Phytoecdysones and / or 20-hydroxyecdysone derivatives in combination with a GLP-1 agonist for use in the treatment of obesity and overweight
Combining phytoecdysones or semi-synthetic 20-hydroxyecdysone derivatives with GLP-1 receptor activators addresses muscle loss and enhances fat loss and insulin sensitivity, providing effective and sustained weight management for obesity and overweight patients.
Patent Information
- Application Number
- FR2024001011
- Authority / Receiving Office
- FR · FR
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-02-01
- Publication Date
- 2025-08-08
AI Technical Summary
Existing GLP-1 receptor agonist treatments for obesity and overweight lead to significant muscle mass loss and reduced lean body mass, posing risks for mobility and metabolic health, particularly in sarcopenic obese patients, while their weight loss effects are transient and may promote weight regain.
Combining phytoecdysones or semi-synthetic derivatives of 20-hydroxyecdysone with GLP-1 receptor activators to concomitantly activate the ACE2/Ang-1-7/MASR axis, enhancing muscle maintenance and fat loss, improving insulin sensitivity, and preventing weight regain.
The combination therapy maintains muscle mass and strength, enhances fat loss, and improves insulin sensitivity, offering sustained weight management with reduced adverse effects and lower dosages of GLP-1 receptor activators.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
Title of the invention: Phytoecdysones and / or 20-hydroxyecdysone derivatives in combination with a GLP-1 agonist for their use in the treatment of obesity and overweight Technical field of the invention
[0001] The invention relates to the use of phytoecdysones and / or semisynthetic derivatives of 20-hydroxyecdysone, in combination with a GLP-1 receptor agonist, for their use in the treatment of metabolic disorders in obese or overweight mammals, in particular by preventing a loss of muscle mass and function, in particular mobility, or even improving the loss of fat mass, preventing the regain of fat mass and improving insulin sensitivity. Prior art
[0002] Among metabolic diseases, obesity is a chronic disease whose number of cases has almost tripled since 1975. In 2016, more than 1.9 billion people aged 18 and over were overweight (39%), of which more than 650 million were obese (13%) (Aune et al., 2016). Being overweight (Body Mass Index [BMI] between 25 and 29.9 kg / m2) or obese (BMI>30 kg / m2) increases the risk of type 2 diabetes, fatty liver disease, kidney disease, and other health problems.
[0003] The concept of sarcopenic obesity was introduced a few years ago to describe, in the elderly, the concomitance of excess fat mass and a reduction in lean mass and / or muscle function. The pathophysiology of sarcopenic obesity is complex but an inter-relationship between adipose tissue and muscle, in the form of a vicious circle, is clearly documented (Cauley et al., 2015). Advancing age leads to a decrease in physical activity and basal energy expenditure, thus promoting weight gain. In response to the accumulation of this adiposity, a state of chronic inflammation appears, mediated mainly by leptin but also by pro-inflammatory cytokines, inhibiting muscle anabolism (Kalinkovich et al., 2017).Furthermore, with aging, adipose tissue loses its capacity for lipid accumulation and expansion, which leads to an increase in lipid infiltration of the muscle, causing a loss of strength and a decrease in protein synthesis. One of the consequences, particularly in obese elderly people, is a loss of mobility (Vincent et al. 2010). Interventions should therefore prioritize low-fat dietary intake and promote physical activity, with a view to stimulating muscle anabolism.
[0004] Incretins are hormones secreted by endocrine intestinal cells following food intake. Two physiological incretins exist: Glucose-dependent insulinotropic Polypeptide (GIP) and Glucagon-like Peptide-1 (GLP-1), both of polypeptide nature. Incretins (mainly GLP-1) regulate carbohydrate homeostasis by different mechanisms such as (i) stimulation of glucose-dependent insulin secretion by cells [3 and inhibition of postprandial glucagon secretion by α-cells at the pancreatic level; (ii) reduction of hepatic gluconeogenesis; (iii) increase of insulin sensitivity and increase of glucagon uptake at the muscular level.They also slow down gastric emptying and gastric acid secretion, which has the effect of reducing the post-prandial glycemic peak, causing a feeling of satiety or reducing appetite, and therefore limiting food intake and weight gain (Millier et al., 2019).
[0005] The GLP-1 receptor agonist (GLP-1RA) treatments that have obtained marketing authorization are mostly peptide analogues of GLP-1, administered by subcutaneous injection and are commonly used for the treatment of type 2 diabetes, such as Dulaglutide (Trulicity®), Exenatide (Byetta®, Bydureon®), Liraglutide (Victoza®), Lixisenatide (Adlyxin®), Semaglutide (Ozempic®, Wegovy®), Albiglutide (Eperzan®, Tanzeum®), Noiiglutide. The Food and Drug Administration in the United States recently authorized an oral formulation of Semaglutide (Rybelsus®). Finally, Tirzepatide (Mounjaro®) is a dual activator of the GLP-1 and GIP receptors.Two GLP-1RAs (liraglutide and semaglutide in injectable form), given their high efficacy in weight loss in obese patients, have obtained Marketing Authorization in Europe in recent years for weight loss in certain non-diabetic obese patients, in addition to lifestyle and dietary measures (Alruwaili et al., 2021; Pi-Sunyer et al., 2015; Wilding et al., 2021). More recently, an international trial demonstrated promising effects for orforglipron, an orally active non-peptide GLP-1 analogue, in this indication (Wharton et al., 2023).
[0006] Some results obtained following the intake of these molecules (GLP-IRA) raise questions. At the preclinical level, in animals, a recent study showed that semaglutide maintained muscle mass, highlighting a protective effect against muscle wasting by suppressing muscle atrophy factors and stimulating myogenic factors (Xiang et al., 2023). Furthermore, in humans, in the STEP 1 and SUSTAIN 8 clinical trials, the proportion of lean mass in relation to total body mass increased overall, indicating an overall improvement in body composition. Nevertheless, a number A growing body of data highlights a link between GLP-1RA and reduced lean body mass, particularly muscle mass. In these same clinical trials (STEP 1 and SUSTAIN 8) on semaglutide, it was shown that 39–40% of the weight lost with this GLP-1RA was lean mass (Wilding et al., 2021; Lingway et al., 2019). A 2021 meta-analysis of 18 randomized controlled trials showed that GLP-1RA drugs, including oral and subcutaneous semaglutide as well as older GLP-1RA drugs such as lixisenatide, exenatide, and liraglutide, led to a significant decrease in lean mass (Uneda et al., 2021). Data from the SURMOUNT-1 study of tirzepatide (a dual GLP-1 and GIP receptor activator) provided more positive findings: fat mass decreased by 33–36% and lean mass by 10–11%, depending on the age group (Jastreboff et al., 2022). In other words, about a quarter of the weight lost in this study was lean mass. Finally, another meta-analysis concluded that semaglutide and other GLP-1 receptor agonists significantly decreased lean mass compared to placebo (Ida et al., 2021).
