be employed to form pharmaceutically acceptable acid addition salts include such inorganic acids as hydrochloric acid, sulphuric acid and phosphoric acid and such organic acids as oxalic acid, maleic acid, succinic acid and citric acid. In a further aspect, salts further include, but are not limited, to the following: hydrochloride, hydrobromide, hydroiodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzensulfonate, p- toluenesulfonate, butyrate, camphorate, camphorsulfonate, digluconate, glycerophosphate, hemisulfate, heptanoate, hexanoate, fumarate, hydrochloride, 2-hydroxyethanesulfonate (isethionate), nicotinate, 2-naphthalenesulfonate, oxalate, pectinate, persulfate, 3- phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, phosphate, glutamate, bicarbonate, undecanoate, and pamoate (i.e., 1,1'-methylene-bis-(2-hydroxy-3- naphthoate)) salts. Also, basic nitrogen-containing groups can be quatemized with such agents as lower alkyl halides, such as methyl, ethyl, propyl, and butyl chloride, bromides, and iodides; dialkyl sulfates like dimethyl, diethyl, dibutyl, and diamyl sulfates, long chain halides such as decyl, lauryl, myristyl and stearyl chlorides, bromides and iodides, aralkyl halides like benzyl and phenethyl bromides, and others.
[0129] Basic addition salts can be prepared in situ during the final isolation and purification of a disclosed compound, or separately by reacting carboxylic acid moieties with a suitable base such as the hydroxide, carbonate or bicarbonate of a pharmaceutical acceptable metal cation or with ammonia, or an organic primary, secondary or tertiary amine. Pharmaceutical acceptable salts include, but are not limited to, cations based on the alkali and alkaline earth metals, such as sodium, lithium, potassium, calcium, magnesium, aluminum salts and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. Other representative organic amines useful for the formation of base addition salts include diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine and the like. In further aspects, bases which may be used in the preparation of pharmaceutically acceptable salts include the following: ammonia, L-arginine, benethamine, benzathine, calcium hydroxide, choline, deanol, diethanolamine, diethylamine, 2-(diethylamino)-ethanol, ethanolamine, ethylenediamine, N- methyl-glucamine, hydrabamine, 1H-imidazole, L-lysine, magnesium hydroxide, 4-(2-Attorney Docket No.222120-2030 hydroxyethyl)-morpholine, piperazine, potassium hydroxide, 1-(2-hydroxyethyl)-pyrrolidine, secondary amine, sodium hydroxide, triethanolamine, tromethamine and zinc hydroxide.
[0130] In yet another aspect, this disclosure provides for a pharmaceutical composition formulated for administering to a subject. In one aspect, the pharmaceutical composition includes any one of the VGSC inhibitor compounds as disclosed herein or a pharmaceutically acceptable salt thereof (e.g., a pharmaceutically acceptable acid addition salt). The pharmaceutical composition can further comprise a pharmaceutically acceptable carrier. The present disclosure also provides for a method of treating a condition (e.g., cancer, metastatic cancers, medullary thyroid cancer, metastatic medullary thyroid cancer, chronic pain) in a subject (e.g., animal or human subject). The method can include administering to a subject in need thereof, a therapeutically effective amount of a pharmaceutical composition as disclosed herein or a therapeutically effective amount of a VGSC inhibitor compound, or pharmaceutically acceptable salt thereof, as disclosed herein.
[0131] The condition to be treated in a subject (e.g., mammal) in need of treatment can include those for which the inhibitor is directed towards. The condition can be a disease or condition such as cancer, chronic pain, and the like. In one aspect, the condition can be medullary thyroid cancer (MTC). In another aspect, the condition can be metastatic MTC. In one aspect, the VGSC inhibitor can be used to treat chronic pain, such as inflammatory pain and neuropathic pain, or cancer-associated pain. In one aspect, the VGSC inhibitors can be used to inhibit VGSC subtypes, such as the Nav1.7 channel.
[0132] Despite the recent advances in the diagnosis and treatment, medullary thyroid cancer remains an understudied cancer type and continues to disproportionately contribute to thyroid cancer-related mortality. The VGSC subtype Nav1.7 has been shown to be overexpressed in MTC cells and MTC patient samples, while it is not expressed in normal thyroid cells and tissues. Small molecule VGSC inhibitors can be used to target this channel and inhibit INa current in Nav1.7. The unique overexpression of Nav1.7 in MTC can be a target for the use of VGSC inhibitors to treat MTC and metastatic MTC.
[0133] Pharmaceutical Formulations and Routes of Administration
[0134] Embodiments of the present disclosure include the agent (e.g., the VGSC inhibitor) as identified herein and can be formulated with one or more pharmaceutically acceptable excipients, diluents, carriers and / or adjuvants. In addition, embodiments of the present disclosure include the agent formulated with one or more pharmaceutically acceptable auxiliary substances. In particular the agent can be formulated with one or more pharmaceutically acceptable excipients, diluents, carriers, and / or adjuvants to provide an embodiment of a composition of the present disclosure.Attorney Docket No.222120-2030
[0135] A wide variety of pharmaceutically acceptable excipients are known in the art. Pharmaceutically acceptable excipients have been amply described in a variety of publications, including, for example, A. Gennaro (2000) “Remington: The Science and Practice of Pharmacy,” 20th edition, Lippincott, Williams, & Wilkins; Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H.C. Ansel et al., eds., 7thed., Lippincott, Williams, & Wilkins; and Handbook of Pharmaceutical Excipients (2000) A.H. Kibbe et al., eds., 3rded. Amer. Pharmaceutical Assoc.
[0136] Pharmaceutically acceptable excipients, such as vehicles, adjuvants, carriers or diluents, are readily available to the public. Moreover, pharmaceutically acceptable auxiliary substances, such as pH adjusting and buffering agents, tonicity adjusting agents, stabilizers, wetting agents and the like, are readily available to the public.
[0137] In an embodiment of the present disclosure, the agent can be administered to the subject using any means capable of resulting in the desired effect. Thus, the agent can be incorporated into a variety of formulations for therapeutic administration. For example, the agent can be formulated into pharmaceutical compositions by combination with appropriate, pharmaceutically acceptable carriers or diluents, and may be formulated into preparations in solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants and aerosols.
[0138] In pharmaceutical dosage forms, the agent may be administered in the form of its pharmaceutically acceptable salts, or a subject active composition may be used alone or in appropriate association, as well as in combination, with other pharmaceutically active compounds. The following methods and excipients are merely exemplary and are in no way limiting.
[0139] For oral preparations, the agent can be used alone or in combination with appropriate additives to make tablets, powders, granules or capsules, for example, with conventional additives, such as lactose, mannitol, corn starch or potato starch; with binders, such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins; with disintegrators, such as corn starch, potato starch or sodium carboxymethylcellulose; with lubricants, such as talc or magnesium stearate; and if desired, with diluents, buffering agents, moistening agents, preservatives and flavoring agents.
[0140] Embodiments of the agent can be formulated into preparations for injection by dissolving, suspending, or emulsifying them in an aqueous or nonaqueous solvent, such as vegetable or other similar oils, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol; and if desired, with conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives.Attorney Docket No.222120-2030
[0141] Embodiments of the agent can be utilized in aerosol formulation to be administered via inhalation. Embodiments of the agent can be formulated into pressurized acceptable propellants such as dichlorodifluoromethane, propane, nitrogen and the like.
[0142] Furthermore, embodiments of the agent can be made into suppositories by mixing with a variety of bases such as emulsifying bases or water-soluble bases. Embodiments of the agent can be administered rectally via a suppository. The suppository can include vehicles such as cocoa butter, carbowaxes and polyethylene glycols, which melt at body temperature, yet are solidified at room temperature.
[0143] Unit dosage forms for oral or rectal administration, such as syrups, elixirs, and suspensions, may be provided wherein each dosage unit, for example, teaspoonful, tablespoonful, tablet, or suppository, contains a predetermined amount of the composition containing one or more compositions. Similarly, unit dosage forms for injection or intravenous administration may comprise the agent in a composition as a solution in sterile water, normal saline, or another pharmaceutically acceptable carrier.
[0144] Embodiments of the agent can be formulated in an injectable composition in accordance with the disclosure. Typically, injectable compositions are prepared as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection may also be prepared. The preparation may also be emulsified or the active ingredient (triamino-pyridine derivative and / or the labeled triamino-pyridine derivative) encapsulated in liposome vehicles in accordance with the present disclosure.
[0145] In an embodiment, the agent can be formulated for delivery by a continuous delivery system. The term “continuous delivery system” is used interchangeably herein with “controlled delivery system” and encompasses continuous (e.g., controlled) delivery devices (e.g., pumps) in combination with catheters, injection devices, and the like, a wide variety of which are known in the art.
[0146] Mechanical or electromechanical infusion pumps can also be suitable for use with the present disclosure. Examples of such devices include those described in, for example, U.S. Pat. Nos. 4,692,147; 4,360,019; 4,487,603; 4,360,019; 4,725,852; 5,820,589; 5,643,207; 6,198,966; and the like. In general, delivery of the agent can be accomplished using any of a variety of refillable, pump systems. Pumps provide consistent, controlled release over time. In some embodiments, the agent can be in a liquid formulation in a drug-impermeable reservoir and is delivered in a continuous fashion to the individual.
[0147] In one embodiment, the drug delivery system is an at least partially implantable device. The implantable device can be implanted at any suitable implantation site using methods and devices well known in the art. An implantation site is a site within the body of a subject atAttorney Docket No.222120-2030 which a drug delivery device is introduced and positioned. Implantation sites include, but are not necessarily limited to, a subdermal, subcutaneous, intramuscular, or other suitable site within a subject's body. Subcutaneous implantation sites are used in some embodiments because of convenience in implantation and removal of the drug delivery device.
[0148] Drug release devices suitable for use in the disclosure may be based on any of a variety of modes of operation. For example, the drug release device can be based upon a diffusive system, a convective system, or an erodible system (e.g., an erosion-based system). For example, the drug release device can be an electrochemical pump, osmotic pump, an electroosmotic pump, a vapor pressure pump, or osmotic bursting matrix, e.g., where the drug is incorporated into a polymer and the polymer provides for release of drug formulation concomitant with degradation of a drug-impregnated polymeric material (e.g., a biodegradable, drug-impregnated polymeric material). In other embodiments, the drug release device is based upon an electrodiffusion system, an electrolytic pump, an effervescent pump, a piezoelectric pump, a hydrolytic system, etc.
[0149] Drug release devices based upon a mechanical or electromechanical infusion pump can also be suitable for use with the present disclosure. Examples of such devices include those described in, for example, U.S. Pat. Nos.4,692,147; 4,360,019; 4,487,603; 4,360,019; 4,725,852, and the like. In general, a subject treatment method can be accomplished using any of a variety of refillable, non-exchangeable pump systems. Pumps and other convective systems are generally preferred due to their generally more consistent, controlled release over time. Osmotic pumps are used in some embodiments due to their combined advantages of more consistent controlled release and relatively small size (see, e.g., PCT published application no. WO 97 / 27840 and U.S. Pat. Nos. 5,985,305 and 5,728,396). Exemplary osmotically-driven devices suitable for use in the disclosure include, but are not necessarily limited to, those described in U.S. Pat. Nos. 3,760,984; 3,845,770; 3,916,899; 3,923,426; 3,987,790; 3,995,631; 3,916,899; 4,016,880; 4,036,228; 4,111,202; 4,111,203; 4,203,440; 4,203,442; 4,210,139; 4,327,725; 4,627,850; 4,865,845; 5,057,318; 5,059,423; 5,112,614; 5,137,727; 5,234,692; 5,234,693; 5,728,396; and the like.
[0150] In some embodiments, the drug delivery device is an implantable device. The drug delivery device can be implanted at any suitable implantation site using methods and devices well known in the art. As noted herein, an implantation site is a site within the body of a subject at which a drug delivery device is introduced and positioned. Implantation sites include, but are not necessarily limited to a subdermal, subcutaneous, intramuscular, or other suitable site within a subject's body.Attorney Docket No.222120-2030
[0151] In some embodiments, the agent can be delivered using an implantable drug delivery system, e.g., a system that is programmable to provide for administration of the agent. Exemplary programmable, implantable systems include implantable infusion pumps. Exemplary implantable infusion pumps, or devices useful in connection with such pumps, are described in, for example, U.S. Pat. Nos. 4,350,155; 5,443,450; 5,814,019; 5,976,109; 6,017,328; 6,171,276; 6,241,704; 6,464,687; 6,475,180; and 6,512,954. A further exemplary device that can be adapted for the present disclosure is the Synchromed™ infusion pump (Medtronic Inc., Minneapolis, Minnesota).
[0152] Suitable excipient vehicles for the agent are, for example, water, saline, dextrose, glycerol, ethanol, or the like, and combinations thereof. In addition, if desired, the vehicle may contain minor amounts of auxiliary substances such as wetting or emulsifying agents or pH buffering agents. Methods of preparing such dosage forms are known, or will be apparent upon consideration of this disclosure, to those skilled in the art. See, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pennsylvania, 17th edition, 1985. The composition or formulation to be administered will, in any event, contain a quantity of the agent adequate to achieve the desired state in the subject being treated.
[0153] Compositions of the present disclosure can include those that comprise a sustained- release or controlled release matrix. In addition, embodiments of the present disclosure can be used in conjunction with other treatments that use sustained-release formulations. As used herein, a sustained-release matrix is a matrix made of materials, usually polymers, which are degradable by enzymatic or acid-based hydrolysis or by dissolution. Once inserted into the body, the matrix is acted upon by enzymes and body fluids. A sustained-release matrix desirably is chosen from biocompatible materials such as liposomes, polylactides (polylactic acid), polyglycolide (polymer of glycolic acid), polylactide co-glycolide (copolymers of lactic acid and glycolic acid), polyanhydrides, poly(ortho)esters, polypeptides, hyaluronic acid, collagen, chondroitin sulfate, carboxylic acids, fatty acids, phospholipids, polysaccharides, nucleic acids, polyamino acids, amino acids such as phenylalanine, tyrosine, isoleucine, polynucleotides, polyvinyl propylene, polyvinylpyrrolidone and silicone. Illustrative biodegradable matrices include a polylactide matrix, a polyglycolide matrix, and a polylactide co-glycolide (co-polymers of lactic acid and glycolic acid) matrix.
[0154] In another embodiment, the pharmaceutical composition of the present disclosure (as well as combination compositions) can be delivered in a controlled release system. For example, the agent may be administered using intravenous infusion, an implantable osmotic pump, a transdermal patch, liposomes, or other modes of administration. In one embodiment, a pump may be used (Sefton (1987). CRC Crit. Ref. Biomed. Eng.14:201; Buchwald et al. (1980). Surgery 88:507; Saudek et al. (1989). N. Engl. J. Med. 321:574). In anotherAttorney Docket No.222120-2030 embodiment, polymeric materials are used. In yet another embodiment a controlled release system is placed in proximity of the therapeutic target thus requiring only a fraction of the systemic dose. In yet another embodiment, a controlled release system is placed in proximity of the therapeutic target, thus requiring only a fraction of the systemic. Other controlled release systems are discussed in the review by Langer (1990). Science 249:1527-1533.
[0155] In another embodiment, the compositions of the present disclosure (as well as combination compositions separately or together) include those formed by impregnation of the agent described herein into absorptive materials, such as sutures, bandages, and gauze, or coated onto the surface of solid phase materials, such as surgical staples, zippers and catheters to deliver the compositions. Other delivery systems of this type will be readily apparent to those skilled in the art in view of the instant disclosure.
[0156] Dosages
[0157] Embodiments of the agent (e.g., the VGSC inhibitor) can be administered to a subject in one or more doses. Those of skill will readily appreciate that dose levels can vary as a function of the specific the agent administered, the severity of the symptoms and the susceptibility of the subject to side effects. Preferred dosages for a given compound are readily determinable by those of skill in the art by a variety of means.
[0158] In an embodiment, multiple doses of the agent are administered. The frequency of administration of the agent can vary depending on any of a variety of factors, e.g., severity of the symptoms, and the like. For example, in an embodiment, the agent can be administered once per month, twice per month, three times per month, every other week (qow), once per week (qw), twice per week (biw), three times per week (tiw), four times per week, five times per week, six times per week, every other day (qod), daily (qd), twice a day (qid), or three times a day (tid). As discussed above, in an embodiment, the agent is administered continuously.
[0159] The duration of administration of the agent, e.g., the period of time over the agent is administered, can vary, depending on any of a variety of factors, e.g., patient response, etc. For example, the agent in combination or separately, can be administered over a period of time of about one day to one week, about two weeks to four weeks, about one month to two months, about two months to four months, about four months to six months, about six months to eight months, about eight months to 1 year, about 1 year to 2 years, or about 2 years to 4 years, or more.
[0160] Dosage at concentrations as high as 60 micrograms / kilograms that are non-toxic. Also lower concentrations, such as 1-4 micrograms / kilogram, show biological activity in in vivo systems. The concentration in in vitro established at 10-9-10-6M are active and thisAttorney Docket No.222120-2030 concentration is expected to be achieved in the cell environment. (See Slominski AT, Janjetovic Z, Fuller BE, Zmijewski MA, Tuckey RC, et al. (2010) Products of vitamin D3 or 7- dehydrocholesterol metabolism by cytochrome P450scc show anti-leukemia effects, having low or absent calcemic activity. PLoS ONE 5(3): e990; Slominski AT, Kim T-K., Janjetovic Z, Tuckey RC, Bieniek, R, Yue Y, Li W, Chen J, Miller D, Chen T, Holick M (2011) 20- hydroxyvitamin D2 is a non-calcemic analog of vitamin D with potent antiproliferative and prodifferentiation activities in normal and malignant cells. Am J Physiol: Cell Physiol 300:C526- C541; Wang J, Slominski AT, Tuckey RC, Janjetovic Z, Kulkarni A, Chen J, Postlethwaite A, Miller D, Li W (2012) 20-Hydroxylvitamin D3possesses high efficacy against proliferation of cancer cells while being non-toxic. Anticancer Res 32: 739-746; Slominski A, Janjetovic Z, Tuckey RC, Nguyen MN, Bhattacharya KG, Wang J, Li W, Jiao Y, Gu W, Brown M, Postlethwaite AE (2013) 20-hydroxyvitamin D3, noncalcemic product of CYP11A1 action on vitamin D3, exhibits potent antifibrogenic activity in vivo. J Clin Endocrinol Metab 98, E298- E30; Chen, J., J. Wang, T. Kim, E. Tieu, E. Tamg, Lin Z, D. Kovacic, D. Miller, A. Postlethwaite, R. Tuckey, A. Slominski and W. Li (2014). Novel Vitamin D Analogs as Potential Therapeutics: The Metabolism, Toxicity Profiling, and Antiproliferative Activity. Anticancer Res 34: 2153- 2163.)
