Application of nigericin in preparation of anti-PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) medicine

Abstract

The invention provides an application of nigericin in preparation of an anti-PRRSV (Porcine Reproductive and Respiratory Syndrome Virus) drug, and belongs to the technical field of antiviral drugs. Experimental results show that the nigericin has extremely remarkable inhibiting and blocking effects on a 1-bit ribosome framing process of the PRRSV virus, and can be used for effectively inhibiting the replication of the PRRSV virus so as to inhibit the proliferation of the PRRSV virus; in addition, the compound has an extremely remarkable inhibition effect on the frame shift process of-1-bit ribosomes of different strains of PRRSV viruses; the nigericin can effectively inhibit replication and proliferation of PRRSV in vitro and in vivo of live pigs, can be used for preparing products for inhibiting proliferation of the PRRSV and can be used for preparing drugs for treating and preventing diseases caused by PRRSV infection, and the drugs are broad-spectrum anti-PRRSV drugs and have wide application prospects.

Description

Technical Field

[0001] This invention belongs to the field of antiviral drug technology, specifically relating to the application of nigrain in the preparation of anti-PRRSV virus drugs. Background Technology

[0002] PRRSV virus is porcine reproductive and respiratory syndrome virus, also known as blue ear virus. It belongs to the Arteritisvirus genus of the Arteritisviridae family and is an enveloped single-stranded positive-sense RNA virus.

[0003] -1 ribosomal frameshifting during ribosome elongation is common in RNA viruses, not only in PRRSV, but also in viruses such as IBV (Infectious Bronchitis Virus), HIV-1 (Human Immunodeficiency Virus 1), and SARS (Severe Acute Respiratory Syndrome Coronavirus). This process consists of three steps: First, a pseudoknot structure in the mRNA forces the ribosome to stop during the elongation phase, at which point the anticodon loops of aminoacyl-tRNA at site A and peptidyl-tRNA at site P bind to the sliding sequence of the mRNA. Second, the sliding sequence causes a -1 shift in the tRNA. Then, the downstream mRNA pseudoknot is opened, and the ribosome continues to move forward, but the reading frame is altered. Studies have shown that the sliding sequence in PRRSV is "UUUAAAC," followed by a three-necked "pseudoknot" structure that mediates ribosome retreat. When the ribosome moves to the sliding sequence, the tRNA detaches from the ribosome, causing the ribosome to slide back one step, resulting in a "-1 Ribosomal Frameshifting" in the reading frame. The tRNA then re-enters its position, the peptidyl transfer center remains unaffected, the nascent polypeptide chain does not detach, and the ribosome continues translation of ORF1b. This mechanism gives viruses advantages such as a streamlined genome, rapid replication, and high efficiency in utilizing genetic material, thereby promoting rapid viral proliferation within host cells.

[0004] If the -1 Ribosomal Frameshifting process of PRRSV can be inhibited, then PRRSV replication can be blocked, thereby inhibiting viral proliferation. Therefore, researching drugs that can effectively inhibit the -1 Ribosomal Frameshifting process of PRRSV is of great significance for the development of drugs against PRRSV or for the treatment of blue ear disease caused by PRRSV. Summary of the Invention

[0005] Therefore, the purpose of this invention is to provide the use of nigrain in the preparation of anti-PRRSV virus drugs.

[0006] The technical solution adopted in this invention is as follows:

[0007] Application of Nigerian mycins in the preparation of anti-PRRSV virus drugs.

[0008] Nigericin is a polyether ionocarrier antibiotic derived from Streptomyces. It is known to have antibacterial properties, regulate cell signaling pathways, and have antitumor effects.

[0009] The molecular formula of Nigerian styracin is: C 40 H 68 O 11 ;

[0010] The structural formula of Nigerian mycin is:

[0011] .

[0012] Furthermore, the drug is used to prevent and / or treat porcine reproductive and respiratory syndrome caused by PRRSV virus infection.

[0013] Furthermore, the drug is a drug that inhibits the replication and proliferation of PRRSV virus.

[0014] Furthermore, the PRRSV virus includes strains VR2332, JXA1, NADC30, and NADC34.

