Sod1-modulating compositions and methods of use thereof

EP4720286A2Pending Publication Date: 2026-04-08ADARX PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-05-24
Publication Date
2026-04-08

AI Technical Summary

Technical Problem

Current treatments for CNS-related diseases and neurodegenerative conditions, such as ALS, are inadequate in effectively reducing SOD1 expression and activity, leading to insufficient therapeutic outcomes for patients.

Method used

Development of specific compounds and compositions that modulate SOD1 expression by targeting SOD1 mRNA and protein, using oligonucleotides and other molecular agents to inhibit SOD1 activity, which can be administered via various routes to achieve therapeutic benefits.

Benefits of technology

These compounds effectively reduce SOD1 expression and activity, providing potent and tolerable treatments that slow disease progression or ameliorate symptoms of CNS-related diseases and neurodegenerative disorders, including ALS, with improved potency and duration of action compared to existing therapies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000022_0001
    Figure IMGF000022_0001
  • Figure IMGF000023_0001
    Figure IMGF000023_0001
  • Figure IMGF000024_0001
    Figure IMGF000024_0001
Patent Text Reader

Abstract

Aspects of the disclosure provide compounds, compositions, and methods for modulating the expression or activity of superoxide dismutase 1 (SOD1). In some aspects, the compounds, compositions, and methods of the disclosure can be used to reduce the expression of SOD1 mRNA in a cell or animal. In some aspects, the compounds, compositions, and methods of the disclosure can be used to reduce the expression of SOD1 protein in a cell or animal.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] SOD1-MODULATING COMPOSITIONS AND METHODS OF USE THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority under 35 U.S.C. § 119(e) of U.S. Provisional Application No.63 / 504,692, filed May 26, 2023; U.S. Provisional Application No.63 / 510,090, filed June 23, 2023; and U.S. Provisional Application No.63 / 613,687, filed December 21, 2023. The disclosure of each of the prior applications is considered part of and is incorporated by reference in its entirety in the disclosure of this application. SUMMARY The present disclosure provides compounds, compositions, and methods for modulating the expression or activity of superoxide dismutase 1 (SOD1). In certain embodiments, the compounds, compositions, and methods can be used to reduce the expression of SOD1 mRNA in a cell or animal. In certain embodiments, the compounds, compositions, and methods can be used to reduce the amount of SOD1 protein in a cell or animal. In certain embodiments, the animal has a CNS related disease, disorder or condition. In certain embodiments, the disease, disorder or condition is a neurodegenerative disease, including amyotrophic lateral sclerosis (ALS) or a symptom thereof such as loss of motor function or neuron death. Certain compounds, compositions and methods provided herein are directed to reducing a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death in an animal. In certain embodiments, the compounds and compositions provided herein are potent and tolerable and inhibit SOD1 expression, which can be used to treat, prevent, ameliorate, or slow progression of a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, the compounds and compositions comprise one or more features that are effective for increasing potency. In certain embodiments, the compounds and compositions comprise one or more features that are effective for increasing tolerability. In certain embodiments, compounds and compositions comprise one or more features that are effective for targeting the compound or composition to a cell or tissue. In certain embodiments, the compounds and compositions are more potent, have greater duration of action or have greater therapeutic value than compounds publicly disclosed. DETAILED DESCRIPTION It is to be understood that both the foregoing summary and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank, NCBI and other sequence reference records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety as of the date of filing this application. It is understood that the sequence set forth in each SEQ ID NO contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase even if shown in context with a modified compound. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Oligomeric compounds referenced by Compound Number or Ref ID NO indicate a combination of nucleobase sequence, chemical modification, and motif. Herein, the use of the singular includes the plural unless specifically stated otherwise. For example, the articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements. As used herein, the use of “or” means “and / or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting and is used interchangeably with, the phrase "including but not limited to". Definitions Unless otherwise indicated, the following terms have the following meanings: “Superoxide dismutase 1,” used interchangeably with the term “SOD1,” refers to any nucleic acid or protein of SOD1. Exemplary nucleotide and amino acid sequences of SOD1 can be found, for example, at GenBank Accession No. NM_000454.5 (incorporated herein as SEQ ID NO:1), and nucleotides 5001 to 14310 of NG_008689.1 (incorporated herein as SEQ ID NO: 2. Additional examples of SOD1 sequences are readily available through publicly available databases, e.g., GenBank, UniProt, and OMIM. Further information on SOD1 can be found, for example, at www.ncbi.nlm.nih.gov / gene / ?term=SOD1. SOD1, as used herein, also refers to variations of the SOD1 gene including variants provided in the SNP database. Numerous sequence variations within the SOD1 gene have been identified and may be found at, for example, NCBI dbSNP and UniProt (see, e.g., www.ncbi.nlm.nih.gov / snp / ?term=SOD1). “SOD1 mRNA” means an mRNA encoding a SOD1 protein. SOD1 may be referred to in either upper or lower case. “SOD1 specific inhibitor” refers to any agent capable of specifically inhibiting SOD1 RNA and / or SOD1 protein expression or activity at the molecular level. For example, SOD1 specific inhibitors include nucleic acids (including oligonucleotide compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of SOD1 RNA and / or SOD1 protein. “2’-O-methoxyethyl” or “2’-MOE” means a 2’-O(CH2)2-OCH3modification. A 2’-O- methoxyethyl modified sugar is a modified sugar with 2’-O(CH2)2-OCH3 in the place of the 2’-OH group of a ribosyl ring. “5’ start site” means the nucleotide of the target nucleic acid or region which is aligned to the 3’-most nucleoside of an antisense oligonucleotide. “3’ stop site” means the nucleotide of the target nucleic acid or region which is aligned to the 5’-most nucleoside of an antisense oligonucleotide. “About” means within ±10% of a value. For example, if it is stated, “a compound achieved about 70% inhibition of SOD1”, it is implied that SOD1 levels are inhibited within a range of 60% and 80%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range. “Administer” or “administering” refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example, routes of administration that can be used include, but are not limited to, intrathecal (IT) administration, intracerebroventricular (ICV) administration, parenteral administration, such as subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration. “Ameliorate” refers to an improvement or lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art. “Animal” refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees. “Antisense oligonucleotide” or “antisense strand” means an oligonucleotide which includes a region that is complementary to a target nucleic acid, e.g., a SOD1 RNA or a region thereof. “Complementarity” in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof that is complementary to the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (Τ), adenine (A) and uracil (U), and cytosine (C) and guanine (G) unless otherwise specified. Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. By contrast, “fully complementary” or “100% complementary” in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches. “Composition” or “pharmaceutical composition” means a mixture of substances suitable for administering to an individual. For example, a composition may comprise one or more compounds or salt thereof and a sterile aqueous solution. “Co-administration” means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Co-administration does not require both compounds to be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Co-administration includes parallel or sequential administration of the one or more compounds. “Conjugate group” means a group of atoms that is attached to an oligonucleotide. A conjugate group is optionally attached to an oligonucleotide through a conjugate linker. A conjugate group may, for example, alter the distribution, targeting, or half-life of a compound into which it is incorporated. Conjugate groups include lipids (or lipophilic moieties), ligands, and other targeting moieties. “Conjugate linker” means a group of atoms comprising at least one bond that connects a linked moiety to an oligonucleotide. “Identity” in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof that matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof. Identity of an oligonucleotide to another oligonucleotide or nucleic acid need not require each nucleobase to match and may include one or more different nucleobases. By contrast, “fully identical” or “100% identity” in reference to oligonucleotides means that such oligonucleotides have the same nucleobase at each relative position over its length as the other oligonucleotide or nucleic acid. “Individual” means a human or non-human animal selected for treatment or therapy. “Inhibiting the expression or activity” with reference to a target nucleic acid or protein means to reduce or block the expression or activity of such target relative to the expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity. As used herein, the term “internucleoside linkage” is the covalent linkage between adjacent nucleosides in an oligonucleotide. As used herein, “modified internucleoside linkage” means any internucleoside linkage other than a phosphodiester internucleoside linkage. “Phosphorothioate internucleoside linkage” is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom. Representative internucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations as further described below. Unless otherwise indicated, chiral internucleoside linkages of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration. The compounds of the present disclosure may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds may be radiolabeled with radioactive isotopes, such as for example tritium (3H), iodine-125 (125I), or carbon-14 (14C). All isotopic variations of the compounds of the present disclosure, whether radioactive or not, are encompassed within the scope of the present disclosure. The term “isotopic variant” refers to a therapeutic agent (e.g., a compound and / or modified oligonucleotide disclosed herein) that contains an unnatural proportion of an isotope at one or more of the atoms that constitute such a therapeutic agent. In certain embodiments, an “isotopic variant” of a therapeutic agent contains unnatural proportions of one or more isotopes, including, but not limited to, hydrogen (H), deuterium (2H), tritium (3H), carbon-11 (11C), carbon-12 (12C), carbon-13 (13C), carbon-14 (14C), nitrogen-13 (13N), nitrogen-14 (14N), nitrogen-15 (15N), oxygen-14 (14O), oxygen-15 (15O), oxygen-16 (16O), oxygen-17 (17O), oxygen-18 (18O), fluorine-17 (17F), fluorine-18 (18F), phosphorus-31 (31P), phosphorus-32 (32P), phosphorus-33 (33P), sulfur-32 (32S), sulfur-33 (33S), sulfur-34 (34S), sulfur-35 (35S), sulfur-36 (36S), chlorine-35 (35Cl), chlorine-36 (36Cl), chlorine-37 (37Cl), bromine-79 (79Br), bromine-81 (81Br), iodine 123 (123I), iodine-125 (125I), iodine-127 (127I), iodine-129 (129I), and iodine-131 (131I). In certain embodiments, an “isotopic variant” of a therapeutic agent contains unnatural proportions of one or more isotopes, including, but not limited to, hydrogen (H), deuterium (2H), tritium (3H), carbon-11 (11C), carbon-12 (12C), carbon-13 (13C), carbon-14 (14C), nitrogen-13 (13N), nitrogen-14 (14N), nitrogen-15 (15N), oxygen-14 (14O), oxygen-15 (15O), oxygen-16 (16O), oxygen-17 (17O), oxygen-18 (18O), fluorine-17 (17F), fluorine-18 (18F), phosphorus-31 (31P), phosphorus-32 (32P), phosphorus-33 (33P), sulfur-32 (32S), sulfur-33 (33S), sulfur-34 (34S), sulfur-35 (35S), sulfur-36 (36S), chlorine-35 (35Cl), chlorine-36 (36Cl), chlorine-37 (37Cl), bromine-79 (79Br), bromine-81 (81Br), iodine 123 (123I), iodine-125 (125I), iodine-127 (127I), iodine-129 (129I), and iodine-131 (131I). It will be understood that, in a therapeutic agent (e.g., a compound and / or modified oligonucleotide disclosed herein), any hydrogen can be2H, for example, or any carbon can be13C, for example, or any nitrogen can be15N, for example, or any oxygen can be18O, for example, where feasible according to the judgment of one of skill. In certain embodiments, an “isotopic variant” of a therapeutic agent contains unnatural proportions of deuterium (D). “Lipid” or “lipophilic moiety” refers to an aliphatic, cyclic (such as alicyclic), or polycyclic (such as polyalicyclic) compound, such as a steroid (e.g., sterol) or a linear or branched aliphatic hydrocarbon. The term lipid includes cholesterol, retinoic acid, cholic acid, adamantane acetic acid, 1-pyrene butyric acid, dihydrotestosterone, 1,3-bis- O(hexadecyl)glycerol, geranyloxyhexyanol, hexadecylglycerol, borneol, menthol, 1,3- propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3- (oleoyl)cholenic acid, ibuprofen, naproxen, dimethoxytrityl, or phenoxazine. The term lipid includes a saturated or unsaturated C4-C30hydrocarbon chain (e.g., C4-C30alkyl or alkenyl). In certain embodiments, the lipophilic moiety contains a saturated or unsaturated C5-C20 hydrocarbon chain (e.g., a linear C5-C20 alkyl or alkenyl). In certain embodiments, the lipophilic moiety contains a saturated or unsaturated C14-C20hydrocarbon chain (e.g., a linear C14-C20 alkyl or alkenyl). In certain embodiments, the lipophilic moiety contains a saturated or unsaturated C6-C18 hydrocarbon chain (e.g., a linear C6-C18 alkyl or alkenyl). In certain embodiments, the lipophilic moiety contains a saturated or unsaturated C16hydrocarbon chain (e.g., a linear C16alkyl or alkenyl). In certain embodiments, the lipophilic moiety contains a saturated or unsaturated C17 hydrocarbon chain (e.g., a linear C17 alkyl or alkenyl). In certain embodiments, the lipophilic moiety contains a saturated or unsaturated C18 hydrocarbon chain (e.g., a linear C18alkyl or alkenyl). In certain embodiments, the lipophilic moiety contains a saturated or unsaturated C22 hydrocarbon chain (e.g., a linear C22 alkyl or alkenyl). “Mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide or nucleic acid that is not complementary to the corresponding nucleobase of a second oligonucleotide or nucleic acid when the first oligonucleotide / nucleic acid and second oligonucleotide / nucleic acid are aligned in an antiparallel orientation. For example, nucleobases including, but not limited to, a universal nucleobase, inosine, and hypoxanthine, are capable of hybridizing with at least one nucleobase but are still mismatched or non- complementary with respect to the nucleobase to which they are hybridized. As another example, a nucleobase of a first oligonucleotide / nucleic acid that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide / nucleic acid when the first and second oligonucleotides are aligned in an antiparallel orientation is a mismatch or non-complementary nucleobase. “Modified oligonucleotide” means an oligonucleotide, wherein at least one sugar, nucleobase, or internucleoside linkage is modified. “Modulating” refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating SOD1 RNA can mean to increase or decrease the level of SOD1 RNA and / or SOD1 protein in a cell, tissue, organ or organism. A “modulator” effects the change in the cell, tissue, organ or organism. For example, a SOD1 compound can be a modulator that decreases the amount of SOD1 RNA and / or SOD1 protein in a cell, tissue, organ or organism. “Motif” means the pattern of unmodified and modified sugar moieties, nucleobases, and / or internucleoside linkages, in an oligonucleotide. “Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, and double-stranded nucleic acids. “Nucleobase” means a heterocyclic moiety capable of pairing with a base of another nucleic acid. As used herein a “naturally occurring nucleobase” is adenine (A), thymine (Τ), cytosine (C), uracil (U), and guanine (G). A “modified nucleobase” is a naturally occurring nucleobase that is chemically modified. A “universal base” or “universal nucleobase” is a nucleobase other than a naturally occurring nucleobase and modified nucleobase and is capable of pairing with any nucleobase. “Nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage. “Nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. “Modified nucleoside” means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase. “Oligomeric Compound” means a compound comprising one or more oligonucleotides and optionally one or more additional features, such as a conjugate group or terminal group. Examples of oligomeric compounds include single-stranded and double- stranded compounds, such as, oligonucleotides, antisense oligonucleotides, interfering RNA compounds (RNAi compounds), microRNA targeting oligonucleotides, occupancy-based compounds (e.g., mRNA processing or translation blocking compounds and splicing compounds). RNAi compounds include double-stranded compounds (e.g., short-interfering RNA (siRNA) and double-stranded RNA (dsRNA)) and single-stranded compounds (e.g., single-stranded siRNA (ssRNA), single-stranded RNAi (ssRNAi), short hairpin RNA (shRNA) and microRNA mimics) which work at least in part through the RNA-induced silencing complex (RISC) pathway resulting in sequence specific degradation and / or sequestration of a target nucleic acid through a process known as RNA interference (RNAi). The term “RNAi compound” is meant to be equivalent to other terms used to describe nucleic acid compounds that are capable of mediating sequence-specific RNA interference, for example, interfering RNA (iRNA), iRNA agent, RNAi agent, short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, and others. Additionally, the term “RNAi” is meant to be equivalent to other terms used to describe sequence-specific RNA interference. “Oligomeric duplex” means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.” The oligonucleotides of each oligomeric compound of an oligomeric duplex may include non-complementary overhanging nucleosides. In some embodiments, the terms “duplexed oligomeric compound” and “modified oligonucleotide” are used interchangeably. In other embodiments, the terms “oligomeric duplex” and “compound” are used interchangeably. “Oligonucleotide” means a polymer of linked nucleosides, each of which can be modified or unmodified, independent from one another. “Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration. “Pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to an individual. In certain embodiments, a pharmaceutically acceptable carrier or diluent aids the administration of a compound to and absorption by an individual and can be included in the compositions of the present disclosure without causing a significant adverse toxicological effect on the patient. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, and the like. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for-injection. One of skill in the art will recognize that other pharmaceutical excipients are useful in the present disclosure. “Pharmaceutically acceptable salt” means or refers to physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. “Tropomyosin Receptor Kinase B” or “TrkB,” as may be used interchangeably herein, means the receptor for brain-derived neurotrophic factor (BDNF) protein encoded by the NTRK2 gene. TrkB is also known as tyrosine receptor kinase B, BDNF / NT-3 growth factors receptor and neurotrophic tyrosine kinase, receptor, type 2. “Cannabinoid Receptor Type 1” or “CB1” means the G protein-coupled receptor for cannabinoids. In humans, CB1is encoded by the CNR1 gene. CB1is also known as cannabinoid receptor 1. “α4β1 / 7 integrin receptor” refers to heterodimeric integrin receptors formed by association of integrin alpha 4 and integrin beta 1 (i.e., the α4β1integrin receptor) and integrin alpha 4 and integrin beta 7 (i.e., the α4β7 integrin receptor). In certain embodiments, the α4β1 / 7 integrin receptor ligand has a higher binding affinity for α4β1 integrin receptor than α4β7 integrin receptor. In certain embodiments, the α4β1 / 7integrin receptor ligand has a higher binding affinity for α4β7integrin receptor than α4β1integrin receptor. “N-methyl-D-aspartate receptor” or “NMDA receptor” refers to the glutamate receptor and ion channel that is found in neurons, e.g., in humans. Many ligands of the NMDA receptor are known in the art including, for example, those disclosed in Neuropharmacology 2007, 53(6), 699-723; J. Med. Chem.1990, 33(2), 789-808; Neuroscience 2001, 105(3), 663-669; J. Med. Chem.2022, 65(13), 9063-9075; Drugs Fut. 2004, 29(10), 992; Drugs Fut.2004, 29(10), 993; and British Journal of Pharmacology 2022, 179(6), 1146-1187, each of which is incorporated by reference herein. As used herein, a pharmaceutically acceptable salt is any salt of a compound provided herein which retains its biological properties and which is not toxic or otherwise undesirable for pharmaceutical use. The pharmaceutically acceptable salts of the therapeutic agents disclosed herein include salts that are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds or modified oligonucleotides described herein. When compounds of the present disclosure contain relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent. When compounds of the present disclosure contain relatively basic functionalities, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent. Thus, the compounds of the present disclosure may exist as salts, such as with pharmaceutically acceptable acids. Such salts may be derived from a variety of organic and inorganic counter-ions well known in the art. Such salts include, but are not limited to: (1) acid addition salts formed with organic or inorganic acids such as hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, sulfamic, acetic, trifluoroacetic, trichloroacetic, propionic, hexanoic, cyclopentylpropionic, glycolic, glutaric, pyruvic, lactic, malonic, succinic, sorbic, ascorbic, malic, maleic, fumaric, tartaric, citric, benzoic, 3-(4-hydroxybenzoyl)benzoic, picric, cinnamic, mandelic, phthalic, lauric, methanesulfonic, ethanesulfonic, 1,2-ethane- disulfonic, 2-hydroxyethanesulfonic, benzenesulfonic, 4-chlorobenzenesulfonic, 2- naphthalenesulfonic, 4-toluenesulfonic, camphoric, camphorsulfonic, 4-methylbicyclo[2.2.2]- oct-2-ene-1-carboxylic, glucoheptonic, 3-phenylpropionic, trimethylacetic, tert-butylacetic, lauryl sulfuric, gluconic, benzoic, glutamic, hydroxynaphthoic, salicylic, stearic, cyclohexylsulfamic, quinic, muconic acid and the like acids; or (2) salts formed when an acidic proton present in the parent compound either (a) is replaced by a metal ion, e.g., an alkali metal ion, an alkaline earth ion or an aluminum ion, or alkali metal or alkaline earth metal hydroxides, such as sodium, potassium, calcium, magnesium, aluminum, lithium, zinc, and barium hydroxide, ammonia, or (b) coordinates with an organic base, such as aliphatic, alicyclic, or aromatic organic amines, such as ammonia, methylamine, dimethylamine, diethylamine, picoline, ethanolamine, diethanolamine, triethanolamine, ethylenediamine, lysine, arginine, ornithine, choline, N,N′-dibenzylethylene-diamine, chloroprocaine, diethanolamine, procaine, N-benzylphenethylamine, N-methylglucamine piperazine, tris(hydroxymethyl)-aminomethane, tetramethylammonium hydroxide, and the like (see, for example, Berge et al., “Pharmaceutical Salts,” Journal of Pharmaceutical Science, 1977, 66, 1-19). Pharmaceutically acceptable salts further include, by way of example only and without limitation, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like, and when the compound contains a basic functionality, salts of non-toxic organic or inorganic acids, such as hydrohalides, e.g. hydrochloride and hydrobromide, sulfate, phosphate, sulfamate, nitrate, acetate, trifluoroacetate, trichloroacetate, propionate, hexanoate, cyclopentylpropionate, glycolate, glutarate, pyruvate, lactate, malonate, succinate, sorbate, ascorbate, malate, maleate, fumarate, tartarate, citrate, benzoate, 3-(4-hydroxybenzoyl)benzoate, picrate, cinnamate, mandelate, phthalate, laurate, methanesulfonate (mesylate), ethanesulfonate, 1,2-ethane-disulfonate, 2- hydroxyethanesulfonate, benzenesulfonate (besylate), 4-chlorobenzenesulfonate, 2- naphthalenesulfonate, 4-toluenesulfonate, camphorate, camphorsulfonate, 4- methylbicyclo[2.2.2]-oct-2-ene-1-carboxylate, glucoheptonate, 3-phenylpropionate, trimethylacetate, tert-butylacetate, lauryl sulfate, gluconate, benzoate, glutamate, hydroxynaphthoate, salicylate, stearate, cyclohexylsulfamate, quinate, muconate, and the like. In some embodiments, the pharmaceutically acceptable salt of the compounds and modified oligonucleotides disclosed herein is a sodium or a potassium salt. In some embodiments, the pharmaceutically acceptable salt of the compounds and modified oligonucleotides disclosed herein is a sodium salt. The neutral forms of the compounds are preferably regenerated by contacting the salt with a base or acid and isolating the parent compound in the conventional manner. The parent form of the compound may differ from the various salt forms in certain physical properties, such as solubility in polar solvents. In embodiments, compounds of the present disclosure contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts. The neutral forms of the compounds may be regenerated by contacting the salt with a base or acid and isolating the parent compound in a conventional manner. The parent form of the compounds differs from the various salt forms in certain physical properties, such as solubility in polar solvents, but, unless specifically indicated, the salts disclosed herein are equivalent to the parent form of the compound for the purposes of the present disclosure. “Pharmaceutical agent” means a compound that provides a therapeutic benefit when administered to an individual. “Phosphorothioate linkage” means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. “Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligonucleotide. “Prevent” refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time. “RNA interference compound” or “RNAi compound” means a compound that acts, at least in part, through an RNA-induced silencing complex (RISC) pathway or Ago2, but not through RNase Η, to modulate a target nucleic acid and / or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single- stranded siRNA, and microRNA, including microRNA mimics. “Sense oligonucleotide” or “sense strand” means the strand of a double-stranded compound that includes a region that is substantially complementary to a region of the antisense strand of the compound. “Specifically inhibit” with reference to a target nucleic acid or protein means to reduce or block expression or activity of the target nucleic acid or protein while minimizing or eliminating effects on non-target nucleic acids or proteins. “Subunit” with reference to an oligonucleotide means a nucleotide, nucleoside, nucleobase or sugar or a modified nucleotide, nucleoside, nucleobase or sugar as provided herein. “Target nucleic acid,” “target RNA,” and “nucleic acid target” all mean a nucleic acid capable of being targeted by compounds described herein. “Target region” means a portion of a target nucleic acid to which one or more compounds is targeted. “Targeting moiety” means a conjugate group that provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a compound absent such a moiety. “Terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide. “Therapeutically effective amount” or “effective amount” means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual. A “therapeutically effective amount” or “effective amount” is an amount sufficient for a compound to accomplish a stated purpose relative to the absence of the compound (e.g., achieve the effect for which it is administered, treat, prevent or ameliorate a disease or reduce one or more symptoms of a disease or condition). An example of a “therapeutically effective amount” or “effective amount” is an amount sufficient to contribute to the treatment, prevention, amelioration, or reduction of a symptom or symptoms of a disease. A “reduction” of a symptom or symptoms (and grammatical equivalents of this phrase) means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). A “prophylactically effective amount” of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms. The term “therapeutically effective amount,” as used herein, refers to that amount of the therapeutic agent sufficient to provide a therapeutic benefit to an individual, such as treating, preventing or ameliorating the disease or disorder or symptom thereof, as described above. For example, for the given parameter, a therapeutically effective amount will show an increase or decrease of at least 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100%. Therapeutic efficacy can also be expressed as “-fold” increase or decrease. For example, a therapeutically effective amount can have at least a 1.2- fold, 1.5-fold, 2-fold, 5-fold, or more effect over a control. The terms “treating” or “treatment” refer to any indicia of success in the therapy or amelioration of an injury, disease, pathology or condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the injury, pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating; improving a patient's physical or mental well-being. The treatment or amelioration of symptoms can be based on objective or subjective parameters, including the results of a physical examination. The term “treating” and conjugations thereof, may include prevention of an injury, pathology, condition, or disease. In embodiments, treating is preventing. In embodiments, treating does not include preventing. “Treating” or “treatment” as used herein (and as well-understood in the art) also broadly includes any approach for obtaining beneficial or desired results in a subject's condition, including clinical results. Beneficial or desired clinical results can include, but are not limited to, alleviation or amelioration of one or more symptoms or conditions, diminishment of the extent of a disease, stabilizing (i.e., not worsening) the state of disease, prevention of a disease’s transmission or spread, delay or slowing of disease progression, amelioration or palliation of the disease state, diminishment of the reoccurrence of disease, and remission, whether partial or total and whether detectable or undetectable. In other words, “treatment” as used herein includes any cure, amelioration, or prevention of a disease. Treatment may prevent the disease from occurring; inhibit the disease’s spread; relieve the disease’s symptoms, fully or partially remove the disease’s underlying cause, shorten a disease’s duration, or do a combination of these things. “Treating” and “treatment” as used herein include prophylactic treatment. Treatment methods include administering to a subject a therapeutically effective amount of a compound described herein. The administering step may consist of a single administration or may include a series of administrations. The length of the treatment period depends on a variety of factors, such as the severity of the condition, the age of the patient, the concentration of the compound, the activity of the compositions used in the treatment, or a combination thereof. It will also be appreciated that the effective dosage of an agent used for the treatment or prophylaxis may increase or decrease over the course of a particular treatment or prophylaxis regime. In some instances, chronic administration may be required. For example, the compositions are administered to the subject in an amount and for a duration sufficient to treat the patient. “Treat” refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal. Certain compounds of the present disclosure possess asymmetric carbon atoms (optical or chiral centers) or double bonds; the enantiomers, racemates, diastereomers, tautomers, geometric isomers, stereoisometric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)- or, as (D)- or (L)-for amino acids, and individual isomers are encompassed within the scope of the present disclosure. The compounds of the present disclosure do not include those that are known in art to be too unstable to synthesize and / or isolate. The present disclosure is meant to include compounds in racemic and optically pure forms. Optically active (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents or resolved using conventional techniques. When the compounds described herein contain olefinic bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers. As used herein, the term “isomers” refers to compounds having the same number and kind of atoms, and hence the same molecular weight, but differing in respect to the structural arrangement or configuration of the atoms. The term “tautomer,” as used herein, refers to one of two or more structural isomers which exist in equilibrium and which are readily converted from one isomeric form to another. It will be apparent to one skilled in the art that certain compounds of this disclosure may exist in tautomeric forms, all such tautomeric forms of the compounds being within the scope of the disclosure. Unless otherwise stated, structures depicted herein are also meant to include all stereochemical forms of the structure (i.e., the R and S configurations for each asymmetric center). Therefore, single stereochemical isomers as well as enantiomeric and diastereomeric mixtures of the present compounds are within the scope of the disclosure. As used herein, “chirally enriched population” means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are compounds comprising modified oligonucleotides. Unless otherwise stated, structures depicted herein are also meant to include compounds which differ only in the presence of one or more isotopically enriched atoms. For example, compounds having the present structures except for the replacement of a hydrogen by a deuterium or tritium, or the replacement of a carbon by13C- or14C-enriched carbon are within the scope of this disclosure. As used herein, “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center having a random stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be but is not necessarily the same as the number of molecules having the (R) configuration of the stereorandom chiral center. The stereochemical configuration of a chiral center is considered random when it is the results of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, a stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage. Certain Embodiments In certain aspects, the disclosure relates to methods, compounds and compositions for inhibiting SOD1. In certain embodiments, SOD1 is specifically inhibited. In certain embodiments, SOD1 is specifically degraded. In certain embodiments, SOD1 expression is inhibited. In certain embodiments, SOD1 translation is inhibited. In certain embodiments, SOD1 activity is inhibited. In certain embodiments, SOD1 expression, translation, or activity is reduced by at least 10% relative to the expression, translation, or activity in an untreated or control sample. For example, in certain embodiments, SOD1 expression, translation, or activity is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, 10-50%, 25-50%, 25-75%, 50-75%, 50-99%, or 75-99% relative to the expression, translation, or activity in an untreated or control sample. In certain embodiments, SOD1 expression, translation, or activity is reduced as measured by any suitable assay, including but not limited to, an immunoassay, a hybridization-based assay, or a sequencing-based assay (e.g., RNA-Seq). In certain aspects, the disclosure relates to compounds targeted to a SOD1 nucleic acid. In certain embodiments, the SOD1 nucleic acid has the sequence set forth in GenBank Accession No. NM_000454.5 (incorporated herein as SEQ ID NO:1), and nucleotides 5001 to 14310 of NG_008689.1 (incorporated herein as SEQ ID NO: 2). In certain embodiments, the compound is an oligomeric compound. In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded. Certain embodiments provide a compound comprising a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. Certain embodiments provide a compound comprising a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. Certain embodiments provide a compound comprising a modified oligonucleotide having a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, the modified oligonucleotide is at least 80%, at least 85%, at least 90%, or at least 95% complementary to SEQ ID NO: 1 or 2. In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the compound is double-stranded. Certain embodiments provide a compound comprising a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence provided in Tables 2 and 3, and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. Certain embodiments provide a compound comprising a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11- 223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. Certain embodiments provide a compound comprising a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. Certain embodiments provide a compound comprising a first modified oligonucleotide comprising a 5′-phosphonate modification, where the first modified oligonucleotide is at least 80% complementary to a region of SEQ ID NO: 1 or 2, and a second modified oligonucleotide comprising one or more ligands described herein (e.g., one or more Tropomyosin receptor B (TrkB) ligands, one or more cannabinoid receptor type 1 (CB1) ligands, one or more α4β1 / 7 integrin ligands, or one or more N-methyl-D-aspartate receptor (NMDA) ligands). In certain embodiments, the first modified oligonucleotide comprises a 5′-terminal nucleoside comprising the 5′-phosphonate modification. In certain embodiments, the 5′-phosphonate modification is a 5′-vinylphosphonate modification or a 5′- ethylenephosphonate modification. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28- 106, 184-187, 196-202, and 214-223 and a second modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In certain embodiments, the modified oligonucleotide or first modified oligonucleotide of any preceding compound has at least 80%, at least 85%, at least 90%, or at least 95% complementarity or identity to SEQ ID NO: 1 or 2 over its length. In certain embodiments, the modified oligonucleotide or first modified oligonucleotide has at least 1, at least 2, at least 3 mismatches to a region of SEQ ID NO: 1 or 2. In certain embodiments, the region of complementarity between the first modified oligonucleotide or first strand and the second modified oligonucleotide or second strand is 14 to 30 linked nucleosides in length. In certain embodiments, the region of complementarity between the first modified oligonucleotide or first strand and the second modified oligonucleotide or second strand is 14 to 23 linked nucleosides in length. In certain embodiments, the region of complementarity between the first modified oligonucleotide or first strand and the second modified oligonucleotide or second strand is 19 to 23 linked nucleosides in length. In certain embodiments, the region of complementarity between the first modified oligonucleotide or first strand and the second modified oligonucleotide or second strand is 21 to 23 linked nucleosides in length. In certain embodiments, the first modified oligonucleotide is fully complementary to the second modified oligonucleotide. In certain embodiments, the modified oligonucleotide or first modified oligonucleotide of any preceding compound comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the second modified oligonucleotide of any preceding compound comprises at least one modification selected from the group consisting of a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage or a methylphosphonate internucleoside linkage. In certain embodiments, the phosphorothioate internucleoside linkage or methylphosphonate internucleoside linkage is at the 3’ terminus of the first or second modified oligonucleotide or at the 5’ terminus of the first modified oligonucleotide. In certain embodiments, the modified sugar comprises a modification selected from the group consisting of a halogen, an alkoxy group and a bicyclic sugar. In certain embodiments, the modified sugar comprises a 2’-F modification. In certain embodiments, the modified sugar comprises a 2’-OMe modification. In certain embodiments, each nucleoside of the first modified oligonucleotide comprises a modified sugar. In certain embodiments, each nucleoside of the second modified oligonucleotide comprises a modified sugar. In certain embodiments, the modified sugar comprises a modification selected from the group consisting of a halogen, an alkoxy group and a bicyclic sugar or a combination thereof. In certain embodiments, the modified sugar comprises a modification selected from the group consisting of 2’-MOE, 2’-F, and 2’-OMe or a combination thereof. In certain embodiments, the first modified oligonucleotide comprises no more than ten 2’-F sugar modifications. In certain embodiments, the second modified oligonucleotide comprises no more than five 2’-F sugar modifications. In certain embodiments, the compound of any preceding embodiment comprises a conjugate group. In certain embodiments, the conjugate group is attached to the 5’ end of the modified oligonucleotide. In certain embodiments, the conjugate group is a targeting moiety. In certain embodiments, the targeting moiety comprises one or more TrkB ligands. In certain embodiments, the targeting moiety comprises one or more CB1ligands. In certain embodiments, the targeting moiety comprises one or more α4β1 / 7integrin ligands. In certain embodiments, the targeting moiety comprises one or more NMDA ligands. In certain embodiments, the modified oligonucleotide is the second modified oligonucleotide or sense oligonucleotide. In certain embodiments, the one or more TrkB ligands is attached at the 5’ or 3’ end of the oligonucleotide or both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the one or more CB1 ligands is attached at the 5’ or 3’ end of the oligonucleotide or both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the one or more α4β1 / 7 integrin ligands is attached at the 5’ or 3’ end of the oligonucleotide or both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the one or more NMDA ligands is attached at the 5’ or 3’ end of the oligonucleotide or both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the TrkB ligand of a modified oligonucleotide is of the Formula (I) or a salt, solvate, or hydrate thereof: Formula (I), wherein: R1is the modified oligonucleotide; L1, L2, L3, and L4are as described herein; R2is hydrogen, -OR7, -SR8, or -NR9R10; R3is hydrogen, -OR11, -SR12, or -NR13R14; R4is hydrogen, -OR15, -SR16, or -NR17R18; R5is hydrogen, -OR19, -SR20, or -NR21R22; R6is hydrogen, -OH, optionally substituted -O-alkyl, optionally substituted -OAc, - NH2, optionally substituted -NHAc, -SH, or =O; R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19, R20, R21, and R22are each independently hydrogen, optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl; Y is CH2, NH, S, or O; and Z is optionally substituted aryl or optionally substituted heteroaryl. In certain embodiments, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19, R20, R21, and R22are each independently optionally substituted unsaturated or partially unsaturated alkyl. In certain embodiments, R7, R8, R9, and R10are each independently alkenyl. In certain embodiments, R7, R8, R9, and R10are each independently alkynyl. In certain embodiments, R2is OR7. In certain embodiments, R3is OR11. In certain embodiments, R7and R11are each independently hydrogen, optionally substituted alkyl or optionally substituted alkenyl. In certain embodiments, one or both R7and R11are each independently hydrogen. In certain embodiments, one or both R7and R11are each independently optionally substituted alkyl. In certain embodiments, one or both R7and R11are each independently optionally substituted unsaturated or partially unsaturated alkyl. In certain embodiments, one or both R7and R11are each independently alkenyl. In certain embodiments, R7is optionally substituted alkyl and R11is hydrogen. In certain embodiments, R7is hydrogen and R11is optionally substituted alkyl. In certain embodiments, R7is alkenyl and R11is hydrogen. In certain embodiments, R7is hydrogen and R11is optionally substituted alkenyl. In certain embodiments, the TrkB ligand of a modified oligonucleotide is selected from the following Formulae or a salt, solvate, or hydrate thereof: Formula (II-C), wherein: R1is the modified oligonucleotide; L1, L2, L3, and L4are as described herein. In certain embodiments, the TrkB ligand of a modified oligonucleotide is of the Formula (XXX) or a salt, solvate, or hydrate thereof: wherein: L1, L2, L3, L4, and R1are as described herein; R11and R13are each independently absent, hydrogen, or optionally substituted alkyl; R12, R14, and R15are each independently hydrogen, optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, or optionally substituted heteroaryl; R16is hydrogen, halogen, –CN, –N3, –SOn16R1A, –SOv16NR16BR16C, −NHNR16BR16C, −ONR16BR16C, −NHC(O)NHNR16BR16C, −NHC(O)NR16BR16C, –N(O)m16, –NR16BR16C, –C(O)R16D, –C(O)OR16D, –C(O)NR16BR16C, –OR16A, -NR16BSO2R16A, -NR16BC(O)R16D, - NR16BC(O)OR16D, –NR16BOR16D, optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, or optionally substituted heteroaryl; and are each independently a single bond or a double bond, wherein if is a single bond, then is a double bond and R13is absent; and further wherein if is a single bond, then is a double bond and R11is absent; R16A, R16B, R16C, R16Dare each independently hydrogen, halogen, –CF3, –CCl3, –CBr3, –CI3, –COOH, –CONH2, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or R16Band R16Csubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl; z3 is 0, 1, 2, 3, 4, or 5; n16 is 0, 1, 2, 3, or 4; and v16 and m16 are each independently 1 or 2. In certain embodiments, the α4β1 / 7 integrin ligand of a modified oligonucleotide is of the Formula (XXXI) or a salt, solvate, or hydrate thereof: . Formula (XXXI) wherein L1, L2, L3, L4, and R1are as described herein; R2, R3, R4, and R5are each independently H, halogen, optionally substituted alkyl, optionally substituted -O-alkyl, cycloalkyl, or absent; R8is optionally substituted C1-C5alkyl, optionally substituted C1-C5alkylene-(C3- C6)-cycloalkyl, or optionally substituted (C1-C4)-alkylene-(C1-C4)-alkoxy; and R6, and R7are each independently H, halogen, alkyl, or optionally substituted alkyl, , In certain embodiments, the α4β1 / 7 integrin ligand of a modified oligonucleotide is of the Formula (XXXII) or a salt, solvate, or hydrate thereof: wherein L1, L2, L3, L4, and R1are as described herein; R2is H, polyethylene glycol (PEG), optionally substituted heteroalkyl, or optionally substituted heteroaryl; and R3and R4are each independently H, halogen, optionally substituted alkyl, or optionally substituted -O-alkyl. In certain embodiments, L1, L2, L3, and L4are each independently absent, a bond, an optionally substituted alkyl linker, an optionally substituted polyethylene glycol (PEG) linker, an optionally substituted heteroalkyl linker, or an optionally substituted heteroaryl linker. In certain embodiments, L1is an optionally substituted heteroaryl linker. In certain embodiments, L1is an optionally substituted unsaturated heteroaryl, an optionally substituted heteroaryl or an optionally substituted saturated or partially unsaturated heterocycloalkyl linker. In certain embodiments, L1comprises the structure: . In certain embodiments, L1is an optionally substituted heteroalkyl linker. In certain embodiments, the optionally substituted heteroalkyl linker is an optionally substituted heteroalkyl or optionally substituted C1-10alkyl chain in which one or more carbon atoms are replaced with O, N, or S. In certain embodiments, L1comprises the structure: . In certain embodiments, L1comprises the structure: or –N(CH3)–. In certain embodiments, L2is an optionally substituted PEG linker. In certain embodiments, the PEG linker is five PEG units in length. In certain embodiments, the PEG linker is four PEG units in length. In certain embodiments, the PEG linker is three PEG units in length. In certain embodiments, L2is an optionally substituted alkyl linker. In certain embodiments, L2is an optionally substituted C1-20 alkyl linker. In certain embodiments, L2is an optionally substituted C8 alkyl linker. In certain embodiments, L3is an optionally substituted heteroaryl linker. In certain embodiments, L3is an optionally substituted partially unsaturated heteroaryl linker, an optionally substituted heteroaryl or an optionally substituted saturated or partially unsaturated heterocycloalkyl linker. In certain embodiments, L3comprises the structure: . In certain embodiments, L4is an optionally substituted heteroalkyl linker. In certain embodiments, the heteroalkyl linker is substituted with one or more =O substituents. In certain embodiments, the heteroalkyl linker comprises two substituents joined together to form an optionally substituted carbocyclyl ring. In certain embodiments, L4comprises the structure: salt thereof, wherein X is O or S. In certain embodiments, L4comprises the structure: salt thereof, wherein X is O or S. In certain embodiments, L1– L2–L3–L4comprises the structure: ,

