Fused bicyclic heterocyclic or hetero aryl amide compounds

EP4727540A2Pending Publication Date: 2026-04-22QUANTX BIOSCIENCES US INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
QUANTX BIOSCIENCES US INC
Filing Date
2024-06-14
Publication Date
2026-04-22

AI Technical Summary

Technical Problem

Current anticancer therapies face challenges in effectively targeting and inhibiting DNA polymerase theta (Polθ) enzyme activity, particularly in cancers with DNA repair deficiency, such as BRCA-deficient cancers that are resistant to PARP inhibitors.

Method used

Development of novel fused bicyclic heterocyclic or heteroaryl amide compounds that act as Polθ inhibitors, which can be administered alone or in combination with other therapeutic agents to treat cancers by inhibiting Polθ enzyme activity.

Benefits of technology

These compounds effectively inhibit Polθ enzyme activity, potentially enhancing the efficacy of existing cancer treatments and overcoming resistance in BRCA-deficient cancers, thereby providing a new therapeutic approach for cancer therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024034007_19122024_PF_FP_ABST
    Figure US2024034007_19122024_PF_FP_ABST
Patent Text Reader

Abstract

Provided herein are novel compounds (e.g., Formula K), pharmaceutical compositions, and methods of use for treating a variety of diseases or disorders, such as cancer.
Need to check novelty before this filing date? Find Prior Art

Description

FUSED BICYCLIC HETEROCYCLIC OR HETEROARYL AMIDE COMPOUNDS

[0001] This application claims the benefit of priority to U.S. Provisional Application Nos. 63 / 521,419, filed June 16, 2023, and 63 / 546,990, filed November 2, 2023, the content of each of which is herein incorporated by reference in its entirety.

[0002] In various embodiments, the present disclosure generally relates to novel compounds, compositions comprising the same, methods of preparing and methods of using the same, e.g., for inhibiting Polθ enzyme activity and / or for treating or preventing a disease or disorder described herein. BACKGROUND

[0003] DNA polymerase theta (Polθ) is encoded by the POLQ gene and mediates one of the three major double strand break (DSB) repair pathways: theta-mediated end joining (TMEJ). DNA repair deficient cancers often become dependent on backup DNA repair pathways. When non-homologous end joining (NHEJ) and / or homologous recombination (HR) in a cancer cell are not functioning properly, Polθ is usually overexpressed and TMEJ is activated to provide a backup pathway for DSB repairs for the cancer cell's survival (see e.g., Barszczewska-Pietraszek, G. et al. Int. J. Mol. Sci.24:319 (2023)). TMEJ pathway activation is also observed in NHEJ-proficient cells.

[0004] Polθ is a promising target for anticancer drug development, especially in cancers with DNA repair deficiency. Polθ knockout in non-cancerous cells had minimal effect. However, Polθ overexpression has been identified in various human cancers, such as breast cancer, lung cancer, ovarian cancer, etc. It has also been reported that Polθ overexpression is associated with poor clinical outcomes in breast or liver cancer patients with HR deficiency. Inhibition of Polθ was shown to kill cancer cells both in vitro and in vivo. In addition, inhibition of Polθ was shown to activate the cGAS-STING pathway and can be used in combination with an immune checkpoint inhibitor for treating BRCA-deficient cancer. See e.g., Patterson-Fortin, J. et al. Nature Communications 14:1390 (2023). Additionally, inhibition of Polθ can enhance the effect of a poly (ADP-ribose) polymerase (PARP) inhibitor and can overcome PARP inhibitor resistance.

[0005] In various embodiments, the present disclosure is based in part on the discovery of certain novel bicyclic heterocyclic or heteroaryl amide compounds that can be Polθ inhibitors and can be used for inhibiting Polθ enzyme activity in a cell (e.g., a cancer cell) and / or for treating or preventing a disease or disorder associated with Polθ, such as cancer, as described herein.

[0006] In some embodiments, the present disclosure provides a compound of Formula A, or a pharmaceutically acceptable salt thereof:wherein the variables are defined herein. In some embodiments, the compound of Formula A can be characterized as having a structure according to a subformula selected from Formula I, I-1, I-1a, I-1b, I-1c, I-1d, I-1e, I-1f, I-1g, II, II-1, III, III-1, A1, A2, A3, A1a, A1b, A1c, A2a, A2b, A2c, A2b-1, A2b-2, A2b-3, A2b-4, A2b-5, or A2b-6, as defined herein.

[0007] In some embodiments, the present disclosure provides a compound of Formula K, or a pharmaceutically acceptable salt thereof:wherein the variables are defined herein. In some embodiments, the compound of Formula K can be characterized as having a structure according to a subformula selected from Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, K-1b-4, K-3a, K- 3b, K-5a, or K-5b, as defined herein.

[0008] In some embodiments, the present disclosure also provides a compound selected from Table 1 herein, or a pharmaceutically acceptable salt thereof. In some embodiments, the present disclosure also provides a compound selected from Examples 1-145 herein, or a pharmaceutically acceptable salt thereof.

[0009] Some embodiments of the disclosure are directed to a pharmaceutical composition comprising one or more compounds of the present disclosure (e.g., a compound of Formula A (e.g., Formula I, I-1, I-1a, I-1b, I-1c, I-1d, I-1e, I-1f, I-1g, II, II-1, III, III-1, A1, A2, A3, A1a, A1b, A1c, A2a, A2b, A2c, A2b-1, A2b-2, A2b-3, A2b-4, A2b-5, or A2b-6), Formula K (e.g., Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, K-1b-4, K-3a, K-3b, K-5a, or K-5b), any of Examples 1-145, any of the compounds listed in Table 1 herein, or a pharmaceutically acceptable salt thereof) and optionally a pharmaceutically acceptable excipient. The pharmaceutical composition described herein can be formulated for different routes of administration, such as for oral administration or parenteral injection.

[0010] Certain embodiments of the present disclosure are directed to a method of treating a disease or disorder associated with Polθ, such as a cancer herein. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of a compound of the present disclosure (e.g., a compound of Formula A (e.g., Formula I, I-1, I-1a, I-1b, I-1c, I-1d, I-1e, I-1f, I-1g, II, II-1, III, III-1, A1, A2, A3, A1a, A1b, A1c, A2a, A2b, A2c, A2b-1, A2b-2, A2b-3, A2b-4, A2b-5, or A2b-6), Formula K (e.g., Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, K-1b-4, K-3a, K-3b, K-5a, or K-5b), any of Examples 1-145, any of the compounds listed in Table 1 herein, or a pharmaceutically acceptable salt thereof) or a pharmaceutical composition herein.

[0011] Certain embodiments of the present disclosure are directed to a method of treating a cancer. In some embodiments, the cancer is a homologous recombination (HR) deficient cancer. In some embodiments, the cancer is characterized by a reduction or absence of BRCA gene expression, the absence of the BRCA gene, and / or reduced function of BRCA protein. In some embodiments, the cancer is resistant to poly(ADP-ribose) polymerase (PARP) inhibitor therapy. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of a compound of the present disclosure (e.g., a compound of Formula A (e.g., Formula I, I-1, I-1a, I-1b, I-1c, I-1d, I-1e, I- 1f, I-1g, II, II-1, III, III-1, A1, A2, A3, A1a, A1b, A1c, A2a, A2b, A2c, A2b-1, A2b-2, A2b- 3, A2b-4, A2b-5, or A2b-6), Formula K (e.g., Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, K-1b-4, K-3a, K-3b, K-5a, or K-5b), any of Examples 1-145, any of the compounds listed in Table 1 herein, or a pharmaceutically acceptable salt thereof) or a pharmaceutical composition herein.

[0012] The administering in the herein is not limited to any particular route of administration. For example, in some embodiments, the administering can be orally, nasally, transdermally, pulmonary, inhalationally, buccally, sublingually, intraperitoneally, subcutaneously, intramuscularly, intravenously, rectally, intrapleurally, intrathecally, or parenterally. In some embodiments, the administering is orally. In some embodiments, the administering is a parenteral injection, such as an intravenous injection.

[0013] Compounds of the present disclosure can be used as a monotherapy or in a combination therapy. In some embodiments according to the methods described herein, one or more compounds of the present disclosure can be administered as the only active ingredient(s). In some embodiments, the method herein further comprises administering to the subject an additional therapeutic agent, such as additional anticancer agents described herein, for example, a PARP inhibitor, a signal transduction inhibitor, a chemotherapeutic agent, and / or an immune checkpoint inhibitor.

[0014] It is to be understood that both the foregoing summary and the following detailed description are exemplary and explanatory only, and are not restrictive of the invention herein. DETAILED DESCRIPTION

[0015] In various embodiments, provided herein are novel compounds, pharmaceutical compositions, methods of preparation and methods of use. The compounds of the present disclosure are generally Polθ inhibitors, which are also useful for treating various diseases or disorders, such as those described herein, e.g., cancer. Compounds Formula A

[0016] In some embodiments, the present disclosure provides a compound of Formula A, or a pharmaceutically acceptable salt thereof:A, wherein: J1is S, O, N, CR10Aor NR10B; J2is C or N; J3is C or N; Z is N or CR10A, preferably, Z is N; provided that the 5-membered ring containing Z, J1, J2, and J3is a heteroaryl ring having 1-3 ring heteroatoms; Ring A is a phenyl ring or 5-10-membered heteroaryl ring having 1 to 4 ring heteroatoms independently selected from N, O, and S; Ring B is an optionally substituted 5-7 membered carbocyclic or heterocyclic ring, or an optionally substituted phenyl ring, or an optionally substituted 5 or 6-membered heteroaryl ring having 1-3 ring heteroatoms each independently N, S, or O; preferably, Ring B is an optionally substituted 6-membered heteroaryl ring having 1 or 2 ring nitrogen atoms; R1is an optionally substituted phenyl, optionally substituted naphthyl, an optionally substituted 3-10 membered carbocyclic, or an optionally substituted 5-10 membered heterocyclic or heteroaryl, preferably, R1is ortho to the amide group (-C(O)-NH-) shown in Formula A; the subscript m is an integer of 0-4, as valency permits; R2at each occurrence is independently deuterium, halogen, OH, NH2, CN, SF5, COOH, CONH2, SO2NH2, R20, OR20, SR20, N(R20)(R21), SO2R20, SO2N(R20)(R21), N(R21)SO2R20, COR20, CON(R20)(R21), or N(R21)COR20, wherein R20at each occurrence is independently an optionally substituted C1-6alkyl, an optionally substituted C2-6alkenyl, an optionally substituted C2-6 alkynyl, an optionally substituted C1-6 heteroalkyl, or an optionally substituted 3-10 membered ring structure; and R21at each occurrence is independently hydrogen, an optionally substituted C1-6 alkyl, an optionally substituted C2- 6 alkenyl, an optionally substituted C2-6 alkynyl, an optionally substituted C1-6 heteroalkyl, or an optionally substituted 3-10 membered ring structure; or as applicable, R20and R21together with the intervening atom (e.g., the nitrogen atom) or atoms are joined to form an optionally substituted 4-8 membered heterocyclic ring; wherein:R10Aat each occurrence is hydrogen, deuterium, halogen, CN, or a C1-3 alkyl optionally substituted with deuterium or F; and R10Bis hydrogen or a C1-3 alkyl optionally substituted with deuterium or F.

[0017] In some embodiments, the compound of Formula A (including any of the applicable sub-formulae as described herein) can comprise one or more asymmetric centers and / or axial chirality, and thus can exist in various stereoisomeric forms, e.g., enantiomers and / or diastereomers. In some embodiments, the compound of Formula A can exist in the form of an individual enantiomer and / or diastereomer, as applicable, or a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomers. In some embodiments, when applicable, the compound of Formula A (including any of the applicable sub-formulae as described herein) can exist as an individual enantiomer substantially free of the other enantiomer, such as having an enantiomeric excess ("ee") of greater than 60%, preferably, greater than 80% ee, greater than 90% ee, greater than 95% ee, greater than 98% ee, or greater than 99% ee. In some embodiments, when applicable, the compound of Formula A (including any of the applicable sub-formulae as described herein) can also exist as a mixture of stereoisomers in any ratio, such as a racemic mixture.

[0018] In some embodiments, the compound of Formula A (including any of the applicable sub-formulae as described herein) can exist as an isotopically labeled compound, particularly, a deuterated analog, wherein one or more of the hydrogen atoms of the compound of Formula A is / are substituted with a deuterium atom with an abundance above its natural abundance, e.g., a CD3analog when the compound has a CH3group. Without wishing to be bound by theories, it is believed that in certain situations, substitution with deuterium can lead to a deuterated analog with a better pharmacokinetic profile. Deuterated analogs can be generally prepared by using commercially available deuterating reagents.

[0019] It should be apparent to those skilled in the art that in certain cases, the compound of Formula A may exist as a mixture of tautomers. The present disclosure is not limited to any specific tautomer. Rather, the present disclosure encompasses any and all of such tautomers whether or not explicitly drawn or referred to.

[0020] In Formula A (including any applicable subformulae), the 5-membered ring containing Z, J1, J2, and J3is a heteroaryl ring having 1-3, such as 2 ring heteroatoms. Typically, Z in the 5-membered ring is N. In some embodiments, Z is N, and the 5-membered ring has one additional ring such as an additional ring oxygen, sulfur, or nitrogen. In some embodiments, J1is CR10A(e.g., CH). In some embodiments, Z is N and J1is CR10A(e.g., CH). In some preferred embodiments, the 5-membered ring is a thiazole ring, wherein Z is N, J1is S, and J2and J3are C. In some embodiments, the 5-membered ring can be an oxazole, imidazole, or pyrazole ring. For example, in some embodiments, Z is N, J1is CR10A(e.g., CH), and J2is C and J3is N. In some embodiments, Z is N, J1is CR10A(e.g., CH), and J3is C and J2is N. Typically, in embodiments wherein J1is CR10A, R10Ais hydrogen, halogen, or methyl optionally substituted with deuterium or F, preferably, R10Ais hydrogen. In some embodiments, Z can be CR10A, wherein R10Ais defined herein.

[0021] In Formula A (including any applicable subformulae), Ring B is typically an optionally substituted phenyl ring, or an optionally substituted 5 or 6-membered heteroaryl ring having 1-3 ring heteroatoms each independently N, S, or O. For example, Ring B can be a benzene, pyridine, pyridone (e.g., pyridin-2-one), pyrazine, pyridazine, or pyrimidine ring, each of which is optionally substituted. To be clear, as used herein, a pyridone is considered a 6-membered heteroaryl ring. When substituted, the phenyl or 5 or 6-membered heteroaryl ring can preferably be substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, NH2, SF5, CN, or -Y1-Y2, wherein Y1is null, O, S, NH, NY3, C(O), SO2, C(O)NH, C(O)NY3, P(O)Y3, SO2NH, or SO2NY3, and each of Y2and Y3at each occurrence is independently an optionally substituted C1-6 alkyl, an optionally substituted C2-6alkenyl, an optionally substituted C2-6alkynyl, an optionally substituted C1-6heteroalkyl, an optionally substituted 3-10 membered carbocyclic or heterocyclic ring, an optionally substituted phenyl, or an optionally substituted 5 or 6-membered heteroaryl. Preferably, in the definition of variables or substituents herein, or the combination of substituents and / or variables herein, a carbon atom of a carbon-carbon double bond of an alkenyl or carbon-carbon triple bond of an alkynyl group is not directly bonded with an oxygen or nitrogen atom. To be clear, unless otherwise specified or contrary from context, as used herein, a bivalent structure herein, such as a -Y1- as defined herein, can connect to the remainder of the molecule in either direction. For example, when -Y1- is stated to be C(O)NY3, then the moiety -Y1-Y2can be -C(O)N(Y3)-Y2or -N(Y3)C(O)-Y2. Other similar expressions should be understood similarly.

[0022] In some preferred embodiments, the optionally substituted C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C1-6 heteroalkyl, 3-10 membered carbocyclic or heterocyclic ring, phenyl, or 5or 6-membered heteroaryl, referred to in of Y2and Y3herein, can be independently unsubstituted or substituted with one or more (e.g., 1-3) substituents each independently selected from deuterium, halogen, OH, NH2, SF5, CN, or -Y1A-Y2A, wherein Y1Ais null, O, S, NH, NY3A, C(O), SO2, C(O)NH, C(O)NY3A, P(O)Y3A, SO2NH, or SO2NY3A, and each of Y2Aand Y3Aat each occurrence is independently (i) C1-6 alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy, or a 3-6 membered ring, (ii) C2-6 alkenyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4alkoxy, or a 3-6 membered ring, (iii) C2-6 alkynyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4alkoxy, or a 3-6 membered ring, (iv) C1-6 heteroalkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4alkoxy, or a 3-6 membered ring, (v) a 3-8 membered carbocyclic or heterocyclic optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, oxo, OH, CN, C1-4alkyl, C1-4alkoxy, or a 3-6 membered ring; or (vi) a phenyl or 5 or 6-membered heteroaryl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, OH, CN, C1-4 alkyl, C1-4 alkoxy, or a 3-6 membered ring (preferably carbocyclic or heterocyclic ring); wherein each of the 3-6 membered ring referred to in (i)-(vi) can be independently selected from 3-6 membered carbocyclic or heterocyclic ring, phenyl, or a 5, or 6-membered heteroaryl, and wherein each of the C1-4alkyl, C1-4alkoxy, or 3-6 membered ring referred to in (i)-(vi) is independently unsubstituted or substituted with one or more (e.g., 1-3) substituents independently selected from deuterium, halogen (e.g., F), CN, OH, oxo (as applicable), C1-4 alkyl (e.g., methyl) optionally substituted with deuterium or F, C1-4 heteroalkyl (e.g., methoxy) optionally substituted with deuterium or F, or 3-4 membered carbocyclic or heterocyclic ring (e.g., cyclopropyl, cyclobutyl, azetidinyl, oxetanyl, etc.) optionally substituted with deuterium, F, OH, and / or methyl.

[0023] In some preferred embodiments, the optionally substituted C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C1-6 heteroalkyl, 3-10 membered carbocyclic or heterocyclic ring, phenyl, or 5 or 6-membered heteroaryl, referred to in the definition of Y2and Y3herein, can be independently unsubstituted or substituted with one or more (e.g., 1-3) substituents each independently selected from deuterium, halogen, OH, CN, C1-4 alkyl optionally substituted with deuterium or F, C1-4 heteroalkyl optionally substituted with deuterium or F, or a 3-6membered ring (e.g., 3-6 membered or heterocyclic ring, phenyl, or 5, or 6- membered heteroaryl) optionally substituted with oxo, deuterium, halogen, OH, CN, C1-4alkyl optionally substituted with deuterium or F, or C1-4 heteroalkyl optionally substituted with deuterium or F.

[0024] In some preferred embodiments, each occurrence of the C1-6 heteroalkyl as referred to in the definition of Y2, Y3, Y2A, or Y3A, is independently a C1-6alkoxy, NH(C1-6alkyl), N(C1-4 alkyl)(C1-4 alkyl), -(C1-5 alkylene)-O-(C1-5 alkyl), -(C1-5 alkylene)-NH(C1-5 alkyl), -(C1-4alkylene)-N(C1-4alkyl)(C1-4alkyl), -(C1-5alkylene)-S-(C1-5alkyl), -(C1-5alkylene)-SO2-(C1-5 alkyl), SO2(C1-6 alkyl), P(O)(C1-4 alkyl)(C1-4 alkyl), SO2NH(C1-6 alkyl), SO2N(C1-4alkyl)(C1-4alkyl), -(C1-5alkylene)-SO2NH-(C1-5alkyl), or -(C1-4alkylene)- SO2N(C1-4 alkyl)(C1-4 alkyl), provided that the total number of carbons are no greater than 6, not counting any optional substituents. It should be noted that for "N(C1-4alkyl)(C1-4alkyl)", the two C1-4 alkyl can be the same or different, for example, both N(CH3)2 and N(CH3)(C2H5) are within the definition of N(C1-4alkyl)(C1-4alkyl) herein. Unless otherwise specified or contrary from context, other similar expressions herein of a variable containing two or more groups of the same type (e.g., two alkyl groups) which are also designated as having the same range of carbon atoms should be understood similarly, i.e., the two or more groups are independently selected and can be the same or different.

[0025] In some preferred embodiments, each occurrence of the C1-4 heteroalkyl as referred to in the definition of Y2, Y3, Y2A, or Y3A, is independently a C1-4alkoxy, NH(C1-4alkyl), N(C1-3 alkyl)(C1-3 alkyl), -(C1-3 alkylene)-O-(C1-3 alkyl), -(C1-3 alkylene)-NH(C1-3 alkyl), -(C1-2alkylene)-N(C1-2alkyl)(C1-2alkyl), -(C1-3alkylene)-S-(C1-3alkyl), -(C1-3alkylene)-SO2-(C1-3 alkyl), SO2(C1-4 alkyl), P(O)(C1-3 alkyl)(C1-3 alkyl), SO2NH(C1-4 alkyl), SO2N(C1-3alkyl)(C1-3alkyl), -(C1-3alkylene)-SO2NH-(C1-3alkyl), or -(C1-2alkylene)- SO2N(C1-2 alkyl)(C1-2 alkyl), provided that the total number of carbons are no greater than 4, not counting any optional substituents.

[0026] In some preferred embodiments, the compound of Formula A (including any applicable subformulae) can be characterized as having a structure according to Formula I:I wherein: J4is CR11or N; J5is CR12or N; J6is CR13Aor N, and J7is CR14or N; or J6is NR13Band J7is C(O); provided that the bicyclic ring containing J1, J2, J3, J4, J5, J6, and J7is a heteroaryl ring having 1-4 ring heteroatoms in addition to the ring nitrogen atom shown in Formula I; R11, R12, R13A, and R14are each independently hydrogen, deuterium, halogen, OH, NH2, SF5, CN, or -Y1-Y2, wherein Y1is null, O, S, NH, NY3, C(O), SO2, C(O)NH, C(O)NY3, P(O)Y3, SO2NH, or SO2NY3, and Y2and Y3are each independently an optionally substituted C1-6alkyl, an optionally substituted C2-6alkenyl, an optionally substituted C2-6alkynyl, an optionally substituted C1-6 heteroalkyl, an optionally substituted 3-10 membered carbocyclic or heterocyclic ring, an optionally substituted phenyl, or an optionally substituted 5 or 6-membered heteroaryl; and R13Bis hydrogen, an optionally substituted C1-6alkyl, an optionally substituted C2-6alkenyl, an optionally substituted C2-6 alkynyl, an optionally substituted C1-6 heteroalkyl, an optionally substituted 3-10 membered carbocyclic or heterocyclic ring, an optionally substituted phenyl, or an optionally substituted 5 or 6-membered heteroaryl, wherein J1, J2, J3, Ring A, R1, m, and R2are defined herein.

[0027] To be clear, a bicyclic ring having J6as NR13Band J7as C(O) is considered a heteroaryl ring if the bicyclic ring is aromatic when J6-J7is replaced with C=N. For example, the bicyclic ring is considered a heteroaryl ring herein, as when theC(O)-NR13Ba J6-J7) is replaced with C=N, the resulting ring has a N , which is aromatic.

[0028] embodiments, J1in Formula I is S, and J2and J3are C, and the compound can have a structure according to Formula I-1:wherein the variables are and J7can be a single bond when J6is NR13Band J7is C(O). In other embodiments, wherein J6is CR13Aor N, and J7is CR14or N, the bond between J6and J7is a double bond.

[0029] In some embodiments, in Formula I or I-1, J4is N.

[0030] In some embodiments, in Formula I or I-1, J5is N.

[0035] In some embodiments, in Formula I or I-1, J4and J7are both N, and J5is CR12.

[0036] In some embodiments, in J5are both N, and J7is CR14.

[0037] In some embodiments, in and J5and J7are both N.

[0038] Typically, in embodimentshydrogen. In some embodiments, R11can be deuterium, halogen, OH, NH2, SF5, CN, or -Y1-Y2, as defined herein. For example, in some embodiments, R11can be halogen, such as F or Cl, CN, an optionally substituted C1-6 alkyl, or an optionally substituted C1-6 heteroalkyl. In some embodiments, R11can be halogen, CN, a C1-4alkyl optionally substituted with deuterium or F, or a C1-4 heteroalkyl (e.g., a C1-4 alkoxy) optionally substituted with deuterium or F.

[0039] Typically, in embodiments where J5is CR12, R12is hydrogen. In some embodiments, R12can be deuterium, halogen, OH, NH2, SF5, CN, or -Y1-Y2, as defined herein. For example, in some embodiments, R12can be halogen, such as F or Cl, CN, an optionally substituted C1-6 alkyl, or an optionally substituted C1-6 heteroalkyl. In some embodiments, R12can be halogen, CN, a C1-4alkyl optionally substituted with deuterium or F, or a C1-4 heteroalkyl (e.g., a C1-4 alkoxy) optionally substituted with deuterium or F.

[0040] Typically, in embodiments where J7is CR14, R14is hydrogen. In some embodiments, R14can be deuterium, halogen, OH, NH2, SF5, CN, or -Y1-Y2, as defined herein. For example, in some embodiments, R14can be halogen, such as F or Cl, CN, an optionally substituted C1-6 alkyl, or an optionally substituted C1-6 heteroalkyl. In someembodiments, R14can be halogen, CN, alkyl optionally substituted with deuterium or F, or a C1-4heteroalkyl (e.g., a C1-4alkoxy) optionally substituted with deuterium or F.

[0041] Typically, in Formula I or I-1, J6is CR13A, wherein R13Ais defined herein. For example, in some embodiments, the compound of Formula I or I-1 can be characterized as having a structure according to Formula I-1a: wherein R13A, Ring A,

[0042] In some embodiments, the compound of Formula I or I-1 can be characterized as having a structure according to Formula I-1b: wherein R13A, Ring A,

[0043] In some embodiments, the compound of Formula I or I-1 can be characterized as having a structure according to Formula I-1c: wherein R13A, Ring A,

[0044] In some embodiments, the compound of Formula I or I-1 can be characterized as having a structure according to Formula I-1d:I-1d, wherein R13A, Ring A, R1, m, and R2are defined herein.

[0045] In some embodiments, the compound of Formula I or I-1 can be characterized as having a structure according to Formula I-1e:wherein R13A, Ring A, R1, m, are

[0046] In some embodiments, the compound of Formula I or I-1 can be characterized as having a structure according to Formula I-1f:wherein R13A, Ring A, R1, m, and R2are defined herein.

[0047] In some embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais hydrogen.

[0048] In some embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais halogen, such as F, Cl, or Br.

[0049] In some embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais CN.

[0050] In some embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais -Y1-Y2as defined herein. For example, in some embodiments, R13Ais -Y1-Y2, wherein Y1is null, in other words, R13Ais Y2as defined herein. In some embodiments, R13Ais Y2, wherein Y2is an optionally substituted C1-6alkyl, an optionally substituted C2-6 alkenyl, or an optionally substituted C2-6 alkynyl. In some embodiments, R13Ais Y2, wherein Y2is an optionally substituted C1-6heteroalkyl.

[0051] In some embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais -Y1-Y2, wherein Y1is O, NH, or NY3, wherein Y2and Y3are defined herein.

[0052] In some preferred is Y2, wherein Y2is an optionally substituted 3-10 membered carbocyclic or heterocyclic ring. Suitable 3-10 membered carbocyclic or heterocyclic rings are not particularly limited and include those described herein, which can be monocyclic or have a fused, spiro, or bridged bicyclic structure. In some embodiments, the 3-10 membered carbocyclic ring can have two rings in which one of the rings is phenyl and the other ring is fused to the phenyl ring. In some embodiments, the 3-10 membered heterocyclic ring can have 1-4 ring heteroatoms each independently N, O, or S, wherein the S atom is optionally oxidized such as existing as S=O, SO2, etc. In some embodiments, the 3-10 membered heterocyclic ring can have two rings in which one of the rings is phenyl or 5, or 6-membered heteroaryl, and the other ring is fused to the phenyl or heteroaryl ring.

[0053] In some embodiments, Y2can be a C3-7cycloalkyl, which is optionally substituted with one or more substituents herein, e.g., one or more substituents independently selected from halogen (e.g., F), OH, C1-4alkyl optionally substituted with deuterium or F, or C1-4heteroalkyl optionally substituted with deuterium or F. In some embodiments, Y2can be an unsubstituted C3-6cycloalkyl, such as cyclopropyl.

[0054] In some embodiments, Y2can be a 4-10 membered heterocyclic ring, such as a 4- 8 membered heterocyclic ring (e.g., tetrahydropyran, piperidine, etc.) having 1-3 ring heteroatoms each independently N, O, or S, wherein the S atom is optionally oxidized (e.g., as SO2), which is optionally substituted with one or more substituents herein, e.g., one or more substituents independently selected from halogen (e.g., F), OH, C1-4 alkyl optionally substituted with deuterium or F, or C1-4heteroalkyl optionally substituted with deuterium or F. In some embodiments, Y2can be a tetrahydropyran or piperidine, which is optionally substituted with a C1-4alkyl optionally substituted with deuterium or F.

[0055] In some preferred embodiments, R13Ais Y2, wherein Y2is an optionally substituted phenyl. In some preferred embodiments, R13Ais Y2, wherein Y2is an optionally substituted 5-membered heteroaryl having 1-4 ring heteroatoms each independently N, O, or S, such as an optionally substituted pyrazolyl. In some preferred embodiments, R13Ais Y2, wherein Y2is an optionally substituted 6-membered heteroaryl having 1 or 2 ring nitrogens, such as an optionally substituted pyridyl, pyrimidinyl, pyridazinyl, or pyrazinyl.

[0056] In some embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Acan be hydrogen, halogen (e.g., Cl, Br, etc.), CN, anoptionally substituted C1-4 alkyl, an substituted C2-4 alkenyl, an optionally substituted C2-4alkynyl, an optionally substituted C1-4heteroalkyl, SF5, an optionally substituted C3-7 cycloalkyl, or an optionally substituted 4-10 membered heterocyclic ring having 1-3 ring heteroatoms each independently N, O, or S. In some preferred embodiments, when substituted, the C1-4 alkyl, C2-4 alkenyl, C2-4 alkynyl, C1-4 heteroalkyl, C3-7 cycloalkyl, or 4-10 membered heterocyclic ring, is substituted with one or more (e.g., 1-3) substituents each independently selected from deuterium, halogen (e.g., F), OH, SF5, CN, oxo, CONR30R31, N(R30)C(O)R31, SO2NR30R31, N(R30)SO2R31, SR31, OR31, SO2R31, C1-4alkyl optionally substituted with deuterium or F, or a 3-4 membered carbocyclic or heterocyclic ring (e.g., cyclopropyl, cyclobutyl, azetidinyl, oxetanyl, etc.) optionally substituted with deuterium, F, OH, and / or methyl, wherein each of R30and R31at each occurrence is independently hydrogen, C1-4alkyl optionally substituted with deuterium or F, or a 3-6 membered carbocyclic or heterocyclic ring (e.g., cyclopropyl, cyclobutyl, azetidinyl, oxetanyl, etc.) optionally substituted with deuterium, F, OH, and / or methyl; or as applicable, R30and R31together with the intervening atom or atoms are joined to form an optionally substituted 4-8 membered heterocyclic ring (e.g., optionally substituted with deuterium, F, OH, and / or methyl). For example, in some embodiments, R13Acan be hydrogen, halogen (e.g., Cl or Br), CN, C1-4alkyl optionally substituted with deuterium or F (e.g., CF2H or CF3), cyclopropyl, C1-4 alkoxy optionally substituted with deuterium or F (e.g., OCF2H or OCF3), or a 4-10 membered heterocyclic ring having 1-3 ring heteroatoms each independently N, O, or S, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4alkyl optionally substituted with deuterium or F (e.g., CF2H or CF3), or C1-4 alkoxy optionally substituted with deuterium or F (e.g., OCF2H or OCF3). In some embodiments, R13Acan be a 4-10 membered heterocycloalkyl ring having 1- 3 ring heteroatoms each independently N, O, or S, such as a monocyclic 4-8 membered heterocycloalkyl, e.g., a tetrahydropyran or piperidinyl ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkyl optionally substituted with deuterium or F (e.g., CF2H or CF3), and C1-4 alkoxy optionally substituted with deuterium or F (e.g., OCF2H or OCF3).

[0057] In some preferred embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais an optionally substituted phenyl. In some embodiments, the phenyl is unsubstituted or substituted with one or more (e.g., 1-3)substituents each independently (e.g., F, Cl, Br, etc.), CN, OH, NH2, SF5, G1, or -X1-X2-G1, wherein X1is null, C1-4 alkylene or C1-4 heteroalkylene, and X2is O, S, NH, NG1, C(O), SO2, C(O)NH, C(O)NG1, SO2NH, or SO2NG1, and wherein G1at each occurrence is independently an optionally substituted C1-4 alkyl, an optionally substituted C2-4alkenyl, an optionally substituted C2-4alkynyl, an optionally substituted C1-4 heteroalkyl, an optionally substituted C3-6 cycloalkyl, an optionally substituted 4-7 membered heterocyclic ring having 1 or 2 ring heteroatoms each independently N, O, or S, or an optionally substituted 5 or 6-membered heteroaryl having 1-3 ring heteroatoms each independently N, O, or S. Preferably, when substituted, the C1-4 alkyl, C2-4 alkenyl, C2-4 alkynyl, C1-4 heteroalkyl, C3-6 cycloalkyl, 4-7 membered heterocyclic ring, or 5 or 6-membered heteroaryl is substituted with one or more (e.g., 1- 3) substituents each independently selected from deuterium, halogen (e.g., F), OH, CN, oxo, C1-4alkyl optionally substituted with deuterium or F, C1-4alkoxyl optionally substituted with deuterium or F, or a 3-4 membered carbocyclic or heterocyclic ring (e.g., cyclopropyl, cyclobutyl, azetidinyl, oxetanyl, etc.) optionally substituted with deuterium, F, OH, and / or methyl. In some embodiments, the phenyl is unsubstituted or substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F, Cl, Br, etc.), CN, OH, NH2, SF5, G1, or -X1-X2-G1, wherein X1is null, CH2, or CH2CH2, wherein X2and G1are defined herein. In some embodiments, the phenyl is unsubstituted or substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F, Cl, Br, etc.), CN, OH, NH2, SF5, SCF3, G1, NHG1, NG1G1, OG1, or SO2G1, wherein G1is defined herein.

[0058] In some preferred embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais an optionally substituted 5 or 6 membered heteroaryl, e.g., pyrazolyl, pyridinyl, pyrimidinyl, pyridazinyl, or pyrazinyl. In some embodiments, the 5 or 6 membered heteroaryl is unsubstituted or substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F, Cl, Br, etc.), CN, OH, NH2, SF5, G1, or -X1-X2-G1, wherein X1is null, C1-4 alkylene or C1-4 heteroalkylene, and X2is O, S, NH, NG1, C(O), SO2, C(O)NH, C(O)NG1, SO2NH, or SO2NG1, andwherein G1at each occurrence is an optionally substituted C1-4 alkyl, an optionally substituted C2-4alkenyl, an optionally substituted C2-4alkynyl, an optionally substituted C1-4 heteroalkyl, an optionally substituted C3-6 cycloalkyl, an optionally substituted 4-7 membered heterocyclic ring having 1 or 2 ring heteroatoms each independently N, O, or S, or an optionally substituted 5 or 6-membered heteroaryl having 1-3 ring heteroatoms each independently N, O, or S. Preferably, when substituted, the C1-4 alkyl, C2-4 alkenyl, C2-4 alkynyl, C1-4 heteroalkyl, C3-6 cycloalkyl, 4-7 membered heterocyclic ring, or 5 or 6-membered heteroaryl is substituted with one or more (e.g., 1- 3) substituents each independently selected from deuterium, halogen (e.g., F), OH, CN, oxo, C1-4alkyl optionally substituted with deuterium or F, C1-4alkoxyl optionally substituted with deuterium or F, or a 3-4 membered carbocyclic or heterocyclic ring (e.g., cyclopropyl, cyclobutyl, azetidinyl, oxetanyl, etc.) optionally substituted with deuterium, F, OH, and / or methyl. In some embodiments, the 5 or 6 membered heteroaryl is unsubstituted or substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F, Cl, Br, etc.), CN, OH, NH2, SF5, G1, or -X1-X2-G1, wherein X1is null, CH2, or CH2CH2, wherein X2and G1are defined herein. In some embodiments, the 5 or 6 membered heteroaryl is unsubstituted or substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F, Cl, Br, etc.), CN, OH, NH2, SF5, SCF3, G1, NHG1, NG1G1, OG1, or SO2G1, wherein G1is defined herein.

[0059] In some preferred embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais an optionally substituted phenyl, pyrazolyl, pyridinyl, pyrimidinyl, pyridazinyl, or pyrazinyl. In some embodiments, the phenyl, pyrazolyl, pyridinyl, pyrimidinyl, pyridazinyl, or pyrazinyl is unsubstituted or substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F, Cl, Br, etc.), CN, OH, NH2, SF5, SCF3, G2, NHG2, NG2G2, OG2, or SO2G2, wherein G2at each occurrence is independently an optionally substituted C1-4 alkyl, an optionally substituted C3-6 cycloalkyl, or an optionally substituted 4-7 membered heterocyclic ring having 1 or 2 ring heteroatoms each independently N, O, or S. Preferably, when substituted, the C1-4 alkyl, C3-6 cycloalkyl, or 4-7 membered heterocyclic ring, is substituted with one or more (e.g., 1-3) substituents each independently selected from deuterium, halogen (e.g., F), OH, CN, oxo, C1-4 alkyl optionally substituted with deuterium or F, C1-4 alkoxyl optionallysubstituted with deuterium or F, or a 3-4 carbocyclic or heterocyclic ring (e.g., cyclopropyl, cyclobutyl, azetidinyl, oxetanyl, etc.) optionally substituted with deuterium, F, OH, and / or methyl.

[0060] In some more specific embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais selected from the following: ,n is an integer of 0-3, and G3at each occurrence is independently deuterium, halogen (e.g., F or Cl), CN, C1-4 alkyl, O-(C1-4 alkyl), SO2-(C1-4 alkyl), OH, NH2, NH(C1-4 alkyl), N(C1-4 alkyl)(C1-4 alkyl), 3-4 membered carbocyclic or heterocyclic ring, O-(3-4 membered carbocyclic or heterocyclic ring), (C1-4 alkylene)-(3-4 membered carbocyclic or heterocyclic ring) or O-(C1-4 alkylene)-(3-4 membered carbocyclic or heterocyclic ring), wherein each of the aforementioned C1-4 alkyl is independently optionally substituted with 1-7 deuterium or F, and wherein the C1-4 alkylene or 3-4 membered carbocyclic or heterocyclic ring is optionally substituted with one or more (e.g., 1-3) substituents independently deuterium, F, OH, or methyl. In some embodiments, the 3-4 membered carbocyclic or heterocyclic ring is cyclopropyl or cyclobutyl. In some embodiments, n is 0. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, one instance of G3is C1-4 alkyl optionally substituted with 1-7 deuterium or F or C1-4 alkoxy optionally substituted with 1-7 deuterium or F, such as OCH3, OCF2H, OCF3, CF3, CH3, CF2H, or CH2CF3, and any other instance(s) of G3, if present, is defined above. For example, in some embodiments, when n is 2, the remaining instance of G3can be a halogen.