[0007] This muscle loss is problematic because muscles are necessary for metabolism, strength, motor function, and therefore mobility. According to the Centers for Disease Control and Prevention, 41.5% of older American adults are obese and could benefit from a weight-loss drug. Up to 34.4% of these patients over the age of 60 suffer from sarcopenic obesity, meaning the patients are overweight or obese and also have low muscle mass related to age. These sarcopenic obese patients are potentially at greatest risk of losing muscle mass if they are treated for obesity with a GLP-IRA-based molecule.Patients with extremely low muscle mass may suffer from muscle weakness leading to poor balance, decreased walking speed, inability to ambulate, loss of mobility and independence, falls, bone fractures, and increased mortality.
[0008] Furthermore, regarding the use of GLP-1 analogues for the purpose of weight loss, authorities have recently called for caution, recalling that the weight losses observed are transient, with a recovery upon stopping treatment, and that no effect on obesity-related morbidity and mortality has currently been demonstrated, while the adverse effects linked to their use are potentially serious (acute pancreatitis, severe constipation, etc.).
[0009] The above elements indicate that in people with a BMI>30, although GLP-1 agonist type therapies have demonstrated significant effects on weight loss in treated individuals, it remains necessary to find complementary therapeutic approaches, which would allow both to further protect the mass and muscle function but also to potentiate the effects on fat mass in people receiving treatment with a GLP-1 receptor agonist.
[0010] Phytoecdysones represent an important family of polyhydroxylated phytosterols. These molecules are produced by various plant species (ferns, gymnosperms, angiosperms) and participate in their defense against insect pests. The major phytoecdysone in the plant kingdom is 20-hydroxyecdysone.
[0011] 20-Hydroxyecdysone (20E) is pharmacologically active in mammals. It activates the MAS receptor (MASR), a receptor of the protective arm of the Renin Angiotensin System (Lafont et al., 2021) which induces a number of beneficial effects on muscle that have been described in preclinical studies in physiological and pathological contexts. Ingestion of 20-hydroxyecdysone (20E) by obese mammals on a low-calorie diet reduces adipocyte diameter and improves insulin sensitivity WO2013068704 (Lafont et al., 2013).
[0012] BIO101 is a 20E preparation with a purity greater than or equal to 97%. Its preparation process is disclosed in international patent application WO2018197731 (Lafont et al., 2018). BIO101 demonstrates anabolic properties via activation of the AKT / mTOR pathway as well as beneficial effects dependent on MASR activation on myogenic differentiation (related to increased expression of MyoD and myogenin). Chronic oral BIO101 treatment induced AKT / mTOR activation and anabolic effects accompanied by improvements in physical performance in adult and aged animals (Serova et al. 2023).
[0013] BIO101 is a new drug candidate clinically developed for the treatment of sarcopenia, Duchenne muscular dystrophy and COVID-19. These therapeutic applications are notably the subject of international patent applications, WO2013088084 (Veillet et al., 2012), WO2018197708 (Dilda et al., 2018) and WO2021198588 (Dilda et al., 2021).
[0014] Semi-synthetic derivatives of 20E have also been developed, as disclosed in international patent application WO2015177469 (Lafont et al., 2015), and are used for such therapeutic applications. Presentation of the invention
[0015] The present invention relates to a novel therapy in which a MAS receptor (MASR) activator, more specifically a phytoecdysone (e.g., 20-hydroxyecdysone) or semi-synthetic derivatives of 20-hydroxyecdysone, and an activator of the glucagon-like peptide-1 (GLP-1) signaling pathway are used together for the treatment of obesity, sarcopenic obesity / overweight, or weight management in a mammal. In the context of the present invention, Weight management encompasses not only overall weight loss, but also improvements in body composition, e.g., an increase in lean (muscle) mass relative to fat (adipose) mass or at least protection against loss of lean mass relative to fat mass, protection against weight regain, maintenance or increase in muscle strength, particularly in relation to mobility, and finally an improvement in insulin sensitivity. Combination therapies, which we will call "combinations" of active ingredients, as well as complementary / add-on therapies are considered here.
[0016] The present invention aims to limit as much as possible the loss of muscle mass and strength, in particular at the appendicular level, in mammals treated with a GLP-1 receptor activator. Without being bound by a particular theory, it is envisaged here that a concomitant activation of the ACE2 / Ang-1-7 / MASR axis can prevent a loss of muscle mass and strength resulting from the chronic administration of the active ingredient having the capacity to activate the GLP-1 receptor.
[0017] To this end, the present invention relates to at least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone, for its / their use in mammals treated with at least one active ingredient having the capacity to activate the GLP-1 receptor.
[0018] In particular embodiments, the invention further meets the following characteristics, implemented separately or in each of their technically operative combinations.
[0019] Certain obese, sarcopenic obese, or overweight mammals that do not respond optimally to a GLP-1 pathway activator, or those that poorly tolerate a GLP-1 pathway activator, may benefit from phytoecdysones / 20-hydroxyecdysone derivatives used in conjunction with a GLP-1 pathway activator. Thus, patients who respond poorly to GLP-1 activating therapy may benefit from phytoecdysones / 20-hydroxyecdysone derivatives in combination, either as combination therapy or as adjunctive therapy.
[0020] Thus, the present invention relates to the combination of at least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone, and at least one active ingredient having the capacity to activate the GLP-1 receptor, for their use in the treatment of obesity, sarcopenic obesity or overweight in mammals.
[0021] The present invention further relates to the combination of at least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone, and at least one active ingredient having the capacity to activate the GLP-1 receptor, for their use in the treatment or prevention of loss of muscle mass and / or strength. muscle in obese, sarcopenic obese or overweight mammals.
[0022] The present invention further relates to the combination of at least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone, and at least one active ingredient having the capacity to activate the GLP-1 receptor, for their use in the treatment or prevention of loss of mobility in obese, sarcopenic obese or overweight mammals.