[0002] , ,

[0003] , ,

[0004] , , or a salt thereof, wherein X is O or S. In certain embodiments, the TrkB ligand of a modified oligonucleotide is selected from the following Formulae or a salt, solvate, or hydrate thereof: Formula (V), Formula (IX), Formula (XII),

[0005] Formula (XX),

[0006] Formula (XXV) wherein: R is the modified oligonucleotide; X is S or O. In certain embodiments, the CB1ligand of a modified oligonucleotide is selected from the following Formulae or a salt, solvate, or hydrate thereof: R is the modified oligonucleotide; X is S or O. In certain embodiments, the α4β1 / 7integrin ligand of a modified oligonucleotide is selected from the following Formulae or a salt, solvate, or hydrate thereof:

[0007] Formula (XXVIII) wherein: R is the modified oligonucleotide; X is S or O. In certain embodiments, the NMDA ligand of a modified oligonucleotide is selected from the following Formulae or a salt, solvate, or hydrate thereof:

[0008] Formula (XXIX) wherein: R is the modified oligonucleotide; X is S or O. In certain embodiments, the compound of any preceding embodiment comprises a lipid. In certain embodiments, the lipid is attached to an internucleoside linkage of the modified oligonucleotide. In certain embodiments, the modified oligonucleotide comprises one or more lipids. In certain embodiments, the one or more lipids are attached to one or more internucleoside linkages of the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is the second modified oligonucleotide or sense oligonucleotide. In certain embodiments, the compound of any preceding embodiment comprises one or more substituted or unsubstituted alkyl or alkenyl. In certain embodiments, the substituted or unsubstituted alkyl or alkenyl is attached to an internucleoside linkage of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide comprises one or more substituted or unsubstituted alkyl or alkenyl. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl are attached to one or more internucleoside linkages of the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is the second modified oligonucleotide or sense oligonucleotide. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C4-C30hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C5-C20 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C14-C20hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C16 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C17 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C18 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C22hydrocarbon chain. In certain embodiments, a substituted or unsubstituted alkyl or alkenyl is attached to an internucleoside linkage of a modified oligonucleotide (e.g., a second modified oligonucleotide or sense oligonucleotide). In certain embodiments, the internucleoside linkage is between nucleosides that are within 10 positions (e.g., within 8 positions, within 6 positions, within 5 positions, within 4 positions, within 3 positions, within 2 positions) from a terminal end (e.g., the 5′ and / or 3′ end) of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between nucleosides that are within 5 positions from the 5′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between nucleosides that are within 5 positions from the 3′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, positions 7 and 8, positions 8 and 9, positions 9 and 10, positions 10 and 11, positions 11 and 12, positions 12 and 13, or positions 13 and 14 from the 5′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, or positions 7 and 8 from the 5′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 2 and 3 from the 5′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, positions 7 and 8, positions 8 and 9, positions 9 and 10, positions 10 and 11, positions 11 and 12, positions 12 and 13, or positions 13 and 14 from the 3′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, or positions 7 and 8 from the 3′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 2 and 3 from the 3′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage of the modified oligonucleotide is selected from any one of Formulae XXI-XXIV and XXXIII-XXXV. In certain embodiments, an internucleoside linkage of the modified oligonucleotide comprises Formula (XXI), or a salt solvate, or hydrate thereof: Formula (XXI), wherein: Y is –C(=O)N(RC)–, or –N(RC)C(=O)–; Q1and Q3are each independently –H, –OR4, a ligand, a linker, or a lipid; Q2and Q4are each independently a bond, , a ligand, a linker, or a lipid; RCis independently –H, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R2is independently –H, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, –OR6, -N(R6), or -SR6; each R3is independently –H, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, –OR7, -N(R7), or -SR7; R4and R5are independently an oligonucleotide, or R4and R5are joined together to form a single oligonucleotide; each R6is independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted heteroalkyl; each R7is independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted heteroalkyl; each R8is independently an substituted or unsubstituted heteroaryl; each R9is independently an substituted or unsubstituted heteroaryl; each instance of Z1or Z2is independently a bond, C1-C6alkylene, or C2-C6alkenylene; and each X is independently O or S; or a salt thereof. In certain embodiments, an internucleoside linkage of the modified oligonucleotide comprises Formula (XXII), or a salt solvate, or hydrate thereof: Formula (XXII), wherein: RCis –H, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R2is independently –H, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, –OR6, -N(R6), or -SR6; each R3is independently –H, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, –OR7, -N(R7), or -SR7; R4and R5are independently an oligonucleotide, or R4and R5are joined together to form a single oligonucleotide; each R6is independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted heteroalkyl; each R7is independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted heteroalkyl; each R8is independently a substituted or unsubstituted heteroaryl ring; each R9is independently a substituted or unsubstituted heteroaryl ring; and each X is independently O or S; or a salt or prodrug thereof. In certain embodiments, an internucleoside linkage of the modified oligonucleotide comprises Formula (XXIII), or a salt solvate, or hydrate thereof:

[0009] Formula (XXIII), wherein: each R2is independently –H, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, –OR6, -N(R6), or -SR6; each R3is independently –H, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, –OR7, -N(R7), or -SR7; R4and R5are independently an oligonucleotide, or R4and R5are joined together to form a single oligonucleotide; each R6is independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted heteroalkyl; each R7is independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted heteroalkyl; each R8is independently a substituted or unsubstituted heteroaryl ring; each R9is independently a substituted or unsubstituted heteroaryl ring; and each X is independently O or S; or a salt or prodrug thereof. In certain embodiments, an internucleoside linkage of the modified oligonucleotide comprises Formula (XXIV), or a salt solvate, or hydrate thereof:

