Promoter region of the gadR2 regulatory gene and its use for gamma-aminobutyric acid overproduction

Abstract

Promoter region of the gadR2 regulatory gene and its use for gamma-aminobutyric acid overproduction. The present invention relates to a promoter region of the gadR2 regulatory gene capable of inducing gadR2 overexpression, a gadR2 regulatory cassette comprising a gadR2 regulatory gene and its promoter region, and the use of said cassette to induce upregulation of the gadCB promoter. The invention also relates to a plasmid comprising the gadR2 regulatory cassette and a transformed lactic acid bacterium comprising the plasmid, the plasmid, and the bacterium, which can be used to induce gamma-aminobutyric acid (GABA) overproduction.The invention also relates to a method for producing GABA comprising culturing a lactic acid bacterium transformed according to the invention and a method for producing a genetically modified GABA-producing lactic acid bacterium comprising introducing a plasmid according to the invention into said lactic acid bacterium. Figure for abstract: none.

Description

Title of the invention: Promoter region of the gadR2 regulatory gene and its use for the overproduction of gamma-aminobutyric acid

[0001] The present invention relates to a promoter region of the gadR2 regulatory gene capable of inducing gadR2 overexpression, a gadR2 regulatory cassette comprising a gadR2 regulatory gene and its promoter region, and the use of said cassette to induce upregulation of the gadCB promoter. The invention also relates to a plasmid comprising the gadR2 regulatory cassette and a transformed lactic acid bacterium comprising the plasmid, the plasmid, and the bacterium, which can be used to induce gamma-aminobutyric acid (GABA) overproduction. The invention further relates to a method for producing GABA comprising culturing a transformed lactic acid bacterium according to the invention and a method for producing a genetically modified GABA-producing lactic acid bacterium comprising introducing a plasmid according to the invention into said lactic acid bacterium.

[0002] Lactic acid bacteria are widely used in the food industry (cheese, buttermilk, cream, yogurt) for their acidifying (conversion of sugars to lactic acid), texturizing (production of exopolysaccharides), and protective properties against pathogenic bacteria (production of bacteriocins). They also contribute to the flavor of dairy products, and interest in their potential use as cellular factories for the chemical industry (biofuels, solvents, bio-based plastics) has increased in recent years. Another attractive characteristic of lactic acid bacteria is their ability to produce a range of molecules with applications in the health field, such as bioactive peptides, vitamins, hyaluronic acid, and GABA.

[0003] GABA, a neurotransmitter widely distributed in the sympathetic nervous system, has been the subject of particular research for several years due to its numerous health benefits. GABA plays a crucial role in lowering blood pressure, reduces the risk of lung adenocarcinoma, and possesses antidiabetic, neuroprotective, antidepressant, anti-inflammatory, and visceral antinociceptive properties.

[0004] Lactic acid bacteria are bacteria capable of producing large quantities of GABA. However, this GABA production differs greatly between species and even between strains within the same species.

[0005] The organization of genes involved in GABA production can vary among lactic acid bacteria species, but in the species Lactococcus lactis, strains have a gadCB operon: gadC encoding the glutamate and GABA transporter and gadB encoding glutamate decarboxylase. These two genes depend on the same gadCB promoter (PgadCB). Upstream, there is a gene, named gadR2 (or gadR), which is a positive regulator of the gadCB promoter (PgadCB) and has its own promoter.

[0006] The inventors of the present invention have now discovered, surprisingly, that the promoter region of the gadR2 gene (PgadR2) can induce overexpression of the gadR2 regulatory gene, leading to overexpression of the genes of the gadCB operon and overproduction of GABA. Summary of the invention

[0007] Thus, the present invention relates to a promoter region of the gadR2 regulatory gene capable of inducing the overexpression of gadR2, said region comprising or consisting of:

[0008] (a) The polynucleotide sequence comprising or consisting of the SEQ ID No. 1;

[0009] (b) A polynucleotide sequence at least 80% identical to SEQ ID No. 1 and which allows the overexpression of the gadR2 regulatory gene; or

[0010] (c) A complementary sequence to the polynucleotide sequences (a) or (b), in in which the complementary sequence and the polynucleotide sequence have the same number of nucleotides and are 100% complementary.

[0011] The present invention also relates to a gadR2 regulatory cassette comprising a gadR2 regulatory gene and its PgadR2 promoter region according to the invention.

[0012] The present invention also relates to the use of a regulatory cassette according to the invention, to induce positive regulation of the gadCB promoter.

[0013] It also relates to a plasmid comprising a gadR2 regulatory cassette according to the invention.

[0014] The present invention also relates to a transformed lactic acid bacterium comprising the plasmid according to the invention.

[0015] It also relates to the use of a plasmid according to the invention or a transformed lactic acid bacterium according to the invention, to induce an overproduction of gamma-aminobutyric acid (GABA).

[0016] The present invention also relates to a method for producing GABA comprising the culture of a lactic acid bacterium transformed according to the invention.

[0017] The present invention also relates to a method for producing a genetically modified GABA-producing lactic acid bacterium comprising introducing into said lactic acid bacterium a plasmid according to the invention. Detailed description

[0018] Promoter region of the gadR2 regulatory gene (PgadR2)

[0019] The invention relates to a promoter region of the gadR2 regulatory gene (PgadR2) capable of inducing overexpression of the gadR2 regulatory gene, said promoter region comprising or consisting of:

[0020] (a) The polynucleotide sequence comprising or consisting of the SEQ ID No. 1;

[0021] (b) A polynucleotide sequence at least 80% identical to SEQ ID No. 1 and which allows the overexpression of the gadR2 regulatory gene; or

[0022] (c) A complementary sequence to the polynucleotide sequences (a) or (b), in in which the complementary sequence and the polynucleotide sequence have the same number of nucleotides and are 100% complementary.