[0015] Furthermore, the drug comprises nigrain and pharmaceutically acceptable excipients.

[0016] Furthermore, the drug is an antiviral drug that inhibits the -1 ribosomal frameshift process of the PRRSV virus.

[0017] Furthermore, the concentration of the nigrain in the drug is 0.52~12.49 μM.

[0018] Furthermore, the concentration of the Nigeriamycin in the drug is 1 μM.

[0019] Furthermore, the effective dose of the Nigerian mycotoxin in the application of anti-PRRSV virus drugs in live pigs is 2 mg / kg.

[0020] Furthermore, the drug is an oral preparation or an injection.

[0021] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0022] This application discovers a novel application of nigrain in inhibiting PRRSV virus. Experiments have demonstrated that nigrain exhibits a highly significant inhibitory and blocking effect on the -1 ribosomal frameshifting process of PRRSV virus, effectively inhibiting PRRSV virus replication and thus proliferation. The CC50 of nigrain on MARC-145 cells is 12.49 μM, and the half-maximal concentration (IC50) for inhibiting the -1 ribosomal frameshifting process of PRRSV virus is 0.5247 μM, indicating that its lowest effective concentration is not toxic to wild-type MARC-145 cells. A concentration of 1 μM of nigrain inhibits the -1 ribosomal frameshifting of PRRSV virus. The process exhibits extremely high and significant inhibitory effects; a dose of 2 mg / kg of nigrain has an extremely high and significant inhibitory effect on the proliferation of PRRSV virus in live pigs; in addition, experiments have shown that nigrain has an extremely significant inhibitory effect on the -1 ribosomal frameshift process of different strains of PRRSV virus; thus, nigrain can effectively inhibit the replication and proliferation of PRRSV in vitro and in live pigs, and nigrain can be used to prepare products that inhibit PRRSV proliferation, as well as products that treat and / or prevent diseases caused by PRRSV infection. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 A schematic diagram (a), a schematic diagram (b), and experimental results (c) illustrate the design principle of Nigerian styracin in inhibiting the PRRSV ribosomal frameshift process in a luciferase reporter system.

[0025] Figure 2 The diagram shows the design principle (a), experimental procedure (b), and experimental results (c) for Nigerian styracin inhibiting the PRRSV ribosomal frameshift process in a fluorescent protein reporter system.

[0026] Figure 3 The results of experiments on the toxicity of different concentrations of Nigerian cytosine on MARC-145 cells and its effectiveness in inhibiting the proliferation of live PRRSV virus are presented.

[0027] Figure 4 The results of experiments showing the inhibitory effect of Nigerian styrax on the proliferation of live PRRSV virus are presented.

[0028] Figure 5 The results of experiments showing the inhibitory effects of Nigerian mycotoxin on the proliferation of different PRRSV virus strains (VR2332, JXA1, NADC30, and NADC34).

[0029] Figure 6 This is the result of an experiment on the inhibitory effect of Nigerian styraxin on the proliferation of live PRRSV virus in live pigs. Detailed Implementation

[0030] The present invention will be described in detail below through embodiments and test examples. The examples given are for the purpose of better illustrating the content and advantages of the present invention, but should not be construed as limiting the scope of the invention to the examples provided. Non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.

[0031] Example 1

[0032] To evaluate the inhibitory effect of nigrain on the -1 Ribosomal Frameshifting process of PRRSV virus (luciferase reporter system).

[0033] 1. Experimental Methods

[0034] The inhibitory effect of a drug (nigrain) on the -1 ribosomal frameshifting process of PRRSV was investigated using in vitro cell culture. First, a lentiviral vector containing the PRRSV viral genome sliding sequence was constructed, and the drug's effect was detected in the porcine alveolar macrophage line 3D4 / 21 at a concentration of 1 μM.