[0010] Formula (XXIV). wherein: R4and R5are independently an oligonucleotide, or R4and R5are joined together to form a single oligonucleotide; and each X is independently O or S. In certain embodiments, an internucleoside linkage of the modified oligonucleotide comprises Formula (XXXIII), or a salt solvate, or hydrate thereof: Formula (XXXIII) wherein: R4and R5are independently an oligonucleotide, or R4and R5are joined together to form a single oligonucleotide; and each X is independently O or S. In certain embodiments, an internucleoside linkage of the modified oligonucleotide comprises Formula (XXXIV), or a salt solvate, or hydrate thereof: Formula (XXXIV) wherein: R4and R5are independently an oligonucleotide, or R4and R5are joined together to form a single oligonucleotide; and each X is independently O or S. In certain embodiments, an internucleoside linkage of the modified oligonucleotide comprises Formula (XXXV), or a salt solvate, or hydrate thereof: wherein: R4and R5are independently an oligonucleotide, or R4and R5are joined together to form a single oligonucleotide; and each X is independently O or S. In certain embodiments, the compound of any preceding embodiment comprises a 5′- phosphonate modification. For example, in certain embodiments, a modified oligonucleotide comprises one or more sugars having a phosphonate modification at the 5′ position. In certain embodiments, the modified oligonucleotide comprises a 5′-phosphonate modification. In certain embodiments, the modified oligonucleotide comprises a 5′-terminal nucleoside (e.g., 5′ terminus) comprising the 5′-phosphonate modification. In certain embodiments, the 5′-phosphonate modification is a 5′-vinylphosphonate modification or a 5′- ethylenephosphonate modification. In certain embodiments, the 5′-phosphonate modification is a 5′-vinylphosphonate modification. In certain embodiments, the 5′-phosphonate modification is a 5′-ethylenephosphonate modification. In certain embodiments, the modified oligonucleotide is the first modified oligonucleotide or antisense oligonucleotide. Certain embodiments provide a compound comprising: a first modified oligonucleotide comprising a 5′-phosphonate modification, where the first modified oligonucleotide is at least 80% complementary to a region of SEQ ID NO: 1 or 2; and a second modified oligonucleotide comprising one or more ligands. In some embodiments, the first modified oligonucleotide comprises a 5′-terminal nucleoside comprising the 5′-phosphonate modification. In some embodiments, the 5′- phosphonate modification is a 5′-vinylphosphonate modification or a 5′-ethylenephosphonate modification. In some embodiments, the 5′-phosphonate modification is a 5′- vinylphosphonate modification. In some embodiments, the 5′-phosphonate modification is a 5′-ethylenephosphonate modification. In some embodiments, the second modified oligonucleotide comprises one or more ligands selected from one or more TrkB ligands, one or more CB1 ligands, one or more α4β1 / 7 integrin ligands, and one or more NMDA ligands. In some embodiments, the one or more TrkB ligands, the one or more CB1 ligands, the one or more α4β1 / 7 integrin ligands, or the one or more NMDA ligands are attached to the 5’ end of the second modified oligonucleotide. In some embodiments, the one or more TrkB ligands, the one or more CB1ligands, the one or more α4β1 / 7integrin ligands, or the one or more NMDA ligands are attached to the 3’ end of the second modified oligonucleotide. In some embodiments, the one or more TrkB ligands, the one or more CB1 ligands, the one or more α4β1 / 7 integrin ligands, or the one or more NMDA ligands are attached to the 5’ end and the 3’ end of the second modified oligonucleotide. In some embodiments, the one or more TrkB ligands are selected from any one of Formulae I-XX, XXV, and XXX; the one or more CB1 ligands are of Formula XXVI; the one or more α4β1 / 7integrin ligands are selected from any one of Formulae XXVII, XXVIII, XXXI, and XXXII; and the one or more NMDA ligands are of Formula XXIX. In some embodiments, the second modified oligonucleotide comprises one or more TrkB ligands. In some embodiments, the one or more TrkB ligands are selected from any one of Formulae I-XX, XXV, and XXX. In some embodiments, the second modified oligonucleotide comprises one TrkB ligand. In some embodiments, the second modified oligonucleotide comprises two TrkB ligands. In some embodiments, the second modified oligonucleotide comprises at least two TrkB ligands. In some embodiments, the at least two TrkB ligands are the same. In some embodiments, the at least two TrkB ligands are different. In some embodiments, the second modified oligonucleotide comprises one or more CB1ligands. In some embodiments, the one or more CB1ligands are of Formula XXVI. In some embodiments, the second modified oligonucleotide comprises one CB1 ligand. In some embodiments, the second modified oligonucleotide comprises two CB1 ligands. In some embodiments, the second modified oligonucleotide comprises at least two CB1ligands. In some embodiments, the at least two CB1 ligands are the same. In some embodiments, the at least two CB1 ligands are different. In some embodiments, the second modified oligonucleotide comprises one or more α4β1 / 7integrin ligands. In some embodiments, the one or more α4β1 / 7integrin ligands are selected from any one of Formulae XXVII, XXVIII, XXXI, and XXXII. In some embodiments, the second modified oligonucleotide comprises one α4β1 / 7 integrin ligand. In some embodiments, the second modified oligonucleotide comprises two α4β1 / 7integrin ligands. In some embodiments, the second modified oligonucleotide comprises at least two α4β1 / 7 integrin ligands. In some embodiments, the at least two α4β1 / 7 integrin ligands are the same. In some embodiments, the at least two α4β1 / 7integrin ligands are different. In some embodiments, the second modified oligonucleotide comprises one or more NMDA ligands. In some embodiments, the one or more NMDA ligands are of Formula XXIX. In some embodiments, the second modified oligonucleotide comprises one NMDA ligand. In some embodiments, the second modified oligonucleotide comprises two NMDA ligands. In some embodiments, the second modified oligonucleotide comprises at least two NMDA ligands. In some embodiments, the at least two NMDA ligands are the same. In some embodiments, the at least two NMDA ligands are different. In some embodiments, the second modified oligonucleotide comprises one or more lipids. In some embodiments, the second modified oligonucleotide comprises one or more substituted or unsubstituted alkyl or alkenyl. In some embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C4-C30 hydrocarbon chain. In some embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C5-C20hydrocarbon chain. In some embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C14-C20 hydrocarbon chain. In some embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C16 hydrocarbon chain, a saturated or unsaturated C17hydrocarbon chain, a saturated or unsaturated C18 hydrocarbon chain, or a saturated or unsaturated C22 hydrocarbon chain. In some embodiments, the one or more substituted or unsubstituted alkyl or alkenyl are attached to an internucleoside linkage of the second modified oligonucleotide. In certain embodiments, the internucleoside linkage is between nucleosides that are within 10 positions (e.g., within 8 positions, within 6 positions, within 5 positions, within 4 positions, within 3 positions, within 2 positions) from a terminal end (e.g., the 5′ and / or 3′ end) of the second modified oligonucleotide. In certain embodiments, the internucleoside linkage is between nucleosides that are within 5 positions from the 5′ end of the second modified oligonucleotide. In certain embodiments, the internucleoside linkage is between nucleosides that are within 5 positions from the 3′ end of the second modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, positions 7 and 8, positions 8 and 9, positions 9 and 10, positions 10 and 11, positions 11 and 12, positions 12 and 13, or positions 13 and 14 from the 5′ end of the second modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, or positions 7 and 8 from the 5′ end of the second modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 2 and 3 from the 5′ end of the second modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, positions 7 and 8, positions 8 and 9, positions 9 and 10, positions 10 and 11, positions 11 and 12, positions 12 and 13, or positions 13 and 14 from the 3′ end of the second modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, or positions 7 and 8 from the 3′ end of the second modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 2 and 3 from the 3′ end of the second modified oligonucleotide. In some embodiments, the internucleoside linkage of the second modified oligonucleotide is selected from any one of Formulae XXI-XXIV and XXXIII-XXXV. In some embodiments, the first modified oligonucleotide is 14 to 30 linked nucleosides in length. In some embodiments, the second modified oligonucleotide is 14 to 30 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In some embodiments, the first modified oligonucleotide has a nucleobase sequence comprising at least 14 contiguous nucleobases of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In some embodiments, the second modified oligonucleotide has a nucleobase sequence comprising at least 14 contiguous nucleobases of any one of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In some embodiments, the first modified oligonucleotide is selected from any one of the IA Ref ID NOs in Table 3. In some embodiments, the second modified oligonucleotide is selected from any one of the IS Ref ID NOs in Table 3. Certain embodiments provide a compound comprising a first modified oligonucleotide selected from the group consisting of any one of Ref ID NOs listed in Table 3 and a second modified oligonucleotide 14 to 21 linked nucleosides in length fully complementary to the first modified oligonucleotide. Certain embodiments provide a compound comprising a first modified oligonucleotide selected from the group consisting of any one of the IA Ref ID NOs listed in Table 3 and a second modified oligonucleotide selected from the group consisting of any one of the IS Ref ID NOs listed in Table 3. In certain embodiments, the pharmaceutically acceptable salt of the modified oligonucleotides provided herein is a sodium salt or a potassium salt. In certain embodiments, the pharmaceutically acceptable salt of the compounds provided herein is a sodium salt or a potassium salt. In certain embodiments, provided herein is a population of modified oligonucleotides, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom. In certain embodiments, provided herein is a population of compounds, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotide are stereorandom. In certain embodiments, the compound of any foregoing embodiment is in a pharmaceutically acceptable salt form. In certain embodiments, the pharmaceutically acceptable salt is a sodium salt. In certain embodiments, the pharmaceutically acceptable salt is a potassium salt. Certain embodiments provide a composition comprising the compound of any one of the foregoing embodiments and a pharmaceutically acceptable carrier. Certain embodiments provide a composition comprising a compound of any preceding embodiment, for use in therapy. Certain embodiments provide a method of treating, preventing, or ameliorating a disease, disorder or condition associated with SOD1 in an individual comprising administering to the individual a compound targeted to SOD1, thereby treating, preventing, or ameliorating the disease. In certain embodiments, the compound or composition of any foregoing embodiment is administered to an individual. In certain embodiments, the disease, disorder or condition is a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, administering the compound inhibits or reduces or improves a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual in a therapeutically effective amount. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual at a dosage level sufficient to deliver about 1 to 100 mg / kg of body weight of the individual. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual at a fixed dose of about 25 mg to about 1,000 mg. In certain embodiments, the compound or composition is administered to the individual one or more times in a day up to the dosage level or fixed dose. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual daily, weekly, monthly, quarterly or yearly. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual about once per quarter (i.e., once every three months) to about once per year. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual about once per quarter, about once every six months or about once per year. Certain embodiments provide a method of inhibiting expression of SOD1 in a cell comprising contacting the cell with a compound targeted to SOD1, thereby inhibiting expression of SOD1 in the cell. In certain embodiments, the cell is in the liver of an individual. In certain embodiments, the individual has, or is at risk of having, a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. Certain embodiments provide a method of reducing or inhibiting a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death in an individual, comprising administering a compound targeted to SOD1 to the individual, thereby reducing or inhibiting a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death in the individual. In certain embodiments, the individual has, or is at risk of having, a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, the compound is a compound targeted to SOD1. In certain embodiments, the compound is any of the foregoing compounds. In certain embodiments, the compound or composition is administered parenterally. In certain embodiments, the compound or composition is administered by intrathecal (IT) administration. Certain embodiments provide use of a compound targeted to SOD1 for treating, preventing, or ameliorating a disease, disorder or condition associated with SOD1. In certain embodiments, the disease, disorder or condition is a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, the compound is a compound targeted to SOD1. In certain embodiments, the compound is any of the foregoing compounds. Certain embodiments provide use of a compound targeted to SOD1 in the manufacture of a medicament for treating, preventing, or ameliorating a disease, disorder or condition associated with SOD1. In certain embodiments, the disease, disorder or condition is a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, the compound is a compound targeted to SOD1. In certain embodiments, the compound is any of the foregoing compounds. Certain Indications In certain aspects, the disclosure relates to methods of inhibiting SOD1 expression, which can be useful for treating, preventing, or ameliorating a disease associated with SOD1 in an individual, by administration of a compound that targets SOD1. In certain embodiments, the compound can be a SOD1 specific inhibitor. In certain embodiments, the compound can be an antisense oligonucleotide, an oligomeric compound, or an oligonucleotide targeted to SOD1. In certain aspects, the disclosure relates to treating, preventing, or ameliorating a disease, disorder or condition associated with SOD1. In certain embodiments, diseases, disorders or conditions associated with SOD1 treatable, preventable, and / or ameliorable with the methods provided herein include a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. Certain compounds provided herein are directed to compounds and compositions that reduce a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death in an animal. In certain embodiments, a method of treating, preventing, or ameliorating a disease associated with SOD1 in an individual comprises administering to the individual a compound comprising a SOD1 specific inhibitor, thereby treating, preventing, or ameliorating the disease. In certain embodiments, the individual is identified as having, or at risk of having, a disease associated with SOD1. In certain embodiments, the disease is a CNS related disease. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to SOD1. In certain embodiments, the compound comprises an oligonucleotide targeted to SOD1. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides) in length having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184- 187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203- 213. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223 and a second modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In certain embodiments, a single-stranded compound can be 14 to 30, 14 to 23, 14 to 20, 16 to 20, or 14 to 16, linked nucleosides in length. In certain embodiments, a single-stranded compound can be 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, linked nucleosides in length. In certain embodiments, a double-stranded compound can comprise two oligonucleotides of the same or different lengths, as described elsewhere herein. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the compound is administered to the individual by intrathecal (IT) administration. In certain embodiments, administering the compound improves, preserves, or prevents a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death in an animal. In certain embodiments, a method of treating, preventing, or ameliorating a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death in an animal comprises administering to the individual a compound comprising a SOD1 specific inhibitor, thereby treating, preventing, or ameliorating a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to SOD1. In certain embodiments, the compound comprises an oligonucleotide targeted to SOD1. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, or 203-213. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107- 183, 188-195, and 203-213. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223 and a second modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203- 213. In any of the foregoing embodiments, the compound can be single-stranded or double- stranded. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, administering the compound improves, preserves, or prevents a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death in an animal. In certain embodiments, the individual is identified as having, or at risk of having, a disease associated with SOD1. In certain embodiments, a method of inhibiting expression of SOD1 in an individual having, or at risk of having, a disease associated with SOD1 comprises administering to the individual a compound comprising a SOD1 specific inhibitor, thereby inhibiting expression of SOD1 in the individual. In certain embodiments, administering the compound inhibits expression of SOD1 in the liver. In certain embodiments, the disease is a CNS related disease. In certain embodiments, the individual has, or is at risk of having, a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to SOD1. In certain embodiments, the compound comprises an oligonucleotide targeted to SOD1. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107- 183, 188-195, and 203-213. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223 and a second modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203- 213. In any of the foregoing embodiments, the compound can be single-stranded or double- stranded. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the compound is administered to the individual by intrathecal (IT) administration. In certain embodiments, administering the compound improves, preserves, or prevents a CNS related disease, disorder or condition or a symptom thereof, a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, a method of inhibiting expression of SOD1 in a cell comprises contacting the cell with a compound comprising a SOD1 specific inhibitor, thereby inhibiting expression of SOD1 in the cell. In certain embodiments, the cell is a hepatocyte. In certain embodiments, the cell is in the liver. In certain embodiments, the cell is in the liver of an individual who has, or is at risk of having, a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to SOD1. In certain embodiments, the compound comprises an oligonucleotide targeted to SOD1. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28- 106, 184-187, 196-202, and 214-223 and a second modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11- 223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a method of reducing or inhibiting a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death in an individual having, or at risk of having, a disease associated with SOD1 comprises administering to the individual a compound comprising a SOD1 specific inhibitor, thereby reducing or inhibiting a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death in the individual. In certain embodiments, the individual has, or is at risk of having, a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to SOD1. In certain embodiments, the compound comprises an oligonucleotide targeted to SOD1. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, or 203-213. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28- 106, 184-187, 196-202, and 214-223 and a second modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11- 223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the compound is administered to the individual by intrathecal (IT) administration. In certain embodiments, the individual is identified as having, or at risk of having, a disease associated with SOD1. Certain embodiments are drawn to a compound comprising a SOD1 specific inhibitor for use in treating a disease, disorder or condition associated with SOD1. In certain embodiments, the disease, disorder or condition is a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to SOD1. In certain embodiments, the compound comprises an oligonucleotide targeted to SOD1. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184- 187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, or 203-213. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203- 213. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223 and a second modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In certain embodiments, the compound is administered to the individual parenterally. In certain embodiments, the compound is administered to the individual by intrathecal (IT) administration. Certain embodiments are drawn to a compound comprising a SOD1 specific inhibitor for use in reducing or inhibiting a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to SOD1. In certain embodiments, the compound comprises an oligonucleotide targeted to SOD1. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11- 223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. Certain embodiments are drawn to the use of a compound comprising a SOD1 specific inhibitor for the manufacture or preparation of a medicament for treating a disease associated with SOD1. Certain embodiments are drawn to the use of a compound comprising a SOD1 specific inhibitor for the preparation of a medicament for treating a disease, disorder or condition associated with SOD1. In certain embodiments, the disease, disorder or condition is a CNS related disease, disorder or condition or a symptom thereof. In certain embodiments, the disease, disorder or condition is a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to SOD1. In certain embodiments, the compound comprises an oligonucleotide targeted to SOD1. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184- 187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, or 203-213. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203- 213. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223 and a second modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. Certain embodiments are drawn to the use of a compound comprising a SOD1 specific inhibitor for the manufacture or preparation of a medicament for reducing or inhibiting a CNS related disease, disorder or condition or a symptom thereof in an individual having, or at risk of having, a CNS related disease, disorder or condition or a symptom thereof associated with SOD1. In certain embodiments, the CNS related disease, disorder or condition is a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. Certain embodiments are drawn to use of a compound comprising a SOD1 specific inhibitor for the preparation of a medicament for treating a disease, disorder or condition associated with SOD1. In certain embodiments, the disease, disorder or condition is a CNS related disease, disorder or condition or a symptom thereof or a neurodegenerative disease or a symptom thereof, including ALS or a symptom thereof such as loss of motor function or neuron death. In certain embodiments, the compound comprises an antisense oligonucleotide targeted to SOD1. In certain embodiments, the compound comprises an oligonucleotide targeted to SOD1. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) and having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, a compound comprises a modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, and 214-223. In certain embodiments, a compound comprises a modified oligonucleotide selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In certain embodiments, the compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 11-18, 28- 106, 184-187, 196-202, and 214-223 and a second modified oligonucleotide having a nucleobase sequence selected from the group consisting of the nucleobase sequence of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213. In any of the foregoing embodiments, the compound can be single-stranded or double-stranded. In any of the foregoing embodiments, the compound can be an antisense oligonucleotide or oligomeric compound. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11- 223 and a second modified oligonucleotide (e.g., of 14 to 30, for example, 14 to 23, linked nucleosides in length) having a region of complementarity to the first modified oligonucleotide. In certain embodiments, a compound comprises a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. In any of the foregoing methods or uses, the compound can be an oligomeric compound. In any of the foregoing methods or uses, the compound can be single-stranded or double-stranded. In any of the foregoing methods or uses, the compound can be targeted to SOD1. In certain embodiments, the compound comprises or consists of a modified oligonucleotide. In certain embodiments, the compound comprises one or more modified oligonucleotides. In certain embodiments, the compound comprises a first modified oligonucleotide and a second modified oligonucleotide. In certain embodiments, a modified oligonucleotide is 8 to 80 linked nucleosides in length, 10 to 30 linked nucleosides in length, 14 to 30 linked nucleosides in length, 14 to 23 linked nucleosides in length, or 19 to 23 linked nucleosides in length. In certain embodiments, a modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95% or 100% complementary to the nucleobase sequence recited in SEQ ID NO: 1 over its length. In certain embodiments, a modified oligonucleotide comprises at least one modified internucleoside linkage, at least one modified sugar and / or at least one modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage. In certain embodiments, the modified sugar is a bicyclic sugar, 2’-MOE, 2’-F, or 2’-OMe. In certain embodiments, the modified nucleobase is a 5-methylcytosine. In any of the foregoing embodiments, each modified oligonucleotide is independently 12 to 30, 14 to 30, 14 to 25, 14 to 24, 14 to 23, 16 to 23, 17 to 23, 18 to 23, 19 to 23, 19 to 22, or 19 to 20 linked nucleosides in length. In certain embodiments, a modified oligonucleotide has at least 1, at least 2, at least 3 mismatches to a region of SEQ ID NO: 1 or 2. In any of the forgoing methods or uses, the compound comprises a first and second modified oligonucleotide, wherein there is a region of complementarity between a first modified oligonucleotide and a second modified oligonucleotide. In certain embodiments, the region of complementarity between the first oligonucleotide and the second oligonucleotide is 14 to 23, 19 to 23, or 21 to 23 linked nucleosides in length. In certain embodiments, the first modified oligonucleotide is fully complementary to the second modified oligonucleotide. In certain embodiments, the first modified oligonucleotide comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the second modified oligonucleotide comprises at least one modification selected from the group consisting of a modified internucleoside linkage, a modified sugar, and a modified nucleobase. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage or a methylphosphonate internucleoside linkage. In certain embodiments, the modified internucleoside linkage is at the 3’ terminus of the first or second modified oligonucleotide or at the 5’ terminus of the first or second modified oligonucleotide. In certain embodiments, the first or second modified oligonucleotide comprises one or more modified sugars. In certain embodiments, each nucleoside of the first or second modified oligonucleotide comprises a modified sugar. In certain embodiments, the modified sugar comprises a modification selected from the group consisting of a halogen, an alkoxy group and a bicyclic sugar. In certain embodiments, the modified sugar comprises a modification selected from group consisting of 2’-MOE, 2’-F, and 2’-OMe or a combination thereof. In certain embodiments, the first or second modified oligonucleotide comprises no more than ten 2’-F sugar modifications. In certain embodiments, the first or second modified oligonucleotide comprises no more than five 2’-F sugar modifications. In any of the forgoing methods or uses, a compound comprises a conjugate group. In certain embodiments, the conjugate group is attached to the 5’ end of a modified oligonucleotide. In certain embodiments, the conjugate group is a targeting moiety. In certain embodiments, the targeting moiety comprises one or more TrkB ligands. In certain embodiments, the one or more TrkB ligands is attached at the 5’ or 3’ end of the oligonucleotide or both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the TrkB ligand is selected from Formulae I-XX, XXV, and XXX, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is attached to the TrkB ligand through a phosphodiester group. In certain embodiments, the modified oligonucleotide is attached to the TrkB ligand through a phosphorothioate group. In certain embodiments, the targeting moiety comprises one or more CB1ligands. In certain embodiments, the one or more CB1ligands is attached at the 5’ or 3’ end of the oligonucleotide or both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the CB1 ligand is of Formula XXVI, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is attached to the CB1ligand through a phosphodiester group. In certain embodiments, the modified oligonucleotide is attached to the CB1 ligand through a phosphorothioate group. In certain embodiments, the targeting moiety comprises one or more α4β1 / 7integrin ligands. In certain embodiments, the one or more α4β1 / 7integrin ligands is attached at the 5’ or 3’ end of the oligonucleotide or both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the α4β1 / 7 integrin ligand is selected from Formulae XXVII, XXVIII, XXXI, and XXXII, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is attached to the α4β1 / 7 integrin ligand through a phosphodiester group. In certain embodiments, the modified oligonucleotide is attached to the α4β1 / 7 integrin ligand through a phosphorothioate group. In certain embodiments, the targeting moiety comprises one or more NMDA ligands. In certain embodiments, the one or more NMDA ligands is attached at the 5’ or 3’ end of the oligonucleotide or both the 5’ and 3’ ends of the oligonucleotide. In certain embodiments, the NMDA ligand is of Formula XXIX, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is attached to the NMDA ligand through a phosphodiester group. In certain embodiments, the modified oligonucleotide is attached to the NMDA ligand through a phosphorothioate group. In certain embodiments, the conjugate group comprises one or more lipids. In certain embodiments, the modified oligonucleotide is the second modified oligonucleotide. In certain embodiments, the one or more lipids are attached to an internucleoside linkage of the modified oligonucleotide. In certain embodiments, the internucleoside linkage of the modified oligonucleotide is selected from any one of Formulae XXI-XXIV and XXXIII-XXXV, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide. In certain embodiments, the modified oligonucleotide comprises one or more TrkB ligands and one or more lipids. In certain embodiments, the modified oligonucleotide comprises one or more CB1 ligands and one or more lipids. In certain embodiments, the modified oligonucleotide comprises one or more α4β1 / 7integrin ligands and one or more lipids. In certain embodiments, the modified oligonucleotide comprises one or more NMDA ligands and one or more lipids. In certain embodiments, the modified oligonucleotide is the second modified oligonucleotide. In certain embodiments, the one or more TrkB ligands is attached to the 5’ end of the modified oligonucleotide. In certain embodiments, the one or more TrkB ligands is attached to the 3’ end of the modified oligonucleotide. In certain embodiments, the one or more TrkB ligands is attached to the 5’ end and the 3’ end of the modified oligonucleotide. In certain embodiments, the one or more lipids are attached to an internucleoside linkage of the modified oligonucleotide. In certain embodiments, the one or more TrkB ligands is selected from any one of Formulae I-XX, XXV, and XXX, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide, and the internucleoside linkage of the modified oligonucleotide is selected from any one of Formulae XXI-XXIV and XXXIII-XXXV, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide. In certain embodiments, the one or more CB1ligands is attached to the 5’ end of the modified oligonucleotide. In certain embodiments, the one or more CB1ligands is attached to the 3’ end of the modified oligonucleotide. In certain embodiments, the one or more CB1 ligands is attached to the 5’ end and the 3’ end of the modified oligonucleotide. In certain embodiments, the one or more lipids are attached to an internucleoside linkage of the modified oligonucleotide. In certain embodiments, the one or more CB1 ligands is of Formula XXVI, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide, and the internucleoside linkage of the modified oligonucleotide is selected from any one of Formulae XXI-XXIV and XXXIII-XXXV, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide. In certain embodiments, the one or more α4β1 / 7 integrin ligands is attached to the 5’ end of the modified oligonucleotide. In certain embodiments, the one or more α4β1 / 7 integrin ligands is attached to the 3’ end of the modified oligonucleotide. In certain embodiments, the one or more α4β1 / 7 integrin ligands is attached to the 5’ end and the 3’ end of the modified oligonucleotide. In certain embodiments, the one or more lipids are attached to an internucleoside linkage of the modified oligonucleotide. In certain embodiments, the one or more α4β1 / 7 integrin ligands is selected from any one of Formulae XXVII, XXVIII, XXXI, and XXXII, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide, and the internucleoside linkage of the modified oligonucleotide is selected from any one of Formulae XXI-XXIV and XXXIII-XXXV, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide. In certain embodiments, the one or more NMDA ligands is attached to the 5’ end of the modified oligonucleotide. In certain embodiments, the one or more NMDA ligands is attached to the 3’ end of the modified oligonucleotide. In certain embodiments, the one or more NMDA ligands is attached to the 5’ end and the 3’ end of the modified oligonucleotide. In certain embodiments, the one or more lipids are attached to an internucleoside linkage of the modified oligonucleotide. In certain embodiments, the one or more NMDA ligands is of Formula XXIX, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide, and the internucleoside linkage of the modified oligonucleotide is selected from any one of Formulae XXI-XXIV and XXXIII- XXXV, or a salt, solvate, or hydrate thereof, wherein R is the modified oligonucleotide. In any of the foregoing methods or uses, in certain embodiments, a compound comprises one or more substituted or unsubstituted alkyl or alkenyl. In certain embodiments, the substituted or unsubstituted alkyl or alkenyl is attached to an internucleoside linkage of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide comprises one or more substituted or unsubstituted alkyl or alkenyl. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl are attached to one or more internucleoside linkages of the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is the second modified oligonucleotide or sense oligonucleotide. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C4-C30 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C5-C20 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C14-C20 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C16hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C17 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C18hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C22 hydrocarbon chain. In certain embodiments, a substituted or unsubstituted alkyl or alkenyl is attached to an internucleoside linkage of a modified oligonucleotide (e.g., a second modified oligonucleotide or sense oligonucleotide). In certain embodiments, a substituted or unsubstituted alkyl or alkenyl is attached to an internucleoside linkage of a modified oligonucleotide (e.g., a second modified oligonucleotide or sense oligonucleotide). In certain embodiments, the internucleoside linkage is between nucleosides that are within 10 positions (e.g., within 8 positions, within 6 positions, within 5 positions, within 4 positions, within 3 positions, within 2 positions) from a terminal end (e.g., the 5′ and / or 3′ end) of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between nucleosides that are within 5 positions from the 5′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between nucleosides that are within 5 positions from the 3′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, positions 7 and 8, positions 8 and 9, positions 9 and 10, positions 10 and 11, positions 11 and 12, positions 12 and 13, or positions 13 and 14 from the 5′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, or positions 7 and 8 from the 5′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 2 and 3 from the 5′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, positions 7 and 8, positions 8 and 9, positions 9 and 10, positions 10 and 11, positions 11 and 12, positions 12 and 13, or positions 13 and 14 from the 3′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, or positions 7 and 8 from the 3′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 2 and 3 from the 3′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage of the modified oligonucleotide is selected from any one of Formulae XXI-XXIV and XXXIII-XXXV. In any of the foregoing methods or uses, in certain embodiments, a compound comprises a 5′-phosphonate modification. For example, in certain embodiments, a modified oligonucleotide comprises one or more sugars having a phosphonate modification at the 5′ position. In certain embodiments, the modified oligonucleotide comprises a 5′-phosphonate modification. In certain embodiments, the modified oligonucleotide comprises a 5′-terminal nucleoside (e.g., 5′ terminus) comprising the 5′-phosphonate modification. In certain embodiments, the 5′-phosphonate modification is a 5′-vinylphosphonate modification or a 5′- ethylenephosphonate modification. In certain embodiments, the 5′-phosphonate modification is a 5′-vinylphosphonate modification. In certain embodiments, the 5′-phosphonate modification is a 5′-ethylenephosphonate modification. In certain embodiments, the modified oligonucleotide is the first modified oligonucleotide or antisense oligonucleotide. In any of the foregoing methods or uses, the compound comprises a first modified oligonucleotide selected from the group consisting of any one of the IA Ref ID NOs in Table 3 and a second modified oligonucleotide 14 to 23 linked nucleosides in length fully complementary to the first modified oligonucleotide. In certain embodiments, the compound comprises a first modified oligonucleotide selected from any one of the IA Ref ID NOs in Table 3 and a second modified oligonucleotide selected from any one of the IS Ref ID NOs in Table 3. In certain embodiments, the compound is in a pharmaceutically acceptable salt form. In certain embodiments, the pharmaceutically acceptable salt is a sodium salt. In certain embodiments, the pharmaceutically acceptable salt is a potassium salt. In certain embodiments, a composition comprises the compound of any one of the foregoing embodiments and a pharmaceutically acceptable carrier. In any of the foregoing methods or uses, a compound or composition comprising a compound of any preceding embodiment is administered to an individual in a therapeutically effective amount. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual at a dosage level sufficient to deliver about 1 to 100 mg / kg of body weight of the individual. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual at a fixed dose of about 25 mg to about 1,000 mg. In certain embodiments, the composition is administered to the individual one or more times in a day up to the dosage level or fixed dose. In any of the foregoing methods or uses, a compound or composition comprising a compound of any preceding embodiment is administered to an individual daily, weekly, monthly, quarterly or yearly. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual about once per quarter (i.e., once every three months) to about once per year. In certain embodiments, a compound or composition comprising a compound of any preceding embodiment is administered to an individual about once per quarter, about once every six months or about once per year. Certain Compounds In certain aspects, the disclosure relates to a compound that comprises or consists of an oligomeric compound. In certain embodiments, the oligomeric compound comprises a nucleobase sequence complementary to that of a target nucleic acid. In certain aspects, the disclosure relates to a compound that comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid. In certain aspects, the disclosure relates to a compound that comprises or consists of an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid. In certain aspects, the disclosure relates to a compound that is a single-stranded compound. In certain embodiments, the single-stranded compound comprises or consists of an oligomeric compound. In certain embodiments, such an oligomeric compound comprises or consists of an oligonucleotide and optionally a conjugate group. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide or modified oligonucleotide of a single-stranded compound comprises a self-complementary nucleobase sequence. In certain aspects, the disclosure relates to a compound that is a double-stranded compound. In certain embodiments, the double-stranded compound comprises or consists of an oligomeric compound. In certain embodiments, the double-stranded compound comprises a first oligonucleotide and a second oligonucleotide. In certain embodiments, the first oligonucleotide has a region complementarity to a target nucleic acid and the second oligonucleotide has a region complementarity to the first modified oligonucleotide. In certain embodiments, the double-stranded compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a region complementarity to a target nucleic acid. In certain embodiments, the double-stranded compound comprises a first modified oligonucleotide and a second modified oligonucleotide. In certain embodiments, the first modified oligonucleotide has a region complementarity to a target nucleic acid and the second modified oligonucleotide has a region complementarity to the first modified oligonucleotide. In certain embodiments, an oligonucleotide or modified oligonucleotide of a double-stranded compound is an RNA oligonucleotide. In such embodiments, the thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase. In certain embodiments, a compound described herein comprises a conjugate group. In certain embodiments, the first oligonucleotide or first modified oligonucleotide of a double-stranded compound comprises a conjugate group. In certain embodiments, the second oligonucleotide or second modified oligonucleotide of a double-stranded compound comprises a conjugate group. In certain embodiments, a first oligonucleotide or first modified oligonucleotide and a second oligonucleotide or second modified oligonucleotide of a double-stranded compound each comprises a conjugate group. In certain embodiments, a compound is 14-30 linked nucleosides in length. In certain embodiments, the first oligonucleotide or first modified oligonucleotide of a double-stranded compound is 14-30 linked nucleosides in length. In certain embodiments, the second oligonucleotide or second modified oligonucleotide is 14-30 linked nucleosides in length. In certain embodiments, the oligonucleotides or modified oligonucleotides of a double-stranded compound are blunt ended at one or both ends of the compound. In certain embodiments, the oligonucleotides or modified oligonucleotides of a double-stranded compound include non- complementary overhanging nucleosides at one or both ends of the compound. In certain embodiments, a compound has a nucleobase sequence comprising at least 14 contiguous nucleobases of any of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214- 223. In certain embodiments, one of the oligonucleotides or modified oligonucleotides of a double-stranded compound has a nucleobase sequence comprising at least 14 contiguous nucleobases of any of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. Examples of single-stranded and double-stranded compounds include, but are not limited to, oligonucleotides, antisense oligonucleotides, siRNAs, microRNA targeting oligonucleotides, occupancy-based compounds (e.g., mRNA processing or translation blocking compounds and splicing compounds), and single-stranded RNAi compounds (e.g. small hairpin RNAs (shRNAs), single stranded siRNAs (ssRNAs) and microRNA mimics). In certain embodiments, a compound described herein has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target region of a target nucleic acid to which it is targeted. In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 12 to 23 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 30 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 14 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 15 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 18 to 23 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 to 30 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 to 23 linked subunits in length. In other words, such oligonucleotides are 12 to 30 linked subunits, 12 to 23 linked subunits, 14 to 30 linked subunits, 14 to 23 linked subunits, 15 to 30 linked subunits, 15 to 23 linked subunits, 16 to 30 linked subunits, 16 to 23 linked subunits, 17 to 30 linked subunits, 17 to 23 linked subunits, 18 to 30 linked subunits, 18 to 23 linked subunits, 19 to 30 linked subunits or 19 to 23 linked subunits, respectively. In certain embodiments, a compound described herein comprises an oligonucleotide 14 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 16 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 17 linked subunits in length. In certain embodiments, compound described herein comprises an oligonucleotide 18 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 19 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 20 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 21 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 22 linked subunits in length. In certain embodiments, a compound described herein comprises an oligonucleotide 23 linked subunits in length. In other embodiments, a compound described herein comprises an oligonucleotide 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 23, 18 to 24, 18 to 25, 18 to 50, 19 to 23, 19 to 30, 19 to 50, 20 to 23 or 20 to 30 linked subunits. In certain such embodiments, the compound described herein comprises an oligonucleotide 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 linked subunits in length, or a range defined by any two of the above values. In certain embodiments, the compound may further comprise an additional moiety, such as a conjugate group or delivery moiety. In certain embodiments, such compounds are oligomeric compounds, and the additional moiety is attached to an oligonucleotide. In certain embodiments, a conjugate group is attached to a nucleoside of an oligonucleotide. In certain embodiments, compounds may be shortened or truncated. For example, one or more subunits may be deleted from the 5’ end (5’ truncation), or alternatively from the 3’ end (3’ truncation) of an oligonucleotide. In certain embodiments, compounds may be lengthened. For example, one or more subunits may be attached to the 3′ end or 5′ end of an oligonucleotide. