Use of a miR-27-5p mimic to treat chronic inflammatory bowel disease (IBD)

Abstract

The inventors have discovered that a mimic molecule of miR-27a-5p is capable of strongly modulating the inflammatory response in a recognized animal model of inflammatory bowel disease (IBD). They therefore propose incorporating this mimic into a pharmaceutical formulation to treat patients suffering from this disease. Advantageously, this mimic can be bound to a matrix, incorporated into particles, or delivered via a vector.

Description

Title of the invention: Use of a miR-27-5p mimic for treating chronic inflammatory bowel diseases (IBD)

[0001] Description of the prior art

[0002] Chronic inflammatory bowel diseases (or IBD) include Crohn's disease (CD) and ulcerative colitis (UC). Both are characterized by inflammation of the wall of a part of the digestive tract. In CD, this inflammation can be located at all levels of the digestive system, from the mouth to the anus, although it is most often found in the small intestine. In UC, it is located in the rectum and colon. IBD is most often diagnosed in young people, aged 20 to 30. However, it can occur at any age and 15% of cases affect children.

[0003] These diseases progress through inflammatory flare-ups of extremely variable duration and frequency depending on the patient. These flare-ups alternate with phases of remission. In approximately 20% of patients, the attacks are severe: their intensity may require hospitalization, stopping food and treatment by infusion for a few days. In addition, the progression of the disease may lead to complications requiring surgery.

[0004] There is no curative treatment for IBD. Currently available anti-inflammatory drugs provide partial control, the aim being to prevent flare-ups and prolong remission phases by promoting healing of lesions in the digestive tract. Biotherapies currently used for the treatment of IBD have improved the quality of life of patients and reduced their hospitalization and side effects compared to corticosteroids. However, this use is not without risks.Indeed, many unexpected toxicity problems have occurred and have been recognized as being related to biotherapies, such as with anti-TNFs that cause the worsening of heart failure as well as the reactivation of mycobacterial infections; or anti-integrin antibodies including natalizumab, with rare cases of lethal viral encephalitis or even excessive cytokine release syndrome, observed in healthy volunteers treated with a monoclonal antibody directed against CD28. In addition, the use of certain biotherapies could also be associated with long-term toxicity, including the development of lymphomas in patients treated with infliximab (anti-TNF).

[0005] On the other hand, most biological agents are immunogenic and therefore could lose their effect over time. Furthermore, most patients treated with agents Biologics require induction and maintenance therapy, and the cost of these agents is likely to remain high. Thus, a balance between efficacy and safety must be carefully considered for each patient [1].

[0006] Despite the numerous therapeutic approaches developed to date for the management of intestinal inflammation in the context of IBD, medical needs remain unmet:

[0007] 1) loss of activity of molecules over time, requiring the change of molecule,

[0008] 2) medium and long-term side effects, including disturbances in the immune system. munitaries, developments of cancers, in particular colon cancers,

[0009] 3) absence of response in refractory forms.

[0010] There is therefore an urgent need to identify more effective treatments to treat patients suffering from IBD, with the best possible tolerance or with the fewest possible adverse effects.

[0011] Several teams have reported the beneficial role that miRNA could have in regulating inflammation associated with IBD [2]. MicroRNAs (miRNAs or miRs) are non-coding RNA sequences of 21 to 24 nucleotides, responsible for the post-transcriptional regulation of genes by their specific action on mRNAs. They can modulate the innate response by regulating different signaling pathways [3]. The fine regulation exerted by miRNAs through their action on several effector and / or regulatory molecules of the same signaling pathway, represents a major advantage of this therapeutic approach since it allows a less drastic reduction in the expression level of one or more target genes without completely inhibiting them, unlike direct molecular approaches (e.g. small molecules, biotherapies by monoclonal antibodies or others) which act on their direct and universal target by strongly blocking their activity.This aspect is very important in the case of drugs intended for the treatment of inflammation in IBDs, since, in patients suffering from these diseases, the inflammatory response is a universal physiological response whose actors, whether effectors of signaling pathways, regulators or end products including cytokines, are ubiquitous and present in different tissues. Thus, a fine and targeted regulation of the expression of these genes by a given miRNA allows a less significant reduction of the corresponding effector proteins without completely annihilating them, which consequently limits the significant adverse effects observed during the use of conventional anti-inflammatory treatments.

[0012] Unfortunately, there are still many gray areas in the understanding of the modulation networks linked to each miRNA. Their non-specificity (each miRNA targeting a multitude of genes) could also induce effects secondary in the individual to whom it is administered. The identification of a miRNA of interest to treat a disease as complex as Crohn's disease is still not easy, as the validation of candidates is cumbersome. In addition, it is impossible to predict the effect of a miRNA on this type of disease without carrying out rigorous preclinical or animal experiments, advantageously on different models [2].