[0061] In some more specific embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais a pyridinyl (e.g., 2-pyridinyl, 3- pyridinyl, or 4-pyridinyl) substituted with 1 or 2 substituents independently selected fromdeuterium, halogen (e.g., F or Cl), CN, O-(C1-4 alkyl), SO2-(C1-4 alkyl), OH, NH2, NH(C1-4alkyl), or N(C1-4alkyl)(C1-4alkyl), wherein each of the aforementioned C1-4alkyl is independently optionally substituted with 1-7 deuterium or F. Preferably, the pyridinyl is substituted with one substituent selected from OCH3, OCF2H, OCF3, CF3, CH3, CF2H, or CH2CF3, and optionally a further substituent selected from F or Cl.

[0062] In some preferred embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais a 2-pyridinyl substituted with one substituent selected from OCH3, OCF2H, OCF3, SO2CH3, NH2, CN, Cl, isopropyl, CF3, CH3, CF2H, or CH2CF3, and optionally a further substituent selected from F or Cl, for example, selected from the following: .

[0063] I-1a, I-1b, I-1c, I-1d, I-1e, or I- In some preferred embodiments according toI-1d, I-1e, or I-1f), J6is CR13A, and R13A. In some preferred embodiments according to Formula I or I-1 (e.g.,1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais In some preferred embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f) In some preferred embodiments according to I-1d, I-1e, or I-1f), J6is CR13A,and R13A. In some preferred embodiments according to Formula I or I-1(e.g., Formula I-1a, I-1b, I-1c, I-1d, I- . In some preferred embodiments 1c,I-1d, I-1e, or I-1f), J6is CR13A, and R13A. In some preferred embodiments according to Formula I or I-1 (e.g., I-1c, I-1d, I-1e,6 13Aor I-1f), J is CR , and R13A. In some preferred embodiments according to Formula I or I-1(e.g., Formula I-1a, I-1b, I-1c, I-1d, I- In some preferred embodiments accordingI- 1d, I-1e, or I-1f) In some preferred embodiments according to1c, I-1d, I-1e, or I-1f), J6is CR13A, some preferred embodiments according to Formula I or I-1(e.g., Formula I-1a, I-1b, I-1c, I-1d, I- Insome preferred embodiments according I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I- 1d, I-1e, or I-1f) .

[0064] In Formula I or I-1 (e.g., Formula I-1a,I-1b, I-1c, I-1d, or , a pyridinyl substituted with one substituent selected from OCH3, OCF2H, OCF3, SO2CH3, NH2, CN, Cl, isopropyl, CF3, CH3, CF2H, or CH2CF3, and optionally a further substituent selected from F or Cl, for example, selected from the following: . In someI-1b, I-1c, I- 1d, I-1e, or I-1f) In some preferred embodiments according to I-1d, I-1e, or I-1f)6 13A, J is CR , and R13A. In some preferred embodiments according to Formula I or I-1 (e.g.,FFFormula I-1a, I-1b, I-1c, I-1d, I-1e, or I- In some preferred embodiments according to1d, I-1e, or I-1f) some preferred embodiments according toFormula I or I-1 (e.g., Formula I-1a, I-1b, I- I-1e, or I-1f), J6is CR13A, and R13Ais . In some preferred embodiments according to Formula I or I-1 (e.g., Formula I-1a,I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais a 4-pyridinyl substituted with one substituent selected from OCH3, OCF2H, OCF3, SO2CH3, NH2, CN, Cl, isopropyl, CF3, CH3, CF2H, or CH2CF3, and optionally a further substituent selected from F or Cl, for example, .

[0066] In some more specific embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais a phenyl, pyrimidinyl, pyridazinyl, or pyrazinyl, which is substituted with 1 or 2 substituents independently selected from deuterium, halogen (e.g., F or Cl), CN, C1-4 alkyl, O-(C1-4 alkyl), SO2-(C1-4 alkyl), OH, NH2, NH(C1-4alkyl), or N(C1-4alkyl)(C1-4alkyl), wherein each of the aforementioned C1-4alkyl is independently optionally substituted with 1-7 deuterium or F. In some more specific embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais a pyrimidinyl which is substituted with 1 or 2 substituents independently selected from deuterium, halogen (e.g., F or Cl), CN, C1-4alkyl, O-(C1-4alkyl), SO2-(C1-4alkyl), OH, NH2, NH(C1-4alkyl), or N(C1-4alkyl)(C1-4alkyl), wherein each of the aforementioned C1-4alkyl is independently optionally substituted with 1-7 deuterium or F. In some more specific embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I- 1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais a pyridazinyl, which is substituted with 1 or 2 substituents independently selected from deuterium, halogen (e.g., F or Cl), CN, C1-4alkyl, O-(C1-4 alkyl), SO2-(C1-4 alkyl), OH, NH2, NH(C1-4 alkyl), or N(C1-4 alkyl)(C1-4 alkyl), wherein each of the aforementioned C1-4alkyl is independently optionally substituted with 1- 7 deuterium or F. In some more specific embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais a pyrazinyl which is substituted with 1 or 2 substituents independently selected from deuterium, halogen (e.g., F or Cl), CN, C1-4alkyl, O-(C1-4alkyl), SO2-(C1-4alkyl), OH, NH2, NH(C1-4alkyl), or N(C1-4alkyl)(C1-4 alkyl), wherein each of the aforementioned C1-4 alkyl is independently optionallysubstituted with 1-7 deuterium or F. In preferred embodiments, R13Ais selected from the following: InNOsome preferred embodiments, R13Ais . In some preferred embodiments, R13A.I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais a pyrazolyl, optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F, Cl, Br, etc.), C1-4 alkyl, 3-4 membered carbocyclic or heterocyclic ring, or (C1-4 alkylene)-(3-4 membered carbocyclic or heterocyclic ring), wherein the C1-4alkyl, C1-4alkylene, or 3-4 membered carbocyclic or heterocyclic ring is optionally substituted with one or more (e.g., 1- 3) substituents independently deuterium, F, OH, or methyl. In some preferred embodiments, R13Ais selected from the following: .I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Ais a 5-7 membered heterocyclic ring, such as a tetrahydropyranyl, piperidinyl, piperazinyl, morpholinyl, etc., which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F, Cl, Br, etc.), oxo, C1-4 alkyl, 3-4 membered carbocyclic or heterocyclic ring, or (C1-4 alkylene)-(3-4 membered carbocyclic or heterocyclic ring), wherein the C1-4alkyl, C1-4alkylene, or 3-4 membered carbocyclic or heterocyclic ring is optionally substituted with oneor more (e.g., 1-3) substituents deuterium, F, OH, or methyl. In some preferred embodiments, R13Ais selected from the following: N F F F .

[0069] I-1b, I-1c,I-1d, I-1e, or I-1f), is and can be L- as defined herein in connection with Formula K or its subformulae. In some embodiments according to Formula I or I-1 (e.g., Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), J6is CR13A, and R13Acan also be any of the respective groups of the compounds shown in Table 1 or Examples 1-145 herein.

[0070] In some embodiments, in Formula I or I-1, J6is NR13Band J7is C(O).

[0071] For example, in some embodiments, the compound of Formula I or I-1 can be characterized as having a structure according to Formula I-1g: wherein the variables are

[0072] In some embodiments, in Formula I or I-1, J6is NR13B, and R13Bis an optionally substituted C1-6alkyl, an optionally substituted C2-6alkenyl, an optionally substituted C2-6alkynyl, an optionally substituted C1-6 heteroalkyl, an optionally substituted 3-10 membered carbocyclic or heterocyclic ring, an optionally substituted phenyl, or an optionally substituted 5 or 6-membered heteroaryl, preferably, when substituted, the C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C1-6heteroalkyl, 3-10 membered carbocyclic or heterocyclic ring, phenyl, or 5 or 6- membered heteroaryl is substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, NH2, SF5, CN, or -Y1-Y2, wherein Y1is null, O, S, NH, NY3, C(O), SO2, C(O)NH, C(O)NY3, P(O)Y3, SO2NH, or SO2NY3, and each of Y2and Y3at each occurrence is independently an optionally substituted C1-6alkyl, an optionally substituted C2-6 alkenyl, an optionally substituted C2-6 alkynyl, an optionally substituted C1-6 heteroalkyl, an optionally substituted 3-10 membered carbocyclic or heterocyclic ring, an optionally substituted phenyl, or an optionally substituted 5 or 6-membered heteroaryl.

[0073] In some embodiments, the of Formula I can also have a bicyclic heteroaryl in which one of the fused rings is a pyrazole or imidazole ring. For example, in some embodiments, J1in Formula I can be CH, and one of J2and J3is C and the other of J2and J3is N.

[0074] In some embodiments according to Formula A (including any applicable subformulae), Ring B can also be an optionally substituted 5-7 membered carbocyclic or heterocyclic ring. For example, in some embodiments, Ring B can be a 5-7 membered carbocyclic ring, such as a cyclohexylene , which is optionally substituted.

[0075] For example, in someof Formula A has a structure according to Formula II: wherein:n1 is 0, 1, 2, 3, or 4, RB1at each occurrence is independently deuterium, halogen, OH, CN, NH2, an optionally substituted C1-6alkyl, an optionally substituted C2-6alkenyl, an optionally substituted C2-6alkynyl, an optionally substituted C1-6 heteroalkyl, an optionally substituted 3-10 membered carbocyclic or heterocyclic ring, an optionally substituted phenyl, or an optionally substituted 5 or 6-membered heteroaryl, preferably, when substituted, the C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C1-6heteroalkyl, 3-10 membered carbocyclic or heterocyclic ring, phenyl, or 5 or 6- membered heteroaryl is substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, NH2, SF5, CN, or -Y1-Y2, wherein Y1is null, O, S, NH, NY3, C(O), SO2, C(O)NH, C(O)NY3, P(O)Y3, SO2NH, or SO2NY3, and each of Y2and Y3at each occurrence is independently an optionally substituted C1-6alkyl, an optionally substituted C2-6 alkenyl, an optionally substituted C2-6 alkynyl, an optionally substituted C1-6 heteroalkyl, an optionally substituted 3-10 membered carbocyclic or heterocyclic ring, an optionally substituted phenyl, or an optionally substituted 5 or 6-membered heteroaryl; andthe other variables are defined herein.

[0076] In some embodiments, n1 in Formula II is 0.

[0077] In some embodiments, n1 in Formula II is 1, and the compound has a structure according to Formula II-1:wherein the variables are some RB1is an optionally substituted phenyl or 5 or 6-membered heteroaryl. In some embodiments, RB1is an optionally substituted phenyl, such as phenyl or 4-chlorophenyl. When substituted, the phenyl or 5 or 6-membered heteroaryl ring can preferably be substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, NH2, SF5, CN, or Y1-Y2, wherein Y1is null, O, S, NH, NY3, C(O), SO2, C(O)NH, C(O)NY3, P(O)Y3, SO2NH, or SO2NY3, and each of Y2and Y3at each occurrence is independently an optionally substituted C1-6alkyl, an optionally substituted C2-6alkenyl, an optionally substituted C2-6alkynyl, an optionally substituted C1-6 heteroalkyl, an optionally substituted 3-10 membered carbocyclic or heterocyclic ring, an optionally substituted phenyl, or an optionally substituted 5 or 6- membered heteroaryl.

[0078] In some embodiments, Ring B can be a 5-7 membered heterocyclic ring having 1 or 2 ring heteroatoms, such , which is optionally substituted.

[0079] For example, inof Formula A has a structure according to Formula III:wherein: n2 is 0, 1, 2, 3, or 4, RC1at each occurrence is independently deuterium, halogen, OH, CN, NH2, an optionally substituted C1-6alkyl, an optionally substituted C2-6alkenyl, an optionally substituted C2-6alkynyl, an optionally substituted C1-6 heteroalkyl, an optionally substituted 3-10 membered carbocyclic or heterocyclic ring, an optionally substituted phenyl, or an optionally substituted 5 or 6-membered heteroaryl, preferably, when substituted, the C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C1-6heteroalkyl, 3-10 membered carbocyclic or heterocyclic ring, phenyl, or 5 or 6- membered heteroaryl is substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, NH2, SF5, CN, or -Y1-Y2, wherein Y1is null, O, S, NH, NY3, C(O), SO2, C(O)NH, C(O)NY3, P(O)Y3, SO2NH, or SO2NY3, and each of Y2and Y3at each occurrence is independently an optionally substituted C1-6alkyl, an optionally substituted C2-6 alkenyl, an optionally substituted C2-6 alkynyl, an optionally substituted C1-6 heteroalkyl, an optionally substituted 3-10 membered carbocyclic or heterocyclic ring, an optionally substituted phenyl, or an optionally substituted 5 or 6-membered heteroaryl; and the other variables are defined herein.

[0080] In some embodiments according to Formula III, n2 is 0.

[0081] In some embodiments according to Formula III, and the compound has a structure according to Formula III-1: wherein RC2is ansubstituted C2-6 alkenyl, an optionally substituted C2-6 alkynyl, an optionally substituted C1-6 heteroalkyl, an optionally substituted 3-10 membered carbocyclic or heterocyclic ring, an optionally substituted phenyl, or an optionally substituted 5 or 6-membered heteroaryl, and the other variables are defined herein. In some embodiments, RC2is an optionally substituted phenyl or 5 or 6-membered heteroaryl. When substituted, the phenyl or 5 or 6-membered heteroaryl ring can preferably be substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, NH2, SF5, CN, or -Y1-Y2, wherein Y1is null, O, S, NH, NY3, C(O), SO2,C(O)NH, C(O)NY3, P(O)Y3, SO2NH, or and Y2and Y3are each independently an optionally substituted C1-6alkyl, an optionally substituted C2-6alkenyl, an optionally substituted C2-6 alkynyl, an optionally substituted C1-6 heteroalkyl, an optionally substituted 3-10 membered carbocyclic or heterocyclic ring, an optionally substituted phenyl, or an optionally substituted 5 or 6-membered heteroaryl.

[0082] Ring A in Formula A (e.g., Formula I, II, or III, or any of the subformulae) is typically a phenyl ring or a 5 or 6-membered heteroaryl ring having 1 to 3 ring heteroatoms independently selected from N, O, and S, such as pyridine ring. In some embodiments, Ring A in Formula A can also be a fused bicyclic heteroaryl having 1 to 4 ring heteroatoms independently selected from N, O, and S.

[0083] In some embodiments, Ring A in Formula A (e.g., Formula I, II, or III, or any of the subformulae) is a phenyl, pyridinyl, pyrimidinyl, or imidazo[1,2-a]pyridinyl ring.

[0084] In some preferred embodiments, Ring A in Formula A (e.g., Formula I, II, or III, or any of the subformulae) is a phenyl ring.

[0085] In some preferred embodiments, Ring A in Formula A (e.g., Formula I, II, or III, or any of the subformulae) is a pyridinyl ring.

[0086] For example, in some embodiments, the compound of Formula A can have a structure according to Formula A1: wherein the variables are

[0087] In some embodiments, the compound of Formula A can have a structure according to Formula A2: wherein the variables are

[0088] In some embodiments, the of Formula A can have a structure according to Formula A3: wherein the variables are

[0089] In some embodiments, the moiety in Formula A1, A2, or A3, or any of the subformulae described of any of thosedescribed herein for Formula I (e.g., I-1, I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f), Formula II (e.g., II-1), or Formula III (e.g., III-1).

[0090] In some embodiments, the subscript "m" in Formula A (e.g., any of the applicable subformulae) is 0 or 1, typically 1. Typically, when m is 1, R2is meta to R1.

[0091] For example, in some embodiments, the compound of Formula A1 can have a structure according to Formula A1a: wherein the variables are

[0092] In some embodiments, the compound of Formula A2 can have a structure according to Formula A2a:

[0093] Typically, in embodiments to Formula A (e.g., any of the applicable subformulae), R2at each occurrence is independently deuterium, halogen, CN, OH, (C1-4alkylene)-CN, GA, or Xa-Xb-GA, wherein: Xaat each occurrence is independently null, C1-4 alkylene, or C1-4 heteroalkylene; Xbat each occurrence is independently null, O, NH, N(GB), C(O), C(O)O, C(O)NH, C(O)N(GB), NHC(O), N(GB)C(O), SO2, SO2NH, or SO2N(GB); and GAat each occurrence is independently: (i) C1-6 alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4alkoxy, or a 3-6 membered ring; (ii) C1-6 heteroalkyl optionally substituted with one or more (e.g., 1-3) substituents independently deuterium, halogen, C1-4alkyl, C1-4alkoxy, or a 3-6 membered ring; (iii) a 3-7 membered carbocyclic or heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, oxo, OH, CN, C1-4 alkyl, C1-4 alkoxy, or a 3-6 membered ring; or (iv) a 5 or 6-membered heteroaryl, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, CN, C1-4alkyl, C1-4 alkoxy, or a 3-6 membered ring (preferably carbocyclic or heterocyclic ring), wherein the C1-4 alkyl or C1-4 alkoxy in each of (i)-(iv) is independently optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy, or a 3-4 membered carbocyclic or heterocyclic ring, and wherein each of the 3-6 membered ring in each of (i)-(iv) is independently optionally substituted with one or more (e.g., 1-3) substituents each independently oxo, deuterium, halogen, OH, CN, C1-4 alkyl optionally substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F; GBat each occurrence is independently C1-6 alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy optionally substituted with deuterium or F, or a 3-6 membered ring (preferably carbocyclic or heterocyclic ring) optionally substituted with oxo, deuterium, halogen, OH, CN, C1-4 alkyloptionally substituted with or C1-4 alkoxy optionally substituted with deuterium or F, or when applicable, GAand GBare joined to form a 4-7 membered heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently halogen, oxo, OH, C1-4 alkyl optionally substituted with F, or C1-4 alkoxy optionally substituted with F.

[0094] In some preferred embodiments, in Formula A (e.g., any of the applicable subformulae), one instance of R2is a C1-4alkyl optionally substituted with deuterium, F, and / or OH, e.g., methyl, difluoromethyl, or hydroxymethyl, and if present, any remaining instance(s) of R2is as defined herein, preferably, selected from halogen, OH, CN, C1-4alkyl optionally substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F.

[0095] In some embodiments, in Formula A (e.g., any of the applicable subformulae), one instance of R2is a 5 or 6-membered heteroaryl, which is optionally substituted with 1-3 substituents each independently halogen, OH, CN, C1-4 alkyl, C1-4 alkoxy, or a 3-5 membered carbocyclic or heterocyclic ring, wherein the C1-4alkyl or C1-4alkoxy is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F), OH, C1-4alkoxy, or a 3-5 membered carbocyclic or heterocyclic ring, wherein each of the 3-5 membered carbocyclic or heterocyclic ring, when present, is independently optionally substituted with deuterium, F, OH, and / or methyl, and if present, any remaining instance(s) of R2is as defined herein, preferably, selected from halogen, OH, CN, C1-4 alkyl optionally substituted with deuterium or F, or C1-4alkoxy optionally substituted with deuterium or F.

[0096] In some embodiments, in Formula A (e.g., any of the applicable subformulae), one instance of R2is -(C1-4alkylene)-C(O)NHGA, -(C1-4alkylene)-C(O)N(GA)(GB) or -(C1-4alkylene)-CN, wherein GAand GBare defined herein. In some embodiments, GAand GBare each independently a C1-4alkyl optionally substituted with deuterium, F and / or OH, and if present, any remaining instance(s) of R2is as defined herein, preferably, selected from halogen, OH, CN, C1-4 alkyl optionally substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F. For example, in some embodiments, m is 1, and R2can be CH2C(O)NHCH3 or CH2C(O)N(CH3)2.

[0097] In Formula A (e.g., any of the applicable subformulae), R1is typically an optionally substituted phenyl or an optionally substituted 5-10 membered heteroaryl. Forexample, in some embodiments, R1is an substituted phenyl. In some embodiments, R1is an optionally substituted pyridinyl. In some embodiments, R1is an optionally substituted pyrimidinyl, benzopyrazolyl, benzimidazolyl, imidazolyl, pyridazyl, imidazo[l,2-a]pyrimidinyl, oxazolo[4,5-b]pyridinyl, oxazolo[5,4-b]pyridinyl, thiazolo[4,5- b]pyridinyl, benzo[d]thiazole, indazolyl, [l,2,4]triazolo[l,5-a]pyrimidinyl, [l,2,4]triazolo[l,5- b]pyridazinyl, or tetrazolo[l,5-a]pyridinyl. When substituted, the optionally substituted phenyl or an optionally substituted 5-10 membered heteroaryl, e.g., optionally substituted phenyl or pyridinyl, is preferably substituted with one or more (e.g., 1-3) substituents independently selected from: deuterium, halogen, CN, OH, NH2, COOH, CONH2, (C1-4 alkylene)-CN, GC, or Xc-Xd-GC, wherein: Xcat each occurrence is independently null, C1-4alkylene, or C1-4heteroalkylene; Xdat each occurrence is independently null, O, NH, N(GD), C(O), C(O)O, C(O)NH, C(O)N(GD), NHC(O), N(GD)C(O), P(O)(GD), SO2, SO2NH, or SO2N(GD); and GCat each occurrence is independently: (i) C1-6alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy, or a 3-6 membered ring; (ii) C1-6heteroalkyl optionally substituted with one or more (e.g., 1-3) substituents independently deuterium, halogen, C1-4 alkyl, C1-4 alkoxy, or a 3-6 membered ring; (iii) a 3-7 membered carbocyclic or heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, oxo, OH, CN, C1-4alkyl, C1-4alkoxy, or a 3-6 membered ring; or (iv) a 5 or 6-membered heteroaryl, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, CN, C1-4 alkyl, C1-4alkoxy, or a 3-6 membered ring (preferably carbocyclic or heterocyclic ring), wherein the C1-4 alkyl or C1-4 alkoxy in each of (i)-(iv) is independently optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy, or a 3-4 membered carbocyclic or heterocyclic ring, andwherein each of the 3-6 ring in each of (i)-(iv) is independently optionally substituted with oxo, deuterium, halogen, OH, CN, C1-4alkyl optionally substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F; GDat each occurrence is independently C1-6 alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4alkoxy optionally substituted with deuterium or F, or a 3-6 membered ring optionally substituted with oxo, deuterium, halogen, OH, CN, C1-4alkyl optionally substituted with deuterium or F, or C1-4alkoxy optionally substituted with deuterium or F, or when applicable, GCand GDtogether with the heteroatom they are both attached to are joined to form a 4-7 membered heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently halogen, oxo, OH, C1-4alkyl optionally substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F. In some embodiments, the one or more substituents for the optionally substituted phenyl or optionally substituted 5-10 membered heteroaryl are each independently selected from: deuterium, halogen, CN, OH, NH2, COOH, CONH2, (C1-4alkylene)-CN, GC, or Xc-Xd-GC, wherein Xcis null, and Xdand GCare defined herein. In some embodiments, the one or more substituents for the optionally substituted phenyl or optionally substituted 5-10 membered heteroaryl are each independently selected from: halogen, C1-6alkyl optionally substituted with deuterium, F, CN, and / or OH, C1-6alkoxy optionally substituted with deuterium, F, CN, and / or OH, C3-6 cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-4alkyl), or N(C1-4alkyl)(C1-4 alkyl). In some embodiments, the one or more substituents for the optionally substituted phenyl or optionally substituted 5-10 membered heteroaryl are each independently selected from: halogen, C1-4 alkyl optionally substituted with deuterium, F and / or OH, C1-4alkoxy optionally substituted with deuterium or F, C3-4cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-3 alkyl), or N(C1-3 alkyl)(C1-3 alkyl). In some more specific embodiments, , the one or more substituents for the optionally substituted phenyl or optionally substituted 5-10 membered heteroaryl are each independently selected from: methyl, ethyl, fluoro, chloro, bromo, trifluoromethyl, difluoromethyl, methoxy, ethoxy, difluoromethoxy, trifluoromethoxy, cyclopropyl, -NH2, hydroxymethyl, and 1-hydroxy ethyl, preferably, the substituents areindependently selected from methyl, chloro, trifluoromethyl, difluoromethyl, methoxy, ethoxy, difluoromethoxy, and cyclopropyl.

[0098] In some embodiments, in Formula A (e.g., any of the applicable subformulae), R1can be a phenyl or pyridinyl substituted with one substituent. In such embodiments, the one substituent is preferably ortho to ring A. For example, in some embodiments, R1can be , wherein R1bcan be halogen, C1-6 alkyl optionally substituted with OH, C1-6alkoxy optionally substituted with deuterium, F, CN,and / or OH, C3-6 cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-4alkyl), or N(C1-4alkyl)(C1-4alkyl).

[0099] In some embodiments, in Formula A (e.g., any of the applicable subformulae), R1can be a phenyl or pyridinyl substituted with two substituents. Typically, the two substituents are para to each other, with one of the substituents ortho to ring A.

[0100] For example, in some embodiments, the compound of Formula A can have a structure according to Formula A1b:wherein R1aand R1bare each independently halogen, C1-6alkyl optionally substituted with deuterium, F, CN, and / or OH, C1-6 alkoxy optionally substituted with deuterium, F, CN, and / or OH, C3-6cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-4 alkyl), or N(C1-4 alkyl)(C1-4 alkyl), and the other variables are defined herein.

[0101] In some embodiments, the compound of Formula A can have a structure according to Formula A1c:A1c, wherein R1aand R1bare each independently halogen, C1-6alkyl optionally substituted with deuterium, F, CN, and / or OH, C1-6 alkoxy optionally substituted with deuterium, F, CN, and / or OH, C3-6cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-4 alkyl), or N(C1-4 alkyl)(C1-4 alkyl), and the other variables are defined herein.

[0102] In some embodiments, the compound of Formula A can have a structure according to Formula A2b: N R1bR1awherein R1aand R1bare each independently halogen, C1-6 alkyl optionally substituted with deuterium, F, CN, and / or OH, C1-6alkoxy optionally substituted with deuterium, F, CN, and / or OH, C3-6 cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-4 alkyl), or N(C1-4 alkyl)(C1-4 alkyl), and the other variables are defined herein.

[0103] In some embodiments, the compound of Formula A can have a structure according to Formula A2c:wherein R1aand R1bare each independently halogen, C1-6alkyl optionally substituted with deuterium, F, CN, and / or OH, C1-6 alkoxy optionally substituted with deuterium, F, CN, and / or OH, C3-6cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-4 alkyl), or N(C1-4 alkyl)(C1-4 alkyl), and the other variables are defined herein.

[0104] in Formula A1a, A1b, A1c,described herein forFormula I (e.g., I-1, I-1a, I-1b, I-1c, I- or I-1f), Formula II (e.g., II-1), or Formula III (e.g., III-1), preferably, any of those described herein for Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f.

[0105] To illustrate, in some embodiments, the A2b can have the respective definition of any of those I-1b, I-1c, I-1d, I-1e, or I-1f, and in such embodiments, can have a structure according to any of the following Formula A2b-1, A2b-2, A2b-3, A2b-4, A2b-5, or A2b-6:wherein R1a, R1b, R2, and R13Aare defined herein.

[0106] In some preferred embodiments, in Formula A1b, A1c, A2b, A2b-1, A2b-2, A2b- 3, A2b-4, A2b-5, A2b-6, or A2c, R1aand R1bare each independently selected from methyl, ethyl, fluoro, chloro, bromo, trifluoromethyl, difluoromethyl, methoxy, ethoxy,difluoromethoxy, trifluoromethoxy, -NH2, hydroxymethyl, and 1-hydroxy ethyl, more preferably, R1aand R1bare each independently selected from methyl, fluoro, chloro, trifluoromethyl, difluoromethyl, methoxy, ethoxy, difluoromethoxy, trifluoromethoxy, and cyclopropyl.

[0107] In some preferred embodiments, in Formula A1b, A1c, A2b, A2b-1, A2b-2, A2b- 3, A2b-4, A2b-5, A2b-6, or A2c, R1bis C1-2alkoxy optionally substituted with 1-3 deuterium or F, preferably, R1bis methoxy, ethoxy, or difluoromethoxy.

[0108] In some preferred embodiments, in Formula A1b, A1c, A2b, A2b-1, A2b-2, A2b- 3, A2b-4, A2b-5, A2b-6, or A2c, R1ais halogen, C1-3 alkyl optionally substituted with 1-3 deuterium or F, or cyclopropyl, preferably, R1ais methyl, fluoro, chloro, trifluoromethyl, difluoromethyl, or cyclopropyl.

[0109] In some preferred embodiments, in Formula A1b, A1c, A2b, A2b-1, A2b-2, A2b- 3, A2b-4, A2b-5, A2b-6, or A2c, R1bis C1-2 alkoxy optionally substituted with 1-3 deuterium or F, preferably, R1bis methoxy, ethoxy, or difluoromethoxy; and R1ais halogen, C1-3alkyl optionally substituted with 1-3 deuterium or F, or cyclopropyl, preferably, R1ais methyl, fluoro, chloro, trifluoromethyl, difluoromethyl, or cyclopropyl. Formula K

[0110] In some embodiments, the present disclosure provides a compound of Formula K, or a pharmaceutically acceptable salt thereof:wherein: Ring A is a phenyl ring or 5-10-membered heteroaryl ring having 1 to 4 ring heteroatoms independently selected from N, O, and S; R1is an optionally substituted phenyl, optionally substituted naphthyl, an optionally substituted 3-10 membered carbocyclic, or an optionally substituted 5-10 membered heterocyclic or heteroaryl, preferably, R1is ortho to the amide group (-C(O)-NH-) shown in Formula K;the subscript m is an integer of 0-4, permits; R2at each occurrence is independently deuterium, halogen, OH, NH2, CN, SF5, COOH, CONH2, SO2NH2, R20, OR20, SR20, N(R20)(R21), SO2R20, S(=O)(=NR21)R20, SO2N , N SO2R20, COR20, COOR20, OC R20,CON , or substituted6 alkynyl, an optionally substituted C1-6 heteroalkyl, or an optionally substituted 3-10 membered ring structure; and R21at each occurrence is independently hydrogen, an optionally substituted C1-6 alkyl, an optionally substituted C3-6 alkenyl, an optionally substituted C3-6 alkynyl, an optionally substituted C1-6heteroalkyl, or an optionally substituted 3-10 membered ring structure; or as applicable, R20and R21together with the intervening atom (e.g., the nitrogen atom) or atoms are joined to form an optionally substituted 4-8 membered heterocyclic ring; or two instances of R2are joined to form an optionally substituted 4-7 membered ring; RJis hydrogen, halogen, optionally substituted C1-6 alkyl, an optionally substituted C2-6 alkenyl, an optionally substituted C2-6alkynyl, an optionally substituted C1-6heteroalkyl, or an optionally substituted 3-10 membered ring structure; L is C1-4alkylene, C2-4alkenylene, C2-4alkynylene, or C1-4heteroalkylene, each of which is optionally substituted with deuterium and / or F, and RKis hydrogen, deuterium, an optionally substituted C1-6alkyl, an optionally substituted C1-6 heteroalkyl, or an optionally substituted 3-10 membered ring structure.

[0111] In some embodiments, the compound of Formula K (including any of the applicable sub-formulae as described herein) can comprise one or more asymmetric centers and / or axial chirality, and thus can exist in various stereoisomeric forms, e.g., enantiomers and / or diastereomers. In some embodiments, the compound of Formula K can exist in the form of an individual enantiomer and / or diastereomer, as applicable, or a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomers. In some embodiments, when applicable, the compound of Formula K (including any of the applicable sub-formulae as described herein) can exist as an individual enantiomer substantially free of the other enantiomer, such as having an enantiomeric excess ("ee") of greater than 60%, preferably, greater than 80% ee, greater than 90% ee, greater than 95% ee, greater than 98% ee, or greater than 99% ee. In some embodiments, whenapplicable, the compound of Formula K any of the applicable sub-formulae as described herein) can also exist as a mixture of stereoisomers in any ratio, such as a racemic mixture.

[0112] In some embodiments, the compound of Formula K (including any of the applicable sub-formulae as described herein) can exist as an isotopically labeled compound, particularly, a deuterated analog, wherein one or more of the hydrogen atoms of the compound of Formula K is / are substituted with a deuterium atom with an abundance above its natural abundance, e.g., a CD3analog when the compound has a CH3group. Without wishing to be bound by theories, it is believed that in certain situations, substitution with deuterium can lead to a deuterated analog with a better pharmacokinetic profile. Deuterated analogs can be generally prepared by using commercially available deuterating / deuterated reagents.

[0113] It should be apparent to those skilled in the art that in certain cases, the compound of Formula K may exist as a mixture of tautomers. The present disclosure is not limited to any specific tautomer. Rather, the present disclosure encompasses any and all of such tautomers whether or not explicitly drawn or referred to.

[0114] In some preferred embodiments, L in Formula K is C2-4 alkynylene, which is optionally substituted with deuterium and / or F. For example, in some preferred embodiments, the compound of Formula K can be characterized as having a structure according to Formula K-1:

[0115] In some embodiments, L can also be a C3-4 alkynylene, optionally substituted with deuterium and / or F, such , typically, in such embodiments, the CH2end is bonded with RK.

[0116] In some embodiments, L in Formula K is C1-4alkylene, which is optionally substituted with deuterium and / or F. The C1-4 alkylene can be linear or branched. Forexample, in some embodiments, L can C1-4 alkylene, such as CH2CH2, CH2CH2CH2, or CH2CH2CH2CH2.

[0117] In some embodiments, L in Formula K is C2-4 alkenylene, which is optionally substituted with deuterium and / or F. For example, in some embodiments, L can be a C2alkenylene, e.g., .

[0118] L in Formula K is C1-4heteroalkylene, which is optionally substitutedand / or F. For example, in some embodiments, L can be , or , wherein the oxygen atom can be bonded with RKor to the

[0119] In some preferred embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) can be an optionally substituted C3-8cycloalkyl. Typically, the C3-8 cycloalkyl is a monocyclic ring. However, in some embodiments, the C3-8 cycloalkyl can also be a bicyclic ring structure, such as a fused, bridged, or spiro bicyclic ring structure. When substituted, the C3-8 cycloalkyl is preferably substituted with one or more (e.g., 1, 2, or 3) substituents independently selected from deuterium, halogen, OH, CN, C1-4alkyl, C2-4alkenyl, C2-4 alkynyl, C1-4 heteroalkyl, or a 3-10 membered ring, wherein each of the C1-4 alkyl, C2-4alkenyl, C2-4alkynyl, C1-4heteroalkyl, or 3-10 membered ring is independently optionally substituted with one or more substituents independently selected from deuterium, halogen, CN, OH, oxo, C1-4alkyl optionally substituted with deuterium and / or F, C1-4heteroalkyl optionally substituted with deuterium and / or F, and 3-6 membered ring (e.g., carbocyclic, heterocyclic, heteroaryl, or phenyl ring), wherein the 3-6 membered ring at each occurrence is independently optionally substituted with one or more substituents independently selected from deuterium, halogen, CN, OH, oxo, C1-4alkyl optionally substituted with deuterium and / or F, and C1-4 heteroalkyl optionally substituted with deuterium and / or F.

[0120] In some embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) can be cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl, each of which is optionally substituted with one or more, e.g., 1-5 or 1-3, substituents independently selected from deuterium, F, OH, CN, C1-4alkyl optionally substituted with F, C1-4heteroalkyl optionally substituted with F, or 3-6 membered ring optionally substituted with one or moresubstituents independently selected halogen, CN, OH, oxo, C1-4 alkyl optionally substituted with F, and C1-4heteroalkyl optionally substituted with F.

[0121] For example, in some more specific embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) can be selected from: . the compound of Formula K-1 canhave a structure according to Formula K-1a: wherein the variables

[0123] In some embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) can be an optionally substituted 4-8 membered heterocyclyl. Typically, the 4-8 membered heterocyclyl has 1-3 ring heteroatoms each independently O, S, or N, wherein the sulfur atom, if present, is optionally oxidized. The 4-8 membered heterocyclyl is typically a monocyclic ring. In some embodiments, the 4-8 membered heterocyclyl can also be a fused, bridged, or spiro bicyclic ring structure. When substituted, the 4-8 membered heterocyclyl is preferably substituted with one or more (e.g., 1, 2, or 3) substituents independently selected from deuterium, halogen, OH, oxo, CN, C1-4 alkyl, C2-4 alkenyl, C2-4 alkynyl, C1-4heteroalkyl, or a 3-10 membered ring, wherein each of the C1-4alkyl, C2-4alkenyl, C2-4 alkynyl, C1-4 heteroalkyl, or 3-10 membered ring is independently optionally substituted with one or more substituents independently selected from deuterium, halogen, CN, OH, oxo, C1-4 alkyl optionally substituted with deuterium and / or F, C1-4 heteroalkyl optionally substituted with deuterium and / or F, and 3-6 membered ring (e.g., carbocyclic, heterocyclic, heteroaryl, or phenyl ring), wherein the 3-6 membered ring at each occurrence is independently optionally substituted with one or more substituents independently selectedfrom deuterium, halogen, CN, OH, oxo, optionally substituted with deuterium and / or F, and C1-4heteroalkyl optionally substituted with deuterium and / or F.

[0124] In some embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) is 4-6 membered heterocyclyl having one or two ring heteroatoms, each independently O, S, or N, wherein the sulfur atom, if present, is optionally oxidized, wherein the 4-6 membered heterocyclyl is optionally substituted with one or more (e.g., 1-3) substituents independently selected from deuterium, F, oxo, OH, CN, C1-4 alkyl optionally substituted with deuterium and / or F, C1-4heteroalkyl optionally substituted with deuterium and / or F, 3-6 membered ring, (C1-4 alkylene)-(3-6 membered ring), or (C1-4 heteroalkylene)- (3-6 membered ring), wherein the C1-4alkylene or C1-4heteroalkylene is optionally substituted with deuterium and / or F, and wherein each of the 3-6 membered ring is optionally substituted with one or more substituents independently selected from deuterium, halogen, CN, OH, oxo, C1-4 alkyl optionally substituted with F, and C1-4 heteroalkyl optionally substituted with F.

[0125] For example, in some embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) can be a monocyclic 4-6 membered heterocyclyl having one ring heteroatom, which is O, and the 4-6 membered heterocyclyl is unsubstituted or substituted with 1-3 substituents each independently deuterium, F, OH, C1-4alkyl optionally substituted with deuterium and / or F, or C1-4 heteroalkyl optionally substituted with deuterium and / or F.

[0126] For example, in some embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) can be selected from: .RKin Formula K (e.g., any of the subformulae described herein, as applicable) can be an optionally substituted 5 or 6-membered heteroaryl. Typically, a 5-membered hetaryl has 1-3 ring heteroatoms each independently O, S, or N; and a 6-membered heteroaryl has 1 or 2 ring nitrogen atoms. When substituted, the 5 or 6- membered heteroaryl is preferably substituted with one or more (e.g., 1, 2, or 3) substituents independently selected from deuterium, halogen, OH, CN, C1-4alkyl, C2-4alkenyl, C2-4alkynyl, C1-4 heteroalkyl, or a 3-10 membered ring, wherein each of the C1-4 alkyl, C2-4 alkenyl, C2-4alkynyl, C1-4heteroalkyl, or 3-10 membered ring is independently optionallysubstituted with one or more selected from deuterium, halogen, CN, OH, oxo, C1-4alkyl optionally substituted with deuterium and / or F, C1-4heteroalkyl optionally substituted with deuterium and / or F, and 3-6 membered ring (e.g., carbocyclic, heterocyclic, heteroaryl, or phenyl ring), wherein the 3-6 membered ring at each occurrence is independently optionally substituted with one or more substituents independently selected from deuterium, halogen, CN, OH, oxo, C1-4alkyl optionally substituted with deuterium and / or F, and C1-4 heteroalkyl optionally substituted with deuterium and / or F.