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunits) is attached to the 5′ end of an oligonucleotide. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunits) is attached to the 3′ end of an oligonucleotide. In certain embodiments, at least one or more subunits may be attached to the 3′ end or 5′ end of an oligonucleotide of a double-stranded compound creating a 3′ and / or 5′ end overhang. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunits) is attached to the 5′ end of both oligonucleotides of a double-stranded compound. In certain embodiments, at least one subunit (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more subunit) is attached to the 3′ end of both oligonucleotides of a double-stranded compound. In certain embodiments, subunits are attached to both oligonucleotides of a double-stranded compound at the same end (e.g., that subunits are attached to the 3′ end of one of the oligonucleotides and subunits are attached to the 5′ end of the other oligonucleotide). In certain embodiments, when subunits are attached to both oligonucleotides of a double-stranded compound at the same end, the number of subunits attached to each oligonucleotide may be the same or may be different. In certain embodiments, when subunits are attached to both oligonucleotides of a double-stranded compound at the same end, the number of subunits attached to each oligonucleotide is the same. In certain embodiments, when subunits are attached to both oligonucleotides of a double-stranded compound at the same end, the number of subunits attached to each oligonucleotide is different. This scenario, where subunits are attached to both oligonucleotides of a double-stranded compound at the same end, may occur at one or both ends of a double-stranded compound. In certain embodiments, the subunits attached to the 3′ and / or 5′ end are modified. In certain embodiments, compounds described herein are oligonucleotides. In certain embodiments, compounds described herein are modified oligonucleotides. In certain embodiments, compounds described herein are antisense oligonucleotides. In certain embodiments, compounds described herein are oligomeric compounds. In certain embodiments, compounds described herein are RNAi compounds. In certain embodiments, compounds described herein are siRNA compounds. In certain embodiments, a compound described herein can comprise any of the oligonucleotide sequences targeted to SOD1 described herein. In certain embodiments, the compound can be double-stranded. In certain embodiments, the compound comprises an oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, the compound comprises an oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223. In certain embodiments, the compound comprises a second oligonucleotide. In certain embodiments, the compound comprises an oligonucleotide comprising at least an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 contiguous nucleobase portion of any one of SEQ ID NOs: 19-27, 107- 183, 188-195, or 203-213. In certain embodiments, the compound comprises ribonucleotides in which the oligonucleotide has uracil (U) in place of thymine (Τ) for any of the sequences provided here. In certain embodiments, the compound comprises deoxyribonucleotides in which the oligonucleotide has thymine (Τ) in place of uracil (U) for any of the sequences provided here. Certain Mechanisms In certain embodiments, compounds described herein comprise or consist of modified oligonucleotides. In certain embodiments, compounds described herein comprise or consist of antisense oligonucleotides. In certain embodiments, compounds comprise or consist of oligomeric compounds. In certain embodiments, compounds described herein are capable of hybridizing to a target nucleic acid. In certain embodiments, compounds described herein selectively affect one or more target nucleic acid. Such compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired activity. In certain embodiments, hybridization of a compound described herein to a target nucleic acid results in recruitment of one or more proteins that cause the cleavage of the target nucleic acid. For example, certain compounds described herein or a portion of the compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain compounds described herein result in cleavage of the target nucleic acid by Argonaute. Compounds that are loaded into RISC are RNAi compounds. RNAi compounds may be double-stranded (siRNA) or single-stranded (ssRNA). In certain embodiments, hybridization of compounds described herein to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in the alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of the compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the compound to the target nucleic acid results in the alteration of RNA processing. In certain such embodiments, hybridization of the compound to a target nucleic acid results in alteration of translation of the target nucleic acid. Activities resulting from the hybridization of a compound to a target nucleic acid may be observed directly or indirectly. In certain embodiments, observation or detection of an activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a phenotypic change in a cell or animal. Certain Modifications In certain aspects, the disclosure relates to compounds that comprise or consist of oligonucleotides. Oligonucleotides consist of linked nucleosides. In certain embodiments, oligonucleotides may be unmodified RNA or DNA or may be modified. In certain embodiments, the oligonucleotides are modified oligonucleotides. In certain embodiments, the modified oligonucleotides comprise at least one modified sugar, modified nucleobase or modified internucleoside linkage relative to an unmodified RNA or DNA. In certain embodiments, an oligonucleotide has a modified nucleoside. A modified nucleoside may comprise a modified sugar, a modified nucleobase or both a modified sugar and a modified nucleobase. Modified oligonucleotides may also include end modifications, e.g., 5’-end modifications and 3’-end modifications. Sugar Modifications and Motifs In certain embodiments, a modified sugar is a substituted furanosyl sugar or non- bicyclic modified sugar. In certain embodiments, a modified sugar is a bicyclic or tricyclic modified sugar. In certain embodiments, a modified sugar is a sugar surrogate. A sugar surrogate may comprise one or more substitutions described herein. In certain embodiments, a modified sugar is a substituted furanosyl or non-bicyclic modified sugar. In certain embodiments, the furanosyl sugar is a ribosyl sugar. In certain embodiments, the furanosyl sugar comprises one or more substituent groups, including, but not limited to, substituent groups at the 2’, 3’, 4’, and 5’ positions. In certain embodiments, substituents at the 2’ position include, but are not limited to, F and OCH3 (“OMe”, “O-methyl” or “methoxy”). In certain embodiments, substituent groups at the 2’ position suitable for non-bicyclic modified sugars include, but are not limited to, halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, F, Cl, Br, SCH3, SOCH3, SO2CH3, ΟΝΟ2, ΝΟ2, Ν3, and ΝΗ2. In certain embodiments, substituent groups at the 2’ position include, but are not limited to, O-(C1-C10) alkoxy, alkoxyalkyl, O-alkyl, S-alkyl, N-alkyl, O- alkenyl, S-alkenyl, N-alkenyl, O-alkynyl, S-alkynyl, N-alkynyl, O-alkyl-O-alkyl, alkynyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. In certain embodiments, substituent groups at the 2’ position include, but are not limited to, alkaryl, aralkyl, O-alkaryl, and O-aralkyl. In certain embodiments, these 2’ substituent groups can be further substituted with one or more substituent groups independently selected from hydroxyl, alkoxy, carboxy, benzyl, phenyl, nitro (ΝΟ2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. In certain embodiments, substituent groups at the 2’ position include, but are not limited to, O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nCH3, O(CH2)nONH2, O(CH2)nNH2, O(CH2)nSCH3, and O(CH2)nON[(CH2)nCH3)]2, where n and m are independently from 1 to about 10. In certain embodiments, substituent groups at the 2’ position include, but are not limited to, OCH2CH2OCH3 (“MOE”), O(CH2)2ON(CH3)2 (“DMAOE”), O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”), and OCH2C(=O)-N(H)CH3 (“NMA”). In certain embodiments, substituent groups at the 4’ position suitable for non-bicyclic modified sugars include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. In certain embodiments, substituent groups at the 5’ position suitable for non-bicyclic modified sugars include, but are not limited to, methyl (“Me” or “CH3”) (R or S), vinyl, and methoxy. In certain embodiments, the 5' modification is a 5'-monophosphate ((HO)2(O)P-O-5'); 5'-diphosphate ((HO)2(O)P-O- P(HO)(O)-O-5'); 5'-triphosphate ((HO)2(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5'); 5'-guanosine cap (7-methylated or non-methylated) (7m-G-O-5'-(HO)(O)P-O-(HO)(O)P-O-P(HO)(O)-O- 5'); 5'adenosine cap (Appp), and any modified or unmodified nucleotide cap structure (N-O- 5'(HO)(O)P-O-(HO)(O)P-O-P(HO)(O)-O-5'); 5'-monothiophosphate (phosphorothioate; (HO)2(S)P-O-5'); 5'-monodithiophosphate (phosphorodithioate; (HO)(HS)(S)P-O-5'), 5'phosphorothiolate ((HO)2(O)P-S-5'); any additional combination of oxygen / sulfur replaced monophosphate, diphosphate and triphosphates (e.g.5'-alpha-thiotriphosphate, 5'- gammathiotriphosphate, etc.), 5'-phosphoramidates ((HO)2(O)P-NH-5', (HO)(NH2)(O)P-O- 5'), 5'alkylphosphonates (R=alkyl=methyl, ethyl, isopropyl, propyl, etc., e.g. RP(OH)(O)-O- 5'-, 5'alkenylphosphonates (i.e. vinyl, substituted vinyl), (OH)2(O)P-5'-CH2-), 5'alkyletherphosphonates (R=alkylether=methoxymethyl (MeOCH2-), ethoxymethyl, etc., e.g. RP(OH)(O)-O-5'-). In certain embodiments, one or more sugars comprise a 5′- phosphonate modification. In certain embodiments, the 5′-phosphonate modification is a 5′- vinylphosphonate modification or a 5′-ethylenephosphonate modification. In certain embodiments, one or more sugars comprise a 5′-vinylphosphonate modification. In certain embodiments, one or more sugars comprise a 5′-ethylenephosphonate modification. In certain embodiments the 5′ modification is at the terminus of an oligonucleotide. In certain embodiments the 5′ modification is at the terminus of an antisense oligonucleotide. In certain embodiments, substituents described herein for the 2’, 4’ and 5’ position can be added to other specific positions on the sugar. In certain embodiments, such substituents may be added to the 3’ position of the sugar on the 3’ terminal nucleoside or the 5’ position of the 5’ terminal nucleoside. In certain embodiments, a non-bicyclic modified sugar may comprise more than one non-bridging sugar substituent. In certain such embodiments, non-bicyclic modified sugars substituents include, but are not limited to, 5’-Me-2’-F, 5’-Me-2’-OMe (including both R and S isomers). In certain embodiments, modified sugar substituents include those described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US2013 / 0203836. In certain embodiments, a modified sugar is a bicyclic sugar. A bicyclic sugar is a modified sugar comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, a bicyclic sugar comprises a bridging substituent that bridges two atoms of the furanosyl ring to form a second ring. In certain embodiments, a bicyclic sugar does not comprise a furanosyl moiety. A “bicyclic nucleoside” (“BNA”) is a nucleoside having a bicyclic sugar. In certain embodiments, the bicyclic sugar comprises a bridge between the 4’ and 2’ furanose ring atoms. In certain embodiments, the bicyclic sugar comprises a bridge between the 5’ and 3’ furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. In certain embodiments, 4’ to 2’ bridging substituents include, but are not limited to, 4'-CH2-2', 4'-(CH2)2-2', 4'- (CH2)3-2', 4'-CH2-O-2' (“LNA”), 4'-CH2-S-2', 4'- (CH2)2-O-2' (“ENA”), 4'-CH(CH3)-O-2' (“constrained ethyl” or “cEt” when in the S configuration), 4’-CH2-O-CH2-2’, 4’-CH2-N(R)-2’, 4'- CH(CH2OCH3)-O-2' (“constrained MOE” or “cMOE”) and analogs thereof (e.g., U.S. Patent No.7,399,845), 4'-C(CH3)(CH3)- O-2' and analogs thereof (e.g., U.S. Patent No.8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (e.g., U.S. Patent No.8,278,425), 4'-CH2-O-N(CH3)-2' (e.g., U.S. Patent Publication No.2004 / 0171570), 4'-CH2-N(R)-O-2', wherein R is Η, C1-C12alkyl, or a protecting group (e.g., U.S. Patent No.7,427,672), 4'-CH2-C(H)(CH3)-2' (e.g., Chattopadhyaya el al., J. Org. Chem., 2009, 74, 118- 134), and 4'-CH2-C(=CH2)-2' and analogs thereof (e.g., U.S. Patent No.8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference. Additional representative U.S. Patents and U.S. Patent Publications that teach the preparation of bicyclic nucleic acid nucleotides include, but are not limited to, the following: U.S. Patent Nos.6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008 / 0039618; and US 2009 / 0012281, US 2013 / 0190383; and WO 2013 / 036868, the entire contents of each of which are hereby incorporated herein by reference. Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see e.g., WO 99 / 14226). Specified bicyclic nucleosides herein are in the β-D configuration, unless otherwise specified. In certain embodiments, a modified sugar is a sugar surrogate. In certain embodiments, a sugar surrogate has the oxygen atom replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, the sugar surrogate may also comprise bridging and / or non-bridging substituents as described herein. In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. In certain such embodiments, the sugar surrogate comprises a cyclobutyl moiety in place of the pentofuranosyl sugar. In certain embodiments, the sugar surrogate comprises a six membered ring in place of the pentofuranosyl sugar. In certain embodiments, the sugar surrogate comprises a tetrahydropyran (“THP”) in place of the pentofuranosyl sugar. In certain embodiments, the sugar surrogate comprises a morpholino in place of the pentofuranosyl sugar. Representative US patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Patent Nos.4,981,957; 5,118,800; 5,166,315; 5,185,444; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,700,920; 7,875,733; 7,939,677, 8,088,904; 8,440,803; and 9,005,906, the entire contents of each of the foregoing are hereby incorporated herein by reference. In some embodiments, sugar surrogates comprise acyclic moieties. In certain embodiments, the sugar surrogate is an unlocked nucleic acid (“UNA”). A UNA is unlocked acyclic nucleic acid, wherein any of the bonds of the sugar has been removed, forming an unlocked "sugar" residue. In one example, UNA also encompasses a monomer where the bonds between C1’-C4’ have been removed (i.e. the covalent carbon-oxygen-carbon bond between the C1’ and C4’ carbons). In another example, the C2’-C3’ bond (i.e. the covalent carbon-carbon bond between the C2’ and C3’ carbons) of the sugar has been removed. Representative U.S. publications that teach the preparation of UNA include, but are not limited to, U.S. Patent No.8,314,227; and U.S. Patent Publication Nos.2013 / 0096289; 2013 / 0011922; and 2011 / 0313020, the entire contents of each of which are hereby incorporated herein by reference. In certain embodiments, sugar surrogates comprise peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013 / 130378, the entire contents of which is hereby incorporated herein by reference. Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides. In certain aspects, the disclosure relates to compounds comprising at least one oligonucleotide wherein the nucleosides of such oligonucleotide comprise one or more types of modified sugars and / or unmodified sugars arranged along the oligonucleotide or region thereof in a defined pattern or “sugar motif”. In certain instances, such sugar motifs include, but are not limited to, any of the patterns of sugar modifications described herein. In certain embodiments, an oligonucleotide comprises a gapmer sugar motif. A gapmer oligonucleotide comprises or consists of a region having two external “wing” regions and a central or internal “gap” region. The gap and wing regions form a contiguous sequence of nucleosides, wherein the majority of nucleoside sugars of each of the wings differ from the majority of nucleoside sugars of the gap. In certain embodiments, the wing regions comprise a majority of modified sugars and the gap comprises a majority of unmodified sugars. In certain embodiments, the nucleosides of the gap are deoxynucleosides. Compounds with a gapmer sugar motif are described in, for example US Patent 8,790,919, the entire contents of which is hereby incorporated herein by reference. In certain embodiments, one or both oligonucleotides of a double-stranded compound comprise a triplet sugar motif. An oligonucleotide with a triplet sugar motif comprises three identical sugar modifications on three consecutive nucleosides. In certain embodiments, the triplet is at or near the cleavage site of the oligonucleotide. In certain embodiments, an oligonucleotide of a double-stranded compound may contain more than one triplet sugar motif. In certain embodiments, the identical sugar modification of the triplet sugar motif is a 2’-F modification. Compounds with a triplet sugar motif are disclosed, for example, in US Patent 10,668,170, the entire contents of which is incorporated herein by reference. In certain embodiments, one or both oligonucleotides of a double-stranded compound comprise a quadruplet sugar motif. An oligonucleotide with a quadruplet sugar motif comprises four identical sugar modifications on four consecutive nucleosides. In certain embodiments, the quadruplet is at or near the cleavage site. In certain embodiments, an oligonucleotide of a double-stranded compound may contain more than one quadruplet sugar motif. In certain embodiments, the identical sugar modification of the quadruplet sugar motif is a 2’-F modification. For a double-stranded compound having a duplex region of 19-23 nucleotides in length, the cleavage site of the antisense oligonucleotide is typically around the 10, 11, and 12 positions from the 5’-end. In certain embodiments, the quadruplet sugar motif is at the 8, 9, 10, 11 positions; the 9, 10, 11, 12 positions; the 10, 11, 12, 13 positions; the 11, 12, 13, 14 positions; or the 12, 13, 14, 15 positions of the sense oligonucleotide, counting from the first nucleoside of the 5’-end of the sense oligonucleotide, or, the count starting from the first paired nucleotide within the duplex region from the 5’-end of the sense oligonucleotide. In certain embodiments, the quadruplet sugar motif is at the 8, 9, 10, 11 positions; the 9, 10, 11, 12 positions; the 10, 11, 12, 13 positions; the 11, 12, 13, 14 positions; or the 12, 13, 14, 15 positions of the antisense oligonucleotide, counting from the first nucleoside of the 5’-end of the antisense oligonucleotide, or, the count starting from the first paired nucleotide within the duplex region from the 5’- end of the antisense oligonucleotide. The cleavage site may change according to the length of the duplex region of the double- stranded compound and may change the position of the quadruplet accordingly. In certain embodiments, an oligonucleotide comprises an alternating sugar motif. In certain embodiments, one or both oligonucleotides of a double-stranded compound comprise an alternating sugar motif. An oligonucleotide with an alternating sugar motif comprises at least two different sugar modifications wherein one or more consecutive nucleosides comprising a first sugar modification alternates with one or more consecutive nucleosides comprising a second sugar modification and one or more consecutive nucleosides comprising a third sugar modification, etc. For example, if A, Β and C each represent one type of modification to the nucleoside, the alternating motif can be “ABABABABABAB...,” “AABBAABBAABB...,” “AABAABAABAAB...,” “AAABAAABAAAB...,” “AAABBBAAABBB...,” or “ABCABCABCABC...” etc. In certain embodiments, the alternating sugar motif is repeated for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 contiguous nucleobases along an oligonucleotide. In certain embodiments, the alternating sugar motif is comprised of two different sugar modifications. In certain embodiments, the alternating sugar motif comprises 2’-OMe and 2’-F sugar modifications. In certain embodiments, each nucleoside of an oligonucleotide is independently modified with one or more sugar modifications provided herein. In certain embodiments, each oligonucleotide of a double-stranded compound independently has one or more sugar motifs provided herein. In certain embodiments, an oligonucleotide containing a sugar motif, is fully modified in that each nucleoside other than the nucleosides comprising the sugar motif comprises a sugar modification. Nucleobase Modifications and Motifs In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleosides that do not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and Ν-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5- hydroxymethyl cytosine, 5- methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N- methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C≡C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5- ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8- aza and other 8-substituted purines, 5-halo, particularly, 5-bromo, 5-trifluoromethyl, 5- halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2- aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-Ν- benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-Ν-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2- one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2- pyridone. Further nucleobases include those disclosed in U.S. Patent 3,687,808; Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, Ρ. ed. Wiley-VCH, 2008; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859; Kroschwitz, J.L., Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, dsRNA Research and Applications, pages 289-302; Antisense Research and Applications, Crooke, S.T. and Lebleu, Β., Eds., CRC Press, 1993, 273-288; Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443 (Chapters 6 and 15), each of which are hereby incorporated herein by reference. Publications that teach the preparation of certain of the above noted modified nucleobases, as well as other modified nucleobases include without limitation, US Application Publication Nos.2003 / 0158403 and 2003 / 0175906; U.S. Patents 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,434,257; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,681,941; 5,811,534; 5,750,692; 5,948,903; 5,587,470; 5,457,191; 5,763,588; 5,830,653; 5,808,027; 6,005,096.6,015,886; 6,147,200; 6,166,197; 6,166,199; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672; and 7,495,088, the entire contents of each of which are hereby incorporated herein by reference. In certain embodiments, compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and / or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines. In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3’-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3’-end of the oligonucleotide. In certain embodiments, the block is at the 5’-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5’-end of the oligonucleotide. Internucleoside Linkage Modifications and Motifs A 3' to 5' phosphodiester linkage is the naturally occurring internucleoside linkage of RNA and DNA. In certain embodiments, compounds described herein have one or more modified, i.e. non-naturally occurring, internucleoside linkages. Certain non-naturally occurring internucleoside linkages may impart desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases. Representative phosphorus-containing modified internucleoside linkages include, but are not limited to, phosphotriesters, alkylphosphonates (e.g. methylphosphonates), phosphoramidates, and phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphorus containing internucleoside linking groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2), thiodiester, thionocarbamate (-O-C(=O)(NH)-S-); siloxane (-O-SiH2-O-); and N,N'- dimethylhydrazine (-CH2-Ν((CΗ3)-Ν((CΗ3)-). Methods of preparation of phosphorous- containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art. Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)- N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See, for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed Ν, O, S and CH2component parts. In certain embodiments, compounds provided herein comprise at least one modified internucleoside linkage. A modified internucleoside linkage may be placed at any position of an oligonucleotide. For double-stranded compounds, a modified internucleoside linkage may be placed within the sense oligonucleotide, antisense oligonucleotide, or both oligonucleotides of the double-stranded compound. In certain embodiments, the internucleoside linkage modification may occur on every nucleoside of an oligonucleotide. In certain embodiments, internucleoside linkage modifications may occur in an alternating pattern along an oligonucleotide. In certain embodiments, essentially each internucleoside linking group is a phosphate internucleoside linkage (Ρ=O). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is a phosphorothioate (P=S). In certain embodiments, each internucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphate internucleoside linkage. In certain embodiments, the pattern of the internucleoside linkage modification on each oligonucleotide of a double-stranded compound is the same. In certain embodiments, the pattern of the internucleoside linkage modification on each oligonucleotide of a double-stranded compound is different. In certain embodiments, a double-stranded compound comprises 6-8 modified internucleoside linkages. In certain embodiments, the 6-8 modified internucleoside linkages are phosphorothioate internucleoside linkages or alkylphosphonate internucleoside linkages. In certain embodiments, the sense oligonucleotide comprises at least two modified internucleoside linkages at either or both the 5’-end and the 3’-end. In certain such embodiments, the modified internucleoside linkages are phosphorothioate internucleoside linkages or alkylphosphonate internucleoside linkages. In certain embodiments, the antisense oligonucleotide comprises at least two modified internucleoside linkages at either or both the 5’-end and the 3’-end. In certain such embodiments, the modified internucleoside linkages are phosphorothioate internucleoside linkages or alkylphosphonate internucleoside linkages. In certain embodiments, a double-stranded compound comprises an overhang region. In certain embodiments, a double-stranded compound comprises a phosphorothioate or alkylphosphonate internucleoside linkage modification in the overhang region. In certain embodiments, a double-stranded compound comprises a phosphorothioate or alkylphosphonate internucleotide linkage linking the overhang nucleotide with a paired nucleotide that is next to the overhang nucleotide. For instance, there may be at least two phosphorothioate internucleoside linkages between the terminal three nucleosides, in which two of the three nucleosides are overhang nucleosides, and the third is a paired nucleoside next to the overhang nucleoside. These terminal three nucleosides may be at the 3’-end of the antisense oligonucleotide, the 3’-end of the sense oligonucleotide, the 5’-end of the antisense oligonucleotide, or the 5’end of the antisense oligonucleotide. In certain embodiments, modified oligonucleotides comprise one or more internucleoside linkages having chiral centers. Representative chiral internucleoside linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising internucleoside linkages having chiral centers can be prepared as populations of modified oligonucleotides comprising stereorandom internucleoside linkages, or as populations of modified oligonucleotides comprising phosphorothioate linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate internucleoside linkages wherein all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. As is well understood by those of skill in the art, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate internucleoside linkages in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 80% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate linkage is present in at least 99% of the molecules in the population. Such enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res.42, 13456 (2014), and WO 2017 / 015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. Conjugate Groups In certain embodiments, the compounds described herein comprise or consist of one or more oligonucleotides and, optionally, one or more conjugate groups. Conjugate groups may be attached to either or both ends of an oligonucleotide and / or at any internal position. In certain embodiments, a conjugate group is attached at the 3’ end of an oligonucleotide. In certain embodiments, a conjugate group is attached at the 5’ end of an oligonucleotide. In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups are terminal groups attached to either or both ends of an oligonucleotide. In certain such embodiments, terminal groups are attached at the 3’ end of an oligonucleotide. In certain such embodiments, terminal groups are attached at the 5’ end of an oligonucleotide. In certain embodiments, terminal groups include, but are not limited to, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified, such as an overhang. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, activity, half-life, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups enhance the affinity of a compound for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a compound absent such a conjugate group. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. In certain embodiments, conjugate groups include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes. In certain embodiments, conjugate groups include an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)- (+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial, or an antibiotic. In certain embodiments, conjugate groups are targeting moieties. In certain embodiments, a targeting moiety includes, but is not limited to, a lectin, glycoprotein, lipid, protein, peptide, peptide mimetic, receptor ligand, antibody, thyrotropin, melanotropin, surfactant protein A, carbohydrate, carbohydrate derivative, modified carbohydrate, carbohydrate cluster, polysaccharide, modified polysaccharide, or polysaccharide derivative, mucin carbohydrate, multivalent lactose, multivalent galactose, N-acetyl-galactosamine (GalNAc), N-acetylglucosamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, polyglutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin Β12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic. In certain embodiments, conjugate groups may include, but are not limited to, the conjugate groups described in the following references such as cholesterol (e.g., Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (e.g., Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), thioether, e.g., hexyl-S-tritylthiol (e.g., Manoharan et al., Αnn. NY. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), thiocholesterol (e.g., Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), aliphatic chains, e.g., do-decan-diol or undecyl residues (e.g., Saison- Behmoaras et al., ΕΜΒΟ J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327- 330; Svinarchuk et al., Biochimie, 1993, 75:49-54), phospholipids, e.g., di-hexadecyl-rac- glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (e.g, Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), polyamines or a polyethylene glycol chains (e.g., Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), adamantane acetic acid (e.g., Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), palmityl (e.g., Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), octadecylamine or hexylamino-carbonyloxychole sterol moiety (e.g., Crooke et al. J. Pharmacol. Exp. Ther., 1996, 277:923-937), tocopherol (e.g., Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220 and Nishina et al., Molecular Therapy, 2008, 16:734-740), GalNAc and other carbohydrates (e.g., Maier et al., Bioconjugate Chemistry, 2003, 14, 18-29; Rensen et al., J. Med. Chem.2004, 47, 5798-5808; WO2009 / 073809 and US Patents 8,106,022; 8,450,467 and 8,828,957; and WO2014 / 179445; WO2014 / 179620 and US Patents 9,127,276; 9,181,549 and 10,844,379) each of which is incorporated herein by reference in its entirety. Conjugate groups may be attached to oligonucleotides through conjugate linkers. In certain embodiments, a conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units or combination of such repeating units. In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, οxο, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain embodiments, a conjugate linker comprises at least one phosphorus group. In certain embodiments, a conjugate linker comprises at least one phosphate group. In certain embodiments, a conjugate linker includes at least one neutral linking group. In certain embodiments, conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (ΑΗΕΧ or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C1-C10alkyl, substituted or unsubstituted C2- C10 alkenyl, or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl. In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, such linker- nucleosides may be modified or unmodified nucleosides. It is typically desirable for linker- nucleosides to be cleaved from the compound after it reaches a target tissue. Accordingly, linker-nucleosides herein can be linked to one another and to the remainder of the compound through cleavable bonds. Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which a compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid and the compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. In certain embodiments, conjugate groups and conjugate linkers as well as other modifications include, without limitation, those described in the following references: US 5,994,517; US 6,300,319; US 6,660,720; US 6,906,182; US 7,262,177; US 7,491,805; US 8,106,022; US 7,723,509; US 9,127,276; US 2006 / 0148740; US 2011 / 0123520; WO2013 / 033230; WO2012 / 037254, Biessen et al., J. Med. Chem.1995, 38, 1846-1852; Lee et al., Bioorganic & Medicinal Chemistry 2011,19, 2494-2500; Rensen et al., J. Biol. Chem. 2001, 276, 37577-37584; Rensen et al., J. Med. Chem.2004, 47, 5798-5808; Sliedregt et al., J. Med. Chem.1999, 42, 609-618; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Lee, Carhohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al., J Med Chem, 1995, 38, 1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Kim et al., Tetrahedron Lett, 1997, 38, 3487-3490; Lee et al., Bioconjug Chem, 1997, 8, 762-765; Kato et al., Glycohiol, 2001, 11, 821-829; Rensen et al., J Biol Chem, 2001, 276, 37577-37584; Lee et al., Methods Enzymol, 2003, 362, 38-43; Westerlind et al., Glycoconj J, 2004, 21, 227-241; Lee et al., Bioorg Med Chem Lett, 2006, 16(19), 5132-5135; Maierhofer et al., Bioorg Med Chem, 2007, 15, 7661-7676; Khorev et al., Bioorg Med Chem, 2008, 16, 5216-5231; Lee et al., Bioorg Med Chem, 2011, 19, 2494-2500; Kornilova et al., Analyt Biochem, 2012, 425, 43-46; Pujol et al., Angew Chemie Int Ed Engl, 2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38, 1846-1852; Sliedregt et al., J Med Chem, 1999, 42, 609-618; Rensen et al., J Med Chem, 2004, 47, 5798-5808; Rensen et al., Arterioscler Thromh Vase Biol, 2006, 26, 169-175; van Rossenberg et al., Gene Ther, 2004, 11, 457-464; Sato et al., JAm Chem Soc, 2004, 126, 14013-14022; Lee et al., J Org Chem, 2012, 77, 7564-7571; Biessen et al., FASEB J, 2000, 14, 1784-1792; Rajur et al., Bioconjug Chem, 1997, 8, 935-940; Duff et al., Methods Enzymol, 2000, 313, 297-321; Maier et al., Bioconjug Chem, 2003, 14, 18-29; Jayaprakash et al., Org Lett, 2010, 12, 5410- 5413; Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12, 103-128; Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al., Bioorg Med Chem, 2013, 21, 5275-5281; International applications WO1998 / 013381; WO2011 / 038356; WO1997 / 046098; W02008 / 098788; W02004 / 101619; WO2012 / 037254; WO2011 / 120053; WO2011 / 100131; WO2011 / 163121; WO2012 / 177947; W02013 / 033230; W02013 / 075035; WO2012 / 083185; WO2012 / 083046; W02009 / 082607; WO2009 / 134487; W02010 / 144740; W02010 / 148013; WO1997 / 020563; W02010 / 088537; W02002 / 043771; W02010 / 129709; WO2012 / 068187; WO2009 / 126933; W02004 / 024757; WO2010 / 054406; WO2012 / 089352; WO2012 / 089602; WO2013 / 166121; WO2013 / 165816; U.S. Patents 4,751,219; 7,582,744; 8,552,163; 8,137,695; 6,908,903; 6,383,812; 7,262,177; 6,525,031; 5,994,517; 6,660,720; 6,300,319; 7,723,509; 8,106,022; 7,491,805; 7,491,805; 8,541,548; 8,344,125; 8,313,772; 8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177; 6,906,182; 6,620,916; 8,435,491; 8,404,862; 7,851,615; Published U.S. Patent Application Publications US2011 / 0097264; US2011 / 0097265; US2013 / 0004427; US2003 / 0119724; US2011 / 0207799; US2012 / 0035115; US2012 / 0230938; US2005 / 0164235; US2006 / 0183886; US2012 / 0136042; US2012 / 0095075; US2013 / 0109817; US2006 / 0148740; US2008 / 0206869; US2012 / 0165393; US2012 / 0101148; US2013 / 0121954; US2011 / 0123520; US2003 / 0077829; US2008 / 0108801; and US2009 / 0203132; each of which is incorporated herein by reference in its entirety. Certain Conjugate Groups In certain embodiments, a compound provided herein comprises a conjugate group. In certain embodiments, an oligonucleotide provided herein comprises a conjugate group. In certain embodiments, the conjugate group is a targeting moiety. In certain embodiments, the targeting moiety comprises one or more TrkB ligands. In certain embodiments, the targeting moiety comprises one or more CB1ligands. In certain embodiments, the targeting moiety comprises one or more α4β1 / 7 integrin ligands. In certain embodiments, the targeting moiety comprises one or more NMDA ligands. In certain embodiments, the TrkB ligand of a modified oligonucleotide is of the Formula (I) or a salt, solvate, or hydrate thereof: Formula (I), wherein: R1is the modified oligonucleotide; L1, L2, L3, and L4are as described herein; R2is hydrogen, -OR7, -SR8, or -NR9R10; R3is hydrogen, -OR11, -SR12, or -NR13R14; R4is hydrogen, -OR15, -SR16, or -NR17R18; R5is hydrogen, -OR19, -SR20, or -NR21R22; R6is hydrogen, -OH, optionally substituted -O-alkyl, optionally substituted -OAc, - NH2, optionally substituted -NHAc, -SH, or =O; R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19, R20, R21, and R22are each independently hydrogen, optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, optionally substituted heteroaryl; Y is CH2, NH, S, or O; and Z is optionally substituted aryl or optionally substituted heteroaryl. In certain embodiments, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19, R20, R21, and R22are each independently optionally substituted unsaturated or partially unsaturated alkyl. In certain embodiments, R7, R8, R9, and R10are each independently alkenyl. In certain embodiments, R7, R8, R9, and R10are each independently alkynyl. In certain embodiments, R2is OR7. In certain embodiments, R3is OR11. In certain embodiments, R7and R11are each independently hydrogen, optionally substituted alkyl or optionally substituted alkenyl. In certain embodiments, one or both R7and R11are each independently hydrogen. In certain embodiments, one or both R7and R11are each independently optionally substituted alkyl. In certain embodiments, one or both R7and R11are each independently optionally substituted unsaturated or partially unsaturated alkyl. In certain embodiments, one or both R7and R11are each independently alkenyl. In certain embodiments, R7is optionally substituted alkyl and R11is hydrogen. In certain embodiments, R7is hydrogen and R11is optionally substituted alkyl. In certain embodiments, R7is alkenyl and R11is hydrogen. In certain embodiments, R7is hydrogen and R11is optionally substituted alkenyl. In certain embodiments, the TrkB ligand of a modified oligonucleotide is selected from the following Formulae or a salt, solvate, or hydrate thereof: Formula (II-B), Formula (II-C), wherein: R1is the modified oligonucleotide; and L1, L2, L3, and L4are as described herein. In certain embodiments, the TrkB ligand of a modified oligonucleotide is of the Formula (XXX) or a salt, solvate, or hydrate thereof: wherein: L1, L2, L3, L4, and R1are as described herein; R11and R13are each independently absent, hydrogen, or optionally substituted alkyl; R12, R14, and R15are each independently hydrogen, optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, or optionally substituted heteroaryl; R16is hydrogen, halogen, –CN, –N3, –SOn16R1A, –SOv16NR16BR16C, −NHNR16BR16C, −ONR16BR16C, −NHC(O)NHNR16BR16C, −NHC(O)NR16BR16C, –N(O)m16, –NR16BR16C, –C(O)R16D, –C(O)OR16D, –C(O)NR16BR16C, –OR16A, -NR16BSO2R16A, -NR16BC(O)R16D, - NR16BC(O)OR16D, –NR16BOR16D, optionally substituted alkyl, optionally substituted heteroalkyl, optionally substituted cycloalkyl, optionally substituted heterocycloalkyl, optionally substituted aryl, or optionally substituted heteroaryl; and are each independently a single bond or a double bond, wherein if is a single bond, then is a double bond and R13is absent; and further wherein if is a single bond, then is a double bond and R11is absent; R16A, R16B, R16C, R16Dare each independently hydrogen, halogen, –CF3, –CCl3, –CBr3, –CI3, –COOH, –CONH2, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; or R16Band R16Csubstituents bonded to the same nitrogen atom may optionally be joined to form a substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heteroaryl; z3 is 0, 1, 2, 3, 4, or 5; n16 is 0, 1, 2, 3, or 4; and v16 and m16 are each independently 1 or 2. In certain embodiments, the α4β1 / 7 integrin ligand of a modified oligonucleotide is of the Formula (XXXI) or a salt, solvate, or hydrate thereof: . wherein L1, L2, L3, L4, and R1are as described herein; R2, R3, R4, and R5are each independently H, halogen, optionally substituted alkyl, optionally substituted -O-alkyl, cycloalkyl, or absent; R8is optionally substituted C1-C5alkyl, optionally substituted C1-C5alkylene-(C3- C6)-cycloalkyl, or optionally substituted (C1-C4)-alkylene-(C1-C4)-alkoxy; and R6, and R7are each independently H, halogen, alkyl, or optionally substituted alkyl, optionally substituted heteroalkyl, , , , In certain embodiments, the α4β1 / 7 integrin ligand of a modified oligonucleotide is of the Formula (XXXII) or a salt, solvate, or hydrate thereof: Formula (XXXII) wherein L1, L2, L3, L4, and R1are as described herein; R2is H, polyethylene glycol (PEG), optionally substituted heteroalkyl, or optionally substituted heteroaryl; and R3and R4are each independently H, halogen, optionally substituted alkyl, or optionally substituted -O-alkyl. In certain embodiments, L1, L2, L3, and L4are each independently absent, a bond, an optionally substituted alkyl linker, an optionally substituted polyethylene glycol (PEG) linker, an optionally substituted heteroalkyl linker, or an optionally substituted heteroaryl linker. In certain embodiments, L1is an optionally substituted heteroaryl linker. In certain embodiments, L1is an optionally substituted unsaturated heteroaryl, an optionally substituted heteroaryl or an optionally substituted saturated or partially unsaturated heterocycloalkyl linker. In certain embodiments, L1comprises the . In certain embodiments, L1is an optionally substituted heteroalkyl linker. In certain embodiments, the optionally substituted heteroalkyl linker is an optionally substituted heteroalkyl or optionally substituted C1-C10 alkyl chain in which one or more carbon atoms are replaced with O, N, or S. In certain embodiments, L1comprises the structure: . In certain embodiments, L1comprises the structure: or –N(CH3)–. In certain embodiments, L2is an optionally substituted PEG linker. In certain embodiments, the PEG linker is five PEG units in length. In certain embodiments, the PEG linker is four PEG units in length. In certain embodiments, the PEG linker is three PEG units in length. In certain embodiments, L2is an optionally substituted alkyl linker. In certain embodiments, L2is an optionally substituted C1-20alkyl linker. In certain embodiments, L2is an optionally substituted C8alkyl linker. In certain embodiments, L3is an optionally substituted heteroaryl linker. In certain embodiments, L3is an optionally substituted partially unsaturated heteroaryl linker, an optionally substituted heteroaryl or an optionally substituted saturated or partially unsaturated heterocycloalkyl linker. In certain embodiments, L3comprises the structure: . In certain embodiments, L4is an optionally substituted heteroalkyl linker. In certain embodiments, the heteroalkyl linker is substituted with one or more =O substituents. In certain embodiments, the heteroalkyl linker comprises two substituents joined together to form an optionally substituted carbocyclyl ring. In certain embodiments, L4comprises the structure: In certain embodiments, L4comprises the structure: X is O or S. In certain embodiments, L1– L2–L3–L4comprises the structure: ,