[0013] In this context, the present inventors have obtained very satisfactory results by administering to model animals a mimic of miRNA 27a-5p (miR-27a-5p). It is interesting that such a molecule has an effect in IBD model animals, because this particular miRNA has never been implicated in these diseases (unlike other miRNAs, see for example those listed in Table 2 of Suri et al (2021) [2].

[0014] This miR-27a-5p mimic molecule has indeed been proposed in the past to treat a mouse model of Clostridioides difficile infection (CDI) (WO2020 / 094865). However, the therapeutic effect of this miRNA was intrinsically linked to the effect of flagellins allowing the C. difficile bacterium to induce a strong intestinal inflammatory response. Indeed, the results presented in this patent application showed that the C. difficile flagellin FliC induces a pro-inflammatory response in intestinal epithelial cells and in the mouse cecum (mouse model of C. difficile infection or CDI), and that the NF-kB signaling pathway played a predominant role via the activation of the innate response receptor TRL5, which is specific for flagellin [4,5]. In this very particular context, the miR-27a-5p mimic would mainly inhibit the pro-inflammatory NF-kB signaling pathway induced specifically by C.difficile, inducing a strong inhibition of the expression of the genes of the cytokines TNFa and interleukin IL-8.

[0015] However, it is now well known that the same miRNA can have a given role in given conditions and in a given cell type and a completely opposite role in another type of cell. For example, it is known that miR-146a has opposite effects depending on the cells studied: a pro-inflammatory effect in endothelial cells stimulated by supernatants of monocytes activated with LPS [6] or an anti-inflammatory effect in vascular endothelial cells stimulated with LPS [7]. Furthermore, miR-27a itself may have an oncogenic role in breast cancer, but, conversely, a tumor suppressor role in prostate cancers [8,9]. Thus, existing results on models other than IBD, and in particular on cells infected with C. difficile, could not be transposed to mouse models of intestinal inflammation (IBD).

[0016] In 2005, Fichtner-Feigl et al

[10] proposed that decoy oligonucleotides (double-stranded DNA) targeting NF-kB in a mouse model of colitis induced by TNBS, can reduce such intestinal inflammation. However, these results have never been confirmed since. On the contrary, in 2020, the phase 2 study by Danes et al

[11] found no effect of indirect inhibition of NF-kB in intestinal inflammation. Moreover, numerous publications have since shown that signaling pathways other than NF-kB play a much more important role in the development of IBD. Indeed, the pathophysiological mechanisms of IBD are complex and multifactorial (immune, genetic, environmental, etc.). It is now well established that the immune response, both the innate and the adaptive response, plays an important role in the development and maintenance of IBD.Indeed, the differentiation of CD4 T lymphocyte populations towards Th17 cells occupies a central place in the pathogenesis of IBD with the activation of different complex signaling pathways leading to the synthesis of different pro-inflammatory cytokines

[12] . This differentiation of CD4 T cells into Th17 induced by TGF[3 and 1TL-6 (not shown in the case of inflammation during C. difficile infection) leads to the activation of the signaling pathways of STAT3, JAK1 and the transcription factors STAT3, BATF, SMAD2 and IRF4, resulting in the production of the cytokines IL-17, IL-21 and TNFa. However, the central transcription factor NF-kB does not play any direct role in these pathways. Thus, it is now well established that the adaptive immune response through the activation of Thl7 promotes inflammation in the intestines, without a direct link to the NF-kB pathway.

[0017] Furthermore, the therapeutic molecules used and under development in the context of IBD target signaling pathways other than that of NF-kB. For example, we can cite: anti-TNFa monoclonal antibodies such as adalizumab (on the market), anti-integrin monoclonal antibodies such as ve-dolizumab (on the market), etrolizumab (in phase II), abrilumab (phase IIb); anti-MAdCAM-1 adhesion molecules such as entavalimab (phase III), anti-IL23 antibodies such as ustekinumab (on the market), mirikizumab (in phase II), rizankizumab (in phase II), and brazikumab (in phase III), as well as kinase inhibitor molecules (JAK1 inhibitors) such as filgotinib (in phase III), upadacitinib (in phase III)

[13] . Other targets are also in clinical study phase (TLR9 ​​agonists, sphingosine-1-phosphate receptor modulators).These molecules target pro-inflammatory factors but none directly affect the NF-kB pathway.

[0018] In this context, it could not be envisaged that the inhibition of the NF-kB pathway (directly or indirectly) could reduce the strong inflammatory response found in murine models of intestinal inflammation (IBD) not infected by C. difficile.

[0019] Furthermore, recently, several studies have evaluated the involvement of miRNAs in the pathogenesis of IBD and colitis-associated cancers. In particular, many miRNAs have been implicated in the inflammation pathways and in the fibrogenesis of IBD; consequently, their use as diagnostic biomarkers of inflammation and / or fibrosis has been proposed. In light of these results in the diagnostic field, however, it was not obvious that one of these miRNAs could act effectively as a therapeutic agent.