[0035] 1.1. Carrier Construction:

[0036] (1) Synthesis of PRRSV virus-1 Ribosomal Frameshifting sliding region gene sequence (frameshifting elements of four strains were synthesized respectively: VR2332, JXA1, NADC30, and NADC34). The lentiviral backbone vector was double-digested with EcoRI and BamHI. Digestion conditions: 37℃ for 15 minutes. After digestion, the digestion products were recovered by nucleic acid electrophoresis. For the synthesized PRRSV virus-1 Ribosomal Frameshifting sliding region gene sequence, it was first denatured at 95℃ for 10 minutes and annealed at 72℃ for 30 seconds. Then, the annealing product was mixed with the digestion product at a ratio of annealing product: digestion product = 3:1. 10 μL of T4 ligase was added to the above mixture, and ligation was carried out in a constant temperature metal bath at 16℃ for 16 hours. Plasmid transformation of competent cells: Competent cells were removed from a -80°C freezer and thawed on ice. A lentiviral vector containing the PRRSV virus-1 Ribosomal Frameshifting gene sequence was added to every 100 μL of competent cells and mixed thoroughly. The mixture was then placed on ice for 30 minutes. The cell-plasmid mixture was then placed in 42°C water for 90 seconds for heat shock. After heat shock, the cell-plasmid mixture was cooled on ice for 10 seconds. The cooled mixture was transferred to a solid LB agar plate, and the liquid was evenly spread on the surface of the plate using a glass rod. The plate was then inverted and incubated at 37°C for 16 hours. After incubation, single-clone plaques were picked up with a pipette tip and inoculated into liquid LB agar. The plates were incubated at 37°C for 8 hours and then sent to the company for sequencing. Single clones with correct sequencing results were amplified and plasmids were extracted.

[0037] (2) Through homologous recombination, Renal luciferase was constructed upstream of the -1 Ribosomal Frameshifting region, and firefly luciferase was constructed downstream of the -1 Ribosomal Frameshifting region. The specific method is as follows: The Renal luciferase gene sequence was amplified by PCR, and homologous arms were added upstream and downstream of the sequence, respectively. The vector obtained in step (1) was subjected to PCR to obtain a linearized vector. The gel recovery products of Renal luciferase and linearized vector were obtained by nucleic acid electrophoresis and gel recovery. Homologous recombination: The gel recovery products of Renal luciferase and linearized vector were mixed at a mass ratio of 3:1, and 2 μL of homologous recombination enzyme was added. The mixture was reacted at 37°C for 15 minutes.

[0038] (3) Transform competent cells with plasmids, select single clones and sequence them, and amplify and extract plasmids from viral backbone vectors with correct sequencing. The transformation of competent cells and extraction steps are the same as in step (1).

[0039] 1.2. Establishing a cell screening system:

[0040] (1) The viral backbone vector containing dual luciferase and -1 Ribosomal Frameshifting region, PMD2.G, and pspax2 packaging vector were mixed with PEI (full name: Polyethylenimine) in a volume ratio of 4:2:1. 70 micrograms of PEI were added for every 35 micrograms of DNA and transfected into 293T cells.

[0041] (2) Collect the culture supernatant of 293T cells 48 hours and 72 hours after transfection with viral plasmid, respectively. After centrifuging at 12000g for 10min to remove cell impurities, collect lentivirus particles by cesium chloride gradient centrifugation.

[0042] (3) See Figure 1 As shown in Figure b, lentiviral particles were added to 3D4 / 21 cells. Seven days after infection, positive cells were selected using Puro (puromycin selection). Cells were digested with trypsin to prepare single-cell suspensions, which were then sorted by flow cytometry.

[0043] (4) Genotyping of cultured monoclonal cells and expansion culture of positive clones to obtain 3D4 / 21 cells (CMV-Renilla-framshift-Firefly) containing the -1 Ribosomal Frameshifting region.

[0044] 1.3. Experimental steps for drug inhibition-1 Ribosomal Frameshifting process:

[0045] (1) 3D4 / 21 cells containing -1 Ribosomal Frameshifting region were cultured into 96-well plates. After 24 hours of culture, candidate compounds (control group: DMSO; experimental group: Nigerian styraxin) were added to the plates at a concentration of 1 μM.

[0046] (2) After culturing for 24 hours, the cells were lysed, firefly luciferase substrate was added to the lysate, and the luminescence value was detected by an enzyme-linked immunosorbent assay (ELISA) reader.