[0023] The identification of this specific promoter region allows overexpression of the gadR2 regulatory gene, and therefore of the genes of the gadCB operon, as well as overproduction of GABA.

[0024] By "overexpression of the gadR2 regulatory gene," we mean in particular an expression greater than the expression of the gadR2 regulatory gene obtained with a control promoter region, for example the promoter region of the gadR2 regulatory gene of the model strain Lactococcus lactis ssp. lactis NCDO2118, also called strain NCDO2118. More particularly, the promoter region according to the invention allows an expression of the gadR2 regulatory gene at least 14 times greater than the expression obtained with a control promoter region of strain NCDO2118.

[0025] By "overexpression of the genes of the gad CB operon", we mean in particular a higher expression of the gadC and gadB genes compared to that obtained with a control promoter region, for example the promoter region of the gadCB operon of the model strain NCDO2118. More particularly, the promoter region with the gad R2 regulator according to the invention makes it possible to activate the basal level of the PgadCB promoter responsible for the expression of the gadC and gadB genes by a factor of 268 compared to the basal level, and to increase by a factor of 3 compared to the expression obtained with a control promoter region and its gadR2 regulator of the model strain NCDO2118.

[0026] The basal level corresponds to the expression of the gadCB promoter without the gadR2 regulator.

[0027] By "GABA overproduction" is meant a production of GABA greater than that obtained with a control promoter region, for example the promoter region with the gadR2 regulator of the control strain NCDO2118, or the promoter region with the gadR2 regulator of the non-producing strain Lactococcus lactis ssp. lactis IL1403, also called strain IL1403. More specifically, the region promoter according to the invention makes it possible to obtain a production of GABA 18 times greater than the production obtained with a control promoter region of the NCD02118 strain and 21 times greater than the production obtained with the promoter region of the low-producing strain IL 1403 (values ​​obtained by culturing the strains transformed by a plasmid carrying or not the promoter and regulator in a bioreactor).

[0028] GABA, also known as gamma-aminobutyric acid, is the main inhibitory neurotransmitter of the central nervous system (CNS) and has the following structure:

[0029] [Chem.l] 0

[0030] GABA is produced by neurons in the CNS and by lactic acid bacteria present in the digestive system, such as Lactococcus and Lactobacillus. It is also found in many fermented foods, as lactic acid bacteria, such as Lactococcus, produce it. The bacteria produce GABA by fraction of a glutamic acid decarboxylase (GAD) system, which comprises a GAD enzyme encoded by the gadA or gadB genes and a glutamate / GABA antiporter encoded by the gadC gene.

[0031] SEQ ID No. 1 corresponds to the following sequence: 5'-CTAATAGAGCAGATGATGA GCCCAGTATAAGCTTTCACACTGTTTTTATTAATAGCCTAAGAGAAATATA AAGTAATAATAAATGTTTTTTATTATAAATTATGTAAGATATACTTTTTGTA TGAACTGGTATAAATTTGACGATTAAGTCCTAAATATGTTATAAT CTCAATTGCGTAATTTCTTAAATCCAGAAATAACAGCTACATTGACATACT GATTAAAGAGTATAGCCAATGAACTGTTATAAATCTTGAAAAA ACAATAAAAATAATAGTTTGGGGGATGTTGAGA-3'

[0032] This sequence includes all the nucleotides upstream of the coding sequence of the gadR2 gene including the -10, -35 boxes and the 5'UTR region with the RBS (Ribosome Binding Site).

[0033] Said promoter region comprises a SNP (single nucleotide polymorphism) consisting of the inversion of an A to T upstream of the -10 box, and the insertion of an A between the -10 box and the RBS, relative to the promoter region of the gadR2 regulator of the model strain NCDO2118 which is taken as control (in bold in Seq ID No. 1).

[0034] In particular, PgadR2 is derived from the Lactococcus lactis EIP3I strain (CNCM 1-5388). The Lactococcus lactis EIP3I strain was deposited at the CNCM (National Collection of Microorganism Cultures, 25 rue du Docteur Roux, Paris) on December 13, 2018 under number 1-5388.

[0035] Such polynucleotides can be easily obtained by persons skilled in the art. The polynucleotides according to the invention can, for example, be obtained by in vitro DNA synthesis. The polynucleotide can then be cloned into a plasmid.

[0036] The term "promoter region" here refers to DNA, including complementary strand DNA, genomic DNA, and synthetic DNA. Polynucleotides can have any three-dimensional structure. A polynucleotide can be double-stranded. The polynucleotides isolated according to the invention can be purified or recombined.

[0037] The promoter region according to the invention may, for example, consist of a minimum of 160 nucleotides.

[0038] This promoter region according to the invention is an isolated sequence.

[0039] The term "isolated" in reference to a biological component means a biological component that has been substantially separated or purified from other biological components of the organism's cell, or of the organism itself, in which the component is naturally present, such as other chromosomal and extrachromosomal DNA, proteins, cells, and organelles. "Isolated promoter regions" include nucleic acid molecules purified by standard purification methods. This term also encompasses nucleic acids prepared by amplification and / or cloning, as well as chemically synthesized nucleic acids.