[0020] Furthermore, it is well known in the art that the same miRNA can have a given role in certain conditions and in a certain cell type and a completely opposite role in another cell type. For example, miR-146a has opposite effects depending on the cells considered (pro-inflammatory effect in endothelial cells stimulated by LPS-activated monocyte supernatants [6] or anti-inflammatory effect in LPS-stimulated vascular endothelial cells [7]).

[0021] Moreover, unlike the present inventors, the team of Xie et al showed that miR-27a increased the inflammatory response mediated by IL-10, in activated macrophages

[14] . In this complex and contradictory technical context, it could not be envisaged that the administration of a miRNA mimic of miR-27a could reduce the strong inflammatory response found in murine models of intestinal inflammation (IBD) not infected with C. difficile.

[0022] The technical problem posed by the inventors was to identify a new treatment for Chronic Inflammatory Bowel Diseases (IBD). The inventors identified an unexpected anti-inflammatory effect of miR-27a in animal models of this disease, the molecular mechanisms of which remain to be elucidated.

[0023] As indicated above, this is the first study revealing the role of miR-27a-5p in the intestinal inflammatory process of IBD, this miRNA having never been proposed in the context of the diagnosis or treatment of this disease. Detailed description of the invention

[0024] As explained in the examples below, the present inventors investigated the effect of miR-27a-5p mimic in a murine model of colitis commonly used for the study of IBD. In this model, dextran sulfate sodium (DSS), a sulfated polysaccharide that is directly toxic to the colonic epithelium, induced a highly reproducible acute inflammation limited to the colon and characterized by erosions / ulcers, crypt loss, and granulocyte infiltration, indicating that effector cytokines produced by effectors of the innate response are sufficient to cause inflammation. On this basis, DSS colitis has become a useful model for the study of immune mechanisms involved in the development of intestinal inflammation [2].

[0025] The inventors were able to demonstrate that the intravenous injection of a lipid formulation of a miR-27a-5p mimic in C57BL / 6 mice treated with DSS in drinking water and suffering from severe colitis, makes it possible to improve the clinical signs with a strong reduction in diarrhea and rectal bleeding from 24 hours after the start of treatment, as well as the cessation of colon narrowing.

[0026] In a first aspect, the present invention therefore relates to a pharmaceutical composition containing a miR-27a-5p mimic, for use in treating a subject suffering from a chronic inflammatory bowel disease.

[0027] In the context of the present application, the term "miRNA" is used to designate indifferently a micro-RNA (or miRNA). These are short non-coding RNAs having between 20 and 25 nucleotides, binding to target mRNAs and thus inhibiting their translation. Micro-RNAs bind to the target mRNA by 5 to 8 consecutive nucleotides at the level of the 3'UTR region of the target mRNA, this recognition sequence being called "seed" carried by the strand called "guide" of the molecule [3]. Each micro-RNA is therefore capable of recognizing and modulating a large number of mRNAs (in practice, all mRNAs containing these 5 to 8 nucleotides of the 3'UTR region of the target mRNA, which potentially code for different genes). These miRNAs can be in double-stranded form (precursor or duplex) or single-stranded form (mature form, ready to bind to the target mRNA).

[0028] The miRNA known as "miR-27a-5p" is a single-stranded RNA (in its mature form) having the same sequence SEQ ID NO: 1 (AGGGCUUAGCUGCUUGUGAGCA) in mice and humans. It was identified in 2001

[15] and has been implicated in the NF-kB pathway in aortic cells

[16] , and in cancer

[17] . It has also been identified in mitral valve interstitial cells

[18] .

[0029] By "miR-27a-5p mimic" is meant here any synthetic double-stranded RNA molecule which has the same sequence or a sequence similar to that of the natural miR-27a-5p microRNA (miRNA), and which makes it possible to modulate the same genetic target(s) (these genes are described in: Romay et al

[16] .

[0030] This “mimic” molecule is synthesized artificially. It ideally contains the 5 to 8 consecutive “seed” nucleotides in the “guide” strand of the natural microRNA known to bind to the target mRNA, but could, for example, advantageously present nucleotide differences at its ends, in order to more specifically target target genes among those known to be modulated by the natural microRNA. The literature explains precisely how to choose the sequence of microRNA mimics, so as to optimize its biological effects

[19] . “MicroRNA mimics” can therefore be more specific than the natural microRNAs from which they are derived (only mRNAs containing precisely the complementary sequence of this precise succession of nucleotides will therefore be affected by the mimic, which restricts the number of modulated genes).

[0031] In the context of the present invention, the expression "miR-27a-5p mimic" therefore denotes a synthetic double-stranded RNA molecule which contains at least 5, 6, 7 or 8 of the 8 consecutive nucleotides AGGGCUUA which constitute the "seed" part in the "guide" strand of miR-27a-5p [5' part which binds to the target mRNA]. The remainder of the oligonucleotide sequence of the mimic of the invention may then be similar to the remainder of the natural miR-27a-5p molecule of SEQ ID NO: 1, i.e., be similar with SEQ ID NO: 4 (representing the 3' part of the sequence SEQ ID NO: 1, without the 8 nucleotides AGGGCUUA constituting the "seed" part).