[0047] (3) Add the Renaissance luciferase substrate and detect the luminescence value using an enzyme-linked immunosorbent assay (ELISA) reader.

[0048] (4) The ratio of firefly luciferase to kidney luciferase was used as a reference for the -1 Ribosomal Frameshifting efficiency. The smaller the ratio, the better the candidate molecule can inhibit the -1 Ribosomal Frameshifting process.

[0049] 2. Experimental Results

[0050] Experimental results are as follows Figure 1 As shown, Figure 1 A schematic diagram illustrating the design principle of nigrain in inhibiting PRRSV virus-1 ribosomal frameshifting in a luciferase reporter system. Figure 1 a) Schematic diagram of the experimental procedure ( Figure 1 b) and experimental results ( Figure 1 c). Among them. Figure 1 In the 'a' section, the reporter system design scheme is as follows: when ribosome frameshift occurs normally, both the reporter genes Renilla luciferase and Firefly luciferase are expressed; when ribosome frameshift is blocked, the reporter gene Renilla luciferase is expressed, while Firefly luciferase is not expressed. Figure 1 In section b, the reporter system workflow is as follows: First, the reporter vector is stably integrated into the host cells (porcine alveolar macrophage cell line 3D4 / 21) via a lentiviral vector. Positive monoclonal cells are then treated with compounds (control group: DMSO; experimental group: Nigerian styracin). The inhibitory effect of the compounds on the PRRSV ribosome frameshift process is determined using a dual-luciferase reporter gene assay kit and an enzyme-linked immunosorbent assay (ELISA) reader. Figure 1 In the figure, c represents the effect of 1 μM nigrain on the -1 Ribosomal Frameshifting process of PRRSV virus, while the control group was treated with 1 μM DMSO. Figure 1 As shown in Figure c, 1 μM of nigericin has a highly significant inhibitory effect on the -1 ribosome frameshifting process of PRRSV virus (*** indicates P < 0.001).

[0051] Example 2

[0052] To evaluate the inhibitory effect of nigrain on the -1 Ribosomal Frameshifting process of PRRSV virus (fluorescent protein reporter system).

[0053] 1. Experimental Methods

[0054] To further determine the inhibitory activity of nigrain against the -1 Ribosomal Frameshifting process of PRRSV virus, a reporter gene system based on short-half-life fluorescent proteins was constructed. First, ubiquitin was ligated to GFP (green fluorescent protein) to obtain UbGFP (ubiquitin-GFP). Then, Renillaluciferase and Firefly luciferase in the dual-luciferase reporter system were replaced with Ub-GFP and RFP (red fluorescent protein), respectively. The updated reporter system was: CMV-UbGFP-Frameshift-RFP (see [link to CMV-UbGFP-Frameshift-RFP]). Figure 2 (As shown in a). For detection, CMV-UbGFP-Frameshift-RFP cells were passaged in 96-well plates 24 hours in advance, ensuring cell confluence reached 80%–90% at the time of drug addition. DMSO or nigrain (1 μM) was added to the culture dish for 8 hours, followed by 5 μM MG-132 (a proteasome inhibitor) for another 4 hours. Each group had 3 replicates. The fluorescence ratio of RFP to GFP was obtained using fluorescence microscopy. A higher ratio indicates higher -1 Ribosomal Frameshifting efficiency, while a lower ratio indicates lower efficiency. A lower ratio indicates that nigrain is more effective at inhibiting -1 Ribosomal Frameshifting, thus better suppressing the process.