[0040] By "polynucleotide sequence identical to at least 80% to SEQ ID No. 1 and which allows overexpression of the gadR2 regulatory gene", means in particular a polynucleotide sequence identical to 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% to SEQ ID No. 1 and which allows overexpression of the gadR2 regulatory gene. For example, a polynucleotide sequence that is "95% identical" means that the polynucleotide sequence is identical to SEQ ID No. 1 and allows overexpression of the gadR2 regulatory gene, except that the sequence can contain up to five nucleotide alterations per 100 nucleotides of SEQ ID No. 1. In other words, to obtain a polynucleotide whose sequence is at least 95% identical to SEQ ID No. 1, up to 5% (5 out of 100) of the nucleotides in the sequence can be inserted, deleted, or replaced by another nucleotide.In other words, the sequences must be compared over their entire length (i.e., by preparing a global alignment). For example, a first polynucleotide of 100 nt (nucleotides) contained within a second polynucleotide of 200 nt is 50% identical to that second polynucleotide.

[0041] The Needle program, which uses the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970, A general method applicable to the search for similarities in the amino acid sequence of two proteins, J. Mol. Biol. 48:443-453) to find the optimal alignment (including gaps) of two sequences in taking into account their total length, can for example be used. Preferably, the percentage of identity according to the invention is calculated using the needle program with a "Gap open" parameter equal to 10.0, a "Gap Extend" parameter equal to 0.5, and a Blosum matrix of 62. The needle program is available, for example, on the website ebi.ac.uk.

[0042] A "complementary sequence" as used here refers to a sequence that specifically hybridizes in solution, for example, according to Watson-Crick base-matching rules.

[0043] In particular, the gadR2 regulatory gene according to the invention comprises or consists of the polynucleotide sequence comprising or consisting of a sequence at least 80% identical to SEQ ID No. 2.

[0044] SEQ ID No. 2 corresponds to the following sequence: 5'-ATGTATAAAAAATATGGAG ATTGTTTTAAAAAGTTACGAAACCAAAAGAATTTAGGATTATCATACTTTA GTAAATTAGGAATAGACCGTTCAAATATATCTAGATTTGAACATGGAAAGT GTATGATGAGTTTTGAGCGCATAGATTTGATGTTAGAAGAAATGCAAGTGC CATTAGCTGAGTACGAATTGATAGTAAATAATTATATGCCGAATTTCCAAG AATTTTTTATATTAGAATTGGAAAAAGCTGAATTTAGTCAAAATCGAGATA AAATAAAGAGTTATATTCTGAGGTTAAAGAAAC AGGGAATCATTTACTGACGATTACCGTTAAAACGAAGCTTGGGACTATTAG TCAGACAGAAGTTAAGGAAATTGAAACTTATCTTTGTAATATTGAAGAGTG GGGATATTTTGAACTAACTTTATTCTATTTTGTATCTGATTATCTCAATGT CAATCAATTAGAATTGCTGCTTTTTAACTTTGACAAAAGATGTGAAAATTA CTGTAGAGTCTTAAAATATAGAAGGAGACTATTG CAAATAGCCTATAAAAGCGTTGCGATATACGCGG CTAATGGAGAAAGAACAAAAGCCGAAAATATTTT AGAAATGACTAAAAAAATATCGGACTGTAGGTGTTGATTTATATTCTGAAGT ATTAAGACATCTTGCCAGAGGTATCATTATTTTTAATTTTGAAAATGCAGA AGTGGGAGAAGAAAAAAATAAATTATGCGCTTGAA ACTTTGGAAGAATTTGGAGGAATGAAGATAAAAG AATTCTATCAGAAAAAAATGGAAAAGTATTTGAAAAAGTCAATTTAG-3 '.

[0045] By "polynucleotide sequence identical to at least 80% to SEQ ID No. 2", we mean in particular a polynucleotide sequence identical to 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% to SEQ ID No. 2. For example, a polynucleotide sequence "identical" to 95% means that the polynucleotide sequence is identical to the SEQ ID No. 2 sequence, except that the sequence may include up to five nucleotide alterations per 100 nucleotides of SEQ ID No. 2. In other words, to obtain a polynucleotide whose sequence is at least 95% identical to SEQ ID No. 2, up to 5% (5 out of 100) Nucleotides in the sequence can be inserted, deleted, or replaced by another nucleotide. In other words, sequences must be compared along their entire length (i.e., by preparing a global alignment). For example, a first polynucleotide of 100 nucleotides contained within a second polynucleotide of 200 nucleotides is 50% identical to that second polynucleotide.

[0046] The Needle program, which uses the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch, 1970, A general method applicable to the search for similarities in the amino acid sequence of two proteins, J. Mol. Biol. 48:443-453) to find the optimal alignment (including gaps) of two sequences, taking into account their total length, can, for example, be used. Preferably, the percentage of identity according to the invention is calculated using the Needle program with a "Gap open" parameter equal to 10.0, a "Gap Extend" parameter equal to 0.5, and a Blosum 62 matrix. The Needle program is, for example, available on the website ebi.ac.uk. gadR2 regulator cassette

[0047] The present invention also relates to a gadR2 regulatory cassette comprising a gadR2 regulatory gene according to the invention and its PgadR2 promoter region according to the invention.

[0048] A regulatory cassette according to the invention is a natural DNA fragment or a recombinant construct comprising an artificial combination of nucleic acid fragments, including, but not limited to, regulatory and coding sequences that are not found together in nature. For example, a recombinant DNA construct may comprise regulatory and coding sequences from different sources, or regulatory and coding sequences from the same source arranged in a manner different from that found in nature.