[0128] In some embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) can be a 5-membered heteroaryl having 1-4 ring heteroatoms, each independently O, S, or N, wherein the 5-membered heteroaryl is optionally substituted with 1-3 substituents independently selected from F, Cl, OH, CN, C1-4 alkyl optionally substituted with deuterium and / or F, C1-4heteroalkyl optionally substituted with deuterium and / or F, 3-6 membered ring, (C1-4 alkylene)-(3-6 membered ring), or (C1-4 heteroalkylene)-(3-6 membered ring), wherein the C1-4alkylene or C1-4heteroalkylene is optionally substituted with deuterium and / or F, and wherein each of the 3-6 membered ring is optionally substituted with one or more substituents independently selected from deuterium, halogen, CN, OH, oxo, C1-4alkyl optionally substituted with F, and C1-4 heteroalkyl optionally substituted with F. The 3-6 membered ring at each occurrence can be independently a 3-6 membered carbocyclic, 4-6 membered heterocyclic, 5 or 6-membered heteroaryl, or phenyl ring.

[0129] In some embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) can be a 5-membered heteroaryl selected from pyrazolyl, isoxazolyl, oxadiazolyl, or thiadiazolyl, which is optionally substituted, as valency permits, with 1-3 substituents independently selected from F, Cl, OH, CN, C1-4 alkyl optionally substituted with deuterium and / or F, C1-4heteroalkyl optionally substituted with deuterium and / or F, 3-6 membered ring, (C1-2 alkylene)-(3-6 membered ring), or (C1-2 heteroalkylene)-(3-6 membered ring), wherein the C1-2alkylene or C1-2heteroalkylene is optionally substituted with deuterium and / or F, and wherein, preferably, the 3-6 membered ring at each occurrence is independently selected from (a) C3-6 cycloalkyl optionally substituted with methyl and / or F; or (b) 4-6 membered heterocyclyl having 1 or 2 ring heteroatoms independently selected from O, S, and N, wherein the sulfur atom, if present, is optionally oxidized, and wherein the 4-6 membered heterocyclyl is optionally substituted with 1-3 substituents independently selected fromdeuterium, F, OH, oxo, CN, C1-4 alkyl substituted with F, or C1-4 heteroalkyl optionally substituted with F.

[0130] In some embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) wherein:q is 0, 1, 2, or 3; and G10at each occurrence is independently F, Cl, CN, C1-4 alkyl optionally substituted with deuterium and / or F, C1-4heteroalkyl optionally substituted with deuterium and / or F, 3-6 membered ring, (C1-2 alkylene)-(3-6 membered ring), or (C1-2 heteroalkylene)-(3-6 membered ring), wherein the C1-2alkylene or C1-2heteroalkylene is optionally substituted with deuterium and / or F, and wherein, preferably, the 3-6 membered ring at each occurrence is independently selected from (a) C3-6cycloalkyl optionally substituted with methyl and / or F; or (b) 4-6 membered heterocyclyl having 1 or 2 ring heteroatoms independently selected from O, S, and N, wherein the sulfur atom, if present, is optionally oxidized, and wherein the 4-6 membered heterocyclyl is optionally substituted with 1-3 substituents independently selected from deuterium, F, OH, oxo, CN, C1-4alkyl optionally substituted with F, or C1-4 heteroalkyl optionally substituted with F.

[0131] For example, in some embodiments, the compound of Formula K-1 can have a structure according to Formula K-1b: wherein the

[0132] In some embodiments, the compound of Formula K-1 can have a structure according to Formula K-1c:wherein the

[0133] It should be understood that in Formula K-1b or K-1c, or similar structures or partial structures herein, the G10group(s), when present, can be attached to any of the available positions of the pyrazole ring, including ring nitrogen atom.

[0134] In some embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) can be selected from:G10Aat each occurrence is independently C1-4alkyl optionally substituted with deuterium and / or F, 3-6 membered ring, or (C1-2 alkylene)-(3-6 membered ring), wherein the C1-2 alkylene or C1-2heteroalkylene is optionally substituted with deuterium and / or F, and wherein, preferably, the 3-6 membered ring at each occurrence is independently selected from (a) C3-6cycloalkyl optionally substituted with methyl and / or F; or (b) 4-6 membered heterocyclyl having 1 or 2 ring heteroatoms independently selected from O, S, and N, wherein the sulfur atom, if present, is optionally oxidized, and wherein the 4-6 membered heterocyclyl is optionally substituted with 1-3 substituents independently selected from deuterium, F, OH, oxo, CN, C1-4alkyl optionally substituted with F, or C1-4heteroalkyl optionally substituted with F; and G10Bat each occurrence is independently F, Cl, CN, or G10A.

[0135] For example, in some embodiments, the compound of Formula K-1 can have a structure according to Formula K-1b-1, K-1b-2, K-1b-3, or K-1b-4:wherein the

[0136] In some embodiments, G10Aat each occurrence is independently C1-4alkyl (e.g., methyl) optionally substituted with deuterium and / or F, cyclopropyl, cyclobutyl, (C1-2 alkylene)-(cyclopropyl) or (C1-2alkylene)-(cyclobutyl). For example, in some embodiments,in Formula K-1b-2 or K-1b-4, G10Ais optionally substituted with deuterium and / or F, such as methyl.

[0137] In some embodiments, G10Bat each occurrence is independently F, Cl, C1-4 alkyl (e.g., methyl) optionally substituted with deuterium and / or F, cyclopropyl, cyclobutyl, (C1-2alkylene)-(cyclopropyl) or (C1-2 alkylene)-(cyclobutyl). For example, in some embodiments, in Formula K-1b-3 or K-1b-4, G10Bis C1-4alkyl optionally substituted with deuterium and / or F, such as methyl.

[0138] In some embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) can be selected from: .herein, as applicable) can be a 6-membered heteroaryl having 1 or 2 ring nitrogen atoms, e.g., pyridyl, pyrimidyl, etc., wherein the 6-membered heteroaryl is optionally substituted with 1-3 substituents independently selected from F, Cl, OH, CN, C1-4 alkyl optionally substituted with deuterium and / or F, C1-4heteroalkyl optionally substituted with deuterium and / or F, 3-6 membered ring, (C1-4 alkylene)-(3-6 membered ring), or (C1-4 heteroalkylene)-(3-6 membered ring), wherein the C1-4alkylene or C1-4heteroalkylene is optionally substituted with deuterium and / or F, and wherein each of the 3-6 membered ring is optionally substituted with one or more substituents independently selected from deuterium, halogen, CN, OH, oxo, C1-4alkyl optionally substituted with F, and C1-4 heteroalkyl optionally substituted with F.

[0140] In some embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) can also be hydrogen.

[0141] In some embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) can also be an optionally substituted C1-6 alkyl. When substituted, the C1-6 alkyl can be preferably substituted with one or more (e.g., 1, 2, or 3) substituents independently selected from deuterium, halogen, OH, CN, C2-4 alkenyl, C2-4 alkynyl, C1-4 heteroalkyl, or a 3-10 membered ring, wherein each of the C2-4 alkenyl, C2-4 alkynyl, C1-4 heteroalkyl, or 3-10 membered ring is independently optionally substituted with one or more substituents independently selected from deuterium, halogen, CN, OH, oxo, C1-4 alkyl optionally substituted with deuterium and / or F, C1-4 heteroalkyl optionally substituted withdeuterium and / or F, and 3-6 membered carbocyclic, heterocyclic, heteroaryl, or phenyl ring), wherein the 3-6 membered ring at each occurrence is independently optionally substituted with one or more substituents independently selected from deuterium, halogen, CN, OH, oxo, C1-4alkyl optionally substituted with deuterium and / or F, and C1-4heteroalkyl optionally substituted with deuterium and / or F.

[0142] In some embodiments, RKin Formula K (e.g., any of the subformulae described herein, as applicable) can also be a C1-4 alkyl optionally substituted with deuterium and / or F. For example, in some embodiments, L-RKin Formula K (e.g., any of the subformulae described herein, as applicable) can .

[0143] Typically, RJin Formula described herein, asapplicable, such as Formula K-1, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, or K-1b-4) is hydrogen.

[0144] For example, in some embodiments, the compound of Formula K can be characterized as having a structure according to Formula K-2:wherein the variables are defined and preferred herein.

[0145] In some embodiments, ring A in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K-1a, K-1b, K-1c, K-1b-1, K-1b- 2, K-1b-3, or K-1b-4) can be a phenyl ring. In some embodiments, ring A in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K- 1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, or K-1b-4) can be a 5 or 6-membered heteroaryl ring having 1 to 3 ring heteroatoms independently selected from N, O, and S. In some embodiments, ring A can be a pyridinyl, pyrimidinyl, or imidazo[1,2-a]pyridinyl ring.

[0146] In some preferred embodiments, ring A in in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, or K-1b-4) is a or a pyridyl ring. For example, in some asa structurewherein the variables are defined and preferred herein.

[0148] In some embodiments, the compound of Formula K can be characterized as having a structure of Formula K-5:wherein the variables are defined and preferred herein.

[0149] The integer m in Formula K is typically 1 or 2. When m is 1, R2is typically meta is

[0151] In some embodiments, the of Formula K can be characterized as having a structure of Formula K-4:wherein the variables are

[0152] In some embodiments, the compound of Formula K can be characterized as having a structure of Formula K-6:wherein the variables are defined and preferred herein.

[0153] In some embodiments, in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K- 1b-1, K-1b-2, K-1b-3, or K-1b-4), R2at each occurrence is independently deuterium, halogen, CN, OH, (C1-4 alkylene)-CN, GA, or Xa-Xb-GA, wherein: Xaat each occurrence is independently null, C1-4 alkylene, or C1-4 heteroalkylene; Xbat each occurrence is independently , O, NH, N(GB), C(O), C(O)O, C(O)NH, C(O)N(GB), NHC(O), N(GB)C(=O)(=NH), S(=O)(=NGB), SO2NH, or SO2N(GB); and GAat each occurrence is independently: (i) C1-6alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy, C(O)-NH(C1-4 alkyl), C(O)- N(C1-4alkyl)(C1-4alkyl), or a 3-6 membered ring;(ii) C1-6 heteroalkyl with one or more (e.g., 1-3) substituents independently deuterium, halogen, oxo, C1-4alkyl, C1-4alkoxy, or a 3-6 membered ring; (iii) a 3-8 membered carbocyclic or heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, oxo, OH, CN, C1-4alkyl, C1-4alkoxy, C(O)NH2, C(O)-NH(C1-4 alkyl), C(O)-N(C1-4 alkyl)(C1-4 , , wherein the nitrogen containing Ring E is a 4-8 membered ring, or a 3-6 membered ring;or (iv) a 5 or 6-membered heteroaryl, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, CN, C1-4 alkyl, C1-4alkoxy, or a 3-6 membered ring (preferably carbocyclic or heterocyclic ring), wherein each of the C1-4alkyl or C1-4alkoxy in each of (i)-(iv) is independently optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4alkoxy, or a 3-4 membered carbocyclic or heterocyclic ring, and wherein each of the 3-6 membered ring in each of (i)-(iv) or Ring E is independently optionally substituted with one or more (e.g., 1-3) substituents each independently oxo, deuterium, halogen, OH, CN, C1-4alkyl optionally substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F; GBat each occurrence is independently C1-6alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy optionally substituted with deuterium or F, or a 3-6 membered ring optionally substituted with oxo, deuterium, halogen, OH, CN, C1-4 alkyl optionally substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F, or when applicable, GAand GBare joined to form a 4-8 membered heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently halogen, oxo, OH, C1-4 alkyl optionally substituted with F, or C1-4 alkoxy optionally substituted with F.

[0154] In some embodiments, in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, or K-1b-4), R2at is independently GA, wherein GAis defined herein.

[0155] In some embodiments, in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K- 1b-1, K-1b-2, K-1b-3, or K-1b-4), R2at each occurrence is independently a C1-4 alkyl optionally substituted with deuterium, F, and / or OH, e.g., methyl, difluoromethyl, or hydroxymethyl.

[0156] In some embodiments, in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K- 1b-1, K-1b-2, K-1b-3, or K-1b-4), R2at each occurrence is independently a 5 or 6-membered heteroaryl, which is optionally substituted with 1-3 substituents each independently halogen, OH, CN, C1-4alkyl, C1-4alkoxy, or a 3-5 membered carbocyclic or heterocyclic ring, wherein the C1-4 alkyl or C1-4 alkoxy is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F), OH, C1-4alkoxy, or a 3-5 membered carbocyclic or heterocyclic ring, wherein each of the 3-5 membered carbocyclic or heterocyclic ring, when present, is independently optionally substituted with deuterium, F, OH, and / or methyl.

[0157] In some embodiments, in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K- 1b-1, K-1b-2, K-1b-3, or K-1b-4), R2at each occurrence is independently -(C1-4alkylene)- C(O)NHGA, -(C1-4 alkylene)-C(O)N(GA)(GB) or -(C1-4 alkylene)-CN, wherein GAand GBare defined herein. For example, in some embodiments, GAand GBare each independently a C1-4alkyl optionally substituted with deuterium, F and / or OH. In some embodiments, GAand GB, together with the nitrogen atom they are both attached to, are joined to form a 4-8 membered heterocyclic ring, which is optionally substituted as described herein.

[0158] R1in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, or K-1b-4) is typically an optionally substituted phenyl or heteroaryl. For example, in some embodiments, R1is a phenyl, pyridinyl, pyrimidinyl, benzopyrazolyl, benzimidazolyl, imidazolyl, pyridazyl, imidazo[l,2-a]pyrimidinyl, oxazolo[4,5-b]pyridinyl, oxazolo[5,4- b]pyridinyl, thiazolo[4,5-b]pyridinyl, benzo[d]thiazole, indazolyl, [l,2,4]triazolo[l,5-a]pyrimidinyl, [l,2,4]triazolo[l,5-b] or tetrazolo[l,5-a]pyridinyl, each of which is optionally substituted.

[0159] In some embodiments, in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K- 1b-1, K-1b-2, K-1b-3, or K-1b-4), R1is a phenyl or pyridinyl, each of which is optionally substituted with 1-3 substituents independently selected from: deuterium, halogen, CN, OH, NH2, COOH, CONH2, (C1-4 alkylene)-CN, GC, or Xc-Xd-GC, wherein: Xcat each occurrence is independently null, C1-4 alkylene, or C1-4 heteroalkylene; Xdat each occurrence is independently null, O, NH, N(GD), C(O), C(O)O, C(O)NH, C(O)N(GD), NHC(O), N(GD)C(O), P(O)(GD), SO2, SO2NH, or SO2N(GD); and GCat each occurrence is independently: (i) C1-6 alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4alkoxy, or a 3-6 membered ring; (ii) C1-6 heteroalkyl optionally substituted with one or more (e.g., 1-3) substituents independently deuterium, halogen, C1-4alkyl, C1-4alkoxy, or a 3-6 membered ring; (iii) a 3-7 membered carbocyclic or heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, oxo, OH, CN, C1-4 alkyl, C1-4 alkoxy, or a 3-6 membered ring; or (iv) a 5 or 6-membered heteroaryl, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, CN, C1-4alkyl, C1-4 alkoxy, or a 3-6 membered ring (preferably carbocyclic or heterocyclic ring), wherein the C1-4 alkyl or C1-4 alkoxy in each of (i)-(iv) is independently optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy, or a 3-4 membered carbocyclic or heterocyclic ring, and wherein each of the 3-6 membered ring in each of (i)-(iv) is independently optionally substituted with oxo, deuterium, halogen, OH, CN, C1-4 alkyl optionally substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F;GDat each occurrence is 6 alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4alkoxy optionally substituted with deuterium or F, or a 3-6 membered ring optionally substituted with oxo, deuterium, halogen, OH, CN, C1-4alkyl optionally substituted with deuterium or F, or C1-4alkoxy optionally substituted with deuterium or F, or when applicable, GCand GDtogether with the heteroatom they are both attached to are joined to form a 4-7 membered heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently halogen, oxo, OH, C1-4alkyl optionally substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F.

[0160] In some embodiments, in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K- 1b-1, K-1b-2, K-1b-3, or K-1b-4), R1can be a phenyl or pyridinyl, each of which is optionally substituted with one or more (e.g., 1-3) substituents independently selected from halogen, C1-6 alkyl optionally substituted with deuterium, F, CN, and / or OH, C1-6 alkoxy optionally substituted with deuterium, F, CN, and / or OH, C3-6cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-4 alkyl), or N(C1-4 alkyl)(C1-4alkyl).

[0161] In some embodiments, in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K- 1b-1, K-1b-2, K-1b-3, or K-1b-4), R1can be a phenyl or pyridinyl, each of which is optionally substituted with one or more (e.g., 1-3) substituents independently selected from halogen, C1-4 alkyl optionally substituted with deuterium, F and / or OH, C1-4 alkoxy optionally substituted with deuterium or F, C3-4cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-3 alkyl), or N(C1-3 alkyl)(C1-3 alkyl).

[0162] In some embodiments, in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K- 1b-1, K-1b-2, K-1b-3, or K-1b-4), R1can be a phenyl or pyridinyl, each of which is optionally substituted with 1-3 substituents independently selected from methyl, ethyl, fluoro, chloro, bromo, trifluoromethyl, difluoromethyl, methoxy, ethoxy, difluoromethoxy, trifluoromethoxy, cyclopropyl, -NH2, hydroxymethyl, and 1-hydroxyethyl, preferably, thesubstituents are independently selected fluoro, chloro, trifluoromethyl, difluoromethyl, methoxy, ethoxy, difluoromethoxy, and cyclopropyl.

[0163] In some embodiments, in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K- ,6 and / or OH, C3-6 cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-4alkyl), or N(C1-4alkyl)(C1-4alkyl).

[0164] For example, in some embodiments, the compound of Formula K can be characterized as having a structure according to Formula K-3a or K-3b:wherein the variables are defined and preferred herein.

[0165] In some embodiments, the compound of Formula K can be characterized as having a structure according to Formula K-5a or K-5b:wherein the variables are defined and preferred herein.

[0166] In some embodiments, in any of the applicable formulae or a partial structure, e.g., in Formula K-3a, K-3b, K-5a, or K-5b, R1aand R1bcan each independently be selected from methyl, ethyl, fluoro, chloro, bromo, trifluoromethyl, difluoromethyl, methoxy, ethoxy, difluoromethoxy, trifluoromethoxy, cyclopropyl, -NH2, hydroxymethyl, and 1-hydroxyethyl.

[0167] In some embodiments, in any of the applicable formulae or a partial structure, e.g., in Formula K-3a, K-3b, K-5a, or K-5b, R1bcan be C1-4alkoxy optionally substituted with 1-3 deuterium or F, for example, methoxy, ethoxy, or difluoromethoxy.

[0168] In some embodiments, in any of the applicable formulae or a partial structure, e.g., in Formula K-3a, K-3b, K-5a, or K-5b, R1acan be (i) halogen (e.g., F or Cl); (ii) C1-4 alkyl optionally substituted with 1-3 deuterium or F, e.g., methyl, trifluoromethyl, difluoromethyl, etc.; or (iii) cyclopropyl or cyclobutyl, optionally substituted with methyl and / or F.

[0169] Ring A, R1, R2, and m in Formula K (e.g., any of the subformulae described herein, as applicable, such as Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K- 1b-1, K-1b-2, K-1b-3, K-1b-4, K-3a, K-3b, K-5a, or K-5b) can also have any of the definition described herein in connection with Formula A or its subformulae.

[0170] In some embodiments, the present disclosure provides compounds according to any of the following enumerated embodiments A1-A44:Embodiment A1. A compound A, or a pharmaceutically acceptable salt thereof:wherein: J1is S, O, N, CR10Aor NR10B; J2is C or N; J3is C or N; Z is N or CR10A, preferably, Z is N; provided that the 5-membered ring containing Z, J1, J2, and J3is a heteroaryl ring having 1-3 ring heteroatoms; Ring A is a phenyl ring or 5-10-membered heteroaryl ring having 1 to 4 ring heteroatoms independently selected from N, O, and S; Ring B is an optionally substituted 5-7 membered carbocyclic or heterocyclic ring, or an optionally substituted phenyl ring, or an optionally substituted 5 or 6-membered heteroaryl ring having 1-3 ring heteroatoms each independently N, S, or O; preferably, Ring B is an optionally substituted 6-membered heteroaryl ring having 1 or 2 ring nitrogen atoms; R1is an optionally substituted phenyl, optionally substituted naphthyl, an optionally substituted 3-10 membered carbocyclic, or an optionally substituted 5-10 membered heterocyclic or heteroaryl, preferably, R1is ortho to the amide group (-C(O)-NH-) shown in Formula A; the subscript m is an integer of 0-4, as valency permits; R2at each occurrence is independently deuterium, halogen, OH, NH2, CN, SF5, COOH, CONH2, SO2NH2, R20, OR20, SR20, N(R20)(R21), SO2R20, SO2N(R20)(R21), N(R21)SO2R20, COR20, COOR20, OC(O)R20,CON(R20)(R21), or N(R21)COR20, wherein R20at each occurrence is independently an optionally substituted C1-6 alkyl, an optionally substituted C2-6alkenyl, an optionally substituted C2-6alkynyl, an optionally substituted C1-6heteroalkyl, or an optionally substituted 3-10 membered ring structure; and R21at eachoccurrence is independently optionally substituted C1-6 alkyl, an optionally substituted C2-6alkenyl, an optionally substituted C2-6alkynyl, an optionally substituted C1-6 heteroalkyl, or an optionally substituted 3-10 membered ring structure; or as applicable, R20and R21together with the intervening atom (e.g., the nitrogen atom) or atoms are joined to form an optionally substituted 4-8 membered heterocyclic ring; wherein: R10Aat each occurrence is independently hydrogen, deuterium, halogen, CN, or a C1-3 alkyl optionally substituted with deuterium or F; and R10Bis hydrogen or a C1-3 alkyl optionally substituted with deuterium or F. Embodiment A2. The compound of Embodiment A1, or a pharmaceutically acceptable salt thereof, wherein J1is S, J2and J3are C, preferably, Z is N, J1is S, J2and J3are C. Embodiment A3. The compound of Embodiment A1, or a pharmaceutically acceptable salt thereof, wherein (i) Z is N; (ii) J1is CH; or (iii) Z is N and J1is CH. Embodiment A4. The compound of Embodiment A1 or 3, or a pharmaceutically acceptable salt thereof, wherein J2is C and J3is N. Embodiment A5. The compound of Embodiment A1 or 3, or a pharmaceutically acceptable salt thereof, wherein J3is C and J2is N. Embodiment A6. The compound of any of Embodiments A1-5, or a pharmaceutically acceptable salt thereof, wherein Ring B is a benzene, pyridine, pyridone (e.g., pyridin-2-one), pyrazine, pyridazine, or pyrimidine ring, each of which is optionally substituted. Embodiment A7. The compound of any of Embodiments A1-5, or a pharmaceutically acceptable salt thereof, wherein Ring B is a cyclohexene ring,Embodiment A8. The of Embodiments A1-5, or a pharmaceutically acceptable salt thereof, characterized as having a structure according to Formula I:wherein: J4is CR11or N; J5is CR12or N; J6is CR13Aor N, and J7is CR14or N; or J6is NR13Band J7is C(O); provided that the bicyclic ring containing J1, J2, J3, J4, J5, J6, and J7is a heteroaryl ring having 1-4 ring heteroatoms in addition to the ring nitrogen atom shown in Formula I; R11, R12, R13A, and R14are each independently hydrogen, deuterium, halogen, OH, NH2, SF5, CN, or -Y1-Y2, wherein Y1is null, O, S, NH, NY3, C(O), SO2, C(O)NH, C(O)NY3, P(O)Y3, SO2NH, or SO2NY3, and each of Y2and Y3at each occurrence is independently an optionally substituted C1-6 alkyl, an optionally substituted C2-6 alkenyl, an optionally substituted C2-6 alkynyl, an optionally substituted C1-6 heteroalkyl, an optionally substituted 3-10 membered carbocyclic or heterocyclic ring, an optionally substituted phenyl, or an optionally substituted 5 or 6-membered heteroaryl; and R13Bis hydrogen, an optionally substituted C1-6alkyl, an optionally substituted C2-6alkenyl, an optionally substituted C2-6 alkynyl, an optionally substituted C1-6 heteroalkyl, an optionally substituted 3-10 membered carbocyclic or heterocyclic ring, an optionally substituted phenyl, or an optionally substituted 5 or 6-membered heteroaryl. Embodiment A9. The compound of Embodiment A8, or a pharmaceutically acceptable salt thereof, characterized as having a structure according to Formula I-1:Embodiment A10. The compound of Embodiment A8 or 9, or a pharmaceutically acceptable salt thereof, wherein J7is N. Embodiment A11. The compound of Embodiment A8 or 9, or a pharmaceutically acceptable salt thereof, wherein J4is N. Embodiment A12. The compound of Embodiment A8 or 9, or a pharmaceutically acceptable salt thereof, wherein J5is N. Embodiment A13. The compound of Embodiment A8 or 9, or a pharmaceutically acceptable salt thereof, wherein (i) J4is N, J5is CR12, and J7is CR14; (ii) J5is N, J4is CR11, and J7is CR14; or (iii) J7is N, J4is CR11, and J5is CR12. Embodiment A14. The compound of Embodiment A8 or 9, or a pharmaceutically acceptable salt thereof, wherein (i) J4and J7are both N, and J5is CR12, preferably CH; (ii) J4and J5are both N, and J7is CR14, preferably CH; or (iii) J4is CR11, preferably CH, and J5and J7are both N. Embodiment A15. The compound of any of Embodiments A8-14, or a pharmaceutically acceptable salt thereof, wherein as applicable, (i) when J5is CR12, R12is H; (ii) when J4is CR11, R11is H; and / or (iii) when J7is CR14, R14is H. Embodiment A16. The compound of any of Embodiments A8-15, or a pharmaceutically acceptable salt thereof, wherein J6is CR13A. Embodiment A17. The compound of Embodiment A8 or 9, or a pharmaceutically acceptable salt thereof, characterized as having a structure according to Formula I-1a, I-1b, I-1c, I-1d, I-1e, or I-1f:Embodiment A18. The compound of any of Embodiments A8-17, or a pharmaceutically acceptable salt thereof, wherein R13A, when present, is hydrogen, halogen (e.g., Cl, Br, etc.), CN, an optionally substituted C1-4 alkyl, an optionally substituted C2-4alkenyl, an optionally substituted C2-4alkynyl, an optionally substituted C1-4 heteroalkyl, SF5, an optionally substituted C3-7 cycloalkyl, or an optionally substituted 4-10 membered heterocyclic ring having 1-3 ring heteroatoms each independently N, O, or S, preferably, when substituted, the C1-4 alkyl, C2-4alkenyl, C2-4 alkynyl, C1-4 C3-7 cycloalkyl, or 4-10 membered heterocyclic ring, is substituted with one or more (e.g., 1-3) substituents each independently selected from deuterium, halogen (e.g., F), OH, SF5, CN, oxo, CONR30R31, N(R30)C(O)R31, SO2NR30R31, N(R30)SO2R31, SR31, OR31, SO2R31, C1-4alkyl optionally substituted with deuterium or F, or a 3-4 membered carbocyclic or heterocyclic ring (e.g., cyclopropyl, cyclobutyl, azetidinyl, oxetanyl, etc.) optionally substituted with deuterium, F, OH, and / or methyl, wherein each of R30and R31at each occurrence is independently hydrogen, C1-4alkyl optionally substituted with deuterium or F, or a 3- 6 membered carbocyclic or heterocyclic ring (e.g., cyclopropyl, cyclobutyl, azetidinyl, oxetanyl, etc.) optionally substituted with deuterium, F, OH, and / or methyl; or as applicable, R30and R31together with the intervening atom or atoms are joined to form an optionally substituted 4-8 membered heterocyclic ring (e.g., optionally substituted with deuterium, F, OH, and / or methyl); for example, R13Ais hydrogen, halogen (e.g., Cl or Br), CN, C1-4alkyl optionally substituted with deuterium or F (e.g., CF2H or CF3), cyclopropyl, C1-4 alkoxy optionally substituted with deuterium or F (e.g., OCF2H or OCF3), or a 4-10 membered heterocyclic ring having 1-3 ring heteroatoms each independently N, O, or S, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkyl optionally substituted with deuterium or F (e.g., CF2H or CF3), or C1-4alkoxy optionally substituted with deuterium or F (e.g., OCF2H or OCF3). Embodiment A19. The compound of any of Embodiments A8-17, or a pharmaceutically acceptable salt thereof, wherein R13A, when present, is an optionally substituted phenyl or optionally substituted 5 or 6-membered heteroaryl, preferably, when substituted, the phenyl or 5 or 6-membered heteroaryl is substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F, Cl, Br, etc.), CN, OH, NH2, SF5, G1, or -X1-X2-G1, wherein X1is null, C1-4alkylene or C1-4heteroalkylene, and X2is O, S, NH, NG1, C(O), SO2, C(O)NH, C(O)NG1, SO2NH, or SO2NG1, wherein G1at each occurrence is independently an optionally substituted C1-4alkyl, an optionally substituted C2-4 alkenyl, an optionally substituted C2-4 alkynyl, an optionally substituted C1-4heteroalkyl, an optionally substituted C3-6cycloalkyl, an optionally substituted 4-7 membered heterocyclic ring having 1 or 2 ring heteroatoms eachindependently N, O, or S, or an substituted 5 or 6-membered heteroaryl having 1-3 ring heteroatoms each independently N, O, or S, preferably, when substituted, the C1-4 alkyl, C2-4 alkenyl, C2-4 alkynyl, C1-4 heteroalkyl, C3-6cycloalkyl, 4-7 membered heterocyclic ring, or 5 or 6-membered heteroaryl is substituted with one or more (e.g., 1-3) substituents each independently selected from deuterium, halogen (e.g., F), OH, CN, oxo, C1-4alkyl optionally substituted with deuterium or F, C1-4 alkoxyl optionally substituted with deuterium or F, or a 3-4 membered carbocyclic or heterocyclic ring (e.g., cyclopropyl, cyclobutyl, azetidinyl, oxetanyl, etc.) optionally substituted with deuterium, F, OH, and / or methyl. Embodiment A20. The compound of any of Embodiments A8-17, or a pharmaceutically acceptable salt thereof, wherein R13A, when present, is an optionally substituted phenyl, pyrazolyl, pyridinyl, pyrimidinyl, pyridazinyl, or pyrazinyl, preferably, when substituted, the phenyl, pyrazolyl, pyridinyl, pyrimidinyl, pyridazinyl, or pyrazinyl is substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F, Cl, Br, etc.), CN, OH, SF5, SCF3, NH2, G2, NHG2, NG2G2, OG2, or SO2G2, wherein G2at each occurrence is independently an optionally substituted C1-4alkyl, an optionally substituted C3-6cycloalkyl, or an optionally substituted 4-7 membered heterocyclic ring having 1 or 2 ring heteroatoms each independently N, O, or S, preferably, when substituted, the C1-4alkyl, C3-6cycloalkyl, or 4-7 membered heterocyclic ring, is substituted with one or more (e.g., 1-3) substituents each independently selected from deuterium, halogen (e.g., F), OH, CN, oxo, C1-4 alkyl optionally substituted with deuterium or F, C1-4 alkoxyl optionally substituted with deuterium or F, or a 3-4 membered carbocyclic or heterocyclic ring (e.g., cyclopropyl, cyclobutyl, azetidinyl, oxetanyl, etc.) optionally substituted with deuterium, F, OH, and / or methyl. Embodiment A21. The compound of any of Embodiments A8-17, or a pharmaceutically acceptable salt thereof, wherein R13A, when present, is selected from the following: ,wherein n is an integer of 0- G3at each occurrence is independently deuterium, halogen (e.g., F or Cl), CN, C1-4alkyl, O-(C1-4 alkyl), SO2-(C1-4 alkyl), OH, NH2, NH(C1-4 alkyl), N(C1-4 alkyl)(C1-4 alkyl), 3-4 membered carbocyclic or heterocyclic ring, O-(3-4 membered carbocyclic or heterocyclic ring), (C1-4 alkylene)-(3-4 membered carbocyclic or heterocyclic ring) or O-(C1-4 alkylene)-(3-4 membered carbocyclic or heterocyclic ring), wherein each of the aforementioned C1-4 alkyl is independently optionally substituted with 1-7 deuterium or F, and wherein the C1-4 alkylene or 3-4 membered carbocyclic or heterocyclic ring is optionally substituted with one or more (e.g., 1-3) substituents independently deuterium, F, OH, or methyl, preferably, one instance of G3is C1-4 alkyl optionally substituted with 1-7 deuterium or F or C1-4 alkoxy optionally substituted with 1-7 deuterium or F, such as OCH3, OCF2H, OCF3, CF3, CH3, CF2H, or CH2CF3. Embodiment A22. The compound of any of Embodiments A8-17, or a pharmaceutically acceptable salt thereof, wherein R13A, when present, is a pyridinyl (e.g., 2-pyridinyl or 3-pyridinyl) substituted with 1 or 2 substituents independently selected from deuterium, halogen (e.g., F or Cl), CN, C1-4 alkyl, O-(C1-4 alkyl), SO2- (C1-4alkyl), OH, NH2, NH(C1-4alkyl), or N(C1-4alkyl)(C1-4alkyl), wherein each of the aforementioned C1-4 alkyl is independently optionally substituted with 1-7 deuterium or F, for example, R13Acan be selected from the following:, OCF3, SO2CH3, NH2, CN, Cl, isopropyl, CF3, CH3, CF2H, or CH2CF3, and optionally a further substituent selected from F or Cl. Embodiment A23. The compound of any of Embodiments A8-17, or a pharmaceutically acceptable salt thereof, wherein R13A, when present, is a phenyl, pyrimidinyl, pyridazinyl, or pyrazinyl, which is substituted with 1 or 2 substituents independently selected from deuterium, halogen (e.g., F or Cl), CN, C1-4 alkyl, O-(C1-4 alkyl), SO2-(C1-4alkyl), OH, NH2, NH(C1-4alkyl), or N(C1-4alkyl)(C1-4alkyl), wherein each of the aforementioned C1-4 alkyl is independently optionally substituted with 1-7 deuterium or F, for example, R13Acan be selected from the following: .any or a pharmaceutically acceptable salt thereof, wherein R13A, when present, is a pyrazolyl, optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F, Cl, Br, etc.), C1-4alkyl, 3-4 membered carbocyclic or heterocyclic ring, or (C1-4 alkylene)-(3-4 membered carbocyclic or heterocyclic ring),wherein the C1-4 alkyl, C1-4 3-4 membered carbocyclic or heterocyclic ring is optionally substituted with one or more (e.g., 1-3) substituents independently deuterium, F, OH, or methyl, for example, R13Acan be selected from the following: .pharmaceutically acceptable salt thereof, wherein R13A, when present, is a 5-7 membered heterocyclic ring, such as a tetrahydropyranyl, piperidinyl, piperazinyl, morpholinyl, etc., which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F, Cl, Br, etc.), oxo, C1-4 alkyl, 3-4 membered carbocyclic or heterocyclic ring, or (C1-4 alkylene)-(3-4 membered carbocyclic or heterocyclic ring), wherein the C1-4 alkyl, C1-4 alkylene, or 3-4 membered carbocyclic or heterocyclic ring is optionally substituted with one or more (e.g., 1-3) substituents independently deuterium, F, OH, or methyl, for example, R13Acan be selected from the following: F F .pharmaceutically acceptable salt thereof, wherein ring A is a phenyl ring or a 5 or 6- membered heteroaryl having 1 to 3 ring heteroatoms independently selected from N, O, and S, such as pyridine ring. Embodiment A27. The compound of any of Embodiments A1-25, or a pharmaceutically acceptable salt thereof, wherein ring A is a phenyl, pyridinyl, pyrimidinyl, or imidazo[1,2-a]pyridinyl ring, preferably, a phenyl or pyridinyl ring. Embodiment A28. The compound of any of Embodiments A1-25, or a pharmaceutically acceptable salt thereof, characterized as having a structure according to Formula A1, A2, or A3:Embodiment A29. The compound of any of Embodiments A1-28, or a pharmaceutically acceptable salt thereof, wherein m is 0, 1, or 2, and R2at each occurrence is independently deuterium, halogen, CN, OH, (C1-4 alkylene)-CN, GA, or Xa-Xb-GA, wherein: Xaat each occurrence is independently null, C1-4alkylene, or C1-4heteroalkylene; Xbat each occurrence is independently null, O, NH, N(GB), C(O), C(O)O, C(O)NH, C(O)N(GB), NHC(O), N(GB)C(O), SO2, SO2NH, or SO2N(GB); and GAat each occurrence is independently: (i) C1-6alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy, or a 3-6 membered ring; (ii) C1-6heteroalkyl optionally substituted with one or more (e.g., 1-3) substituents independently deuterium, halogen, C1-4 alkyl, C1-4 alkoxy, or a 3-6 membered ring; (iii) a 3-7 membered carbocyclic or heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, oxo, OH, CN, C1-4 alkyl, C1-4 alkoxy, or a 3-6 membered ring; or(iv) a 5 or 6-membered which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, CN, C1-4alkyl, C1-4 alkoxy, or a 3-6 membered ring (preferably carbocyclic or heterocyclic ring), wherein the C1-4 alkyl or C1-4 alkoxy in each of (i)-(iv) is independently optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy, or a 3-4 membered carbocyclic or heterocyclic ring, and wherein each of the 3-6 membered ring in each of (i)-(iv) is independently optionally substituted with one or more (e.g., 1-3) substituents each independently oxo, deuterium, halogen, OH, CN, C1-4 alkyl optionally substituted with deuterium or F, or C1-4alkoxy optionally substituted with deuterium or F; GBat each occurrence is independently C1-6 alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4alkoxy optionally substituted with deuterium or F, or a 3-6 membered ring optionally substituted with oxo, deuterium, halogen, OH, CN, C1-4alkyl optionally substituted with deuterium or F, or C1-4alkoxy optionally substituted with deuterium or F, or when applicable, GAand GBare joined to form a 4-7 membered heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently halogen, oxo, OH, C1-4alkyl optionally substituted with F, or C1-4alkoxy optionally substituted with F. Embodiment A30. The compound of Embodiment A29, or a pharmaceutically acceptable salt thereof, wherein m is 0. Embodiment A31. The compound of Embodiment A29, or a pharmaceutically acceptable salt thereof, wherein m is 1. Embodiment A32. The compound of Embodiment A31, or a pharmaceutically acceptable salt thereof, wherein the compound is characterized as having a structure according to Formula A1a or A2a:Embodiment A33. The compound of Embodiment A31 or 32, or a pharmaceutically acceptable salt thereof, wherein R2is a C1-4 alkyl optionally substituted with deuterium, F, and / or OH, e.g., methyl, difluoromethyl, or hydroxymethyl. Embodiment A34. The compound of Embodiment A31 or 32, or a pharmaceutically acceptable salt thereof, wherein R2is a 5 or 6-membered heteroaryl, which is optionally substituted with 1-3 substituents each independently halogen, OH, CN, C1-4 alkyl, C1-4 alkoxy, or a 3-5 membered carbocyclic or heterocyclic ring, wherein the C1-4 alkyl or C1-4 alkoxy is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F), OH, C1-4 alkoxy, or a 3-5 membered carbocyclic or heterocyclic ring, wherein each of the 3-5 membered carbocyclic or heterocyclic ring, when present, is independently optionally substituted with deuterium, F, OH, and / or methyl. Embodiment A35. The compound of Embodiment A31 or 32, or a pharmaceutically acceptable salt thereof, wherein R2is -(C1-4alkylene)-C(O)NHGA, -(C1-4alkylene)- C(O)N(GA)(GB) or -(C1-4 alkylene)-CN, preferably, GAand GBare each independently a C1-4alkyl optionally substituted with deuterium, F and / or OH. Embodiment A36. The compound of any of Embodiments A1-35, or a pharmaceutically acceptable salt thereof, wherein R1is a phenyl, pyridinyl, pyrimidinyl, benzopyrazolyl, benzimidazolyl, imidazolyl, pyridazyl, imidazo[l,2- a]pyrimidinyl, oxazolo[4,5-b]pyridinyl, oxazolo[5,4-b]pyridinyl, thiazolo[4,5- b]pyridinyl, benzo[d]thiazole, indazolyl, [l,2,4]triazolo[l,5-a]pyrimidinyl, [l,2,4]triazolo[l,5-b]pyridazinyl, or tetrazolo[l,5-a]pyridinyl, each of which is optionally substituted. Embodiment A37. The compound of any of Embodiments A1-35, or a pharmaceutically acceptable salt thereof, wherein R1is a phenyl or pyridinyl, each ofwhich is optionally substituted 3 substituents independently selected from: deuterium, halogen, CN, OH, NH2, COOH, CONH2, (C1-4alkylene)-CN, GC, or Xc- Xd-GC, wherein: Xcat each occurrence is independently null, C1-4 alkylene, or C1-4 heteroalkylene; Xdat each occurrence is independently null, O, NH, N(GD), C(O), C(O)O, C(O)NH, C(O)N(GD), NHC(O), N(GD)C(O), P(O)(GD), SO2, SO2NH, or SO2N(GD); and GCat each occurrence is independently: (i) C1-6 alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4alkoxy, or a 3-6 membered ring; (ii) C1-6 heteroalkyl optionally substituted with one or more (e.g., 1-3) substituents independently deuterium, halogen, C1-4alkyl, C1-4alkoxy, or a 3-6 membered ring; (iii) a 3-7 membered carbocyclic or heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, oxo, OH, CN, C1-4 alkyl, C1-4 alkoxy, or a 3-6 membered ring; or (iv) a 5 or 6-membered heteroaryl, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, CN, C1-4alkyl, C1-4 alkoxy, or a 3-6 membered ring (preferably carbocyclic or heterocyclic ring), wherein the C1-4 alkyl or C1-4 alkoxy in each of (i)-(iv) is independently optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy, or a 3-4 membered carbocyclic or heterocyclic ring, and wherein each of the 3-6 membered ring in each of (i)-(iv) is independently optionally substituted with oxo, deuterium, halogen, OH, CN, C1-4alkyl optionally substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F; GDat each occurrence is independently C1-6 alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy optionally substituted with deuterium or F, or a 3-6 membered ring optionally substituted with oxo,deuterium, halogen, OH, CN, C1-4 substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F, or when applicable, GCand GDtogether with the heteroatom they are both attached to are joined to form a 4-7 membered heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently halogen, oxo, OH, C1-4 alkyl optionally substituted with deuterium or F, or C1-4alkoxy optionally substituted with deuterium or F. Embodiment A38. The compound of any of Embodiments A1-35, or a pharmaceutically acceptable salt thereof, wherein R1is a phenyl or pyridinyl, each of which is optionally substituted with one or more (e.g., 1-3) substituents independently selected from halogen, C1-6alkyl optionally substituted with deuterium, F, CN, and / or OH, C1-6 alkoxy optionally substituted with deuterium, F, CN, and / or OH, C3-6 cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-4 alkyl), or N(C1-4 alkyl)(C1-4 alkyl). Embodiment A39. The compound of any of Embodiments A1-35, or a pharmaceutically acceptable salt thereof, wherein R1is a phenyl or pyridinyl, each of which is optionally substituted with one or more (e.g., 1-3) substituents independently selected from halogen, C1-4alkyl optionally substituted with deuterium, F and / or OH, C1-4 alkoxy optionally substituted with deuterium or F, C3-4 cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-3alkyl), or N(C1-3alkyl)(C1-3 alkyl). Embodiment A40. The compound of any of Embodiments A1-35, or a pharmaceutically acceptable salt thereof, wherein R1is a phenyl or pyridinyl, each of which is optionally substituted with 1-3 substituents independently selected from methyl, ethyl, fluoro, chloro, bromo, trifluoromethyl, difluoromethyl, methoxy, ethoxy, difluoromethoxy, trifluoromethoxy, cyclopropyl, -NH2, hydroxymethyl, and 1-hydroxy ethyl, preferably, the substituents are independently selected from methyl, fluoro, chloro, trifluoromethyl, difluoromethyl, methoxy, ethoxy, difluoromethoxy, and cyclopropyl.Embodiment A41. The of Embodiments A1-35, or a pharmaceutically acceptable salt thereof, characterized as having a structure according to Formula A1b, A1c, A2b or A2c:wherein R1aand R1bare each independently halogen, C1-6 alkyl optionally substituted with deuterium, F, CN, and / or OH, C1-6 alkoxy optionally substituted with deuterium, F, CN, and / or OH, C3-6 cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-4 alkyl), or N(C1-4 alkyl)(C1-4 alkyl). Embodiment A42. The compound of Embodiment A41, or a pharmaceutically acceptable salt thereof, wherein R1aand R1bare each independently selected from methyl, ethyl, fluoro, chloro, bromo, trifluoromethyl, difluoromethyl, methoxy, ethoxy, difluoromethoxy, trifluoromethoxy, cyclopropyl, -NH2, hydroxymethyl, and 1-hydroxy ethyl, more preferably, R1aand R1bare each independently selected from methyl, fluoro, chloro, trifluoromethyl, difluoromethyl, methoxy, ethoxy, difluoromethoxy, trifluoromethoxy, and cyclopropyl. Embodiment A43. The compound of Embodiment A41, or a pharmaceutically acceptable salt thereof, wherein R1bis C1-2 alkoxy optionally substituted with 1-3 deuterium or F, preferably, R1bis methoxy, ethoxy, or difluoromethoxy. Embodiment A44. The compound of any of Embodiments A41-43, or a pharmaceutically acceptable salt thereof, wherein R1ais halogen, C1-3 alkyl optionallysubstituted with 1-3 deuterium cyclopropyl, preferably, R1ais methyl, fluoro, chloro, trifluoromethyl, difluoromethyl, or cyclopropyl.