[0011] , , ,

[0012] , ,

[0013] , , or a salt thereof, wherein X is O or S. In certain embodiments, the TrkB ligand of a modified oligonucleotide is selected from the following Formulae or a salt, solvate, or hydrate thereof: Formula (V),

[0014] Formula (IX),

[0015] Formula (XII),

[0016] Formula (XX),

[0017] Formula (XXV) wherein: R is the modified oligonucleotide; and X is S or O. In certain embodiments, the CB1ligand of a modified oligonucleotide is selected from the following Formulae or a salt, solvate, or hydrate thereof: R is the modified oligonucleotide; X is S or O. In certain embodiments, the α4β1 / 7integrin ligand of a modified oligonucleotide is selected from the following Formulae or a salt, solvate, or hydrate thereof:

[0018] Formula (XXVIII) wherein: R is the modified oligonucleotide; X is S or O. In certain embodiments, the NMDA ligand of a modified oligonucleotide is selected from the following Formulae or a salt, solvate, or hydrate thereof:

[0019] wherein: R is the modified oligonucleotide; X is S or O. In certain embodiments, a compound provided herein comprises a conjugate group. In certain embodiments, an oligonucleotide provided herein comprises a conjugate group. In certain embodiments, the conjugate group is a lipid. In certain embodiments, an internucleoside linkage of a modified oligonucleotide provided herein comprises one or more lipids. In certain embodiments, an internucleoside linkage of the modified oligonucleotide comprises Formula (XXI), or a salt solvate, or hydrate thereof: Formula (XXI), wherein: Q1and Q3are each independently –H, –OR4, a ligand, a linker, or a lipid; Q2and Q4are each independently a bond, , a ligand, a linker, or a lipid; RCis independently –H, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R2is independently –H, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, –OR6, -N(R6), or -SR6; each R3is independently –H, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, –OR7, -N(R7), or -SR7; R4and R5are independently an oligonucleotide, or R4and R5are joined together to form a single oligonucleotide; each R6is independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted heteroalkyl; each R7is independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted heteroalkyl; each R8is independently an substituted or unsubstituted heteroaryl; each R9is independently an substituted or unsubstituted heteroaryl; each instance of Z1or Z2is independently a bond, C1-C6 alkylene, or C2-C6 alkenylene; and each X is independently O or S; or a salt thereof. In certain embodiments, an internucleoside linkage of the modified oligonucleotide comprises Formula (XXII), or a salt solvate, or hydrate thereof: Formula (XXII), wherein: RCis –H, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; each R2is independently –H, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, –OR6, -N(R6), or -SR6; each R3is independently –H, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, –OR7, -N(R7), or -SR7; R4and R5are independently an oligonucleotide, or R4and R5are joined together to form a single oligonucleotide; each R6is independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted heteroalkyl; each R7is independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted heteroalkyl; each R8is independently a substituted or unsubstituted heteroaryl ring; each R9is independently a substituted or unsubstituted heteroaryl ring; and each X is independently O or S; or a salt or prodrug thereof. In certain embodiments, an internucleoside linkage of the modified oligonucleotide comprises Formula (XXIII), or a salt solvate, or hydrate thereof: Formula (XXIII), wherein: each R2is independently –H, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, –OR6, -N(R6), or -SR6; each R3is independently –H, halogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, –OR7, -N(R7), or -SR7; R4and R5are independently an oligonucleotide, or R4and R5are joined together to form a single oligonucleotide; each R6is independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted heteroalkyl; each R7is independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted heteroalkyl; each R8is independently a substituted or unsubstituted heteroaryl ring; each R9is independently a substituted or unsubstituted heteroaryl ring; and each X is independently O or S; or a salt or prodrug thereof. In certain embodiments, an internucleoside linkage of the modified oligonucleotide comprises Formula (XXIV), or a salt solvate, or hydrate thereof: Formula (XXIV). wherein: R4and R5are independently an oligonucleotide, or R4and R5are joined together to form a single oligonucleotide; and each X is independently O or S. In certain embodiments, an internucleoside linkage of the modified oligonucleotide comprises Formula (XXXIII), or a salt solvate, or hydrate thereof:

[0020] Formula (XXXIII) wherein: R4and R5are independently an oligonucleotide, or R4and R5are joined together to form a single oligonucleotide; and each X is independently O or S. In certain embodiments, an internucleoside linkage of the modified oligonucleotide comprises Formula (XXXIV), or a salt solvate, or hydrate thereof: Formula (XXXIV) wherein: R4and R5are independently an oligonucleotide, or R4and R5are joined together to form a single oligonucleotide; and each X is independently O or S. In certain embodiments, an internucleoside linkage of the modified oligonucleotide comprises Formula (XXXV), or a salt solvate, or hydrate thereof:

[0021] wherein: R4and R5are independently an oligonucleotide, or R4and R5are joined together to form a single oligonucleotide; and each X is independently O or S. In certain embodiments, the compound of any preceding embodiment comprises one or more lipid conjugate groups. In certain embodiments, the one or more lipid conjugate groups are attached to one or more internucleoside linkages of the modified oligonucleotide. In certain embodiments, the one or more lipid conjugate groups are attached to the 5’ or 3’ end of the modified oligonucleotide. In certain embodiments, the one or more lipid conjugate groups are attached to an internucleoside linkage and the 5’ or 3’ end of the modified oligonucleotide. In certain embodiments, the one or more lipid conjugate groups are attached to an internucleoside linkage and both the 5’ and 3’ ends of the modified oligonucleotide. In certain embodiments, the one or more TrkB ligands are attached to the 5’ or 3’ end of the modified oligonucleotide or both the 5’ and 3’ ends of the modified oligonucleotide. In certain embodiments, the one or more conjugate groups comprise at least one TrkB ligand attached to the 5’ or 3’ end of the modified oligonucleotide or both the 5’ and 3’ ends of the modified oligonucleotide and at least one lipid. In certain embodiments, the one or more conjugate groups comprise at least one TrkB ligand attached to the 5’ or 3’ end of the modified oligonucleotide or both the 5’ and 3’ ends of the modified oligonucleotide and one or more lipid conjugate groups attached to one or more internucleoside linkages of the modified oligonucleotide. In certain embodiments, the modified oligonucleotide comprises a TrkB ligand and a lipid. In certain embodiments, the modified oligonucleotide comprises one or more TrkB ligands and one or more lipids. In certain embodiments, the modified oligonucleotide is the second modified oligonucleotide or sense oligonucleotide. In certain embodiments, the compound of any preceding embodiment comprises one or more substituted or unsubstituted alkyl or alkenyl. In certain embodiments, the substituted or unsubstituted alkyl or alkenyl is attached to an internucleoside linkage of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide comprises one or more substituted or unsubstituted alkyl or alkenyl. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl are attached to one or more internucleoside linkages of the modified oligonucleotide. In certain embodiments, the modified oligonucleotide is the second modified oligonucleotide or sense oligonucleotide. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C4-C30hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C5-C20hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C14-C20 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C16 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C17 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C18 hydrocarbon chain. In certain embodiments, the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C22hydrocarbon chain. In certain embodiments, a substituted or unsubstituted alkyl or alkenyl is attached to an internucleoside linkage of a modified oligonucleotide (e.g., a second modified oligonucleotide or sense oligonucleotide). In certain embodiments, a substituted or unsubstituted alkyl or alkenyl is attached to an internucleoside linkage of a modified oligonucleotide (e.g., a second modified oligonucleotide or sense oligonucleotide). In certain embodiments, the internucleoside linkage is between nucleosides that are within 10 positions (e.g., within 8 positions, within 6 positions, within 5 positions, within 4 positions, within 3 positions, within 2 positions) from a terminal end (e.g., the 5′ and / or 3′ end) of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between nucleosides that are within 5 positions from the 5′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between nucleosides that are within 5 positions from the 3′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, positions 7 and 8, positions 8 and 9, positions 9 and 10, positions 10 and 11, positions 11 and 12, positions 12 and 13, or positions 13 and 14 from the 5′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, or positions 7 and 8 from the 5′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 2 and 3 from the 5′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, positions 7 and 8, positions 8 and 9, positions 9 and 10, positions 10 and 11, positions 11 and 12, positions 12 and 13, or positions 13 and 14 from the 3′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 1 and 2, positions 2 and 3, positions 3 and 4, positions 4 and 5, positions 5 and 6, positions 6 and 7, or positions 7 and 8 from the 3′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage is between positions 2 and 3 from the 3′ end of the modified oligonucleotide. In certain embodiments, the internucleoside linkage of the modified oligonucleotide is selected from any one of Formulae XXI-XXIV and XXXIII-XXXV. Target Nucleic Acids and Target Regions In certain embodiments, compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain embodiments, the target nucleic acid is non-coding. In certain such embodiments, the target nucleic acid is selected from an mRNA and a pre-mRNA, including intronic, exonic and untranslated regions. In certain embodiments, the target RNA is an mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an exon. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, compounds disclosed herein hybridize with a SOD1 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding between complementary nucleobases of the nucleic acid molecules. Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized. Methods of determining whether a sequence hybridizes specifically to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein specifically hybridize with a SOD1 nucleic acid. Nucleotide sequences that encode SOD1 include, without limitation, the following: GenBank Accession No. NM_000454.5 (incorporated herein as SEQ ID NO:1), and nucleotides 5001 to 14310 of NG_008689.1 (incorporated herein as SEQ ID NO: 2). Complementarity Oligonucleotides provided herein may have a defined percent complementarity to a particular nucleic acid, target region, oligonucleotide, or portion thereof. Non-complementary nucleobases may be tolerated provided that the oligonucleotide remains able to specifically hybridize to the nucleic acid, oligonucleotide, or portion thereof. In certain embodiments, the oligonucleotides provided herein, or a specified portion thereof are at least, or are up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a target nucleic acid, a target region, an oligonucleotide or specified portion thereof. In certain embodiments, the oligonucleotides provided herein, or a specified portion thereof, are 70% to 75%, 75% to 80%, 80% to 85%, 85% to 90%, 90% to 95%, 95% to 100%, or any number in between these ranges, complementary to a target nucleic acid, a target region, an oligonucleotide or specified portion thereof. Percent complementarity of an oligonucleotide with a target nucleic acid, a target region, an oligonucleotide or specified portion thereof can be determined using routine methods. For example, an oligonucleotide in which 18 of 20 nucleobases of the oligonucleotide are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an oligonucleotide which is 18 nucleobases in length having four non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid. Percent complementarity of an oligonucleotide with a region of a target nucleic acid, a target region, an oligonucleotide or specified portion thereof can be determined routinely using BLAST programs (basic local alignment search tools) known in the art. In certain embodiments, oligonucleotides described herein, or specified portions thereof, are fully complementary (i.e.100% complementary) to a target nucleic acid, a target region, an oligonucleotide or specified portion thereof. For example, an oligonucleotide may be fully complementary to a target nucleic acid, a target region, an oligonucleotide, or specified portion thereof. As used herein, “fully complementary” means each nucleobase of an oligonucleotide is complementary to the corresponding nucleobase of a target nucleic acid, a target region, an oligonucleotide, or a specified portion thereof. For example, a 20 nucleobase oligonucleotide is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the compound. “Fully complementary” can also be used in reference to a specified portion of the first and / or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase oligonucleotide can be “fully complementary” to a 20 nucleobase region of a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase compound is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the compound. At the same time, the entire 30 nucleobase compound may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the compound are also complementary to the target sequence. In certain embodiments, oligonucleotides described herein comprise one or more mismatched nucleobases relative to a target nucleic acid, a target region, an oligonucleotide or a specified portion thereof. In certain embodiments, oligonucleotides described herein that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non- complementary nucleobase(s) relative to a target nucleic acid, or specified portion thereof. In certain embodiments, oligonucleotides described herein that are, or are up to 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, a target region, an oligonucleotide, or specified portion thereof. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 from the 5’-end of the oligonucleotide. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12, 13 or 14 from the 3’-end of the oligonucleotide. In certain embodiments, the mismatch forms a wobble base pair with a corresponding nucleobase on the target nucleic acid. For example, in certain embodiments, the mismatch forms a wobble base pair selected from hypoxanthine (nucleobase of inosine) and uracil (I:U base pair); guanine and uracil (G:U base pair); hypoxanthine and adenine (I:A base pair); and hypoxanthine and cytosine (I:C base pair). Accordingly, in certain embodiments, a mismatched nucleobase on an oligonucleotide comprises hypoxanthine, guanine, or uracil. In certain embodiments, oligonucleotides described herein may be complementary to a portion of a nucleic acid. As used herein, “portion” refers to a defined number of contiguous nucleobases within a region of a nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an oligonucleotide. In certain embodiments, the oligonucleotides are complementary to at least an 8 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 9 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 10 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least an 11 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 12 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 13 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 14 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 15 nucleobase portion of a nucleic acid. In certain embodiments, the oligonucleotides are complementary to at least a 16 nucleobase portion of a nucleic acid. Also contemplated are oligonucleotides that are complementary to at least a 9, 10, 17, 18, 19, 20, 21, 22, 23 or more nucleobase portion of a nucleic acid, or a range defined by any two of these values. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, a portion of the antisense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid. In certain embodiments, the oligonucleotide is a sense oligonucleotide. In certain embodiments, a portion of the sense oligonucleotide is compared to an equal length portion of an antisense oligonucleotide. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion of a sense oligonucleotide is compared to an equal length portion of an antisense oligonucleotide. Identity The oligonucleotides provided herein may also have a defined percent identity to a particular nucleic acid, target region, oligonucleotide, or specified portion thereof. As used herein, an oligonucleotide is identical to a sequence disclosed herein if it has the same nucleobase pairing ability. For example, a DNA which contains thymidine in place of uracil in a disclosed RNA sequence would be considered identical to the RNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the compounds described herein as well as compounds having non-identical bases relative to the compounds provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the compound. Percent identity of an oligonucleotide is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared. In certain embodiments, oligonucleotides described herein, or portions thereof, are, or are at least, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to one or more of the nucleic acids, oligonucleotides, or a portion thereof, disclosed herein. In certain embodiments, oligonucleotides described herein are about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, or any percentage between such values, to a particular nucleic acid or oligonucleotide, or portion thereof. In certain embodiments, an oligonucleotide may have one or more mismatched nucleobases. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 from the 5’-end of the oligonucleotide. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12, 13 or 14 from the 3’-end of the oligonucleotide. In certain embodiments, a portion of the oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid. In certain embodiments, the oligonucleotide is a sense oligonucleotides. In certain embodiments, a portion of the sense oligonucleotide is compared to an equal length portion of the target nucleic acid. In certain embodiments, an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleobase portion is compared to an equal length portion of the target nucleic acid. Pharmaceutical Compositions and Formulations Compounds described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered. Certain embodiments provide pharmaceutical compositions comprising one or more compounds or a salt thereof. In certain embodiments, the compounds are antisense oligonucleotides. In certain embodiments, the compounds are oligomeric compounds. In certain embodiments, the compounds comprise or consist of one or more modified oligonucleotides. In certain such embodiments, the pharmaceutical composition comprises one or more compound and a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises one or more compound and a sterile saline solution. In certain embodiments, such pharmaceutical composition consists of one compound and a sterile saline solution. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises one or more compound and sterile water. In certain embodiments, a pharmaceutical composition consists of one compound and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, a pharmaceutical composition comprises one or more compounds and phosphate-buffered saline (PBS). In certain embodiments, a pharmaceutical composition consists of one compound and sterile PBS. In certain embodiments, the sterile PBS is pharmaceutical grade PBS. A compound described herein targeted to SOD1 can be utilized in pharmaceutical compositions by combining the compound with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising a compound targeted to SOD1 and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the compound comprises or consists of one or more modified oligonucleotide provided herein. Pharmaceutical compositions comprising compounds provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. In certain embodiments, the compounds are antisense oligonucleotides. In certain embodiments, the compounds are oligomeric compounds. In certain embodiments, the compound comprises or consists of one or more modified oligonucleotide. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts. A prodrug can include the incorporation of additional nucleosides at one or both ends of a compound which are cleaved by endogenous nucleases within the body, to form the active compound. In certain embodiments, the compounds or compositions further comprise a pharmaceutically acceptable carrier or diluent. EXAMPLES The following examples describe the process to identify lead compounds targeted to SOD1. Certain compounds are distinguished as having high potency and tolerability. The following examples serve only to illustrate the compounds described herein and are not intended to limit the same. The following examples and related sequence listing accompanying this filing may identify sequence as either “RNA” or “DNA”; however, as disclosed herein, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that the designation of a sequence as “RNA” or “DNA” is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2’-OH for the natural 2’-H of DNA) or as an RNA having a modified base (methylated uracil for natural uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to, those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including, but not limited to, such nucleic acids having modified nucleobases. Each of the references recited in the present application is incorporated herein by reference in its entirety. Table 1 Chemical Nomenclature Table 2 Compound Sequence and Targeting Position on SEQ ID NO: 1