[0055] 2. Experimental Results

[0056] Experimental results are as follows Figure 2 As shown, Figure 2 A schematic diagram illustrating the design principle of nigrain in inhibiting the PRRSV ribosomal frameshift process in a fluorescent protein reporter system. Figure 2 a) Schematic diagram of the experimental procedure ( Figure 2 b) and experimental results ( Figure 2 c). Among them. Figure 2 In the middle 'a', a fluorescent protein reporter system design scheme is used. When ribosome frameshift occurs normally, both the reporter genes GFP and RFP are expressed. When ribosome frameshift is blocked, the reporter gene GFP is expressed, but RFP is not expressed. Figure 2In section b, the workflow of the fluorescent protein reporter system is as follows: First, the reporter vector is stably integrated into the host cell (porcine alveolar macrophage line 3D4 / 21) via a lentiviral vector. Positive monoclonal cells are then treated with compounds (control group: DMSO; experimental group: nigrain). Fluorescence images are obtained using a high-content fluorescence microscope, and the inhibitory effect of the compounds on the PRRSV ribosome frameshift process is determined by fluorescence signal analysis. Figure 2 In the figure, c represents the result of treatment with 1 μM Nigerian styracin on the -1 Ribosomal Frameshifting process of PRRSV virus, while the control group was treated with 1 μM DMSO. Figure 2 As shown in Figure c, 1 μM of nigrain also has a highly significant inhibitory effect on the -1 ribosome frameshifting process of PRRSV virus (VR2332, JXA1, NADC30, and NADC34 strains) (*** indicates P < 0.001).

[0057] Example 3

[0058] To evaluate the efficacy and cytotoxicity of Nigerian styramine in inhibiting PRRSV-1 Ribosomal Frameshifting.

[0059] 1. Experimental Methods

[0060] To further determine the inhibitory effect of nigrain on PRRSV virus-1 ribosomal frashifting, cytotoxicity was tested in wild-type MARC-145 cells by adding different concentrations of nigrain (0.01, 0.0625, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20, 40, 80 μM) to the MARC-145 cell culture supernatant.

[0061] To determine its effectiveness, we modified MARC-145 cells and integrated the luciferase reporter gene into the MARC-145 cell genome by infection with lentivirus (the lentivirus obtained in Example 1), and added different concentrations of nigrain (0.01, 0.0625, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20, 40, 80 μM).

[0062] 2. Experimental Results

[0063] Cytotoxicity test results and efficacy test results are as follows Figure 3As shown. The toxicity index CC50 of nigra to MARC-145 cells was 12.49 μM, which means that the half-maximal toxic concentration (CC50) of nigra to MARC-145 cells was 12.49 μM.

[0064] Nigerian styracin inhibits the -1 ribosomal frashifting process of PRRSV virus, with a half-maximal effective concentration (EC50) of 0.5247 μM. This concentration of styracin is not toxic to wild-type MARC-145 cells. Its drug selectivity index (SI = CC50 / EC50) is 23.80. An SI value greater than 5.00 indicates that the drug is effective and has a high safety profile; a higher value indicates a broader safety window. A Nigerian styracin SI of 23.80 indicates a large safety window.

[0065] Example 4

[0066] To evaluate the inhibitory effect of Nigerian styrax on live PRRSV virus.

[0067] 1. Experimental Methods

[0068] To further determine the inhibitory effect of nigrain on live PRRSV virus, an in vitro culture and detection system for PRRSV was constructed. First, in a biosafety level II laboratory, MARC-145 cells were cultured at a concentration of 2 × 10⁶ cells / mL. 5 Cells were seeded at a rate of 0.1 cells / ml in 6-well plates. The NC group received no virus. After 24 hours of culture, cells were infected with 0.1 MOI virus per well. After another 24 hours, either 1 μM Nigerian cytosine or DMSO (as a positive control) was added. The negative control group (NC group) received no virus. After culturing at 37°C for 24 hours, anti-PRRSV-N antibody was added, and viral load was detected by immunofluorescence.

[0069] 2. Experimental Results

[0070] See the experimental results. Figure 4 As shown, the fluorescence signal of PRRSV virus in the Nigerian styrax treatment group disappeared and weakened significantly, indicating that 1 μM Nigerian styrax has a highly significant inhibitory effect on the proliferation of PRRSV in vitro.

[0071] Example 5

[0072] To evaluate the inhibitory effect of Nigerian styrax on different strains of live PRRSV virus.

[0073] 1. Experimental Methods

[0074] Experiments were conducted under P2 laboratory conditions. PRRSV virus (VR2332, JXA1, NADC30, and NADC34 strains) were cultured in PAM (porcine primary alveolar macrophage) cells. Two hours after infection, the culture medium was replaced with normal medium. Twenty-four hours later, 1 μM nigrain or DMSO (as a positive control) was added. The negative control group (PRRSV-) received no virus. After culturing at 37°C for 24 hours, cells were collected, total RNA was extracted using the Trizol method, cDNA was obtained using a reverse transcription kit, and the PRRSV virus copy number was detected by qPCR.