[0161] In an aspect, the dosage for administering to a subject (e.g., a mammal such as a human) having a condition (e.g., COVID-19) of any single agent the present disclosure is about 2 to 60 micrograms / kilogram or a combination of agents, each agent can be about 2 to 60 micrograms / kilogram.
[0162] Routes of Administration
[0163] Embodiments of the present disclosure provide methods and compositions for the administration of the agent (e.g., the VGSC inhibitor) to a subject (e.g., a human) using any available method and route suitable for drug delivery, including in vivo and ex vivo methods, as well as systemic and localized routes of administration.
[0164] Routes of administration include intranasal, intramuscular, intratracheal, subcutaneous, intradermal, topical application, intravenous, rectal, nasal, oral, and other enteral and parenteral routes of administration. Routes of administration may be combined, if desired, or adjusted depending upon the agent and / or the desired effect. An agent can be administered in a single dose or in multiple doses.
[0165] Embodiments of the agent can be administered to a subject using available conventional methods and routes suitable for delivery of conventional drugs, including systemic or localized routes. In general, routes of administration contemplated by the disclosure include, but are not limited to, enteral, parenteral, or inhalational routes.Attorney Docket No.222120-2030
[0166] Parenteral routes of administration other than inhalation administration include, but are not limited to, topical, transdermal, subcutaneous, intramuscular, intraorbital, intracapsular, intraspinal, intrasternal, and intravenous routes, i.e., any route of administration other than through the alimentary canal. Parenteral administration can be conducted to effect systemic or local delivery of the agent. Where systemic delivery is desired, administration typically involves invasive or systemically absorbed topical or mucosal administration of pharmaceutical preparations.
[0167] In an embodiment, the agent can also be delivered to the subject by enteral administration. Enteral routes of administration include, but are not limited to, oral and rectal (e.g., using a suppository) delivery.
[0168] Methods of administration of the agent through the skin or mucosa include, but are not limited to, topical application of a suitable pharmaceutical preparation, transdermal transmission, injection and epidermal administration. For transdermal transmission, absorption promoters or iontophoresis are suitable methods. Iontophoretic transmission may be accomplished using commercially available "patches" that deliver their product continuously via electric pulses through unbroken skin for periods of several days or more. Aspects
[0169] Aspect 1. A compound having a formula represented by the following structure:wherein R1is hydrogen, a primary amine, a secondary amine, a tertiary amine, a substituted or unsubstituted cycloalkyl group, a substituted or unsubstituted heterocycloalkyl group, a substituted or unsubstituted aryl group, or a substituted or unsubstituted heteroaryl group; m and n are independently an integer from 0 to 5; R2a, R2b, R2c, R2d, R2e, and R2fare independently selected from hydrogen, a hydroxyalkyl group, an ether, or a carboxyl group; each R3are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group; each R4are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkylAttorney Docket No.222120-2030 group, an ether, or a carboxyl group; Y is nitrogen or CH; and X is NH or C(Z)H, wherein Z is NH or O; or a pharmaceutically acceptable salt thereof.
[0170] Aspect 2. The compound of aspect 1, wherein R1is a heterocycloalkyl group wherein at least one heteroatom is nitrogen.
[0171] Aspect 3. The compound of aspect 1, wherein R1is a secondary or tertiary amine substituted with one or two alkyl groups.
[0172] Aspect 4. The compound of aspect 1, wherein R1iswherein R5aand R5bare independently selected from hydrogen or a C1-C6 alkyl group.
[0173] Aspect 5. The compound of aspect 4, wherein R5aand R5bare independently selected from a C1-C3 alkyl group.
[0174] Aspect 6. The compound of any one of aspects 1-5, wherein m and n are independently an integer from 1 to 5.
[0175] Aspect 7. The compound of any one of aspects 1-5, wherein m and n are independently an integer from 1 to 3.
[0176] Aspect 8. The compound of any one of aspects 1-7, wherein one of R2a, R2b, R2c, R2d, R2e, and R2fis hydrogen, a hydroxyalkyl group, an ether, or a carboxyl group and the other of R2a, R2b, R2c, R2d, R2e, and R2fare hydrogen.
[0177] Aspect 9. The compound of any one of aspects 1-8, wherein at least one of R3is hydroxy, fluorine, chlorine, a C1-C6 alkyl group, or a C1-C6 hydroxyalkyl group and the other of R3are hydrogen.
[0178] Aspect 10. The compound of any one of aspects 1-9, wherein at least one of R3is fluorine or chlorine and the other of R3are hydrogen.Attorney Docket No.222120-2030
[0179] Aspect 11. The compound of any one of aspects 1-9, wherein at least one of R3is a C1-C6 alkyl group and the other of R3are hydrogen.
[0180] Aspect 12. The compound of any one of aspects 1-9, wherein at least one of R3is hydroxy and the other of R3are hydrogen.
[0181] Aspect 13. The compound of any one of aspects 1-9, wherein at least one of R3is a C1-C6 hydroxyalkyl group and the other of R3are hydrogen.
[0182] Aspect 14. The compound of any one of aspects 1-13, wherein at least one of R4is hydroxy, fluorine, chlorine, a C1-C6 alkyl group, or a C1-C6 hydroxyalkyl group and the other of R4are hydrogen.
[0183] Aspect 15. The compound of any one of aspects 1-14, wherein at least one of R4is fluorine or chlorine and the other of R4are hydrogen.
[0184] Aspect 16. The compound of any one of aspects 1-14, wherein at least one of R4is a C1-C6 alkyl group and the other of R4are hydrogen.
[0185] Aspect 17. The compound of any one of aspects 1-14, wherein at least one of R4is hydroxy and the other of R4are hydrogen.
[0186] Aspect 18. The compound of any one of aspects 1-14, wherein at least one of R4is a C1-C6 hydroxyalkyl group and the other of R4are hydrogen.
[0187] Aspect 19. The compound of aspect 1, wherein the compound has the following structurewherein R1is hydrogen, a primary amine, a secondary amine, or a tertiary amine, a substituted or unsubstituted cycloalkyl group, a substituted or unsubstituted heterocycloalkyl group, a substituted or unsubstituted aryl group, or a substituted or unsubstituted heteroaryl group; m and n are independently an integer from 0 to 5; each R3are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether,Attorney Docket No.222120-2030 or a carboxyl group; and each R4are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group;
[0188] Aspect 20. The compound of aspect 19, wherein R1is a heterocycloalkyl group wherein at least one heteroatom is nitrogen.
[0189] Aspect 21. The compound of aspect 19, wherein R1is a secondary or tertiary amine substituted with one or two alkyl groups.
[0190] Aspect 22. The compound of aspect 19, wherein R1iswherein R5aand R5bare independently selected from hydrogen or a C1-C6 alkyl group.
[0191] Aspect 23. The compound of aspect 22, wherein R5aand R5bare independently selected from a C1-C3 alkyl group.
[0192] Aspect 24. The compound of any one of aspects 19-23, wherein m and n are independently an integer from 1 to 5.
[0193] Aspect 25. The compound of any one of aspects 19-23, wherein m and n are independently an integer from 1 to 3.
[0194] Aspect 26. The compound of any one of aspects 19-25, wherein at least one of R3is hydroxy, fluorine, chlorine, a C1-C6 alkyl group, or a C1-C6 hydroxyalkyl group and the other of R3are hydrogen.
[0195] Aspect 27. The compound of any one of aspects 19-26, wherein at least one of R3is fluorine or chlorine and the other of R3are hydrogen.
[0196] Aspect 28. The compound of any one of aspects 19-26, wherein at least one of R3is a C1-C6 alkyl group and the other of R3are hydrogen.Attorney Docket No.222120-2030
[0197] Aspect 29. The compound of any one of aspects 19-26, wherein at least one of R3is hydroxy and the other of R3are hydrogen.
[0198] Aspect 30. The compound of any one of aspects 19-26, wherein at least one of R3is a C1-C6 hydroxyalkyl group and the other of R3are hydrogen.
[0199] Aspect 31. The compound of any one of aspects 19-30, wherein at least one of R4is hydroxy, fluorine, chlorine, a C1-C6 alkyl group, or a C1-C6 hydroxyalkyl group and the other of R4are hydrogen.
[0200] Aspect 32. The compound of any one of aspects 19-31, wherein at least one of R4is fluorine or chlorine and the other of R4are hydrogen.
[0201] Aspect 33. The compound of any one of aspects 19-31, wherein at least one of R4is a C1-C6 alkyl group and the other of R4are hydrogen.
[0202] Aspect 34. The compound of any one of aspects 19-31, wherein at least one of R4is hydroxy and the other of R4are hydrogen.
[0203] Aspect 35. The compound of any one of aspects 19-31, wherein at least one of R4is a C1-C6 hydroxyalkyl group and the other of R4are hydrogen.
[0204] Aspect 36. The compound of aspect 1 or aspect 19, wherein the compound has the following structurewherein each R3are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group and each R4are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group;
[0205] Aspect 37. The compound of aspect 36, wherein at least one of R3is hydroxy, fluorine, chlorine, a C1-C6 alkyl group, or a C1-C6 hydroxyalkyl group and the other of R3are hydrogen.Attorney Docket No.222120-2030
[0206] Aspect 38. The compound of aspect 36 or aspect 37, wherein at least one of R3is fluorine or chlorine and the other of R3are hydrogen.
[0207] Aspect 39. The compound of aspect 36 or aspect 37, wherein at least one of R3is a C1-C6 alkyl group and the other of R3are hydrogen.
[0208] Aspect 40. The compound of aspect 36 or aspect 37, wherein at least one of R3is hydroxy and the other of R3are hydrogen.
[0209] Aspect 41. The compound of aspect 36 or aspect 37, wherein at least one of R3is a C1-C6 hydroxyalkyl group and the other of R3are hydrogen.
[0210] Aspect 42. The compound of any one of aspects 36-41, wherein at least one of R4is hydroxy, fluorine, chlorine, a C1-C6 alkyl group, or a C1-C6 hydroxyalkyl group and the other of R4are hydrogen.
[0211] Aspect 43. The compound of any one of aspects 36-42, wherein at least one of R4is fluorine or chlorine and the other of R4are hydrogen.
[0212] Aspect 44. The compound of any one of aspects 36-42, wherein at least one of R4is a C1-C6 alkyl group and the other of R4are hydrogen.
[0213] Aspect 45. The compound of any one of aspects 36-42, wherein at least one of R4is hydroxy and the other of R4are hydrogen.
[0214] Aspect 46. The compound of any one of aspects 36-42, wherein at least one of R4is a C1-C6 hydroxyalkyl group and the other of R4are hydrogen.
[0215] Aspect 47. The compound of any one of aspects 36-46, wherein each R3are independently selected from hydrogen, -C(O)OH, OH, or -CH2OR7, wherein R7is hydrogen, a substituted or unsubstituted alkyl group, or a substituted or unsubstituted heterocycloalkyl group.
[0216] Aspect 48. The compound of any one of aspects 36-47, wherein each R4are independently selected from hydrogen, -C(O)OH, OH, or -CH2OR7, wherein R7is hydrogen, a substituted or unsubstituted alkyl group, or a substituted or unsubstituted heterocycloalkyl group.
[0217] Aspect 49. A compound having a formula represented by the following structure:Attorney Docket No.222120-2030wherein R1is hydrogen, a primary amine, a secondary amine, a tertiary amine, a substituted or unsubstituted cycloalkyl group, a substituted or unsubstituted heterocycloalkyl group, a substituted or unsubstituted aryl group, or a substituted or unsubstituted heteroaryl group; m and n are independently an integer from 0 to 5; R2a, R2b, R2c, R2d, R2e, and R2fare independently selected from hydrogen, a hydroxyalkyl group, an ether, or a carboxyl group; each R3are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group; R4is hydrogen, an alkyl group, or a substituted or unsubstituted aryl group; Y is nitrogen or CH; and X is NH or C(Z)H, wherein Z is NH or O; or a pharmaceutically acceptable salt thereof.
[0218] Aspect 50. The compound of aspect 49, wherein R1is a heterocycloalkyl group wherein at least one heteroatom is nitrogen.
[0219] Aspect 51. The compound of aspect 49, wherein R1is a secondary or tertiary amine substituted with one or two alkyl groups.
[0220] Aspect 52. The compound of aspect 49, wherein R1iswherein R5aand R5bare independently selected from hydrogen or a C1-C6 alkyl group.
[0221] Aspect 53. The compound of aspect 52, wherein R5aand R5bare independently selected from a C1-C3 alkyl group.Attorney Docket No.222120-2030
[0222] Aspect 54. The compound of any one of aspects 49-53, wherein m and n are independently an integer from 1 to 5.
[0223] Aspect 55. The compound of any one of aspects 49-53, wherein m and n are independently an integer from 1 to 3.
[0224] Aspect 56. The compound of any one of aspects 49-55, wherein one of R2a, R2b, R2c, R2d, R2e, and R2fis hydrogen, a hydroxyalkyl group, an ether, or a carboxyl group and the other of R2a, R2b, R2c, R2d, R2e, and R2fare hydrogen.
[0225] Aspect 57. The compound of any one of aspects 49-56, wherein at least one of R3is hydroxy, fluorine, chlorine, a C1-C6 alkyl group, or a C1-C6 hydroxyalkyl group and the other of R3are hydrogen.
[0226] Aspect 58. The compound of any one of aspects 49-57, wherein at least one of R3is fluorine or chlorine and the other of R3are hydrogen.
[0227] Aspect 59. The compound of any one of aspects 49-57, wherein at least one of R3is a C1-C6 alkyl group and the other of R3are hydrogen.
[0228] Aspect 60. The compound of any one of aspects 49-57, wherein at least one of R3is hydroxy and the other of R3are hydrogen.
[0229] Aspect 61. The compound of any one of aspects 49-57, wherein at least one of R3is a C1-C6 hydroxyalkyl group and the other of R3are hydrogen.
[0230] Aspect 62. The compound of any one of aspects 49-61, wherein R4is hydrogen or a substituted or unsubstituted phenyl group.
[0231] Aspect 63. The compound of any one of aspects 49-62, wherein R4is:wherein each R6are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group.
[0232] Aspect 64. The compound of aspect 63, wherein at least one of R6is hydroxy, fluorine, chlorine, a C1-C6 alkyl group, or a C1-C6 hydroxyalkyl group, and the other of R6are hydrogen.
[0233] Aspect 65. The compound of aspect 63 or 64, wherein at least one of R6is fluorine or chlorine and the other of R6are hydrogen.Attorney Docket No.222120-2030
[0234] Aspect 66. The compound of aspect 63 or 64, wherein at least one of R6is a C1-C6 alkyl group and the other of R6are hydrogen.
[0235] Aspect 67. The compound of aspect 63 or 64, wherein at least one of R6is hydroxy and the other of R6are hydrogen.
[0236] Aspect 68. The compound of aspect 63 or 64, wherein at least one of R6is a C1-C6 hydroxyalkyl group and the other of R6are hydrogen.
[0237] Aspect 69. The compound of aspect 49, wherein the compound has the following structurewherein R1is hydrogen, a primary amine, a secondary amine, or a tertiary amine, a substituted or unsubstituted cycloalkyl group, a substituted or unsubstituted heterocycloalkyl group, a substituted or unsubstituted aryl group, or a substituted or unsubstituted heteroaryl group; m and n are independently an integer from 0 to 5; each R3are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group; and R4is hydrogen, an alkyl group, or a substituted or unsubstituted aryl group.
[0238] Aspect 70. The compound of aspect 69, wherein R1is a heterocycloalkyl group wherein at least one heteroatom is nitrogen.
[0239] Aspect 71. The compound of aspect 69, wherein R1is a secondary or tertiary amine substituted with one or two alkyl groups.
[0240] Aspect 72. The compound of aspect 69, wherein R1isAttorney Docket No.222120-2030wherein R5aand R5bare independently selected from hydrogen or a C1-C6 alkyl group.
[0241] Aspect 73. The compound of aspect 72, wherein R5aand R5bare independently selected from a C1-C3 alkyl group.
[0242] Aspect 74. The compound of any one of aspects 69-73, wherein m and n are independently an integer from 1 to 5.
[0243] Aspect 75. The compound of any one of aspects 69-73, wherein m and n are independently an integer from 1 to 3.
[0244] Aspect 76. The compound of any one of aspects 69-75, wherein at least one of R3is hydroxy, fluorine, chlorine, a C1-C6 alkyl group, or a C1-C6 hydroxyalkyl group and the other of R3are hydrogen.
[0245] Aspect 77. The compound of any one of aspects 69-76, wherein at least one of R3is fluorine or chlorine and the other of R3are hydrogen.
[0246] Aspect 78. The compound of any one of aspects 69-76, wherein at least one of R3is a C1-C6 alkyl group and the other of R3are hydrogen.
[0247] Aspect 79. The compound of any one of aspects 69-76, wherein at least one of R3is hydroxy and the other of R3are hydrogen.
[0248] Aspect 80. The compound of any one of aspects 69-76, wherein at least one of R3is a C1-C6 hydroxyalkyl group and the other of R3are hydrogen.
[0249] Aspect 81. The compound of any one of aspects 69-80, wherein R4is hydrogen or a substituted or unsubstituted phenyl group.
[0250] Aspect 82. The compound of any one of aspects 69-81, wherein R4is:Attorney Docket No.222120-2030wherein each R6are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group.
[0251] Aspect 83. The compound of aspect 82, wherein at least one of R6is hydroxy, fluorine,chlorine, a C1-C6 alkyl group, or a C1-C6 hydroxyalkyl group, and the other of R6arehydrogen.
[0252] Aspect 84. The compound of aspect 82 or 83, wherein at least one of R6is fluorine or chlorine and the other of R6are hydrogen.
[0253] Aspect 85. The compound of aspect 82 or 83, wherein at least one of R6is a C1-C6 alkyl group and the other of R6are hydrogen.
[0254] Aspect 86. The compound of aspect 82 or 83, wherein at least one of R6is hydroxy and the other of R6are hydrogen.
[0255] Aspect 87. The compound of aspect 82 or 83, wherein at least one of R6is a C1-C6 hydroxyalkyl group and the other of R6are hydrogen.
[0256] Aspect 88. The compound of aspect 49 or aspect 69, wherein the compound has the following structurewherein each R3are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group; R4is hydrogen, an alkyl group, or a substituted or unsubstituted aryl group; and X is CH2or O.
[0257] Aspect 89. The compound of aspect 88, wherein at least one of R3is hydroxy, fluorine, chlorine, a C1-C6 alkyl group, or a C1-C6 hydroxyalkyl group and the other of R3are hydrogen.
[0258] Aspect 90. The compound of aspect 88 or aspect 89, wherein at least one of R3is fluorine or chlorine and the other of R3are hydrogen.
[0259] Aspect 91. The compound of aspect 88 or aspect 89, wherein at least one of R3is a C1-C6 alkyl group and the other of R3are hydrogen.Attorney Docket No.222120-2030
[0260] Aspect 92. The compound of aspect 88 or aspect 89, wherein at least one of R3is hydroxy and the other of R3are hydrogen.