[0023] Without being bound by any particular theory, it is contemplated herein that concomitant activation of the ACE2 / Ang-1-7 / MASR axis may enhance the effect of GLP-1 pathway activation and improve a therapeutic outcome or allow a therapeutic outcome, in terms of fat mass losses, at a lower dose or less frequent administration of the GLP-1 pathway activating drug.
[0024] According to a particular embodiment, the invention relates to the combination which is the subject of the present invention, for its use in the potentiation of the loss of fat mass in obese, sarcopenic obese or overweight mammals treated with the active ingredient having the capacity to activate the GLP-1 receptor.
[0025] The use of phytoecdysones / 20-hydroxyecdysone derivatives allows for the maintenance of weight loss in an obese or overweight subject. While not intended to be bound by theory, it is contemplated that MASR activation may lead to the avoidance of certain metabolic changes associated with weight loss in a subject that would otherwise promote weight regain. Such metabolic changes include, but are not limited to, decreased energy expenditure, decreased lean muscle mass, decreased skeletal muscle function, decreased insulin sensitivity relative to the level(s) observed in the subject prior to treatment, i.e., in the absence of a MASR activator. Thus, in certain embodiments, the present invention encompasses the use of a MASR activator to reverse metabolic changes associated with weight loss in an obese or overweight subject.The effects of such use may include increased energy expenditure, increased lean muscle mass, increased overall skeletal muscle function, increased insulin sensitivity (Foucault et al., 2014) compared to baseline, i.e., in the absence of a MASR activator.
[0026] According to a particular embodiment, the invention relates to the combination which is the subject of the present invention, for its use in maintaining weight loss or protecting against weight regain, in obese, overweight or sarcopenic obese mammals, treated with the active ingredient having the capacity to activate the GLP-1 receptor.
[0027] Without being bound by any particular theory, it is envisaged here that concomitant activation of the ACE2 / Ang-1-7 / MASR axis may enhance the effect of activation of the GLP-1 pathway and improve insulin sensitivity, at a lower dose or less frequent administration of the active ingredient with the ability to activate the GLP-1 receptor.
[0028] According to a particular embodiment, the invention relates to the combination which is the subject of the present invention, for its use in improving insulin sensitivity in obese, sarcopenic obese or overweight mammals treated with the active ingredient having the capacity to activate the GLP-1 receptor.
[0029] In some embodiments, the treatment comprising the active ingredient having the ability to activate the GLP-1 receptor further comprises a calorie restriction regimen and / or a physical exercise regimen as part of the treatment.
[0030] Thus, the therapeutic methods described herein may be useful for chronic weight management aimed at treating excess adiposity and metabolic disorders in obese, sarcopenic obese or overweight subjects while maintaining or improving their health status, their body composition (for example, lean mass / fat mass ratios) and their muscular function, in particular appendicular and more broadly their motor function and mobility.
[0031] In the context of the present application, the term "combination therapy" or “Combination” means the co-administration of at least two biologically active agents. In the case of the present invention, a first active agent is selected from phytoecdysones or semi-synthetic derivatives of 20-hydroxyecdysone or is a composition comprising at least one phytoecdysones and / or at least one semi-synthetic derivative of 20-hydroxyecdysone, at least a second active agent being the active ingredient having the ability to activate the GLP-1 receptor. The combination therapy may comprise a single formulation or several formulations. The co-administration may be carried out simultaneously or sequentially. The co-administration may be carried out by the same route of administration or by different routes of administration. It is considered a combination therapy as long as the effects of the two (or more) agents overlap in the subject to achieve additional, additive or synergistic clinical effects.
[0032] In particular embodiments, said at least one phytoecdysone and / or said at least one semi-synthetic derivative of 20-hydroxyecdysone, and said at least one active ingredient having the capacity to activate the GLP-1 receptor are co-administered.
[0033] In particular embodiments, said at least one phytoecdysone and / or said at least one semi-synthetic derivative of 20-hydroxyecdysone, and said at least one active ingredient having the capacity to activate the GLP-1 receptor are co-administered within the same composition.
[0034] In particular embodiments, said at least one phytoecdysone and / or said at least one semi-synthetic derivative of 20-hydroxyecdysone are administered by oral or systemic or intranasal route to the mammal, and said at least one active ingredient having the capacity to activate the GLP-1 receptor is administered to the mammal by subcutaneous route and / or by oral route.
[0035] For oral administrations, said at least one phytoecdysone and / or said at least one semi-synthetic derivative of 20-hydroxyecdysone and / or the active ingredient having the capacity to activate the GLP-1 receptor, is preferably incorporated into an acceptable pharmaceutical formulation which can be administered orally.
[0036] Modifications may be introduced into the peptide hormone to generate GLP-1 analogs to prolong or stabilize its activity. In embodiments, the active ingredient having the ability to activate the GLP-1 receptor is a GLP-1 peptide analog preferably selected from dulaglutide (Trulicity®), exenatide (Byetta®, Bydureon®), liraglutide (Victoza®), lixisenatide (Adlyxin®), se-maglutide (Ozempic®, Wegovy®, Rybelsus®), albiglutide (Eperzan®, Tanzeum®), and noiiglutide.
[0037] In embodiments, the active ingredient having the ability to activate the GLP-1 receptor is a peptide analog of GLP-1 also having the ability to activate the GIP receptor. An example of such an active ingredient is tirzepatide (Mounjaro®).
[0038] In some embodiments, the active ingredient having the ability to activate the GLP-1 receptor is non-peptidic in nature. By non-peptidic, it is meant that the active ingredient having the ability to activate the GLP-1 receptor is a molecule that is not a GLP-1 analog. Non-limiting examples of active ingredient having the ability to activate the GLP-1 receptor of non-peptidic nature include orforglipron and danuglipron.
[0039] In particular embodiments of the present invention, the active ingredient having the capacity to activate the GLP-1 receptor is a molecule of size less than or equal to 0.8 kDa.
[0040] In particular embodiments of the present invention, the active ingredient having the capacity to activate the GLP-1 receptor is a peptide-type GLP-1 analog.
[0041] In particular embodiments of the present invention, the active ingredient having the capacity to activate the GLP-1 receptor is GLP-1.
[0042] In particular embodiments of the present invention, the active ingredient having the capacity to activate the GLP-1 receptor is administered subcutaneously at a dose of between 0.25 and 50 mg in humans. Preferably this dose is administered once a week.