[0022] Table 3 Compound Chemistry

[0023] Example 1: Preparation of N-(17-azido-3,6,9,12,15-pentaoxaheptadecyl)-4-(7,8- dihydroxy-4-oxochroman-2-yl)benzamide A solution of 2,5-dioxopyrrolidin-1-yl 4-(7,8-dihydroxy-4-oxochroman-2-yl)benzoate (144 mg, 0.365 mmol, 1 eq) and 17-azido-3,6,9,12,15-pentaoxaheptadecan-1-amine (223 mg, 0.73 mmol, 2eq.) in DMF (2 mL) was heated at 60°C for 20 min. The mixture was then concentrated, and the crude material was purified by flash chromatography (ethyl acetate / methanol, 0-5% eluent), to afford the title compound (160 mg, 75%) as a brown solid. LCMS m / z 587 (M+1) 1H NMR (499 MHz, DMSO- d6) δ 8.71 (t, J = 5.6 Hz, 1H), 8.25 (d, J = 8.6 Hz, 2H), 8.02 (d, J = 8.6 Hz, 2H), 7.41 (d, J = 8.6 Hz, 1H), 6.99 (s, 1H), 6.96 (d, J = 8.6 Hz, 1H), 3.60 – 3.48 (m, 20H), 3.45 (q, J = 5.8 Hz, 2H), 3.40 – 3.34 (m, 2H) Example 2: Preparation of: N-(17-azido-3,6,9,12,15-pentaoxaheptadecyl)-4-(7,8- dimethoxy-4-oxochroman-2-yl)benzamide To a stirred suspension of N-(17-azido-3,6,9,12,15-pentaoxaheptadecyl)-4-(7,8- dihydroxy-4-oxochroman-2-yl)benzamide (400 mg, 0.683 mmol, 1 eq) and K2CO3 (188 mg, 1.365 mmol, 2 eq) in DMF (10 mL) was added Iodomethane (0.043 mL, 0.683 mmol, 1 eq), and the mixture stirred overnight at RT. LCMS showed a mixture of starting material, mono and di-methylation. The mixture was concentrated and purified by reverse phase column chromatography using 0-60% Water / MeCN with 0.1% formic acid as eluent, to afford three products, as yellow sticky solids: (100 mg, 24% yield) 100% pure LCMS: m / z = 615 [M+1]1H NMR (500 MHz, DMSO- d6) δ 8.71 (t, J = 5.6 Hz, 1H), 8.16 (d, J = 8.5 Hz, 2H), 8.04 (d, J = 8.5 Hz, 2H), 7.80 (d, J = 9.0 Hz, 1H), 7.30 (d, J = 9.0 Hz, 1H), 7.07 (s, 1H), 3.97 (s, 3H), 3.96 (s, 3H), 3.60 – 3.42 (m, 22H), 3.40 – 3.34 (m, 2H). Example 3: Preparation of N-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethyl)-4-(7,8- dihydroxy-4-oxochroman-2-yl)benzamide A suspension of 2,5-dioxopyrrolidin-1-yl 4-(7,8-dihydroxy-4-oxochroman-2- yl)benzoate (665 mg, 1.684 mmol, 1 eq) and 2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethan-1- amine (440 mg, 2 mmol, 1.2 eq) and DIPEA (0.5 ml, 3.7 mmol, 2.2 eq) in THF (20 mL) was heated at 60°C for 3h. The mixture was concentrated, and the resulting solids were triturated with methanol and filtered to afford the title compound (595 mg, 71%) as a beige solid, with >95% purity by HPLC. LCMS m / z 521 (M+Na) 1H NMR (499 MHz, DMSO- d6) δ 8.71 (t, J = 5.6 Hz, 1H), 8.25 (d, 8.6 Hz, 2H), 8.02 (d, 8.6 Hz, 2H), 7.41 (d, J = 8.6 Hz, 1H), 6.99 (s, 1H), 6.96 (d, J = 8.7 Hz, 1H), 3.61 – 3.51 (m, 12H), 3.45 (q, J = 5.8 Hz, 2H), 3.39 – 3.35 (m, 2H)

[0024] Example 4: Preparation of 8-(4-((17-azido-3,6,9,12,15- pentaoxaheptadecyl)(methyl)amino)phenyl)-2-methylchromeno[7,8-d]imidazol-6(3H)- one STEP 1: 8-(4-((17-azido-3,6,9,12,15-pentaoxaheptadecyl)(methyl)amino)phenyl)-2- methylchromeno[7,8-d]imidazol-6(3H)-one To a solution of 7,8-diamino-2-(4-((17-azido-3,6,9,12,15- pentaoxaheptadecyl)(methyl) amino)phenyl)-4H-chromen-4-one (700 mg, 1.28 mmol, 1 eq) in acetonitrile (15 mL) was added 1,1,1-trimethoxyethane (169.55 mg, 1.41 mmol, 1.1 eq) and iodine (32.56 mg, 128.29 μmol, 25.84 μL, 0.1 eq). The mixture was stirred at 25°C for 1 hour and then quenched by addition aq. NaHSO3 (20 mL) and extracted with ethyl acetate (20 mL x 3). The combined organic extracts were washed with brine (40 mL x 1), dried over anhydrous Na2SO4, filtered, concentrated, and purified by flash silica gel chromatography (ISCO®; 20 g SepaFlash® Silica Flash Column, Eluent 0~15% MeOH / DCM gradient @ 100 mL / min) to afford the title compound (470 mg, 64%) as a brown gum. MS ES+: 570.2 STEP 2: 8-(4-((17-chloro-3,6,9,12,15-pentaoxaheptadecyl)(methyl)amino)phenyl)-2- methylchromeno[7,8-d]imidazol-6(3H)-one To a solution of 8-(4-((17-azido-3,6,9,12,15- pentaoxaheptadecyl)(methyl)amino)phenyl)-2-methylchromeno[7,8-d]imidazol-6(3H)- one(400 mg, 702.19 umol, 1 eq) in DCM (6 mL) was added SOCl2(835.40 mg, 7.02 mmol, 509.39 μL, 10 eq). The mixture was stirred at 25 °C for 4 hours and then poured into saturated aq. NaHCO3 (40 mL) and extracted with ethyl acetate (40 mL x 3). The combined organic extracts were washed with brine (80 mL x 1), dried over anhydrous Na2SO4, filtered, and concentrated to afford the title compound as a mixture of tautomers (320 mg, 71%) as a brown gum. MS ES+: 588.3 1H NMR (400 MHz, DMSO- d6) δ = 8.08 - 7.85 (m, 2H), 7.76 (d, J = 8.5 Hz, 1H), 7.50 (br d, J = 8.3 Hz, 1H), 6.87 (br d, J = 8.9 Hz, 2H), 6.79 (s, 1H), 3.70 - 3.66 (m, 2H), 3.66 - 3.60 (m, 6H), 3.54 - 3.47 (m, 16H), 3.05 (s, 3H), 2.61 (s, 3H). STEP 3: 8-(4-((17-azido-3,6,9,12,15-pentaoxaheptadecyl)(methyl)amino)phenyl)-2- methylchromeno[7,8-d]imidazol-6(3H)-one 8-(4-((17-chloro-3,6,9,12,15-pentaoxaheptadecyl)(methyl)amino)phenyl)-2- methylchromeno[7,8-d]imidazol-6(3H)-one (310 mg, 0.527 mmol, 1 eq), and sodium azide (171 mg, 2.63 mmol, 5 eq) in dry DMF (2mL) was heated at 70°C for 12 hours. The mixture was cooled, diluted with water (20 mL), and extracted with DCM (100 mL). The organic extract was dried over Na2SO4, filtered, concentrated, and purified by column chromatography (0-20% MeOH / DCM), to afford the title compound as a mixture of tautomers: 1:2 (30:70) (120 mg, 38%) as a dark orange gum with >95% purity. LCMS m / z = 595 (M+1) Tautomeric structures were confirmed by1H NMR: Isomer 1, wherein the 7-NH proton appears further down field at δ 13.38; and Isomer 2, wherein the 9-NH proton appears upfield at δ 12.98 The isomer 1 tautomeric mixture (80 mg) was further purified by flash column chromatography to obtain pure 2 (50 mg) as a dark orange gum. Isomer 1:1H NMR: (499 MHz, DMSO- d6) δ 13.38, 12.85 (2s, 1H), 8.09, 7.94 (d, J = 8.7 Hz, 2H), 7.77, 7.72 (d, J = 8.5 Hz, 1H), 7.54, 7.47 (d, J = 8.5 Hz, 1H), 6.88, 6.85 (d, J = 9.0 Hz, 2H), 6.81, 6.79 (s, 1H), 3.67 – 3.62 (m, 2H), 3.58 – 3.54 (m, 2H), 3.54 – 3.45 (m, 16H), 3.38 – 3.35 (m, 2H), 3.06, 3.05 (s, 3H), 2.63, 2.60 (s, 3H). Isomer 2:1H NMR (499 MHz, DMSO- d6) δ 12.98 (s, 1H), 7.98 (d, J = 8.7 Hz, 2H), 7.76 (d, J = 8.5 Hz, 1H), 7.50 (d, J = 8.5 Hz, 1H), 6.87 (d, J = 9.0 Hz, 2H), 6.80 (s, 1H), 3.62 (m, 4H), 3.58 – 3.54 (m, 2H), 3.54 – 3.45 (m, 16H), 3.40 – 3.34 (m, 2H), 3.05 (s, 3H), 2.61 (s, 3H). Example 5: Preparation of (S)-3-(4-(5-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)-2- methyl-3-oxo-2,3-dihydropyridazin-4-yl)phenyl)-2-(3,5- dichloroisonicotinamido)propanoic acid STEP 1: tert-butyl (S)-2-(3,5-dichloroisonicotinamido)-3-(4-(5-(2-(2-(2-(2-hydroxyethoxy) ethoxy)ethoxy)ethoxy)-2-methyl-3-oxo-2,3-dihydropyridazin-4-yl)phenyl)propanoate A solution of tert-butyl (S)-2-(3,5-dichloroisonicotinamido)-3-(4-(2-methyl-3-oxo-5- ((1-phenyl-2,5,8,11-tetraoxatridecan-13-yl)oxy)-2,3-dihydropyridazin-4- yl)phenyl)propanoate (prepared as described in Gong et. al., “Synthesis and Biological Evaluation of Novel Pyridazinone-Based α4 Integrin Receptor Antagonists,” J. Med. Chem., 2006, 49, 11, 3402-3411, 0.81 g, 1.02 mmol) in methanol (17 ml) was stirred under Hydrogen atmosphere (1atm), in the presence of Pd / C (0.11 g, 1.02 mmol) for 2 hours. The catalyst was removed by filtration, and the filtrate was concentrated and purified by silica gel column chromatography using a 0-5% MeOH in DCM to obtain the titled compound (0.47 g, 66%). MS (ESI) m / z 696.6 [M+H]+STEP 2: tert-butyl (S)-2-(3,5-dichloroisonicotinamido)-3-(4-(2-methyl-5-(2-(2-(2-(2- ((methylsulfonyl)oxy)ethoxy)ethoxy)ethoxy)ethoxy)-3-oxo-2,3-dihydropyridazin-4- yl)phenyl)propanoate Methanesulfonyl chloride (17 ul, 0.216 mmol) in DCM (1.4 ml) was added dropwise to a solution of tert-butyl (S)-2-(3,5-dichloroisonicotinamido)-3-(4-(5-(2-(2-(2-(2- hydroxyethoxy) ethoxy)ethoxy)ethoxy)-2-methyl-3-oxo-2,3-dihydropyridazin-4- yl)phenyl)propanoate (0.10 g, 0.144 mmol) in pyridine (1.4 ml) at 0°C. The reaction mixture was stirred at room temperature for 16 h and then quenched by addition of water (10 ml) and extracted with DCM (3x10 ml). The organic layer was washed with a saturated solution of NaHCO3(10 ml) and brine (10 ml). The combined organic extracts were dried over anhydrous Na2SO4 and concentrated to obtain the title compound as a brown oil (0.11 g, quant.). MS (ESI) m / z 773.5 [M+H]+STEP 3: tert-butyl (S)-3-(4-(5-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)-2-methyl-3- oxo-2,3-dihydropyridazin-4-yl)phenyl)-2-(3,5-dichloroisonicotinamido)propanoate To a solution of tert-butyl (S)-2-(3,5-dichloroisonicotinamido)-3-(4-(2-methyl-5-(2- (2-(2-(2-((methylsulfonyl)oxy)ethoxy)ethoxy)ethoxy)ethoxy)-3-oxo-2,3-dihydropyridazin-4- yl)phenyl)propanoate (0.11 mg, 0.143 mmol) in DMF (2.3 ml) was added NaN3 (21 mg, 0.316 mmol) followed by 1 drop of water. The mixture was stirred for 6 hours at 80°C and then cooled to room temperature and partitioned between ethyl acetate (20 ml) and water (20 ml). The organic phase was separated, and the aqueous phase was extracted twice with ethyl acetate (2x15 ml). The combined organic extracts were washed with brine (x2), dried, filtered, concentrated, and purified by silica-gel column chromatography using a gradient 0- 100% ethyl acetate in hexane to afford the titled compound as a clear oil (85 mg, 82%). MS (ESI) m / z 721.6 [M+H]+STEP 4: (S)-3-(4-(5-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)-2-methyl-3-oxo-2,3- dihydropyridazin-4-yl)phenyl)-2-(3,5-dichloroisonicotinamido)propanoic acid TFA (0.14 ml) was added dropwise at 0°C to a solution of tert-butyl (S)-3-(4-(5-(2-(2- (2-(2-azidoethoxy)ethoxy)ethoxy)ethoxy)-2-methyl-3-oxo-2,3-dihydropyridazin-4- yl)phenyl)-2-(3,5-dichloroisonicotinamido)propanoate (25 mg, 0.035 mmol) in DCM (0.3 ml). The cooling bath was removed, and the mixture was stirred at room temperature for 17 hours and then concentrated and purified by silica-gel column chromatography using a gradient 0-100% methanol in DCM to afford the title product (16 mg, 69%). MS (ESI) m / z 687.8 [M+Na]+1H NMR (500 MHz, DMSO-d6) δ 12.95 (s, 1H), 9.31 (d, J = 10 Hz, 1H), 8.63 (s, 2H), 8.20 (s, 1H), 7.42 (d, J = 10 Hz, 2H), 7.29 (d, J = 10 Hz, 2H), 4.78-4.72 (m, 1H), 4.36-4.32 (m, 2H), 3.66 (s, 5H), 3.57 (t, J = 5 Hz, 2H), 3.36 (t, J = 5 Hz, 2H), 3.53-3.47 (m, 8H), 3.20 (dd, J = 10, 5 Hz, 1H), 2.93 (q, J = 10 Hz, 1H) Example 6: Preparation of (3S)-3-(2-(4-(14-azido-3-methyl-6,9,12-trioxa-3- azatetradecyl)-2-oxopyridin-1(2H)-yl)-5-methylhexanamido)-3-(2’,4’,6’-trimethyl-[1,1’- biphenyl]-3-yl)propanoic acid STEP 1: ethyl (E)-2-(4-(2-ethoxyvinyl)-2-oxopyridin-1(2H)-yl)-5-methylhexanoate To a stirred solution of ethyl 2-(4-bromo-2-oxopyridin-1-yl)-5-methylhexanoate (prepared according to procedures described in WO2021076890, 4.8 g, 14.54 mmol) and 2- [(E)-2-ethoxyethenyl]-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (5.76 g, 29.081 mmol) in dioxane (50 ml) and water (5 ml) were added K2CO3(4.02 g, 29.10 mmol) and Pd(PPh3)4(1.68 g, 1.45 mmol) at room temperature under nitrogen atmosphere. The resulting mixture was stirred overnight at 70°C under nitrogen atmosphere. The mixture was cooled to room temperature, quenched by the addition of water, and then extracted with ethyl acetate. The combined organic extracts were washed with brine, dried over anhydrous Na2SO4, filtered, concentrated, and purified by silica gel column chromatography and eluted with PE / EA (1:1) to afford the title product (Pinacol containing). The residue was further purified by reversed-phase flash chromatography (C18 silica gel column; mobile phase, acetonitrile in water, 10-100% gradient in 25 min; detector, UV 254 nm) to afford the title compound (4 g, 86%) as a brown oil. MS (ESI) m / z 322.1 [M+H]+1H NMR (300 MHz, CDCl3) δ 7.16 (m, J = 19.4, 10.1 Hz, 2H), 6.37 (s, 1H), 6.19 (d, J 5 = 7.4 Hz, 1H), 5.60 (d, J = 13.0 Hz, 1H), 5.54 (m, J = 10.2, 5.6 Hz, 1H), 4.19 (q, J = 7.2 Hz, 2H), 3.94 (q, J = 7.1 Hz, 2H), 2.29 – 2.03 (m, 1H), 1.86 (d, J = 12.3 Hz, 1H), 1.57 (m, J = 13.3, 6.8 Hz, 1H), 1.35 (t, J = 7.0 Hz, 3H), 1.24 (m, J = 8.5, 7.8 Hz, 4H), 1.14 – 1.04 (m, 1H), 0.87 (m, J = 6.8, 3.0 Hz, 6H) 0 STEP 2: ethyl 5-methyl-2-(2-oxo-4-(2-oxoethyl)pyridin-1(2H)-yl)hexanoate Ethyl (E)-2-(4-(2-ethoxyvinyl)-2-oxopyridin-1(2H)-yl)-5-methylhexanoate (3.9 g, 12.134 mmol) and TFA (40 ml) were stirred overnight at room temperature. The resulting mixture was concentrated and purified by silica gel column chromatography, (eluted with PE / EA, 1 / 2) to afford the title compound (1.9 g, 53%) as a yellow oil. 5 MS (ESI) m / z 294.2 1H NMR (300 MHz, Chloroform-d) δ 9.76 (t, J = 2.0 Hz, 1H), 7.35 (d, J = 7.1 Hz, 1H), 6.54 – 6.47 (m, 1H), 6.14 (m, J = 7.2, 2.0 Hz, 1H), 5.56 (m, J = 10.1, 5.6 Hz, 1H), 4.21 (q, J = 7.1 Hz, 2H), 3.56 (d, J = 2.0, 0.8 Hz, 2H), 2.19 (m, J = 14.0, 11.1, 5.5 Hz, 1H), 1.88 (m, J = 18.8, 10.4, 4.8 Hz, 1H), 1.59 (m, J = 13.3, 6.7 Hz, 1H), 1.34 – 1.16 (m, 4H), 1.16 –0 0.98 (m, 1H), 0.88 (q, J = 6.6, 3.1 Hz, 6H) STEP 3: ethyl 5-methyl-2-(2-oxo-4-(2,2,3,3,16-pentamethyl-4,7,10,13-tetraoxa-16-aza-3- silaoctadecan-18-yl)pyridin-1(2H)-yl)hexanoate To a stirred solution of ethyl 5-methyl-2-(2-oxo-4-(2-oxoethyl)pyridin-1(2H)-5 yl)hexanoate (1.8 g, 6.136 mmol) in DCM (27 ml) was added 15,15,16,16-tetramethyl- 5,8,11,14-tetraoxa-2-aza-15-silaheptadecane (1.97 g, 6.127 mmol) and STAB (2.60 g, 12.268 mmol). The resulting mixture was stirred for 2 hours at room temperature, quenched by the addition of water (100 ml), and extracted with DCM (3 x 120ml). The combined organic extracts were washed with brine (2 x 50 ml), dried over anhydrous Na2SO4, filtered, 0 concentrated, and purified by silica gel column chromatography (eluted with DCM / MeOH (10:1)) to afford the title compound (1.6 g, 44%) as a yellow-brown oil. MS(ESI) m / z 599.3 [M+H]+1HNMR (300 MHz, Acetonitrile-d3) δ 7.25 (d, J = 7.1 Hz, 1H), 6.20 (s, 1H), 6.11 (m, J = 7.1, 2.0 Hz, 1H), 5.08 (m, J = 10.2, 5.4 Hz, 1H), 4.08 (q, J = 7.1 Hz, 2H), 3.66 (m, J = 5.7, 4.4 Hz, 2H), 3.57 – 3.47 (m, 11H), 3.47 – 3.37 (m, 3H), 2.68 – 2.48 (m, 4H), 2.24 (s, 3H), 2.15 – 1.99 (m, 1H), 1.90 (m, 1H), 1.48 (m, J = 13.4, 6.8 Hz, 1H), 1.25 – 1.11 (m, 5H),1.07-0.88 (m, 1H), 0.83 (s, 9H), 0.79 (m, J = 6.6, 3.0 Hz, 6H), 0.02 (s, 6H) STEP 4: 5-methyl-2-(2-oxo-4-(2,2,3,3,16-pentamethyl-4,7,10,13-tetraoxa-16-aza-3- silaoctadecan-18-yl)pyridin-1(2H)-yl)hexanoic acid To a stirred solution of ethyl 5-methyl-2-[2-oxo-4-(2,2,3,3,16-pentamethyl-4,7,10,13- tetraoxa-16-aza-3-silaoctadecan-18-yl)pyridin-1-yl]hexanoate (1.4 g, 2.338 mmol) in THF (14 ml) and water (2.8 ml) was added lithium hydroxide (223.95 mg, 9.352 mmol), and the resulting mixture was stirred for 2 hours at room temperature. Acetic acid (0.71 g, 11.688 mmol) in water (14 ml) was then added dropwise at 0°C, and the resulting mixture extracted with CH3Cl (3 x 100 ml). The combined organic extracts were washed with brine (2 x 40 ml), dried over anhydrous MgSO4, filtered, and concentrated to provide the title compound (0.90 g, 67%) as a yellow semi-solid, which was used in the next step without further purification. MS(ESI) m / z 571.3 [M+H]+STEP 5: methyl (3S)-3-(5-methyl-2-(2-oxo-4-(2,2,3,3,16-pentamethyl-4,7,10,13-tetraoxa-16- aza-3-silaoctadecan-18-yl)pyridin-1(2H)-yl)hexanamido)-3-(2',4',6'-trimethyl-[1,1'-biphenyl]- 3-yl)propanoate To methyl (3S)-3-amino-3-(2',4',6'-trimethyl-[1,1'-biphenyl]-3-ylpropanoate (600 mg, 2.017 mmol) and 5-methyl-2-[2-oxo-4-(2,2,3,3,16-pentamethyl-4,7,10,13-tetraoxa-16-aza-3- silaoctadecan-18-yl)pyridin-1-yl]hexanoic acid (1.15 g, 2.017 mmol) in DMF (12 ml) were added DIEA (782.27 mg, 6.051 mmol), HBTU (765.13 mg, 2.017 mmol), and HOBT (27.26 mg, 0.202 mmol), and the resulting mixture was stirred for 2h at room temperature under nitrogen atmosphere and then purified by reversed-phase flash chromatography (C18 silica gel column; mobile phase, acetonitrile in water, 40-100% gradient in 10 min; 100% gradient in 20 min; detector, UV 220 nm / 305nm) to afford the title compound (509.0 mg, 29%) as a brown oil. MS(ESI) m / z 850.6 [M+H]+1H NMR (300 MHz, DMSO-d6) δ 8.95 (m, J = 27.0, 8.5, 5.6 Hz, 1H), 7.57 (m, J = 12.3, 7.3, 5.2 Hz, 1H), 7.45 – 7.19 (m, 2H), 7.12 – 6.86 (m, 4H), 6.18 (m, J = 21.3, 11.5, 5.6 Hz, 2H), 5.77 (d, J = 5.1 Hz, 1H), 5.34 (m, J = 61.7, 13.7, 5.9 Hz, 2H), 3.68 (q, J = 5.2 Hz, 2H), 3.63 – 3.39 (m, 15H), 3.32 (s, 2H), 2.83 (t, J = 6.5 Hz, 2H), 2.24 (m, J = 12.7, 5.5 Hz, 6H), 1.95 – 1.80 (m, 7H), 1.70 – 1.57 (m, 1H), 1.57 – 1.47 (m, 1H), 1.47-1.34 (m, 1H), 1.24 (d, J = 5.5 Hz, 2H), 1.15-0.96 (m, 1H), 0.93 – 0.79 (m, 13H), 0.72 (t, J = 6.0 Hz, 4H), 0.08 – 0.01 (m, 6H) STEP 6: methyl (3S)-3-(2-(4-(14-hydroxy-3-methyl-6,9,12-trioxa-3-azatetradecyl)-2- oxopyridin-1(2H)-yl)-5-methylhexanamido)-3-(2',4',6'-trimethyl-[1,1'-biphenyl]-3- yl)propanoate To a solution of methyl (3S)-3-(5-methyl-2-(2-oxo-4-(2,2,3,3,16-pentamethyl- 4,7,10,13-tetraoxa-16-aza-3-silaoctadecan-18-yl)pyridin-1(2H)-yl)hexanamido)-3-(2',4',6'- trimethyl-[1,1'-biphenyl]-3-yl)propanoate (0.25 g, 0.294 mmol) in THF (2 ml), TBAF (0.35 ml, 0.35 mmol, 1M in THF) was added dropwise. The reaction mixture was stirred at room temperature under inert atmosphere for 2 hours and then diluted with saturated ammonium chloride solution (15 ml) and extracted with ethyl acetate (3 x 15 ml). The combined organic extracts were washed with brine (10 mL), dried over anhydrous Na2SO4, filtered, concentrated and purified by column chromatography (0-15 % MeOH in DCM) to afford the title compound as a clear oil (0.12 mg, 55%). MS (ESI) m / z 759.1 [M+Na]+STEP 7: methyl (3S)-3-(5-methyl-2-(4-(3-methyl-14-((methylsulfonyl)oxy)-6,9,12-trioxa-3- azatetradecyl)-2-oxopyridin-1(2H)-yl)hexanamido)-3-(2',4',6'-trimethyl-[1,1'-biphenyl]-3- yl)propanoate To a solution of methyl (3S)-3-(2-(4-(14-hydroxy-3-methyl-6,9,12-trioxa-3- azatetradecyl)-2-oxopyridin-1(2H)-yl)-5-methylhexanamido)-3-(2',4',6'-trimethyl-[1,1'- biphenyl]-3-yl)propanoate (0.12 g, 0.163 mmol) in DCM (1 ml), methanesulfonyl chloride (0.016 ml, 0.212 mmol) and triethylamine (0.045 ml, 0.33 mmol) were added. The reaction mixture was stirred at 0°C for 2 hours and then diluted with saturated aqueous sodium bicarbonate (10 ml) and extracted with DCM (3 x 20 ml). The combined organic extracts were washed with brine (10 ml), dried over anhydrous Na2SO4, filtered, and concentrated to afford the title compound as a brown oil (0.11 g, 83%). MS (ESI) m / z 815.1 [M+H]+ STEP 8: methyl (3S)-3-(2-(4-(14-azido-3-methyl-6,9,12-trioxa-3-azatetradecyl)-2- oxopyridin-1(2H)-yl)-5-methylhexanamido)-3-(2',4',6'-trimethyl-[1,1'-biphenyl]-3- yl)propanoate To a solution of methyl (3S)-3-(5-methyl-2-(4-(3-methyl-14-((methylsulfonyl)oxy)- 6,9,12-trioxa-3-azatetradecyl)-2-oxopyridin-1(2H)-yl)hexanamido)-3-(2',4',6'-trimethyl-[1,1'- biphenyl]-3-yl)propanoate (0.11 g, 0.135 mmol) in DMF (1 ml), sodium azide (24 mg, 0.37 mmol) was added. The reaction mixture was heated at 65°C for 2 hours and then diluted with water (15 ml) and extracted with ethyl acetate (3 x 15 ml). The combined organic extracts were washed with brine (10 ml), dried over anhydrous Na2SO4, filtered, concentrated, and purified by silica gel column chromatography (0-15% MeOH in DCM) to afford the title compound as a clear oil (45 mg, 44%). MS (ESI) m / z 762.2 [M+H]+STEP 9: (3S)-3-(2-(4-(14-azido-3-methyl-6,9,12-trioxa-3-azatetradecyl)-2-oxopyridin- 1(2H)-yl)-5-methylhexanamido)-3-(2',4',6'-trimethyl-[1,1'-biphenyl]-3-yl)propanoic acid To a solution of methyl (3S)-3-(2-(4-(14-azido-3-methyl-6,9,12-trioxa-3- azatetradecyl)-2-oxopyridin-1(2H)-yl)-5-methylhexanamido)-3-(2',4',6'-trimethyl-[1,1'- biphenyl]-3-yl)propanoate (45 mg, 0.059 mmol) in methanol / water / dioxane (1.5 ml, 1:1:1), lithium hydroxide (4 mg, 0.177 mmol) was added, and the mixture was stirred at room temperature for 2 hours. The mixture was concentrated, and the resulting residue was treated with 10% citric acid solution and extracted with ethyl acetate (3 x 15 ml). The combined organic extracts were washed with brine (5 ml), dried over anhydrous Na2SO4, filtered, and concentrated to afford the title compound as a clear oil (30 mg, 75%). MS (ESI) m / z 748.1 [M+H]+1H NMR (500 MHz, DMSO-d6) δ 12.35 (bs, 1H), 9.00 (d, J = 10 Hz, 1H), 7.69 (d, J = 10 Hz, 1H), 7.37 (t, J = 10 Hz, 1H), 7.27 (d, J = 5 Hz, 1H), 7.06 (s, 1H), 6.99 (d, J = 5 Hz, 1H), 6.91 (s, 2H), 6.29 (s, 1H), 6.18 (d, J = 5 Hz, 1H), 5.47 (q, J = 5 Hz, 1H), 5.17 (q, J = 5 Hz, 1H), 4.09 (m, 3H), 2.64 (t, 5 Hz, 2H), 3.61-3.57 (m, 13H), 3.16 (s, 6H), 2.26 (s, 3H), 1.90 (s, 6H), 1.87-1.79 (m, 1H), 1.68-1.64 (m, 1H), 1.41-1.35 (m, 1H), 0.95-0.82 (m, 3H), 6.60 (d, J = 10 Hz, 6H) Example 7: Synthesis of N-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethyl)-2-(2- chlorophenyl)pyrrolidine-1-carboxamide To a stirred solution of 2-[(8-azido-3,6-dioxaoct-1-yl)oxy]ethan-1-amine (300 mg, 1.375 mmol) in DCM (6 mL) was added disuccinimidyl carbonate (422.53 mg, 1.649 mmol) in portions at 0°C and the mixture stirred for 4 h at room temperature under nitrogen atmosphere. DIEA (44.06 mg, 0.341 mmol) and 2-(2-chlorophenyl)tetrahydropyrrole (247.71 mg, 1.364 mmol) were then added dropwise at 0°C, and the resulting mixture was stirred overnight at room temperature under nitrogen atmosphere. The reaction was quenched by the addition of saturated NaHCO3 solution at 0°C and extracted with ethyl acetate. The combined organic extracts were washed with water and brine, dried over Na2SO4, filtered, concentrated, and purified by prep-HPLC (SunFire C18 OBD Prep Column 19*150 mm, 5m; Mobile Phase A: Water (0.1% FA), Mobile Phase B: ACN; Flow rate: 25 mL / min mL / min; Gradient: isocratic 37-47; Wave Length: 254nm / 220nm nm; RT1(min): 8.26) to afford the title compound (180 mg, 31%) as a colorless oil. MS(ESI) m / z= 426.1 [M+H]+NMR (300 MHz, Chloroform-d) δ 7.36 – 7.24 (m, 1H), 7.20 – 7.15 (m, 1H), 7.15 – 7.07 (m, 2H), 5.16 – 5.00 (m, 1H), 4.01 (s, 1H), 3.71 – 3.51 (m, 8H), 3.50 – 3.38 (m, 4H), 3.37 – 3.23 (m, 5H), 2.43 – 2.26 (m, 1H), 1.89 – 1.71 (m, 3H) PREPARATION OF LIGAND-CONJUGATED OLIGONUCLEOTIDES Exemplary ligand-conjugated oligonucleotides falling within the scope of the present disclosure, may be synthesized according to the following procedures. In some instances, one Ligand (Ligand A in the general procedures described below) is conjugated to the 5' end of an oligonucleotide. In some instances, two identical Ligands (Ligand A and Ligand A) are conjugated to the 5' and 3' ends of an oligonucleotide. In some instances, two different Ligands (Ligand A and Ligand B) are conjugated to the 5' and 3' ends of an oligonucleotide. In some instances, one Ligand (Ligand A) is conjugated to the 3' end of an oligonucleotide. Example 8: General Procedure I Type A - Ligand Conjugated to 5’ end of Sense Strand STEP 1: 5'-DBCO Functionalized Sense Strand Sodium Phosphate buffer (10% V / V, 1M, pH7) and acetonitrile (20%-50% V / V) were added to an aqueous solution of 5’-amine functionalized sense strand. A solution of DBCO- NHS (1.5-3 eq) in DMSO or acetonitrile was then added and the reaction monitored by LCMS and HPLC. Upon completion, any precipitate was removed via centrifugation and the aqueous solution purified by reverse phase HPLC, dried by lyophilization and the dried 5'- DBCO functionalized sense strand reconstituted in RNase free water. STEP 2: 5’- Ligand Conjugated Sense Strand A solution of Ligand A—N3 (2 eq) in DMSO or THF was added to a solution of 5’- DBCO modified sense strand (1 eq) and the reaction monitored by HPLC and LCMS. Upon completion, the 5’-conjugated sense strand was purified by reverse phase HPLC or molecular weight cut-off with Amicon® Ultra-15 Centrifugal filter (3K, 5 times). Example 9: General Procedure I Type B - Ligand Conjugated to 5’ end of Sense Strand STEP 1: 5'-DBCO Functionalized Sense Strand Sodium Phosphate buffer (10% V / V 1M, pH7) is added to an aqueous solution of 5’- (C6-SS-C6)-mC functionalized sense strand. Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) (25 eq) in water (pH7) is added and the reaction monitored by HPLC and LCMS. Upon completion, excess TCEP is removed by molecular weight cut-off with sodium phosphate buffer (100 mM, pH7, 3x). A solution of DBCO-MAL (3 eq) in DMSO is added and the reaction monitored by LCMS and HPLC. Upon completion, any solids are removed via centrifugation, the solution purified by reverse phase HPLC, dried by lyophilization and the dried product reconstituted in RNase free water. STEP 2: 5'- Ligand Conjugated Sense Strand To a solution of 5’-DBCO functionalized sense strand (1 eq) is added a solution of Ligand A—N3 (3 eq) in DMSO or THF and the reaction monitored by HPLC and LCMS. Upon completion, the 5’-conjugated sense strand is purified by reverse phase HPLC or molecular weight cut-off with Amicon® Ultra-15 Centrifugal filter (3K, 5 times). Example 10: General Procedure II Type A - Bis-homo-3',5'-Ligand Conjugated Sense Strand STEP 1: 3’,5’-bis-DBCO modified sense strand Sodium Phosphate buffer (10% V / V 1M, pH7) and acetonitrile (20%-50% V / V) were added to an aqueous solution of 3’,5’ amine functionalized sense strand. A solution of DBCO-NHS (3 eq) in DMSO or CH3CN was then added and the reaction monitored by LCMS and HPLC. Upon completion, the product was purified by reverse phase HPLC, dried by lyophilization and reconstituted in RNase free water. STEP 2: 3’,5’-bis-conjugated sense strand A solution of Ligand A—N3 (3 eq) in DMSO or CH3CN was added to a solution of 3’,5’-bis-DBCO modified sense strand (1 eq) and the reaction monitored by HPLC and LCMS. Upon completion, the 3’,5’-bis conjugated sense strand was purified by reverse phase HPLC, dried by lyophilization, reconstituted in RNase free water and desalted using Amicon®Ultra-15 Centrifugal filter (3K, 5 times).