[0261] Aspect 93. The compound of aspect 88 or aspect 89, wherein at least one of R3is a C1-C6 hydroxyalkyl group and the other of R3are hydrogen.
[0262] Aspect 94. The compound of aspect 88 or aspect 89, wherein each R3are independently selected from hydrogen, -C(O)OH, OH, or -CH2OR7, wherein R7is hydrogen, a substituted or unsubstituted alkyl group, or a substituted or unsubstituted heterocycloalkyl group.
[0263] Aspect 95. The compound of any one of aspects 88-94, wherein R4is hydrogen or a substituted or unsubstituted phenyl group.
[0264] Aspect 96. The compound of any one of aspects 88-94, wherein R4is:wherein each R6are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group.
[0265] Aspect 97. The compound of aspect 96, wherein at least one of R6is hydroxy, fluorine, chlorine, a C1-C6 alkyl group, or a C1-C6 hydroxyalkyl group, and the other of R6are hydrogen.
[0266] Aspect 98. The compound of aspect 96 or 97, wherein at least one of R6is fluorine or chlorine and the other of R6are hydrogen.
[0267] Aspect 99. The compound of aspect 96 or 97, wherein at least one of R6is a C1-C6 alkyl group and the other of R6are hydrogen.
[0268] Aspect 100. The compound of aspect 96 or 97, wherein at least one of R6is hydroxy and the other of R6are hydrogen.
[0269] Aspect 101. The compound of aspect 96 or 97, wherein at least one of R6is a C1-C6 hydroxyalkyl group and the other of R6are hydrogen.
[0270] Aspect 102. The compound of aspect 96, wherein each R6are independently selected from hydrogen, -C(O)OH, OH, or -CH2OR7, wherein R7is hydrogen, a substituted or unsubstituted alkyl group, or a substituted or unsubstituted heterocycloalkyl group.
[0271] Aspect 103. A pharmaceutical comprising the compound of any one of aspects 1 to 102 and a pharmaceutically-acceptable carrier, formulated for administering to a subject.Attorney Docket No.222120-2030
[0272] Aspect 104. A method for treating a disease, comprising administering to a subject in need thereof, a therapeutically effective amount of the pharmaceutical composition of aspect 103 or a therapeutically effective amount of the compound of any one of aspect 1 to 102, or a pharmaceutically acceptable salt thereof.
[0273] Aspect 105. The method of claim aspect 104, further comprising a pharmaceutically acceptable carrier.
[0274] Aspect 106. The method of aspect 104, wherein the disease is medullary thyroid cancer.
[0275] Aspect 107. The method of aspect 104, wherein the disease is metastatic medullary thyroid cancer.
[0276] Aspect 108. The method of aspect 104, wherein the disease is chronic pain.
[0277] While embodiments of the present disclosure are described in connection with the following Examples and the corresponding text and figures, there is no intent to limit the disclosure to the embodiments in these descriptions. On the contrary, the intent is to cover all alternatives, modifications, and equivalents included within the spirit and scope of embodiments of the present disclosure. EXAMPLES EXAMPLE 1
[0278] Medullary thyroid cancer (MTC) is a type of neuroendocrine tumor (NET) evolving from neural crest-derived calcitonin-producing parafollicular C cells which in turn are responsible for controlling Ca2+levels in the blood stream [1-3]. MTC accounts for approximately 4% of all thyroid cancer cases but disproportionally accounts for 13% of thyroid cancer related deaths [4,5]. The major cause of MTC deaths is hepatic metastases and patients with metastatic form of this disease have poor prognosis with a 10-year survival rate of only 10% [6]. This subtype within the thyroid cancer is particularly challenging to treat as it doesn’t respond to standard-of-care treatments [7]. Surgery is the only curative treatment for MTC [8]. Although, there are targeted agents to treat metastatic disease, none have shown an effect on overall survival [9]. Tyrosine kinase inhibitors (TKIs) is one of the treatment options for metastatic MTC
[0010] . Currently, there are only four FDA approved TKIs that have been used for the treatment of advanced or progressive MTC, namely vandetanib, cabozatinib, selpercatinib and pralsetinib [4]. Although, these are considered to be promising drugs to treat advanced MTC, drug resistance arising from the mutations in tyrosine kinase domains is a significant problem
[0011] . In addition, these drugs exhibit multiple side effects such as diarrhea,Attorney Docket No.222120-2030 rash, fatigue, hypertension, and weight loss
[0012] . Furthermore, approximately 27% of vandetanib treated patients showed QTc (corrected for heart rate) prolongation, which is a serious side effect that could lead to sudden cardiac arrest [12,13]. Despite the recent advances in diagnosis and treatment, MTC remains an understudied cancer type and continues to disproportionately contribute to thyroid cancer related mortality. Therefore, there is a need in the field to identify additional therapeutic targets for MTC.
[0279] One such promising anti-metastatic drug target is voltage-gated sodium channels (VGSCs) [14-17], which are responsible for the generation and propagation of action potentials in the excitable cells [18,19]. There are nine different subtypes of VGSCs expressed in different organs namely, NaV1.1-NaV1.9. The complex structure of VGSCs consists of an D- subunit and 1 or 2 auxiliary E-subunits. The D-subunit contains 4 very similar domains, each domain contains 6 transmembrane domains, S1-S6, where S1-S4 are the voltage sensing domains and S5 and S6 are the pore forming domains (FIGS. 1A-1B)
[0020] . VGSCs play a crucial role in the membrane depolarization during action potential in excitable cells such as neurons, skeletal, and cardiac muscle cells. The effect of the membrane potential (Vm) in non- excitable cells such as cancer cells was first discovered in 1970s. Although a few studies have reported the excitability of cancer cells where a larger number of membrane currents and Vmfluctuations was observed [21,22], these discrete fluctuations might not be enough to generate nor propagate the action potentials, a distinctive characteristic that will define a cell as “electrically excitable”
[0023] . The changes in Vmin the cancer cells and other non-excitable cells were found to be related to cell proliferation
[0024] , migration
[0025] , wound healing and regeneration [26,27]. According to Tokuoka et al., membrane potential becomes significantly less negative during the transformation of normal cells to cancerous
[0028] . Similarly, several studies have shown that Vmin cancer cells are more depolarized and cancer cells have substantially higher intracellular Na+levels compared to non-cancerous tissues [28-31].
[0280] Recent studies have put-forth a few plausible mechanisms for the involvement of VGSC sub-types in the development of metastasis in various tumors [14,32-34]. VGSCs are co-localized with the Na+ / H+exchanger isoform 1, NHE1 and Na+ / Ca2+exchanger, NCX in the cell membrane [33,35,36]. An increase in Na+influx activates H+efflux through NHE1, thereby increasing the acidity of the tumor microenvironment. Acidic tumor microenvironment has been known to activate the secretion of extracellular matrix proteases, most notably cathepsins and matrix metalloproteases (MMPs) which facilitate cancer cell migration from the primary tumor to the distal metastatic sites [37,38]. At the same time, increased Na+concentration within the cells results in a Ca2+influx through NCX activation that leads to higher Ca2+consumption by mitochondria which then releases Ca2+to cytosol. A greater Ca2+concentration in cytosol initiates actin polymerization and formation of invadopodia, whichAttorney Docket No.222120-2030 supports cancer cell movement and migration (FIG. 1C) [14,33,36]. Thus, VGSCs play a critical role in promoting tumor metastasis, therefore inhibition of VGSC activity by small molecules is a novel strategy for the development of therapeutic drugs for metastatic cancers [39-41].
[0281] VGSCs are druggable targets and their inhibitors have been commonly used as anticonvulsants, local anesthetics, antiarrhythmics and in the treatment of neuronal excitability disorders
[0043] . Clinically used VGSC inhibitors are considered to be state-dependent or use- dependent inhibitors which show higher affinity to the binding site when the channel is in the open or inactivated state, and lower affinity when the channel is in the resting state [44,45]. The selectivity of drugs towards the cells in the disease state vs normal state is due to the preferential binding of the drug molecules to the binding site (the S6 of Domain IV) which is located at the inner pore of the channel (FIG. 1A). In the disease state, the channels have higher rates of cell depolarization (opening state), as a consequence, the relative time of the channels staying in the resting state is lower than the normal cells, resulting in more selective drug binding to the channels in the disease state [46-48].
[0282] In recent years, VGSC expression has been found to be aberrantly enhanced in non- excitable cells in aggressive human cancers of epithelial origin such as lung, prostate, ovarian, colon and breast cancer, and this overexpression has been shown to be associated with cancer cells invasiveness [14,16,41,49-51]. To date, multiple VGSC subtypes have been targeted for the discovery of potential anticancer drugs [15-17,40,52,53]. Recently, NaV1.6 has been found to promote human follicular thyroid carcinoma by increasing cells proliferation, epithelial-to-mesenchymal transition, and invasion
[0054] . However, no such investigation of sodium channel inhibitors in MTC has been reported since the initial discovery of the presence of sodium channel genes in MTC cells by Klugbauer et al in 1995
[0055] .
[0283] As a part of our interest in targeting VGSCs for cancer therapy, we have recently reported small molecule inhibitors for the VGSC subtype NaV1.5, with impressive cell invasion inhibitory activities in breast cancer cells, MDA-MB-231 and colon cancer cells, SW620 and HCT116 [40,56]. As a continuation of these studies, we have investigated the expression of VGSC subtype NaV1.7 in MTC and discovered small molecule inhibitors of this channel. Here, we report for the first time the discovery of the overexpression of NaV1.7 (SCN9A gene) in aggressive MTC cells and patient samples, and lack of this protein in normal thyroid cells and tissues. We further established the druggability of NaV1.7 channel in MTC by identifying a novel inhibitor and investigated its mode of binding and the ability to inhibit Na+current (INa) in NaV1.7. These studies demonstrate how the lead compound targeting NaV1.7 inhibits MTC cell viability, migration, and invasion in vitro.Attorney Docket No.222120-2030
[0284] Materials and Methods
[0285] Cell Culture: Human MTC cell line MZ-CRC-1 was obtained from Dr. Gilbert Cote (MD Anderson Cancer Center, Houston, TX, USA) and human MTC cell line (TT) was obtained from Dr. Barry D. Nelkin (John Hopkins University, Baltimore, MD, USA). Human MTC cell lines were maintained under the condition as described
[0057] . Mouse MTC cell line (MTC- p25OE) was obtained from Dr. James Bibb (University of Alabama at Birmingham, Birmingham, USA). Human normal thyroid cell lines (Htori-3 and Nty-ori) were purchased from Sigma Life Science / European Collection of Cell Cultures.
[0286] Human tissue samples: Human MTC tumor samples with pathology status and control tumor samples were obtained from UAB Tissue Biorepository with approved IRB protocol (IRB-300006132-002). The MTC microarray contained formalin-fixed, paraffin-embedded thyroid biopsies from 45 patients including normal thyroid, primary MTC and metastatic MTC each mounted in triplicate for a total of 133 cores. Tumor cell lysates were prepared for Western blot analysis as described below.
[0287] Western Blot Analysis: Cells or tumor specimens were lysed using radio- immunoprecipitation assay (RIPA) buffer with the addition of protease and phosphatase inhibitor (Sigma-Aldrich). Protein concentrations in each sample were quantified using a Pierce BCA Protein Assay Kit (thermos Scientific). Prior to performing gel electrophoresis, 1:1 of 2x Leammli Sample buffer (Bio-Rad) was added in protein samples. The mixture was diluted with 5% 2- mercaptoethanol (ThermoFisher Scientific). All protein samples were heated at 95 °C for 5 min and run on 4-15% Criterion TGX gradient gels (Bio-Rad). Gel transfer and immunoblotting detections were performed as previously described
[0058] . Primary antibodies for NaV1.7 (EMD Millipore Corp, Darmstadt, Germany) was used at 1:1000 and the reference protein GAPDH (Cell Signaling Technology) and ȕ-actin (Cell Signaling Technology) were used at 1:2000. The horseradish peroxidase-conjugated anti-rabbit / mouse with a dilution of 1:1000 (Cell Signaling Technology) was used as secondary antibodies. The molecular weight marker broad range protein ladder (10-260 kDa) (Spectra Multicolor, ThermoFisher Scientific) was used to confirm the size of the protein of our interest.
[0288] TMA staining, quantification, and evaluation: NaV1.7 was immunostained using an anti- NaV1.7 monoclonal antibody (ab85015, Abcam). Immunohistochemistry (IHC) positive and negative controls were generated from cell lines that represent high or no expression of NaV1.7. MZ-CRC-1, which showed high expression of NaV1.7 was used as a positive control and Nthy-ori3-1 (normal thyroid) which did not have an expression of NaV1.7 was used as a negative control. NaV1.7 expression was quantified within each core using an automated digital quantification (custom MATLAB® code). IHC samples were automatically segmentedAttorney Docket No.222120-2030 to extract out tissue boundaries and transitioned from RGB images to HSV, followed by a saturation mask to distinguish tissue. The distribution of saturation was plotted and Otsu’s automated threshold for separating positive vs. negative staining was employed to extract out % positive tissue expression.
[0289] Real time quantitative PCR (RT-qPCR): Each RNA sample was isolated using RNeasy Plus Mini kit (Qiagen, Hilden, Germany). The RNA concentrations were determined by NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, Inc., Waltham, Massachussetts). The RNA samples which have the ratio of absorbance at 260 nm and 280 nm greater than 2.0 were used in the experiments. Complementary DNA (cDNA) was synthesized using iScript RT Supermix (Bio-5DG^^^^^^J^WRWDO^51$^ZDV^XVHG^LQ^HDFK^VDPSOH^^ PCR samples were prepared using SYBR Green master mixes (Bio-Rad Laboratories, Inc., Hercules, California). Real-time quantitative PCR was performed in triplicate on CFX Connect Real-Time PCR Detection System (Bio-Rad). The sequences of the PCR primers, SCN5A (NaV1.5), SCN8A (NaV1.6), SCN9A (NaV1.7), and SCN9A1 (NHE1) used for the analysis in this experiment are SCN5A (NaV1.5) forward: CACGCGTTCACTTTCCTTC, reverse: CATCAGCCAGCTTCTTCACA, SCN8A (NaV1.6) forward: CGCCTTATGACCCAGGACTA, reverse: GTGCCTCTTCCTGTTGCTTC, SCN9A (NaV1.7) forward: GGCTCCTTGTTTTCTGCAAG, reverse: TGGCTTGGCTGATGTTACTG and SCN9A1 (NHE1) forward: GGCATCGAGGACATCTGTGG, reverse: CTGCAGACTTGGGGTGGATG as described
[0034] . Target gene expression was normalized to either S27 or GAPDH, and the ǻǻ&W^ PHWKRG^ ZDV^ XVHG^ WR^ FDOFXODWH^ UHODWLYH^ JHQH^ H[SUHVVLRQ^
[0059] . Error bars show the standard error of the mean (SEM).
[0290] NaV1.7 transfection: Human embryonic kidney cells (HEK-293) were acquired from the American Type Cell Culture Collection (ATCC CRL-1573) and grown in DMEM / F12 mixture supplemented with 10% FBS, 100 U / ml penicillin, and 100 μg / ml streptomycin at 37 °C in a CO2incubator. Transient transfections were performed with PEI (polyethyleneimine; Santa Cruz Biotechnology) in 35 mm dishes, by using a 3:1 ratio for PEI: DNA. HEK-293 cells were transfected with 2.5 μg of rat cDNA NaV1.7 (GenBank No. U79568), and 0.2 μg of GFP cDNA as a reporter gene. After transfection, cells were cultured for 24-72 h before being dissociated and seeded on 0.25 cm2glass coverslips contained into a 35 mm Petri dish for electrophysiological experiments.
[0291] Electrophysiology: Sodium currents (INa) of NaV1.7 channels were recorded at room temperature (21 ± 2 °C) with the whole-cell configuration of the patch-clamp technique [60,61]. The NaV1.7 channels activity was investigated by using an Axopatch 200B amplifier, a Digidata1550B A / D converter and pCLAMP™ 10.7 software (Molecular Devices, LLC, San Jose, California). Unless otherwise noted, the holding potential (HP) used in the experimentsAttorney Docket No.222120-2030 was -120 mV. Current recordings were usually sampled at 50 kHz, following 5 kHz analogue filtering. Whole-cell series resistance (Rs) and cell capacitance (Cm) were estimated from optimal cancellation of the capacitive transients with the built-in circuitry of the amplifier and in some cases Rswas compensated electrically by 60 to 80%. Currents were recorded on two channels, one with on-line leak subtraction using the P / -5 method, and the other to evaluate cell stability and holding current. Only leak subtracted data are shown. Recording pipettes were made from TW150-3 capillary tubing (WPI, Inc.), using a Model P-97 Flaming-Brown pipette puller (Sutter Instrument Co.). Cells were bathed in a solution containing the following composition (in mM): 158 NaCl, 2 CaCl2, 2 MgCl2and 10 HEPES-NaOH (pH 7.4) with an osmolality of 305–310 mOsm. Cells were patched with microelectrodes containing the following internal solution (in mM): 110 CsF, 30 NaCl, 2 CaCl2, 10 EGTA and 10 HEPES- CsOH (pH 7.4) and osmolality of 295–300 mOsm. The recording chamber was continuously perfused by gravity at a rate of 2 ml / min and solution exchange was done by a manually controlled six-way rotary valve. A 50 mM stock solution of the compound SV188 dissolved in DMSO was used to prepare fresh test concentrations in external solution ranging from 0.3 to 30 μM. The highest concentration of DMSO in the tested SV188 solutions was 0.06%. Voltage- gated sodium currents were monitored by 16-ms depolarizing pulses to -10 mV from a HP of í^^^^P9^DSSOLed every 10 s. Modifications to this protocol were used to obtain data concerning current-voltage (I-V) relationships, and steady-state inactivation of sodium channels. Peak current values of current recordings were obtained by using the Clampfit application of pCLAMP software. Dose-response relationships for SV188 blockade were fit with the following Hill equation: Y = 1 / (1 + 10[(log IC50-;^^^^K@), where X is the logarithm of concentration, Y is the fraction of current remaining after addition of the drug, IC50is the concentration required for 50% blockade of current, and h is the Hill coefficient. For this analysis, current in control external solution was normalized to 1, and we assumed complete blockade of current with sufficient drug concentration. The voltage dependence of current activation was described with a single Boltzmann distribution: G = Gmax^^^^^^H[S^^í^Vmí^V1 / 2) / k)), where Gmaxis the maximum normalized Na+conductance; Vmis the test potential, V1 / 2is the mid-point of activation, and k is the slope factor. The voltage-dependence of steady-state inactivation was also described with a single Boltzmann function as follows: I = Imax / (1 + exp ((Vmí^V1 / 2) / k)), where Imaxis the maximal normalized sodium current; Vmis the test potential, V1 / 2is the mid- point of steady-state inactivation, and k is the slope factor.