[0032] By "similar sequence" is meant here a nucleic acid sequence having a percentage identity greater than or equal to 70%, preferably greater than or equal to 80%, even more preferably greater than or equal to 90%, with the 3' part of the known natural miR-27a-5p sequence (SEQ ID NO: 4). By "percentage identity" between two nucleic acid sequences is meant a percentage of identical nucleotides between the two sequences to be compared, obtained after the best alignment (optimal alignment), this percentage being purely statistical and the differences between the two sequences being distributed randomly and over their entire length.

[0033] This percentage of identity can be calculated by any sequence analysis method well known to those skilled in the art. The percentage of identity can be determined after global alignment of the sequences to be compared taken in their entirety. In addition to manually, it is possible to determine it using the algorithm of Needleman and Wunsch (1970). For nucleotide sequences, the comparison of the sequences can be carried out using any software well known to those skilled in the art, such as for example the Needle software. The parameters used can in particular be the following: "Gap Open" equal to 10.0, "Gap Extend" equal to 0.5 and the EDNAFULL matrix (EMBOSS version of NCBI NUC4.4). This percentage can also be determined after local alignment of the sequences to be compared. In addition to manually, it is possible to use the algorithm of Smith and Waterman (1981) to determine this percentage.Preferably, the percentage of identity defined within the framework of the present invention is determined by means of a global alignment of the sequences to be compared over their entire length.

[0034] For example, the “miR-27a-5p mimic” used in the context of the invention may be the double-stranded RNA having the sequence (“guide” strand) SEQ ID NO: 2 (5'-AGGGCUUAGCUGCUUGUGACCCCC-3') and having the accompanying sequence (“passenger” strand) SEQ ID NO: 3 (5'-GGGGGUCACAAGCAGCUAAGCCCU-3') (or its complement). This molecule is marketed by RIBOXX under the number M-00303-0200 CONmiR® mimic in vivo.

[0035] Furthermore, this synthetic molecule also advantageously differs from natural miRNAs in that it has undergone chemical modifications on both the guide strand and the "passenger" strand aimed at increasing its stability with respect to RNases and proteins of the RISC complex ("RNA-induced silencing complex"). Said chemical modifications are, for example, methylation, the addition of thioate groups (replacement of the non-binding oxygen of the phosphate group by a sulfur atom), the addition of methyl groups (for example 2'-O-methyl or 2'-O-methoxyethyl) on different bases of the sequence [20,21]. Furthermore, it is possible to modify the bases of the RNA mimics of the invention by adding 2'Fluoro (2'F) groups on different bases of the sequence of the two strands

[22] . S-thioate internucleotide bonds can also be added between the U bases 3' of the "guide" strand

[23] .These chemical modifications make it possible to improve the stability of this “guide” strand.

[0036] In the context of the present invention, chemically modified mimic molecules preferably chosen to exhibit in vivo anti-inflammatory activity similar to or greater than that of the miRNA-27a-5p mimic may be tested.

[0037] It is also possible to modify the miR-27a-5p mimic of the invention by any known means allowing it to be stabilized or made more effective, in particular those described in Bernardo et al. [3].

[0038] In the pharmaceutical composition of the invention, the mimic miRNA (double strand) may be naked. It may also be complexed with positively charged chemical molecules or nanoparticles (i.e., particles having a diameter of less than 1 pm), or even be wrapped in protective materials, for example capsules, liposomes, etc., so as to promote its stability and transfectability (entry into target cells).

[0039] Any known stabilization means for promoting the transport and targeting of siRNAs may be used to facilitate the administration of the mimic of the invention, since these molecules have the same structure. These means are known in the art [23,24].

[0040] In a preferred embodiment, said miR-27a-5p mimic is therefore associated with (or included in) a vector, a matrix or particles promoting its stability and its transfectability.

[0041] If it is carried by a vector, said vector is preferably a recombinant virus chosen from: adenoviruses, retroviruses, lentiviruses, adeno-associated viruses (AAV), herpes viruses, cytomegaloviruses (CMV), vaccinia viruses, etc.

[0042] Advantageously, said recombinant virus is a defective virus, for example a defective AAV. The term "defective virus" here refers to a virus incapable of replicating in a target cell. Generally, the genome of defective viruses lacks at least one of the sequences necessary for the replication of said virus in the infected cell. These regions can be either eliminated, rendered non-functional or substituted by other sequences and in particular by the nucleic acid that codes for the peptide of interest. However, preferably, the defective virus still retains the sequences of its genome that are necessary for the encapsulation of viral particles.

[0043] This vector can also be a bacteriophage, these having already been used successfully to carry siRNAs. Bacteriophages such as MS2, Phi29, etc. can be used in the context of the present invention.

[0044] If said miR-27a-5p mimic is associated with particles, these may be those already proposed for the transport of siRNAs

[23] . These may be, for example, liposomes (DOPC), lipid nanoparticles, nanocells (EnGenelC EDV type), silica nanoparticles, exosomes, etc.