[0043] In particular embodiments of the present invention, the active ingredient having the capacity to activate the GLP-1 receptor is administered subcutaneously to a dose between 10 and 400 pg per day in humans.
[0044] In particular embodiments of the present invention, the active ingredient having the capacity to activate the GLP-1 receptor is administered orally at a dose of between 3 and 250 mg in humans. Preferably, this dose is administered each day in one or more doses.
[0045] A phytoecdysone that can be used according to the invention is, for example, 20-hydroxyecdysone (20E).
[0046] Semi-synthetic derivatives of 20-hydroxyecdysone are understood to mean in particular the known compounds which are the subject of patent application WO 2015 / 177469 in which their production by semi-synthesis is described.
[0047] Phytoecdysones and semi-synthetic derivatives of 20-hydroxyecdysone are advantageously purified to pharmaceutical grade.
[0048] In particular embodiments of the present invention, said at least one phytoecdysone and / or said at least one semi-synthetic derivative of 20-hydroxyecdysone are in the form of a composition comprising said at least one phytoecdysone and / or said at least one semi-synthetic derivative of 20-hydroxyecdysone. According to a preferred embodiment, this composition comprises 20-hydroxyecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone.
[0049] The 20-hydroxyecdysone used is preferably in the form of an extract of plants rich in 20-hydroxyecdysone or of a composition comprising 20-hydroxyecdysone as active agent. Extracts of plants rich in 20-hydroxyecdysone are, for example, extracts of Stemmacantha carthamoides (also called Leuzea carthamoides or Rhaponticum carthamoides), Cyanotis arachnoidea, Cyanotis vaga, Pfaffia glomerata and Pfaffia paniculata.
[0050] The extracts obtained are preferably purified to pharmaceutical grade.
[0051] In one embodiment, the 20-hydroxyecdysone is included in an extract of a plant or a part of a plant, said plant being chosen from plants containing at least 0.5% of 20-hydroxyecdysone by dry weight of said plant. Said extract preferably comprises at least 95%, and preferably at least 97%, of 20-hydroxyecdysone. Said extract thus represents 20-hydroxyecdysone purified to pharmaceutical grade.
[0052] Said extract or said 20-hydroxyecdysone thus purified are hereinafter called BIO101. BIO101 remarkably contains impurities, such as minor ecdysteroids, in individual proportions of between 0 and 0.5%.
[0053] In a particular embodiment, the phytoecdysones are administered at a dose of between 0.1 and 15 milligrams per kilogram per day in humans. Phytoecdysones are understood here to mean both phytoecdysones in general than 20-hydroxyecdysone (especially in extract form) and its semi-synthetic derivatives.
[0054] Preferably, the phytoecdysones are administered at a dose of 5 to 1000 mg / day, in one or more doses, in an adult human, and a dose of 0.2 to 350 mg / day, in one or more doses, in a human child or infant. Phy-toecdysone is understood here to mean both phytoecdysones in general and 20-hydroxyecdysone (in particular in extract form) and its semi-synthetic derivatives.
[0055] In particular embodiments of the present invention, said at least one semi-synthetic derivative of 20-hydroxyecdysone is chosen from: - a compound of general formula (I): [Chem 1] in which: R1 is chosen from: a (Ci-C6)W(Ci-C6) group; a (Ci-C6)W(Ci -C6)W(Ci-C6) group; a (Ci-C6)W(Ci-C6)CO2(Ci-C6) group; a (Ci-C6)A group, A representing a heterocycle optionally substituted by a group of the OH, OMe, (Ci-C6), N(Ci-C6), CO2(Ci-C6) type; a CH2Br group; W being a heteroatom chosen from N, O and S, preferably O and even more preferably S; and, - a compound having formula (II): [Chem 2]
[0056] In the context of the present invention, the term "(Ci-C6)" means any alkyl group of 1 to 6 carbon atoms, linear or branched, in particular, the methyl, ethyl, n-propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl, t-butyl, n-pentyl, n-hexyl groups. Advantageously, it is a methyl, ethyl, iso-propyl or t-butyl group, in particular a methyl or ethyl group, more particularly a methyl group.
[0057] In the context of the present invention, the term heterocycle preferably means a cycle comprising 5 or 6 atoms including one or two heteroatoms (O, S or N), the remaining atoms being carbon atoms.
[0058] In a preferred embodiment of the present invention, in general formula (I): R1 is chosen from: a (Ci-C6)W(Ci-C6) group; a (Ci-C6)W(Ci -C6)W(Ci-C6) group; a (Ci-C6)W(Ci-C6)CO2(Ci-C6) group; a (Ci-C6)A group, A representing a heterocycle optionally substituted by a group of the OH, OMe, (CrC6), N(Ci-C6), CO2(CrC6) type; W being a heteroatom chosen from N, O and S, preferably O and more preferably S.
[0059] In particular embodiments of the present invention, said at least one semi-synthetic derivative of 20-hydroxyecdysone is a compound chosen from the following compounds: No. 1: (2S,3R,5R,10R,13R,14S,17S)-2,3,14-trihydroxy-10,13-dimethyl-17-(2-morpholinoacet yl)-2,3,4,5,9,111,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one, No. 2: (2S,3R,5R, 10R, 13R, 14S, 17S)-2,3,14-trihydroxy-17-[2-(3-hydroxypyrrolidin- l-yl)acet y 1] -10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1 H-cyclopenta[a]phenanthren-6-one; No. 3: (2S,3R,5R,10R,13R,14S,17S)-2,3,14-trihydroxy-17-[2-(4-hydroxy-l-piperidyl)acetyl]-10,13-dimethyl-2,3,4,5,9,ll,12,15,16,17-decaliydro-lH-cyclopenta[a]phenanthrene-6-one; No. 4: (2S,3R,5R,10R,13R,14S,17S)-2,3,14-trihydroxy- 17-[2-[4-(2-hydroxyethyl)- 1-piperidyl]acetyl]-10,13-dimethyl-2,3,4,5,9,111,12,15,16,17-decalihydro-1H-cyclopenta[a]phenanthrene-6-one; No. 5: (2S,3R,5R,10R,13R,14S,17S)-17-[2-(3-dimethylaminopropyl (methyl)amino)acetyl]-2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,111,12,15,16,17-dec ahy dro-1 Hc y clopenta[a] phenanthrene- 6-one; No. 6: 2-[2-oxo-2-[(2S,3R,5R,10R,13R,14S,17S)-2,3,14-trihydroxy-10,13-dimethyl-6-oxo-2, 3,4,5,9,111,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-17-yl]ethyl]sulfanylac etate d'éthyle; No. 7: (2S,3R,5R,10R,13R,14S,17S)-17-(2-ethylsulfanylacetyl)-2,3,14-trihydroxy-10,13-dim ethyl-2,3,4,5,9,ll,12,15,16,17-decahydro-lH-cyclopenta[a]phenanthren-6-one; No. 8: (2S,3R,5R,10R,13R,14S,17S)-2,3,14-trihydroxy-17-[2-(2-hydroxyethylsulfanyl)acetyl]-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H cy-clopenta[a]phenanthren-6-one.