[0171] In some embodiments, the present disclosure also provides a compound selected from Table 1 below, a deuterated analog thereof, a stereoisomer thereof, or a pharmaceutically acceptable salt thereof:Fsome applicable, the genus of compounds described herein also excludes any specifically known single compounds prior to this disclosure. In some embodiments, to the extent applicable, any sub-genus or species of compounds prior to this disclosure that are entirely within a genus of compounds described herein can also be excluded from such genus herein. Method of Synthesis

[0173] The compounds of the present disclosure can be readily synthesized by those skilled in the art in view of the present disclosure. Exemplified syntheses are also shown in the Examples section.

[0174] As will be apparent to those skilled in the art, conventional protecting groups may be necessary to prevent certain functional groups from undergoing undesired reactions. Suitable protecting groups for various functional groups as well as suitable conditions for protecting and deprotecting particular functional groups are well known in the art. For example, numerous protecting groups are described in “Protective Groups in Organic Synthesis”, 4thed. P. G. M. Wuts; T. W. Greene, John Wiley, 2007, and references cited therein. The reagents for the reactions described herein are generally known compounds or can be prepared by known procedures or obvious modifications thereof. For example, many of the reagents are available from commercial suppliers such as Sigma-Aldrich (Milwaukee, Wisconsin, USA). Others may be prepared by procedures, or obvious modifications thereof, described in standard reference texts such as Fieser and Fieser's Reagents for Organic Synthesis, Volumes 1-15 (John Wiley and Sons, 1991), Rodd's Chemistry of Carbon Compounds, Volumes 1-5 and Supplemental (Elsevier Science Publishers, 1989), Organic Reactions, Volumes 1-40 (John Wiley and Sons, 1991), March's Advanced Organic Chemistry, (Wiley, 7thEdition), and Larock's Comprehensive Organic Transformations (Wiley-VCH, 1999), and any of available updates as of this filing.Pharmaceutical Compositions

[0175] Certain embodiments are directed to a pharmaceutical composition comprising one or more compounds of the present disclosure.

[0176] The pharmaceutical composition can optionally contain a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition comprises a compound of the present disclosure (e.g., a compound of Formula A (e.g., Formula I, I-1, I- 1a, I-1b, I-1c, I-1d, I-1e, I-1f, I-1g, II, II-1, III, III-1, A1, A2, A3, A1a, A1b, A1c, A2a, A2b, A2c, A2b-1, A2b-2, A2b-3, A2b-4, A2b-5, or A2b-6), Formula K (e.g., Formula K-1, K-2, K- 3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, K-1b-4, K-3a, K-3b, K-5a, or K-5b), any of Examples 1-145, any of the compounds listed in Table 1 herein, or a pharmaceutically acceptable salt thereof) and a pharmaceutically acceptable excipient. Pharmaceutically acceptable excipients are known in the art. Non-limiting suitable excipients include, for example, encapsulating materials or additives such as antioxidants, binders, buffers, carriers, coating agents, coloring agents, diluents, disintegrating agents, emulsifiers, extenders, fillers, flavoring agents, humectants, lubricants, perfumes, preservatives, propellants, releasing agents, sterilizing agents, sweeteners, solubilizers, wetting agents and mixtures thereof. See also Remington's The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, Md., 2005; incorporated herein by reference), which discloses various excipients used in formulating pharmaceutical compositions and known techniques for the preparation thereof.

[0177] The pharmaceutical composition can include any one or more of the compounds of the present disclosure. For example, in some embodiments, the pharmaceutical composition comprises a compound of Formula A or a pharmaceutically acceptable salt thereof, e.g., in a therapeutically effective amount. In any of the embodiments described herein, the pharmaceutical composition can comprise a therapeutically effective amount (e.g., for treating a cancer herein) of a compound selected from any of Examples 1-145, or any of the specific compounds disclosed in Table 1 herein, or a pharmaceutically acceptable salt thereof. In some preferred embodiments, the pharmaceutical composition can comprise a compound selected from the compounds according to Examples 1-145 that have an IC50value less than 100 nM, more preferably, less than 50 nM, as measured according to Biological Example 1.

[0178] The pharmaceutical can be formulated for delivery via any of the known routes of delivery, which include but not limited to administering orally, nasally, transdermally, pulmonary, inhalationally, buccally, sublingually, intraperitoneally, subcutaneously, intramuscularly, intravenously, rectally, intrapleurally, intrathecally or parenterally.

[0179] In some embodiments, the pharmaceutical composition can be formulated for oral administration. The oral formulations can be presented in discrete units, such as capsules, pills, cachets, lozenges, or tablets, each containing a predetermined amount of the active compound; as a powder or granules; as a solution or a suspension in an aqueous or non- aqueous liquid; or as an oil-in-water or water-in-oil emulsion. Excipients for the preparation of compositions for oral administration are known in the art. Non-limiting suitable excipients include, for example, agar, alginic acid, aluminum hydroxide, benzyl alcohol, benzyl benzoate, 1,3-butylene glycol, carbomers, castor oil, cellulose, cellulose acetate, cocoa butter, corn starch, corn oil, cottonseed oil, cross-povidone, diglycerides, ethanol, ethyl cellulose, ethyl laureate, ethyl oleate, fatty acid esters, gelatin, germ oil, glucose, glycerol, groundnut oil, hydroxypropylmethyl cellulose, isopropanol, isotonic saline, lactose, magnesium hydroxide, magnesium stearate, malt, mannitol, monoglycerides, olive oil, peanut oil, potassium phosphate salts, potato starch, povidone, propylene glycol, Ringer's solution, safflower oil, sesame oil, sodium carboxymethyl cellulose, sodium phosphate salts, sodium lauryl sulfate, sodium sorbitol, soybean oil, stearic acids, stearyl fumarate, sucrose, surfactants, talc, tragacanth, tetrahydrofurfuryl alcohol, triglycerides, water, and mixtures thereof.

[0180] In some embodiments, the pharmaceutical composition is formulated for parenteral administration (such as intravenous injection or infusion, subcutaneous or intramuscular injection). The parenteral formulations can be, for example, an aqueous solution, a suspension, or an emulsion. Excipients for the preparation of parenteral formulations are known in the art. Non-limiting suitable excipients include, for example, 1,3- butanediol, castor oil, corn oil, cottonseed oil, dextrose, germ oil, groundnut oil, liposomes, oleic acid, olive oil, peanut oil, Ringer's solution, safflower oil, sesame oil, soybean oil, U.S.P. or isotonic sodium chloride solution, water and mixtures thereof.

[0181] Compounds of the present disclosure can be used alone, in combination with each other, or in combination with one or more additional therapeutic agents, e.g., in combinationwith an additional anticancer therapeutic such as a PARP inhibitor, a signal transduction inhibitor, a chemotherapeutic agent, and / or an immune checkpoint inhibitor.

[0182] When used in combination with one or more additional therapeutic agents, compounds of the present disclosure or pharmaceutical compositions herein can be administered to the subject either concurrently or sequentially in any order with such additional therapeutic agents. In some embodiments, the pharmaceutical composition can comprise one or more compounds of the present disclosure and the one or more additional therapeutic agents in a single composition. In some embodiments, the pharmaceutical composition comprising one or more compounds of the present disclosure can be included in a kit which also comprises a separate pharmaceutical composition comprising the one or more additional therapeutic agents.

[0183] The pharmaceutical composition can include various amounts of the compounds of the present disclosure, depending on various factors such as the intended use and potency and selectivity of the compounds. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of a compound of the present disclosure. In some embodiments, the pharmaceutical composition comprises a therapeutically effective amount of the compound of the present disclosure and a pharmaceutically acceptable excipient. As used herein, a therapeutically effective amount of a compound of the present disclosure is an amount effective to treat a disease or disorder as described herein, such as a cancer herein, which can depend on the recipient of the treatment, the disorder, condition or disease being treated and the severity thereof, the composition containing the compound, the time of administration, the route of administration, the duration of treatment, the compound potency, its rate of clearance and whether or not another drug is co-administered. Method of Treatment / Use

[0184] Compounds of the present disclosure have various utilities. For example, compounds of the present disclosure can be used as therapeutic active substances for the treatment and / or prophylaxis of a disease or disorder associated with Polθ, such as overexpression of Polθ. Accordingly, some embodiments of the present disclosure are also directed to methods of using one or more compounds of the present disclosure or pharmaceutical compositions herein for treating or preventing a disease or disorder associated with Polθ in a subject in need thereof, such as for treating cancer in a subject in need thereof.

[0185] In some embodiments, the disclosure provides a method of inhibiting Polθ enzyme activity, e.g., DNA repair activity mediated by Polθ, in a cell, the method comprising contacting the cell with an effective amount of the compound of present disclosure (e.g., a compound of Formula A (e.g., Formula I, I-1, I-1a, I-1b, I-1c, I-1d, I-1e, I-1f, I-1g, II, II-1, III, III-1, A1, A2, A3, A1a, A1b, A1c, A2a, A2b, A2c, A2b-1, A2b-2, A2b-3, A2b-4, A2b-5, or A2b-6), Formula K (e.g., Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K-1b- 1, K-1b-2, K-1b-3, K-1b-4, K-3a, K-3b, K-5a, or K-5b), any of Examples 1-145, any of the compounds listed in Table 1 herein, or a pharmaceutically acceptable salt thereof). In some embodiment, contacting the cell occurs in vitro. In some embodiment, contacting the cell occurs in vivo. In some embodiments, the cell is a cancer cell. In some embodiments, the cell is an HR deficient cell. In some embodiments, the cancer cell has overexpression of Polθ. The cancer cell can be a cell of any of the cancer described herein.

[0186] In some embodiments, the present disclosure provides a method of inhibiting cell proliferation, in vitro or in vivo, the method comprising contacting the cell with an effective amount of the compound of present disclosure (e.g., a compound of Formula A (e.g., Formula I, I-1, I-1a, I-1b, I-1c, I-1d, I-1e, I-1f, I-1g, II, II-1, III, III-1, A1, A2, A3, A1a, A1b, A1c, A2a, A2b, A2c, A2b-1, A2b-2, A2b-3, A2b-4, A2b-5, or A2b-6), Formula K (e.g., Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, K-1b-4, K-3a, K- 3b, K-5a, or K-5b), any of Examples 1-145, any of the compounds listed in Table 1 herein, or a pharmaceutically acceptable salt thereof). In some embodiments, the cell is a cancer cell. In some embodiments, the cell is an HR deficient cell. In some embodiments, the cancer cell has overexpression of Polθ. The cancer cell can be a cell of any of the cancer described herein.

[0187] In some embodiments, the present disclosure provides a method of treating a disease or disorder associated with Polθ in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the compound of present disclosure (e.g., a compound of Formula A (e.g., Formula I, I-1, I-1a, I-1b, I-1c, I-1d, I-1e, I- 1f, I-1g, II, II-1, III, III-1, A1, A2, A3, A1a, A1b, A1c, A2a, A2b, A2c, A2b-1, A2b-2, A2b- 3, A2b-4, A2b-5, or A2b-6), Formula K (e.g., Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, K-1b-4, K-3a, K-3b, K-5a, or K-5b), any of Examples 1-145, any of the compounds listed in Table 1 herein, or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition as defined herein. In some embodiments, thedisease or disorder associated with Polθ described herein. In some embodiments, the disease or disorder associated with Polθ is characterized by an overexpression of Polθ. In some embodiments, the cancer is a homologous recombination (HR) deficient cancer. In some embodiments, the cancer is characterized by a reduction or absence of BRCA gene expression, the absence of the BRAC gene, or reduced function of BRCA protein. In some embodiments, the cancer is resistant to poly(ADP-ribose) polymerase (PARP) inhibitor therapy. In some embodiments, the cancer is selected from lymphoma, rhabdoid tumor, multiple myeloma, uterine cancer, gastric cancer, peripheral nervous system cancer, rhabdomyosarcoma, bone cancer, colorectal cancer, mesothelioma, breast cancer, ovarian cancer, lung cancer, fibroblast cancer, central nervous system cancer, urinary tract cancer, upper aerodigestive cancer, leukemia, kidney cancer, skin cancer, esophageal cancer, and pancreatic cancer.

[0188] In some embodiments, the present disclosure provides a method of treating a homologous recombination (HR) deficient cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the compound of present disclosure (e.g., a compound of Formula A (e.g., Formula I, I-1, I-1a, I-1b, I-1c, I- 1d, I-1e, I-1f, I-1g, II, II-1, III, III-1, A1, A2, A3, A1a, A1b, A1c, A2a, A2b, A2c, A2b-1, A2b-2, A2b-3, A2b-4, A2b-5, or A2b-6), Formula K (e.g., Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, K-1b-4, K-3a, K-3b, K-5a, or K-5b), any of Examples 1-145, any of the compounds listed in Table 1 herein, or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition as defined herein. In some embodiments, the HR-deficient cancer is breast cancer. Breast cancer includes, but is not limited to, lobular carcinoma in situ (LCIS), a ductal carcinoma in situ (DCIS), an invasive ductal carcinoma (IDC), inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, Angiosarcoma, adenoid cystic carcinoma, low-grade adenosquamous carcinoma, medullary carcinoma, mucinous carcinoma, papillary carcinoma, tubular carcinoma, metaplastic carcinoma, micropapillary carcinoma, mixed carcinoma, or another breast cancer, including but not limited to triple negative, HER positive, estrogen receptor positive, progesterone receptor positive, HER and estrogen receptor positive, HER and progesterone receptor positive, estrogen and progesterone receptor positive, and HER and estrogen and progesterone receptor positive. In some embodiments, the HR-deficient cancer is ovarian cancer. Ovarian cancer includes, but is not limited to, epithelial ovarian carcinomas (EOC),maturing teratomas, dysgerminomas, sinus tumors, granulosa-theca tumors, Sertoli-Leydig cell tumors, and primary peritoneal carcinoma.

[0189] In some embodiments, the present disclosure provides a method of treating a cancer in a subject in need thereof, wherein the cancer is characterized by a reduction or absence of BRCA gene expression, the absence of the BRCA gene, and / or reduced function of BRCA protein, the method comprising administering to the subject a therapeutically effective amount of the compound of present disclosure (e.g., a compound of Formula A (e.g., Formula I, I-1, I-1a, I-1b, I-1c, I-1d, I-1e, I-1f, I-1g, II, II-1, III, III-1, A1, A2, A3, A1a, A1b, A1c, A2a, A2b, A2c, A2b-1, A2b-2, A2b-3, A2b-4, A2b-5, or A2b-6), Formula K (e.g., Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, K-1b-4, K-3a, K-3b, K-5a, or K-5b), any of Examples 1-145, any of the compounds listed in Table 1 herein, or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition as defined herein.

[0190] In some embodiments, the present disclosure provides a method of treating a cancer in a subject in need thereof, wherein the cancer is resistant to poly(ADP-ribose) polymerase (PARP) inhibitor therapy, the method comprising administering to the subject a therapeutically effective amount of the compound of present disclosure (e.g., a compound of Formula A (e.g., Formula I, I-1, I-1a, I-1b, I-1c, I-1d, I-1e, I-1f, I-1g, II, II-1, III, III-1, A1, A2, A3, A1a, A1b, A1c, A2a, A2b, A2c, A2b-1, A2b-2, A2b-3, A2b-4, A2b-5, or A2b-6), Formula K (e.g., Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, K-1b-4, K-3a, K-3b, K-5a, or K-5b), any of Examples 1-145, any of the compounds listed in Table 1 herein, or a pharmaceutically acceptable salt thereof), or a pharmaceutical composition as defined herein. In some embodiments, the cancer resistant to PARP inhibitor therapy is selected from breast cancer, ovarian cancer, lung cancer, bladder cancer, liver cancer, head and neck cancer, pancreatic cancer, gastrointestinal cancer, and colorectal cancer. As used herein and unless otherwise specified, the phrase “cancer resistant to PARP inhibitor therapy” means that the cancer is not responding to a PARP inhibitor or that the cancer is not responding sufficiently to the PARP inhibitor or that the cancer has progressed on or after treatment with the PARP inhibitor. For example, in some cases, the subject having the cancer may at one time be responsive to the PARP inhibitor but has become no longer responsive to such treatment or is no longer responding sufficiently to such treatment.

[0191] The compound of the present can be used alone, in combination with a different Polθ inhibitor, or in combination with other active agents or other prophylactic or therapeutic modalities. In some embodiments, the compound of the present disclosure can be used in a combination therapy, such as in combination with one or more active therapeutic agents (e.g., chemotherapeutic agents) or other prophylactic or therapeutic modalities (e.g., radiation). In such combination therapy, the various active agents frequently have different, complementary mechanisms of action. Such combination therapy may be especially advantageous by allowing a dose reduction of one or more of the agents, thereby reducing or eliminating the adverse effects associated with one or more of the agents.

[0192] In some embodiments, the compound of the present disclosure is administered in combination with at least one additional therapeutic agent, such as a PARP inhibitor, a signal transduction inhibitor, a chemotherapeutic agent, and / or an immune checkpoint inhibitor.

[0193] In some embodiments, the additional therapeutic agent is a signal transduction inhibitor (STI) or chemotherapeutic agent. As used herein, the term “signal transduction inhibitor” refers to an agent that selectively inhibits one or more steps in a signaling pathway. In some embodiments, chemotherapeutic agents include anti-hormonal agents that act to regulate or inhibit hormonal action on tumors such as anti-estrogens. In certain embodiments, combination therapy comprises administration of a hormone or related hormonal agent. Agents involved in immunomodulation can also be used in combination with one or more compounds of the present disclosure.

[0194] In some embodiments, the compound of the present disclosure is administered in combination with one or more poly ADP ribose polymerase (PARP) inhibitors. For example, in some embodiments, the method herein is for treating a cancer in a subject who is not responsive to a PARP inhibitor therapy or has developed resistance to the PARP inhibitor, the method can comprise administering to the subject one or more compounds of the present disclosure in combination with a PARP inhibitor. Without wishing to be bound by theories, it is believed that in such embodiments, the administration of Polθ sensitizes or resensitizes the cancer to PARP inhibitor treatment. Suitable PARP inhibitors include any of those known in the art, such as those approved for marketing by the U.S. Food and Drug Administration or a non-US counterpart agency. In some embodiments, the method comprises administering to the subject a PARP inhibitor selected from niraparib, rucaparib, olaparib, talazoparib, veliparib, and fluzoparib.

[0195] In some embodiments, the of the present disclosure is administered in combination with an immune checkpoint inhibitor. The tremendous number of genetic and epigenetic alterations that are characteristic of all cancers provides a diverse set of antigens that the immune system can use to distinguish tumor cells from their normal counterparts. In the case of T cells, the ultimate amplitude (e.g., levels of cytokine production or proliferation) and quality (e.g., the type of immune response generated, such as the pattern of cytokine production) of the response, which is initiated through antigen recognition by the T-cell receptor (TCR), is regulated by a balance between co-stimulatory and inhibitory signals (immune checkpoints). Under normal physiological conditions, immune checkpoints are crucial for the prevention of autoimmunity (i.e., the maintenance of self-tolerance) and for the protection of tissues from damage when the immune system is responding to pathogenic infection. The expression of immune checkpoint proteins can be dysregulated by tumors as an important immune resistance mechanism. Examples of immune checkpoint inhibitors include but are not limited to those targeting CTLA-4, PD-1, PD-L1, BTLA, TIM3, LAG3, OX40, 4 IBB, VISTA, CD96, TGFp, CD73, CD39, A2AR, A2BR, IDO1, TDO2, Arginase, B7-H3, and / or B7-H4. For example, in some embodiments, the method comprises administering to the subject an anti-PD-1 antibody, such as pembrolizumab or nivolumab, and / or an anti-PD- L1 antibody, such as avelumab or atezolizumab. In some embodiments, the method comprises administering to the subject an anti-CTLA-4 antibody, such as ipilimumab. Cell- based modulators of anti-cancer immunity are also contemplated. Agents that may be combined with a Polθ inhibitor also include those described in WO2020243459A1, WO2022118210A1, WO2022259204A1, and WO2023067515A1.

[0196] As understood herein, the term "combination" refers to simultaneous, separate or sequential administration. In one aspect of the invention "combination" refers to simultaneous administration. In another aspect of the invention "combination" refers to separate administration. In a further aspect of the invention "combination" refers to sequential administration. Where the administration is sequential or separate, the delay in administering the second component should not be such as to lose the beneficial effect of the combination.

[0197] Dosing regimen including doses for the methods described herein can vary and be adjusted, which can depend on the recipient of the treatment, the disorder, condition or disease being treated and the severity thereof, the composition containing the compound, thetime of administration, the route of the duration of treatment, the compound potency, its rate of clearance and whether or not another drug is co-administered. Definitions

[0198] It is meant to be understood that proper valences are maintained for all moieties and combinations thereof.

[0199] It is also meant to be understood that a specific embodiment of a variable moiety herein can be the same or different as another specific embodiment having the same identifier.

[0200] Suitable groups for the variables in compounds of Formula A, Formula K, or a subformula thereof, as applicable, are independently selected. Non-limiting useful groups for the variables in compounds of Formula A, Formula K, or a subformula thereof, as applicable, include any of the respective groups, individually or in any combination, as shown in the Examples or in the specific compounds described in Table 1 herein. In addition, it is to be understood that the definition of a variable in Formula A or Formula K can have the same definition for the variable defined in a subformula of Formula A or Formula K, respectively. Similarly, unless otherwise specified or contrary from context, the definition of a subformula of Formula A or Formula K can have the same definition for the variable defined in connection with Formula A or Formula K or another subformula of Formula A or Formula K, respectively.

[0201] The described embodiments of the present disclosure can be combined. Such combination is contemplated and within the scope of the present disclosure. For example, it is contemplated that the definition(s) of any one or more of Z, J1, J2, J3, R1, R2, Ring A, Ring B, and m of Formula A can be combined with the definition of any one or more of the other(s) of Z, J1, J2, J3, R1, R2, Ring A, Ring B, and m, as applicable, and the resulted compounds from the combination are contemplated and within the scope of the present disclosure.

[0202] The symbol, when displayed perpendicular to (or otherwise crossing) a bond, indicates the point at which the displayed moiety is attached to the remainder of the molecule. It should be noted that for a divalent structure (or multivalent structure), the immediately connected group or groups or appropriate variable(s) shown in a formula may be shown in the divalent structure (or multivalent structure) beyond the symbol, to indicate direction of attachment. When the immediately connected group(s) or variable is not shown for either of the two attaching points of a divalent structure, it should mean that either direction ofattachment to the remainder of the allowed, unless otherwise specified or obviously contrary from context.

[0203] Definitions of specific functional groups and chemical terms are described in more detail below. The chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75thEd., inside cover, and specific functional groups are generally defined as described therein. Additionally, general principles of organic chemistry, as well as specific functional moieties and reactivity, are described in Thomas Sorrell, Organic Chemistry, University Science Books, Sausalito, 1999; Smith and March, March’s Advanced Organic Chemistry, 5thEdition, John Wiley & Sons, Inc., New York, 2001; Larock, Comprehensive Organic Transformations, VCH Publishers, Inc., New York, 1989; and Carruthers, Some Modern Methods of Organic Synthesis, 3rdEdition, Cambridge University Press, Cambridge, 1987. The disclosure is not intended to be limited in any manner by the exemplary listing of substituents described herein.

[0204] Compounds described herein can comprise one or more asymmetric centers, and thus can exist in various stereoisomeric forms, e.g., enantiomers and / or diastereomers. For example, the compounds described herein can be in the form of an individual enantiomer, diastereomer or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer. Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high performance liquid chromatography (HPLC), chiral supercritical fluid chromatography (SFC), and the formation and crystallization of chiral salts; or preferred isomers can be prepared by asymmetric syntheses. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, Stereochemistry of Carbon Compounds (McGraw–Hill, NY, 1962); and Wilen, Tables of Resolving Agents and Optical Resolutions p.268 (E.L. Eliel, Ed., Univ. of Notre Dame Press, Notre Dame, IN 1972). The disclosure additionally encompasses compounds described herein as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers including racemic mixtures. When a stereochemistry is specifically drawn, unless otherwise contradictory from context, it should be understood that with respect to that particular chiral center or axial chirality, the compound can exist predominantly as the as-drawn stereoisomer, such as with less than 20%, less than 10%, lessthan 5%, less than 1%, by weight, by SFC area, or both, or with a non-detectable amount of the other stereoisomer(s), for example, the compound can have an enantiomeric excess of greater than 60%, greater than 80%, greater than 90%, greater than 95%, greater than 98%, or greater than 99%. The presence and / or amounts of stereoisomers can be determined by those skilled in the art in view of the present disclosure, including through the use of a chiral HPLC or chiral SFC. As understood by those skilled in the art, when a "*" is shown in the chemical structures herein, unless otherwise contradictory from context, it is to designate that the corresponding chiral center is enantiomerically pure or enriched in either of the configurations or is enantiomerically pure or enriched in the as-dawn configuration, such as with less than 20%, less than 10%, less than 5%, less than 1%, by weight, by HPLC or SFC area, or both, or with a non-detectable amount of the other stereoisomer(s). Also, when no stereochemistry is specifically drawn, and no "*" is used in the chemical structures, unless otherwise contradictory from context, it should be understood that such structures include the corresponding compound in any stereoisomeric forms, including individual isomers substantially free of other isomers and mixtures of various isomers including racemic mixtures.

[0205] When a range of values is listed, it is intended to encompass each value and sub– range within the range. For example “C1–6” is intended to encompass, C1, C2, C3, C4, C5, C6, C1–6, C1–5, C1–4, C1–3, C1–2, C2–6, C2–5, C2–4, C2–3, C3–6, C3–5, C3–4, C4–6, C4–5, and C5–6.

[0206] As used herein, the term “compound(s) of the present disclosure” refers to any of the compounds described herein according to Formula A (e.g., Formula I, I-1, I-1a, I-1b, I-1c, I-1d, I-1e, I-1f, I-1g, II, II-1, III, III-1, A1, A2, A3, A1a, A1b, A1c, A2a, A2b, A2c, A2b-1, A2b-2, A2b-3, A2b-4, A2b-5, or A2b-6), Formula K (e.g., Formula K-1, K-2, K-3, K-4, K-5, K-6, K-1a, K-1b, K-1c, K-1b-1, K-1b-2, K-1b-3, K-1b-4, K-3a, K-3b, K-5a, or K-5b), any of Examples 1-145, or any of the specific compounds disclosed in Table 1 herein, isotopically labeled compound(s) thereof (such as a deuterated analog wherein one or more of the hydrogen atoms is / are substituted with a deuterium atom with an abundance above its natural abundance, e.g., a CD3 analog when the compound has a CH3 group), possible regioisomers, possible geometric isomers, possible stereoisomers thereof (including diastereoisomers, enantiomers, and racemic mixtures), tautomers thereof, conformational isomers thereof, pharmaceutically acceptable esters thereof, and / or possible pharmaceutically acceptable salts thereof (e.g., acid addition salt such as HCl salt or base addition salt such as Na salt).Hydrates and solvates of the compounds present disclosure are considered compositions of the present disclosure, wherein the compound(s) is in association with water or solvent, respectively.

[0207] Compounds of the present disclosure can exist in isotope-labeled or -enriched form containing one or more atoms having an atomic mass or mass number different from the atomic mass or mass number most abundantly found in nature. Isotopes can be radioactive or non-radioactive isotopes. Isotopes of atoms such as hydrogen, carbon, phosphorous, sulfur, fluorine, chlorine, and iodine include, but are not limited to2H,3H,13C,14C,15N,18O,32P, 35S,18F,36Cl, and125I. Compounds that contain other isotopes of these and / or other atoms are within the scope of this invention.

[0208] As used herein, the phrase “administration” of a compound, “administering” a compound, or other variants thereof means providing the compound or a prodrug of the compound to the individual in need of treatment.

[0209] As used herein, the term "alkyl" as used by itself or as part of another group refers to a straight- or branched-chain aliphatic saturated hydrocarbon. In some embodiments, the alkyl can include one to twelve carbon atoms (i.e., C1-12alkyl) or the number of carbon atoms designated. In one embodiment, the alkyl group is a straight chain C1-10 alkyl group. In another embodiment, the alkyl group is a branched chain C3-10alkyl group. In another embodiment, the alkyl group is a straight chain C1-6 alkyl group. In another embodiment, the alkyl group is a branched chain C3-6alkyl group. In another embodiment, the alkyl group is a straight chain C1-4 alkyl group. For example, a C1-4 alkyl group includes methyl, ethyl, propyl (n-propyl), isopropyl, butyl (n-butyl), sec-butyl, tert-butyl, and iso-butyl. As used herein, the term "alkylene" as used by itself or as part of another group refers to a divalent radical derived from an alkyl group. For example, non-limiting straight chain alkylene groups include -CH2-CH2-CH2-CH2-, -CH2-CH2-CH2-, -CH2-CH2-, and the like.

[0210] As used herein, the term "alkenyl" as used by itself or as part of another group refers to a straight- or branched-chain aliphatic hydrocarbon containing one or more, for example, one, two or three carbon-to-carbon double bonds. In one embodiment, the alkenyl group is a C2-6 alkenyl group. In another embodiment, the alkenyl group is a C2-4 alkenyl group. Non-limiting exemplary alkenyl groups include ethenyl, propenyl, isopropenyl, butenyl, sec-butenyl, pentenyl, and hexenyl.

[0211] As used herein, the term as used by itself or as part of another group refers to a straight- or branched-chain aliphatic hydrocarbon containing one or more, for example, one to three carbon-to-carbon triple bonds. In one embodiment, the alkynyl has one carbon-carbon triple bond. In one embodiment, the alkynyl group is a C2-6alkynyl group. In another embodiment, the alkynyl group is a C2-4 alkynyl group. Non-limiting exemplary alkynyl groups include ethynyl, propynyl, butynyl, 2-butynyl, pentynyl, and hexynyl groups.

[0212] As used herein, the term "alkoxy" as used by itself or as part of another group refers to a radical of the formula ORa1, wherein Ra1is an alkyl.

[0213] As used herein, the term "cycloalkoxy" as used by itself or as part of another group refers to a radical of the formula ORa1, wherein Ra1is a cycloalkyl.

[0214] As used herein, the term "haloalkyl" as used by itself or as part of another group refers to an alkyl substituted with one or more fluorine, chlorine, bromine and / or iodine atoms. In preferred embodiments, the haloalkyl is an alkyl group substituted with one, two, or three fluorine atoms. In one embodiment, the haloalkyl group is a C1-10haloalkyl group. In one embodiment, the haloalkyl group is a C1-6 haloalkyl group. In one embodiment, the haloalkyl group is a C1-4haloalkyl group.

[0215] As used herein, the term "heteroalkyl," by itself or in combination with another term, means, unless otherwise stated, a stable straight or branched-chain alkyl group, e.g., having from 2 to 14 carbons, such as 2 to 10 carbons in the chain, in which one or more of the carbons has been replaced by a heteroatom selected from S, O,P and N, and wherein the nitrogen, phosphine, and sulfur atoms can optionally be oxidized and the nitrogen heteroatom can optionally be quaternized. The heteroatom(s) S, O,P and N may be placed at any interior position of the heteroalkyl group or at the position at which the alkyl group is attached to the remainder of the molecule. When the heteroalkyl is said to be substituted, the substituent(s) can replace one or more hydrogen atoms attached to the carbon atom(s) and / or the heteroatom(s) of the heteroalkyl. In some embodiments, the heteroalkyl is a C1-4heteroalkyl, which refers to the heteroalkyl defined herein having 1-4 carbon atoms. Examples of C1-4 heteroalkyl include, but are not limited to, C4 heteroalkyl such as -CH2-CH2-N(CH3)-CH3, C3 heteroalkyl such as -CH2-CH2-O-CH3, -CH2-CH2-NH-CH3, -CH2-S-CH2-CH3, -CH2-CH2- S(O)-CH3, -CH2-CH2-S(O)2-CH3, C2 heteroalkyl such as -CH2-CH2-OH, -CH2-CH2-NH2, - CH2-NH(CH3), -O-CH2-CH3 and C1 heteroalkyl such as, -CH2-OH, -CH2-NH2, -O-CH3. Preferably, the C1-4 heteroalkyl (or C1-4 heteroalkylene) herein contains 1 or 2 heteroatoms,such as one oxygen, one nitrogen, two two nitrogens, or one oxygen and one nitrogen. Similarly, the term "heteroalkylene" by itself or as part of another substituent means a divalent radical derived from heteroalkyl, as exemplified, but not limited by, -CH2- CH2-O-CH2-CH2- and –O-CH2-CH2-NH-CH2-. For heteroalkylene groups, heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like). Still further, for alkylene and heteroalkylene linking groups, no orientation of the linking group is implied by the direction in which the formula of the linking group is written. Where "heteroalkyl" is recited, followed by recitations of specific heteroalkyl groups, such as -NR'R''or the like, it will be understood that the terms heteroalkyl and -NR'R'' are not redundant or mutually exclusive. Rather, the specific heteroalkyl groups are recited to add clarity. Thus, the term "heteroalkyl" should not be interpreted herein as excluding specific heteroalkyl groups, such as -NR'R''or the like.