[0045] More specifically, these particles may be poly(alkylcyanoacrylate) nanoparticles, preferably coated with chitosan. The mimic miRNA of the invention can be easily adsorbed therein by formation of an ion pair, as previously demonstrated for siRNAs

[25] .

[0046] If said miR-27a-5p mimic is included in a matrix, said matrix may be a neutral lipid emulsion (NLE), polyethylenimine (PEI), poly(lactide-co-glycolide) (PLGA), etc.

[0047] Particularly preferably, said miR-27a-5p mimic can be complexed in a cationic polymer such as “in vivo-jet PEI®”, well known for efficiently transporting any type of nucleic acids in vivo into different organs, without eliciting an inflammatory response

[26] .

[0048] It is also possible to administer the mimic of the invention conjugated with a protein or a chemical molecule of interest, for example chosen from: lipids, cholesterol, PEG, cyclodextrin, chitosan, dendrimers (of poly(amidoamine) or poly(propylenimine), N-acetyl-D-galactosamine (GalNAc), etc.

[0049] The present invention also relates to methods for treating subjects suffering from chronic inflammatory bowel disease. These methods contain a step of administering the pharmaceutical composition of the invention to patients suffering from chronic inflammatory bowel disease.

[0050] The present invention finally relates to the use of the mimic of the invention, as defined above, for manufacturing a medicament intended to treat patients suffering from a chronic inflammatory bowel disease.

[0051] These subjects / patients may be animals (domestic or not, for example cats, dogs, equines) or human beings. Preferably, these subjects are not young children.

[0052] The subjects / patients to be treated in the context of the present invention suffer from chronic inflammatory bowel disease (“IBD”), in particular Crohn’s disease (CD) or ulcerative colitis (UC). These diseases are characterized by inflammation of the wall of a part of the digestive tract, due to deregulation of the intestinal immune system. This uncontrolled inflammation is responsible for tissue damage and the chronicity of the disease. Its origin appears to result from the complex combination of environmental factors, associated with a genetic susceptibility of the patient and the particular reactivity of his immune system. IBD develops through inflammatory flare-ups, of extremely variable duration and frequency depending on the patient, which alternate with phases of remission.They are distinguished by the location and nature of the inflammation in the digestive tract, the complications, the risk factors, the symptoms, or even the responses to treatments.

[0053] In Crohn's disease, inflammation can affect all segments of the digestive tract (from the mouth to the anus), but is most often located in the intestine and frequently affects the terminal ileum, with or without colonic involvement. In ulcerative colitis, the inflammation always affects the lower part of the rectum and goes up to a greater or lesser extent into the colon. The intestine is never affected.

[0054] The diagnosis of IBD is based on several clinical, biological and medical imaging criteria. When clinical symptoms suggest IBD, a biological assessment is carried out first. It allows the detection of an inflammatory syndrome by measuring the CRP protein in the blood and by looking for the presence of cal-protectin in the stool. Indeed, the latter is found in the stool only in cases of severe inflammation of the intestine (this leads to destruction of the intestinal epithelium which allows the passage of the molecule through the intestinal wall). Although the increase in the calprotectin level is not specific to IBD, it allows the discrimination of IBD from a functional intestinal disorder. This indicator is also used to monitor the disease and evaluate the effectiveness of the treatment implemented. The reference examination for diagnosis is nevertheless digestive endoscopy.It allows us to look for the presence and location of lesions in the digestive tract, as well as to take samples. This examination involves inserting a probe equipped with a camera into the patient's digestive system. If necessary, an entero-MRI (or abdominal MRI) can complete the examination to study the small intestine in more detail. The use of a video capsule, a swallowable capsule equipped with a mini-camera, also allows us to observe the small intestine, which is inaccessible to others. the endoscope. In ulcerative colitis, the inflammation affects only the rectum and colon. There is continuous involvement with red, fragile, easily bleeding mucosa, with microulcerations and pus. In Crohn's disease, the involvement is discontinuous: segments of affected mucosa alternate with healthy mucosa. The examination may also reveal narrowing of the intestinal lumen (stenosis) or a fistula, particularly in the anoperineal region. The entire digestive tract may be affected.

[0055] IBD is most often diagnosed between the ages of 20 and 30. However, it can occur at any age and 15% of cases occur in children.

[0056] There is a genetic susceptibility to IBD and the risk of developing it increases by 6 to 10% in the case of a family history. Analysis of the genome of affected patients has led to the identification of more than 170 genes predisposing to these diseases. Some are common to both pathologies and others specific to one of them. With rare exceptions, their impact on the occurrence of IBD is however moderate. Nevertheless, the presence of a particular polymorphism affecting the NOD2 / CARD15 gene would multiply by 40 the risk of developing Crohn's disease, certainly in the presence of other triggering factors that remain to be discovered. This gene codes for a cellular receptor for a bacterial agent.