[0060] According to another aspect, the present invention relates to a composition comprising: - at least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hy droxyecdy sone, - at least one active ingredient having the capacity to activate the GLP-1 receptor.
[0061] The present invention relates in particular to such a composition for its use in the treatment of obesity, sarcopenic obesity or overweight in mammals. Such a composition can in particular be used in the treatment or prevention of loss of muscle mass and strength, in particular a loss of mobility, in obese, sarcopenic obese or overweight mammals. It can also be used in the potentiation of loss of fat mass in obese, sarcopenic obese or overweight mammals, and in the maintenance of weight loss in obese or overweight or sarcopenic obese mammals. Finally, this composition can be used to improve insulin sensitivity in obese, sarcopenic obese or overweight mammals.
[0062] This composition for the uses cited may meet one or more of the characteristics described above with reference to the use in combination of said at least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone, and said at least one active ingredient having the capacity to activate the GLP-1 receptor.
[0063] In embodiments the composition is incorporated into an acceptable pharmaceutical formulation which can be administered orally or intranasally or subcutaneously or systemically.
[0064] In the context of the present invention, the term "pharmaceutical acceptable" means that which is useful in the preparation of a pharmaceutical composition, which is generally safe, non-toxic and which is acceptable for veterinary use as well as human pharmaceutical use. Brief description of the figures
[0065] The invention will be better understood on reading the following description, given by way of non-limiting example, and made with reference to the figures which represent:
[0066] [Fig.l] represents a diagram illustrating the scientific rationale for activating the ACE2 / Angl-7 / Mas axis concomitantly with activation of the GLP-1 receptor pathway jointly resulting in a reduction of muscle atrophy, stimulation of muscle differentiation and improvement of insulin sensitivity. Description of the embodiments
[0067] I. Tests carried out on myoblast cultures
[0068] a. Culture conditions, treatments and gene expression analysis
[0069] The mouse myoblast cell line used is C2C12 (ATCC CRL 1772; Yaffe and Saxel, 1977). For C2C12 proliferation, cells were maintained in a 50 / 50 DMEM / F-12 mixture (Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12) containing 2.5 g / L glucose supplemented with 15% fetal bovine serum (FBS). To induce C2C12 differentiation, the medium was replaced with a DMEM / F-12 mixture supplemented with 2% horse serum.
[0070] The myotubes were then treated with 1.0 mM Palmitic Acid (PA) for 24 hours to simulate obesity in vitro and induce myotube atrophy. The cells were divided into five groups: control group, group treated with PA only, an AP + GLP-1RA group, an AP + BIO101 group and an AP + GLP-1RA + BIO101 group. BIO101 is an extract of a plant or a part of a plant, said plant being chosen from plants containing at least 0.5% of 20-hydroxyecdysone by dry weight of said plant, said extract comprising at least 95%, and preferably at least 97%, of 20-hydroxyecdysone. BIO101 remarkably comprises impurities, such as minor ecdysteroids, in individual proportions of between 0 and 0.5%. GLP-1RA is an active ingredient having the capacity to activate the GLP-1 receptor.
[0071] Analysis of the expression of several genes was carried out using the following primers: - the sense primer or "forward" in Anglo-Saxon terminology (F) 5'- CTTCTCGACTGCCATCCTGGAT-3' and antisense primer or "reverse" in English terminology (R) 5'- TCTTTTGGGCGATGCCACTCAG-3' for the gene coding for the Atrogin 1 protein (Identification number 67731 for the pair of primers from the Origene® brand); primer (F) 5'- TACCAAGCCTGTGGTCATCCTG3' and primer (R) 5'-ACGGAAACGACCTCCAGACATG-3' for the gene encoding the MURF1 protein (ID number 433766 for the primer pair of the Origene® brand); primer (F) 5'-A GCACTACAGTGGCGACTCAGAT-3' and primer (R) 5'-TAGTAGGCGGTGTCGTAGCCAT-3' for the gene encoding the protein MyoD (Identification number 17927, from the brand Origene®); primer (F) 5'- CCATCCAGTACATTGAGCGCCT -3' and primer (R) 5'-CTGTGGGAGTTGCATTCACTGG-3' for the MyoG gene encoding the Myogenin protein (ID number 17928 for the primer pair of the Origene® brand); primer (F) 5'- GGAGCAGATTAGTAAGCGGCTTG-3' and primer (R) 5'-GTTACTGCCACAGGAACTAGAGG-3' for the SIRT1 gene encoding the Sirtuin 1 protein (ID number 93759 for the primer pair of the Origene® brand); primer (F) 5'-GGTGTGGTCAATACGGTCTTCAC-3' and primer (R) 5'-AGCAGAGCCACGGTCATCAAGA-3' for the gene coding for the GLUT4 protein (Identification number 20528 for the primer pair of the Origene® brand); primer (F) 5'-CATCACTGCCACCCAGAAGACTG-3' and primer (R) 5'-ATGCCAGTGAGCTTCCCGTTCAG-3' for the gene encoding the enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Identification number 14433 for the primer pair of the Origene® brand); primer (F) 5'- GCAGTGCCTATCCAGAAAGTCC-3' and primer (R)5'-GGAATGAAGTCCAAGCCAGTGAC-3' for the gene encoding the protein Leptin (Identification number 16846 for the primer pair of the Origene® brand).
[0072] b. Preparation of cell lysates and western blots
[0073] C2C12 cell cultures under various conditions were harvested directly into ice-cold radioimmunoprecipitation assay (RIPA) buffer. For Western blots, cell lysates were electrophoresed on 5-15% gradient sodium dodecyl sulfate-polyacrylamide (or SDS-polyacrylamide) gels, then transferred to a nitrocellulose membrane and incubated with primary antibodies diluted 1:1000 overnight at 4°C (anti-SIRT1, anti-GLUT4, anti-Atrogin, anti-Myogenin, anti-GAPDH). The membrane was then incubated with a secondary antibody at 37°C for 1 hour.