[0292] Cell viability assay: A 3-(4,5-Dimethylthiazole-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay (Sigma-Aldrich) was used to measure the effect of the compound against cell proliferation and IC50determination. MTC cell lines were plated in flat bottom 96 well plate at seeding density of 104cells / well. Cells were allowed to grow overnight. A differentAttorney Docket No.222120-2030 concentration of the treatment up to 100 PM were tested comparing to control (0.2% DMSO) and incubated for 72 h. After the incubation, cell viability was determined using MTT reagent, the treatment media was removed and 20 μL of serum-free media containing 0.5 mg / mL MTT (Sigma-Aldrich) was added to each well followed by an incubation at 37 °C for 2 h. Then, the cells and MTT reagent were suspended with 75 μL of DMSO prior to the analysis at 562 nm using a plate reader (Infinite M200 PRO, TECAN). Percent cell viability and concentrations were plotted and the IC50value was calculated using GraphPad Prism9.3.1
[0062] . The concentrations were converted to log10(concentration) and the IC50curve was plotted with normalized curve fit vs dose response (variable slope) to obtain the IC50value.
[0293] Motility assays (migration / invasion): Inhibition of cell migration and invasion was determined using the Boyden chamber assay. For migration assay, transwell cell culture inserts, 8.0 PM pore size (Corning Life Sciences) were plated in 24-well plate (Costar, Corning Life Sciences). MTC cell suspension in serum free media containing 0.06% DMSO (as a control) and different concentrations of SV188 were plated (4×105cells per insert) in upper compartment of transwell cell culture inserts, 8.0 PM pore size while 650 μL of media containing fetal bovine serum (chemo-attractant) was added in 24-well plates. MTC Cells were allowed to migrate for 48 h. The cells that migrated through the membrane were stained using 3 steps staining kit (Fisher). The membrane was cut and mounted on microscope slides, size 25 x 75 x 1 mm (Fisher). The membranes were covered using microscope cover glass (Fisher). Migrated cells were counted from a microscope (OLYMPUS DP74) imaging. Number of migrated cells from each individual experiment was normalized and triplicated results were reported as mean fold change in number of cells migrated through membrane r SEM. For invasion assay, the upper compartment will be coated with Matrigel Metrix (Corning Life Sciences) to mimic the extra cellular matrix (ECM) environment. The gel was allowed to set by incubation at 37 °C for 2 h. Number of invaded cells from each individual experiment was normalized and reported as mean fold change in number of cells migrated through membrane r SEM. Migration / invasion in each concentration was done quadruplicate for the total of 3 experiments. The results were plotted, and statistical significance was determined using GraphPad Prism 9.3.1
[0062] .
[0294] Cell cycle analysis flow cytometry: Cell cycle analysis data was acquired using Flow Cytometry (BD LSRFortessa™, BD Biosciences, Rutherford, New Jersey), at least 3000 events were collected in each sample for 3 individual experiments. MZ-CRC-1 cells were plated on 90 mm Petri dishes suspension (0.5 - 1 x 106cells). Cells were allowed to grow overnight before changing to the treatment media containing different concentrations of SV188, the final concentration were 3 μM, 6 μM, 9 μM, and growth media containing 0.09% DMSO was used for the control. Cells were incubated for 48 h before harvested using bufferAttorney Docket No.222120-2030 containing EDTA. The cell pellets were washed with PBS prior to fixing by adding 70% ethanol (ice cold) dropwise while gently vortexing. The cells were fixed at í20 °C overnight. On the next day, ethanol was removed, cells were washed again with PBS and resuspended in staining buffer containing propidium iodide (PI) and RNase (FxCycleTMPI / RNase Staining, Invitrogen Corporation, Waltham, Massachussetts). Cells were incubated in staining buffer in a dark, cold place (4 °C) for 30 min before transferring to a cell cycle analysis tube and acquire the data using flow cytometry. The data was processed using FlowJo 10.8.1 (FlowJo, LLC, Ashton, Oregon;
[0063] ). The combined results were plotted, and statistical significance was determined using GraphPad Prism 9.3.1 (Insightful Science, San Diego, CA;
[0062] ).
[0295] Statistical analysis: Bivariate correlation with confidence interval was achieved through IBM SPSS Statistics for Macintosh, Version 29.0.0
[0064] . Statistical significance was assessed using GraphPad Prism 9.3.1
[0062] , One-way ANOVA followed by Dunnett’s multiple comparisons test (GraphPad Software, San Diego, CA). All data are expressed as mean ± standard error of the mean (SEM), unless otherwise noted.
[0296] General methods for compound synthesis and characterization: Anhydrous solvents used for reactions were purchased in Sure-Seal™ bottles from Aldrich chemical company. THF and ether were freshly distilled over sodium / benzophenone. Other reagents were purchased from Sigma-Aldrich, Alfa Aesar or Acros. Solvent evaporations were carried out under vacuum using a rotary evaporator (BUCHI). Thin layer chromatography (TLC) was performed on Si gel plates aluminum backed, with fluorescent indicator (20 × 20 cm F-254, ^^^^^P^^'\QDPLF^$GVRUEHQWV^^^7 / &^VSRWV^ZHUH^YLVXDOL]HG^E\^89^OLJKW^DW^^^^^DQG^^^^^QP^RU^ by using staining agents such as ninhydrin or KMnO4. Purification by column and flash chromatography was carried out using Si gel (32–^^^ ^P^^ '\QDPLF^ $EVRUEHQW^^ XVLQJ^ WKH^ solvent systems as indicated. The NMR spectra were recorded on a Bruker DPX 400 spectrometer. The peak calibration was done using TMS or the NMR solvent peaks as internal VWDQGDUG^^7KH^FKHPLFDO^VKLIW^ ^į^^YDOXHV^DQG^FRXSOLQJ^FRQVWDQWV^^-^^ZHUH^JLYHQ^ LQ^Sarts per million and in Hz, respectively. Mass spectra were recorded on an Applied Biosystems 4000 Q Trap instrument at the Mass Spectrometry Facility in the department of Chemistry and Biochemistry, University of Alabama, Tuscaloosa, AL. All compounds are > 97% pure by HPLC, HPLC traces were performed on Shimadzu HPLC with the following parts / software: DGU-20A3Prominence Degasser, FCV-11AL Valve Unit, 2 x LC-20AD Prominence Liquid Chromatographs, SIL-20AC HT Prominence Auto Sampler, CBM-20A Prominence Communications Bus Module, SPD-M20A Prominence Diode Array Detector, CTO-20AC Prominence Column Oven, and LCsolution Version 1.22 SP1. Mobile Phase Buffer (60% MeCN / 40% H2O / 0.1% formic acid) was freshly prepared using HPLC grade reagents / solvents in a 500 mL volumetric flask and thoroughly degassed using the DGU-20A3Attorney Docket No.222120-2030 Prominence Degasser. Raw data from the HPLC chromatograms were exported as text files and plotted using GraphPad Prism 9.3.1.
[0297] 4,4-Diphenylbutyric acid (2): To a solution of phenyl butyrolactone, 1 (0.5 g, 3.08 mmol) in anhydrous benzene (20 mL) anhydrous AlCl3(0.62 g, 4.63 mmol) was added slowly, and the reaction mixture was stirred overnight under N2atmosphere. When the reaction was complete as indicated by TLC (50% EtOAc in hexanes, Rf = 0.4), pH of the reaction mixture was adjusted to 1 using 1N. HCl. The reaction mixture was further diluted with distilled water (20 mL) and extracted with (3 × 20 mL). The combined organic layer was washed with water (2 × 30 mL), brine (1 × 30 mL) and dried over Na2SO4. The drying agent was filtered off and the filtrate was concentrated in a rotary evaporator under vacuum to obtain pure 4,4- diphenylbutyric acid, 2 as a white solid (0. 698g, 94%); mp: 102-103 °C;1H-NMR (CDCl3, ^^^0+]^^į^^^^^-2.23 (m, 2H), 2.26-2.32 (m, 2H), 3.84 (t, 2H, J = 7.4 Hz), 7.06-7.10 (m, 2H), 7.12-7.20 (m, 8H), 9.47 (brS, 1H);13C-NMR (CDCl3^^į^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ 144.1, 179.9; HRMS [M-H]+calculated for C16H15O2239.1072, found 239.1074.
[0298] 3-(Piperidin-1-yl)propan-1-amine (5): To a solution of 1-piperidinepropionitrile, 3 (1g, 7.23 mmol) in anhydrous MeOH (100 mL), Raney-Ni (2.5 g) suspension in water was added quickly and stirred for 12 h at room temperature under a hydrogen atmosphere from a balloon. TLC examination (20% MeOH in CHCl3,Rf = 0.12) showed that the reaction is complete. Raney Ni was filtered off carefully over celite 545, washed with MeOH (50 mL) continuously without letting the celite dry out. The combined filtrate was concentrated under vacuum and redissolved in CH2Cl2(50 mL) and dried over Na2SO4. The drying agent was removed by filtration and the filtrate was concentrated under vacuum to obtain 3-(piperidin-1-yl)propan-1- amine, 5 (0.914 g, 89 %) as a colorless oil.1H-NMR (CDCl3^^^^^^0+]^^į^^^^^-1.58 (m, 6H), 1.63 (quint, 2H, J = 7.44 Hz), 2.33 (t, 6H, J = 7.24 Hz), 2.65 (brS, 2H), 2.73 (t, 2H, J = 6.76 Hz);13C-NMR (CDCl3^^^^^^0+]^^į^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^+506^ [M+H]+calculated for C8H19N2143.1548, found 143.1543.
[0299] 4,4-Diphenyl-N-[3-(piperidin-1-yl)propyl]butanamide (6): To a solution of 3-(piperidin- 1-yl)propan-1-amine.5 (0.88g, 6.20 mmol) in 200 mL CH2Cl2(200 mL) 4,4-diphenylbutyric acid, 2 (1.79 g, 7.44 mmol) was added, followed by the addition of EDC (1.44 g, 9.30 mmol), and DMAP (0.76g, 0.62 mmol). The reaction mixture was stirred at room temperature under N2atmosphere overnight. The TLC examination (10% MeOH in CHCl3, Rf = 0.3) indicated the completion of the reaction. The reaction mixture was washed with saturated NaHCO3(2 × 50mL), water (2 × 50 mL), brine (1 × 50 mL) and dried over Na2SO4. The drying agent was removed by filtration and the filtrate was concentrated under vacuum to obtain the crude product, which was purified by column chromatography over Si gel using 0-5% MeOH in CHCl3as eluent to afford the pure product 4,4-Diphenyl-N-[3-(piperidin-1-yl)propyl]butanamide, 6Attorney Docket No.222120-2030 (1.88g, 83.2 %) as a white solid. mp: 74 °C;1H-NMR (CDCl3^^^^^^0+]^^į^^^^^-1.47 (m, 6H), 1.63 (quint, 2H, J = 6.12 Hz), 2.10 (t, 2H, J = 8.64 Hz), 2.37-2.43 (m, 8 H), 3.30 (q, J = 5.36 Hz), 3.93 (t, 1H, J = 7.92 Hz), 7.15-7.19 (m, 2H), 7.24-7.30 (m, 8H), 7.45 (brS, 1H);13C-NMR (CDCl3^^^^^^0+]^^į^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ 144.4, 172.4; HRMS [M-H]+calculated for C24H33N2O 365.2593, found 365.2585.
[0300] 4,4-Diphenylbutyl[3-(piperidin-1-yl)propyl]amine hydrochloride (SV188): To a solution of 4,4-diphenyl-N-[3-(piperidin-1-yl)propyl]butanamide, 6 (2.09 g, 5.73 mmol) in anhydrous THF (100 mL), LiAlH4( 0.87 g, 22.93 mmol) was added slowly under N2atmosphere. The reaction mixture was refluxed for 2 h. TLC examination (10% MeOH in CHCl3) indicated the completion of the reaction. The reaction mixture was then carefully quenched by a very slow drop-wise addition of saturated Na2SO4solution until the evolution of H2ceased. The reaction mixture was then filtered over celite 545 and washed with EtOAc (100 mL). The combined filtrate was concentrated under vacuum and redissolved in EtOAc (100 mL) and dried over Na2SO4. The drying agent was filtered off and the filtrate was concentrated under vacuum to obtain the amine product as a light-yellow oil. This product was dissolved in ether (10 mL) and treated with 2N. HCl (0.4 mL) to make the hydrochloride salt of 4,4-Diphenylbutyl[3-(piperidin- 1-yl)propyl]amine hydrochloride, SV188 as a white solid (1.47 g, 61 %). mp: 215 °C (decomposed);1H-NMR (DMSO-d6^^^^^^0+]^^į^^^^^-1.41 (m, 1H), 1.54 (quint, 2H, J = 6.96 Hz), 1.66-1.84 (m, 5H), 2.06-2.10 (m, 4H), 2.77-2.92 (m, 6H), 3.09 (quint, 2H, J = 5.16 Hz), 3.33-3.40 (m, 2H), 3.94 (t, 1H, J = 7.88 Hz), 7.16 (t, 2H, J = 7.08 Hz), 7.26-7.33(m, 8H), 9.13 (brS, 2H), 10.72 (brS, 1H);13C-NMR (DMSO-d6^^^^^^0+]^^į^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ 46.5, 50.0, 51.7, 52.6, 126.0, 127.5, 128.3, 144.6; HRMS [M+H]+calculated for C24H35N2351.2800, found 351.2792.
[0301] 4,4-Diphenyl-N-(3-phenylpropyl)butanamide (8): To a solution of 3- phenylpropylamine, 7 (0.5 g, 3.70 mmol) in CH2Cl2(120mL) 4-(4-phenyl)butyric acid, 2, (0.88 g, 3.70 mmol), EDC (0.861 g, 5.55 mmol), and DMAP (0.045 g, 0.37 mmol) were added, and the reaction mixture was stirred at room temperature under N2atmosphere overnight. The TLC examination (5% MeOH / in NH3saturated CHCl3, Rf = 0.71) indicated the completion of the reaction. The reaction mixture was washed with saturated NaHCO3(2 × 50 mL), water (2 × 50 mL), brine (1 × 50 mL), and dried over Na2SO4. The drying agent was removed by filtration and the filtrate was concentrated under vacuum to obtain the crude product, which was purified by column chromatography over Si gel using NH3saturated CHCl3as eluent to afford the pure 4,4-Diphenyl-N-(3-phenylpropyl)butanamide, 8 (0. 967 g, 73 %) as a yellow oil.1H-NMR (CDCl3^^į^^^^^^^TXLQW^^^+^^J = 7.32 Hz), 2.04 (t, 2H, J = 7.92 Hz), 2.33-2.38 (m, 2H) , 2.61 (t, 2H, J = 7.76 Hz), 3.23 (q, 2H, J = 6.76 Hz), 3.89 (t, 1H, J = 7.96 Hz), 5.32 (brS, 1H), 7.16 (t, 5H, J = 7.40 Hz), 7.21-7.28 (m, 10H);13C-NMR (CDCl3^^^^^^0+]^^į^^^^^^^^^^^^^^^^^^^^^^^^^Attorney Docket No.222120-2030 39.1, 50.5, 126.0, 126.3, 127.8, 128. 3, 128.4, 128.5, 141.4, 144.2, 172.4; HRMS [M+H]+calculated for C25H28NO 358.2171, found 358.2178.
[0302] 4,4-Diphenylbutyl(3-phenylpropyl)amine hydrochloride (WJB-133): To a solution of 4,4-Diphenyl-N-(3-phenylpropyl)butanamide, 8 (0.5 g, 1.40 mmol) in anhydrous THF (35 mL), LiAlH4(0.159 g, 4.2 mmol) was added slowly under N2atmosphere. The reaction mixture was refluxed for 2 h. TLC examination (2% MeOH in NH3saturated CHCl3) indicated the completion of the reaction. The reaction mixture was then carefully quenched by a very slow drop-wise addition of saturated Na2SO4until the evolution of H2ceased. The reaction mixture was then filtered over celite 545, and the filtrate was washed with EtOAc (100 mL). The combined filtrate was concentrated under vacuum and redissolved in EtOAc (100 mL) and dried over Na2SO4.The drying agent was filtered off and the filtrate was concentrated under vacuum to obtain the amine product as a light-yellow oil. This product was dissolved in ether (4 mL) and treated with 2N. HCl (0.2 mL) to make the hydrochloride salt of WJB-133 as a clear gummy sticky oil (0.248 g, 47 %);1H-NMR (CDCl3^^^^^^0+]^^į^^^^^-1.80 (m, 2H), 2.03-2.09 (m, 4H), 2.56 (t, 2H, J = 6.60 Hz), 2.71-2.76 (m, 4H), 3.81 (t, 1H, J = 7.40 Hz), 7.10-7.19 (m, 10H), 7.21-7.26 (m, 5H), 9.47 (brS, 2H);13C-NMR (CDCl3^^^^^^0+]^^į^^^^^^^^^^^^^^^^^^^^^^^^^ 46.4, 47.1, 50.7, 126.3, 126.4, 127.7, 128.3, 128.6 (2C), 139.7, 144.1; HRMS [M+H]+calculated for C25H30N 344.2378, found 344.2380.
[0303] 4-(4-Fluorophenyl)butyl][3-(piperidin-1-yl)propyl amine hydrochloride (compound 4): 4- (4-Fluorophenyl)butyl][3-(piperidin-1-yl)propyl]amine (compound 4) was prepared following our previously reported procedure
[0040] . Compound 4 (0.042 g, 0.143 mmol) was converted to hydrochloride salt by the treatment of its solution in ether (2 mL) with 2N. HCl (0.1 mL) to obtained the hydrochloride salt of compound 4 (0.034 g, 72.4 %) yield as a white solid; mp: 197°C (decomposed);1H-NMR (DMSO-d6^^^^^^0+]^^į^^^^^-1.39 (m, 1H), 1.61-1.66 (m, 5H), 1.74-1.85 (m, 4H), 2.13 (t, 2H, J = 7.1 Hz), 2.58 (t, 2H, J = 7.2 Hz), 2.80-2.87 (m, 4H), 2.96 (t, 2H, J = 5.5 Hz), 3.10-3.15 (m, 2H), 3.35-3.38 (m, 2H), 7.07-7.11 (m, 2H), 7.23-7.27 (m, 2H) , 9.28 (brS, 2H), 10.74 (brS, 1H);13C-NMR (DMSO-d6^^^^^^0+]^^į^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ 33.6, 44.0, 46.5, 51.9, 52.8, F-splitting 114.8, 115.0, F-splitting 130.0, 130.1, F-splitting 137.7, 137.8, F-splitting 159.4, 161.8; HRMS [M+H]+calculated for C18H30N2F 293.2393, found 293.2386.