[0049] The expression cassette may comprise 5' and 3' regulatory sequences operationally linked to the PgadR2 promoter and / or the gadR2 regulatory gene according to the invention. "Operationally linked" means a functional link between two or more elements. "Regulatory sequences" are nucleotides located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence and which can influence the transcription, RNA processing, stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, translation head sequences and polyadenylation recognition sequences.

[0050] The present invention also relates to the use of a regulatory cassette according to the invention, to induce positive regulation of the gadCB promoter.

[0051] The gadCB operon comprises the gadC gene which encodes the glutamate and GABA transporter and gadB which encodes glutamate decarboxylase, these two genes depending on the same gadCB promoter (PgadCB).

[0052] By "positive regulation", it is understood that the regulatory cassette according to the invention will induce an activation of ? gadCB, in particular an overactivation of PgadCB.

[0053] This positive regulation of the gadCB promoter allows overexpression of the gadC and gadB genes, which leads to overproduction of GABA.

[0054] By "overexpression of the gad C and gad B genes" and "overproduction of GABA", we mean the same definition as that given in the paragraph relating to the PgadR2 promoter region.

[0055] By "overactivation of γ-gadCB," we mean in particular a greater activation of PgadCB compared to that obtained with a control promoter region, for example, the promoter region of the gadCB operon of the NCDO2118 model strain. More specifically, the promoter region according to the invention enables the basal level of the PgadCB promoter responsible for the expression of the gadC and gadB genes to be activated by a factor of 268 compared to the basal level, and to increase by a factor of 3 compared to the expression obtained with a control promoter region and its regulator gadR2 of the NCDO2118 model strain (values ​​obtained by fusion of the promoter to a reporter gene). By "basal level" we mean the same definition as that given in the paragraph relating to the PgadR2 promoter region. Plasmid

[0056] The present invention also relates to a plasmid comprising a gadR2 regulatory cassette according to the invention.

[0057] By "plasmid", we mean here a circular double-stranded DNA. The plasmid may include a marker gene allowing the selection of cells containing said plasmid, an origin of replication to allow the cell to replicate the plasmid and / or a multiple cloning site allowing the insertion of a DNA fragment, in particular the cassette according to the invention.

[0058] In particular, said plasmid is chosen from those described in Table 1.

[0059] [Tables 1] Plasmid name Description Construction Vector Insertion Operating mode pTRKH3-PermGFP Plasmid pTRKH3 expressing eGFP under the control of the erm promoter; eryR (Addgene ref 27169) pTRKH3-eG FP pTRKH3-PermGFP with erm promoter deletion; eryR Al+A2 amplification of pTRKH3-Perm GFP Blunt-end lignition of the pTRKH3-pC BE1P31-eGFP vector pTRKH3-eGFP expressing eGFP under the control of the EIP3I adCB g-promoter; eryR Al+A2 amplification of pTRKH3-Perm GFP A4+A5 amplification of EIP3I gDNA Gibson cloning pTRKH3-pC B2ii8-eGFP pTRKH3-eGFP expressing GFP under the control of the NCDO2118 adCB g-promoter; eryR Al+A2 amplification of pTRKH3-Perm GFP Amplify A4+A5 ion of gDNA NCDO211 8 Gibson cloning of pTRKH3-R2 ElP3rPCBEU>3i -eGFP pTRKH3-pCBE1P31-eGFP expressing gadR2dc EIP3I under the control of its own promoter; eryR Al+A6 amplification of pTRKH3-pCBE ij>3i-eGFP Amplify A7+A8 ion of gDNA E IP3I Gibson cloning of pTRKH3-R2 2118-PCB2118' eGFP pTRKH3-pCB2n8-eGFP expressing gadR2 of NCDO2118 under the control of its own promoter;eryR Amplification Al+A 6 of pTRKH3-pCB2 ii8-eGFP Amplification A7+A8 of NCDO211 8 gDNA Clonge Gibson pTRKH3-pR 2E1P31-eGFP pTRKH3-eGFP expressing eGFP under the control of the g adR2 promoter of EIP3I; eryR Amplification A2+A 11 of pTRKH3-R2E1 p3rpCBE1P31-eGFP Blunt-end lignification of the pTRKH3-pR 22ii8-eGFP vector pTRKH3-eGFP expressing eGFP under the control of the g adR2 promoter of NCDO2118; eryR Amplification A2+A 11 of pTRKH3-R22i i8-pCB2n8-eGFP Blunt-end ligation of the pTRKH3-R2 EIP3I pTRKH3-ermGFP vector, in which the [ermGFP] casing has been replaced by the gadR2 regulator of EIP3I under the control of its own promoter Amplification A3+A 16 of pTRKH3-R2E1 p3rpCBE1P31-eGFP Blunt-end ligation of the vector;

[0060] [Table 1]

[0061] The present invention also relates to the use of a plasmid according to the invention, to induce an overproduction of GABA.

[0062] What is meant by "overproduction of GABA" has already been explained in the part relating to the PgadR2 promoter region.

[0063] Within the framework of the present invention, the use of the plasmid according to the invention will make it possible in particular to transform a lactic acid bacterium in order to obtain a strain that overproduces GABA. Transformed lactic acid bacteria

[0064] The present invention therefore also relates to a transformed lactic acid bacterium comprising the plasmid according to the invention.