[0074] IL Tests carried out on adipocyte cultures
[0075] 3T3-L1 cells were cultured into pre-adipocytes in a suitable cell medium. For adipocyte differentiation, 3T3-L1 cells that had reached ~90% confluence were cultured in adipocyte induction medium for 3 days. The cells were treated during the differentiation phase with different concentrations of GLP-1A alone, or with BIO101 alone, or in combination (BIO101+GLP1-RA).
[0076] An assessment of adipocyte proliferation was carried out using Ki67 labeling. The production of lipid droplets (using Oil Red O labeling) was determined as well as the adipocyte differentiation capacities using RTqPCR analysis of the expression of genes coding for the C / EBPa and PPARy proteins. The primer pairs used are as follows: primer (F) 5'- GCAAAGCCAAGAAGTCGGTGGA -3' and primer (R) 5'-CCTTCTGTTGCGTCTCCACGTT -3' for the gene encoding the C / EBPa protein (ID number 12606 for the primer pair of the Origene® brand); primer (F) 5'- GTACTGTCGGTTTCAGAAGTGCC -3' and primer (R) 5'-ATCTCCGCCAACAGCTTCTCCT -3' for the gene coding for the PPARy protein (Identification number 19016 for the primer pair of the Origene® brand).
[0077] III. Tests carried out on rodents
[0078] Animal models mimicking obesity have been used, such as the obese rat or mouse model induced by the consumption of a high-fat diet (“Highfat diet” in English terminology).
[0079] a. Intraperitoneal glucose tolerance test (IPGTT) and insulin tolerance test (ITT).
[0080] After 16 hours of fasting, the mice received an intraperitoneal injection of 20% glucose at a dose of 2.0 g / kg body weight. Blood glucose levels were then completed at 0, 15, 30, 60 and 120 minutes post injection. One week after the glucose tolerance test, the mice were fasted for 4 hours and then received an intraperitoneal injection of insulin at 0.5 U / kg body weight (Unit per kg). Blood glucose levels were then determined at 0, 15, 30, 45, 60 and 90 minutes post injection.
[0081] b. Assessment of body weight and lower limb muscle weight and biochemical markers
[0082] The body weight of the mice is determined weekly, during and after stopping treatment with GLP-1 and / or BIO101. After anesthesia and sacrifice of the animals, the muscles of the lower limbs are separated, removed and weighed. The muscles in question are the gastrocnemius muscle, the tibialis anterior muscle, the soleus muscle and the quadriceps femoris muscle.
[0083] A longitudinal analysis of biomarkers relating to lipid homeostasis was carried out using plasma assays of adipokines (adiponectin, leptin), triglycerides, and cholesterol.
[0084] c. Tissue preparation and histological analysis
[0085] The muscles collected and cited above were frozen in a suitable compound to preserve the cellular ultrastructure which is OCT ("Optimal Cutting Temperature" in English terminology) then cut into 7 μm sections in order to be stained with hematoxylin-eosin, or with Oil Red O, in order to be able to respectively determine the average diameter of the muscle fibers and quantify the fatty infiltration in the muscle (positive area for Oil Red O).
[0086] d. Grip strength test
[0087] The measurement of the grip strength (grip test) of the mice is carried out using an electronic grip meter. The mouse grasps the metal grid with its limbs, then a progressive traction is applied to the tail backwards and parallel to the table until it releases the grid. The maximum force developed is recorded and corresponds to the grip strength of the mouse. This operation is repeated three times per animal.
[0088] e. Suspension test
[0089] Each mouse is placed inverted under a grid which it grasps with the claws of all 4 limbs. The suspension time is measured. This operation is repeated three times per animal and the maximum suspension time is determined.
[0090] f Physical activity in toto on treadmill
[0091] Mice were subjected to a running tolerance test on a horizontal motorized treadmill. Their maximum running speed (Vmax) and maximum running distance were recorded at the end of the experiment. The treadmill speed increased to 20 cm / s within 2 minutes. The speed was then increased by 5 cm / s every 5 minutes until the mice were exhausted.
[0092] g. In situ evaluation of the strength and contractile properties of isolated muscles
[0093] This approach was used at the end of treatment in order to analyze the overall strength and the Contractile characteristics of the extensor digitorum longus (Edi, fast muscle) and soleus (slow muscle) in anesthetized animals. Mechanical responses such as twitch and tetanus, developed in response to electrical stimulation of increasing intensity and frequency, were analyzed. This approach also allows for the analysis of sensitivity to the muscle fatigue process as well as the post-fatigue recovery capacity (Auda-Boucher et al., 2007).
[0094] All these experiments were carried out blindly.
[0095] Mice were anesthetized with sodium pentobarbital ip (85 mg / kg). The tibialis anterior was freed from the distal tendon, and then a suture (Flexocrin 6 / 0) was passed under the Edl tendons. The muscle was then ligated, and the tendons were cut below this ligature. The muscle was attached to the tension sensor. Stimulating electrodes were placed under the muscle perfused with HEPES-buffered Ringer's.
[0096] Bibliographie
[0097] Alruwaili H, Dehestani B, le Roux CW. Clinical Impact of Liraglutide as a Treatmentof Obesity. Clin Pharmacol. 2021;13:53-60. doi: 10.2147 / CPAA.S276085.
[0098] Aune D, Sen A, Prasad M, et al. BMI and ail cause mortality: systematic review and non-linear dose-response meta-analysis of 230 cohort studies with 3.74 million deaths among 30.3 million participants. BMJ 2016;353:i2156. DOI: 10.1136 / bmj.i2156.
[0099] Auda-Boucher G, Rouaud T, Lafoux A, Levitsky D, Huchet-Cadiou C, Feron M, Guevel L, Talon S, Fontaine-Pérus J, Gardahaut MF. Fêtai muscle-derived cells can repair dystrophie muscles in mdx mice. Exp Cell Res. 2007;313(5):997-1007. doi: 10.1016 / j.yexcr.2006.12.021.
[0100] Cauley, J.A. An OverView of Sarcopenic Obesity. J Clin Densitom 2015;18(4):499-505.