[0216] In some preferred embodiments, unless otherwise specified or contrary from context, a C1-6heteroalkyl herein can be a C1-6alkoxy, NH(C1-6alkyl), N(C1-4alkyl)(C1-4alkyl), -(C1-5 alkylene)-O-(C1-5 alkyl), -(C1-5 alkylene)-NH(C1-5 alkyl), -(C1-4 alkylene)-N(C1-4 alkyl)(C1-4alkyl), -(C1-5alkylene)-S-(C1-5alkyl), -(C1-5alkylene)-SO2-(C1-5alkyl), SO2(C1-6alkyl), P(O)(C1-4 alkyl)(C1-4 alkyl), SO2NH(C1-6 alkyl), SO2N(C1-4 alkyl)(C1-4 alkyl), -(C1-5 alkylene)-SO2NH-(C1-5alkyl), or -(C1-4alkylene)-SO2N(C1-4alkyl)(C1-4alkyl), provided that the total number of carbons are no greater than 6, not counting any optional substituents.

[0217] In some preferred embodiments, unless otherwise specified or contrary from context, a C1-4 heteroalkyl herein can be a C1-4 alkoxy, NH(C1-4 alkyl), N(C1-3 alkyl)(C1-3 alkyl), -(C1-3alkylene)-O-(C1-3alkyl), -(C1-3alkylene)-NH(C1-3alkyl), -(C1-2alkylene)-N(C1-2alkyl)(C1-2 alkyl), -(C1-3 alkylene)-S-(C1-3 alkyl), -(C1-3 alkylene)-SO2-(C1-3 alkyl), SO2(C1-4 alkyl), P(O)(C1-3alkyl)(C1-3alkyl), SO2NH(C1-4alkyl), SO2N(C1-3alkyl)(C1-3alkyl), -(C1-3alkylene)-SO2NH-(C1-3 alkyl), or -(C1-2 alkylene)-SO2N(C1-2 alkyl)(C1-2 alkyl), provided that the total number of carbons are no greater than 4, not counting any optional substituents.

[0218] “Carbocyclyl” or “carbocyclic” as used by itself or as part of another group refers to a radical of a non–aromatic cyclic hydrocarbon group having at least 3 carbon atoms, e.g., from 3 to 10 ring carbon atoms (“C3–10 carbocyclyl”), and zero heteroatoms in the non– aromatic ring system. The carbocyclyl group can be either monocyclic (“monocyclic carbocyclyl”) or contain a fused, bridged or spiro ring system such as a bicyclic system (“bicyclic carbocyclyl”) and can be saturated or can be partially unsaturated. Non-limitingexemplary carbocyclyl groups include cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, norbornyl, decalin, adamantyl, cyclopentenyl, and cyclohexenyl. As used herein, the term "carbocyclylene" as used by itself or as part of another group refers to a divalent radical derived from the carbocyclyl group defined herein.

[0219] In some embodiments, “carbocyclyl” is fully saturated, which is also referred to as cycloalkyl. In some embodiments, the cycloalkyl can have from 3 to 10 ring carbon atoms (“C3–10 cycloalkyl”). In preferred embodiments, the cycloalkyl is a monocyclic ring. As used herein, the term "cycloalkylene" as used by itself or as part of another group refers to a divalent radical derived from a cycloalkyl group, for , etc.

[0220] Unless otherwise defined or contrary from refers toan atom selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon.

[0221] “Heterocyclyl” or “heterocyclic” as used by itself or as part of another group refers to a radical of a 3-membered or larger, such as 3– to 14–membered, non–aromatic ring system having ring carbon atoms and at least one ring heteroatom, such as 1 to 4 ring heteroatoms, wherein each heteroatom is independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon. In heterocyclyl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. A heterocyclyl group can either be monocyclic (“monocyclic heterocyclyl”) or a fused, bridged, or spiro ring system, such as a bicyclic system (“bicyclic heterocyclyl”), and can be saturated or can be partially unsaturated. When all ring carbon atoms in a heterocyclyl as defined herein are saturated carbons, then the heterocyclyl may also be referred to as a heterocycloalkyl. Heterocyclyl bicyclic ring systems can include one or more heteroatoms in one or both rings, and the point of attachment can be on any ring. As used herein, the term "heterocyclylene" as used by itself or as part of another group refers to a divalent radical derived from the heterocyclyl group defined herein. The heterocyclyl or heterocylylene can be optionally linked to the rest of the molecule through a carbon or nitrogen atom.

[0222] Exemplary 3–membered heterocyclyl groups containing one heteroatom include, without limitation, azirdinyl, oxiranyl, thiiranyl. Exemplary 4–membered heterocyclyl groups containing one heteroatom include, without limitation, azetidinyl, oxetanyl and thietanyl. Exemplary 5–membered heterocyclyl groups containing one heteroatom include, without limitation, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, dihydrothiophenyl,pyrrolidinyl, dihydropyrrolyl, and Exemplary 5–membered heterocyclyl groups containing two heteroatoms include, without limitation, dioxolanyl, oxasulfuranyl, disulfuranyl, and oxazolidin-2-one. Exemplary 5–membered heterocyclyl groups containing three heteroatoms include, without limitation, triazolinyl, oxadiazolinyl, and thiadiazolinyl. Exemplary 6–membered heterocyclyl groups containing one heteroatom include, without limitation, piperidinyl, tetrahydropyranyl, dihydropyridinyl, and thianyl. Exemplary 6– membered heterocyclyl groups containing two heteroatoms include, without limitation, piperazinyl, morpholinyl, dithianyl, and dioxanyl. Exemplary 6–membered heterocyclyl groups containing two heteroatoms include, without limitation, triazinanyl. Exemplary 7– membered heterocyclyl groups containing one heteroatom include, without limitation, azepanyl, oxepanyl and thiepanyl. Exemplary 8–membered heterocyclyl groups containing one heteroatom include, without limitation, azocanyl, oxecanyl and thiocanyl. Exemplary 5- membered heterocyclyl groups fused to a C6 aryl ring (also referred to herein as an example of a 5,6-bicyclic heterocyclic ring) include, without limitation, indolinyl, isoindolinyl, dihydrobenzofuranyl, dihydrobenzothienyl, benzoxazolinonyl, and the like. Exemplary 6- membered heterocyclyl groups fused to an aryl ring (also referred to herein as an example of a 6,6-bicyclic heterocyclic ring) include, without limitation, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and the like.

[0223] “Aryl” as used by itself or as part of another group refers to a radical of a monocyclic or polycyclic (e.g., bicyclic or tricyclic) 4n+2 aromatic ring system (e.g., having 6, 10, or 14 pi electrons shared in a cyclic array) having 6–14 ring carbon atoms and zero heteroatoms provided in the aromatic ring system (“C6–14aryl”). In some embodiments, an aryl group has six ring carbon atoms (“C6 aryl”; e.g., phenyl). In some embodiments, an aryl group has ten ring carbon atoms (“C10aryl”; e.g., naphthyl such as 1–naphthyl and 2– naphthyl). In some embodiments, an aryl group has fourteen ring carbon atoms (“C14 aryl”; e.g., anthracyl). As used herein, the term "arylene" as used by itself or as part of another group refers to a divalent radical derived from the aryl group defined herein.

[0224] “Aralkyl” as used by itself or as part of another group refers to an alkyl substituted with one or more aryl groups, preferably, substituted with one aryl group. Examples of aralkyl include benzyl, phenethyl, etc. When an aralkyl is said to be optionally substituted, either the alkyl portion or the aryl portion of the aralkyl can be optionally substituted.

[0225] “Heteroaryl” as used by part of another group refers to a radical of a 5– 14 membered monocyclic, bicyclic, or tricyclic 4n+2 aromatic ring system (e.g., having 6 or 10 pi electrons shared in a cyclic array) having ring carbon atoms and at least one, preferably, 1–4, ring heteroatoms provided in the aromatic ring system, wherein each heteroatom is independently selected from nitrogen, oxygen and sulfur (“5–14 membered heteroaryl”). As used herein, for clarity, a pyridone (e.g., a pyridin-2- , wherein R can be hydrogen or a nitrogen atom substituent), such as a pyridone fusedto an aryl or heteroaryl (e.g., , wherein R can be hydrogen or a nitrogen atom substituent), is considered a heteroaryl ring herein. In heteroaryl groups that contain one or more nitrogen atoms, the point of attachment can be a carbon or nitrogen atom, as valency permits. Heteroaryl bicyclic ring systems can include one or more heteroatoms in one or both rings. In bicyclic heteroaryl groups wherein one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, and the like), the point of attachment can be on either ring, i.e., either the ring bearing a heteroatom (e.g., 2–indolyl) or the ring that does not contain a heteroatom (e.g., 5–indolyl). As used herein, the term "heteroarylene" as used by itself or as part of another group refers to a divalent radical derived from the heteroaryl group defined herein.

[0226] Exemplary 5–membered heteroaryl groups containing one heteroatom include, without limitation, pyrrolyl, furanyl, and thiophenyl. Exemplary 5–membered heteroaryl groups containing two heteroatoms include, without limitation, imidazolyl, pyrazolyl, oxazolyl, isoxazolyl, thiazolyl, and isothiazolyl. Exemplary 5–membered heteroaryl groups containing three heteroatoms include, without limitation, triazolyl, oxadiazolyl, and thiadiazolyl. Exemplary 5–membered heteroaryl groups containing four heteroatoms include, without limitation, tetrazolyl. Exemplary 6–membered heteroaryl groups containing one heteroatom include, without limitation, pyridinyl. Exemplary 6–membered heteroaryl groups containing two heteroatoms include, without limitation, pyridazinyl, pyrimidinyl, and pyrazinyl. Exemplary 6–membered heteroaryl groups containing three or four heteroatoms include, without limitation, triazinyl and tetrazinyl, respectively. Exemplary 7–membered heteroaryl groups containing one heteroatom include, without limitation, azepinyl, oxepinyl, and thiepinyl. Exemplary 5,6–bicyclic heteroaryl groups include, without limitation, indolyl,isoindolyl, indazolyl, benzotriazolyl, isobenzothiophenyl, benzofuranyl, benzoisofuranyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzoxadiazolyl, benzthiazolyl, benzisothiazolyl, benzthiadiazolyl, indolizinyl, and purinyl. Exemplary 6,6– bicyclic heteroaryl groups include, without limitation, naphthyridinyl, pteridinyl, quinolinyl, isoquinolinyl, cinnolinyl, quinoxalinyl, phthalazinyl, and quinazolinyl.

[0227] “Heteroaralkyl” as used by itself or as part of another group refers to an alkyl substituted with one or more heteroaryl groups, preferably, substituted with one heteroaryl group. When a heteroaralkyl is said to be optionally substituted, either the alkyl portion or the heteroaryl portion of the heteroaralkyl can be optionally substituted.

[0228] As used herein, unless specified or otherwise contrary, a "ring structure", "cyclic structure", or simply "ring", with a designated number of ring members, such as a "3-10 membered ring structure", a "3-12 membered ring structure", or a "5- or 6-membered ring", should be understood as encompassing any ring structure (e.g., carbocyclic, heterocyclic, aryl, heteroaryl, etc.) having the designated number of ring members, which can be (1) monocyclic or polycyclic (as chemically feasible), such as a monocyclic ring or a bicyclic ring (including fused, spiro, and bridged bicyclic ring, and those ring systems where two monocyclic rings are connected through a single or double bond); (2) aromatic, partially unsaturated, or fully saturated; and in the case of a polycyclic structure, each ring can be independently aromatic, partially unsaturated, or fully saturated; and (3) containing no heteroatom (i.e., all ring members are carbon atoms) or 1-4 heteroatoms; or in the case of a polycyclic structure, each ring can independently have no ring heteroatom or 1-4 ring heteroatoms (e.g., O, N, S, etc.). When a ring is said to contain a ring sulfur or nitrogen atom, the sulfur or nitrogen atom can be optionally oxidized. One or more ring carbon atoms in a ring structure can be present as C(=O). A fully saturated ring refers to a ring in which none of the ring carbon atom(s) and any present ring heteroatom(s) (e.g., nitrogen) forms a double bond or triple bond with any other atom. The ring structure can be optionally substituted with one or more substituents described herein. The substituents of a ring structure herein can also have a cyclic structure, and in some cases, two substituents of a ring structure may be said to be joined to form a cyclic structure.

[0229] As commonly understood in the art, for clarity, when a structure can be characterized in multiple ways, as long as one such characterization falls within the scope of the definition of a variable herein, it can be said that the structure is a suitable definition forthe variable. For example, when a variable is defined as an optionally substituted 6-membered ring, the variable encompasses, among other structures, (a) the structure of , which can be viewed as a 6-membered monocyclic orbicyclic ring substituted with a phenyl group; and (b) the structure , which can be viewed as a 6-membered ring, wherein two substituents are joinedcyclopropyl ring (unless the optional substituents for the 6-membered ring are specified and do not include this as an option); but the variable would not because the attaching ring is not a 6-membered ring under any characterizationTo further explain, when the variable is instead defined as an optionally substituted monocyclic 6-membered ring, then the variable does not , but encompasses the structure (unless the optionalring are specified and dothis as an option). And if the variable is defined as a 6-membered ring optionally substituted with halogen, then the variable can encompass structures such as, ,or substituted with 1 or two fluorine atoms.

[0230] As commonly understood in the art, alkylene, alkenylene, alkynylene, heteroalkylene, carbocyclylene, heterocyclylene, arylene, and heteroarylene refer to thecorresponding divalent radicals of alkyl, alkynyl, heteroalkyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl groups, respectively.

[0231] An “optionally substituted” group, such as an optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, and optionally substituted heteroaryl groups, refers to the respective group that is unsubstituted or substituted. In general, the term “substituted”, whether preceded by the term “optionally” or not, means that at least one hydrogen present on a group (e.g., a carbon or nitrogen atom) is replaced with a permissible substituent, e.g., a substituent which upon substitution results in a stable compound, e.g., a compound which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, or other reaction. Unless otherwise indicated, a “substituted” group has a substituent at one or more substitutable positions of the group, and when more than one position in any given structure is substituted, the substituent can be the same or different at each position. Typically, when substituted, the optionally substituted groups herein can be substituted with 1-5 substituents. Substituents can be a carbon atom substituent, a nitrogen atom substituent, an oxygen atom substituent or a sulfur atom substituent, as applicable, each of which can be optionally isotopically labeled, such as deuterated. Two of the optional substituents can join to form a ring structure, such as an optionally substituted cycloalkyl, heterocylyl, aryl, or heteroaryl ring. Substitution can occur on any available carbon, oxygen, or nitrogen atom, and can form a spirocycle. Typically, substitution herein does not result in an O-O, O-N, S-S, S-N (except SO2-N bond), heteroatom-halogen, or -C(O)-S bond or three or more consecutive heteroatoms, with the exception of O-SO2-O, O-SO2-N, and N-SO2-N, except that some of such bonds or connections may be allowed if in a stable aromatic system.

[0232] In a broad aspect, the permissible substituents herein include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and non-aromatic substituents of organic compounds. The permissible substituents can be one or more and the same or different for appropriate organic compounds. For purposes of this disclosure, the heteroatoms such as nitrogen may have hydrogen substituents and / or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms. Substituents can include any substituents described herein, for example, a halogen, a hydroxyl, a carbonyl (such as a carboxyl, an alkoxycarbonyl, a formyl, or an acyl),a thiocarbonyl (such as a thioester, a or a thioformate), an alkoxy, a cycloalkoxy, a phosphoryl, a phosphate, a phosphonate, a phosphinate, an amino, an amido, an amidine, an imine, a cyano, a nitro, an azido, a sulfhydryl, an alkylthio, a sulfate, a sulfonate, a sulfamoyl, a sulfonamido, a sulfonyl, a heterocyclyl, an alkyl, an alkenyl, an alkynyl, a cycloalkyl, a heterocyclyl, an aralkyl, an aryl, or a heteroaryl, each of which can be substituted, if appropriate.

[0233] Exemplary substituents include, but not limited to, alkyl, alkenyl, alkynyl, aryl, heteroaryl, -alkylene-aryl, -arylene-alkyl, -alkylene-heteroaryl, -alkenylene-heteroaryl, - alkynylene-heteroaryl, —OH, hydroxyalkyl, haloalkyl, —O-alkyl, —O-haloalkyl, -alkylene- O-alkyl, —O-aryl, —O-alkylene-aryl, —O-heteroaryl, —O-alkylene-heteroaryl, —O- cycloalkyl, —O-heterocycloalkyl, acyl, — C(O)-alkyl, — C(O)-haloalkyl, —C(O)-aryl, — C(O)-alkylene-aryl, — C(O)-heteroaryl, — C(O)-alkylene-heteroaryl, — C(O)-cycloalkyl, — C(O)-heterocycloalkyl, halo, —NO2, —CN, —SF5, —C(O)OH, —C(O)O-alkyl, —C(O)O- aryl, —C(O)O—alkylene-aryl, —S(O)-alkyl, —S(O)2-alkyl, —S(O)-haloalkyl, —S(O)2- haloalkyl, —S(O)-aryl, —S(O)2-aryl, —S(O)-heteroaryl, —S(O)2-heteroaryl, —S-alkyl, —S- aryl, —S-heteroaryl, —S-alkylene-aryl, —S-alkylene-heteroaryl, —S(O)2-alkylene-aryl, — S(O)2-alkylene-heteroaryl, —S-cycloalkyl, —S-heterocycloalkyl, —S(O)-cycloalkyl, — S(O)-heterocycloalkyl, —S(O)2-cycloalkyl, —S(O)2-heterocycloalkyl, —S(O)(═NH)-alkyl, —S(O)(═NH)-haloalkyl, —S(O)(═NH)-aryl, —S(O)(═NH)-alkylene-aryl, —S(O)(═NH)- heteroaryl, —S(O)(═NH)-alkylene-heteroaryl, —S(O)(═NH)-cycloalkyl, —S(O)(═NH)- heterocycloalkyl, —S(O)(═Nalkyl)-alkyl, —S(O)(═Nalkyl)-haloalkyl, —S(O)(═Nalkyl)- aryl, —S(O)(═Nalkyl)-alkylene-aryl, —S(O)(═Nalkyl)-heteroaryl, —S(O)(═Nalkyl)- alkylene-heteroaryl, —S(O)(═Nalkyl)-cycloalkyl, —S(O)(═Nalkyl)-heterocycloalkyl, cycloalkyl, heterocycloalkyl, —O—C(O)-alkyl, —O—C(O)-aryl, —O—C(O)-cycloalkyl, — C(═N—CN)—NH2, —C(═NH)—NH2, —C(═NH)—NH(alkyl), —N(Y1)(Y2), -alkylene- N(Y1)(Y2), —C(O)N(Y1)(Y2) and —S(O)2N(Y1)(Y2), wherein Y1 and Y2 can be the same or different and are independently selected from the group consisting of hydrogen, alkyl, haloalkyl, aryl, -alkylene-aryl, heteroaryl, -alkylene-heteroaryl, cycloalkyl, heterocycloalkyl, and Y1 and Y2 with the nitrogen they linked can form a heterocyclic ring.

[0234] Some examples of suitable substituents include, but not limited to, (C1-C8)alkyl groups, (C2-C8)alkenyl groups, (C2-C8)alkynyl groups, (C3-C10)cycloalkyl groups, halogen(F, Cl, Br or I), halogenated (C1-C8) (for example but not limited to —CF3), — O—(C1-C8)alkyl groups, —OH, —S—(C1-C8)alkyl groups, —SH, —NH(C1-C8)alkyl groups, —N((C1-C8)alkyl)2 groups, —NH2, —C(O)NH2, —C(O)NH(C1-C8)alkyl groups, — C(O)N((C1-C8)alkyl)2, —NHC(O)H, —NHC(O)(C1-C8)alkyl groups, —NHC(O)(C3- C8)cycloalkyl groups, —N((C1-C8)alkyl)C(O)H, —N((C1-C8)alkyl)C(O)(C1-C8)alkyl groups, —NHC(O)NH2, —NHC(O)NH(C1-C8)alkyl groups, —N((C1-C8)alkyl)C(O)NH2groups, — NHC(O)N((C1-C8)alkyl)2 groups, —N((C1-C8)alkyl)C(O)N((C1-C8)alkyl)2 groups, —N((C1- C8)alkyl)C(O)NH((C1-C8)alkyl), —C(O)H, —C(O)(C1-C8)alkyl groups, —CN, —NO2, — S(O)(C1-C8)alkyl groups, —S(O)2(C1-C8)alkyl groups, —S(O)2N((C1-C8)alkyl)2 groups, — S(O)2NH(C1-C8)alkyl groups, —S(O)2NH(C3-C8)cycloalkyl groups, —S(O)2NH2groups, — NHS(O)2(C1-C8)alkyl groups, —N((C1-C8)alkyl)S(O)2(C1-C8)alkyl groups, —(C1-C8)alkyl- O—(C1-C8)alkyl groups, —O—(C1-C8)alkyl-O—(C1-C8)alkyl groups, —C(O)OH, — C(O)O(C1-C8)alkyl groups, NHOH, NHO(C1-C8)alkyl groups, —O-halogenated (C1-C8)alkyl groups (for example but not limited to —OCF3), —S(O)2-halogenated (C1-C8)alkyl groups (for example but not limited to —S(O)2CF3), —S-halogenated (C1-C8)alkyl groups (for example but not limited to —SCF3), —(C1-C6) heterocycle (for example but not limited to pyrrolidine, tetrahydrofuran, pyran or morpholine), —(C1-C6) heteroaryl (for example but not limited to tetrazole, imidazole, furan, pyrazine or pyrazole), -phenyl, —NHC(O)O—(C1- C6)alkyl groups, —N((C1-C6)alkyl)C(O)O—(C1-C6)alkyl groups, —C(═NH)—(C1-C6)alkyl groups, —C(═NOH)—(C1-C6)alkyl groups, or —C(═N—O—(C1-C6)alkyl)-(C1-C6)alkyl groups.

[0235] Exemplary carbon atom substituents include, but are not limited to, deuterium, halogen, –CN, –NO2, –N3, hydroxyl, alkoxy, cycloalkoxy, aryloxy, amino, monoalkyl amino, dialkyl amino, amide, sulfonamide, thiol, acyl, carboxylic acid, ester, sulfone, sulfoxide, alkyl, haloalkyl, alkenyl, alkynyl, C3–10 carbocyclyl, C6–10 aryl, 3–10 membered heterocyclyl, 5–10 membered heteroaryl, etc. For example, exemplary carbon atom substituents can include F, Cl, -CN, –SO2H, –SO3H, –OH, –OC1–6 alkyl, –NH2, –N(C1–6 alkyl)2, –NH(C1–6 alkyl), –SH, –SC1–6alkyl, –C(=O)(C1–6alkyl), –CO2H, –CO2(C1–6alkyl), –OC(=O)(C1–6alkyl), –OCO2(C1–6 alkyl), –C(=O)NH2, –C(=O)N(C1–6 alkyl)2, –OC(=O)NH(C1–6 alkyl), – NHC(=O)(C1–6alkyl), –N(C1–6alkyl)C(=O)( C1–6alkyl), –NHCO2(C1–6alkyl), – NHC(=O)N(C1–6 alkyl)2, –NHC(=O)NH(C1–6 alkyl), –NHC(=O)NH2, –NHSO2(C1–6 alkyl), – SO2N(C1–6alkyl)2, –SO2NH(C1–6alkyl), –SO2NH2,–SO2C1–6alkyl, –SO2OC1–6alkyl, –OSO2C1–6 alkyl, –SOC1–6 alkyl, C1–6 haloalkyl, C2–6 alkenyl, C2–6 alkynyl, C3–10 carbocyclyl, C6–10aryl, 3–10 membered heterocyclyl, 5–10 membered heteroaryl; or two geminal substituents can be joined to form =O.

[0236] Nitrogen atoms can be substituted or unsubstituted as valency permits, and include primary, secondary, tertiary, and quaternary nitrogen atoms. Exemplary nitrogen atom substituents include, but are not limited to, acyl groups, esters, sulfone, sulfoxide, C1–10alkyl, C1–10 haloalkyl, C2–10 alkenyl, C2–10 alkynyl, C3–10 carbocyclyl, 3–14 membered heterocyclyl, C6–14aryl, and 5–14 membered heteroaryl, or two substituent groups attached to a nitrogen atom are joined to form a 3–14 membered heterocyclyl or 5–14 membered heteroaryl ring, wherein each alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl can be further substituted as defined herein. In certain embodiments, the substituent present on a nitrogen atom is a nitrogen protecting group (also referred to as an amino protecting group). Nitrogen protecting groups are well known in the art and include those described in detail in Protective Groups in Organic Synthesis, 4thed. P. G. M. Wuts; T. W. Greene, John Wiley, 2007, incorporated by reference herein. Exemplary nitrogen protecting groups include, but not limited to, those forming carbamates, such as Carbobenzyloxy (Cbz) group, p- Methoxybenzyl carbonyl (Moz or MeOZ) group, tert-Butyloxycarbonyl (BOC) group, Troc, 9-Fluorenylmethyloxycarbonyl (Fmoc) group, etc., those forming an amide, such as acetyl, benzoyl, etc., those forming a benzylic amine, such as benzyl, p-methoxybenzyl, 3,4- dimethoxybenzyl, etc., those forming a sulfonamide, such as tosyl, Nosyl, etc., and others such as p-methoxyphenyl.

[0237] Exemplary oxygen atom substituents include, but are not limited to, acyl groups, esters, sulfonates, C1–10 alkyl, C1–10 haloalkyl, C2–10 alkenyl, C2–10 alkynyl, C3–10 carbocyclyl, 3–14 membered heterocyclyl, C6–14aryl, and 5–14 membered heteroaryl, wherein each alkyl, alkenyl, alkynyl, carbocyclyl, heterocyclyl, aryl, and heteroaryl can be further substituted as defined herein. In certain embodiments, the oxygen atom substituent present on an oxygen atom is an oxygen protecting group (also referred to as a hydroxyl protecting group). Oxygen protecting groups are well known in the art and include those described in detail in Protective Groups in Organic Synthesis, 4thed. P. G. M. Wuts; T. W. Greene, John Wiley, 2007, incorporated herein by reference. Exemplary oxygen protecting groups include, but are not limited to, those forming alkyl ethers or substituted alkyl ethers, such as methyl, allyl, benzyl, substituted benzyls such as 4-methoxybenzyl, methoxylmethyl (MOM), benzyloxymethyl(BOM), 2–methoxyethoxymethyl those forming silyl ethers, such as trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), t-butyldimethylsilyl (TBDMS), etc., those forming acetals or ketals, such as tetrahydropyranyl (THP), those forming esters such as formate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, etc., those forming carbonates or sulfonates such as methanesulfonate (mesylate), benzylsulfonate, and tosylate (Ts), etc.

[0238] Unless expressly stated to the contrary, combinations of substituents and / or variables are allowable only if such combinations are chemically allowed and result in a stable compound. A “stable” compound is a compound that can be prepared and isolated and whose structure and properties remain or can be caused to remain essentially unchanged for a period of time sufficient to allow use of the compound for the purposes described herein (e.g., therapeutic administration to a subject).

[0239] Unless otherwise specified or contrary from context, the optionally substituted groups as referred to herein can be (A) unsubstituted; (B) substituted with one or more substituents each independently deuterium, halogen, CN, orQ1-Q2-Q3-Q4, wherein Q1, Q2, and Q3are each independently null, O, NQ4, C(O), S, SO, SO2, S(O)(=NQ4), C1-4alkylene optionally substituted with deuterium, F, and / or OH, or P(O)Q4, wherein Q4at each occurrence is independently hydrogen, C1-6alkyl optionally substituted with one or more Q10, C2-6alkenyl optionally substituted with one or more Q10, C2-6 alkynyl optionally substituted with one or more Q10, C1-6heteroalkyl optionally substituted with one or more Q10, or 3-14 membered ring optionally substituted with one or more Q10, wherein Q10at each occurrence is independently deuterium, halogen, oxo (as applicable), CN, orQ20-Q21-Q22-Q23, wherein Q20, Q21, and Q22are each independently null, O, NQ23, C(O), S, SO, SO2, S(O)(=NQ23), C1-4 alkylene optionally substituted with deuterium, F, and / or OH, or P(O)Q23, wherein Q23at each occurrence is independently hydrogen, C1-6 alkyl optionally substituted with one or more Q30, C2-6alkenyl optionally substituted with one or more Q30, C2-6alkynyl optionally substituted with one or more Q30, C1-6 heteroalkyl optionally substituted with one or more Q30, or 3-8 membered ring optionally substituted with one or more Q30, wherein Q30at each occurrence is independently deuterium, halogen, oxo (as applicable), CN, OH, NH2, C1-4 alkyl optionally substituted with one or more Q31, C1-4 heteroalkyl optionally substituted with one or more Q31, or 3-5 membered ring optionally substituted with one or more Q31, wherein Q31at each occurrence is independently deuterium, F, OH, C1-4 alkyl optionally substitutedwith deuterium and / or F, or C1-4 substituted with deuterium and / or F; or (C) two or more substituents of the respective optionally substituted group, and / or one of the substituents of the respective optionally substituted group and another variable herein, are joined to form a ring (e.g., a spiro ring, a fused ring, or a bridged ring), which is optionally substituted with one or more substituents as defined in (B), and any remaining substituents of the respective optionally substituted group are as defined in (B). In some preferred embodiments, the optionally substituted groups as defined in connection with a formula herein can be unsubstituted or substituted with one or more substituents as defined in (B). The combination of Q1, Q2, and Q3is not particularly limited, which can preferably be (a) a linker of O, NQ4, C(O), S, SO, SO2, or P(O)Q4, when two of Q1, Q2, and Q3are null, or (b) a linker of amide (C(O)NQ4), ester (C(O)O), sulfonamide (SO2NQ4), etc., when one of Q1, Q2, and Q3is null, or (c) a linker of carbamate (OC(O)NQ4), urea (NQ4C(O)NQ4), sulfamoylamino (NQ4SO2NQ4), etc., when none of Q1, Q2, and Q3is null. The combination of Q20, Q21, and Q22should be understood similarly.

[0240] Unless otherwise specified or contrary from context, when a group herein is defined as being optionally substituted with one or more substituents selected from a defined list or simply a defined list of substituents, the group is typically unsubstituted or substituted with 1, 2, 3, or 4 substituents as defined, although in some embodiments, the group can also be substituted with more than 4 substituents. For example, an alkyl group optionally substituted with one or more substituents independently selected from deuterium, F, and OH can be typically unsubstituted or substituted with 1-4 substituents each independently deuterium, F, or OH. Similarly, an alkyl group optionally substituted with deuterium and / or F is typically unsubstituted or substituted with 1-4 substituents each independently deuterium or F.

[0241] Unless otherwise specified or contrary from context, a 3-x membered ring herein, wherein x is an integer of 6 or greater, e.g., 3-14 membered, 3-8 membered ring, etc., can be a (i) 3-x membered carbocyclic ring, (ii) 4-x membered heterocyclic ring having 1-3 ring heteroatoms each independently O, S, and N, wherein the sulfur atom, if present, is optionally oxidized; (iii) phenyl ring, or phenyl or naphthyl ring when x is 10 or greater; (iv) a 5 or 6- membered heteroaryl ring having 1-4 ring heteroatoms each independently O, S, and N, or a 5 or 6-membered heteroaryl ring or bicyclic heteroaryl ring having 1-4 ring heteroatoms each independently O, S, and N, when x is 9 or greater.

[0242] Unless otherwise specified or from context, a 3-6 membered ring herein can be a (i) 3-6 membered carbocyclic ring, e.g., cyclopropyl, cyclobutyl, etc., (ii) 4-6 membered heterocyclic ring having 1-2 ring heteroatoms each independently O, S, and N, wherein the sulfur atom, if present, is optionally oxidized, e.g., oxetane, azetidine, etc.; (iii) a 5-membered heteroaryl ring having 1-4 ring heteroatoms each independently O, S, and N; (iv) a 6- membered heteroaryl ring having 1 or 2 ring nitrogen atoms; or (v) a phenyl ring.

[0243] Unless otherwise specified or contrary from context, a 3-5 membered ring herein can be a (i) 3-5 membered carbocyclic ring, e.g., cyclopropyl, cyclobutyl, etc., (ii) 4-5 membered heterocyclic ring having 1-2 ring heteroatoms each independently O, S, and N, wherein the sulfur atom, if present, is optionally oxidized, e.g., oxetane, azetidine, etc.; or (iii) a 5- membered heteroaryl ring having 1-4 ring heteroatoms each independently O, S, and N.

[0244] In some embodiments, the “optionally substituted” alkyl, alkylene, heteroalkyl, heteroalkylene, alkenyl, alkynyl, carbocyclic, carbocyclylene, cycloalkyl, cycloalkylene, alkoxy, cycloalkoxy, heterocyclyl, or heterocyclylene herein can each be independently unsubstituted or substituted with 1, 2, 3, or 4 substituents independently selected from deuterium, F, Cl, -OH, CN, protected hydroxyl, oxo (as applicable), NH2, protected amino, NH(C1-4 alkyl) or a protected derivative thereof, N(C1-4 alkyl)(C1-4 alkyl), C1-4 alkyl, C2-4 alkenyl, C2-4alkynyl, C1-4alkoxy, C3-6cycloalkyl, C3-6cycloalkoxy, phenyl, 5 or 6 membered heteroaryl containing 1, 2, or 3 ring heteroatoms independently selected from O, S, and N, 3- 7 membered heterocyclyl containing 1 or 2 ring heteroatoms independently selected from O, S, and N, wherein each of the alkyl, alkenyl, alkynyl, alkoxy, cycloalkyl, cycloalkoxy phenyl, heteroaryl, and heterocyclyl, is optionally substituted with 1, 2, or 3 substituents independently selected from deuterium, F, -OH, oxo (as applicable), C1-4 alkyl, fluoro- substituted C1-4alkyl (e.g., CF3), C1-4alkoxy and fluoro-substituted C1-4alkoxy. In some embodiments, the “optionally substituted” aryl, arylene, heteroaryl or heteroarylene group herein can each be independently unsubstituted or substituted with 1, 2, 3, or 4 substituents independently selected from deuterium, F, Cl, -OH, -CN, NH2, protected amino, NH(C1-4 alkyl) or a protected derivative thereof, N(C1-4 alkyl)(C1-4 alkyl), –S(=O)(C1-4 alkyl), –SO2(C1- 4 alkyl), C1-4 alkyl, C2-4 alkenyl, C2-4 alkynyl, C1-4 alkoxy, C3-6 cycloalkyl, C3-6 cycloalkoxy, phenyl, 5 or 6 membered heteroaryl containing 1, 2 or 3 ring heteroatoms independently selected from O, S, and N, 3-7 membered heterocyclyl containing 1 or 2 ring heteroatoms independently selected from O, S, and N, wherein each of the alkyl, alkenyl, alkynyl, alkoxy,cycloalkyl, cycloalkoxy, phenyl, heterocyclyl, is optionally substituted with 1, 2, or 3 substituents independently selected from deuterium, F, -OH, oxo (as applicable), C1-4alkyl, fluoro-substituted C1-4 alkyl, C1-4 alkoxy and fluoro-substituted C1-4 alkoxy.

[0245] “Halo” or “halogen” refers to fluorine (fluoro, –F), chlorine (chloro, –Cl), bromine (bromo, –Br), or iodine (iodo, –I).

[0246] The term “pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art.

[0247] The term “tautomers” or “tautomeric” refers to two or more interconvertible compounds resulting from tautomerization. The exact ratio of the tautomers depends on several factors, including for example temperature, solvent, and pH. Tautomerizations are known to those skilled in the art. Exemplary tautomerizations include keto-to-enol, amide-to- imide, lactam-to-lactim, enamine-to-imine, and enamine-to-(a different enamine) tautomerizations.

[0248] The term “subject” (alternatively referred to herein as “patient”) as used herein, refers to an animal, preferably a mammal, most preferably a human, who has been the object of treatment, observation or experiment.

[0249] The term "inhibiting", "reducing," or any variation of these terms in relation of Polθ, includes any measurable decrease or complete inhibition to achieve a desired result. For example, there may be a decrease of about, at most about, or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more, or any range derivable therein, reduction of Polθ activity compared to its normal activity.

[0250] The term "homologous recombination" refers to the cellular process of genetic recombination in which nucleotide sequences are exchanged between two similar or identical DNA.

[0251] The term "homologous recombination (HR) deficient cancer", or any variation thereof, refers to a cancer that is characterized by a reduction or absence of a functional HR repair pathway. HR deficiency may arise from absence of one or more HR-associated genes or presence of one or more mutations in one or more HR-associated genes. Examples of HR-associated genes include BRCA1, RAD51B, CtlP (Choline Transporter- Like Protein), PALB2 (Partner and Localizer of BRCA2), XRCC2 (X-ray repair complementing defective repair in Chinese hamster cells 2), RECQL4 (RecQ Protein-Like 4), BLM (Bloom syndrome, RecQ helicase-like), WRN (Werner syndrome , one or more HR- associated genes) Nbs 1 (Nibnn), and genes encoding Fanconi anemia (FA) proteins or FA- like genes e.g, FANCA, FANCB, FANCC, FANCD1 (BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANJ (BRIP1), FANCL, FANCM, FANCN (RALB2), FANCP (SLX4), FANCS (BRCA1), RAD51C, and XPF.

[0252] The term "Polθ overexpression", or any variation thereof, refers to the increased expression or activity of Polθ in a diseased cell, e.g., cancerous cell, relative to expression or activity of Polθ in a normal cell (e.g., non-diseased cell of the same kind). The amount of Polθ can be at least 2-fold, at least 3-fold, at least 4- fold, at least 5- fold, at least 10-fold, or more relative to the Polθ expression in a normal cell. Examples of cancers having overexpression of Polθ include, but are not limited to, breast, ovarian, cervical, lung, colorectal, gastric, bladder and prostate cancers.

[0253] As used herein, the terms "treat," "treating," "treatment," and the like refer to eliminating, reducing, or ameliorating a disease or condition, and / or symptoms associated therewith. Although not precluded, treating a disease or condition does not require that the disease, condition, or symptoms associated therewith be completely eliminated. As used herein, the terms "treat," "treating," "treatment," and the like may include "prophylactic treatment," which refers to reducing the probability of redeveloping a disease or condition, or of a recurrence of a previously-controlled disease or condition, in a subject who does not have, but is at risk of or is susceptible to, redeveloping a disease or condition or a recurrence of the disease or condition. The term "treat" and synonyms contemplate administering a therapeutically effective amount of a compound described herein to a subject in need of such treatment.

[0254] The term "effective amount" refers to that amount of a compound or combination of compounds as described herein that is sufficient to effect the intended application including, but not limited to, prophylaxis or treatment of diseases. A therapeutically effective amount may vary depending upon the intended application (in vitro or in vivo), or the subject and disease condition being treated (e.g., the weight, age and gender of the subject), the severity of the disease condition, the manner of administration, etc. which can readily bedetermined by one of ordinary skill in term also applies to a dose that will induce a particular response in target cells and / or tissues. The specific dose will vary depending on the particular compounds chosen, the dosing regimen to be followed, whether the compound is administered in combination with other compounds, timing of administration, the tissue to which it is administered, and the physical delivery system in which the compound is carried.

[0255] As used herein, the singular form “a”, “an”, and “the”, includes plural references unless it is expressly stated or is unambiguously clear from the context that such is not intended.