[0065] The present invention also relates to the use of a lactic acid bacterium transformed according to the invention, to induce an overproduction of GABA.

[0066] Lactic acid bacteria are well known to a person skilled in the art who will be able to carry out the transformation on the basis of their general knowledge.

[0067] Lactic acid bacteria according to the invention shall in particular be selected from Lactococcus lactis ssp. lactis IL1403, as described in Chopin A, Chopin MC, Moillo-Batt A, Langella P (1984) Two plasmid determined restriction and modification Systems in Streptococcus lactis. Plasmid 11:260-263, Lactococcus lactis ssp. lactis NCDO2118, as described in Oliveira LC, Saraiva TDL, Soares SC, Ramos RTJ, Sa PHCG, Cameiro AR, et al. Genome Sequence of Lactococcus lactis subsp. lactis NCDO 2118, a GABA-Producing Strain. Genome Announc. 2014;2:e00980-14., and Lactococcus lactis EIP3I (CNCM 1-5388) as described in Gomes P et al., 2023, FASEB J., https: / / doi.org / 10.1096 / fj.202301588R.

[0068] The overproduction of GABA is as defined above and will result from the presence of the plasmid according to the invention, itself comprising a regulatory cassette according to the invention, said cassette comprising the promoter region according to the invention capable of in the end inducing the overproduction of GABA. GABA production process

[0069] The present invention also relates to a method for producing GABA comprising the culture of a lactic acid bacterium transformed according to the invention.

[0070] As already mentioned, lactic acid bacteria are well known to those skilled in the art, who can carry out the transformation based on their general knowledge. The preparation of culture media and the definition of culture conditions enabling the growth and production of GABA in the lactic acid bacteria strains of the present invention are well known to those skilled in the art; these culture media can be adapted to each specific strain of L. actococcus lactis.

[0071] Furthermore, the culture of transformed lactic acid bacteria can be carried out between 25 and 42°C. In some cases, the culture of transformed lactic acid bacteria can be carried out under aerobic or anaerobic conditions. Temperature conditions These conditions can be regulated using a thermostatic bath, heating jacket, or similar device. Furthermore, the term "anaerobic conditions" as used here refers to a low-oxygen or oxygen-free environment in which lactic acid bacteria can thrive. For example, in such an environment, anaerobic conditions can be achieved by using an anaerobic chamber, anaerobic box, airtight container or bag containing a deoxidizer, or other similar product, or simply by sealing a culture vessel tightly. Culture formats include static culture, stir culture, and tank culture. Additionally, the culture duration can range from 3 to 96 hours. In some cases, the pH of the medium can be maintained between 4.5 and 7.0 at the start of the culture.

[0072] For example, the culture medium and culture conditions used in a bioreactor may be as follows: 5 g / L of glutamic acid, 50 g / L of glucose and 5 pg / mL of erythromycin in a basic medium with yeast extract at 10 g / L, pH regulation at 6.6 for 7 h and then a decrease in pH to 4.6.

[0073] Such lactic acid bacteria will in particular be selected from Lactococcus lactis ssp. lactis IL1403, as described in Chopin A, Chopin MC, Moillo-Batt A, Langella P (1984) Two plasmid determined restriction and modification Systems in Streptococcus lactis. Plasmid 11:260-263., Lactococcus lactis ssp. lactis NCDO2118, as described in Oliveira LC, Saraiva TDL, Soares SC, Ramos RTJ, Sa PHCG, Cameiro AR, et al. Genome Sequence of Lactococcus lactis subsp. lactis NCDO 2118, a GABA-Producing Strain. Genome Announc. 2014;2:e00980-14., Lactococcus lactis EIP3I (CNCM 1-5388) as described in Gomes P et al., 2023, FASEB J., https: / / doi.org / 10.1096 / fj.202301588R.

[0074] Here again, the overproduction of GABA is as defined previously and will result from the presence of the plasmid according to the invention, itself comprising a regulatory cassette according to the invention, said cassette comprising the promoter region according to the invention capable of in the end inducing the overproduction of GABA.

[0075] In particular, the culture obtained from transformed GABA-producing lactic acid bacteria can be used directly. In some cases, the culture of transformed lactic acid bacteria may be subjected to other treatments, including sterilization, crude purification by centrifugation, and / or solid-liquid separation by filtration, as required. Furthermore, the transformed lactic acid bacteria according to the invention may be in the form of viable bacterial cells and / or in the form of moist bacterial cells or dried bacterial cells. The transformed lactic acid bacteria according to the invention may also be dead bacteria, said bacteria having retained their intact cell morphology. as well as GAD activity. According to one embodiment, these dead bacteria were inactivated with ethanol.

[0076] In particular, a sterilized product can be prepared by a sterilization treatment of transformed lactic acid bacteria. The sterilization treatment may include sterilization by filtration, disinfection by radiation, disinfection by overheating, and disinfection by pressure.

[0077] In some embodiments, a heated product can be prepared by heat treatment of transformed lactic acid bacteria. The heat treatment may include high-temperature treatment (e.g., 80°C to 150°C) of the transformed lactic acid bacteria for a certain time (e.g., from 10 minutes to 1 hour, or from 10 to 20 minutes).

[0078] In certain embodiments, a destructured product or acellular extract can be prepared by destructuring, fracturing, reducing the size of, crushing, pulverizing, disintegrating, or grinding the transformed lactic acid bacteria. For example, physical disorganization (e.g., agitation or filtration), enzymatic lysis treatment, chemical treatment, and / or autolysis induction treatment can be carried out.