[0101] Foucault AS, Even P, Lafont R, Dioh W, Veillet S, Tomé D, Huneau JF, Hermier D, Quignard-Boulangé A. Quinoa extract enriched in 20-hydroxyecdysone affects energy homeostasis and intestinal fat absorption in mice fed a high-fat diet. Physiol Behav. 2014 Apr 10;128:226-31. doi: 10.1016 / j.physbeh.2014.02.002.
[0102] Ida S, Kaneko R, Imataka K, et al. Effects of Antidiabetic Drugs on Muscle Mass in Type 2 Diabètes Mellitus. Current Diabètes Reviews. 2021; 17(3):293-303. DOI: 10.2174 / 1573399816666200705210006.
[0103] Jastreboff AM, Aronne LJ, Ahmad NN, Wharton S, Connery L, Alves B, Kiyosue A, Zhang S, Liu B, Bunck MC, Stefanski A; SURMOUNT-1 Investigators. Tirzepatide Once Weekly for the Treatment of Obesity. N Engl J Med. 2022;387(3):205-216. DOI: 10.1056 / NEJMoa2206038.
[0104] Kalinkovich A, Livshits G. Sarcopenic obesity or obese sarcopenia: A cross talk between age-associated adipose tissue and skeletal muscle inflammation as a main mechanism of the pathogenesis. Ageing Res Rev. 2017;35:200-221. doi: 10.1016 / j.arr.2016.09.008.
[0105] Lafont R, Serova M, Didry-Barca B, Raynal S, Guibout L, Dinan L, Veillet S, Latil M, Dioh W, Dilda PJ. 20-Hydroxyecdysone activâtes the protective arm of the RAAS via the MAS receptor. J Mol Endocrinol. 2021 Dec 23;68(2):77-87. doi: 10.1530 / JME-21-0033.
[0106] Lingvay I, Catarig AM, Frias JP, Kumar H, Lausvig NL, le Roux CW, Thielke D, Viljoen A, McCrimmon RJ. Efficacy and safety of once-weekly semaglutide versus daily canagliflozin as add-on to metformin in patients with type 2 diabètes (SUSTAIN 8): a double-blind, phase 3b, randomised controlled trial. Lancet Diabètes Endocrinol. 2019;7(l 1):834-844. doi: 10.1016 / S2213-8587(19)30311-0.
[0107] Millier TD, Finan B, Bloom SR, D'Alessio D, Drucker DJ, Flatt PR, Fritsche A, Gribble F, Grill HJ, Habener JF, Holst JJ, Langhans W, Meier JJ, Nauck MA, Perez-Tilve D, Pocai A, Reimann F, Sandoval DA, Schwartz TW, Seeley RJ, Stemmer K, Tang-Christensen M, Woods SC, DiMarchi RD, Tschôp MH. Glucagon-like peptide 1 (GLP-1). Mol Metab. 2019;30:72-130. doi: 10.1016 / j.molmet.2019.09.010.
[0108] Pi-Sunyer X, Astrup A, Fujioka K, Greenway F, Halpern A, Krempf M, Lau DC, le Roux CW, Violante Ortiz R, Jensen CB, Wilding JP; SCALE Obesity and Prediabetes NN8022-1839 Study Group. A Randomized, Controlled Trial of 3.0 mg of Liraglutide in Weight Management. N Engl J Med. 2015;373(l): 11-22. doi: 10.1056 / NEJMoal411892.
[0109] Uneda K, Kawai Y, Yamada T, Kinguchi S, Azushima K, Kanaoka T, Toya Y, Wakui H, Tamura K. Systematic review and meta-analysis for prévention of cardio-vascular complications using GLP-1 receptor agonists and SGLT-2 inhibitors in obese diabetic patients. Sci Rep. 2021; 11(1): 10166. doi: 10.1038 / s41598-021-89620-7.
[0110] Vincent HK, Vincent KR, Lamb KM. Obesity and mobility disability in the older adult. Obes Rev. 2010 Aug;l 1(8):568-79. doi: 10.1111 / j.l467-789X.2009.00703.x
[0111] Wharton S, Blevins T, Connery L, Rosenstock J, Raha S, Liu R, Ma X, Mather KJ, Haupt A, Robins D, Pratt E, Kazda C, Konig M; GZGI Investigators. Daily Oral GLP-1 Receptor Agonist Orforglipron for Adults with Obesity. N Engl J Med. 2023;389(10):877-888. doi: 10.1056 / NEJMoa2302392.
[0112] Wilding JPH, Batterham RL, Calanna S, Davies M, Van Gaal LF, Lingvay I, McGowan BM, Rosenstock J, Tran MTD, Wadden TA, Wharton S, Yokote K, Zeuthen N, Kushner RF; STEP 1 Study Group. Once-Weekly Semaglutide in Adults with Overweight or Obesity. N Engl J Med. 2021;384(l 1):989-1002. doi: 10.1056 / NEJMoa2032183.
[0113] Xiang J, Qin L, Zhong J, Xia N, Liang Y. GLP-1RA Liraglutide and Semaglutide Improves Obesity-Induced Muscle Atrophy via SIRT1 Pathway. Diabètes Metab Syndr Obes. 2023; 16: 2433-2446 https: / / doi.org / 10.2147 / DMSO.S42562.
[0114] Yaffe D, Saxel O. Serial passaging and différentiation of myogénie cells isolated from dystrophie mouse muscle. Nature. 1977 Dec 22-29;270(5639):725-7. doi: 10.1038 / 270725a0. PMID: 563524.
Claims
Claims
1. At least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone, for use in mammals treated with at least one active ingredient having the capacity to activate the GLP-1 receptor.
2. At least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone, and at least one active ingredient having the capacity to activate the GLP-1 receptor, for their use in the treatment of obesity, sarcopenic obesity or overweight in mammals.
3. At least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone, and at least one active ingredient having the capacity to activate the GLP-1 receptor, for their use in the treatment or prevention of loss of muscle mass and / or muscle strength and / or mobility in obese, sarcopenic obese or overweight mammals.
4. At least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone, and at least one active ingredient having the capacity to activate the GLP-1 receptor, for their use in the potentiation of fat mass loss in obese, sarcopenic obese or overweight mammals.
5. At least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone, and at least one active ingredient having the capacity to activate the GLP-1 receptor, for their use in maintaining weight loss or protecting against weight regain in obese, sarcopenic obese or overweight mammals.
6. At least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone, and at least one active ingredient having the capacity to activate the GLP-1 receptor, for their use in improving insulin sensitivity in obese, sarcopenic obese or overweight mammals.