[0304] Results and discussion
[0305] VGSC expression in neuroendocrine tumors (NETs): The expression of VGSCs has been reported to be associated with invasion and metastatic behavior of various cancers. A few examples of such channels are NaV1.5 in breast [40,52,53], colon
[0065] , and ovarian cancers
[0066] , NaV1.6 in cervical cancer
[0067] , and NaV1.7 in prostate [68,69], gastric
[0034] , lungAttorney Docket No.222120-2030
[0070] , and endometrial cancers
[0071] . However, over the past decade, VGSCs subtypes NaV1.5, NaV1.6, and NaV1.7 were the most reported isoforms that are shown to influence migration and invasion [32,41,72]. We initially examined the mRNA expression levels of VGSCs isoforms NaV1.5, NaV1.6, and NaV1.7 in NETs using pancreatic (BON), lung (H727), and thyroid (MZ-CRC-1 and TT) cells and observed that the aggressive MTC cells originated from lymph node metastasis, MZ-CRC-1 showed strong expression of the channels NaV1.5, NaV1.6, and NaV1.7. The highest expression was observed in NaV1.7 with 400-fold higher than the lowest expression of NaV1.5. Moreover, NaV1.7 was uniquely overexpressed in MTC cells, MZ-CRC-1 and TT compared to the other NET cell lines where MZ-CRC-1 showed 1800-fold higher than BON and 30-fold higher than H727; TT showed 700-fold higher than BON and 13- fold higher than H727. The highly metastatic MZ-CRC-1 cells showed 2-fold higher expression of NaV1.7 compared to the weakly-metastatic TT cells (FIG. 2A), suggesting that the expression level of NaV1.7 could be correlated to metastatic and aggressive behavior of MTC cell lines. Further, there was detectable expression of NaV1.5 among less aggressive NETs: MTC (TT), pancreatic cancer (BON) and lung cancer (H727) cells (FIG.2A). To confirm this observation further, we examined the mRNA expression of NaV1.7 in non-neuroendocrine thyroid cancers cells and normal thyroid cells and in MTC patient samples. We found that the expression of NaV1.7 is conserved in MZ-CRC-1 cells and in MTC patient tissues when com- pared to normal thyroid cells (Nthy-ori3-1 and Htori-3), normal thyroid counterparts (TH64 normal, TH79 normal and TH46 normal) and cells that represent both papillary and anaplastic thyroid carcinomas (FIGS.2B-2C).
[0306] The expression of NaV1.7 in MTC cells and patient samples were also confirmed by immunoblotting. To establish the basal expression of NaV1.7 in MTC, we used MZ-CRC-1 and TT human cells, p25OE MTC cells originating from transgenic mice, and MTC patient tissues: cancerous and adjacent non-cancerous thyroid tissues for direct comparison. We have determined that only MTC specimens, human MTC cell lines and mouse transgenic MTC cells were Nav1.7 positive, (Figs. 3A). The highly metastatic MZ-CRC-1 cells showed higher expression of NaV1.7 compared to the weakly-metastatic TT cells (FIG.3A). Additional MTC specimen analysis revealed that the expression of NaV1.7 was found in four out of six patient tissues examined, while it was not detected in normal thyroid specimen (FIG.3B). We have also detected the presence of somatostatin receptor, SSTR2, a known MTC biomarker in four patient tumor tissues, out of which three had the presence of NaV1.7 expression (FIG. 3C)
[0073] .
[0307] Overall, the results from quantitative PCR and immunoblotting showed that the expression of NaV1.7 was found in all MTC cells and in 66.7% (four out of six) patient tissues examined, while it was not detected in any normal thyroid specimens. The highly metastaticAttorney Docket No.222120-2030 MZ-CRC-1 cells showed higher expression of NaV1.7 compared to weakly-metastatic TT cells. These results are consistent with the recent reports of NaV1.7 mRNA expression in the prostate cancer cell lines in rat: MAT-LyLu and AT-2 and human: PC-3 and LNCaP. The cell lines with stronger metastatic potential (MAT-LyLu and PC-3) had 1000-fold higher in NaV1.7 expression than weakly metastatic cell lines (AT-2 and LNCaP)
[0068] . Moreover, the study of NaV1.7 expression in human prostate biopsies demonstrated that NaV1.7 expression was elevated in prostate cancer samples (~20 fold higher) compared to non-cancerous prostate samples
[0069] . Similarly, the expression of neonatal splice variant of NaV1.5 (nNaV1.5) in breast cancer cells was reported to be lower in weakly-metastatic breast cancer cell line, MCF-7 and higher in highly metastatic triple negative breast cell line, MDA-MB-231 [16,74,75].
[0308] High-throughput analysis of NaV1.7 expression in human MTC: We further confirmed the overexpression of NaV1.7 in a larger set of MTC patients. We have constructed tissue microarrays (TMAs) consisting of 45 human samples including normal thyroid and MTC tissues and performed immunohistochemical (IHC) analysis
[0076] . The IHC results from TMAs confirmed that NaV1.7 was significantly upregulated in MTC compared to normal thyroid tissue. This result is consistent with the results of our immunoblotting and RT-qPCR analysis. Positive and negative IHC controls were prepared by staining NaV1.7 antibody on MZ-CRC-1 cell pellet (highly expressed NaV1.7) and normal thyroid cell line, Nthy-ori3-1 cell pellet (no detectable expression of NaV1.7) (FIG. 4A). A total of 45 tissue samples including normal thyroid, MTC primary and MTC metastases, distributed on 4 TMA slides, were prepared and stained with NaV1.7 antibody (FIG. 4B). Positive and negative expression of NaV1.7 were verified with patient’s metastatic status by pathologists at UAB Department of Pathology. The quantification of TMAs was carried out through the automated processing of the MTC tissue cores with custom MATLAB code. Overall, 70.7% of MTC patients showed t 50% NaV1.7 expression (29 / 41), with the median of 60.37% and the mean of 54.56 r 1.93 % (FIG.4D). There was statistically significant difference in the percentage of NaV1.7 expression between normal thyroid samples (non-cancerous) and MTC patient samples (cancerous) (Fig 4E).
[0309] Quantitative RT-PCR, Immunoblotting and TMA results suggested that the level of NaV1.7 expression in MTC cell lines and patient tissues could be related to patient’s metastatic status and therefore, we have performed Point-biserial correlation on 133 human specimens from all TMAs to determine the relationship between the percent of NaV1.7 expression vs disease status; using normal thyroid, primary MTC and metastatic MTC tissues (FIG.12). We found that there was a positive correlation between percent NaV1.7 expression and patient disease status from normal to metastases which was statistically significant. However, once we investigated the expression level of NaV1.7 in primary MTC and metastatic MTC samples, the results showed no significant difference in these groups (FIG.4F).Attorney Docket No.222120-2030
[0310] Overall, our results show that the expression of NaV1.7 is substantially higher in MTC cells and MTC patient tissues compared to normal thyroid cells and normal thyroid tissues. Therefore, NaV1.7 in MTC could be used as a therapeutic target for drug discovery and / or as a biomarker for diagnostic purposes.
[0311] Identification of NaV1.7 inhibitors: Several compounds from our known NaV1.5 inhibitor library were used for the initial screening aimed at identifying NaV1.7 inhibitors
[0040] . This screen resulted in the identification of three potential lead compounds, SV188, compound 4 and WJB-133 (structures illustrated below) for NaV1.7 inhibition in MTC.
[0312] This screening was carried out using the highly metastatic MTC cell line MZ-CRC-1, which has the highest basal expression of NaV1.7. Cyto-toxicity of the three compounds against MZ-CRC-1 were determined first using an MTT assay. The results revealed that MZ- CRC-1 is more sensitive to SV188 and WJB-133 compared to compound 4. The IC50of SV188 and WJB-133 are 9.00 ± 1.92 μM and 8.04 ± 0.47 μM respectively, whereas compound 4’s IC50was 2-fold higher (FIG. 5A). In recent reports, the inhibition of NaV1.7 in gastric cancer using TTX significantly reduced the expression of NHE1 at mRNA and protein level
[0034] . In addition, the inhibition of NaV1.6 and NaV1.7 in prostate cancer cells with small molecules, S0154 and S0161, promoting the degradation of NaVproteins in prostate cancer cells and downregulating both NaV1.6 and NaV1.7 protein expression levels with no significant effect on cell apoptosis at the same concentration
[0035] . To identify NaV1.7 inhibitors using a similar approach, we have evaluated the three compounds at 5 μM concentration after 24 h treatment for their effects on NaV1.7 and related genes in MZ-CRC-1 cell line. Based on the preliminary screening using RT-qPCR against two genes: SCN9A (NaV1.7) and SLC9A1 (NHE1). Compound SV188 was selected for further evaluation as it substantially lowered the expression of SLC9A1 (NHE1) and SCN9A (NaV1.7) compared to corresponding controls (FIG.5B).
[0313] Next, we tested SV188 against NaV1.5, NaV1.6, and NaV1.7 channels that have been reported to be involved in cancer cells migration and invasion [41,72]. The results showed that the treatment of SV188 at 5 μM for 48 h significantly decreased mRNA expression of NaV1.7 and increased mRNA expression of NaV1.5 with no significant effect on mRNA expression of NaV1.6 (FIGS.6A-6C). Although the treatment of SV188 affected NaV1.5 expression, when comparing the expression of all three channels, the expression of NaV1.7 was 400-fold higherAttorney Docket No.222120-2030 than NaV1.5 and 25-fold higher than NaV1.6 (Fig 2A); the effect on NaV1.7 is more likely to outweigh the effect on NaV1.5.
[0314] Synthesis of compound 4, SV188 and WJB-133: Compound 4 was synthesized using a previously reported procedure from our lab
[0040] . The synthesis of the compound, SV188 was carried out in three steps VWDUWLQJ^IURP^Ȗ-phenyl-Ȗ-butyrolactone (1) as outlined in Scheme1. Lactone 1 was first converted to 4,4-diphenylbutyric acid (2) by treatment with AlCl3in anhydrous benzene in 94% yield. The carboxylic acid 2 was converted to the amide 6 using the EDC mediated amide coupling reaction with 3-piperidylpropanamine (5) in 83% yield. The amine 5 used in the amide coupling reaction was obtained in 89% yield by the reduction of 3- piperidylpropionitrile (3) using Raney Ni in MeOH. Reduction of the amide 6 with LiAlH4in THF followed by the conversion of the product amine to its hydrochloride salt by treatment with HCl afforded SV188 as a hydrochloride salt in 61% yield for two steps.Scheme 1. Synthesis of compound SV188
[0315] Compound WJB-133 was synthesized in two steps as shown in Scheme 2. The carboxylic acid 2 was converted to the amide 8 using the EDC mediated amide coupling reaction with 3-phenylpropanamine (7) in 73% yield. Reduction of the amide 8 with LiAlH4in THF followed by the conversion of the product amine to its hydrochloride salt by treatment with HCl afforded WJB-133 as a hydrochloride salt in 47% yield for two steps.Attorney Docket No.222120-2030Scheme 2. Synthesis of compound WJB-133
[0316] Dose-dependent inhibition of NaV1.7 currents (INa) by SV188: To test the ability of SV188 to inhibit the sodium currents (INa) carried by the NaV1.7 channel, we performed whole- cell patch-clamp experiments using HEK-293 cells transiently expressing NaV1.7 and measured the dose-dependent inhibition of INa peak evoked by depolarizations to -10 mV from a holding potential (HP) of -120 mV applied every 10 seconds. We first tested the effect of 0.06% DMSO alone on the INaamplitude in all patch-clamped cells and found that DMSO diminished the current magnitude by 3% on average. Then, the cells were superfused with increasing concentrations of SV188 and INapeak currents were measured (FIG. 7A). Stationary blockade of INawas reached around 4-5 min after superfusing the cell with each concentration of the compound (FIG. 7B). Inhibition of INaby SV188 was partially reversed (74%) after washing with control saline for a period of 10-15 min. The fraction of INaunblocked by SV188 in each cell was averaged and plotted as a function of the compound concentration and the data was fitted with the Hill equation (FIG. 7C). To determine whether the SV188 blockade of INawas more effective at more depolarized holding potentials, we investigated the effect at 3 μM and 10 μM of SV188 on partially inactivated channels by using a HP of -80 mV. The fraction of sodium current blocked at -10 mV under these experimental conditions was practically the same as with the HP of -120 mV (pink solid circles on FIG.7C), and both data points overlap with the fit of the data obtained with the HP of -120 mV. These results suggest that SV188 inhibits the INawith the same potency in the closed state (HP of -120 mV) and the inactivation state (HP of -80 mV) of the NaV1.7 channels [77,78].
[0317] Effects of SV188 on NaV1.7 channels gating: Current-voltage relationships (I-V curves) for NaV1.7 channels were measured using 16-ms step depolarizations to varying potentials from a HP of -60 to +100 mV in 10 mV steps. Representative families of INarecordings obtained from the HEK-293 cell expressing NaV1.7 channels in the absence, during and after exposure to 5 μM of SV188 are shown in FIG. 8A. Average I-V curves are shown in FIG. 8B. TheAttorney Docket No.222120-2030 maximum peak current was observed at -10 mV under control recording conditions, and the blockade by SV188 shifted this value to -20 mV. This effect is also observed in the recordings of FIG. 8A. To further analyze the effect of SV188 on the voltage-dependent activation of NaV1.7 channels, we calculated channel conductance with the equation: G(V) = I / (V - Vrev), where I, V, and Vrevrepresent sodium current elicited as shown in FIG.8A, test potential, and reversal potential, respectively. Conductance values were normalized and plotted as a function of test potential for NaV1.7 channels in the absence and the presence of 5 μM of SV188, and each data set was fitted to a Boltzmann function (FIG. 8C, smooth lines). The obtained parameters indicate that SV188 shifted the voltage-dependence of NaV1.7 channels activation to more negative potentials by 8.5 mV. In addition, although SV188 effectively blocked INaover a wide range of testing potentials, it was clearly more potent at more positive voltages, being more evident at Vmvalues beyond the Vrev(Figs.8A-B). For example, at -10 mV, 5 μM SV188 inhibited INaby an average of 56%. By comparison, at +80 mV, INawas inhibited by 92% (FIG.13). These results suggest that the inhibition of NaV1.7 sodium current by SV188 is voltage-dependent, with stronger block at membrane potentials where INashould be outward.
[0318] We next sought to determine whether SV188 alters the voltage-dependence of the NaV1.7 channels inactivation. For this purpose, we used a classical two-pulse voltage clamp protocol. The first step was a 200 milliseconds prepulse to voltages between -120 and -50 mV intended to promote channels into the inactivated state. The second voltage step was a brief test pulse to -10 mV, in which the relative amplitude is proportional to the fraction of NaVchannels that were not inactivated by the prepulse. Representative INaobtained from NaV1.7 channel recorded in the absence and the presence of 5 μM SV188 are illustrated in FIG.8D. It is shown that in the absence and presence of SV188 the current amplitude at -10 mV after a prepulse to -90 mV is roughly the same, i.e., around 63% of the maximal current in each condition. This observation was further analyzed with the inactivation curves shown in FIG. 8E. Normalized data of INarecorded during test pulses to -10 mV was plotted as a function of the prepulse potential. Data points were fitted well by single Boltzmann functions, assuming that channels fully inactivated at depolarized voltages. In this case, the interaction of SV188 with NaV1.7 channels led to a non-significant shift of 7 mV in the voltage dependence of inactivation toward more negative potentials, suggesting that the inactivated state of the channel is not affected by SV188 binding or vice versa. This result is also consistent with the observation that the percent blocked of INais not different when using HP of -120 or -80 mV (FIG.7C). Interestingly, in a previous work of our group, several secondary amine compounds which have similar chemical structure to SV188, induced a significant state-dependent effect on the NaV1.5 sodium currents of MDA-MB-231 breast cancer cell line
[0040] ; however, theAttorney Docket No.222120-2030 potential use-dependence effect was not explored for such compounds. It is likely that the lack of state-dependent effect of SV188 in NaV1.7 channels could be due to a discrete difference in the sequence / structure when compared with NaV1.5 channels.
[0319] Use-dependent blockade of NaV1.7 channels by SV188: VGSC inhibitors such as local anesthetics, antiarrhythmics and opiate antihyperalgesics are known to display state- dependent and use-dependent channel blockade [47,77,79-81]. This characteristic constitutes a functional selectivity for inhibitors to preferentially bind to channels that are activated frequently, and hence attracting additional molecules to bind to such states. To further investigate the inhibition of resting state of NaV1.7 channels by SV188, currents were first recorded at 10-s intervals in control solution before superfusing the cell with 5 μM of SV188 for 5 min without applying depolarizing steps (FIG.9A). When voltage steps were resumed, INawas initially inhibited by 20% (FIGS. 9A-9C, p1). However, the proportion of inhibition increased with subsequent test pulses, reaching a maximum of 77% at 4.5 min (FIGS.9A-9C, pn). Thus, the inhibition of NaV1.7 channel currents by SV188 requires the opening of the channel for the binding of the compound to its site of action. Although it has been shown that fenestrations of VGSCs could be an alternative gateway to the central cavity of some resting- state blocker
[0082] , this could not be the preferred shortcut for SV188 on NaV1.7 channel as only a very small fraction of channels were blocked at -120 mV, suggesting that the main access route for SV188 to its binding site should be the intracellular gate of NaV1.7 channel
[0083] . On the contrary, tetrodotoxin (TTX), a well-known open channel blocker of VGSCs [42,84,85], did not need the channel to be opened to induce the maximum blockade the INa, as the first depolarizing pulse after resuming voltage steps showed practically the same blocked fraction of INaas that one reached at the stationary blockade (FIGS.9B-9C, p1, pn). The observation that the compound needed periodic depolarization to block the INasuggests that channels states visited during depolarizations unmasks higher affinity conformations compared with the closed state.
[0320] To further test the use of dependence effect of SV188 on NaV1.7 channels, cells were held at -120 mV and sodium currents were elicited by a train of forty 16-ms pulses to -10 mV at 40 Hz. Peak current amplitude at each pulse was normalized to that of the first pulse. As shown in FIG. 9D, SV188 displayed preferential inhibition on test pulse 40 than pulse 1, showing an 81% current decrease (blue points); whereas in the absence of the blocker the level of current decrease is only by 30% from pulse 1 to 40 (black points); which implies that blockade of NaV1.7 channels by SV188 is increased by around 50% when the channel is activated at 40 Hz in comparison when the channels are activated every 10 s (0.1 Hz; Episode 1, blue point FIG.9D).Attorney Docket No.222120-2030
[0321] The results of the electrophysiological studies presented here suggest that SV188 is a dose-dependent and voltage-dependent inhibitor. The INablockage was greater at higher concentrations of SV188 and the inhibition of NaV1.7 channel is stronger at more depolarized membrane potentials. These studies also suggest that SV188 functions as a use-dependent inhibitor of NaV1.7 because the highest percent inhibition of INaby SV188 was observed when the channels are activated at higher frequencies (FIG.9D).