[0079] In some embodiments, an extract can be obtained by extraction of the transformed lactic acid bacteria using a suitable aqueous or organic solvent. For example, the transformed lactic acid bacteria can be immersed in an aqueous or organic solvent (e.g., water, methanol, or ethanol), or can be agitated or refluxed in the solvent.

[0080] In some embodiments, the transformed lactic acid bacteria can be transformed into a powder or granular product by drying. Drying methods include spray drying, drum drying, vacuum drying, and freeze-drying, which can be used alone or in combination.

[0081] In some embodiments, GABA can be purified from transformed lactic acid bacteria by a known separation / purification method. Examples of such separation / purification methods include: a method involving the precipitation of salts or organic solvents based on degrees of solubility; a method involving dialysis, ultrafiltration, or gel filtration based on molecular weight differences; a method involving ion-exchange chromatography based on charge differences; a method involving affinity chromatography based on degrees of specific binding; and a method involving hydrophobic chromatography or reversed-phase chromatography based on degrees of hydrophobicity, or a combination thereof.

[0082] Process for producing a genetically modified lactic acid bacterium producing G AB A

[0083] The present invention also relates to a method for producing a genetically modified GABA-producing lactic acid bacterium comprising introducing into said lactic acid bacterium a plasmid according to the invention.

[0084] As already mentioned, lactic acid bacteria are well known to a person skilled in the art who will be able to genetically modify the lactic acid bacterium on the basis of their general knowledge.

[0085] Such lactic acid bacteria will in particular be selected from Lactococcus lactis ssp. lactis IL1403, as described in Chopin A, Chopin MC, Moillo-Batt A, Langella P (1984) Two plasmid determined restriction and modification Systems in Streptococcus lactis. Plasmid 11:260-263, Lactococcus lactis ssp. lactis NCDO2118, as described in Oliveira LC, Saraiva TDL, Soares SC, Ramos RTJ, Sa PHCG, Cameiro AR, et al. Genome Sequence of Lactococcus lactis subsp. lactis NCDO2118, a GABA-Producing Strain. Genome Announc. 2014;2:e00980-14, Lactococcus lactis EIP3I (CNCM 1-5388) as described in Gomes P et al., 2023, FASEB J., https: / / doi.org / 10.1096 / fj.202301588R.

[0086] Genetically modified lactic acid bacteria, as described herein, can be propagated under conditions and in media known to those skilled in the art.

[0087] In some embodiments, the genetically modified lactic acid bacteria can be prepared by culture under suitable conditions using a medium conventionally used for culturing lactic acid bacteria. A natural or synthetic medium can be used as the culture medium provided that it contains a carbon source, a nitrogen source, a mineral salt, a genetic construct selection agent (e.g., erythromycin), and other components, and that it allows the efficient culture of the genetically modified lactic acid bacteria. To produce GABA, the medium must contain free glutamate, as this is the precursor of GABA. A person skilled in the art can appropriately select a known medium suitable for a particular bacterial strain. Examples of carbon sources that can be used include lactose, glucose, sucrose, fructose, galactose, and blackstrap molasses.Examples of nitrogen sources that can be used include nitrogen-containing organic substances such as casein hydrolysate, whey protein hydrolysate, and soy protein hydrolysate. Examples of mineral salts that can be used include phosphate, sodium, potassium, and magnesium. Examples of suitable media for culturing lactic acid bacteria include MRS liquid medium, GAM medium, BL medium, Briggs liver broth, animal milk, skimmed milk, and whey derived from milk. Tomato juice, carrot juice, and other juices are also suitable. Vegetable juice, apple juice, pineapple juice and grape juice are examples of natural media that can be used.

[0088] The genetically modified lactic acid bacteria obtained by the process according to the invention can be used and processed according to the methods described in the paragraph relating to the GABA production process.

[0089] As mentioned above, GABA can be used to treat intestinal pain, mood disorders, stress management, and more generally to improve human and animal health and nutrition. It is also used as a bitterness blocker and / or food flavoring agent.

[0090] Thus, the lactic acid bacteria according to the invention can be used in human and animal health and / or nutrition.

[0091] The invention is now illustrated by the following figures and examples. Figures

[0092] [Fig-1]: Construction strategy of the different plasmids used

[0093] [Fig.2]: Endpoint fluorescence measurement protocol

[0094] [Fig.3]: Alignment of the PgadR2 promoter sequences of L. lactis strains EIP3I and NCDO2118

[0095] [Fig.4]: Measurement of the activation of P gadCB promoters with or without regulator in EIP3I and NCDO2118 strains

[0096] [Fig.5]: Measurement of PgadR2 promoter activation in L. lactis EIP3I and NCDO2118 strains Examples

[0097] Study of the expression of g ad genes in different strains of Z. lactis

[0098] Expression levels of the different gad genes of 2 strains of L. lactis (EIP3I (CNCM 1-5388) as described in Gomes P et al., 2023, FASEB J., https: / / doi.org / 10.1096 / fj.202301588R) and NCDO2118 (Oliveira LC, Saraiva TDL, Soares SC, Ramos RTJ, Sa PHCG, Cameiro AR, et al. Genome Sequence of Lactococcus lactis subsp. lactis NCDO2118, a GABA-Producing Strain. Genome Announc. 2014;2:e00980-14) were measured by fusing gadR2 promoters, gadR2 genes and gadCB promoters with eGFP (enhanced form of green fluorescent protein GFP) in a pTRKH3-eGFP plasmid and the plasmid was introduced into the reference strain L. lactis IL 1403. Materials and methods in silico analysis

[0099] The sequences of the promoter regions (PgadCB and PgadRZ) and the gadR2 genes of the EIP3I and NCDO2118 strains were aligned using the CLUSTALW algorithm (default settings used) available in the MEGA11 (Molecular Evolutionary Genetics Analysis) software

[0100] The BENCHLING software was used for the in silico construction of plasmids as well as for the design of oligonucleotides.