[0256] The term “and / or” as used in a phrase such as “A and / or B” herein is intended to include both A and B; A or B; A (alone); and B (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0257] Headings and subheadings are used for convenience and / or formal compliance only, do not limit the subject technology, and are not referred to in connection with the interpretation of the description of the subject technology. Features described under one heading or one subheading of the subject disclosure may be combined, in various embodiments, with features described under other headings or subheadings. Further it is not necessarily the case that all features under a single heading or a single subheading are used together in embodiments. Examples Abbreviations CMPI 2-chloro-1-methylpyridinium iodide DCM dichloromethane DIAD diisopropyl azodicarboxylate DIPEA N,N-diisopropylethylamine DMAP 4-dimethylaminopyridine DMF N,N-dimethylformamide DMSO dimethylsulfoxide hrs hours LCMS liquid chromatography-mass spectrometryNBS N- NMI N-methylimidazole PE petroleum ether SFC super critical fluid TCFH N,N,N′,N′-tetramethylchloroformamidinium hexafluorophosphate TEA triethylamine X-Phos dicyclohexyl(2',4',6'-triisopropylbiphenyl-2-yl)phosphine

[0258] The various starting materials, intermediates, and compounds of embodiments herein can be isolated and purified where appropriate using conventional techniques such as precipitation, filtration, crystallization, evaporation, distillation, and chromatography. Characterization of these compounds can be performed using conventional methods such as by melting point, mass spectrum, nuclear magnetic resonance, and various other spectroscopic analyses. The abbreviations used in the Examples section should be understood as having their ordinary meanings in the art unless specifically indicated otherwise or obviously contrary from context. The examples are illustrative only and do not limit the claimed invention in any way.

[0259] Exemplary embodiments of steps for performing the synthesis of products described herein are described in greater detail infra. Intermediate A 6-phenyl-4,5,6,7-tetrahydrobenzo[d]thiazol-2-amine

[0260] To ag, 5.14 mmol) in THF (15 mL) was added thiourea (390.9 mg, 5.14 mmol). The mixture was stirred at room temperature for 24 hrs. LCMS showed the reaction was complete. The reaction mixture was concentrated under reduced pressure. The residue was treated with water and extracted with EtOAc. The combined organic layers were washed with saturate brine, dried over anhydrous Na2SO4, filtered and concentrated to afford the crude Intermediate A (1.3 g), which was used without further purification. LCMS (ESI, m / z): [M+H]+= 231.1. Intermediate B6-(4-chlorophenyl)- 1,3-benzothiazol-2-amine Step 1:

[0261] mg, , NBS (290 mg, 1.63 mmol) and p-toluenesulfonic acid (28.1 mg, 0.163 mmol) in CCl4 (5 mL) was stirred at 80 °C for 4 hrs. After completion, the reaction mixture was cooled to room temperature and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel (eluting with 1-5% EtOAc in PE) to afford 2-bromo-4- (4-chlorophenyl) cyclohexanone (210 mg).1H NMR (400 MHz, DMSO-d6) δ 7.43-7.30 (m, 4H), 4.63-4.57 (m, 1H), 3.43-3.33 (m, 1H), 3.22-3.12 (m, 1H), 2.68-2.58 (m, 1H), 2.34-2.18 (m, 2H), 2.09-1.93 (m, 2H). Step 2: 6-(4-chlorophenyl)-4,5,6,7-tetrahydro-1,3-benzothiazol-2-amine (B)

[0262] A solution of 2-bromo-4-(4-chlorophenyl) cyclohexanone (210 mg, 0.73 mmol) and thiourea (133 mg, 1.75 mmol) in THF (10 mL) was stirred at room temperature for 2 hrs under N2 atmosphere. LCMS showed the reaction was complete. The reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated under vacuum to afford Intermediate B (180 mg). LCMS (ESI, m / z): [M+H]+= 265.0. Intermediate C 2-amino-5-(4-chlorophenyl)-6,7-dihydrothiazolo[5,4-c]pyridin-4(5H)-one

[0263] To a solution of 4-chloroaniline (13.8 g, 0.108 mol) in acetic acid (8 mL) was added ethyl acrylate (13.0 g, 0.130 mol). The mixture was stirred at 100 °C for 16 hrs. LCMSshowed the reaction was complete. The mixture was cooled to room temperature and poured into saturated aqueous sodium bicarbonate solution. The resulting mixture was extracted with EtOAc. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel (eluting with 5% EtOAc in PE) to afford ethyl 3- ((4-chlorophenyl)amino)propanoate (13 g). LCMS (ESI, m / z): [M+H]+= 228.1. Step 2: ethyl 3-((4-chlorophenyl)(3-ethoxy-3-oxopropyl)amino)-3-oxopropanoate (C-2)

[0264] To a solution of ethyl 3-((4-chlorophenyl)amino)propanoate (13.0 g, 0.057 mol) in DCM (40 mL) was added DIPEA (14.7 g, 0.114 mol). After cooling to 0 °C, ethyl 3-chloro- 3-oxopropanoate (10.2 g, 0.068 mol) was added under N2. The mixture was stirred at room temperature for 18 hrs. LCMS showed the reaction was complete. The reaction mixture was poured into ice cold water and extracted with dichloromethane. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel (eluting with 25% EtOAc in PE) to afford ethyl 3-((4-chlorophenyl)(3-ethoxy-3- oxopropyl)amino)-3-oxopropanoate (10.0 g). LCMS (ESI, m / z): [M+H]+= 342.2. Step 3: ethyl 1-(4-chlorophenyl)-2,4-dioxopiperidine-3-carboxylate (C-3)

[0265] To a mixture of ethyl 3-((4-chlorophenyl)(3-ethoxy-3-oxopropyl)amino)-3- oxopropanoate (10.0 g, 0.029 mol) in ethanol (20 mL) was added sodium ethoxide (21% in ethanol, 19.1 g, 0.059 mol). The resulting mixture was stirred at reflux for 16 hrs under N2. LCMS showed the reaction was complete. The reaction mixture was concentrated under vacuum. The residue was dispersed in chloroform, acidified to pH = 3.0 with 1 N aqueous HCl and extracted with chloroform. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated under vacuum to afford the crude product which was used without purification. LCMS (ESI, m / z): [M+H]+= 296.1. Step 4: 1-(4-chlorophenyl)piperidine-2,4-dione (C-4)

[0266] To a round-bottom flask was added ethyl l-(4-chlorophenyl)-2,4-dioxopiperidine- 3-carboxylate (6.5 g, 0.022 mol), acetic acid (50 mL) and water (10 mL). The mixture was stirred at 100 °C for 4 hrs. LCMS showed the reaction was complete. The mixture was concentrated under reduced pressure. The residue was dispersed with water and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered andconcentrated under vacuum to afford the crude product which was used without purification. LCMS (ESI, m / z): [M+H]+= 224.0. Step 5: 3-bromo-1-(4-chlorophenyl)piperidine-2,4-dione (C-5)

[0267] To a solution of 1-(4-chlorophenyl)piperidine-2,4-dione (1.0 g, 4.47 mmol) in CH2Cl2 (25 mL) was added NBS (0.952 g, 5.34 mmol) at 0 ℃. The mixture was allowed to warm to room temperature and stirred for 18 hrs. LCMS showed the reaction was complete. The reaction mixture was treated with water and extracted with DCM. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The crude product was used without further purification. LCMS (ESI, m / z): [M+H]+= 301.7. Step 6: 2-amino-5-(4-chlorophenyl)-6,7-dihydrothiazolo[5,4-c]pyridin-4(5H)-one (C)

[0268] To the mixture of 3-bromo-1-(4-chlorophenyl)piperidine-2,4-dione (1.045 g, 3.45 mmol), sodium bicarbonate (320 mg, 3.81 mmol) in ethanol (20 mL) was added thiourea (291 mg, 3.82 mmol). The mixture was stirred at reflux for 2.5 hrs. LCMS showed the reaction was complete. The reaction mixture was concentrated under vacuum. The residue was dispersed with water and extracted with EtOAc. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by prep-HPLC (0.05% NH4HCO3) to afford Intermediate C (0.45 g). LCMS (ESI, m / z): [M+H]+= 280.1. Intermediate D 2-amino-5-(4-chlorophenyl)thiazolo[5,4-c]pyridin-4(5H)-one

[0269] To adioxane was added 2,3-dichloro-5,6-dicyano-1,4-benzoquinone (536 mg, 2.36 mmol) at room temperature. The mixture was stirred at 100 °C for 6 hrs. LCMS showed the reaction was complete. The reaction mixture was treated with saturated aqueous sodium bicarbonate solution and extracted with EtOAc. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel (eluting with 5% EtOAc in PE) to afford Intermediate D (65.0 mg). LCMS (ESI, m / z): [M+H]+= 278.1.E 6-(4-chlorophenyl)-6,7-dihydro-4H-pyrazolo[5,1-c][1,4]oxazin-2-amine ONO O 2 N NHO2NN BrK2CO3, MeCNCl NaBH4+ N Cl

[0270] To a solution of ethyl 3-nitro-1H-pyrazole-5-carboxylate (1.00 g, 5.40 mmol) in MeCN (60 mL) was added 2-bromo-1-(4-chlorophenyl)ethanone (1.39 g, 5.95 mmol) and K2CO3(1.49 g, 10.8 mmol). The mixture was stirred at reflux for 5 hrs. LCMS showed the reaction was complete. The reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were washed with 5% aqueous citric acid, dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel (eluting with 30% EtOAc in PE) to afford ethyl 2-[2-(4-chlorophenyl)-2-oxo-ethyl]-5-nitro-pyrazole-3-carboxylate (1.59 g). LCMS (ESI, m / z): [M+H]+= 336.0. Step 2: 1-(4-chlorophenyl)-2-(5-(hydroxymethyl)-3-nitro-1H-pyrazol-1-yl)ethan-1-ol (E-2)

[0271] To a solution of ethyl 2-[2-(4-chlorophenyl)-2-oxo-ethyl]-5-nitro-pyrazole-3- carboxylate (1.59 g, 4.71 mmol) in MeOH (59.5 mL) was added sodium borohydride (0.53 g, 14.1 mmol) at 0 °C. The mixture was stirred at 0 ℃ for 4 hrs. LCMS showed the reaction was complete. The reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were washed with 5% aqueous citric acid, dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel (eluting with 20-60% EtOAc in PE) to afford 1-(4- chlorophenyl)-2-[5-(hydroxymethyl)-3-nitro-pyrazol-1-yl]ethanol (861.0 mg). LCMS (ESI, m / z): [M+H]+= 296.2. Step 3: 6-(4-chlorophenyl)-2-nitro-6,7-dihydro-4H-pyrazolo[5,1-c][1,4]oxazine (E-3)

[0272] To a degassed solution of 1-(4-chlorophenyl)-2-[5-(hydroxymethyl)-3-nitro- pyrazol-1-yl]ethanol (340.0 mg, 1.14 mmol) in DCM (4 mL) was added PPh3 (898.7 mg, 3.43 mmol) and DIAD (692.8 mg, 3.43 mmol) under N2. The mixture was stirred at roomtemperature for 3 hrs. After completion, was treated with water and extracted with DCM. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel (eluting with 25% EtOAc in PE) to afford 6-(4-chlorophenyl)-2-nitro-6,7-dihydro-4H-pyrazolo[5,1-c][1,4]oxazine (184.0 mg). LCMS (ESI, m / z): [M+H]+= 280.1. Step 4: 6-(4-chlorophenyl)-6,7-dihydro-4H-pyrazolo[5,1-c][1,4]oxazin-2-amine (E)

[0273] To a solution of 6-(4-chlorophenyl)-2-nitro-6,7-dihydro-4H-pyrazolo[5,1- c][1,4]oxazine (180.0 mg, 0.64 mmol) in THF (3 mL) was added Raney nickel (37.8 mg) at room temperature under N2. Hydrazine (85% in water, 379 mg, 6.44 mmol) was added dropwise at 0 ℃. The mixture was stirred at room temperature for 3 hrs. LCMS showed the reaction was complete. The mixture was filtered and concentrated under reduced pressure. The residue was purified by reverse phase column chromatography (0.05% NH4HCO3) to afford Intermediate E (125.0 mg). LCMS (ESI, m / z): [M+H]+= 250.2. Intermediate F 5-(4-chlorophenyl)thiazolo[5,4-b]pyridin-2-amine

[0274] A mixture of tert-butyl (5-bromothiazolo[5,4-b]pyridin-2-yl)carbamate (700 mg, 2.12 mmol), (4-chlorophenyl)boronic acid (497 mg, 3.18 mmol), Pd(PPh3)2Cl2 (298 mg, 0.424 mmol) and Cs2CO3(1.45 g, 4.45 mmol) in DMF (36 mL) and water (9 mL) was degassed and stirred at 116 °C for 4 hrs under N2 atmosphere. LCMS showed the reaction was complete. The reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel (eluting with 10-50% EtOAc in PE) to afford tert-butyl (5-(4- chlorophenyl)thiazolo[5,4-b]pyridin-2-yl)carbamate (450 mg). LCMS (ESI, m / z): [M+H]+= 362.1. Step 2: 5-(4-chlorophenyl)thiazolo[5,4-b]pyridin-2-amine (F)

[0275] A solution of tert-butyl (5-(4-chlorophenyl) thiazolo[5,4-b] pyridine-2-yl) carbamate (450 mg, 1.24 mmol) and HCl (4 M in 1,4-dioxane, 10 mL) in MeOH (10 mL)was stirred at 50 °C for 1 hr. LCMS the reaction was complete. The reaction mixture was concentrated under vacuum to afford crude Intermediate F (400 mg). LCMS (ESI, m / z): [M+H]+= 261.9. Intermediate G 5-(6-methoxy-3-pyridyl)thiazolo[5,4-d]pyrimidin-2-amine Step 1:To a solution of 5-chlorothiazolo[5,4-d]pyrimidin-2-amine (500 mg, 2.68 mmol), (33 mg, 0.27 mmol) and TEA (542 mg, 5.36 mmol) in THF (10 mL) was added Boc2O (1.75 g, 8.02 mmol). The mixture was stirred at room temperature for 8 hrs. LCMS showed the reaction was complete. The mixture was concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel (eluting with 30% EtOAc in PE) to afford tert-butyl (5-chlorothiazolo[5,4-d]pyrimidin-2-yl)carbamate (500 mg). LCMS (ESI, m / z): [M+H]+= 287.1. Step 2: tert-butyl (5-(6-methoxypyridin-3-yl)thiazolo[5,4-d]pyrimidin-2-yl)carbamate (G-2)

[0277] A mixture of tert-butyl (5-chlorothiazolo[5,4-d]pyrimidin-2-yl)carbamate (220 mg, 0.767 mmol), (6-methoxy-3-pyridyl)boronic acid (141 mg, 0.921 mmol) in 1,4-dioxane (8 mL) and H2O (2 mL) was added Pd(dppf)Cl2·CH2Cl2complex (125 mg, 0.154 mmol) and Cs2CO3 (750 mg, 2.30 mmol) under N2. The mixture was degassed and stirred at 100 °C for 12 hrs under N2 atmosphere. LCMS showed the reaction was complete. The mixture was treated with water and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel (eluting with 20-50% EtOAc in PE) to afford tert- butyl (5-(6-methoxypyridin-3-yl)thiazolo[5,4-d]pyrimidin-2-yl)carbamate (270 mg). LCMS (ESI, m / z): [M+H]+= 360.3. Step 3: 5-(6-methoxy-3-pyridyl)thiazolo[5,4-d]pyrimidin-2-amine (G)

[0278] A solution of tert-butyl N-[5-(6-methoxy-3-pyridyl)thiazolo[5,4-d]pyrimidin-2- yl]carbamate (260 mg, 0.723 mmol) in HCl (4 M in 1,4-dioxane, 5 mL) was stirred at 50 °Cfor 12 hrs. LCMS showed the reaction The mixture was concentrated under vacuum to afford crude Intermediate G, which was used without further purification. LCMS (ESI, m / z): [M+H]+= 260.1. Intermediate H 6-[4-(difluoromethoxy)phenyl]thiazolo[4,5-b]pyrazin-2-amine 1)

[0279] A solution of tert-butyl N-(6-bromothiazolo[4,5-b]pyrazin-2-yl)carbamate (500 mg, 1.51 mmol), 2-[4-(difluoromethoxy)phenyl]-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (530 mg, 1.96 mmol), Pd(PPh3)2Cl2 (212 mg, 0.30 mmol) and Cs2CO3 (984 mg, 3.02 mmol) in DMF (8 mL) and water (2 mL) was degassed and stirred at 116 °C for 4 hrs under N2atmosphere. LCMS showed the reaction was complete. The reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel (eluting with 30% EtOAc in PE) to afford tert-butyl N-[6-[4- (difluoromethoxy)phenyl]thiazolo[4,5-b]pyrazin-2-yl]carbamate (550 mg). LCMS (ESI, m / z): [M+H]+= 394.9. Step 2: 6-[4-(difluoromethoxy)phenyl]thiazolo[4,5-b]pyrazin-2-amine (H)

[0280] To a mixture of tert-butyl N-[6-[4-(difluoromethoxy)phenyl]thiazolo[4,5- b]pyrazin-2-yl]carbamate (400 mg, 1.01 mmol) in MeOH (4 mL) was added HCl (4.0 M in 1,4-dioxane, 4 mL). The mixture was stirred at 50 °C for 2 hrs. LCMS showed the reaction was complete. The mixture was treated with saturated aqueous NaHCO3 solution and extracted with DCM. The combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. The crude Intermediate H was used without further purification. LCMS (ESI, m / z): [M+H]+= 295.2. Intermediate I 2'-chloro-5'-methoxy-6-methyl-[4,4'-bipyridine]-3-carboxylic acidStep 1:

[0281] a g, and (2- chloro-5-methoxypyridin-4-yl)boronic acid (8.96 g, 47.8 mmol) in 1,4-dioxane (100 mL) and H2O (25 mL) was added K2CO3 (18.0 g, 130.2 mmol) and Pd(dppf)Cl2·CH2Cl2 complex (3.18 g, 4.3 mmol) under N2. The mixture was degassed and stirred at 80 °C under N2atmosphere for 2 hrs. LCMS showed the reaction was complete. The reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel (eluting with 10-50% EtOAc in PE) to afford methyl 2'-chloro-5'-methoxy-6-methyl-[4,4'-bipyridine]-3-carboxylate (10.1 g). LCMS (ESI, m / z): [M+H]+= 293.3. Step 2: 2'-chloro-5'-methoxy-6-methyl-[4,4'-bipyridine]-3-carboxylic acid (I)

[0282] To a solution of methyl 2'-chloro-5'-methoxy-6-methyl-[4,4'-bipyridine]-3- carboxylate (10.1 g, 34.5 mmol) in THF (50 mL) and H2O (50 mL) was added LiOH·H2O (5.79 g, 138.0 mmol). The mixture was stirred at room temperature for 2 hrs. LCMS showed the reaction was complete. The reaction mixture was concentrated in vacuo to remove most THF. The resulting mixture was acidified with aqueous HCl solution (2 N) to pH = 4-5. The mixture was extracted with 10% MeOH in DCM. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel (eluting with 10% MeOH in DCM) to afford Intermediate I (8.7 g). LCMS (ESI, m / z): [M+H]+= 278.9.1H NMR (400 MHz, DMSO-d6) δ 13.05 (br s, 1H), 8.89 (s, 1H), 8.21 (s, 1H), 7.44(s, 1H), 7.30 (s, 1H), 3.78 (s, 3H), 2.56 (s, 3H). Intermediate J5'-methoxy-2',6- -3-carboxylic acid Step 1:

[0283] a -3- carboxylate (8.0 g, 27.3 mmol) in DME (100 mL) was added 2,4,6-trimethyl-1,3,5,2,4,6- trioxatriborinane (3.5 M in THF, 25 mL, 87.5 mmol), Pd(dppf)Cl2·CH2Cl2complex (3.96 g, 5.41 mmol) and K2CO3 (11.3 g, 81.8 mmol) under N2. The mixture was degassed and stirred at reflux for 16 hrs. LCMS showed the reaction was complete. The reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel (eluting with 10-50% EtOAc in PE) to afford methyl 5'-methoxy-2',6-dimethyl-[4,4'-bipyridine]-3-carboxylate (6.0 g). LCMS (ESI, m / z): [M+H]+= 273.2. Step 2: 5'-methoxy-2',6-dimethyl-[4,4'-bipyridine]-3-carboxylic acid (J)

[0284] To a solution of methyl 5'-methoxy-2',6-dimethyl-[4,4'-bipyridine]-3-carboxylate (6.0 g, 22.0 mmol) in THF (30 mL), methanol (10 mL) and water (10 mL) was added LiOH (1.05 g, 43.8 mmol). The mixture was stirred at room temperature for 3 hrs. LCMS showed the reaction was complete. The reaction mixture was concentrated under vacuum to remove most of the solvent. The remaining aqueous phase was acidified with aqueous HCl solution (2 N) to pH = 4-5. The mixture was purified with prep-HPLC (0.05% FA) to afford Intermediate J (3.0 g). LCMS (ESI, m / z): [M+H]+= 259.1;1H NMR (400 MHz, CD3OD) δ 8.88 (s, 1H), 8.12 (s, 1H), 7.28 (s, 1H), 7.23 (s, 1H), 3.84 (s, 3H), 2.63 (s, 3H), 2.54 (s, 3H). Intermediate K N-(5-chlorothiazolo[5,4-d]pyrimidin-2-yl)-5'-methoxy-2',6-dimethyl-[4,4'-bipyridine]-3- carboxamide

[0285] To a solution of g, 3.87 mmol) in MeCN (10 mL) was added 5-chlorothiazolo[5,4-d]pyrimidin-2-amine (0.86 g, 4.61 mmol), CMPI (1.98 g, 7.75 mmol) and Et3N (1.96 g, 19.4 mmol). The mixture was stirred at 40 °C for 3 hrs under N2. LCMS showed the reaction was complete. The mixture was treated with water and extracted with EtOAc. The combined organic layers were washed with saturate brine, dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure. The residue was triturated with EtOAc and PE (2 / 1) and filtered to afford Intermediate K (0.98 g). LCMS (ESI, m / z): [M+H]+= 427.2. Intermediate L N-(5-bromothiazolo[5,4-b]pyridin-2-yl)-2'-chloro-5'-methoxy-6-methyl-[4,4'-bipyridine]-3- carboxamide

[0286] To a5- bromothiazolo[5,4-b]pyridin-2-amine (2.48 g, 10.8 mmol) in DMF (40 mL) was added TCFH (3.02 g, 10.8 mmol) and NMI (1.77 g, 21.6 mmol) at room temperature. The mixture was stirred at room temperature for 16 hrs under N2. LCMS showed the reaction was complete. The reaction mixture was treated with water and extracted with DCM. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel (eluting with 50-80% EA in PE) to afford Intermediate L (860 mg). LCMS (ESI, m / z): [M+H]+= 490.0. Intermediate M N-(6-bromothiazolo[4,5-b]pyridin-2-yl)-5'-methoxy-2',6-dimethyl-[4,4'-bipyridine]-3- carboxamide

[0287] was added 6- bromothiazolo[4,5-b]pyridin-2-amine (1.66 g, 7.21 mmol), CMPI (1.98 g, 7.75 mmol) andEt3N (1.96 g, 19.4 mmol). The mixture at 40 °C under N2 for 2 hrs. LCMS showed the reaction was complete. The mixture was treated with water and extracted with EtOAc. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel (eluting with 5% MeOH in DCM) to afford Intermediate M (600 mg). LCMS (ESI, m / z): [M+H]+= 470.1. Intermediate N N-(3-bromothiazolo[4,5-c]pyridazin-6-yl)-5'-methoxy-2',6-dimethyl-[4,4'-bipyridine]-3- carboxamide Step 1:

[0288] To a solution of 4,6-dibromopyridazin-3-amine (2 g, 7.91 mmol) in acetone (20 mL) was added O-ethyl carbonisothiocyanatidate (9.10 g, 69.4 mmol). The mixture was stirred under N2at reflux for 16 hrs. LCMS showed the reaction was complete. The mixture was treated with water and extracted with MeOH / DCM (1 / 3). The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered, and concentrated under vacuum to afford the crude product which was used without further purification. LCMS (ESI, m / z): [M+H]+= 303.0. Step 2: 3-bromothiazolo[4,5-c]pyridazin-6-amine (N-2)

[0289] To a solution of the crude ethyl N-(3-bromothiazolo[4,5-c]pyridazin-6- yl)carbamate from step 1 in MeOH (20 mL) was added aqueous NaOH solution (2 N, 20 mL, 40 mmol). The mixture was stirred at 100 °C for 4 hrs. LCMS showed the reaction was complete. The reaction mixture was neutralized by aqueous HCl solution (1 N). The precipitate was collected, washed with water, and dried under vacuum to afford 3- bromothiazolo[4,5-c]pyridazin-6-amine (600 mg). LCMS (ESI, m / z): [M+H]+= 231.0. Step 3: N-(3-bromothiazolo[4,5-c]pyridazin-6-yl)-5'-methoxy-2',6-dimethyl-[4,4'-bipyridine]-3- carboxamide (N)

[0290] To a solution of 3- c]pyridazin-6-amine (280 mg, 1.21 mmol), Intermediate J (344 mg, 1.33 mmol) and NMI (497 mg, 6.05 mmol) in DMF (10 mL) was added TCFH (680 mg, 2.42 mmol). The mixture was stirred at 40 °C for 24 hrs. LCMS showed the reaction was complete. The mixture was treated with water and extracted with EtOAc. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel (eluting with 5% MeOH in DCM) to afford Intermediate N (60 mg). LCMS (ESI, m / z): [M+H]+= 471.1. Intermediate O N-(6-chlorothiazolo[4,5-c] pyridin-2-yl)-5'-methoxy-2',6-dimethyl-[4,4'-bipyridine]-3- carboxamide

[0291] 3.23 mmol) and Intermediate J (557 mg, 2.16 mmol) in MeCN (15 mL) was added CMPI (550 mg, 2.15 mmol) and TEA (218 mg, 2.15 mmol). After stirring under N2 at room temperature for 16 hrs, LCMS showed the reaction was complete. The mixture was treated with water and extracted with DCM. The combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel (eluting with 5% MeOH in DCM) to give Intermediate O (590 mg). LCMS (ESI, m / z): [M+H]+= 426.2. Intermediate P 2-(difluoromethyl)-5-methoxypyridin-4-yl trifluoromethanesulfonate

[0292] Intermediate P wasa litwerature reported procedure (WO202350007). Intermediate Q 2-bromo-4-(difluoromethyl)-1-methoxybenzene

[0293] To a stirred (4.3 g, 20.5 mmol) in DCM (10 mL) was added g, at 0 °C. After stirring at room temperature for 16 hrs, the reaction mixture was quenched with saturated aqueous NaHCO3 solution and extracted with DCM. The combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by silica gel column chromatography, eluting with PE / EtOAc (20:1), to afford Intermediate Q (2.69 g).1H NMR (400 MHz, DMSO-d6) δ 7.70 (s, 1H), 7.42 (d, J = 8.4 Hz, 1H), 6.94 (d, J = 8.4 Hz, 1H), 6.57 (t, J = 56.8 Hz, 1H), 3.93 (s, 3H). Intermediate R 2-chloro-5-(difluoromethoxy)-4-iodopyridine

[0294] A, sodium chlorodifluoroacetate (17.9 g, 117.4 mmol) and Cs2CO3(38.3 g, 117.4 mmol) in DMF (200 mL) was stirred at 100 °C for 16 hrs. After completion, the reaction mixture was treated with saturated brine and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel, eluting with PE / EtOAc (10:1), to afford Intermediate R (12 g).1H NMR (400 MHz, DMSO-d6) δ 8.31 (s, 1H), 8.24 (s, 1H), 7.40 (t, J = 72.6 Hz, 1H). Intermediate S methyl 5-bromo-1-methyl-2-oxo-1,2-dihydropyridine-4-carboxylate

[0295] To a stirreddihydropyridine-4-carboxylate (2 g, 8.62 mmol) and Cs2CO3 (8.44 g, 25.9 mmol) in DMF (30 mL) at 0 °C was added methyl iodide (1.84 g, 13.0 mmol) under N2atmosphere. After stirring for 2 hrs at room temperature, the reaction mixture was treated with water and extracted with EtOAc. The combined organiclayers were dried over anhydrous and concentrated under vacuum to afford Intermediate S (1.5 g). LCMS (ESI, m / z): [M+H]+= 246.0. Intermediate T ethyl 4-chloro-6-(1-(difluoromethyl)-1H-pyrazol-4-yl)nicotinate

[0296] A , 1-(difluoromethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (698 mg, 2.86 mmol), Pd(dppf)Cl2 (234 mg, 0.32 mmol), and Cs2CO3 (2.07 g, 6.36 mmol) in 1,4-dioxane (10 mL) and H2O (2.5 mL) was degassed and stirred at 80 °C for 2 hrs under N2 atmosphere. After completion, the reaction mixture was treated with H2O and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by flash column chromatography on silica gel, eluting with PE / EtOAc (10:1), to afford Intermediate T (400 mg). LCMS (ESI, m / z): [M+H]+= 301.9. Intermediate U 1-bromo-5-(difluoromethyl)-4-fluoro-2-methoxybenzene Step 1: 5-bromo-2-

[0297] To a stirred solution of Br2 (10.37 g, 64.8 mmol) in MeOH (50 mL) was added 2- fluoro-4-methoxybenzaldehyde (5 g, 32.4 mmol) in MeOH (10 ml) dropwise at -20 °C. After stirring at -20 °C, the reaction mixture was quenched with saturated aqueous sodium hydrogen sulfite solution and water. The precipates were collected by filtration, washed with water, and dried under reduce pressure to give 5-bromo-2-fluoro-4-methoxybenzaldehyde (U- 1, 6 g).1H NMR (400 MHz, DMSO-d6) δ 10.02 (s, 1H), 7.97 (d, J = 7.6 Hz, 1H), 7.25 (d, J = 12.4 Hz, 1H), 3.98 (s, 3H). Step 2: 1-bromo-5-(difluoromethyl)-4-fluoro-2-methoxybenzene (U)

[0298] To a stirred solution of 5-bromo-2-fluoro-4-methoxybenzaldehyde (5.9 g, 25.3 mmol) in DCM (6 mL) at 0 °C was added DAST (8.16 g, 50.6 mmol) under N2atmosphere. After stirring for 2 hrs at room temperature, the reaction mixture was quenched with MeOHfollowed by water and extracted with combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by silica gel column chromatography, eluting with PE / EtOAc (20:1), to afford Intermediate U (3.12 g).1H NMR (400 MHz, DMSO-d6) δ 7.82 (d, J = 7.6 Hz, 1H), 7.25 (d, J = 12.4 Hz, 1H), 7.10 (t, J = 54.0 Hz, 1H), 3.92 (s, 3H). Intermediate V methyl 5-bromo-1-(2-(dimethylamino)-2-oxoethyl)-2-oxo-1,2-dihydropyridine-4-carboxylate

[0299] To a stirred 4-carboxylate(2 g, 8.62 mmol) in DMF (20 mL) was added Cs2CO3(8.43 g, 25.9 mmol) and 2-bromo-N,N- dimethylacetamide (2.15 g, 13.0 mmol) under N2 atmosphere. After stirring for 2 hrs at room temperature, the reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under vacuum to afford Intermediate V (800 mg). LCMS (ESI, m / z): [M+H]+= 316.9. Intermediate W methyl 4-bromo-6-(dimethylcarbamoyl)nicotinate

[0300] A solution of methyl 4-bromo-6-methylnicotinate (2.3 g, 10 mmol) and DMF- DMA (3.57 g, 30 mmol) in DMF (10 mL) was stirred at 120 °C for 18 hrs under N2atmosphere. LCMS showed the reaction was complete. After cooling to room temperature, the reaction mixture was concentrated under vacuum. The residue was purified by silica gel column chromatography, eluting with PE / EtOAc (10:1), to afford methyl (E)-4-bromo-6-(2- (dimethylamino)vinyl)nicotinate (W-1, 1.1 g). LCMS (ESI, m / z): [M+H]+= 284.9. Step 2: 4-bromo-5-(methoxycarbonyl)picolinic acid (W-2)

[0301] To a solution of methyl (E)-4-bromo-6-(2-(dimethylamino)vinyl)nicotinate (W-1, 1 g, 3.51 mmol) and K2CO3 (969 mg, 7.01 mmol) in t-BuOH (17 mL) and water (17 mL) was added KMnO4(1.66 g, 10.5 mmol) portion-wise. After stirring for 1 hr at room temperature,the reaction mixture was filtered. The purified by reverse-phase column chromatography (0.1% FA) to afford 4-bromo-5-(methoxycarbonyl)picolinic acid (W-2, 550 mg). LCMS (ESI, m / z): [M+H]+= 260.0. Step 3: methyl 4-bromo-6-(dimethylcarbamoyl)nicotinate (W)

[0302] To a stirred solution of 4-bromo-5-(methoxycarbonyl)picolinic acid (W-2, 600 mg, 2.31 mmol) and dimethylamine hydrochloride (282 mg, 3.46 mmol) in MeCN (30 mL) was added CMPI (884 mg, 3.46 mmol) and TEA (934 mg, 1.29 mL, 9.23 mmol) under N2. After stirring at rt for 1 hr, the reaction mixture was treated with water and extracted with DCM. The combined organic layeres were washed with saturated brine, dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by silica gel column chromatography, eluting with PE / EtOAc (10:1 to 1:1), to afford Intermediate W (135 mg). LCMS (ESI, m / z): [M+H]+= 286.9. Intermediate X 4-(5-(difluoromethyl)-2-methoxyphenyl)-6-methylnicotinic acid Step 1:

[0303] A mixture of 2-bromo-4-(difluoromethyl)-1-methoxybenzene (2.68 g, 11.3 mmol), B2pin2(4.32 g, 17.0 mmol), Pd(dppf)Cl2(827 mg, 1.13 mmol) and KOAc (3.33 g, 33.9 mmol) in 1,4-dioxane (100 mL) was degassed and stirred at 100 °C for 3 hrs under N2 atmosphere. After cooling to room temperature, methyl 4-bromo-6-methylnicotinate (2.17 g, 9.43 mmol), Pd(dppf)Cl2 (690 mg, 0.943 mmol), Cs2CO3 (6.16 g, 18.9 mmol) and water (25 mL) were added to the mixture. The resulting mixture was degassed and stirred at 80 °C for another 2 hrs under N2 atmosphere. LCMS showed the reaction was complete. The reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by silica gel column chromatography, eluting with PE / EtOAc (10:1 to 2:1), to afford methyl 4-(5-(difluoromethyl)-2-methoxyphenyl)-6- methylnicotinate (X-1, 2 g). LCMS (ESI, m / z): [M+H]+= 308.2. Step 2: 4-(5-(difluoromethyl)-2-methoxyphenyl)-6-methylnicotinic acid (X)

[0304] To a stirred solution of (difluoromethyl)-2-methoxyphenyl)-6- methylnicotinate (1.8 g, 5.86 mmol) in MeOH (10 mL) and was added LiOH·H2O (1.23 g, 29.3 mmol) in water (20 mL). After stirring at room temperature for 3 hrs, the reaction mixture was concentrated under vacuum to remove most MeOH and water. The residue was acidified to pH = 5-6 with aqueous HCl solution (1 N). The mixture was purified by reversed- phase column chromatography (0.1% FA) to afford Intermediate X (1.3 g). LCMS (ESI, m / z): [M+H]+= 294.1.

[0305] The intermediates in the table below were synthesized using conditions analogous to that used to synthesize Intermediates X, by converting appropriate aromatic halide or triflate to the corresponding boronic reagents, Suzuki coupling and hydrolysis. Intermediate LCMS (ESI, m / z): NumberStructure Name[M+H]+-2- methoxyphenyl)-1-(2-Intermediate AL methyl 3-(5-chloro-2-methoxyphenyl)isonicotinate

[0306] To a solutionacid (3 g, 16.1 mmol) and methyl 3-bromoisonicotinate (3.47 g, 16.1 mmol) in 1,4-dioxane (50 mL) and water (15 mL) was added Pd(dppf)Cl2.DCM (1.29 g, 1.58 mmol) and K2CO3 (5.55 g, 40.2 mmol) under N2. The mixture was degassed and stirred at 100 °C for 4 hrs under N2atmosphere. LCMS showed the reaction was complete. The reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by silica gel column chromatography, eluting with PE / EtOAc (1:1), to afford Intermediate AL (2.5 g). LCMS (ESI, m / z): [M+H]+= 278.3.Step 1: methyl (AM-1)

[0307] a -3- carboxylate (I-1, 2.2 g, 7.52 mmol) in 1,4-dioxane (40 mL), water (10 mL) was added cyclopropylboronic acid (6.46 g, 75.2 mmol), Cs2CO3 (7.35 g, 22.6 mmol) and Pd(dppf)Cl2 (1.10 g, 1.50 mmol) under N2. The mixture was degassed and stirred at 90 °C for 6 hrs under N2 atmosphere. After completion, the reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by silica gel column chromatography, eluting with EtOAc, to afford methyl 2'-cyclopropyl-5'- methoxy-6-methyl-[4,4'-bipyridine]-3-carboxylate (AM-1, 2 g) as a brown oil. LCMS (ESI, m / z): [M+H]+= 299.2. Step 2: 2'-cyclopropyl-5'-methoxy-6-methyl-[4,4'-bipyridine]-3-carboxylic acid (AM)

[0308] To a solution of methyl 2'-cyclopropyl-5'-methoxy-6-methyl-[4,4'-bipyridine]-3- carboxylate (AM-1, 2 g, 6.70 mmol) in THF (30 mL) and water (15 mL) was added LiOH.H2O (1.41 g, 33.6 mmol). After stirring at room temperature for 16 hrs, the reaction mixture was concentrated under vacuum to remove most THF and water. The residue was acidified to pH = 5-6 with aqueous HCl solution (1 N). The mixture was purified by reversed- phase column chromatography (0.1% FA) to afford Intermediate AL (1.6 g). LCMS (ESI, m / z): [M+H]+= 285.2.