[0322] Effect on MTC cell viability by SV188: The results of electrophysiological study suggested that SV188 is a use-dependent blocker of NaV1.7 at low micromolar concentrations and the observed effects are reversible, highlighting the potential for SV188 to inhibit the migration and invasion activities of MTC cells. A highly aggressive MTC cell line originated from lymph node metastasis, MZ-CRC-1 and a less aggressive MTC cell line TT, derived from primary tumor were used for the cell migration and invasion inhibition studies. These two cell lines are the only available human MTC derived cells. These studies needed to be conducted at lower doses than the cytotoxic concentrations of SV188 to ensure that the observed effects on cell migration and invasion are independent of the effects on the cell viability. Therefore, the inhibitory effects of SV188 on MTC cell lines (IC50values), MZ-CRC-1 and TT were determined using the reported MTT assay
[0086] . MTC Cells were treated in quadruplicate for each concentration in each individual experiment. The results from each experiment were plotted in normalized curve fit vs dose response (variable slope) to obtain IC50value. The experiments were repeated 3 times and average IC50value was calculated in mean ± SEM. SV188 inhibited the cell viability of MZ-CRC-1 cells with an IC50value of 8.47 PM and TT cells with an IC50value of 9.32 PM (FIGS.10A-10B).
[0323] Effect on cell migration by SV188: Migration and invasion inhibitory activities of SV188 were evaluated using MZ-CRC-1 and TT cells in a reported Boyden Chamber assay
[0087] at two doses (3 μM and 6 μM) lower than its cell viability IC50value. In the Boyden Chamber assay, the ability of cancer cells to invade is measured based on the number of cells that can invade the matrigel and migrate through the pores across the membrane. MZ-CRC-1 and TT cells were treated with 3 PM and 6 PM of SV188 and compared to control 0.06 % DMSO for 48 hours and the number of invade cells were counted manually. Our results revealed that at 3 PM of SV188 dose significantly reduced the MTC cells migration by 27 % and 57 % for MZ- CRC-1 and TT cells, respectively. The percent inhibition on cell migration in MZ-CRC-1 increased to 42 % when treated with 6 PM of SV188. However, the degree of migration inhibition of TT at 6 PM was relatively similar as at 3 PM, 53 % vs 57 % (Figs.10B-C).
[0324] Effect on cell invasion by SV188: SV188 significantly inhibited MZ-CRC-1 cell invasion by 35 % and 52 % after treatment with 3 PM and 6 PM. In contrast, SV188 showed no effectAttorney Docket No.222120-2030 on the invasion of TT cells with lower basal expression of NaV1.7 and derived from primary tumor (FIGS.10E-10F). The lack of invasion inhibition by SV188 in TT cells may be resulting from a weakly metastatic potential and low expression of NaV1.7. Similar results were found in a previous report of comparison invasion inhibition of weakly metastatic breast cancer cell line MCF-7 and highly metastatic breast cancer cell line MDA-MB-231, where MCF-7 cell line showed no response to Nav1.5 inhibitor (phenytoin) treatment in contrast to MDA-MB-231, where treatment substantially reduced cancer cell invasion
[0075] . MZ-CRC-1 cells which have significantly higher basal expression of both NaV1.5 and NaV1.7 and originated from lymph node metastasis showed a reduction in both migration and invasion. In contrast, SV188 treatment of TT cells, which were derived from primary tumor and expressing lower basal level of NaV1.5 and NaV1.7, inhibited only migration. Our results suggest that the MTC cell invasion inhibition by SV188 is directly corelated with the expression level of sodium channels in these cells.
[0325] Cell cycle analysis in response to SV188 treatment: We have performed flow cytometry analysis to investigate the effects of SV188 on MZ-CRC-1 cell cycle. This study revealed that SV188 induced the cell cycle arrest at G0 / G1 phase and decreased cell population at S and G2 phases (FIG.11). Voltage-gated ion channels (VGICs) play an important role in cell cycle progression through the differentiation of membrane potential (Vm). Cells at resting state have more negative Vmcompared to the cells during proliferation. Additionally, Vmbecomes less negative or depolarized due to the transition from G0 / G1 to S phase, and VGSCs and / or Ca2+channels are opened what results in positive (+) ions influx inside the cells. Then, VGSCs and / or Ca2+channels are close during the S-phase causing Vmrepolarization leading back to an initial phase of cell cycle, G0 / G1 [88-91]. Therefore, the inhibition of VGSCs could potentially affect cell cycle arrest and inhibit cell proliferation. There are a few studies that have explored the effect of VGSC inhibitors on cell cycle such as the report from Li et al. in 2018 indicating that 3 out of 6 VGSC drugs, levobupivacaine (25 μM), ropivacaine (35 μM), and chloroprocaine (150 μM) inhibited the cell migration in wound healing assay after 24 hours in human breast cancer MDA-MB-231 cells which expressed NaV1.5
[0092] . From the cell cycle analysis, levobupivacaine and chloroprocaine slightly activated cell cycle arrest at S phase while ropivacaine remarkably induced cell cycle arrest at G2 / M phase
[0092] . Interestingly, lidocaine, a VGSC inhibitor which has been reported to decrease cell proliferation and reduce cancer cells migration and invasion [93-95] showed mild effect on cell cycle arrest at S phase with no significant influence on migration of MDA-MB-231 cells at its antiarrhythmic plasma concentration (10 μM) after 24 h treatment
[0092] . Additionally, the treatment of lidocaine at 100 μM was reported to inhibit cell growth at 72 h and increase apoptosis at 48 h, however, it did not show a significant effect on cell cycle arrest in hepatocellular carcinoma HuH7 andAttorney Docket No.222120-2030 HepaRG cells (both cell lines has no report on VGSCs expression)
[0096] . The recent study on the treatment of lidocaine in cervical cancer HeLa cells which expressed NaV1.6
[0067] , found that this drug significantly inhibited the cell growth at 0.3 mM by reducing a proliferating protein, Ki-67 (MKI67) and the cell cycle analysis indicated that lidocaine significantly induced arrest at G0 / G1 phase and decreased cells population at G / M and S phase in a dose- dependent manner
[0093] . In addition, the knockdown of NaV1.5 in oral squamous cell carcinoma (OSCC) HSC-3 cells caused cell cycle arrest at G1 phase and a drastic reduction of cell migration and invasion
[0097] . The cell progression in knockdown NaV1.5 HSC-3 was reported to be regulated by Wnt / ȕ-catenin signaling pathway which also had influence on cancer cell migration and invasiveness [98-100].
[0326] In the current study, we have seen the effect of SV188 on cell cycle arrest at G0 / G1 which could lead to the inhibition of cell proliferation by inducing cell apoptosis, as observed in the previous reports of induction of apoptosis associated with Nav1.5 and Nav1.6 expression with siRNAs in astrocytoma
[0101] , expression of neonatal Nav1.5 in human brain astrocytoma and its effect on proliferation, invasion and apoptosis of astrocytoma cells
[0102] and follicular thyroid carcinoma cells
[0054] . We have also noticed a significant decrease in mRNA expression of NaV1.7 and NHE-1, and the reduction of cell migration and invasion after the treatments with SV188. The mechanism of how inhibition of sodium channels inhibits cancer metastases have not been fully elucidated. However, a plausible mechanism pathway for this effect could involve VGSCs colocalized proteins as NCX and NHE-1 as shown in schematic FIG.1C [33,72,103]. One of the important factors contributing to the metastasis is the ability of highly aggressive cancer cells to cause proteolytic degradation of extracellular matrix (ECM), break away from the tumor site, enter the blood stream and travel to the distant sites to initiate metastasis. Recent literature shows that nNav1.5 activity in MDA-MB-231 cells enhances ECM degradation
[0104] by activating cysteine cathepsins B and S through the acidification of the pericellular microenvironment [38,105]. The Na+ / H+ exchanger (NHE1) is the central regulator of intracellular and perimembrane pH, which is also overexpressed and overactivated in cancer cells [106,107]. This acidity activates cathepsins and proteolytic degradation of ECM
[0108] . Thus, the persistent activity of nNav1.5 at a membrane potential of breast cancer cells (about -36 mV) is responsible for increased ECM proteolysis and cancer cell invasion [38,109]. Moreover, the changes of sodium level across cell membrane produced by Nav1.7 inhibition may activate the function of NCX and NHE-1 proteins. Several studies have disclosed that the reduction of cell migration and invasion was caused by the decrease of calcium dependent proteins that are essential for epithelial-mesenchymal transition (EMT) and the reduction of H+efflux through NHE-1 [56,110-112]. Therefore, besides the downstream effect on NHE-1, in the future studies it would also be interesting to investigateAttorney Docket No.222120-2030 the changes of calcium dependent proteins (N-cadherin, vimentin and snai1) and the changes of cysteine cathepsins activity between SV188 treated and untreated MTC cells.
[0327] Conclusions
[0328] In conclusion, we report for the first time, the overexpression of NaV1.7 (SCN9A gene) in aggressive and metastatic MTC as a potential target for drug discovery. Our results from quantitative RT-PCR, western blotting, and TMA immunostaining of 45 patient specimens, including both normal thyroid and MTC samples confirmed that VGSC subtype NaV1.7 was specifically overexpressed in MTC while not expressed in normal thyroid cells and tissues. Highly metastatic cell line, MZ-CRC-1, originated from lymph node metastasis showed a remarkably high expression of NaV1.7 compared to the low-level expression in TT cells derived from primary tumor suggesting a role for NaV1.7 in MTC metastasis. We have demonstrated the druggability of NaV1.7 in MTC by identifying a novel inhibitor (SV188) of this channel and investigated its mode of binding and the ability to block NaV1.7 sodium current. Patch-clamp studies of SV188 in NaV1.7 channels expressed in HEK-293 cells showed that SV188 inhibited NaV1.7 current with an IC50value of 3.6 μM and Hill coefficient of 1.2. The results of our electrophysiological studies suggest that SV188 blocks NaV1.7 channel in a voltage-and use- dependent manner, without significant effects on the steady-state inactivation of the channel. The inhibition of INawith SV188 led to significant shift in the NaV1.7 channel conductance activation to more hyperpolarized potentials (around 8 mV). The mechanism of blocking of NaV1.7 channels by SV188 does not involve an effect of the steady-state inactivation, nor does the percentage block of INashow differences when using different HPs. In addition, our results demonstrate that higher blockade of outward INaagree with the use-dependence effect of SV188 in NaV1.7 channels as Na+ions moving out of the cell find the pore channel pathway blocked by the presence of SV188, which is favored by the higher frequencies of channel openings. Altogether, the electrophysiological data suggests that SV188 might be entering the central cavity of the channel through the intracellular gate and binding somewhere in the permeation pathway of the channel. SV188 inhibited the viability of two MTC cell lines, MZ- CRC-1 and TT with IC50values of 8.47 μM and 9.32 μM, respectively. Supporting our hypothesis, SV188 significantly inhibited cells invasion of MZ-CRC-1 cells by 35% and 52% after treatment with 3 PM and 6 PM, respectively. In contrast, SV188 showed no effect on the invasion of TT cells derived from primary tumor, which has lower basal expression of NaV1.7. SV188 significantly inhibited the cell migration of MZ-CRC-1 and TT cells by 27 % and 57 %, respectively at 3 mM concentration. The dose at which SV188 displayed inhibition of invasion and migration of MTC cells are below their cell viability IC50values, indicating that these effects are independent from the drug cytotoxicity. In addition, the cell cycle analysis on MZ-CRC-1 indicated that the treatment of SV188 induced arrest at G0 / G1 phase and decreased cellAttorney Docket No.222120-2030 population at S and G2 phases what led to the inhibition of MZ-CRC-1 cell proliferation possible by promoting cell apoptosis. Overall, our data show that NaV1.7 uniquely overexpressed in MTC and suggest that NaV1.7 could serve as a target to develop the small molecule drugs and / or as a biomarker for diagnostic purposes. It is reported that the individuals carrying a mutation in SCN9A do not express Nav1.7 in their cells have congenital insensitivity to pain (CIP), a rare autosomal recessive disorder in which affected individuals are unable to perceive pain from birth to death [113,114]. Therefore, an additional benefit of using Nav1.7 inhibitors in cancer therapy would be their ability to reduce cancer related pain. Studies to examine SV188 and other Nav1.7 inhibitors as potential pain therapeutics are currently in progress [115,116].
[0329] References for Example 1 1. Greenblatt, D.Y.; Elson, D.; Mack, E.; Chen, H. Initial lymph node dissection increases cure rates in patients with medullary thyroid cancer. Asian J. Surg.2007, 30, 108-112, doi:10.1016 / s1015-9584(09)60141-x. 2. Sippel, R.S.; Kunnimalaiyaan, M.; Chen, H. Current management of medullary thyroid cancer. Oncologist 2008, 13, 539-547, doi:10.1634 / theoncologist.2007-0239. 3. Chen, H.; Sippel, R.S.; O'Dorisio, M.S.; Vinik, A.I.; Lloyd, R.V.; Pacak, K. The North American Neuroendocrine Tumor Society consensus guideline for the diagnosis and management of neuroendocrine tumors: pheochromocytoma, paraganglioma, and medullary thyroid cancer. Pancreas 2010, 39, 775-783, doi:10.1097 / MPA.0b013e3181ebb4f0. 4. Okafor, C.; Hogan, J.; Raygada, M.; Thomas, B.J.; Akshintala, S.; Glod, J.W.; Del Rivero, J. Update on Targeted Therapy in Medullary Thyroid Cancer. Front. Endocrinol. (Lausanne) 2021, 12, 708949, doi:10.3389 / fendo.2021.708949. 5. Roy, M.; Chen, H.; Sippel, R.S. Current understanding and management of medullary thyroid cancer. Oncologist 2013, 18, 1093-1100, doi:10.1634 / theoncologist.2013-0053. 6. Schlumberger, M.; Carlomagno, F.; Baudin, E.; Bidart, J.M.; Santoro, M. New therapeutic approaches to treat medullary thyroid carcinoma. Nat. Clin. Pract. Endocrinol. Metab.2008, 4, 22-32, doi:10.1038 / ncpendmet0717. 7. Sandilos, G.; Lou, J.; Butchy, M.V.; Gaughan, J.P.; Reid, L.; Spitz, F.R.; Beninato, T.; Moore, M.D. Features of mixed medullary thyroid tumors: An NCDB analysis of clinicopathologic characteristics and survival. Am. J. Surg.2023, ‘in press’, doi:10.1016 / j.amjsurg.2023.02.006.Attorney Docket No.222120-2030 Shepet, K.; Alhefdhi, A.; Lai, N.; Mazeh, H.; Sippel, R.; Chen, H. Hereditary medullary thyroid cancer: age-appropriate thyroidectomy improves disease-free survival. Ann. Surg. Oncol.2013, 20, 1451-1455, doi:10.1245 / s10434-012-2757-9. Pajak, C.; Cadili, L.; Nabata, K.; Wiseman, S.M. (68)Ga-DOTATATE-PET shows promise for diagnosis of recurrent or persistent medullary thyroid cancer: A systematic review. Am. J. Surg.2022, 224, 670-675, doi:10.1016 / j.amjsurg.2022.03.046. Cabanillas, M.E.; Habra, M.A. Lenvatinib: Role in thyroid cancer and other solid tumors. Cancer Treat. Rev.2016, 42, 47-55, doi:10.1016 / j.ctrv.2015.11.003. Priya, S.R.; Dravid, C.S.; Digumarti, R.; Dandekar, M. Targeted Therapy for Medullary Thyroid Cancer: A Review. Front. Oncol.2017, 7, 238-238, doi:10.3389 / fonc.2017.00238. Li, L.; Cheng, L.; Sa, R.; Qiu, X.; Chen, L. Real-world insights into the efficacy and safety of tyrosine kinase inhibitors against thyroid cancers. Crit. Rev. Oncol. Hematol. 2022, 172, 103624, doi:10.1016 / j.critrevonc.2022.103624. Efstathiadou, Z.A.; Tsentidis, C.; Bargiota, A.; Daraki, V.; Kotsa, K.; Ntali, G.; Papanastasiou, L.; Tigas, S.; Toulis, K.; Pazaitou-Panayiotou, K.; et al. Benefits and Limitations of TKIs in Patients with Medullary Thyroid Cancer: A Systematic Review and Meta-Analysis. Eur. Thyroid J.2021, 10, 125-139, doi:10.1159 / 000509457. Roger, S.; Gillet, L.; Le Guennec, J.