[0025] Example 11: General Procedure II Type B - Bis-homo-5',3'- Ligand Conjugated Sense Strand STEP 1: 3’,5’-bis-DBCO modified sense strand Sodium Phosphate buffer (10% V / V 1M, pH7) is added to an aqueous solution of 5’, 3’-Bis (C6-SS-C6)-mC functionalized sense strand. Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) (25 eq) in water (pH7) is added and the reaction monitored by HPLC and LCMS. Upon completion, excess TCEP is removed by MWCO with sodium phosphate buffer (100 mM, pH7, 3x). A solution of DBCO-MAL (3 eq) in DMSO is added and the reaction monitored by LCMS and HPLC. Upon completion, any solids are removed via centrifugation and the solution purified by reverse phase HPLC, dried by lyophilization and the dried bis-DBCO modified sense strand reconstituted in RNase free water. STEP 2: 3’,5’-bis-conjugated sense strand To a solution of 5’,3’-Bis-DBCO functionalized sense strand (1 eq) is added a solution of Ligand A-N3(3 eq) in DMSO or THF and the reaction monitored by HPLC and LCMS. Upon completion, the bis-homo-5’-, 3’conjugated sense strand is purified by reverse phase HPLC or molecular weight cut-off with Amicon® Ultra-15 Centrifugal filter (3K, 5 times). Example 12: General Procedure II Type C - Bis-homo-5',3'- Ligand Conjugated Sense Strand STEP 1: 5'-DBCO / 3'-(C6-SS-C6)-mC Functionalized Sense Strand 5 Sodium Phosphate buffer (10% V / V 1M, pH7) and acetonitrile (20% -50% V / V) were added to an aqueous solution of 5’-amine functionalized sense strand. A solution of DBCO- NHS (1.5-3 eq) in DMSO or acetonitrile was then added and the reaction was monitored by LCMS and HPLC. Upon completion, any precipitate was removed via centrifugation and the aqueous solution purified by reverse phase HPLC. The product fractions were combined,0 dried by lyophilization and the dried N-DBCO modified sense strand reconstituted in RNase free water for step 2. STEP 2: 5',3'-Bis DBCO Functionalized Sense Strand Sodium Phosphate buffer (10% V / V 1M, pH7) was added to an aqueous solution of5 5’-DBCO / 3’-(C6-SS-C6)-mC functionalized sense strand. Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) (25 eq) in water (pH7) was added and the reaction was monitored by HPLC and LCMS. Upon completion, excess TCEP was removed by MWCO with sodium phosphate buffer (100 mM, pH7, 3x). A solution of DBCO-MAL (3 eq) in DMSO was added and the reaction was monitored by LCMS and HPLC. Upon completion, any solids were removed via centrifugation and the solution was purified by reverse phase HPLC, dried by lyophilization and the dried bis-DBCO modified sense strand reconstituted in RNase free water for step 3. STEP 3: Bis-homo-5',3'- Ligand Conjugated Sense Strand To a solution of 5’-, 3’-Bis-DBCO functionalized sense strand (1 eq) was added a solution of Ligand A-N3(3 eq) in DMSO or THF and the reaction was monitored by HPLC and LCMS. Upon completion, the bis-homo-5’-, 3’conjugated sense strand was purified by reverse phase HPLC or molecular weight cut-off with Amicon® Ultra-15 Centrifugal filter (3K, 5 times). The product was confirmed by HPLC and LCMS.

[0026] Example 13: General Procedure II Type D - Bis-homo-5',3'- Ligand Conjugated Sense Strand STEP 1: 5'-(C6-SS-C6)-mC / 3'-DBCO Functionalized Sense Strand Sodium Phosphate buffer (10% V / V 1M, pH7) and acetonitrile (20% -50% V / V) were added to an aqueous solution of 5’-amine functionalized sense strand. A solution of DBCO- NHS (1.5-3 eq) in DMSO or acetonitrile was then added and the reaction was monitored by LCMS and HPLC. Upon completion, any precipitate was removed via centrifugation and the aqueous solution purified by reverse phase HPLC. The product fractions were combined, dried by lyophilization and the dried N-DBCO modified sense strand reconstituted in RNase free water for step 2. STEP 2: 5',3'-Bis DBCO Functionalized Sense Strand Sodium Phosphate buffer (10% V / V 1M, pH7) was added to an aqueous solution of 5’-DBCO / 3’-(C6-SS-C6)-mC functionalized sense strand. Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) (25 eq) in water (pH7) was added and the reaction was monitored by HPLC and LCMS. Upon completion, excess TCEP was removed by MWCO with sodium phosphate buffer (100 mM, pH7, 3x). A solution of DBCO-MAL (3 eq) in DMSO was added and the reaction was monitored by LCMS and HPLC. Upon completion, any solids were removed via centrifugation and the solution was purified by reverse phase HPLC, dried by lyophilization and the dried bis-DBCO modified sense strand reconstituted in RNase free water for step 3. STEP 3: Bis-homo-5',3'- Ligand Conjugated Sense Strand To a solution of 5’-, 3’-Bis-DBCO functionalized sense strand (1 eq) was added a solution of Ligand A-N3(3 eq) in DMSO or THF and the reaction was monitored by HPLC and LCMS. Upon completion, the bis-homo-5’-, 3’conjugated sense strand was purified by reverse phase HPLC or molecular weight cut-off with Amicon® Ultra-15 Centrifugal filter (3K, 5 times). The product was confirmed by HPLC and LCMS.

[0027] Example 14: General Procedure III Type A - Bis-hetero-3',5'- Ligand Conjugated Sense Strand STEP 1: 5’-conjugated, 3’-(C6-SS-C6)-mC functionalized sense strand A solution of Ligand A—N3 (2 eq) in DMSO was added to an aqueous solution of 5’- DBCO modified sense strand (1 eq, see above for preparation) and the reaction was monitored by HPLC and LCMS. Upon completion, the 5’-conjugated sense strand was purified by reverse phase HPLC or molecular weight cut-off with Amicon®Ultra-15 Centrifugal filter (3K, 5 times). STEP 2: The 5’-conjugated, 3’-DBCO modified sense strand Sodium phosphate buffer (10% V / V 1M, pH7) was added to a solution of 5’- conjugated, 3’-(C6-SS-C6)-mC functionalized sense strand (1 eq) in water. Tris(2- carboxyethyl)phosphine hydrochloride (TCEP, 25 eq) in water (pH7) was added and the reaction was monitored by HPLC and LCMS. Upon completion, excess TCEP was removed by MWCO with sodium phosphate buffer (100 mM, pH7, 3x). A solution of DBCO-MAL (3 eq) in DMSO was added and the reaction monitored by HPLC and LCMS. Upon completion, the aqueous solution was purified by reverse phase HPLC, dried by lyophilization and the dried 5’-conjugated, 3’-DBCO modified sense strand was reconstituted in Sodium Phosphate buffer (100mM) for step 3. STEP 3: Bis-hetero-3',5'- Ligand Conjugated Sense Strand A solution of Ligand B—N3 (2 eq) in DMSO was added to an aqueous solution of 5’- conjugated, 3’-DBCO functionalized sense strand (1 eq) and the reaction was monitored by HPLC and LCMS. Upon completion, the 5’-, 3’-conjugated sense strand was purified by reverse phase HPLC or molecular weight cut-off with Amicon®Ultra-15 Centrifugal filter (3K, 5 times).

[0028] Example 15: General Procedure III Type B - Bis-hetero-3',5'- Ligand Conjugated Sense Strand STEP 1: 5'-(C6-SS-C6)-mC, 3’-conjugated sense strand A solution of Ligand A—N3 (2 eq) in DMSO was added to an aqueous solution of 3'- DBCO modified sense strand (1 eq, see above for preparation) and the reaction was monitored by HPLC and LCMS. Upon completion, the 3’-conjugated sense strand was purified by reverse phase HPLC or molecular weight cut-off with Amicon®Ultra-15 Centrifugal filter (3K, 5 times). STEP 2: The 5’-DBCO, 3’-conjugated sense strand Sodium phosphate buffer (10% V / V 1M, pH7) was added to a solution of 5’- conjugated, 3’-(C6-SS-C6)-mC functionalized sense strand (1 eq) in water. Tris(2- carboxyethyl)phosphine hydrochloride (TCEP, 25 eq) in water (pH7) was added and the reaction was monitored by HPLC and LCMS. Upon completion, excess TCEP was removed by MWCO with sodium phosphate buffer (100 mM, pH7, 3x). A solution of DBCO-MAL (3 eq) in DMSO was added and the reaction monitored by HPLC and LCMS. Upon completion, the aqueous solution was purified by reverse phase HPLC, dried by lyophilization and the dried 5’-conjugated, 3’-DBCO modified sense strand was reconstituted in Sodium Phosphate buffer (100mM) for step 3. STEP 3: Bis-hetero-3',5'- Ligand Conjugated Sense Strand A solution of Ligand B—N3 (2 eq) in DMSO was added to an aqueous solution of 5’- conjugated, 3’-DBCO functionalized sense strand (1 eq) and the reaction was monitored by HPLC and LCMS. Upon completion, the 5’-, 3’-conjugated sense strand was purified by reverse phase HPLC or molecular weight cut-off with Amicon®Ultra-15 Centrifugal filter (3K, 5 times). Example 16: General Procedure IV Type A - Ligand Conjugated to 3’ end of Sense Strand STEP 1: 3’- DBCO modified sense strand Sodium Phosphate buffer (10% V / V 1M, pH7) was added to an aqueous solution of 3’-(C6-SS-C6)-mC functionalized sense strand. Tris(2-carboxyethyl)phosphine hydrochloride (TCEP, 25 eq) in water (pH7) was added and the reaction monitored by HPLC and LCMS. Upon completion, excess TCEP was removed by MWCO with sodium phosphate buffer (100 mM, pH=7, 3x). A solution of DBCO-MAL (3 eq) in DMSO was added and the reaction was monitored by HPLC and LCMS. Upon completion, any solids were removed via centrifugation and the solution was purified by reverse phase HPLC, dried by lyophilization and the dried 3’-DBCO modified sense strand was reconstituted in 100mM Sodium Phosphate buffer for step 2. STEP 2: 3'- Ligand Conjugated Sense Strand A solution of Ligand A—N3 (3 eq) in DMSO was added to an aqueous solution of 3’- DBCO functionalized sense strand (1 eq) and the reaction was monitored by HPLC and LCMS. Upon completion, the 3’-conjugated sense strand was purified by reverse phase HPLC or molecular weight cut-off with Amicon® Ultra-15 Centrifugal filter (3K, 5x). Example 17: General Procedure IV Type B - Ligand Conjugated to 3’ end of Sense Strand STEP 1: 3'- DBCO Functionalized Sense Strand Sodium Phosphate buffer (10% V / V, 1M, pH7) and acetonitrile (20%-50% V / V) are added to an aqueous solution of 3’-amine functionalized sense strand. A solution of DBCO- NHS (1.5-3 eq) in DMSO or acetonitrile is then added and the reaction monitored by LCMS and HPLC. Upon completion, any precipitate is removed via centrifugation, the aqueous solution purified by reverse phase HPLC, dried by lyophilization and the dried DBCO modified sense strand reconstituted in RNase free water. STEP 2: 3’- Ligand Conjugated Sense Strand A solution of Ligand A—N3 (2 eq) in DMSO or THF is added to a solution of 3’- DBCO modified sense strand (1 eq) and the reaction monitored by HPLC and LCMS. Upon completion, the 3’-conjugated sense strand was purified by reverse phase HPLC or molecular weight cut-off with Amicon® Ultra-15 Centrifugal filter (3K, 5 times). Example 18: General Procedure V STEP 1: 5’-conjugated sense strand A solution of Ligand A—N3 (2 eq) in DMSO was added to an aqueous solution of 5’- DBCO modified sense strand (1 eq), and the reaction was monitored by HPLC and LCMS. Upon completion, the 5’-conjugated sense strand was purified by reverse phase HPLC and desalted with molecular weight cut-off with Amicon®Ultra-15 Centrifugal filter (3K, 5 times). Example 19: Synthesis of ligand-conjugated oligonucleotides using amide linkers Oligonucleotides conjugated to ligands using amide linkers may be synthesized using the following methods: The synthetic methods above may be used to synthesize, for example, the following oligonucleotides comprising ligands at the 5' and / or 3' ends: 5 Example 20: General Procedures for Synthesis of Oligonucleotides Strands were synthesized on solid phase using an oligonucleotide synthesizer Oligopilot100 (Cytiva Life Sciences). Solid support (CPG, 80-90 µmol / g, 500A, from LGC- Biosearch Technologies, Petaluma, CA) was loaded to 150-300 µmol scales. RNA and 2' modified RNA phosphoramidites were purchased from Hongene Biotech (Union City, CA). 2'-O-methyl phosphoramidites used were: 5'-O-(4,4'-Dimethoxytrityl)-N6-benzoyl-2'-O-methyl-adenosine-3'-O-[(2-cyanoethyl)-(N,N- diisopropyl)]-phosphoramidite 5'-O-(4,4'-Dimethoxytrityl)-N4-acetyl-2'-O-methyl-cytidine-3'-O-[(2-cyanoethyl)-(N,N- diisopropyl)]-phosphoramidite 5'-O-(4,4'-Dimethoxytrityl)-N2-isobutyryl-2'-O-methyl-guanosine-3'-O-[(2-cyanoethyl)-(N,N- diisopropyl)]-phosphoramidite 5'-O-(4,4'-Dimethoxytrityl)-2'-O-methyl-uridine-3'-O-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite. 2'-Fluoro phosphoramidites used were: 5'-O-(4,4'-Dimethoxytrityl)-N6-benzoyl-2'-fluoroadenosine-3'-O-[(2-cyanoethyl)-(N,N- diisopropyl)]-phosphoramidite 5'-O-(4,4'-Dimethoxytrityl)-N4-acetyl-2'-fluorocytidine-3'-O-[(2-cyanoethyl)-(N,N- diisopropyl)]-phosphoramidite 5'-O-(4,4'-Dimethoxytrityl)-N2-isobutyryl-2'-fluoroguanosine-3'-O-[(2-cyanoethyl)-(N,N- diisopropyl)]-phosphoramidite 5'-O-(4,4'-Dimethoxytrityl)-2'-fluorouridine-3'-O-[(2-cyanoethyl)-(N,N-diisopropyl)]- phosphoramidite. To create phosphorothioate linkages 3-((Dimethylamino-methylidene)amino)-3H- 1,2,4-dithiazole-3-thione (DDTT.0.1M solution from Chemgenes, Wilmington, MA) was used for 4-6 minutes. To create phosphodiester linkage a solution of I2O in Pyridine / Water (0.05M from Sigma Aldrich, St Louis, MO) was used. Following the oxidation / sulfurization a mixture of 20% n-Methylimidazole in Acetonitrile, and 40% Acetic Anhydride in 60% Lutidine in Acetonitrile (Sigma Aldrich, St Louis, MO) were used to acetylate any unreacted chain attached to the CPG. Phosphoramidites were dissolved in anhydrous acetonitrile (0.2M) and molecular sieves (4A) were added and set overnight (Sigma Aldrich, St. Louis, MO). For the oligonucleotide chain 5-(Ethylthio)-1H-Tetrazole (ETT, 0.6M in acetonitrile, from Sigma Aldrich) was used as activator solution. Coupling times were 6 minutes carried out at 3.0 equivalents for each step. Prior to coupling the support bound oligonucleotide is treated with a solution of Dichloroacetic Acid in Dichloromethane (3% Deblock, Sigma Aldrich) and washed with Anhydrous Acetonitrile. Cleavage and deprotection of support bound oligomer After completion of the solid phase synthesis, the support was treated with AMA solution, a 1:1 volume solution of NH4OH:CH3NH2 (Fisher Scientific, Spectrum Chemicals), for 20 minutes at 65°C. The solution was then evaporated. Prior to purification, in-process analysis is performed on analytical HPLC and LCMS to determine crude purity, identify the target mass and monitor the deprotection for completion. LCMS method A Waters XBridge Oligonucleotide BEH C18 Column, 130Å, 2.5 µm, 2.1 mm x 50 mm (P / N 186003952) column was used with buffer solutions :400 mM HFIP + 15 mM TEA (buffer A) and 100% methanol (buffer B) at a gradient of 15-40% or 50-75% Buffer B over 15 CV at 70°C with a flowrate of 1 mL / minute.. Concentration by tangential flow filtration (TFF) The crude oligos are concentrated using Pall Minimate EVO System (Product ID: OAPMPUNV), using a Pall Minimate TFF cassette capsule with 3k Omega membrane. Purification Purification was performed using reverse phase HPLC. Waters XBridge Prep C185 µm OBD, 250 x 19 mm (P / N: 186004021). Buffer solution mixtures are 100 mM TEAA, 5% ACN at pH of 7.0 (buffer A) and 1:1 acetonitrile:methanol (buffer B). Gradient was 5-30% or 30-60% Buffer B over 60 minutes at 60°C with a flowrate of 20 mL / minute. After purification, fractions are analyzed by reverse phase UPLC. The column used is a Waters ACQUITY UPLC Oligonucleotide BEH C181.7 µm, 2.1 x 50 mm (P / N: 186003949). Buffer solution mixtures are 100 mM TEAA, 5% ACN at pH of 7.0 (buffer A) and 1:1 acetonitrile:methanol (buffer B). Gradient was set at 5-30% or 30-60% Buffer B over 5 minutes at 70°C with a flowrate of 1.0 mL / minute. The minimum spec of the purified pool is 85%. Desalting Once a pool has been established, the oligos are desalted using Pall Minimate EVO System (Product ID: OAPMPUNV). Cassette used is the Pall Minimate TFF capsule with 3k Omega membrane (Product ID: OA003C12). Retentate is collected for lyophilization or annealing directly. PREPARATION OF DOUBLE-STRANDED siRNA Example 21: General Procedure for Annealing Ligand Conjugated RNA sense strands were prepared as described herein. RNA antisense strands were prepared according to procedures well known to those of skill in the art. The concentrations of both sense strand and antisense strands were determined by Nanodrop. The double-stranded siRNA was prepared by mixing equimolar amounts of sense stand and antisense strand. The annealing process was monitored by RP-HPLC, non- denaturing method. After annealing, no more that 5% of antisense strand was in the duplex mixture. Duplex concentration was determined by measuring the solution absorbance on Nanodrop. Example 22: Conjugated sense strand The CB ligand BA-275 described above were conjugated to oligo sense strands according to the general procedures described above. RD6083 FXXVI+IS2068+FXXVI5' BA-275 / 3'BA-275 IA1664The integrin ligands BA-128 and BA-171, described above, were conjugated to oligo sense strands according to the general procedures described above, with the purity mass spec indicated. The NMDA ligand BA-306 was conjugated to oligo sense strands according to the general procedures described above, with the purity mass spec indicated. The TrkB ligands described above were conjugated to oligo sense strands according to the general procedures described above, with the purity mass spec indicated. Example 23: Effect of modified oligonucleotides targeting human SOD1 in C57BL / 6 Wildtype mice Compound was evaluated in an in vivo C57BL / 6 Wildtype mice PD study. The animals received a single vehicle or 0.2 µg (10 mg / kg) dose via intracerebroventricular injection on day 1 (n=3 / group). Animals were observed every day for behavioral changes. Brain regions were collected on Day 15 and Day 29, and tissue was immediately placed in homogenizing tube, snap frozen, then kept at -80 °C for gene expression analysis. RNA Isolation was performed according to the Rneasy Micro Kit (Qiagen Cat #74004) instructions. Following RNA isolation, a 96-well plate was placed on ice while the qRT-PCR reaction was prepared.2 µl of RNA was added to the reaction mixture containing 5 µl TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher #44444432), 1 µl SOD1 TaqMan Gene Expression Assay (Thermo Fisher: Mm01344233_g1, FAM), 1 µl GAPDH (VIC) TaqMan Gene Expression Assay (Thermo Fisher: Mm99999915_g1, VIC) and 11 µl RT- PCR grade nuclease-free water in a MicroAmp Optical 96-well plate (0.2 mL). qPCR was performed using a QuantStudio3 qPCR machine with the following cycles: 50 ℃ for 1 minute, 95 ℃ for 20 seconds and 40 cycles at 95 ℃ for 15 seconds and 60 ℃ for 1 minute. Results are presented in the Table below as percent inhibition of SOD1, relative to vehicle control. Table 4 Average SOD1 Inhibition

[0029] 550 6 6 6 3 35 9 8 6 WT Mouse 200ug administered by Intracerebroventricular (ICV) injection % Knockdown (Day 15) % Knockdown (Day 15)