[0075] The qPCR primers are as follows:

[0076] PRRSVORF7(N)-F AAACCAGTCCAGAGGCAAGG,

[0077] PRRSVORF7(N)-R GCAAACTAAACTCCACAGTGTAA;

[0078] GAPDH-F GAAGGTGAAGGTCGGAGTCA,

[0079] GAPDH-R CATGTAAACCATGTAGTTGAGGTC.

[0080] 2. Experimental Results

[0081] See the experimental results. Figure 5 As shown, 1 μM of nigrain significantly inhibited the proliferation of four strains of PRRSV virus (VR2332, JXA1, NADC30, and NADC34) cultured in vitro (*** indicates P < 0.001). This demonstrates that nigrain has a broad-spectrum inhibitory effect on PRRSV virus.

[0082] Example 6

[0083] To evaluate the inhibitory effect of Nigerian styracin on live PRRSV virus in live pigs.

[0084] 1. Experimental Methods

[0085] Experiments were conducted under P2 laboratory conditions, with 1-month-old piglets infected with PRRSV virus (JXA1). Twenty-four hours after infection, the piglets were administered either nigrain (2 mg / kg) or DMSO (as a positive control) via intramuscular injection. The negative control group (PRRSV-) remained uninfected. Treatment was administered every two days for 20 consecutive days. After 20 days, the piglets were euthanized, and lung lymph nodes were harvested. Total RNA was extracted from the cells using the Trizol method, and cDNA was obtained using a reverse transcription kit. The PRRSV virus copy number was detected by qPCR. The qPCR primers were the same as in Example 5.

[0086] 2. Experimental Results

[0087] See the experimental results. Figure 6 As shown, 2 mg / kg of nigrain significantly inhibited the proliferation of PRRSV virus in live pigs (*** indicates P < 0.001). This demonstrates that nigrain has a highly significant inhibitory effect on the proliferation of PRRSV virus in live pigs.

Claims

1. Application of Nigerian mycin in the preparation of anti-PRRSV virus drugs.

2. The application of the Nigerian styracin according to claim 1 in the preparation of anti-PRRSV virus drugs, characterized in that, The drug is used to prevent and / or treat porcine reproductive and respiratory syndrome caused by PRRSV virus infection.

3. The application of the Nigerian mycotoxin according to claim 1 in the preparation of anti-PRRSV virus drugs, characterized in that, The drug is used to inhibit the replication and proliferation of PRRSV virus.

4. The application of the Nigerian mycotoxin according to claim 1 in the preparation of anti-PRRSV virus drugs, characterized in that, The PRRSV virus includes strains VR2332, JXA1, NADC30, and NADC34.

5. The application of the Nigerian mycotoxin according to claim 1 in the preparation of anti-PRRSV virus drugs, characterized in that, The drug comprises Nigerian styracin and pharmaceutically acceptable excipients.

6. The use of Nigerian styracin according to any one of claims 1 to 5 in the preparation of anti-PRRSV virus drugs, characterized in that, The drug is an antiviral drug that inhibits the -1 ribosomal frameshift process of the PRRSV virus.

7. The use of the Nigerian styracin according to claim 1 in the preparation of anti-PRRSV virus drugs, characterized in that, The concentration of the Nigerian mycotoxin in the drug is 0.52~12.49 μM.

8. The use of the Nigerian styracin according to claim 1 in the preparation of anti-PRRSV virus drugs, characterized in that, The concentration of the Nigerian mycotoxin in the drug is 1 μM.

9. The use of the Nigerian styracin according to claim 1 in the preparation of anti-PRRSV virus drugs, characterized in that, The effective dose of the Nigerian styraxin in the application of this drug against PRRSV virus in live pigs is 2 mg / kg.

10. The use of the Nigerian styracin according to claim 1 in the preparation of an anti-PRRSV virus drug, characterized in that, The drug is an oral preparation or an injection.

Images