7. At least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone for its use according to claim 1 or, at least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone and at least one active ingredient having the capacity to activate the GLP-1 receptor for their use according to any one of claims 2 to 6, wherein the active ingredient having the capacity to activate the GLP-1 receptor is a GLP-1 analogue, preferably chosen from dulaglutide, exenatide, liraglutide, lixisenatide, semaglutide, albiglutide, noiiglutide, or tirzepatide.
8. At least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone for its use according to claim 1, or at least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone and at least one active ingredient having the capacity to activate the GLP-1 receptor for their use according to any one of claims 2 to 6, wherein the active ingredient having the capacity to activate the GLP-1 receptor is of non-peptide nature.
9. At least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone for its use according to claim 1 or, at least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone and at least one active ingredient having the capacity to activate the GLP-1 receptor, for their use according to any one of claims 2 to 8, wherein said at least one phytoecdysone is 20-hydroxyecdysone.
10. At least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone for its use according to claim 1 or, at least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone and at least one active ingredient having the capacity to activate the GLP-1 receptor for their use according to claim 9, wherein the 20-hydroxyecdysone is in the form of a plant extract or a part of a plant, said extract comprising at least 95%, and preferably at least 97%, of 20-hydroxyecdysone.
11. At least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone for its use according to claim 1 or, at least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone and at least one active ingredient having the capacity to activate the GLP-1 receptor for their use according to any one of claims 2 to 10, wherein said at least one semi-synthetic derivative of 20-hydroxyecdysone is chosen from: - a compound of general formula (I): [Chem.l] in which: R1 is chosen from: a (Ci-C6)W(Ci-C6) group; a (C1-C6)W(C1-C6)W(C1-C6) group; a (C1-C6)W(C1-C6)CO2(C1-C6) group; a (Ci-C6)A group, A representing a heterocycle optionally substituted by a group of the OH, OMe, (Ci-C6), N(C i-C6), CO2(Ci-C6) type; a CH2Br group; W being a heteroatom chosen from N, O and S, preferably O and even more preferably S; and, - a compound having formula (II): [Chem. 2]
12. At least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone for its use according to claim 11 or, at least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone and at least one active ingredient having the capacity to activate the GLP-1 receptor for their use according to claim 11, wherein in the general formula (I): R1 is chosen from: a (Ci-C6)W(Ci-C6) group; a (C1-C6)W(C1-C6)W(C1-C6) group; a (C1-C6)W(C1-C6)CO2(C1-C6) group; a group (Ci-C6)A, A representing a heterocycle optionally substituted by a group of type OH, OMe, (Ci-C6), N(C i-C6), CO2(CrC6); W being a heteroatom chosen from N, O and S, preferably O and more preferably S.
13. At least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone for its use according to claim 11 or 12, at least one phytoecdysone and / or at least one semi-synthetic derivative of 20-hydroxyecdysone and at least one active ingredient having the capacity to activate the GLP-1 receptor for their use according to one of claims 11 or 12, in which at least one compound of general formula (I) is chosen from: No. 1: (2S,3R,5R,10R,13R,14S,17S)-2,3,14-trihydroxy-10,13-dimethyl-17-(2-morpholinoacetyl)-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a ]phenanthren-6-one, No. 2: (2S,3R,5R,10R,13R,14S,17S)-2,3,14-trihydroxy-17-[2-(3-hydroxypyrro lidin-l-yl)acetyl]-10,13-dimethyl-2,3,4,5,9,ll,12,15,16,17-decahydro-l H-cyclopenta[a]phenanthren-6-one; No. 3: (2S,3R,5R,10R,13R,14S,17S)-2,3,14-trihydroxy-17-[2-(4-hydroxy-l-pi peridyl)acetyl]-10,13-dimethyl-2,3,4,5,9,ll,12,15,16,17-decahydro-lH-cyclopenta[a]phenanthren-6-one; No. 4: (2S,3R,5R,10R,13R,14S,17S)-2,3,14-trihydroxy-17-[2-[4-(2-hydroxyeth yl)-l-piperidyl]acetyl]-10,13-dimethyl-2,3,4,5,9,ll,12,15,16,17-decahy dro-lH-cyclopenta[a]phenanthrene-6-one; No. 5: (2S,3R,5R,10R,13R,14S,17S)-17-[2-(3-dimethylaminopropyl (methyl)amino)acetyl]-2,3,14-trihydroxy-10,13-dimethyl-2,3,4,5,9,ll,l 2,15,16,17-decahydro-lH-cyclopenta[a]phenanthren-6-one; No. 6: 2-[2-oxo-2-[(2S,3R,5R, 10R, 13R, 14S, 17S)-2,3,14-trihydroxy-10,13-dim ethyl-6-oxo-2,3,4,5,9,ll,12,15,16,17-decahydro-lH-cyclopenta[a]phenanthren-17-yl]ethyl]sulfanylacetate; No. 7: (2S,3R,5R,10R,13R,14S,17S)-17-(2-ethylsulfanylacetyl)-2,3,14-trihydr oxy-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-6-one; No. 8: (2S,3R,5R,10R,13R,14S,17S)-2,3,14-trihydroxy-17-[2-(2-hydroxyethyl sulfanyl)acetyl]-10,13-dimethyl-2,3,4,5,9,11,12,15,16,17-decahydro-1H cyclopenta[a]phenanthren-6-one.
14. Composition comprising: - at least one phytoecdysone and / or at least one semisynthetic derivative of 20-hydroxyecdysone; and - at least one active ingredient having the capacity to activate the GLP-1 receptor.
15. Composition according to claim 14, for its use in the treatment of obesity, sarcopenic obesity or overweight in mammals.
16. Composition according to any one of claims 14 or 15, for its use in the treatment or prevention of loss of muscle mass and strength, in the potentiation of loss of fat mass, in the maintenance of weight loss or in the improvement of insulin sensitivity, in obese, sarcopenic obese or overweight mammals.
Citation Information
Patent Citations
Use of 20-hydroxyecdysone and the derivatives thereof in the treatment of myopathies
WO2018197708A1
Pharmaceutical-grade 20-hydroxyecdysone extract, use of same and preparation thereof
WO2018197731A1
Phytoecdysones and derivatives thereof for use in treating disordered respiratory function on viral infection
WO2021198588A1
Phytoecdysones for use in weight stabilisation after a weight-loss diet
WO2013068704A1
Phytoecdysones for use in improving the muscle quality of obese and / or sarcopenic mammals
WO2013088084A1