[0030] % Knockdown (Day 29) 5 Example 24: Effect of modified oligonucleotides targeting human SOD1 in non-human primates Certain compounds were evaluated in in vivo cynomolgus monkey PD studies. The animals received a single 70 mg dose in a volume of 2 ml in artificial cerebrospinal fluid (aCSF) via intrathecal lumbar injection on Day 1. Animals were observed every day for behavioral changes. Cerebrospinal fluid (CSF) samples were collected at Day -5, Day -2, Day 15, and Day 27 or 29 and immediately kept at -80°C until analysis. For some studies CSF samples were also collected at Day 43, Day, 57, Day 71, Day 85, Day 113, Day 126, Day 169 and / or Day 204. SOD1 protein level in the CSF samples were measured by an ELISA method. Briefly, microplates were coated with SOD1 antibody (clone SD-G6, Sigma Cat# S2147) diluted at 1:1000 in 50 mM carbonate-bicarbonate buffer overnight at 4°C and blocked with SuperBlock-PBS for 1 hour at room temperature. CSF samples were diluted 1:200 with SuperBlock-PBS and incubated at room temperature for 1 hour before the plates were washed and incubated with SOD1 antibody (SOD1-100, Enzo Cat#ADI-SOD-100) at 10 ug / ml for 1 hour at room temperature. Following washing and incubation of anti-rabbit IgG HRP, TMB substrate was added and OD450 was read within 30 minutes. The average of Day -5 and Day -2 CSF SOD1 levels was used as the pre-dose level for comparison to post- dose level in each animal. Results are presented in the table below as percent inhibition of SOD1 protein, relative to pre-dosed level from the same animal. Due to intrathecal injection variation, Animals that received a lower dose generally showed lower inhibition. For example, C1001 received ~8-fold lower dose than Animal C1002 and therefore showed lower inhibition. Table 5 SOD1 Inhibition in CSF Example 25: Effect of modified oligonucleotides targeting human SOD1 in HepG2 Cells HepG2 cells (ATCC Cat #HB-8065) were seeded in antibiotic-free media at 10,000 cells / well in collagen-coated 96-well plates. The following day, hSOD1 test siRNA was diluted to 100, 10 and 1 nM (stock solution is 2.3 mM). Transfection mixes were prepared according to instructions for Dharmafect 4 transfection reagent (Dharmacon Cat #T-2004-0). Prepared transfection mixtures were incubated at room temperature for 20 minutes. During this incubation, the medium was replaced in the 96-well plates with 80 ml of antibiotic-free medium.20 ml of the transfection mixture was then added to each well for a final concentration of 1, 0.1 or 0.01 nM (tested in biological triplicate). The cells were then incubated at 37°C in 5% CO2for 24 hours. Cell lysis was performed according to the Cells-To-CT 1 Step TaqMan Kit instructions. Following cell lysis, the 96-well plate was placed on ice while the qRT-PCR reaction was prepared. 4 ml of cell lysate was added to the reaction mixture containing 5 ml TaqMan 1-Step qRT-PCR Mix, 0.33 ml SOD1(FAM) 60x TaqMan Gene Expression Assay (Hs00533490_m1), 0.33 ml GAPDH(VIC) 60x TaqMan Gene Expression Assay (Hs02786624_g1) and 10.3 ml RT-PCR grade nuclease-free water in a MicroAmp Optical 96- well plate (0.2 mL). qPCR was performed using a QuantStudio3 qPCR machine. The percent inhibition is provided in Table 6. Table 6 SOD1 Inhibition HepG2 Cells Example 26: Effect of modified oligonucleotides targeting human SOD1 in Wildtype rat WT rat 900ug administered ICV % Knockdown (Day 15) % Knockdown (Day 15, DAY 29 and DAY 43)

[0031] Compound RD3072 (DAYS indicated) DAY LUMB THOR CERV BS CBM HPC TCtx CTX STR SEQ ID NO: 1 >NM_000454.5 Homo sapiens superoxide dismutase 1 (SOD1), mRNA GCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCTCGGAACCAGGACCTCGGCGTGGCCTA GCGAGTTATGGCGACGAAGGCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCATCAATTTC GAGCAGAAGGAAAGTAATGGACCAGTGAAGGTGTGGGGAAGCATTAAAGGACTGACTGAAGGCCTGCATG GATTCCATGTTCATGAGTTTGGAGATAATACAGCAGGCTGTACCAGTGCAGGTCCTCACTTTAATCCTCT ATCCAGAAAACACGGTGGGCCAAAGGATGAAGAGAGGCATGTTGGAGACTTGGGCAATGTGACTGCTGAC AAAGATGGTGTGGCCGATGTGTCTATTGAAGATTCTGTGATCTCACTCTCAGGAGACCATTGCATCATTG GCCGCACACTGGTGGTCCATGAAAAAGCAGATGACTTGGGCAAAGGTGGAAATGAAGAAAGTACAAAGAC AGGAAACGCTGGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAAACATTCCCTTGGATGTAG TCTGAGGCCCCTTAACTCATCTGTTATCCTGCTAGCTGTAGAAATGTATCCTGATAAACATTAAACACTG TAATCTTAAAAGTGTAATTGTGTGACTTTTTCAGAGTTGCTTTAAAGTACCTGTAGTGAGAAACTGATTT ATGATCACTTGGAAGATTTGTATAGTTTTATAAAACTCAGTTAAAATGTCTGTTTCAATGACCTGTATTTTGCCAGACTTAAATCACAGATGGGTATTAAACTTGTCAGAATTTCTTTGTCATTCAAGCCTGTGAATAAAAACCCTGTATGGCACTTATTATGAGGCTATTAAAAGAATCCAAATTCAAACTAAA

[0032] EQUIVALENTS AND SCOPE It is to be understood that this disclosure is not limited to any or all of the particular embodiments described expressly herein, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, the preferred methods and materials are now described. As will be readily apparent to the skilled artisan, and should be understood from the terms used herein, where words or terms are defined herein, their applicability should not be limited to the embodiments immediately preceding or following the definition and should be used where context permits t...

Claims

CLAIMS What is claimed is:

1. A compound comprising a modified oligonucleotide 14 to 30 linked nucleosides in length having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223.

2. A compound comprising a modified oligonucleotide 14 to 23 linked nucleosides in length having a nucleobase sequence comprising the nucleobase sequence of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223.

3. A compound comprising a modified oligonucleotide having a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196- 202, and 214-223.

4. The compound of any one of claims 1-3, wherein the modified oligonucleotide is at least 80%, at least 85%, at least 90%, or at least 95% complementary to SEQ ID NO: 1 or 2.

5. The compound of any one of claims 1-4, wherein the modified oligonucleotide comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase.

6. The compound of any one of claims 1-5, wherein the compound is double-stranded.

7. A compound comprising a first modified oligonucleotide 14 to 23 linked nucleosides in length having a nucleobase sequence comprising at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 contiguous nucleobases of any of the nucleobase sequence of SEQ ID NOs: 11-223 and a second modified oligonucleotide 14 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.

8. A compound comprising a first modified oligonucleotide 14 to 23 linked nucleosides in length having a nucleobase sequence comprising the nucleobase sequence of any one ofSEQ ID NOs: 11-223 and a second modified oligonucleotide 14 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.

9. A compound comprising a first modified oligonucleotide having a nucleobase sequence selected from the group consisting of any one of SEQ ID NOs: 11-223 and a second modified oligonucleotide 19 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.

10. The compound of any one of claims 7-9, wherein the first modified oligonucleotide has at least 80%, at least 85%, at least 90%, or at least 95% complementarity or identity to SEQ ID NO: 1 or 2 over its length.

11. The compound of any one of claims 7-10, wherein the first modified oligonucleotide has at least 1, at least 2, at least 3 mismatches to a region of SEQ ID NO: 1 or 2 that is the same length as the first modified oligonucleotide.

12. The compound of any one of claims 7-11, wherein the region of complementarity between the first modified oligonucleotide and the second modified oligonucleotide is 14 to 23 linked nucleosides in length.

13. The compound of any one of claims 7-11, wherein the region of complementarity between the first modified oligonucleotide and the second modified oligonucleotide is 19 to 23 linked nucleosides in length.

14. The compound of any one of claims 7-11, wherein the region of complementarity between the first modified oligonucleotide and the second modified oligonucleotide is 21 to 23 linked nucleosides in length.

15. The compound of any one of claims 7-11, wherein the first modified oligonucleotide is fully complementary to the second modified oligonucleotide.

16. The compound of any one of claims 7-15, wherein the first modified oligonucleotide comprises at least one modification selected from a modified internucleoside linkage, a modified sugar, and a modified nucleobase.

17. The compound of any one of claims 7-16, wherein the second modified oligonucleotide comprises at least one modification selected from the group consisting of a modified internucleoside linkage, a modified sugar, and a modified nucleobase.

18. The compound of any one of claims 5, 16 and 17, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage or a methylphosphonate internucleoside linkage.

19. The compound of claim 18, wherein the phosphorothioate internucleoside linkage or methylphosphonate internucleoside linkage is at the 3’ terminus of the first or second modified oligonucleotide or at the 5’ terminus of the first modified oligonucleotide.

20. The compound of any one of claims 5, 16 and 17, wherein the modified sugar comprises a modification selected from the group consisting of a halogen, an alkoxy group and a bicyclic sugar.

21. The compound of claim 20, wherein the modified sugar comprises a 2’-F modification.

22. The compound of claim 20, wherein the modified sugar comprises a 2’-OMe modification.

23. The compound of any one of claims 7-15, wherein each nucleoside of the first modified oligonucleotide comprises a modified sugar.

24. The compound of any one of claims 7-15, wherein each nucleoside of the second modified oligonucleotide comprises a modified sugar.

25. The compound of claim 23 or 24, wherein the modified sugar comprises a modification selected from the group consisting of a halogen, an alkoxy group and a bicyclic sugar, or a combination thereof.

26. The compound of claim 25, wherein the modified sugar comprises a modification selected from group consisting of LNA, cEt, 2’-MOE, 2’-F, 2’-OMe, and 2’-deoxy, or a combination thereof.

27. The compound of claim 26, wherein the first modified oligonucleotide comprises no more than ten 2’-F sugar modifications.

28. The compound of claim 27, wherein the second modified oligonucleotide comprises no more than five 2’-F sugar modifications.

29. The compound of any preceding claim, comprising a conjugate group.

30. The compound of claim 29, wherein the conjugate group is attached to the 5’ end of the modified oligonucleotide.

31. The compound of claim 29 or 30, wherein the conjugate group comprises a targeting moiety.

32. The compound of claim 31, wherein the targeting moiety comprises one or more ligands selected from one or more Tropomyosin receptor B (TrkB) ligands, one or more cannabinoid receptor type 1 (CB1) ligands, one or more α4β1 / 7 integrin ligands, and one or more N-methyl-D-aspartate receptor (NMDA) ligands.

33. The compound of claim 32, wherein the modified oligonucleotide is the second modified oligonucleotide.

34. The compound of claim 33, wherein the one or more TrkB ligands, the one or more CB1 ligands, the one or more α4β1 / 7 integrin ligands, or the one or more NMDA ligands are attached to the 5’ end of the modified oligonucleotide.

35. The compound of claim 33, wherein the one or more TrkB ligands, the one or more CB1 ligands, the one or more α4β1 / 7 integrin ligands, or the one or more NMDA ligands are attached to the 3’ end of the modified oligonucleotide.

36. The compound of claim 33, wherein the one or more TrkB ligands, the one or more CB1ligands, the one or more α4β1 / 7integrin ligands, or the one or more NMDA ligands are attached to the 5’ end and the 3’ end of the modified oligonucleotide.

37. The compound of any one of claims 32-36, wherein: the one or more TrkB ligands are selected from any one of Formulae I-XX, XXV, and XXX; the one or more CB1 ligands are of Formula XXVI; the one or more α4β1 / 7integrin ligands are selected from any one of Formulae XXVII, XXVIII, XXXI, and XXXII; and the one or more NMDA ligands are of Formula XXIX.

38. The compound of any one of claims 29-37, wherein the conjugate group comprises one or more lipids.

39. The compound of claim 38, wherein the modified oligonucleotide is the second modified oligonucleotide.

40. The compound of claim 38 or 39, wherein the one or more lipids are attached to an internucleoside linkage of the modified oligonucleotide.

41. The compound of claim 40, wherein the internucleoside linkage of the modified oligonucleotide is selected from any one of Formulae XXI-XXIV and XXXIII-XXXV.

42. The compound of any one of claims 32-41, wherein the modified oligonucleotide comprises: one or more TrkB ligands, one or more CB1 ligands, one or more α4β1 / 7 integrin ligands, or one or more NMDA ligands; andone or more lipids.

43. The compound of claim 42, wherein the modified oligonucleotide is the second modified oligonucleotide.

44. The compound of claim 42, wherein the one or more TrkB ligands, the one or more CB1ligands, the one or more α4β1 / 7integrin ligands, or the one or more NMDA ligands are attached to the 5’ end of the modified oligonucleotide.

45. The compound of claim 42, wherein the one or more TrkB ligands, the one or more CB1ligands, the one or more α4β1 / 7integrin ligands, or the one or more NMDA ligands are attached to the 3’ end of the modified oligonucleotide.

46. The compound of claim 42, wherein the one or more TrkB ligands, the one or more CB1 ligands, the one or more α4β1 / 7 integrin ligands, or the one or more NMDA ligands are attached to the 5’ end and the 3’ end of the modified oligonucleotide.

47. The compound of claim 42, wherein: the one or more TrkB ligands are selected from any one of Formulae I-XX, XXV, and XXX; the one or more CB1ligands are of Formula XXVI; the one or more α4β1 / 7 integrin ligands are selected from any one of Formulae XXVII, XXVIII, XXXI, and XXXII; and the one or more NMDA ligands are of Formula XXIX.

48. The compound of any one of claims 42-47, wherein the one or more lipids are attached to an internucleoside linkage of the modified oligonucleotide.

49. The compound of claim 48, wherein the internucleoside linkage of the modified oligonucleotide is selected from any one of Formulae XXI-XXIV and XXXIII-XXXV.

50. The compound of any one of claims 1-49, wherein the modified oligonucleotide comprises one or more substituted or unsubstituted alkyl or alkenyl.

51. The compound of claim 50, wherein the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C4-C30 hydrocarbon chain.

52. The compound of claim 51, wherein the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C5-C20 hydrocarbon chain, optionally wherein the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C14-C20 hydrocarbon chain.

53. The compound of claim 52, wherein the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C16hydrocarbon chain, a saturated or unsaturated C17 hydrocarbon chain, a saturated or unsaturated C18 hydrocarbon chain, or a saturated or unsaturated C22 hydrocarbon chain.

54. The compound of any one of claims 50-53, wherein the one or more substituted or unsubstituted alkyl or alkenyl are attached to an internucleoside linkage of the modified oligonucleotide.

55. The compound of claim 54, wherein the internucleoside linkage of the modified oligonucleotide is selected from any one of Formulae XXI-XXIV and XXXIII-XXXV.

56. The compound of any one of claims 1-6, wherein the modified oligonucleotide comprises a 5′-phosphonate modification.

57. The compound of any one of claims 7-55, wherein the first modified oligonucleotide comprises a 5′-phosphonate modification.

58. The compound of claim 56 or 57, wherein the 5′-phosphonate modification is a 5′- vinylphosphonate modification or a 5′-ethylenephosphonate modification.

59. A compound comprising:a first modified oligonucleotide comprising a 5′-phosphonate modification, wherein the first modified oligonucleotide is at least 80% complementary to a region of SEQ ID NO: 1 or 2; and a second modified oligonucleotide comprising one or more ligands.

60. The compound of claim 59, wherein the first modified oligonucleotide comprises a 5′- terminal nucleoside comprising the 5′-phosphonate modification.

61. The compound of claim 59 or 60, wherein the 5′-phosphonate modification is a 5′- vinylphosphonate modification or a 5′-ethylenephosphonate modification.

62. The compound of any one of claims 59-61, wherein the 5′-phosphonate modification is a 5′-vinylphosphonate modification.

63. The compound of any one of claims 59-61, wherein the 5′-phosphonate modification is a 5′-ethylenephosphonate modification.

64. The compound of any one of claims 59-63, wherein the second modified oligonucleotide comprises one or more ligands selected from one or more TrkB ligands, one or more CB1ligands, one or more α4β1 / 7integrin ligands, and one or more NMDA ligands.

65. The compound of claim 64, wherein the one or more TrkB ligands, the one or more CB1 ligands, the one or more α4β1 / 7 integrin ligands, or the one or more NMDA ligands are attached to the 5’ end of the second modified oligonucleotide.

66. The compound of claim 64, wherein the one or more TrkB ligands, the one or more CB1ligands, the one or more α4β1 / 7integrin ligands, or the one or more NMDA ligands are attached to the 3’ end of the second modified oligonucleotide.

67. The compound of claim 64, wherein the one or more TrkB ligands, the one or more CB1ligands, the one or more α4β1 / 7integrin ligands, or the one or more NMDA ligands are attached to the 5’ end and the 3’ end of the second modified oligonucleotide.

68. The compound of claim 64, wherein: the one or more TrkB ligands are selected from any one of Formulae I-XX, XXV, and XXX; the one or more CB1ligands are of Formula XXVI; the one or more α4β1 / 7 integrin ligands are selected from any one of Formulae XXVII, XXVIII, XXXI, and XXXII; and the one or more NMDA ligands are of Formula XXIX.

69. The compound of any one of claims 59-68, wherein the second modified oligonucleotide comprises one or more TrkB ligands.

70. The compound of claim 69, wherein the one or more TrkB ligands are selected from any one of Formulae I-XX, XXV, and XXX.

71. The compound of claim 69 or 70, wherein the second modified oligonucleotide comprises one TrkB ligand.

72. The compound of claim 69 or 70, wherein the second modified oligonucleotide comprises at least two TrkB ligands.

73. The compound of claim 72, wherein the at least two TrkB ligands are the same.

74. The compound of claim 72, wherein the at least two TrkB ligands are different.

75. The compound of any one of claims 59-68, wherein the second modified oligonucleotide comprises one or more CB1 ligands.

76. The compound of claim 75, wherein the one or more CB1 ligands are of Formula XXVI.

77. The compound of claim 75 or 76, wherein the second modified oligonucleotide comprises one CB1 ligand.

78. The compound of claim 75 or 76, wherein the second modified oligonucleotide comprises at least two CB1 ligands.

79. The compound of claim 78, wherein the at least two CB1ligands are the same.

80. The compound of claim 78, wherein the at least two CB1 ligands are different.

81. The compound of any one of claims 59-68, wherein the second modified oligonucleotide comprises one or more α4β1 / 7 integrin ligands.

82. The compound of claim 81, wherein the one or more α4β1 / 7integrin ligands are selected from any one of Formulae XXVII, XXVIII, XXXI, and XXXII.

83. The compound of claim 81 or 82, wherein the second modified oligonucleotide comprises one α4β1 / 7 integrin ligand.

84. The compound of claim 81 or 82, wherein the second modified oligonucleotide comprises at least two α4β1 / 7 integrin ligands.

85. The compound of claim 84, wherein the at least two α4β1 / 7integrin ligands are the same.

86. The compound of claim 84, wherein the at least two α4β1 / 7 integrin ligands are different.

87. The compound of any one of claims 59-68, wherein the second modified oligonucleotide comprises one or more NMDA ligands.

88. The compound of claim 87, wherein the one or more NMDA ligands are of Formula XXIX.

89. The compound of claim 87 or 88, wherein the second modified oligonucleotide comprises one NMDA ligand.

90. The compound of claim 87 or 88, wherein the second modified oligonucleotide comprises at least two NMDA ligands.

91. The compound of claim 90, wherein the at least two NMDA ligands are the same.

92. The compound of claim 90, wherein the at least two NMDA ligands are different.

93. The compound of any one of claims 59-92, wherein the second modified oligonucleotide comprises one or more lipids.

94. The compound of any one of claims 59-93, wherein the second modified oligonucleotide comprises one or more substituted or unsubstituted alkyl or alkenyl.

95. The compound of claim 94, wherein the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C4-C30 hydrocarbon chain.

96. The compound of claim 95, wherein the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C5-C20 hydrocarbon chain, optionally wherein the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C14-C20hydrocarbon chain.

97. The compound of claim 96, wherein the one or more substituted or unsubstituted alkyl or alkenyl comprise a saturated or unsaturated C16hydrocarbon chain, a saturated or unsaturated C17 hydrocarbon chain, a saturated or unsaturated C18 hydrocarbon chain, or a saturated or unsaturated C22 hydrocarbon chain.

98. The compound of any one of claims 94-97, wherein the one or more substituted or unsubstituted alkyl or alkenyl are attached to an internucleoside linkage of the second modified oligonucleotide.

99. The compound of claim 98, wherein the internucleoside linkage of the second modified oligonucleotide is selected from any one of Formulae XXI-XXIV and XXXIII- XXXV.

100. The compound of any one of claims 59-99, wherein the first modified oligonucleotide is 14 to 30 linked nucleosides in length.

101. The compound of any one of claims 59-100, wherein the second modified oligonucleotide is 14 to 30 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide.

102. The compound of any one of claims 59-101, wherein the first modified oligonucleotide has a nucleobase sequence comprising at least 14 contiguous nucleobases of any one of SEQ ID NOs: 11-18, 28-106, 184-187, 196-202, or 214-223.

103. The compound of any one of claims 59-102, wherein the second modified oligonucleotide has a nucleobase sequence comprising at least 14 contiguous nucleobases of any one of SEQ ID NOs: 19-27, 107-183, 188-195, and 203-213.

104. The compound of any one of claims 59-103, wherein the first modified oligonucleotide is selected from any one of the IA Ref ID NOs in Table 3.

105. The compound of any one of claims 59-104, wherein the second modified oligonucleotide is selected from any one of the IS Ref ID NOs in Table 3.

106. A compound comprising a first modified oligonucleotide selected from the group consisting of any one of the IA Ref ID NOs in Table 3, and a second modified oligonucleotide 14 to 21 linked nucleosides in length fully complementary to the first modified oligonucleotide.

107. A compound comprising a first modified oligonucleotide selected from the group consisting of any one of the IA Ref ID NOs in Table 3, and a second modifiedoligonucleotide selected from the group consisting of any one of the IS Ref ID NO in Table 3.

108. A compound comprising a first modified oligonucleotide selected from the group consisting of any one of the IA Ref ID NOs in Table 3 and a second modified oligonucleotide selected from the group consisting of any one of the IS Ref ID NOs in Table 3.

109. The compound of claim 106, 107, or 108, comprising a conjugate group.

110. The compound of claim 109, wherein the conjugate group is attached to the 5’ end of the modified oligonucleotide.

111. The compound of claim 109 or 110, wherein the conjugate group comprises a targeting moiety.

112. The compound of claim 111, wherein the targeting moiety comprises one or more ligands selected from one or more Tropomyosin receptor B (TrkB) ligands, one or more cannabinoid receptor type 1 (CB1) ligands, one or more α4β1 / 7 integrin ligands, and one or more NMDA ligands.

113. The compound of claim 112, wherein the modified oligonucleotide is the second modified oligonucleotide.

114. The compound of claim 112 or 113, wherein the one or more TrkB ligands, the one or more CB1 ligands, the one or more α4β1 / 7 integrin ligands, or the one or more NMDA ligands are attached to the 5’ end of the modified oligonucleotide.

115. The compound of claim 112 or 113, wherein the one or more TrkB ligands, the one or more CB1 ligands, the one or more α4β1 / 7 integrin ligands, or the one or more NMDA ligands are attached to the 3’ end of the modified oligonucleotide.

116. The compound of claim 112 or 113, wherein the one or more TrkB ligands, the one or more CB1 ligands, the one or more α4β1 / 7 integrin ligands, or the one or more NMDA ligands are attached to the 5’ end and the 3’ end of the modified oligonucleotide.

117. The compound of any one of claims 112-116, wherein: the one or more TrkB ligands is selected from any one of Formulae I-XX XXV, and XXX; the one or more CB1 ligands are of Formula XXVI; the one or more α4β1 / 7 integrin ligands are selected from any one of Formulae XXVII, XXVIII, XXXI, and XXXII; and the one or more NMDA ligands are of Formula XXIX.

118. A compound of any one of claims 1-117, wherein the compound is in a pharmaceutically acceptable salt form.

119. The compound of claim 118, wherein the pharmaceutically acceptable salt is a sodium salt.

120. The compound of claim 118, wherein the pharmaceutically acceptable salt is a potassium salt.

121. A composition comprising the compound of any preceding claim and a pharmaceutically acceptable carrier.

122. A composition comprising the compound of any preceding claim, for use in therapy.

123. A method of treating, preventing or ameliorating a disease, disorder or condition associated with SOD1 in an individual comprising administering to the individual a compound targeted to SOD1, thereby treating, preventing, or ameliorating the disease, disorder or condition.

124. A method of administering the compound of any one of claims 1-120 or composition of claim 122 to an individual.

125. The method of claim 123 or 124, wherein the disease, disorder or condition is a neurodegenerative disease, including ALS or a symptom thereof such as loss of motor function or neuron death.

126. The method of any one of claims 123-125, wherein administering the compound inhibits or reduces or improves a neurodegenerative disease, ALS or a symptom thereof such as loss of motor function or neuron death.

127. A method of inhibiting expression of SOD1 in a cell comprising contacting the cell with a compound targeted to SOD1, thereby inhibiting expression of SOD1 in the cell.

128. The method of claim 127, wherein the cell is in the brain of an individual.

129. The method of claim 128, wherein the individual has, or is at risk of having, a neurodegenerative disease, including ALS or a symptom thereof such as loss of motor function or neuron death.

130. A method of reducing or inhibiting a neurodegenerative disease, including ALS or a symptom thereof such as loss of motor function or neuron death in an individual, comprising administering a compound targeted to SOD1 to the individual, thereby reducing or inhibiting a neurodegenerative disease, including ALS or a symptom thereof such as loss of motor function or neuron death in the individual.

131. The method of claim 130, wherein the individual has, or is at risk of having, a neurodegenerative disease, including ALS or a symptom thereof such as loss of motor function or neuron death.

132. The method of any one of claims 123-131, wherein the compound is a compound targeted to SOD1.

133. The method of any one of claims 123-132, wherein the compound is the compound of any one of claims 1-120 or composition of claim 122.

134. The method of claim 133, wherein the compound or composition is administered parenterally.

135. The method of claim 133, wherein the compound or composition is administered by intrathecal administration.

136. Use of a compound targeted to SOD1 for treating, preventing, or ameliorating a disease, disorder or condition associated with SOD1.

137. The use of claim 136, wherein the disease, disorder or condition is a neurodegenerative disease, including ALS or a symptom thereof such as loss of motor function or neuron death.

138. The use of claim 136 or 137, wherein the compound is a compound targeted to SOD1.

139. The use of any one of claims 136-138, wherein the compound or modified oligonucleotide is the compound of any one of claims 1-120 or composition of claim 122.

140. Use of a compound targeted to SOD1 in the manufacture of a medicament for treating, preventing, or ameliorating a disease, disorder or condition associated with SOD1.

141. The use of claim 140, wherein the disease is a neurodegenerative disease, including ALS or a symptom thereof such as loss of motor function or neuron death.

142. The use of claim 140 or 141, wherein the compound is a compound targeted to SOD1.

143. The use of any one of claims 140-142, wherein the compound or modified oligonucleotide is the compound of any one of claims 1-120 or composition of claim 122.

144. The method or use of any preceding claim, wherein the compound or composition is administered to an individual about once every three months to about once every year.

145. The method or use of any preceding claim, wherein the compound or composition is administered to an individual about once every three months, about once every six months, or about once every year.

146. A method for delivering a therapeutic oligonucleotide to the brain of a subject, comprising administration of a compound, or a stereoisomer, tautomer, prodrug, or salt thereof, of any one of claims 1-120 or composition of claim 122 to the subject.

147. The method of claim 146, wherein the therapeutic oligonucleotide is delivered to one or more brain regions selected from the group consisting of the striatum, the cerebellum, the brain stem, the hippocampus, the frontal cortex, and the spinal cord.

148. A method for treating or ameliorating a disease, disorder, or symptom thereof in a subject, comprising administration of a compound, or a stereoisomer, tautomer, prodrug, or salt thereof, of any one of claims 1-120 or composition of claim 122 to the subject.

149. The method of claim 148, wherein the disease, disorder, or symptom thereof is a central nervous system (CNS) disease, disorder, or symptom thereof.

150. The method of claim 148 or 149, wherein the disease, disorder, or symptom thereof is Alzheimer’s disease, or a symptom thereof.

151. The method of any one of claims 146-150, wherein the administration is intrathecal administration or intracerebroventricular (ICV) administration.

152. A method of delivering one or more cargo molecules to a cell or tissue of a subject in vivo, comprising administering to the subject a compound of any one of claims 1-120 or composition of claim 122.

153. The method of claim 152, wherein the cell or tissue is CNS cell or tissue.