[0057] Preferably, the subjects / patients to be treated within the framework of the present invention are not infected with the Clostridioides difficile bacterium. In other words, they do not suffer from CDI.

[0058] In the context of the invention, it is possible to use the treatment of the invention also to prevent or treat colon cancers which are caused by IBD, and therefore associated with colitis. More specifically, said miR-27a-5p mimic RNA can be advantageously administered to a subject suffering from IBD, to prevent the development of colon cancer, or to a subject suffering from colon cancer induced by IBD.

[0059] By "treatment" is meant here a treatment for curative purposes (aimed at at least spacing out or even preventing symptomatic inflammatory flare-ups of IBD or slowing down or even stopping the development of intestinal or gastric lesions in patients suffering from IBD) or prophylactic purposes (aimed at reducing the risk of these lesions appearing in the event of genetic susceptibility, for example).

[0060] The medicament of the invention is in particular used to alleviate abdominal pain, reduce the frequency and quantity of diarrhea, prevent rectal bleeding, and limit weight loss in patients suffering from IBD.

[0061] The pharmaceutical composition used in the invention contains, as active ingredient, the nucleic acid described above (optionally associated or protected by particles, vectors, lipids, etc.). It also preferably contains a pharmaceutically acceptable excipient.

[0062] In the present description, the term "pharmaceutically acceptable excipient" is intended to denote a compound (or a combination of compounds) entering into a pharmaceutical composition, but not causing side reactions and which allows, for example, the facilitation of the administration of the active compound(s), the increase in its lifespan and / or its effectiveness in the body, the increase in its solubility in solution or even the improvement of its preservation. These pharmaceutically acceptable excipients are well known and will be adapted by those skilled in the art according to the nature and the method of administration of the active compound(s) chosen.

[0063] Preferably, the mimic of the invention will be administered systemically, in particular intravenously, intramuscularly, intradermally, intraperitoneally or subcutaneously, or orally. More preferably, it will be administered parenterally, in hospital or at home. Its administration by subcutaneous route is envisaged and preferable.

[0064] The mimic of the invention can be administered several times, spread out over time.

[0065] Its optimal mode of administration, dosages and galenic forms can be determined according to the criteria generally taken into account in establishing a treatment adapted to a patient such as for example the age or body weight of the patient, the severity of his general condition, tolerance to the treatment and the side effects observed.

[0066] The mimic of the invention may also be formulated in the form of microcapsules, optionally with one or more additive carriers. For the preparation of these microcapsules, the mimic of the invention is generally combined with suitable diluents, suitable stabilizers, agents promoting the prolonged release of the active substances or any other type of additive for the formation of a central core which is then coated with a suitable polymer (for example a water-soluble resin or a water-insoluble resin). Techniques known to those skilled in the art will be used for this purpose. The microcapsules thus obtained are then optionally formulated in suitable dosage units.

[0067] The mimic of the invention can also be formulated in liposomes. Liposomes are formed from phospholipids that are dispersed in an aqueous medium and spontaneously form concentric multilamellar bilayer vesicles. These vesicles are typically 25 nm to 4 μm in diameter and can be sonicated, leading to the formation of smaller unilamellar vesicles, 200 to 500 Å in diameter, containing an aqueous solution at their core. Liposomes will be particularly advantageous for delivering the drug to a target specific cellular or tissue. For this, lipids can be chemically coupled to targeting molecules, such as targeting peptides (e.g. hormones), or antibodies.

[0068] The dosage naturally depends on the vector / complex considered, the mode of administration, the stage of the disease, the patient's age and condition. Some authors have used miRNA doses of 10 mg / kg intravenously. Lower doses can also be used (e.g., between 3 and 5 mg / kg per day).

[0069] When the mimic of the invention is associated with a cationic polymer or another vector, it is possible to use higher doses (25 mg / kg), in one dose, or in several doses, by repeating the injections.

[0070] Legend of the figures

[0071] [Fig.l] [Fig.l] demonstrates the anti-inflammatory effect of the miRNA of the invention in a DSS mouse model of IBD. Evaluation of the size of the cecum, colon and rectum in mice without treatment (DSS, left) and in mice treated with the miR-27a-5p-mimic (right). Examples

[0072] Example 1: Evaluation of the anti-inflammatory effect of miR-27a-5p-mimic on a mouse model treated with dextran sodium sulfate (DSS)

[0073] The miR-27a-5p mimic used in these examples is the double-stranded RNA having the sequence (guide strand) SEQ ID NO: 2 (5'-AGGGCUUAGCUGCUUGUGACCCC-3') and having the accompanying sequence (passenger strand) SEQ ID NO: 3 (5'-GGGGGUCACAAGCAGCUAAGCCCU-3') (or its complement), marketed by RIBOXX under the number M-00303-0200 CONmiR® mimic in vivo. It will be called "miR-27a-5p-mimic" in these examples.