[0101] Construction of the different plasmids used in the study

[0102] Figure 1 illustrates the strategies used for the construction of the different plasmids. Table 1 describes the cloning method used for each plasmid (GIBSON cloning or blunt-end ligation cloning). Table 2 describes the sequence of oligonucleotides (or primers) used to perform the different cloning methods.

[0103] [Tables2] Nom Amorce Al SEQ ID N°3: 5' TCGACCTGAATGGAAG 3' A2 SEQ ID N°4 : 5' ATGAGTAAAGGAGAAGAACTTTTC 3' A3 SEQ ID N°5 : 5' GGATCCACAGGACG 3' A4 SEQ ID N°6 : 5' CCGGCTTCCATTCAGGTCGAGTATTAAGACA TCTTGCCAG 3' A5 SEQ ID N°7 : 5' AGTTCTTCTCCTTTACTCATCATACCTCCTTA TATTTATGATTG 3' A6 SEQ ID N°8 : 5' GTATTAAGACATCTTGCCAG 3' A7 SEQ ID N°9 : 5' AATGATACCTCTGGCAAG 3' A8 SEQ ID N°10 : 5' CCGGCTTCCATTCAGGTCGACTAATAGAGC AGATGATGAGC 3' Ail SEQ ID N°ll : 5' TCTCAACATCCCCC 3' A16 SEQ ID N°12 : 5' CTAAATTGACTTTTTCAAATACTTTTCC 3'

[0104] Oligonucléotides used (Queue flottante on grass)

[0105] The oligonecleotides are synthesized by EUROFINS GENOMICS. All clonings are detected in the area of ​​​​E. coli DH5a.

[0106] More specifically, the pTRKH3-Perm-eGFP plasmid (Ref Plasmid #27169) was purchased from Addgene (Addgene Europe, Teddington, UK). This plasmid contains two origins of replication (pri P15A allowing its replication in E. coli, and ori pAM[31 allowing its replication in Edactis), an erythromycin resistance gene allowing selection in E. coli (ery 150 pg / mL) or E. lactis (ery 5 pg / mL), as well as eGFP under the control of the promoter of the gene conferring erythromycin resistance (Perm). • Al- The pTRKH3-eGFP (T-) plasmid was obtained by deletion of the Perm promoter after PCR amplification of 10 pg of template DNA from pTRKH3-Perm-eGFP with the oligonucleotides Al and A2 (0.5 pM final for each). Amplification was performed using the CloneAmp HiFi PCR Premix (cat. No. 639298) from TaKaRa (TaKaRa Bio Europe SAS) in a final volume of 25 pL, according to the manufacturer's recommendations. The PCR conditions were as follows: 1. Denaturation 2 min at 98°C; 2. Denaturation 10 sec at 98°C; 3. Hybridization 10 sec at 58°C; 4. Elongation 1 min 30 at 72°C; 5. 30 PCR cycles are performed (steps 2 to 4); 6. Elongation 2 min at 72°C.