-Y.; Besson, P. Voltage-gated sodium channels and cancer: is excitability their primary role? Front. Pharmacol.2015, 6, 152, doi:10.3389 / fphar.2015.00152. Roger, S.; Potier, M.; Vandier, C.; Besson, P.; Le Guennec, J.Y. Voltage-gated sodium channels: new targets in cancer therapy? Curr. Pharm. Des.2006, 12, 3681- 3695, doi:10.2174 / 138161206778522047. Brackenbury, W.J. Voltage-gated sodium channels and metastatic disease. Channels (Austin) 2012, 6, 352-361, doi:10.4161 / chan.21910. Lastraioli, E.; Iorio, J.; Arcangeli, A. Ion channel expression as promising cancer biomarker. Biochim. Biophys. Acta.2015, 1848, 2685-2702, doi:10.1016 / j.bbamem.2014.12.016. Hodgkin, A.L.; Huxley, A.F. A quantitative description of membrane current and its application to conduction and excitation in nerve. J. Physiol.1952, 117, 500-544, doi:10.1113 / jphysiol.1952.sp004764. Catterall, W.A. Voltage-gated sodium channels at 60: structure, function and pathophysiology. J. Physiol.2012, 590, 2577-2589, doi:10.1113 / jphysiol.2011.224204.Attorney Docket No.222120-2030 de Lera Ruiz, M.; Kraus, R.L. Voltage-Gated Sodium Channels: Structure, Function, Pharmacology, and Clinical Indications. J. Med. Chem.2015, 58, 7093-7118, doi:10.1021 / jm501981g. Quicke, P.; Sun, Y.; Arias-Garcia, M.; Beykou, M.; Acker, C.D.; Djamgoz, M.B.A.; Bakal, C.; Foust, A.J. Voltage imaging reveals the dynamic electrical signatures of human breast cancer cells. Commun. Biol.2022, 5, 1178, doi:10.1038 / s42003-022- 04077-2. Ribeiro, M.; Elghajiji, A.; Fraser, S.P.; Burke, Z.D.; Tosh, D.; Djamgoz, M.B.A.; Rocha, P.R.F. Human Breast Cancer Cells Demonstrate Electrical Excitability. Front. Neurosci.2020, 14, 404, doi:10.3389 / fnins.2020.00404. Miura, R.M. Analysis of excitable cell models. J. Comput. Appl. Math.2002, 144, 29- 47, doi:10.1016 / S0377-0427(01)00550-7. Sundelacruz, S.; Levin, M.; Kaplan, D.L. Role of Membrane Potential in the Regulation of Cell Proliferation and Differentiation. Stem Cell Rev. Rep.2009, 5, 231- 246, doi:10.1007 / s12015-009-9080-2. Brackenbury, W.J.; Chioni, A.-M.; Diss, J.K.J.; Djamgoz, M.B.A. The neonatal splice variant of Nav1.5 potentiates in vitro invasive behaviour of MDA-MB-231 human breast cancer cells. Breast Cancer Res. Treat.2007, 101, 149-160, doi:10.1007 / s10549-006-9281-1. Yang, M.; Brackenbury, W.J. Membrane potential and cancer progression. Front. Physiol.2013, 4, 185-185, doi:10.3389 / fphys.2013.00185. Nuccitelli, R. Endogenous electric fields in embryos during development, regeneration and wound healing. Radiat. Prot. Dosimetry 2003, 106, 375-383, doi:10.1093 / oxfordjournals.rpd.a006375. Tokuoka, S.; Morioka, H. The membrane potential of the human cancer and related cells. I. Gann.1957, 48, 353-354. Djamgoz, M.B.A. Hyponatremia and Cancer Progression: Possible Association with Sodium-Transporting Proteins. Bioelectricity 2020, 2, 14-20, doi:10.1089 / bioe.2019.0035. Yu, H. Depolarization or hyperpolarization: Emerging role of altered bioelectricity in breast cancer metastasis. EBioMedicine 2022, 76, 103853, doi:10.1016 / j.ebiom.2022.103853. James, A.D.; Leslie, T.K.; Kaggie, J.D.; Wiggins, L.; Patten, L.; Murphy O’Duinn, J.; Langer, S.; Labarthe, M.-C.; Riemer, F.; Baxter, G.; et al. Sodium accumulation in breast cancer predicts malignancy and treatment response. Br. J. Cancer 2022, 127, 337-349, doi:10.1038 / s41416-022-01802-w.Attorney Docket No.222120-2030 Lopez-Charcas, O.; Pukkanasut, P.; Velu, S.E.; Brackenbury, W.J.; Hales, T.G.; Besson, P.; Gomora, J.C.; Roger, S. Pharmacological and nutritional targeting of voltage-gated sodium channels in the treatment of cancers. iScience 2021, 24, 102270, doi:10.1016 / j.isci.2021.102270. Angus, M.; Ruben, P. Voltage gated sodium channels in cancer and their potential mechanisms of action. Channels 2019, 13, 400-409, doi:10.1080 / 19336950.2019.1666455. Xia, J.; Huang, N.; Huang, H.; Sun, L.; Dong, S.; Su, J.; Zhang, J.; Wang, L.; Lin, L.; Shi, M.; et al. Voltage-gated sodium channel Nav 1.7 promotes gastric cancer progression through MACC1-mediated upregulation of NHE1. Int. J. Cancer 2016, 139, 2553-2569, doi:10.1002 / ijc.30381. Hossain, M.M.; Sonsalla, P.K.; Richardson, J.R. Coordinated role of voltage-gated sodium channels and the Na+ / H+ exchanger in sustaining microglial activation during inflammation. Toxicol. Appl. Pharmacol.2013, 273, 355-364, doi:10.1016 / j.taap.2013.09.011. Besson, P.; Driffort, V.; Bon, É.; Gradek, F.; Chevalier, S.; Roger, S. How do voltage- gated sodium channels enhance migration and invasiveness in cancer cells? Biochim. Biophys. Acta 2015, 1848, 2493-2501, doi:10.1016 / j.bbamem.2015.04.013. Egeblad, M.; Werb, Z. New functions for the matrix metalloproteinases in cancer progression. Nat. Rev. Cancer 2002, 2, 161-174, doi:10.1038 / nrc745. Gillet, L.; Roger, S.; Besson, P.; Lecaille, F.; Gore, J.; Bougnoux, P.; Lalmanach, G.; Le Guennec, J.-Y. Voltage-gated Sodium Channel Activity Promotes Cysteine Cathepsin-dependent Invasiveness and Colony Growth of Human Cancer Cells. J. Biol. Chem.2009, 284, 8680-8691, doi:10.1074 / jbc.M806891200. Pal, R.; Kumar, B.; Akhtar, M.J.; Chawla, P.A. Voltage gated sodium channel inhibitors as anticonvulsant drugs: A systematic review on recent developments and structure activity relationship studies. Bioorg. Chem.2021, 115, 105230, doi:10.1016 / j.bioorg.2021.105230. Dutta, S.; Lopez Charcas, O.; Tanner, S.; Gradek, F.; Driffort, V.; Roger, S.; Selander, K.; Velu, S.E.; Brouillette, W. Discovery and evaluation of nNav1.5 sodium channel blockers with potent cell invasion inhibitory activity in breast cancer cells. Bioorg. Med. Chem.2018, 26, 2428-2436, doi:10.1016 / j.bmc.2018.04.003. Djamgoz, M.B.A.; Fraser, S.P.; Brackenbury, W.J. In Vivo Evidence for Voltage- Gated Sodium Channel Expression in Carcinomas and Potentiation of Metastasis. Cancers (Basel) 2019, 11, 1675.Attorney Docket No.222120-2030 Shen, H.; Liu, D.; Wu, K.; Lei, J.; Yan, N. Structures of human Nav1.7 channel in complex with auxiliary subunits and animal toxins. Science 2019, 363, 1303-1308, doi:10.1126 / science.aaw2493. Lenkey, N.; Karoly, R.; Lukacs, P.; Vizi, E.S.; Sunesen, M.; Fodor, L.; Mike, A. Classification of Drugs Based on Properties of Sodium Channel Inhibition: A Comparative Automated Patch-Clamp Study. PLOS One 2010, 5, e15568, doi:10.1371 / journal.pone.0015568. Ragsdale, D.S.; McPhee, J.C.; Scheuer, T.; Catterall, W.A. Molecular determinants of state-dependent block of Na+ channels by local anesthetics. Science 1994, 265, 1724-1728, doi:10.1126 / science.8085162. Benjamin, E.R.; Pruthi, F.; Olanrewaju, S.; Ilyin, V.I.; Crumley, G.; Kutlina, E.; Valenzano, K.J.; Woodward, R.M. State-dependent compound inhibition of Nav1.2 sodium channels using the FLIPR Vm dye: on-target and off-target effects of diverse pharmacological agents. J. Biomol. Screen 2006, 11, 29-39, doi:10.1177 / 1087057105280918. Catterall, W.A. Voltage-Gated Sodium Channels: Structure, Function, and Pathophysiology. In Encyclopedia of Biological Chemistry (2nd Ed.), Lennarz, W.J., Lane, M.D., Eds.; Academic Press: Waltham, 2013; pp.564-569. Chevrier, P.; Vijayaragavan, K.; Chahine, M. Differential modulation of Nav1.7 and Nav1.8 peripheral nerve sodium channels by the local anesthetic lidocaine. Br. J. Pharmacol.2004, 142, 576-584, doi:10.1038 / sj.bjp.0705796. Ragsdale, D.S.; McPhee, J.C.; Scheuer, T.; Catterall, W.A. Common molecular determinants of local anesthetic, antiarrhythmic, and anticonvulsant block of voltage- gated Na+ channels. Proc. Natl. Acad. Sci. USA 1996, 93, 9270-9275, doi:10.1073 / pnas.93.17.9270. Yang, M.; Brackenbury, W.J. Membrane potential and cancer progression. Front. Physiol.2013, 4, 185, doi:10.3389 / fphys.2013.00185. House, C.D.; Vaske, C.J.; Schwartz, A.M.; Obias, V.; Frank, B.; Luu, T.; Sarvazyan, N.; Irby, R.; Strausberg, R.L.; Hales, T.G.; et al. Voltage-gated Na+ channel SCN5A is a key regulator of a gene transcriptional network that controls colon cancer invasion. Cancer Res.2010, 70, 6957-6967, doi:10.1158 / 0008-5472.Can-10-1169. Fairhurst, C.; Martin, F.; Watt, I.; Doran, T.; Bland, M.; Brackenbury, W.J. Sodium channel-inhibiting drugs and cancer survival: protocol for a cohort study using the CPRD primary care database. BMJ Open 2016, 6, e011661, doi:10.1136 / bmjopen- 2016-011661. Driffort, V.; Gillet, L.; Bon, E.; Marionneau-Lambot, S.; Oullier, T.; Joulin, V.; Collin, C.; Pagès, J.C.; Jourdan, M.L.; Chevalier, S.; et al. Ranolazine inhibits NaV1.5-Attorney Docket No.222120-2030 mediated breast cancer cell invasiveness and lung colonization. Mol. Cancer 2014, 13, 264, doi:10.1186 / 1476-4598-13-264. Martin, F.; Ufodiama, C.; Watt, I.; Bland, M.; Brackenbury, W.J. Therapeutic Value of Voltage-Gated Sodium Channel Inhibitors in Breast, Colorectal, and Prostate Cancer: A Systematic Review. Front. Pharmacol.2015, 6, 273, doi:10.3389 / fphar.2015.00273. Li, H.; Liu, J.; Fan, N.; Wang, H.; Thomas, A.M.; Yan, Q.; Li, S.; Qin, H. Nav1.6 promotes the progression of human follicular thyroid carcinoma cells via JAK-STAT signaling pathway. Pathol. Res. Pract.2022, 236, 153984, doi:10.1016 / j.prp.2022.153984. Klugbauer, N.; Lacinova, L.; Flockerzi, V.; Hofmann, F. Structure and functional expression of a new member of the tetrodotoxin-sensitive voltage-activated sodium channel family from human neuroendocrine cells. Embo J.1995, 14, 1084-1090. Lopez-Charcas, O.; Poisson, L.; Benouna, O.; Lemoine, R.; Chadet, S.; Pétereau, A.; Lahlou, W.; Guyétant, S.; Ouaissi, M.; Pukkanasut, P.; et al. Voltage-Gated Sodium &KDQQHO^1D9^^^^&RQWUROV^1+(í^í'HSHQGHQW^,QYDVLYH^3URSHUWLHV^LQ^&RORQ^&DQFHU^ Cells. Cancers (Basel) 2023, 15, 46. Jaskula-Sztul, R.; Eide, J.; Tesfazghi, S.; Dammalapati, A.; Harrison, A.D.; Yu, X.M.; Scheinebeck, C.; Winston-McPherson, G.; Kupcho, K.R.; Robers, M.B.; et al. Tumor- suppressor role of Notch3 in medullary thyroid carcinoma revealed by genetic and pharmacological induction. Mol. Cancer Ther.2015, 14, 499-512, doi:10.1158 / 1535- 7163.Mct-14-0073. Aburjania, Z.; Whitt, J.D.; Jang, S.; Nadkarni, D.H.; Chen, H.; Rose, J.B.; Velu, S.E.; Jaskula-Sztul, R. Synthetic Makaluvamine Analogs Decrease c-Kit Expression and Are Cytotoxic to Neuroendocrine Tumor Cells. Molecules 2020, 25, 4940, doi:10.3390 / molecules25214940. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real- time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402- 408, doi:10.1006 / meth.2001.1262. Hamill, O.P.; Marty, A.; Neher, E.; Sakmann, B.; Sigworth, F.J. Improved patch- clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch.1981, 391, 85-100, doi:10.1007 / bf00656997. Marty, A.; Neher, E. Tight-Seal Whole-Cell Recording. In Single-Channel Recording, Sakmann, B., Neher, E., Eds.; Springer US: Boston, MA, 1995; pp.31-52. GraphPad Prism version 9.3.1 for Windows. GraphPad Software 2021. Ashland, O.B., Dickinson and Company. FlowJo™ Software for Windows Version 10.8.1.2021.Attorney Docket No.222120-2030 Kirkpatrick, L.A. A simple guide to IBM SPSS statistics for versions 20.0 & 21.0; Australia ; Belmont, CA : Wadsworth, 2013. House, C.D.; Vaske, C.J.; Schwartz, A.M.; Obias, V.; Frank, B.; Luu, T.; Sarvazyan, N.; Irby, R.; Strausberg, R.L.; Hales, T.G.; et al. Voltage-gated Na+ channel SCN5A is a key regulator of a gene transcriptional network that controls colon cancer invasion. Cancer Res.2010, 70, 6957-6967, doi:10.1158 / 0008-5472.Can-10-1169. Liu, C.; Yu, M.; Li, Y.; Wang, H.; Xu, C.; Zhang, X.; Li, M.; Guo, H.; Ma, D.; Guo, X. Lidocaine inhibits the metastatic potential of ovarian cancer by blocking NaV1.5- mediated EMT and FAK / Paxillin signaling pathway. Cancer Med.2020, 10, 337 - 349. Lopez-Charcas, O.; Espinosa, A.M.; Alfaro, A.; Herrera-Carrillo, Z.; Ramirez-Cordero, B.E.; Cortes-Reynosa, P.; Perez Salazar, E.; Berumen, J.; Gomora, J.C. The invasiveness of human cervical cancer associated to the function of NaV1.6 channels is mediated by MMP-2 activity. Sci. Rep.2018, 8, 12995, doi:10.1038 / s41598-018- 31364-y. Diss, J.K.; Archer, S.N.; Hirano, J.; Fraser, S.P.; Djamgoz, M.B. Expression profiles of voltage-gated Na(+) channel alpha-subunit genes in rat and human prostate cancer cell lines. Prostate 2001, 48, 165-178, doi:10.1002 / pros.1095. Diss, J.K.J.; Stewart, D.; Pani, F.; Foster, C.S.; Walker, M.M.; Patel, A.; Djamgoz, M.B.A. A potential novel marker for human prostate cancer: voltage-gated sodium channel expression in vivo. Prostate Cancer Prostatic. Dis.2005, 8, 266-273, doi:10.1038 / sj.pcan.4500796. Campbell, T.M.; Main, M.J.; Fitzgerald, E.M. Functional expression of the voltage- gated NaΆ-channel Nav1.7 is necessary for EGF-mediated invasion in human non- small cell lung cancer cells. J. Cell Sci.2013, 126, 4939-4949, doi:10.1242 / jcs.130013. Liu, J.; Tan, H.; Yang, W.; Yao, S.; Hong, L. The voltage-gated sodium channel Nav1.7 associated with endometrial cancer. J. Cancer 2019, 10, 4954-4960, doi:10.7150 / jca.31544. Horne, J.; Mansur, S.; Bao, Y. Sodium ion channels as potential therapeutic targets for cancer metastasis. Drug Discov. Today 2021, 26, 1136-1147, doi:10.1016 / j.drudis.2021.01.026. Pacini, F.; Elisei, R.; Anelli, S.; Basolo, F.; Cola, A.; Pinchera, A. Somatostatin in medullary thyroid cancer. In vitro and in vivo studies. Cancer 1989, 63, 1189-1195, doi:10.1002 / 1097-0142(19890315)63:6<1189::aid-cncr2820630625>3.0.co;2-j.Attorney Docket No.222120-2030 Gould, H.J., 3rd; Norleans, J.; Ward, T.D.; Reid, C.; Paul, D. Selective lysis of breast carcinomas by simultaneous stimulation of sodium channels and blockade of sodium pumps. Oncotarget 2018, 9, 15606-15615, doi:10.18632 / oncotarget.24581. Yang, M.; Kozminski, D.J.; Wold, L.A.; Modak, R.; Calhoun, J.D.; Isom, L.L.; Brackenbury, W.J. Therapeutic potential for phenytoin: targeting Na(v)1.5 sodium channels to reduce migration and invasion in metastatic breast cancer. Breast Cancer Res. Treat.2012, 134, 603-615, doi:10.1007 / s10549-012-2102-9. Simon, R.; Mirlacher, M.; Sauter, G. Immunohistochemical analysis of tissue microarrays. Methods Mol. Biol.2010, 664, 113-126, doi:10.1007 / 978-1-60761-806- 5_12. Wu, Y.; Zou, B.; Liang, L.; Li, M.; Tao, Y.X.; Yu, H.; Wang, X.; Li, M. Loperamide inhibits sodium channels to alleviate inflammatory hyperalgesia. Neuropharmacology 2017, 117, 282-291, doi:10.1016 / j.neuropharm.2017.02.010. Bankar, G.; Goodchild, S.J.; Howard, S.; Nelkenbrecher, K.; Waldbrook, M.; Dourado, M.; Shuart, N.G.; Lin, S.; Young, C.; Xie, Z.; et al. Selective NaV1.7 Antagonists with Long Residence Time Show Improved Efficacy against Inflammatory and Neuropathic Pain. Cell Rep.2018, 24, 3133-3145, doi:10.1016 / j.celrep.2018.08.063. Wang, G.K.; Russell, C.; Wang, S.Y. Mexiletine block of wild-type and inactivation- deficient human skeletal muscle hNav1.4 Na+ channels. J. Physiol.2004, 554, 621- 633, doi:10.1113 / jphysiol.2003.054973. Panigel, J.; Cook, S.P. A point mutation at F1737 of the human Nav1.7 sodium channel decreases inhibition by local anesthetics. J. Neurogenet.2011, 25, 134-139, doi:10.3109 / 01677063.2011.629702. Szabo, A.K.; Pesti, K.; Lukacs, P.; Földi, M.C.; Gerevich, Z.; Sperlagh, B.; Mike, A. Non-blocking modulation as the major mechanism of sodium channel inhibition by riluzole. bioRxiv 2017, 228569, doi:10.1101 / 228569. Gamal El-Din, T.M.; Lenaeus, M.J.; Zheng, N.; Catterall, W.A. Fenestrations control resting-state block of a voltage-gated sodium channel. Proc. Natl. Acad. Sci. USA 2018, 115, 13111-13116, doi:10.1073 / pnas.1814928115. Hille, B. Local anesthetics: hydrophilic and hydrophobic pathways for the drug- receptor reaction. J. Gen. Physiol.1977, 69, 497-515, doi:10.1085 / jgp.69.4.497. Huang, C.J.; Schild, L.; Moczydlowski, E.G. Use-dependent block of the voltage- gated Na(+) channel by tetrodotoxin and saxitoxin: effect of pore mutations that change ionic selectivity. J. Gen. Physiol.2012, 140, 435-454, doi:10.1085 / jgp.201210853.Attorney Docket No.222120-2030 Narahashi, T. Tetrodotoxin: a brief history. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 2008, 84, 147-154, doi:10.2183 / pjab.84.147. Van Meerloo, J.; Kaspers, G.J.; Cloos, J. Cell sensitivity assays: the MTT assay. Methods Mol. Biol.2011, 731, 237-245, doi:10.1007 / 978-1-61779-080-5_20. Chen, H.C. Boyden chamber assay. Methods Mol. Biol.2005, 294, 15-22, doi:10.1385 / 1-59259-860-9:015. Edenfield, S.; Sims, A.M.; Porretta, C.; Gould, H.J., 3rd; Paul, D. Effect of Cell Cycle on Cell Surface Expression of Voltage-Gated Sodium Channels and Na(+),K(+)- ATPase. Cells 2022, 11, doi:10.3390 / cells11203240. Rao, V.R.; Perez-Neut, M.; Kaja, S.; Gentile, S. Voltage-gated ion channels in cancer cell proliferation. Cancers (Basel) 2015, 7, 849-875, doi:10.3390 / cancers7020813. Clapham, D.E. Calcium signaling. Cell 1995, 80, 259-268, doi:10.1016 / 0092- 8674(95)90408-5. Abdul Kadir, L.; Stacey, M.; Barrett-Jolley, R. Emerging Roles of the Membrane Potential: Action Beyond the Action Potential. Front. Physiol.2018, 9, doi:10.3389 / fphys.2018.01661. Li, R.; Xiao, C.; Liu, H.; Huang, Y.; Dilger, J.P.; Lin, J. Effects of local anesthetics on breast cancer cell viability and migration. BMC Cancer 2018, 18, 666, doi:10.1186 / s12885-018-4576-2. Haraguchi-Suzuki, K.; Kawabata-Iwakawa, R.; Suzuki, T.; Suto, T.; Takazawa, T.; Saito, S. Local anesthetic lidocaine induces growth suppression of HeLa cells by decreasing and changing the cellular localization of the proliferation marker Ki-67. Genes Cells 2022, 27, 675-684, doi:10.1111 / gtc.12983. Liu, C.; Yu, M.; Li, Y.; Wang, H.; Xu, C.; Zhang, X.; Li, M.; Guo, H.; Ma, D.; Guo, X. Lidocaine inhibits the metastatic potential of ovarian cancer by blocking NaV1.5- mediated EMT and FAK / Paxillin signaling pathway. Cancer Med.2021, 10, 337-349, doi:10.1002 / cam4.3621. Piegeler, T.; Votta-Velis, E.G.; Liu, G.; Place, Aaron T.; Schwartz, David E.; Beck- Schimmer, B.; Minshall, Richard D.; Borgeat, A. Antimetastatic Potential of Amide- linked Local Anesthetics: Inhibition of Lung Adenocarcinoma Cell Migration and Inflammatory Src Signaling Independent of Sodium Channel Blockade. Anesthesiology 2012, 117, 548-559, doi:10.1097 / ALN.0b013e3182661977. Le Gac, G.; Angenard, G.; Clément, B.; Laviolle, B.; Coulouarn, C.; Beloeil, H. Local Anesthetics Inhibit the Growth of Human Hepatocellular Carcinoma Cells. Anesth. Analg.2017, 125. Xu, X.; Dai, Y.; Feng, L.; Zhang, H.; Hu, Y.; Xu, L.; Zhu, X.; Jiang, Y. Knockdown of Nav1.5 inhibits cell proliferation, migration and invasion via Wnt / -catenin signalingAttorney Docket No.222120-2030 pathway in oral squamous cell carcinoma. Acta Biochim. Biophys. Sin. (Shanghai) 2020, 52, 527-535, doi:10.1093 / abbs / gmaa021. / L^^.^^^=KRX^^=^<^^^-L^^3^3^^^ / XR^^+^6^^.QRFNGRZQ^RI^ȕ-catenin by siRNA influences proliferation, apoptosis and invasion of the colon cancer cell line SW480. Oncol. Lett. 2016, 11, 3896-3900, doi:10.3892 / ol.2016.4481. Iwai, S.; Yonekawa, A.; Harada, C.; Hamada, M.; Katagiri, W.; Nakazawa, M.; Yura, Y. Involvement of the Wnt-ȕ-catenin pathway in invasion and migration of oral squamous carcinoma cells. Int. J. Oncol.2010, 37, 1095-1103, doi:10.3892 / ijo_00000761. =KDQJ^^<^^^:DQJ^^;^^7DUJHWLQJ^WKH^:QW^ȕ-catenin signaling pathway in cancer. J. Hematol. Oncol.2020, 13, 165, doi:10.1186 / s13045-020-00990-3. Wang, J.; Ou, S.W.; Wang, Y.J. Distribution and function of voltage-gated sodium channels in the nervous system. Channels (Austin) 2017, 11, 534-554, doi:10.1080 / 19336950.2017.1380758. Xing, D.; Wang, J.; Ou, S.; Wang, Y.; Qiu, B.; Ding, D.; Guo, F.; Gao, Q. Expression of neonatal Nav1.5 in human brain astrocytoma and its effect on proliferation, invasion and apoptosis of astrocytoma cells. Oncol. Rep.2014, 31, 2692-2700, doi:10.3892 / or.2014.3143. Besson, P.; Driffort, V.; Bon, É.; Gradek, F.; Chevalier, S.; Roger, S. How do voltage- gated sodium channels enhance migration and invasiveness in cancer cells? Biochim. et Biophys. Acta (BBA) - Biomemb.2015, 1848, 2493-2501, doi:10.1016 / j.bbamem.2015.04.013. Gupta, G.P.; Massagué, J. Cancer metastasis: building a framework. Cell 2006, 127, 679-695, doi:10.1016 / j.cell.2006.11.001. Mohamed, M.M.; Sloane, B.F. Cysteine cathepsins: multifunctional enzymes in cancer. Nat. Rev. Cancer 2006, 6, 764-775, doi:10.1038 / nrc1949. Brisson, L.; Gillet, L.; Calaghan, S.; Besson, P.; Le Guennec, J.Y.; Roger, S.; Gore, J. NaV1.5 enhances breast cancer cell invasiveness by increasing NHE1-dependent H(+) efflux in caveolae. Oncogene 2011, 30, 2070-2076, doi:10.1038 / onc.2010.574. Gatenby, R.A.; Smallbone, K.; Maini, P.K.; Rose, F.; Averill, J.; Nagle, R.B.; Worrall, L.; Gillies, R.J. Cellular adaptations to hypoxia and acidosis during somatic evolution of breast cancer. Br. J. Cancer 2007, 97, 646-653, doi:10.1038 / sj.bjc.6603922. Brisson, L.; Driffort, V.; Benoist, L.; Poet, M.; Counillon, L.; Antelmi, E.; Rubino, R.; Besson, P.; Labbal, F.; Chevalier, S.; et al. NaV1.5 NaΆ channels allosterically regulate the NHE-1 exchanger and promote the activity of breast cancer cell invadopodia. J. Cell Sci.2013, 126, 4835-4842, doi:10.1242 / jcs.123901.Attorney Docket No.222120-2030 109. Roger, S.; Besson, P.; Le Guennec, J.Y. Influence of the whole-cell patch-clamp configuration on electrophysiological properties of the voltage-dependent sodium current expressed in MDA-MB-231 breast cancer cells. Eur. Biophys J.2004, 33, 274-279, doi:10.1007 / s00249-003-0365-0. 110. Wang, G.; Cao, R.; Wang, Y.; Qian, G.; Dan, H.C.; Jiang, W.; Ju, L.; Wu, M.; Xiao, Y.; Wang, X. Simvastatin induces cell cycle arrest and inhibits proliferation of bladder FDQFHU^FHOOV^YLD^33$5Ȗ^VLJQDOOLQJ^SDWKZD\^^Sci. Rep.2016, 6, 35783, doi:10.1038 / srep35783. 111. Eidizade, F.; Soukhtanloo, M.; Zhiani, R.; Mehrzad, J.; Mirzavi, F. Inhibition of glioblastoma proliferation, invasion, and migration by Urolithin B through inducing G0 / G1 arrest and targeting MMP-2 / -9 expression and activity. Biofactors 2022, 1-11, doi:10.1002 / biof.1915. 112. Loh, C.Y.; Chai, J.Y.; Tang, T.F.; Wong, W.F.; Sethi, G.; Shanmugam, M.K.; Chong, P.P.; Looi, C.Y. The E-Cadherin and N-Cadherin Switch in Epithelial-to- Mesenchymal Transition: Signaling, Therapeutic Implications, and Challenges. Cells 2019, 8, 1118, doi:10.3390 / cells8101118. 113. Sun, J.; Li, L.; Yang, L.; Duan, G.; Ma, T.; Li, N.; Liu, Y.; Yao, J.; Liu, J.Y.; Zhang, X. Novel SCN9A missense mutations contribute to congenital insensitivity to pain: Unexpected correlation between electrophysiological characterization and clinical phenotype. Mol Pain 2020, 16, 1-9, doi:10.1177 / 1744806920923881. 114. Marchi, M.; D'Amato, I.; Andelic, M.; Cartelli, D.; Salvi, E.; Lombardi, R.; Gumus, E.; Lauria, G. Congenital insensitivity to pain: a novel mutation affecting a U12-type intron causes multiple aberrant splicing of SCN9A. Pain 2022, 163, e882-e887. 115. Trombetti, G.A.; Mezzelani, A.; Orro, A. A Drug Discovery Approach for an Effective Pain Therapy through Selective Inhibition of Nav1.7. Int. J. Mol. Sci.2022, 23, 6793, doi:10.3390 / ijms23126793. 116. Bankar, G.; Goodchild, S.J.; Howard, S.; Nelkenbrecher, K.; Waldbrook, M.; Dourado, M.; Shuart, N.G.; Lin, S.; Young, C.; Xie, Z.; et al. Selective NaV1.7 Antagonists with Long Residence Time Show Improved Efficacy against Inflammatory and Neuropathic Pain. Cell Rep.2018, 24, 3133-3145, doi:10.1016 / j.celrep.2018.08.063. EXAMPLE 2
[0330] FIGS.14A-14B
[0331] As most MTC patients are not candidates for operative intervention because of wide- spread disease or the degree of hepatic metastasis involvement a novel murine MTC modelAttorney Docket No.222120-2030 of liver metastasis was developed to recapitulate clinical disease and mimic the tumor progre- ssion in the microenvironment seen in human MTCs. This xenograft model will enable the investigation of cancer invasion as well as the possible delay of disease progression with SV188 treatment.
[0332] Briefly, after induction of anesthesia, the abdomen of each mouse is prepped with betadine, and a left subcostal incision is made.3 x 106cells are injected into the spleen in 200 ^ / ^RI^+DQNV^%XIIHUHG^6DOW^6ROXWLRQ^^The spleen is identified and isolated with the aid of cotton applicators and stabilized for injection. The tumor cells (MZ-CRC-1) are allowed 3 minutes to enter the circulation and the splenic vessels are tied off and the spleen is removed. The fascia is approximated, and the skin is closed with Vetbond veterinary skin glue. Each mouse is then DSSURSULDWHO\^UHFRYHUHG^IURP^DQHVWKHVLD^DQG^H[DPLQHG^HYHU\^^^^KRXUV^IRU^WKH^¿UVW^ZHHN^DQG^ then twice weekly. The estimated time for each operation is 10 to 15 minutes. Visible tumors are present in the liver within 4 weeks post intrasplenic injection.
[0333] In about 5 weeks mice developed liver metastases. Anatomical MRI imaging is used to detect and quantify MTC metastases in the liver. Three-dimensional anatomical imaging will allow for measuring clinical changes in tumor volume, including number and size of metastasis.
[0334] FIG.15 and FIGS.16A-16B
[0335] After about 5 weeks of MTC cells implantation, mice were anatomically imaged (1stMRI, 16 mice with no detected liver metastasis) and divided into two groups: Control - Group A (7 mice, FIG.16A), and SV188 Treated - Group B (9 mice, FIG.16B). Mice were treated with vehicle or SV188 every other day for 4 weeks at the MTD dose of SV188 (40mg / kg BW). To assess the tumor progression and response to the treatment, all mice were imaged the second time (2ndMRI, 8 weeks after MZ cells implantation). After the second imaging, the in vivo experiment was terminated and all mice were dissected to confirm the presence of hepatic metastasis. Additionally multiple internal organs were collected for histological assessment of potential toxicity.
[0336] This experiment revealed that 85.7% (6 out of 7) control mice developed liver metastasis. In contrast, hepatic nodules were not detected in any (0 in 9) of SV188 treatedmice what was confirmed in both, the 2ndMRI and ex vivo dissection.
[0337] Conclusion
[0338] There was significant association between SV188 treatment and inhibition of liver metastasis establishment, where none of SV188-treated mice (df = 1, p = 0.0063, Fisher’s Exact Test) developed tumors compared to 85.7% of vehicle-treated mice. Importantly,Attorney Docket No.222120-2030 anatomical imaging and ex vivo liver dissections revealed that Nav1.7 inhibitor, SV188, prevented MTC cells colonization, local invasion, and liver metastasis development when treatment was applied before metastasis formation (no later than 4 weeks of cancer cells implantation). EXAMPLE 3
[0339] Provided in Table 1 are examples of the VGSC inhibitor as described herein. Compounds provided in Table 1 are in a pharmaceutically acceptable salt form. Table 1. Pharmaceutically acceptable salts of VGSC inhibitors as described herein.Attorney Docket No.222120-2030Attorney Docket No.222120-2030
[0340] Many variations and modifications may be made to the above-described aspects. All such modifications and variations are intended to be included herein within the scope of this disclosure and protected by the following claims.
Claims
Attorney Docket No.222120-2030 CLAIMS What is claimed:
1. A compound having a formula represented by the following structure:wherein R1is hydrogen, a primary amine, a secondary amine, a tertiary amine, a substituted or unsubstituted cycloalkyl group, a substituted or unsubstituted heterocycloalkyl group, a substituted or unsubstituted aryl group, or a substituted or unsubstituted heteroaryl group; m and n are independently an integer from 0 to 5; R2a, R2b, R2c, R2d, R2e, and R2fare independently selected from hydrogen, a hydroxyalkyl group, an ether, or a carboxyl group; each R3are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group; R4is hydrogen, an alkyl group, or a substituted or unsubstituted aryl group; Y is nitrogen or CH; and X is NH or C(Z)H, wherein Z is NH or O; or a pharmaceutically acceptable salt thereof.
2. The compound of claim 1, wherein R1is a heterocycloalkyl group wherein at least one heteroatom is nitrogen.
3. The compound of claim 1, wherein R1is a secondary or tertiary amine substituted with one or two alkyl groups.
4. The compound of claim 1, wherein R1is:Attorney Docket No.222120-2030wherein R5aand R5bare independently selected from hydrogen or a C1-C6 alkyl group.
5. The compound of claim 4, wherein R5aand R5bare independently selected from a C1-C3 alkyl group.
6. The compound of claim 1, wherein m and n are independently an integer from 1 to 5.
7. The compound of claim 1, wherein m and n are independently an integer from 1 to 3.
8. The compound of claim 1, wherein one of R2a, R2b, R2c, R2d, R2e, and R2fis hydrogen, a hydroxyalkyl group, an ether, or a carboxyl group and the other of R2a, R2b, R2c, R2d, R2e, and R2fare hydrogen.
9. The compound of claim 1, wherein at least one of R3is hydroxy, fluorine, chlorine, a C1- C6 alkyl group, or a C1-C6 hydroxyalkyl group, and the other of R3are hydrogen.
10. The compound of claim 1, wherein R4is hydrogen or a substituted or unsubstituted phenyl group.
11. The compound of claim 1, wherein R4is:wherein each R6are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group.Attorney Docket No.222120-2030 12. The compound of claim 11, wherein at least one of R6is hydroxy, fluorine, chlorine, a C1- C6 alkyl group, or a C1-C6 hydroxyalkyl group, and the other of R6are hydrogen.
13. The compound of claim 1, wherein the compound has the following structure:wherein R1is hydrogen, a primary amine, a secondary amine, or a tertiary amine, a substituted or unsubstituted cycloalkyl group, a substituted or unsubstituted heterocycloalkyl group, a substituted or unsubstituted aryl group, or a substituted or unsubstituted heteroaryl group; m and n are independently an integer from 0 to 5; each R3are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group; and R4is hydrogen, an alkyl group, or a substituted or unsubstituted aryl group.
14. The compound of claim 13, wherein R1is a heterocycloalkyl group wherein at least one heteroatom is nitrogen.
15. The compound of claim 13, wherein R1is a secondary or tertiary amine substituted with one or two alkyl groups.
16. The compound of claim 13, wherein R1is:Attorney Docket No.222120-2030wherein R5aand R5bare independently selected from hydrogen or a C1-C6 alkyl group.
17. The compound of claim 16, wherein R5aand R5bare independently selected from a C1-C3 alkyl group.
18. The compound of claim 13, wherein m and n are independently an integer from 1 to 5.
19. The compound of claim 13, wherein m and n are independently an integer from 1 to 3.
20. The compound of claim 13, wherein at least one of R3is hydroxy, fluorine, chlorine, a C1- C6 alkyl group, or a C1-C6 hydroxyalkyl group, and the other of R3are hydrogen.
21. The compound of claim 13, wherein R4is hydrogen or a substituted or unsubstituted phenyl group.
22. The compound of claim 13, wherein R4is:wherein each R6are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group.
23. The compound of claim 22, wherein at least one of R6is selected from hydroxy, fluorine, chlorine, a C1-C6 alkyl group, or a C1-C6 hydroxyalkyl group, and the other of R6are hydrogen.Attorney Docket No.222120-2030 24. The compound of claim 1 or claim 13, wherein the compound has the following structure:wherein each R3are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group; R4is hydrogen, an alkyl group, or a substituted or unsubstituted aryl group; and X is CH2or O.
25. The compound of claim 24, wherein at least one of R3is hydroxy, fluorine, chlorine, a C1- C6 alkyl group, or a C1-C6 hydroxyalkyl group, and the other of R3are hydrogen.
26. The compound of claim 24, wherein R4is hydrogen or a substituted or unsubstituted phenyl group.
27. The compound of claim 24, wherein R4is:wherein each R6are independently selected from hydrogen, hydroxy, a halide, an alkyl group, an alkoxy group, a hydroxyalkyl group, an ether, or a carboxyl group.
28. The compound of claim 26, wherein at least one of R6is selected from hydroxy, fluorine, chlorine, a C1-C6 alkyl group, or a C1-C6 hydroxyalkyl group, and the other of R6are hydrogen.
29. The compound of claim 24, wherein each R3are independently selected from hydrogen, - C(O)OH, OH, or -CH2OR7, wherein R7is hydrogen, a substituted or unsubstituted alkyl group, or a substituted or unsubstituted heterocycloalkyl group.
30. The compound of claim 24, wherein each R4are independently selected from hydrogen, - C(O)OH, OH, or -CH2OR7, wherein R7is hydrogen, a substituted or unsubstituted alkylAttorney Docket No.222120-2030 group, or a substituted or unsubstituted heterocycloalkyl group.
31. A pharmaceutical composition comprising the compound of claim 1 or a pharmaceutically acceptable salt thereof and a pharmaceutically-acceptable carrier, formulated for administering to a subject.
32. A method for treating a disease, comprising administering to a subject in need thereof, a therapeutically effective amount of the pharmaceutical composition of claim 31 or a therapeutically effective amount of the compound of claim 1, or a pharmaceutically acceptable salt thereof.
33. The method of claim 32, further comprising a pharmaceutically acceptable carrier.
34. The method of claim 32, wherein the disease is medullary thyroid cancer.
35. The method of claim 32, wherein the disease is metastatic medullary thyroid cancer.
36. The method of claim 32, wherein the disease is chronic pain.