[0309] The intermediates in the table below were synthesized using conditions analogous to that used to synthesize Intermediate AL by reacting the synthesized hetero-biaryl chloride with commercially available boronic acid derivatives, via Suzuki coupling, then hydrolysis. Intermediate LCMS (ESI, m / z): Str t r N m5'- -2',6-dimethyl- AO[44'-bi ridin ]-3- rb x li id295.22-(2-(difluoromethyl)-5-methoxypyridin-4-yl)-4-(1-methyl-1H-pyrazol-3-yl)benzoic acid Step 1: 3-yl)benzoate (AQ-1)

[0310] To a solution of methyl 4-bromo-2-(2-(difluoromethyl)-5-methoxypyridin-4- yl)benzoate (precusor of Intermediate AD) (100 mg, 0.27 mmol) in 1,4-dioxane (3 mL) and water (1 mL) was added 1-methyl-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H- pyrazole (84 mg, 0.40 mmol), Pd(dppf)Cl2.CH2Cl2 (24 mg, 0.029 mmol) and Cs2CO3 (263 mg, 0.80 mmol) under N2. The mixture was degassed and stirred at 100 °C for 3 hrs under N2 atmosphere. After completion, the reaction mixture was concentrated under reduced pressure. The residue was purified with silica gel column chromatography, eluting with PE / EtOAc (5:1) to afford methyl 2-(2-(difluoromethyl)-5-methoxypyridin-4-yl)-4-(1-methyl-1H- pyrazol-3-yl)benzoate (AQ-1, 80 mg). LCMS (ESI, m / z): [M+H]+= 374.3. Step 2: 2-(2-(difluoromethyl)-5-methoxypyridin-4-yl)-4-(1-methyl-1H-pyrazol-3-yl)benzoic acid (AQ)

[0311] To a solution of methyl methyl 2-(2-(difluoromethyl)-5-methoxypyridin-4-yl)-4- (1-methyl-1H-pyrazol-3-yl)benzoate (AQ-1, 80 mg, 0.21 mmol) in THF (2 mL) and H2O (2 mL) was added LiOH·H2O (13.5 mg, 0.32 mmol). After stirring at room temperature for 12 hrs, the reaction mixture was concentrated to remove most THF. The mixture was acidified with aqueous HCl solution (1 N) to pH = 6. The resulting precipitates were collected by filtration, washed by water, and dried under vacuum to afford Intermediate AQ (70 mg). LCMS (ESI, m / z): [M+H]+= 360.2.The Intermediate in the table below was using conditions analogous to that used to synthesize Intermediates AQ, via suzuki coupling reaction. Intermediate LCMS (ESI, m / z): NumberStructure Structure[M+H]+N-(6-bromothiazolo[4,5-b]pyrazin-2-yl)-2'-(difluoromethyl)-5'-methoxy-6-methyl-[4,4'- bipyridine]-3-carboxamide

[0312] To ain MeCN (2.0 mL) was added 6-bromothiazolo[4,5-b]pyrazin-2-amine (141 mg, 0.61 mmol), Et3N (257 mg, 2.54 mmol) and CMPI (258 mg, 1.01 mmol) under N2. After stirring at room temperature for 4 hrs, the reaction mixture was concentrated to dryness under vacuum. The residue was purified by prep-HPLC (0.05% NH4HCO3) to afford Intermediate AS (150 mg). LCMS (ESI, m / z): [M+H]+ = 507.2.

[0313] The Intermediates in the table below were synthesized using conditions analogous to that used to synthesize Intermediates AS from the corresponding acids, via amide coupling reaction. Intermediate LCMS (ESI, m / z) Structure NameIntermediate AW 6-(cyclopropylethynyl)thiazolo[4,5-b]pyrazin-2-amineg, , (7.09 g, 32.5 mmol), DMAP (794 mg, 6.5 mmol) and TEA (4.38 g, 43.3 mmol) in acetone (150 mL) was stirred at 60 °C for 4 hrs. After completion, the reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by silica gel column chromatography, eluting with PE / EtOAc (8:1 to 1:1), to afford tert-butyl (6- bromothiazolo[4,5-b]pyrazin-2-yl)carbamate (AW-1, 4 g). LCMS (ESI, m / z): [M+H]+= 331.0. Step 2: tert-butyl (6-(cyclopropylethynyl)thiazolo[4,5-b]pyrazin-2-yl)carbamate (AW-2)

[0315] To a stirred mixture of tert-butyl (6-bromothiazolo[4,5-b]pyrazin-2-yl)carbamate 4 g, 12.1 mmol), ethynylcyclopropane (2.40 g, 36.3 mmol) and TEA (3.67 g, 36.3 mmol) in DMF (40 mL) was added CuI (230 mg, 1.21 mmol) and Pd(PPh3)4 (1.40 g, 1.21 mmol) under N2. The mixture was degassed and stirred at 90 °C for 2 hrs under N2atmosphere. The mixture was treated with water and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by silica gel column chromatography, eluting with PE / EtOAc (3:1), to afford tert-butyl (6-(cyclopropylethynyl)thiazolo[4,5-b]pyrazin-2-yl)carbamate (AW-2, 3 g). LCMS (ESI, m / z): [M+H]+= 317.2. Step 3: 6-(cyclopropylethynyl)thiazolo[4,5-b]pyrazin-2-amine (AW)

[0316] To a stirred solution of tert-butyl (6-(cyclopropylethynyl)thiazolo[4,5-b]pyrazin- 2-yl)carbamate (AW-2, 3 g, 9.48 mmol) in DCM (25 ml) was added TFA (12.5 ml). After stirring at room temperature for 2 hrs, the reaction mixture was concentrated to dryness under vacuum. The residue was purified by trituration with the mixture of aqueous ammonia and methanol to afford Intermediate AV (1.8 g). LCMS (ESI, m / z): [M+H]+= 217.2. Intermediate AX 5-(cyclopropylethynyl)thiazolo[5,4-d]pyrimidin-2-amine(G-1, 200 mg, 0.70 mmol) in 1,4-dioxane (3 mL) was added 2-(cyclopropylethynyl)-4,4,5,5- tetramethyl-1,3,2-dioxaborolane (201 mg, 1.05 mmol), Pd(dppf)Cl2(51 mg, 0.07 mmol) and Cs2CO3 (683 mg, 2.09 mmol) under N2. The mixture was degassed and stirred at 100 °C for 12 hrs under N2atmophsere. After completion, the reaction mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (0.05% NH4HCO3) to afford tert- butyl (5-(cyclopropylethynyl)thiazolo[5,4-d]pyrimidin-2-yl)carbamate (AX-1, 50 mg). LCMS (ESI, m / z): [M+H]+= 317.2. Step 2: 5-(cyclopropylethynyl)thiazolo[5,4-d]pyrimidin-2-amine (AX)

[0318] To a solution of tert-butyl (5-(cyclopropylethynyl)thiazolo[5,4-d]pyrimidin-2- yl)carbamate (AX-1, 50 mg, 0.174 mmol) in THF (2 mL) was added TFA (1 mL). After stirring at room temperature for 2 hrs, the reaction mixture was concentrated to dryness under vacuum to afford Intermediate AX which was used for the next step without purification. LCMS (ESI, m / z): [M+H]+= 217.1. Example 1 2'-chloro-5'-methoxy-6-methyl-N-(6-phenyl-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)-[4,4'- bipyridine]-3-carboxamide

[0319] was added TCFH (151.5 mg, 0.54 mmol) and NMI (147.8 mg, 1.80 mmol), followed by Intermediate A (92.0 mg, 0.40 mmol). The resulting mixture was stirred at room temperature for 2 hrs. LCMS showed the reaction was complete. The reaction mixture was directly purified by prep-HPLC (0.05% NH4HCO3) to afford Example 1. LCMS (ESI, m / z): [M+H]+= 491.5;1H NMR (400 MHz, DMSO-d6) δ 12.49 (br s, 1H), 8.78 (s, 1H), 8.17 (s, 1H), 7.51 (s, 1H), 7.41(s, 1H), 7.35-7.30 (m, 4H), 7.24-7.20 3.62 (s, 3H), 3.05-2.99 (m, 1H), 2.95-2.90 (m, 1H), 2.81-2.69 (m, 3H), 2.58 (s, 3H), 2.07-1.97 (m, 2H). Examples 2 and 3 (S)-2'-chloro-N-(6-(4-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)-5'-methoxy-6- methyl-[4,4'-bipyridine]-3-carboxamide and (R)-2'-chloro-N-(6-(4-chlorophenyl)-4,5,6,7- tetrahydrobenzo[d]thiazol-2-yl)-5'-methoxy-6-methyl-[4,4'-bipyridine]-3-carboxamide I (170mg, 0.642 mmol), Intermediate B (268 mg, 0.962 mmol) were coupled to afford 2'-chloro-N- (6-(4-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)-5'-methoxy-6-methyl-[4,4'- bipyridine]-3-carboxamide (100 mg). The racemate was purified by SFC with the following conditions (OJ column, 0.05% DEA) to afford two separate enantiomers (S)-2'-chloro-N-(6- (4-chlorophenyl)-4,5,6,7-tetrahydrobenzo[d]thiazol-2-yl)-5'-methoxy-6-methyl-[4,4'- bipyridine]-3-carboxamide and (R)-2'-chloro-N-(6-(4-chlorophenyl)-4,5,6,7- tetrahydrobenzo[d]thiazol-2-yl)-5'-methoxy-6-methyl-[4,4'-bipyridine]-3-carboxamide. Example 2 (peak 1): LCMS (ESI, m / z): [M+H]+= 525.2; Retention time on UPCC (YMC Triart C18) 11.6 min;1H NMR (400 MHz, DMSO-d6) δ 12.47 (br s, 1H), 8.78 (s, 1H), 8.17 (s, 1H), 7.51 (s, 1H), 7.40 (s, 1H), 7.38-7.34 (m, 4H), 3.62 (s, 3H), 3.09-3.01 (m, 1H), 2.95- 2.87 (m, 1H), 2.77 -2.66 (m, 3H), 2.58 (s, 3H), 2.05-1.95 (m, 2H). Example 3 (peak 2): LCMS (ESI, m / z): [M+H]+= 525.2, Retention time on UPCC (YMC Triart C18) 8.8 min;1H NMR (400 MHz, DMSO-d6) δ 12.41 (br s, 1H), 8.78 (s, 1H), 8.17 (s, 1H), 7.51 (s, 1H), 7.40 (s, 1H), 7.38-7.34 (m, 4H), 3.62 (s, 3H), 3.09-3.01 (m, 1H), 2.95-2.87 (m, 1H), 2.77-2.66 (m, 3H), 2.58 (s, 3H), 2.05-1.95 (m, 2H).

[0321] Examples 4-10 were synthesized using conditions analogous to that used to synthesize Example 1, by reacting acid Intermediate I with appropriate aminothiazoles from intermediate list or commercial sources. Example LCMS ,m / z): [M+H]+2'-chloro-N-(5-(4- thiazolo[5,4-b] pyridin-2-yl)-5'-Example 11 5'-methoxy-2',6-dimethyl-N-(6-methylthiazolo[4,5-b]pyrazin-2-yl)-[4,4'-bipyridine]-3- carboxamide

[0322] (3 mL) was added 6-methylthiazolo[4,5-b]pyrazin-2-amine (96.5 mg, 0.581 mmol), CMPI (197.8 mg, 0.774 mmol) and TEA (195.9 mg, 1.94 mmol). The mixture was stirred at 40 °C for 2 hrs under N2. LCMS showed the reaction was complete. The mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (0.1% FA) to afford Example 11. LCMS (ESI, m / z): [M+H]+= 407.2;1H NMR (400 MHz, DMSO-d6) δ 13.29 (br s, 1H), 8.84 (s, 1H), 8.50 (s, 1H), 8.18 (s, 1H), 7.39 (s, 1H), 7.29 (s, 1H), 3.57 (s, 3H), 2.60 (s, 3H), 2.59 (s, 3H), 2.49 (s, 3H).

[0323] Examples 12-14 were conditions analogous to that used to synthesize Example 11, by reacting acid Intermediate J with appropriate aminothiazoles from intermediate list or commercial sources. LCMS Example (ESI, MR: ]+Example 15 N-(6-(1-(2,2-difluoroethyl)-1H-pyrazol-4-yl)thiazolo[4,5-b]pyrazin-2-yl)-5'-methoxy-2',6- dimethyl-[4,4'-bipyridine]-3-carboxamide

[0324] To a solution of Example 13 0.212 mmol) in 1,4-dioxane (3 ml) and water (1 mL) was added 1-(2,2-difluoroethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2- yl)-1H-pyrazole (65.7 mg, 0.255 mmol), Pd(dppf)Cl2.DCM complex (17 mg, 0.021 mmol) and Cs2CO3(207 mg, 0.637 mmol) under N2. The mixture was degassed and stirred for 5 hrs at 100 °C under N2 atmosphere. LCMS showed the reaction was complete. The mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (0.05% FA) to afford Example 15. LCMS (ESI, m / z): [M+H]+= 523.3;1H NMR (400 MHz, DMSO-d6) δ 13.35 (br s, 1H), 9.01 (s, 1H), 8.83 (s, 1H), 8.55 (s, 1H), 8.26 (s, 1H), 8.19 (s, 1H), 7.41 (s, 1H), 7.31 (s, 1H), 6.57-6.30(m, 1H), 4.78-4.65 (m, 2H), 3.59 (s, 3H), 2.61 (s, 3H), 2.53 (s, 3H).

[0325] Examples 16-32 were synthesized using conditions analogous to that used to synthesize Example 15, by reacting Intermediates M, Example 10 or Example 13 with appropriate boronic acids or boronic acid esters from commercial sources. LCMS Example (ESI, : ]+1H NMR (400 MHz, DMSO-d6) δ 13.33 (br s,5'-methoxy-N-(6-(6- Hz, 1H), 8.19 (s, 1H), 7.41 3-yl)thiazolo[4,5-b]pyrazin-2-yl)-2',6- (s, 1H), 7.31 (s, 1H), 6.991H NMR (400 MHz, DMSO-d) δ 1335 (br syl)thiazolo[4,5-b]pyrazin- 3H), 3.64 (s, 3H), 2.61 (s, methoxy-6-methyl-[4,4'-bipyridine]-3- 3H).2'-chloro-5'-methoxy-N-(5-(5-methoxypyridin-2-yl)thiazolo[5,4-b]pyridin-2-yl)-6-methyl-[4,4'- bipyridine]-3-carboxamide

[0326] A mixture of 2-bromo-5-methoxypyridine (500 mg, 2.66 mmol), Sn2(n-Bu)6(4.63 g, 7.98 mmol), Pd2(dba)3 (244 mg, 0.266 mmol), tricyclohexylphosphine (149 mg, 0.531 mmol) and LiCl (564 mg, 13.3 mmol) in 1,4-dioxane (30 mL) was degassed and stirred at 110 °C under N2 for 4 hrs. LCMS showed the reaction was complete. The mixture was concentrated under reduced pressure. The residue was purified by flash column chromatography on silica gel (eluting with petroleum ether) to afford 5-methoxy-2- (tributylstannyl)pyridine (550 mg).1H NMR (400 MHz, DMSO-d6) δ 8.45 (d, J = 2.8 Hz, 1H), 7.36 (d, J = 8.0 Hz, 1H), 7.23 (dd, J = 8.0 Hz, 2.8 Hz, 1H), 3.79 (s, 3H), 1.58-1.42 (m, 6H), 1.32-1.23 (m, 6H), 1.10-0.98 (m, 6H), 0.83 (t, J = 7.2, 9H). Step 2: 2'-chloro-5'-methoxy-N-(5-(5-methoxypyridin-2-yl)thiazolo[5,4-b]pyridin-2-yl)-6- methyl-[4,4'-bipyridine]-3-carboxamide (33-2)

[0327] A mixture of Intermediate L (100 mg, 0.204 mmol), 5-methoxy-2- (tributylstannyl)pyridine (121.7 mg, 0.306 mmol), CuCl (40.4 mg, 0.408 mmol), LiCl (43.2 mg, 1.02 mmol) and Pd(PPh3)4(47.1 mg, 0.041 mmol) in 1,4-dioxane (5 mL) was degassedand stirred at 110 °C under N2 for 16 showed the reaction was complete. The mixture was filtered through a celite pad. The filtrate was concentrated under reduced pressure and purified by prep-HPLC (0.1% NH4OH) to afford Example 33. LCMS (ESI, m / z): [M+H]+= 519.3;1H NMR (400 MHz, DMSO-d6) δ 13.13 (br s, 1H), 8.87 (s, 1H), 8.44- 8.37 (m, 3H), 8.21 (d, J = 8.4 Hz, 1H), 8.18 (s, 1H), 7.60 (s, 1H), 7.55 (dd, J = 8.4 Hz, 3.2 Hz, 1H), 7.48 (s, 1H), 3.91 (s, 3H), 3.63 (s, 3H), 2.61 (s, 3H). Example 34 5'-methoxy-N-(5-(5-methoxypyridin-2-yl)thiazolo[5,4-d]pyrimidin-2-yl)-2',6-dimethyl-[4,4'- bipyridine]-3-carboxamide

[0328] dioxane (4 mL) was added hexamethylditin (231 mg, 0.71 mmol) and Pd(PPh3)4 (67 mg, 0.058 mmol) under N2. The mixture was degassed, then stirred at 100 °C under N2for 2 hrs. After cooling to room temperature, Intermediate K (124 mg, 0.29 mmol) and Pd(PPh3)2Cl2 (41 mg, 0.058 mmol) were added. The mixture was degassed and stirred at 100 °C under N2for 2 hrs. LCMS showed the reaction was complete. After concentration in vacuo, the residue was purified by prep-HPLC (0.05% NH4HCO3) to afford Example 34. LCMS (ESI, m / z): [M+H]+= 500.3;1H NMR (400 MHz, DMSO-d6): δ 13.34 (br s, 1H), 9.22 (s, 1H), 8.85 (s, 1H), 8.46- 8.41 (m, 2H), 8.19 (s, 1H), 7.55 (dd, J = 8.4 Hz, 3.2 Hz, 1H), 7.40 (s, 1H), 7.30 (s, 1H), 3.92 (s, 3H), 3.59 (s, 3H), 2.61 (s, 3H), 2.51 (s, 3H).

[0329] Examples 35-46 were synthesized using conditions analogous to that used to synthesize Examples 33 and 34, by converting appropriate commercially available heteroaryl halide to the corresponding tin reagents and subsequent Stille coupling. LCMS , : ]+1H NMR (400 MHz, DMSO- d6) δ 13.14 (br s, 1H), 8.89 (s,5'-methoxy-N-(6-(5- 1H), 4.00 (s, 3H), 3.59 (s, methoxypyrazin-2-yl)thiazolo[4,5- 3H), 2.58 (s, 3H), 2.48 (s,1H NMR (400 MHz, DMSO- d6) δ 1346 (br s 1H) 941 (sExample 47 5'-methoxy-2',6-dimethyl-N-(thiazolo[4,5-b]pyrazin-2-yl)-[4,4'-bipyridine]-3-carboxamide

[0330] (2 ml) and water (0.5mL) was added NaOAc (40.3 mg, 0.492 mmol) and Pd / C (containing 55% water, 17.3 mg). The reaction mixture was stirred at 80 ℃ for 14 hrs. LCMS showed the reaction was complete. The mixture was filtered and the filtrate concentrated under vacuum. The residue was purified by prep-HPLC (0.05% FA) to afford Example 47. LCMS (ESI, m / z): [M+H]+= 393.2;1H NMR (400 MHz, DMSO-d6) δ 13.42 (br s, 1H), 8.84 (s, 1H), 8.63 (d, J =2.4 Hz, 1H), 8.49 (d, J = 2.4 Hz, 1H), , 7.40 (s, 1H), 7.31 (s, 1H), 3.58 (s, 3H), 2.60 (s, 3H), 2.49 (s, 3H). Example 48 5'-methoxy-2',6-dimethyl-N-(6-(tetrahydro-2H-pyran-3-yl)thiazolo[4,5-b]pyrazin-2-yl)-[4,4'- bipyridine]-3-carboxamide[4,4'-bipyridine]-3-carboxamide (48-1)

[0331] To a solution of Example 13 (100 mg, 0.212 mmol) in 1,4-dioxane (3 mL) and water (0.5 mL) was added 2-(5,6-dihydro-2H-pyran-3-yl)-4,4,5,5-tetramethyl-1,3,2- dioxaborolane (44.6 mg, 0.212 mmol), Pd(dppf)Cl2.CH2Cl2 complex (17 mg, 0.021 mmol) and Cs2CO3(207 mg, 0.635 mmol) under N2. The mixture was degassed and stirred at 100 °C under N2 for 3 hrs. LCMS showed the reaction was complete. The mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (0.1% FA) to give N-(6- (5,6-dihydro-2H-pyran-3-yl)thiazolo[4,5-b]pyrazin-2-yl)-5'-methoxy-2',6-dimethyl-[4,4'- bipyridine]-3-carboxamide (22 mg). LCMS (ESI, m / z): [M+H]+= 475.2. Step 2: 5'-methoxy-2',6-dimethyl-N-(6-(tetrahydro-2H-pyran-3-yl)thiazolo[4,5-b]pyrazin-2-yl)- [4,4'-bipyridine]-3-carboxamide (48)

[0332] To a solution of N-(6-(5,6-dihydro-2H-pyran-3-yl)thiazolo[4,5-b]pyrazin-2-yl)-5'- methoxy-2',6-dimethyl-[4,4'-bipyridine]-3-carboxamide (22 mg, 0.046 mmol) in MeOH (3 mL) was added PtO2 (2.3 mg, 0.010 mmol) under N2. The mixture was purged with H2, then stirred under H2atmosphere (1 atm) at room temperature for 16 hrs. LCMS showed the reaction was complete. The mixture was filtered. The filtrate was concentrated under vacuum and purified by prep-HPLC (0.1% NH4HCO3) to afford Example 48. LCMS (ESI, m / z): [M+H]+= 477.3;1H NMR (400 MHz, DMSO-d6) δ 13.34 (br s, 1H), 8.86 (s, 1H), 8.53 (s, 1H), 8.17 (s, 1H), 7.36 (s, 1H), 7.27 (s, 1H), 3.98 (dd, J = 8.8 Hz, 3.2 Hz, 1H), 3.88 (d, J = 7.2 Hz, 1H), 3.57 (s, 3H), 3.52 (t, J = 10.8 Hz, 1H), 3.41 (m, 1H), 3.11 (m, 1H), 2.59 (s, 3H), 2.48 (s, 3H), 2.01 (m, 1H), 1.90 (m, 1H), 1.68 (m, 2H).49 N-(6-(1H-pyrazol-1-yl)thiazolo[4,5-b]pyrazin-2-yl)-5'-methoxy-2',6-dimethyl-[4,4'-bipyridine]- 3-carboxamide

[0333] was added1H- mg, , mg, , mg, 0.043 mmol) and K2CO3(58.6 mg, 0.424 mmol) under N2. The mixture was degassed and stirred at 100 °C under N2 for 18 hrs. LCMS showed the reaction was complete. The mixture was directly purified by prep-HPLC (0.05% FA) to afford Example 49. LCMS (ESI, m / z): [M+H]+= 459.3;1H NMR (400 MHz, DMSO-d6) δ 13.54 (br s, 1H), 9.21 (s, 1H), 8.89 (s, 1H), 8.68 (d, J = 2.8 Hz, 1H), 8.28 (s, 1H), 7.93 (d, J = 2.0 Hz, 1H), 7.51 (s, 1H), 7.45 (s, 1H), 6.66 (dd, J = 2.8 Hz, 2.0 Hz 1H), 3.63 (s, 3H), 2.63 (s, 3H), 2.56 (s, 3H). Example 50 2'-chloro-5'-methoxy-N-(6-(5-methoxypyridin-2-yl) thiazolo[4,5-b] pyrazin-2-yl)-6-methyl-[4,4'- bipyridine]-3-carboxamide6- methyl-[4,4'-bipyridine]-3-carboxamide (50-1)

[0334] A mixture of Example 10 (150 mg, 0.305 mmol), 2-(3,6-dihydro-2H-pyran-4-yl)- 4,4,5,5-tetramethyl-1,3,2-dioxaborolane (96.1 mg, 0.458 mmol), Pd(PPh3)2Cl2 (42.8 mg, 0.061 mmol) and Cs2CO3(248 mg, 0.763 mmol) in DMF (8 mL) and water (2 mL) was degassed and stirred at 110 °C under N2 for 4 hrs. LCMS showed the reaction was complete. The mixture was concentrated under vacuum. The residue was purified by flash column chromatography on silica gel (eluting with 1-5% MeOH in DCM) to afford 2'-chloro-N-(6- (3,6-dihydro-2H-pyran-4-yl)thiazolo[4,5-b]pyrazin-2-yl)-5'-methoxy-6-methyl-[4,4'- bipyridine]-3-carboxamide (110 mg). LCMS (ESI, m / z): [M+H]+= 495.1.Step 2: 2'-chloro-5'-methoxy-6-methyl-N- 2H-pyran-4-yl)thiazolo[4,5-b]pyrazin-2- yl)-[4,4'-bipyridine]-3-carboxamide (50)

[0335] To a mixture of 2'-chloro-N-(6-(3,6-dihydro-2H-pyran-4-yl)thiazolo[4,5- b]pyrazin-2-yl)-5'-methoxy-6-methyl-[4,4'-bipyridine]-3-carboxamide (70.0 mg, 0.141 mmol) in MeOH (20 mL) was added PtO2 (64.2 mg, 0.283 mmol) under N2. The mixture was purged with H2and stirred at room temperature for 16 hrs under H2(1 atm). LCMS showed the reaction was complete. The mixture was filtered through a celite pad. The filtrate was concentrated under reduced pressure. The residue was purified by prep-HPLC (0.1% FA) to afford Example 50. LCMS (ESI, m / z): [M+H]+= 497.3;1H NMR (400 MHz, DMSO-d6) δ 13.36 (br s, 1H), 8.89 (s, 1H), 8.58 (s, 1H), 8.16 (s, 1H), 7.58 (s, 1H), 7.46 (s, 1H), 4.01-3.95 (m, 2H), 3.62 (s, 3H), 3.51-3.44 (m, 2H), 3.18-3.10 (m, 1H), 2.61 (s, 3H), 1.87-1.79 (m, 4H). Example 51 2'-chloro-N-(6-(1-(2,2-difluoroethyl)piperidin-4-yl)thiazolo[4,5-b]pyrazin-2-yl)-5'-methoxy-6- methyl-[4,4'-bipyridine]-3-carboxamide Step 1: 1-tetrahydropyridine (51-1)

[0336] To a solution of 4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,2,3,6- tetrahydropyridine hydrochloride (1.5 g, 6.11 mmol) in DMF (6 mL) was added 2,2- difluoroethyl trifluoromethanesulfonate (2.2 g, 10.3 mmol) and DIPEA (1.85 g, 14.2 mmol). The mixture was stirred at room temperature for 2 hrs. After completion, the reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered and concentrated to afford 1-(2,2- difluoroethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,2,3,6-tetrahydropyridine (1.0g).1H NMR (400 MHz, DMSO-d6) δ (m, 1H), 6.11 (tt, J = 55.6 Hz, 4.4 Hz, 1H), 3.10 (m, 2H), 2.76 (td, J =15.6 Hz, 4.4 Hz, 2H), 2.57 (t, J = 5.6 Hz, 2H), 2.12-2.07 (m, 2H), 1.19 (s, 12H). Step 2: 2'-chloro-N-(6-(1-(2,2-difluoroethyl)-1,2,3,6-tetrahydropyridin-4-yl)thiazolo[4,5- b]pyrazin-2-yl)-5'-methoxy-6-methyl-[4,4'-bipyridine]-3-carboxamide (51-2)

[0337] To a solution of Example 10 (100 mg, 0.203 mmol) in 1,4-dioxane (4 mL) was added 1-(2,2-difluoroethyl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,2,3,6- tetrahydropyridine (66.7 mg, 0.244 mmol), Pd(dppf)Cl2.DCM complex (16.2 mg, 0.020 mmol) and Cs2CO3 (199 mg, 0.61 mmol) under N2. The mixture was degassed and stirred at 100 °C under N2for 2 hrs. LCMS showed the reaction was complete. The reaction mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (0.05% FA) to afford 2'-chloro-N-(6-(1-(2,2-difluoroethyl)-1,2,3,6-tetrahydropyridin-4- yl)thiazolo[4,5-b]pyrazin-2-yl)-5'-methoxy-6-methyl-[4,4'-bipyridine]-3-carboxamide (50 mg). LCMS (ESI, m / z): [M+H]+= 558.2. Step 3: 2'-chloro-N-(6-(1-(2,2-difluoroethyl)piperidin-4-yl)thiazolo[4,5-b]pyrazin-2-yl)-5'- methoxy-6-methyl-[4,4'-bipyridine]-3-carboxamide (51)

[0338] To a solution of 2'-chloro-N-(6-(1-(2,2-difluoroethyl)-1,2,3,6-tetrahydropyridin-4- yl)thiazolo[4,5-b]pyrazin-2-yl)-5'-methoxy-6-methyl-[4,4'-bipyridine]-3-carboxamide (50 mg, 0.90 mmol) in methanol (2 mL) was added PtO2 (5 mg, 0.02 mmol) under N2. The mixture was purged with H2and stirred at room temperature under H2(1 atm) for 2 hrs. LCMS showed the reaction was complete. The mixture was filtered and concentrated under reduced pressure. The residue was purified by prep-HPLC (0.05% FA) to afford Example 51. LCMS (ESI, m / z): [M+H]+= 560.3;1H NMR (400 MHz, DMSO-d6): δ 13.32 (br s, 1H), 8.90 (s, 1H), 8.55 (s, 1H), 8.16 (s, 1H), 7.57 (s, 1H), 7.44 (s, 1H), 6.16 (tt, J = 56.0 Hz, 4.0 Hz, 1H), 3.62 (s, 3H), 3.03 (m, 2H), 2.89-2.72 (m, 3H), 2.60 (s, 3H), 2.35-2.27 (m, 2H), 1.88-1.77 (m, 4H). Example 52 2'-chloro-5'-methoxy-6-methyl-N-(6-morpholinothiazolo[4,5-b]pyrazin-2-yl)-[4,4'-bipyridine]-3- carboxamide

[0339] was added mg, mg, . was stirred at 120 ℃ for 16 hrs under N2. LCMS showed the reaction was complete. The reaction mixture was purified by prep-HPLC (0.05% NH4HCO3) to afford Example 52. LCMS (ESI, m / z): [M+H]+= 498.2;1H NMR (400 MHz, DMSO-d6) δ 13.00 (br s, 1H), 8.87 (s, 1H), 8.31 (s, 1H), 8.16 (s, 1H), 7.55 (s, 1H), 7.42 (s, 1H), 3.77-3.70 (m, 4H), 3.62 (s, 3H), 3.57-3.51 (m, 4H), 2.59 (s, 3H). Example 53 5'-methoxy-N-(6-(4-methoxyphenyl) thiazolo[4,5-c]pyridin-2-yl)-2',6-dimethyl-[4,4'-bipyridine]- 3-carboxamide

[0340] boronic acid (286 mg, 1.88 mmol), X-Phos (45 mg, 0.094 mmol), Pd2(dba)3 (43 mg, 0.047 mmol) and Na2CO3 (149 mg, 1.41 mmol) in 1,4-dioxane (7.5 mL) and water (2.5 mL) was degassed. The mixture was stirred at 110 °C under N2 for 1 hr. LCMS showed the reaction was complete. The mixture was treated with water and extracted with DCM / MeOH (10:1). The combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by prep-HPLC (0.1% FA) to give Example 53. LCMS (ESI, m / z): [M+H]+= 498.3;1H NMR (400 MHz, DMSO-d6) δ 8.99 (s, 1H), 8.85 (s, 1H), 8.49 (s, 1H), 8.18 (s, 1H), 8.07 (d, J = 8.8 Hz, 2H), 7.36 (s, 1H), 7.27 (s, 1H), 7.05 (d, J = 8.8 Hz, 2H), 3.82 (s, 3H), 3.57 (s, 3H), 2.59 (s, 3H), 2.48 (s, 3H). Example 54 (E)-N-(6-(2-cyclopropylvinyl) thiazolo[4,5-b] pyrazin-2-yl)-5'-methoxy-2',6-dimethyl-[4,4'- bipyridine]-3-carboxamide

[0341] A cyclopropylvinyl)- 4,4,5,5- mg, , Cl2(23.3 mg, 0.032 mmol) and Cs2CO3 (207 mg, 0.636 mmol) in 1,4-dioxane (8 mL) and water (2 mL) was degassed and stirred at 80 °C for 2 hrs under N2atmosphere. LCMS showed the reaction was complete. The reaction mixture was concentrated under vacuum. The residue was purified by reversed-phase column chromatography (0.1% FA) to afford Example 54 (110 mg). LCMS (ESI, m / z): [M+H]+= 459.3;1H NMR (400 MHz, DMSO-d6) δ 13.32 (brs, 1H), 8.82 (s, 1H), 8.57 (s, 1H), 8.18 (s, 1H), 7.40 (s, 1H), 7.31 (s, 1H), 6.72 (d, J = 15.6 Hz, 1H), 6.43 (dd, J = 15.6 Hz, 9.6 Hz, 1H), 3.58 (s, 3H), 2.60 (s, 3H), 2.49 (s, 3H), 1.71-1.68 (m, 1H), 0.92-0.82 (m, 2H), 0.70-0.62 (m, 2H). Example 55 N-(6-(2-cyclopropylethyl)thiazolo[4,5-b]pyrazin-2-yl)-5'-methoxy-2',6-dimethyl-[4,4'- bipyridine]-3-carboxamide

[0342] AmL) was added Pd / C (10% palladium on carbon, wetted with ca.55% water for safety, 90 mg) under N2atmosphere. The mixture was purged with H2, then stirred under H2 atmosphere (1 atm) at room temperature for 16 hrs. LCMS showed the reaction was complete. The reaction mixture was filtered through a Celite pad. The filtrate was concentrated under vacuum. The residue was purified by prep-HPLC (0.1% FA) to afford Example 55. LCMS (ESI, m / z): [M+H]+= 461.4;1H NMR (400 MHz, DMSO-d6) δ 13.29 (brs, 1H), 8.83 (s, 1H), 8.53 (s, 1H), 8.18 (s, 1H), 7.39 (s, 1H), 7.30 (s, 1H), 3.57 (s, 3H), 2.95 (t, J = 7.6 Hz, 2H), 2.60 (s, 3H), 2.49 (s, 3H), 1.63 (m, 2H), 0.73 (m, 1H), 0.41-0.36 (m, 2H), 0.06-0.01 (m, 2H). Example 56 N-(6-(3-hydroxypropyl)thiazolo[4,5-b]pyrazin-2-yl)-5'-methoxy-2',6-dimethyl-[4,4'-bipyridine]- 3-carboxamide

[0343] To a solution of Example 13 (203 mg, 0.43 mmol) in 1,4-dioxane (5 mL) and water (1 mL) was added ethyl (E)-3-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)acrylate (117.6 mg, 0.52 mmol), Pd(dppf)Cl2.CH2Cl2 (32.4 mg, 0.04 mmol) and Cs2CO3 (277 mg, 0.85 mmol) under N2. The mixture was degassed and stirred at 100 °C for 3 hrs under N2 atmosphere. LCMS showed the reaction was complete. The reaction mixture was concentrated under reduced pressure. The residue was purified with flash column chromatography, eluting with PE / EtOAc (1:1) to give ethyl (E)-3-(2-(5'-methoxy-2',6- dimethyl-[4,4'-bipyridine]-3-carboxamido)thiazolo[4,5-b]pyrazin-6-yl)acrylate (56-1, 150 mg). LCMS (ESI, m / z): [M+H]+= 491.3. Step 2: ethyl 3-(2-(5'-methoxy-2',6-dimethyl-[4,4'-bipyridine]-3-carboxamido)thiazolo[4,5- b]pyrazin-6-yl)propanoate (56-2)

[0344] To a solution of ethyl (E)-3-(2-(5'-methoxy-2',6-dimethyl-[4,4'-bipyridine]-3- carboxamido)thiazolo[4,5-b]pyrazin-6-yl)acrylate (56-1, 150 mg, 0.306 mmol) and NiCl2 (4 mg, 0.031 mmol) in MeOH (5 mL) was added NaBH4(11 mg, 0.306 mmol) at 0 °C. After stirring at room temperature for 2 hrs, the filtrate was concentrated under vacuum. The residue was purified by prep-HPLC (0.1% FA) to afford ethyl 3-(2-(5'-methoxy-2',6- dimethyl-[4,4'-bipyridine]-3-carboxamido)thiazolo[4,5-b]pyrazin-6-yl)propanoate (56-2, 90 mg). LCMS (ESI, m / z): [M+H]+= 493.2. Step 3: N-(6-(3-hydroxypropyl)thiazolo[4,5-b]pyrazin-2-yl)-5'-methoxy-2',6-dimethyl-[4,4'- bipyridine]-3-carboxamide (56)

[0345] To a solution of ethyl 3-(2-(5'-methoxy-2',6-dimethyl-[4,4'-bipyridine]-3- carboxamido)thiazolo[4,5-b]pyrazin-6-yl)propanoate (56-2, 90 mg, 0.182 mmol) in dry THF (5 mL) was added LiAlH4 (7 mg, 0.182 mmol) and NaBH4 (11 mg, 0.306 mmol) under N2 at -70 °C. After stirring at -70 °C for 1 hr, the reaction mixture was quenched with water and concentrated to dryness under vacuum. The residue was purified by prep-HPLC (0.05% NH4HCO3) to afford Example 56. LCMS (ESI, m / z): [M+H]+= 451.3;1H NMR (400 MHz, DMSO-d6): δ 13.31 (brs, 1H), 8.83 (s, 1H), 8.54 (s, 1H), 8.20 (s, 1H), 7.42 (s, 1H), 7.34 (s,1H), 4.50 (brs, 1H), 3.58 (s, 3H), 3.46 Hz, 2H), 2.92 (t, J = 6.4 Hz, 2H), 2.61 (s, 3H), 2.49 (s, 3H), 1.89 (m, 2H). Example 57 N-(6-(cyclohexylethynyl)thiazolo[4,5-b]pyrazin-2-yl)-2'-(difluoromethyl)-5'-methoxy-6-methyl- [4,4'-bipyridine]-3-carboxamide

[0346] (2 mL) wasadded ethynylcyclohexane (85.3 mg, 0.79 mmol), CuI (3.8 mg, 0.020 mmol), Et3N (81 mg, 0.80 mmol) and Pd(PPh3)2Cl2(14.1 mg, 0.020 mmol) under N2. The mixture was degassed and stirred at 55 °C for 16 hrs under N2 atmosphere. LCMS showed the reaction was complete. The reaction mixture was purified by prep-HPLC (0.1% FA) to afford Example 57. LCMS (ESI, m / z): [M+H]+= 535.4;1H NMR (400 MHz, DMSO-d6): δ 13.56 (brs, 1H), 8.93 (s, 1H), 8.58 (s, 1H), 8.46 (s, 1H), 7.71 (s, 1H), 7.43 (s, 1H), 6.99 (t, J = 55.2 Hz, 1H), 3.70 (s, 3H), 2.73 (m, 1H), 2.61 (s, 3H), 1.88-1.85 (m, 2H), 1.72-1.68 (m, 2H), 1.52-1.48 (m, 3H), 1.38-1.34 (m, 3H).