[0074] C57BL / 6 mice were treated with DSS in the drinking water for 7 days. Upon the appearance of colitis symptoms (diarrhea, rectal bleeding, weight loss), on day 5 of the start of DSS treatment, a group of mice (n = 6) was treated with an intravenous (IV) suspension of miR-27a-5p-mimic associated with the in vivo-jetPEI® vehicle, with a second injection at 24 h interval (day 6 post-DSS treatment). On day 7 (24 h after the second dose of miR-27a-5p-mimic) the intestines (cecum and colon) were analyzed for their macroscopic and histological appearance as well as for the expression of pro-inflammatory cytokine genes.

[0075] As expected, all DSS-treated mice (n = 12) developed manifestations of colitis (diarrhea, rectal bleeding, weight loss) from D5 of DSS treatment. Animals with colitis treated with miR-27a-5p-mimic IV (n = 6) showed improvement in clinical signs with a significant decrease in diarrhea and rectal bleeding as early as 24 h after the first dose and after 48 h of miR-27a-mimic treatment.

[0076] [Tables 1] Mouse group (n=6) Disease J5 J7 DSS 3 / 6 4 / 6 DSS + miR-27a-5p-mimic 4 / 6 0 / 6

[0077] Macroscopic analysis of the intestines (caecum and colon) of mice not treated with miR-27a-5p-mimic compared to that of animals treated with this miRNA (48h after treatment) showed the presence of hemorrhagic intestinal content and a reduction in the length of the large intestine (caecum, colon and rectum) ([Fig.l]).

[0078] These results were confirmed by analyzing the intestinal inflammatory response (histological analysis, detection of pro-inflammatory cytokine mRNA by qRT-PCR) in the two groups of animals tested (data not shown).

[0079] Example 2: Evaluation of the anti-inflammatory effect of miR-27a-5p-mimic on a model of human intestinal epithelial cells

[0080] Cells of the Caco-2 line are transfected with miR-27a-5p-mimic for 24 hours and then treated with 1% DSS for 24 hours. The activation of pro-inflammatory signaling pathways will be analyzed by the activation of effectors by Western blot, the expression of pro-inflammatory cytokine genes by qRT-PCR and their synthesis in the supernatant by ELISA.

[0081] Example 3: Evaluation of the anti-inflammatory effect of miR-27a-5p-mimic on a human monocytic cell model

[0082] Cells of the human monocytic line THP-1 are transfected with miR-27a-5p-mimic for 24 hours and then treated with 1% DSS or Phorbol myristate acetate (PMA) for 24 hours. The activation of pro-inflammatory signaling pathways will be analyzed by the activation of effectors by Western blot, the expression of pro-inflammatory cytokine genes by qRT-PCR and their synthesis in the supernatant by ELISA.

[0083] Bibliographic references

[0084] 1. D'Haens, G., Risks and benefits of biology therapy for inflammatory bowel diseases. Gut, 2007. 56(5): p. 725-32.

[0085] 2. Suri, K., et al., Role of MicroRNA in Inflammatory Bowel Disease: Clinical Evidence and the Development of Preclinical Animal Models. Cells, 2021. 10(9).

[0086] 3. Bernardo, BC, et al., miRNA therapeutics: a new class of drugs with potential therapeutic applications in the heart. Future Med Chem, 2015. 7(13): p. 1771-92.

[0087] 4. Batah, J., et al., Clostridium difficile flagella predominantly activate TLR5-linked NF-kappaB pathway in épithélial cells. Anaerobe, 2016. 38: p. 116-124.

[0088] 5. Batah, J., et al., Clostridium difficile flagella induce a pro-inflammatory response in intestinal epithelium of mice in coopération with toxins. Sci Rep, 2017. 7(1): p. 3256.

[0089] 6. Pfeiffer, D., et al., miR-146a, miR-146b, and miR-155 increase expression of IL-6 and IL-8 and support HSP10 in an In vitro sepsis model. PLoS One, 2017. 12(6): p. e0179850.

[0090] 7. Gao, N. and L. Dong, MicroRNA-146 régulâtes the inflammatory cytokines ex pression in vascular endothélial cells during sepsis. Pharmazie, 2017. 72(11): p. 700-704.

[0091] 8. Barros-Silva, D., et al., MicroRNA-27a-5p régulation by promoter méthylation and MYC signaling in prostate carcinogenesis. Cell Death Dis, 2018. 9(2): p. 167.

[0092] 9. Mertens-Talcott, S.U., et al., The oncogenic microRNA-27a targets genes that regulate specificity protein transcription factors and the G2-M checkpoint in MDA-MB-231 breast cancer cells. Cancer Res, 2007. 67(22): p. 11001-11.

[0093] 10. Fichtner-Feigl, S., et al., Treatment of murine Thl- and Th2-mediated in flammatory bowel disease with NF-kappa B decoy oligonucleotides. J Clin Invest, 2005. 115(11): p. 3057-71.

[0094] 11. Danese, S., et al., Effects of Apremilast, an Oral Inhibitor of Phosphodiesterase 4, in a Randomized Trial of Patients With Active Ulcerative Colitis. Clin Gastroenterol Hepatol, 2020. 18(11): p. 2526-2534 e9.