[0347] The Examples in the table below were synthesized using conditions analogous to that used to synthesize Example 57 from the corresponding bromide and commercially available alkyne, via Sonogashira coupling reaction. LCMS , : ]+N-(6-(cyclobutylethynyl) (s, 1H), 7.44 (s, 1H), 6.99 (t, J = b]pyrazin-2-yl)-2'-(difluoromethyl)-5'- 55.2 Hz, 1H), 3.70 (s, 3H), 3.38phenylcyclopropyl)ethynyl) 2.58 (s, 3H), 1.61-1.57 (m, 2H), b]pyrazin-2-yl)-[4,4'-bipyridine]-3- 1.47-1.43 (m, 2H).1H NMR (400 MHz, DMSO-d6) δ 13.54 (brs, 1H), 8.93 (s, 1H),1H NMR (400 MHz, DMSO-d6):1H NMR (400 MHz, DMSO-d6) δ 13.55 (brs, 1H), 8.90 (s, 1H), 2N-(6-(3,3-difluoroprop-1-yn-1-yl)thiazolo[4,5-b]pyrazin-2-yl)-5'-methoxy-2',6-dimethyl-[4,4'- bipyridine]-3-carboxamide[4,4'-bipyridine]-3-carboxamide (81-1)

[0348] To a solution of Example 13 (2.0 g, 4.24 mmol) in DMF (10 mL) was added 3,3- diethoxyprop-1-yne (1.63 g, 12.6 mmol), Pd(PPh3)2Cl2 (0.30 g, 0.43 mmol), CuI (81 mg, 0.43 mmol) and Et3N (2.15 g, 21.3 mmol) under N2. The mixture was degassed and stirred at 45 °C for 2 hrs under N2 atmosphere. LCMS showed the reaction was complete. The reaction mixture was concentrated under reduced pressure. The residue was purified by prep-HPLC (0.05% NH4HCO3) to afford N-(6-(3,3-diethoxyprop-1-yn-1-yl)thiazolo[4,5-b]pyrazin-2-yl)- 5'-methoxy-2',6-dimethyl-[4,4'-bipyridine]-3-carboxamide (81-1, 1.50 g). LCMS (ESI, m / z): [M+H]+= 519.2. Step 2: 5'-methoxy-2',6-dimethyl-N-(6-(3-oxoprop-1-yn-1-yl)thiazolo[4,5-b]pyrazin-2-yl)-[4,4'- bipyridine]-3-carboxamide (81-2)

[0349] A solution of N-(6-(3,3-diethoxyprop-1-yn-1-yl)thiazolo[4,5-b]pyrazin-2-yl)-5'- methoxy-2',6-dimethyl-[4,4'-bipyridine]-3-carboxamide (81-1, 1.50 g, 2.90 mmol) in TFA (10 mL) was stirred at 50 °C for 2 hrs. LCMS showed the reaction was complete. The reaction mixture was concentrated under vacuum. The residue was purified by prep-HPLC (0.1% FA) to afford 5'-methoxy-2',6-dimethyl-N-(6-(3-oxoprop-1-yn-1-yl)thiazolo[4,5- b]pyrazin-2-yl)-[4,4'-bipyridine]-3-carboxamide (81-2, 490 mg). LCMS (ESI, m / z): [M+H]+= 445.2.Step 3: N-(6-(3,3-difluoroprop-1-yn-1-yl) b]pyrazin-2-yl)-5'-methoxy-2',6-dimethyl- [4,4'-bipyridine]-3-carboxamide (81)

[0350] To a solution of 5'-methoxy-2',6-dimethyl-N-(6-(3-oxoprop-1-yn-1- yl)thiazolo[4,5-b]pyrazin-2-yl)-[4,4'-bipyridine]-3-carboxamide (81-2, 490 mg, 1.10 mmol) in DCM (6 mL) was added DAST (355 mg, 2.20 mmol) dropwise at 0 °C under N2. After stirring at rt for 2 hrs under N2atmosphere, the reaction mixture was quenched by saturated aqueous NaHCO3 solution and extracted with DCM. The combined organic layers were washed with brine, dried over Na2SO4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with DCM / MeOH (20:1- 10:1), to afford the impure product, which was further purified by prep-HPLC (0.1% FA) to afford Example 81. LCMS (ESI, m / z): [M+H]+= 467.3;1H NMR (400 MHz, DMSO-d6): δ 9.07 (s, 1H), 8.49 (s, 1H), 8.16 (s, 1H), 8.14 (s, 1H), 7.13 (s, 1H), 7.10 (s, 1H), 7.02 (t, J = 54.0 Hz, 1 H), 3.58 (s, 3H), 2.54 (s, 3H), 2.45 (s, 3H). Example 82 N-(6-(cyclopropylethynyl) thiazolo[4,5-b] pyrazin-2-yl)-4-(5-(difluoromethyl)-2- methoxyphenyl)-6-methylnicotinamide

[0351] and Intermediate AW (111 mg, 0.513 mmol) in DMF (4 mL) was added TCFH (143 mg, 0.51o mmol) and NMI (83.7 mg, 1.02 mmol) under N2. After stirring at room temperature for 16 hrs, the reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by prep-HPLC (0.1% FA) to provide Example 82. LCMS (ESI, m / z): [M+H]+= 492.3;1H NMR (400 MHz, DMSO-d6) δ 13.43 (brs, 1H), 8.78 (s, 1H), 8.63 (s, 1H), 7.63 (m, 2H), 7.39 (s, 1H), 7.12 (d, J = 8.4 Hz, 1H), 7.05 (t, J = 56.0 Hz, 1H), 3.55 (s, 3H), 2.60 (s, 3H), 1.66 (m, 1H), 1.00-0.95 (m, 2H), 0.87-0.82 (m, 2H). Example 83 2'-cyclopropyl-N-(6-(cyclopropylethynyl)thiazolo[4,5-b]pyrazin-2-yl)-5'-methoxy-6-methyl- [4,4'-bipyridine]-3-carboxamide

[0352] (5 mL) was added , and CMPI (89.4 mg, 0.35 mmol). After stirring at room temperature for 16 hrs, the reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by prep-HPLC (0.1% NH4OH) to afford Example 83. LCMS (ESI, m / z): [M+H]+= 483.2;1H NMR (400 MHz, DMSO-d6) δ 13.48 (brs, 1H), 8.86 (s, 1H), 8.58 (s, 1H), 8.15 (s, 1H), 7.40 (s, 1H), 7.31 (s, 1H), 3.56 (s, 3H), 2.60 (s, 3H), 2.14 (m, 1H), 1.65 (m, 1H), 0.99-0.88 (m, 6H), 0.86-0.81 (m, 2H).

[0353] The Examples in the table below were synthesized using conditions analogous to that used to synthesize Example 83 from the corresponding acids and amines, via amide coupling reactions. LCMS Exam le (ESI, : ]+methoxyphenyl)- dimethylpyridine-2,5-4-bromo-N-(6- 1H), 6.95 (t, J = 54.8 Hz, 1H), (cyclopropylethynyl)thiazolo[4,5- 3.69 (s, 3H), 1.62 (m, 1H),1H NMR (400 MHz, DMSO-d6) δ 13.56 (brs, 1H), 8.79 (d, J =1H), 1.00-0.96 (m, 2H), 0.94- 0.88 (m, 2H), 0.88-0.82 (m,Example 102 N-(6-(cyclopropylmethoxy)thiazolo[4,5-b]pyrazin-2-yl)-5'-methoxy-2',6-dimethyl-[4,4'- bipyridine]-3-carboxamide

[0354] (1.0 mL), Cs2CO3(124 mg, 0.38 mmol) in DMSO (1.0 mL) was added Pd(OAc)2(4.3 mg, 0.019 mmol) and t-BuXPhos (8.1 mg, 0.019 mmol) under N2. The mixture was degassed and stirred at 110 °C for 3 hrs under N2atmosphere. After completion, the reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by prep-HPLC (0.1% FA) to afford Example 102. LCMS (ESI, m / z): [M+H]+= 463.3;1H NMR (400 MHz,DMSO-d6) δ 13.16 (s, 1H), 8.81 (s, 1H) 1H), 8.18 (s, 1H), 7.39 (s, 1H), 7.29 (s, 1H), 4.19 (d, J = 7.2 Hz, 2H), 3.57 (s, 3H), 2.60 (s, 3H), 2.49 (s, 3H), 1.28 (m, 1H), 0.61-0.56 (m, 2H), 0.40-0.36 (m, 2H).

[0355] The Examples in the table below were synthesized using conditions analogous to that used to synthesize Example 102 from the corresponding bromides and acohols, via C-O coupling reactions. LCMS Example (ESI, : ]+b]pyrazin-2-yl)-2'- Hz, 2H), 3.70 (s, 3H), 2.62 (s, (difluoromethyl)-5'-methoxy-6- 3H), 2.36 (m, 1H), 1.83-1.74 (m,p 4-cyano-N-(6-(cyclopropylethynyl)thiazolo[4,5-b]pyrazin-2-yl)-2-(2-(difluoromethyl)-5- methoxypyridin-4-yl)benzamide

[0356] was added ZnCN2(11.6 mg, 0.10 mmol), Xantphos (10.4 mg, 0.018 mmol) and Pd2(dba)3(8.2 mg, 0.0090 mmol) under N2. The mixture was degassed and stirred at 110 °C for 1 hr under N2 atmosphere. After completion, the reaction mixture was treated with water and extracted with EtOAc. The combined organic layers were washed with saturated brine, dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by prep-HPLC (0.1% FA) to afford Example 108. LCMS (ESI, m / z): [M+H]+= 503.2;1H NMR (400 MHz, DMSO-d6) δ 13.63 (brs, 1H), 8.64 (s, 1H), 8.44 (s, 1H), 8.15 (d, J = 8.0 Hz, 1H), 8.09 (s, 1H), 8.02 (d, J = 8.0 Hz, 1H), 7.79 (s, 1H), 6.98 (t, J = 55.2 Hz, 1H), 3.69 (s, 3H), 1.66 (m, 1H), 1.00-0.96 (m, 2H), 0.87-0.83 (m, 2H). Example 109 N-(6-(cyclopropylethynyl)thiazolo[4,5-b]pyrazin-2-yl)-2-(2-(difluoromethyl)-5-methoxypyridin- 4-yl)-4-(N-methylacetamido)benzamide

[0357] mL) was added mg, , mg, , Pd2(dba)3 (58 mg, 0.06 mmol) and Xantphos (7.3 mg, 0.013 mmol) under N2. The mixture was degassed and stirred at 110 °C for 2 hrs. LCMS showed the reaction was complete. The reaction mixture was treated with water and extracted with EtOAc. The combined organic phase was washed with saturated brine, dried over anhydrous Na2SO4, filtered, and concentrated under vacuum. The residue was purified by prep-HPLC (0.05% NH4HCO3) to afford Example 109. LCMS (ESI, m / z): [M+H]+= 549.3;1H NMR (400 MHz, DMSO-d6): δ 13.36 (s, 1H), 8.52 (s, 1H), 8.40 (s, 1H), 7.95 (d, J = 8.4 Hz, 1H), 7.68 (s, 1H), 7.56 (d, J = 8.4 Hz, 1H), 7.46 (s, 1H), 6.96 (t, J = 55.2 Hz, 1H), 3.68 (s, 3H), 3.26 (s, 3H), 1.97 (s, 3H), 1.63 (m, 1H), 0.99- 0.93 (m, 2H), 0.85-0.80 (m, 2H).

[0358] The examples in the table below were synthesized via either Suzuki or Stille coupling reaction, under the contions described for previous examples. LCMS E l ESI, : ]+methoxy-2',6-dimethyl- bipyridine]-3-carboxamide1H NMR (400 MHz, DMSO-d6) δ 13.74 (brs, 1H), 9.50 (s, 1H), 9.051H NMR (400 MHz, DMSO-d6) δ 1361 (br 1H) 946 ( 1H) 893N F1H NMR (400 MHz, DMSO-d6 O F ) δ O N 13.60 (brs, 1H), 9.55 (s, 1H), 8.911H NMR (400 MHz, DMSO-d6) δ 1323 (br 1H) 880 ( 1H) 8521H NMR (400 MHz, DMSO-d6) δ 13.67 (brs, 1H), 9.48 (s, 1H), 8.99methoxy-6-methyl-[4,4'- bipyridine]-3-carboxamideBiological Example 1 Biochemical Enzymatic Assay Protein expression

[0359] For Polθ helicase domain (amino acids 2-894) expression the sequence was first synthesized via gene synthesis. This sequence was then cloned into the pFastBac bacmid forSf9 cell expression. Sf9 cells were then and transfected with the target bacmid. After three days, baculovirus was harvested and used to transduce freshly plated Sf9 cells. After 60 hours, cell pellets were harvested, lysed and the protein purified using Ni-HP Superdex 200 columns. Purified protein was then subject to size exclusion chromatography - high- performance liquid chromatography to confirm protein identity and purity. Polθ helicase ATP assay

[0360] A 4X stock of compound was prepared by serially dilution at a 1:3 dilution in assay buffer (Tris pH7.525 mM, NaCl 6 mM, MgCl21.5 mM, Glycerol 5% (V / V) Triton X- 1000.01%, DTT 1 mM and ddH2O) containing 4% DMSO, with a top final working concentration of 4μM (1µM final concentration) and a ten-point dose-response curve (1% final DMSO concentration).1µl of this stock was then transferred to a 384-well assay plate and centrifuged. A 4X POLθ (2-894) enzyme solution (6.25nM working concentration, 1.5625nM final concentration) was then prepared in assay buffer.1µl of this solution was then added to the 384-well assay plate followed centrifugation and incubation at 23oC for 10 minutes. A 4X stock of cofactor (30bp single stranded DNA sequence, CCAGTGAATTGTTGCTCGGTACCTGCTAAC (SEQ ID NO: 1), 400nM working concentration, 100nM final concentration) and a 4X stock of ATP substrate (200µM working concentration, 50µM final concentration) were then prepared in assay buffer.1µl of the cofactor solution was then added to the assay plate, centrifuged, and incubated at 23oC for 30 minutes.1µl of the substrate solution was then added to the plate, centrifuged, and incubated for 120 minutes at 23oC.4µl of ADP-Glo Reagent was then added to the plate, centrifuged, and incubated for 120 minutes at 23oC. Finally, 8ul of Kinase Detection Reagent was then added to the plate, centrifuged, and incubated for 30 minutes at 23oC. Luminescence was then measured on an Envision plate reader. Percent inhibition was calculated as: % Inhibition =100%- (compound signal-min signal) / (max signal-min signal)*100%, where minimum signal equals signal from wells with substate only and maximum signal equals signal from wells with enzyme + substate. IC50s were calculated by fitting % Inhibition (Y) values and log of compound concentrations (X) to nonlinear regression (log[inhibitor]) vs. response – Variable slope (four parameters) with GraphPad 9.4.1 (Y=Bottom + (Top- Bottom) / (1+10^((LogIC50-X) *hillslope) where X equals.

[0361] For biochemical activity, bracket is denoted as: A < 20 nM; 20 nM < B < 200 nM; C > 200 nMExamplePolθ helicase Polθ helicase ATPassay IC50 Exampleassay IC5091 A 92 A 93 A 94 ACellular Viability Assay

[0362] DLD-1 BRCA2- / -cells were plated at a density of 100 cells per well, in 40µl of complete media, in a 384-well plate and incubated overnight at 37oC in a humidified, 5% CO2, environment.24 hours later, compounds were added starting at a top dose of 10µM for a 9-point dose response curve at a 1:3 dilution using an iDOT HT liquid handler and incubated for 7 days at 37oC in a 5% CO2humidified environment. After 7 days and at Day 0, plates were incubated at room temperature for 30 minutes followed by the addition of 30µl of CellTiter-Glo Reagent. Plates were then mixed for 10 minutes on an orbital shaker followed by incubation at room temperature for 20 minutes. Luminescence was then read using the Envision plate reader. Percent Growth Inhibition was then calculated using the following equation: Percent Growth Inhibition normalized=100-(compound signal-T0) / (max signal- T0)*100%, where Max Signal refers to the DMSO only treated cells and T0 refers to theDay0 viability measurement. Growth 50 was then calculated using the following equation: Y=Bottom + (Top-Bottom) / (1+10^((LogIC50-X) *hillslope)).

[0363] For cell activity, bracket is denoted as: A < 100 nM; 100 nM < B < 1000 nM; C > 1000 nM. ExampleCellular viabilityCellular viability assay IC50Exampleassay IC5087 B 88 A 89 A 90 B

[0364] The Summary and Abstract sections may set forth one or more but not all exemplary embodiments of the present invention as contemplated by the inventor(s), and thus, are not intended to limit the present invention and the appended claims in any way.

[0365] The present invention has been described above with the aid of functional building blocks illustrating the implementation of specified functions and relationships thereof. The boundaries of these functional building blocks have been arbitrarily defined herein for the convenience of the description. Alternate boundaries can be defined so long as the specified functions and relationships thereof are appropriately performed.

[0366] With respect to aspects of the invention described as a genus, all individual species are individually considered separate aspects of the invention. If aspects of theinvention are described as "comprising" embodiments also are contemplated "consisting of” or "consisting essentially of” the feature.

[0367] The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying knowledge within the skill of the art, readily modify and / or adapt for various applications such specific embodiments, without undue experimentation, without departing from the general concept of the present invention. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance.

[0368] The breadth and scope of the present invention should not be limited by any of the above-described exemplary embodiments.

[0369] All of the various aspects, embodiments, and options described herein can be combined in any and all variations.

[0370] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. To the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to that term in this document shall govern.

Claims

WHAT IS CLAIMED IS:

1. A compound of Formula K, or a pharmaceutically acceptable salt thereof:wherein: Ring A is a phenyl ring or 5-10-membered heteroaryl ring having 1 to 4 ring heteroatoms independently selected from N, O, and S; R1is an optionally substituted phenyl, optionally substituted naphthyl, an optionally substituted 3-10 membered carbocyclic, or an optionally substituted 5-10 membered heterocyclic or heteroaryl, preferably, R1is ortho to the amide group (-C(O)-NH-) shown in Formula K; the subscript m is an integer of 0-4, as valency permits; R2at each occurrence is independently deuterium, halogen, OH, NH2, CN, SF5, COOH, CONH2, SO2NH2, R20, OR20, SR20, N(R20)(R21), SO2R20, S(=O)(=NR21)R20, SO2N(R20)(R21), N(R21)SO2R20, COR20, COOR20, OC(O)R20,CON(R20)(R21), or N(R21)COR20, wherein R20at each occurrence is independently an optionally substituted C1-6alkyl, an optionally substituted C2-6alkenyl, an optionally substituted C2-6alkynyl, an optionally substituted C1-6 heteroalkyl, or an optionally substituted 3-10 membered ring structure; and R21at each occurrence is independently hydrogen, an optionally substituted C1-6 alkyl, an optionally substituted C3-6 alkenyl, an optionally substituted C3-6 alkynyl, an optionally substituted C1-6heteroalkyl, or an optionally substituted 3-10 membered ring structure; or as applicable, R20and R21together with the intervening atom (e.g., the nitrogen atom) or atoms are joined to form an optionally substituted 4-8 membered heterocyclic ring; or two instances of R2are joined to form an optionally substituted 4-7 membered ring; RJis hydrogen, halogen, optionally substituted C1-6 alkyl, an optionally substituted C2-6 alkenyl, an optionally substituted C2-6alkynyl, an optionally substituted C1-6heteroalkyl, or an optionally substituted 3-10 membered ring structure;L is C1-4 alkylene, C2-4 alkenylene, or C1-4 heteroalkylene, each of which is optionally substituted with deuterium and / or F, and RKis hydrogen, deuterium, an optionally substituted C1-6 alkyl, an optionally substituted C1-6heteroalkyl, or an optionally substituted 3-10 membered ring structure.

2. The compound of claim 1, or a pharmaceutically acceptable salt thereof, characterized as having a structure according to Formula K-1:

3. The compound of claim 1 or 2, or a pharmaceutically acceptable salt thereof, characterized as having a structure according to Formula K-2:

4. The compound of any of claims 1-3, or a pharmaceutically acceptable salt thereof, characterized as having a structure according to Formula K-3:

5. The compound of any of claims 1- acceptable salt thereof, characterized as having a structure according to Formula K-4:

6. The compound of any of claims 1-3, or a pharmaceutically acceptable salt thereof, characterized as having a structure according to Formula K-5:

7. The compound of any of claims 1-3 or 6, or a pharmaceutically acceptable salt thereof, characterized as having a structure according to Formula K-6:

8. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein L is C2-4 .

9. The compound of any of claims 1-8, or a pharmaceutically acceptable salt thereof, wherein RKis an optionally substituted C3-8 cycloalkyl.

10. The compound of any of claims 1- acceptable salt thereof, wherein RKis cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl, each of which is optionally substituted with one or more, e.g., 1-5, substituents independently selected from deuterium, F, OH, CN, C1-4alkyl optionally substituted with F, C1-4heteroalkyl optionally substituted with F, or 3-6 membered ring optionally substituted with one or more substituents independently selected from deuterium, halogen, CN, OH, oxo, C1-4alkyl optionally substituted with F, and C1-4 heteroalkyl optionally substituted with F.

11. The compound of any of claims 1-9, or a pharmaceutically acceptable salt thereof, wherein RKis selected .

12. The compound of any of claims 1-8, or a pharmaceutically acceptable salt thereof, wherein RKis an optionally substituted 4-8 membered heterocyclyl.

13. The compound of claim 12, or a pharmaceutically acceptable salt thereof, wherein RKis 4-6 membered heterocyclyl having one or two ring heteroatoms, each independently O, S, or N, wherein the sulfur atom, if present, is optionally oxidized, wherein the 4-6 membered heterocyclyl is optionally substituted with one or more (e.g., 1-3) substituents independently selected from deuterium, F, oxo, OH, CN, C1-4alkyl optionally substituted with deuterium and / or F, C1-4 heteroalkyl optionally substituted with deuterium and / or F, 3-6 membered ring, (C1-4alkylene)-(3-6 membered ring), or (C1-4heteroalkylene)-(3-6 membered ring), wherein the C1-4 alkylene or C1-4 heteroalkylene is optionally substituted with deuterium and / or F, and wherein each of the 3-6 membered ring is optionally substituted with one or more substituents independently selected from deuterium, halogen, CN, OH, oxo, C1-4alkyl optionally substituted with F, and C1-4heteroalkyl optionally substituted with F.

14. The compound of claim 12 or 13, or acceptable salt thereof, wherein RKis selected .

15. The compound of any of claims 1-8, or a pharmaceutically acceptable salt thereof, wherein RKis an optionally substituted 5 or 6-membered heteroaryl.

16. The compound of claim 15, or a pharmaceutically acceptable salt thereof, wherein RKis a 5-membered heteroaryl having 1-4 ring heteroatoms, each independently O, S, or N, wherein the 5-membered heteroaryl is optionally substituted with 1-3 substituents independently selected from F, Cl, OH, CN, C1-4alkyl optionally substituted with deuterium and / or F, C1-4 heteroalkyl optionally substituted with deuterium and / or F, 3-6 membered ring, (C1-4alkylene)-(3-6 membered ring), or (C1-4heteroalkylene)-(3-6 membered ring), wherein the C1-4 alkylene or C1-4 heteroalkylene is optionally substituted with deuterium and / or F, and wherein each of the 3-6 membered ring is optionally substituted with one or more substituents independently selected from deuterium, halogen, CN, OH, oxo, C1-4alkyl optionally substituted with F, and C1-4heteroalkyl optionally substituted with F.

17. The compound of claim 15 or 16, or a pharmaceutically acceptable salt thereof, wherein RKis a 5-membered heteroaryl selected from pyrazolyl, isoxazolyl, oxadiazolyl, or thiadiazolyl, which is optionally substituted, as valency permits, with 1-3 substituents independently selected from F, Cl, OH, CN, C1-4alkyl optionally substituted with deuterium and / or F, C1-4 heteroalkyl optionally substituted with deuterium and / or F, 3-6 membered ring, (C1-2alkylene)-(3-6 membered ring), or (C1-2heteroalkylene)-(3-6 membered ring), wherein the C1-2 alkylene or C1-2 heteroalkylene is optionally substituted with deuterium and / or F, and wherein, preferably, the 3-6 membered ring at each occurrence is independently selected from (a) C3-6 cycloalkyl optionally substituted with methyl and / or F; or (b) 4-6 membered heterocyclyl having 1 or 2 ring heteroatoms independently selected from O, S, and N, wherein the sulfur atom, if present, is optionally oxidized, and wherein the 4-6 membered heterocyclyl is optionally substituted with 1-3substituents independently selected F, OH, oxo, CN, C1-4 alkyl optionally substituted with F, or C1-4heteroalkyl optionally substituted with F.

18. The compound of any of claims 15-17, or a pharmaceutically acceptable salt thereof, wherein RKis wherein:q is 0, 1, 2, or 3; and G10at each occurrence is independently F, Cl, CN, C1-4 alkyl optionally substituted with deuterium and / or F, C1-4heteroalkyl optionally substituted with deuterium and / or F, 3-6 membered ring, (C1-2 alkylene)-(3-6 membered ring), or (C1-2 heteroalkylene)-(3-6 membered ring), wherein the C1-2alkylene or C1-2heteroalkylene is optionally substituted with deuterium and / or F, and wherein, preferably, the 3-6 membered ring at each occurrence is independently selected from (a) C3-6cycloalkyl optionally substituted with methyl and / or F; or (b) 4-6 membered heterocyclyl having 1 or 2 ring heteroatoms independently selected from O, S, and N, wherein the sulfur atom, if present, is optionally oxidized, and wherein the 4-6 membered heterocyclyl is optionally substituted with 1-3 substituents independently selected from deuterium, F, OH, oxo, CN, C1-4alkyl optionally substituted with F, or C1-4 heteroalkyl optionally substituted with F.

19. The compound of claim 18, or a pharmaceutically acceptable salt thereof, wherein RKis selected from:G10Aat each occurrence is independently C1-4 alkyl optionally substituted with deuterium and / or F, 3-6 membered ring, or (C1-2 alkylene)-(3-6 membered ring), wherein the C1-2 alkylene or C1-2 heteroalkylene is optionally substituted with deuterium and / or F, andwherein, preferably, the 3-6 at each occurrence is independently selected from (a) C3-6cycloalkyl optionally substituted with methyl and / or F; or (b) 4-6 membered heterocyclyl having 1 or 2 ring heteroatoms independently selected from O, S, and N, wherein the sulfur atom, if present, is optionally oxidized, and wherein the 4-6 membered heterocyclyl is optionally substituted with 1-3 substituents independently selected from deuterium, F, OH, oxo, CN, C1-4alkyl optionally substituted with F, or C1-4heteroalkyl optionally substituted with F; and G10Bat each occurrence is independently F, Cl, CN, or G10A.

20. The compound of claim 19, or a pharmaceutically acceptable salt thereof, wherein G10Aat each occurrence is independently C1-4 alkyl (e.g., methyl) optionally substituted with deuterium and / or F, cyclopropyl, cyclobutyl, (C1-2alkylene)-(cyclopropyl) or (C1-2alkylene)-(cyclobutyl).

21. The compound of claim 19 or 20, or a pharmaceutically acceptable salt thereof, wherein G10Bat each occurrence is independently F, Cl, C1-4alkyl (e.g., methyl) optionally substituted with deuterium and / or F, cyclopropyl, cyclobutyl, (C1-2 alkylene)- (cyclopropyl) or (C1-2alkylene)-(cyclobutyl).

22. The compound of claim 15 or 16, or a pharmaceutically acceptable salt thereof, wherein RKis selected from: .

23. The compound of claim 15, or a pharmaceutically acceptable salt thereof, wherein RKis a 6-membered heteroaryl having 1 or 2 ring nitrogen atoms, e.g., pyridyl, pyrimidyl, etc., wherein the 6-membered heteroaryl is optionally substituted with 1-3 substituents independently selected from F, Cl, OH, CN, C1-4alkyl optionally substituted with deuterium and / or F, C1-4heteroalkyl optionally substituted with deuterium and / or F, 3-6 membered ring, (C1-4alkylene)-(3-6 membered ring), or (C1-4heteroalkylene)-(3-6membered ring), wherein the C1-4 or C1-4 heteroalkylene is optionally substituted with deuterium and / or F, and wherein each of the 3-6 membered ring is optionally substituted with one or more substituents independently selected from deuterium, halogen, CN, OH, oxo, C1-4alkyl optionally substituted with F, and C1-4heteroalkyl optionally substituted with F.

24. The compound of any of claims 1, 2, and 8-23, or a pharmaceutically acceptable salt thereof, wherein RJis hydrogen.

25. The compound of any of claims 1-3 and 8-24, or a pharmaceutically acceptable salt thereof, wherein ring A is a phenyl ring or a 5 or 6-membered heteroaryl ring having 1 to 3 ring heteroatoms independently selected from N, O, and S, such as pyridine ring.

26. The compound of any of claims 1-3 and 8-24, or a pharmaceutically acceptable salt thereof, wherein ring A is a phenyl, pyridinyl, pyrimidinyl, or imidazo[1,2-a]pyridinyl ring, preferably, a phenyl or pyridinyl ring.

27. The compound of any of claims 1-3 and 8-24, or a pharmaceutically acceptable salt28. The compound of any of claims 1-27, or a pharmaceutically acceptable salt thereof, wherein m is 0, 1, or 2, and R2at each occurrence is independently deuterium, halogen, CN, OH, (C1-4 alkylene)-CN, GA, or Xa-Xb-GA, wherein: Xaat each occurrence is independently null, C1-4 alkylene, or C1-4 heteroalkylene;Xbat each occurrence is , O, NH, N(GB), C(O), C(O)O, C(O)NH, C(O)N(GB), NHC(O), N(GB)C (=O)(=NH), S(=O)(=NGB), SO2NH,or SO2N ; andindependently deuterium, halogen, OH, C1-4 alkoxy, C(O)-NH(C1-4 alkyl), C(O)- N(C1-4 alkyl)(C1-4 alkyl), or a 3-6 membered ring; (ii) C1-6heteroalkyl optionally substituted with one or more (e.g., 1-3) substituents independently deuterium, halogen, oxo, C1-4 alkyl, C1-4 alkoxy, or a 3-6 membered ring; (iii) a 3-8 membered carbocyclic or heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, oxo, OH, CN, C1-4 alkyl, C1-4 alkoxy, C(O)NH2, C(O)-NH(C1- 4 alkyl), C(O)-N(C1-4 alkyl)(C1-4 , wherein the nitrogen containing Ring E is a 4-8 memberedring, or a 3-6 membered ring; or (iv) a 5 or 6-membered heteroaryl, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, CN, C1-4 alkyl, C1-4 alkoxy, or a 3-6 membered ring (preferably carbocyclic or heterocyclic ring), wherein each of the C1-4 alkyl or C1-4 alkoxy in each of (i)-(iv) is independently optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy, or a 3-4 membered carbocyclic or heterocyclic ring, and wherein each of the 3-6 membered ring in each of (i)-(iv) or Ring E is independently optionally substituted with one or more (e.g., 1-3) substituents each independently oxo, deuterium, halogen, OH, CN, C1-4 alkyl optionally substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F; GBat each occurrence is independently C1-6 alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4alkoxy optionally substituted with deuterium or F, or a 3-6 membered ring optionally substituted with oxo,deuterium, halogen, OH, CN, C1-4 substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F, or when applicable, GAand GBare joined to form a 4-8 membered heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently halogen, oxo, OH, C1-4 alkyl optionally substituted with F, or C1-4 alkoxy optionally substituted with F.

29. The compound of claim 28, or a pharmaceutically acceptable salt thereof, wherein m is 0.

30. The compound of claim 28, or a pharmaceutically acceptable salt thereof, wherein m is 1.

31. The compound of claim 30, or a pharmaceutically acceptable salt thereof, wherein the .

32. The compound of any of claims 1-27, 30 and 31, or a pharmaceutically acceptable salt thereof, wherein R2at each occurrence is independently (i) a C1-4 alkyl optionally substituted with deuterium, F, and / or OH, e.g., methyl, difluoromethyl, or hydroxymethyl; (ii) a 5 or 6-membered heteroaryl, which is optionally substituted with 1- 3 substituents each independently halogen, OH, CN, C1-4 alkyl, C1-4 alkoxy, or a 3-5 membered carbocyclic or heterocyclic ring, wherein the C1-4alkyl or C1-4alkoxy is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen (e.g., F), OH, C1-4alkoxy, or a 3-5 membered carbocyclic or heterocyclic ring, wherein each of the 3-5 membered carbocyclic or heterocyclic ring, when present, is independently optionally substituted with deuterium, F, OH, and / or methyl; or (iii) -(C1-4 alkylene)-C(O)NHGA, -(C1-4 alkylene)-C(O)N(GA)(GB) or -(C1-4 alkylene)-CN, for example, GAand GBare each independently a C1-4alkyl optionally substituted with deuterium, F and / or OH, or GAand GB, together with the nitrogen atomthey are both attached to, are joined a 4-8 membered heterocyclic ring, which is optionally substituted.

33. The compound of any of claims 1-32, or a pharmaceutically acceptable salt thereof, wherein R1is a phenyl, pyridinyl, pyrimidinyl, benzopyrazolyl, benzimidazolyl, imidazolyl, pyridazyl, imidazo[l,2-a]pyrimidinyl, oxazolo[4,5-b]pyridinyl, oxazolo[5,4- b]pyridinyl, thiazolo[4,5-b]pyridinyl, benzo[d]thiazole, indazolyl, [l,2,4]triazolo[l,5- a]pyrimidinyl, [l,2,4]triazolo[l,5-b]pyridazinyl, or tetrazolo[l,5-a]pyridinyl, each of which is optionally substituted.

34. The compound of any of claims 1-32, or a pharmaceutically acceptable salt thereof, wherein R1is a phenyl or pyridinyl, each of which is optionally substituted with 1-3 substituents independently selected from: deuterium, halogen, CN, OH, NH2, COOH, CONH2, (C1-4alkylene)-CN, GC, or Xc-Xd-GC, wherein: Xcat each occurrence is independently null, C1-4alkylene, or C1-4heteroalkylene; Xdat each occurrence is independently null, O, NH, N(GD), C(O), C(O)O, C(O)NH, C(O)N(GD), NHC(O), N(GD)C(O), P(O)(GD), SO2, SO2NH, or SO2N(GD); and GCat each occurrence is independently: (i) C1-6alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy, or a 3-6 membered ring; (ii) C1-6heteroalkyl optionally substituted with one or more (e.g., 1-3) substituents independently deuterium, halogen, C1-4 alkyl, C1-4 alkoxy, or a 3-6 membered ring; (iii) a 3-7 membered carbocyclic or heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, oxo, OH, CN, C1-4alkyl, C1-4alkoxy, or a 3-6 membered ring; or (iv) a 5 or 6-membered heteroaryl, which is optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, CN, C1-4 alkyl, C1-4alkoxy, or a 3-6 membered ring (preferably carbocyclic or heterocyclic ring),wherein the C1-4 alkyl or C1- in each of (i)-(iv) is independently optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4 alkoxy, or a 3-4 membered carbocyclic or heterocyclic ring, and wherein each of the 3-6 membered ring in each of (i)-(iv) is independently optionally substituted with oxo, deuterium, halogen, OH, CN, C1-4alkyl optionally substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F; GDat each occurrence is independently C1-6 alkyl optionally substituted with one or more (e.g., 1-3) substituents each independently deuterium, halogen, OH, C1-4alkoxy optionally substituted with deuterium or F, or a 3-6 membered ring optionally substituted with oxo, deuterium, halogen, OH, CN, C1-4alkyl optionally substituted with deuterium or F, or C1-4alkoxy optionally substituted with deuterium or F, or when applicable, GCand GDtogether with the heteroatom they are both attached to are joined to form a 4-7 membered heterocyclic ring, which is optionally substituted with one or more (e.g., 1-3) substituents each independently halogen, oxo, OH, C1-4alkyl optionally substituted with deuterium or F, or C1-4 alkoxy optionally substituted with deuterium or F.

35. The compound of any of claims 1-32, or a pharmaceutically acceptable salt thereof, wherein R1is a phenyl or pyridinyl, each of which is optionally substituted with one or more (e.g., 1-3) substituents independently selected from halogen, C1-6alkyl optionally substituted with deuterium, F, CN, and / or OH, C1-6 alkoxy optionally substituted with deuterium, F, CN, and / or OH, C3-6cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-4 alkyl), or N(C1-4 alkyl)(C1-4 alkyl).

36. The compound of any of claims 1-32, or a pharmaceutically acceptable salt thereof, wherein R1is a phenyl or pyridinyl, each of which is optionally substituted with one or more (e.g., 1-3) substituents independently selected from halogen, C1-4 alkyl optionally substituted with deuterium, F and / or OH, C1-4alkoxy optionally substituted with deuterium or F, C3-4 cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-3alkyl), or N(C1-3alkyl)(C1-3alkyl).

37. The compound of any of claims 1- pharmaceutically acceptable salt thereof, wherein R1is a phenyl or pyridinyl, each of which is optionally substituted with 1-3 substituents independently selected from methyl, ethyl, fluoro, chloro, bromo, trifluoromethyl, difluoromethyl, methoxy, ethoxy, difluoromethoxy, trifluoromethoxy, cyclopropyl, -NH2, hydroxymethyl, and 1-hydroxy ethyl, preferably, the substituents are independently selected from methyl, fluoro, chloro, trifluoromethyl, difluoromethyl, methoxy, ethoxy, difluoromethoxy, and cyclopropyl.

38. The compound of any of claims 1-32, or a pharmaceutically acceptable salt thereof, wherein R1is wherein R1aand R1bsubstituted with deuterium, F, CN, and / or OH, C1-6 alkoxy optionally substituted with deuterium, F, CN, and / or OH, C3-6 cycloalkyl optionally substituted with deuterium, F, CN, methyl, and / or OH, NH2, NH(C1-4 alkyl), or N(C1-4 alkyl)(C1-4 alkyl).

39. The compound of claim 38, or a pharmaceutically acceptable salt thereof, wherein R1bis C1-4alkoxy optionally substituted with 1-3 deuterium or F, for example, methoxy, ethoxy, or difluoromethoxy.

40. The compound of claim 38 or 39, or a pharmaceutically acceptable salt thereof, wherein R1ais (i) halogen (e.g., F or Cl); (ii) C1-4alkyl optionally substituted with 1-3 deuterium or F, e.g., methyl, trifluoromethyl, difluoromethyl, etc.; or (iii) cyclopropyl or cyclobutyl, optionally substituted with methyl and / or F.

41. A compound selected from Table 1, or Examples 1-145, or a pharmaceutically acceptable salt thereof.

42. A pharmaceutical composition the compound of any of claims 1-41, or a pharmaceutically acceptable salt thereof and optionally a pharmaceutically acceptable excipient.

43. A method of treating a disease or disorder in a subject in need thereof, wherein the disease or disorder is characterized by overexpression of Polθ, the method comprising administering to the subject a therapeutically effective amount of the compound of any of claims 1-41, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 42.

44. The method of claim 43, wherein the disease or disorder is cancer.

45. A method of treating a homologous recombination (HR) deficient cancer in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the compound of any of claims 1-41, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 42.

46. A method for treating a cancer in a subject in need thereof, wherein the cancer is characterized by a reduction or absence of BRCA gene expression, the absence of the BRCA gene, and / or reduced function of BRCA protein, the method comprising administering to the subject a therapeutically effective amount of the compound of any of claims 1-41, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 42.

47. The method of any one of claims 44-46, wherein the cancer is selected from lymphoma, rhabdoid tumor, multiple myeloma, uterine cancer, gastric cancer, peripheral nervous system cancer, rhabdomyosarcoma, bone cancer, colorectal cancer, mesothelioma, breast cancer, ovarian cancer, lung cancer, fibroblast cancer, central nervous system cancer, urinary tract cancer, upper aerodigestive cancer, leukemia, kidney cancer, skin cancer, esophageal cancer, and pancreatic cancer.

48. The method of any one of claims comprising administering to the subject one or more additional therapeutic agents selected from a PARP inhibitor, a signal transduction inhibitor, a chemotherapeutic agent, and / or an immune checkpoint inhibitor.

49. A method for treating a cancer in a subject in need thereof, wherein the cancer is resistant to poly(ADP-ribose) polymerase (PARP) inhibitor therapy, the method comprising administering to the subject a therapeutically effective amount of the compound of any of claims 1-41, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 42.

50. The method of claim 49, wherein the cancer is breast cancer, ovarian cancer, lung cancer, bladder cancer, liver cancer, head and neck cancer, pancreatic cancer, gastrointestinal cancer, or colorectal cancer.

51. The method of claim 49 or 50, further comprising administering to the subject a PARP inhibitor.