[0095] 12. Jiang, P., et al., The involvement of TH17 cells in the pathogenesis of IBD. Cytokine Growth Factor Rev, 2023. 69: p. 28-42.

[0096] 13. Cohen, N.A. and D.T. Rubin, New targets in inflammatory bowel disease therapy: 2021. Curr Opin Gastroenterol, 2021. 37(4): p. 357-363.

[0097] 14. Xie, N., et al., miR-27a régulâtes inflammatory response of macrophages by targeting IL-10. J Immunol, 2014. 193(1): p. 327-334.

[0098] 15. Lagos-Quintana, M., et al., Identification of novel genes coding for small expressed RNAs. Science, 2001. 294(5543): p. 853-8.

[0099] 16. Romay, M.C., et al., Régulation of NF-kappaB signaling by oxidized glycero- phospholipid and IL-lbeta induced miRs-21-3p and -27a-5p in human aortic endothélial cells. J Lipid Res, 2015. 56(1): p. 38-50.

[0100] 17. Wu, X., et al., Coordinated targeting of the EGFR signaling axis by microRNA- 27a*. Oncotarget, 2013. 4(9): p. 1388-98.

[0101] 18. Chen, H., et al., miR-27a protects human mitral valve interstitial cell from TNF- alpha-induced inflammatory injury via up-regulation of NELL-1. Braz J Med Biol Res, 2018. 51(6): p. e6997.

[0102] 19. Wang, Z., The guideline of the design and validation of MiRNA mimics. Methods Mol Biol, 2011. 676: p. 211-23.

[0103] 20. Geary, R.S., et al., Pharmacokinetic properties of 2'-O-(2-methoxyethyl)-modified oligonucleotide analogs in rats. J Pharmacol Exp Ther, 2001. 296(3): p. 890-7.

[0104] 21. Koizumi, M., et al., Design of 2'-O-methyl RNA and DNA double-stranded oli gonucleotides: naturally-occurring nucléotide components with strong RNA interférence gene expression inhibitory activity. Nucleosides Nucléotides Nucleic Acids, 2020. 39(1-3): p. 292-309.

[0105] 22. van Rooij, E. and S. Kauppinen, Development of microRNA therapeutics is coming of âge. EMBO Mol Med, 2014. 6(7): p. 851-64.

[0106] 23. Baumann, V. and J. Winkler, miRNA-based thérapies: strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents. Future Med Chem, 2014. 6(17): p. 1967-84.

[0107] 24. Rupaimoole, R. and F.J. Slack, MicroRNA therapeutics: towards a new era for the management of cancer and other diseases. Nat Rev Drug Discov, 2017. 16(3): p. 203-222.

[0108] 25. de Martimprey, H., et al., New core-shell nanoparticules for the intravenous delivery of siRNA to experimental thyroid papillary carcinoma. Pharm Res, 2010. 27(3): p. 498-509.

[0109] 26. Pandey, A.P. and K.K. Sawant, Polyethylenimine: A versatile, multifunctional non-viral vector for nucleic acid delivery. Mater Sci Eng C Mater Biol Appl, 2016. 68: p. 904-918.

Claims

Claims

1. A pharmaceutical composition containing a double-stranded RNA mimic of miR-27a-5p for use in treating a subject suffering from chronic inflammatory bowel disease (IBD).

2. Pharmaceutical composition for use according to claim 1, wherein said miR-27a-5p mimic RNA contains the sequence AGGGCUUA.

3. Pharmaceutical composition for use according to claim 1 or 2, wherein said miR-27a-5p mimic RNA contains two RNA strands of respective sequences SEQ ID NO:2 and SEQ ID NO:

3.

4. Pharmaceutical composition for use according to one of claims 1 to 3, further comprising a pharmaceutically acceptable excipient.

5. Pharmaceutical composition for its use according to one of claims 1 to 4, in which said miR-27a-5p mimic RNA is associated with or included in a vector, a matrix or particles promoting its stability and / or its transfection.

6. Pharmaceutical composition for use according to claim 5, wherein said vector is chosen from: adenoviruses, retroviruses, lentiviruses, adeno-associated viruses (AAV), herpes viruses, cytomegaloviruses (CMV), and vaccinia viruses.

7. Pharmaceutical composition for its use according to claim 5, wherein said particles are chosen from: liposomes (DOPC), lipid nanoparticles, nanocells, silica nanoparticles, exosomes.

8. Pharmaceutical composition for use according to claim 5, wherein said matrix is ​​selected from neutral lipid emulsion (NLE), polyethylenimine (PEI), poly(lactide-co-glycolide) (PLGA).

9. Pharmaceutical composition for its use according to one of claims 1 to 4, for preventing or treating colon cancer induced by IBD.

10. Pharmaceutical composition for use according to one of claims 1 to 9, characterized in that the pharmaceutical composition is in a form suitable for intravenous administration.

Images