[0107] (The hybridization temperature was determined using the Tm calculator software (https: / / tmcalculator.neb.eom / #i / main), the elongation time is 5 sec / kb). • A2- After amplification, 5 pL of the PCR mix are passed on a gel in order to check the size of the amplified fragment (7600 bp), and the remaining 20 pL are purified with the QIAquick PCR kit from QIAGEN (Ref 28104) according to the manufacturer's protocol. • A3- The purified DNA (100 ng) is then phosphorylated with T4 polynucleotide kinase (Ref M0201S from New England Biolabs) and ligated using T4 DNA ligase (M0202S from New England Biolabs) according to the supplier's recommendations. • A4-5 pL of ligated DNA (= blunt end cloning) are used for Transform chemocompetent E. coli NEB 5a cells (derived from the E. coli DH5a strain) (C2987H from New England Biolabs). Selection is performed on LB + ery (150 pg / mL). • A5- A colony is then cultured, and the plasmid DNA is extracted using the Monarch Plasmid Miniprep kit (Ref T1010L from New England Biolabs) and according to the supplier's recommendations. The DNA sequence is verified by Sanger sequencing (EUROFINS). • B1 - The dTRKH3-dCB En>3i-eGFP and dTRKH3-dCB 2ns-eGFP plasmids were constructed by replacing Perm with pCBE1P31 or pCB2n8, respectively. More specifically, the pTRKH3-Perm-eGFP vector DNA was amplified by PCR with primers A1 and A2 as described above. The 350 bp pCBE1P31 or pCB2n8 insert DNAs were amplified by PCR using genomic DNA (1 ng) from strains EIP3I and NCDO2118, respectively, as a template. Amplification was performed with the Q5-HF DNA polymerase (M0491 from New England Biolabs) in a volume Final 50 pL with primers A4 and A5, according to the supplier's recommendations. The PCR conditions are as follows: 1. Denaturation 2 min at 98°C; 2. Denaturation 10 sec at 98°C; 3. Hybridization 30 sec at 58°C; 4. 30 sec at 72°C; 5. 30 PCR cycles are performed (steps 2 to 4); 6. Elongation 2 min at 72°C. • (The hybridization temperature was determined using the Tm calculator software (https: / / tmcalculator.neb.eom / #i / main), the elongation time is 20 sec / kb). • B2- After amplification of the insert fragments, the DNA is passed on a gel and purified on QIAGEN column as described previously in A2. • B3- Primers A4 and A5 carry floating tails (nucleotides) (in bold) allowing hybridization to the pTRKH3-Perm-eGFP vector DNA previously amplified with Al and A2. This enables Gibson-type assembly. Thus, 50 ng of pTRKH3-Perm-eGFP vector DNA amplified with Al and A2 will be mixed with EIP3I or NCD02118 insert DNA amplified with A4 and A5 in molar proportions of 1 mole of vector to 3 moles of insert. The Gibson cloning will be performed using the NEBuilder® HiFi DNA Assembly Master Mix kit (E2621 ​​from New England Biolabs). • B4- 4 pL of the GIBSON product are then used to transform Chemocompetent E. coli NEB 5a cells (C2987H from New England Biolabs). Selection is based on LB + ery (150 pg / mL). • B5- A colony is then cultured, and the plasmid DNA is extracted using the Monarch Plasmid Miniprep kit (Ref T1010L from New England Biolabs) and according to the supplier's recommendations. The DNA sequence is verified by Sanger sequencing (EUROFINS). • Cl - The pTRKH3-R2 En>3.pCB EIP3i-eGFP and pTRKH3-R2 2ii8-pCB 2ii8-eGFP plasmids were constructed by upstream cloning of the gadR2 EIP3I and gadR22118 regulatory genes from pCBE1P31 and pCB2n8 under the control of their own promoters (R2E1P31 and R22n8). The pTRKH3-pCBE1P31-eGFP and pTRKH3-pCB2n8-eGFP vectors were amplified by PCR with primers A1 and A6, and the R2E1P31 and R22ii8 inserts were amplified from genomic DNA with primers A7 and A8, and GIBSON cloning was performed as described previously in Part B. • DI - The plasmids pTRKH3-pR2 EiP3i-eGFP and pTRKH3-pR2 2118-eGFP were obtained by deleting the fragments [gadR2 £ZP3rpCBEIP31] and [gadR2 2778-pCB2n8] from the plasmids pTRKH3-R2E1P3 pCBE1P31-eGFP and pTRKH3-R22ii8-pCB2ii8-eGFP, respectively. These were amplified by PCR with primers A2 and Al1 and recircularized according to the protocol described in Part A (blunt-end ligation). • The pTRKH3-R2 EIP3i plasmid was obtained by deleting the [pCBE1P31-eGFP] cassette from the pTRKH3-R2E1P3 pCBE1P31-eGFP plasmid. This was achieved by PCR amplification with primers A3 and A16 and recircularization according to the protocol described in Part A (blunt-end ligation).

[0108] Electro-transformation of the Lactococcus lactis strain IL1403

[0109] The preparation of electrocompetent cells was carried out following the protocol of Le Bourgeois P et al., 2000 (Electrotransformation of bacteria, Chapter 6, Springer Lab Manual, N. Eynard, J. Tessié (eds) Springer-Verlag Berlin Heidelberg 2000) with the following adjustments: the cells were pre-adapted to glycine during a first pre-culture of 5 mL in M17 + 5 g / L glucose + 0.5 M sucrose + 1% glycine for 24 h at 30°C without shaking. Then a second pre-culture was carried out by inoculating 50 pL of the first pre-culture into the same culture medium except that the glycine was added at 2%. Finally, the final culture is carried out in the same medium as the second preculture, at 30°C without agitation until an OD of between 0.5 and 0.8 is obtained. The rest of the protocol is carried out according to Le Bourgeois P et al., 2000, cited above.

[0110] The cells rendered competent are aliquoted at a rate of 75 pL into microtubes, then immediately frozen for 1 min in liquid nitrogen and stored at -80°C.

[0111] For the transformation, an aliquot is thawed on ice. 15 ng of plasmid are added directly to the cells and incubated for 4 min on ice, then transferred to a pre-chilled electroporation tank. The electroporation conditions are: 2.40 kV, 400 ohms, 25 pF. Then, 900 pL of GM17 + 5 g / L glucose + 0.5 M sucrose are immediately added, and the cells are transferred to a microtube for phenotypic expression for 3 h at 30°C without shaking. 100 pL of the direct or 10' dilution are spread onto GM17 + agar + 5 pg / mL erythromycin plates and incubated for 48 h at 30°C. Fluorescence level is measured.

[0112] The protocol is illustrated by [Fig.2].

[0113] More specifically, 1 mL of Yeast Extract (YE) at 10 g / L + Erythromycin (ery) at 5 pg / mL is inoculated with the different IL1403 strains transformed with The plasmids described above were grown from cryotubes for preservation. Growth was carried out overnight at 30°C without agitation. Then, 10 pL of this preculture were inoculated into 1 mL of YE + ery 5 pg / mL and cultured at 30°C without agitation. After 8 h of growth, 10 pL of this last preculture were inoculated into 1 mL of the previously described medium and cultured overnight at 30°C without agitation. Four biological replicates were prepared. This culture was then centrifuged at 6000 rpm for 5 min, and the bacterial pellet was resuspended in 1 mL of PBS buffer. This step was repeated. This bacterial suspension was then diluted 1:1 in PBS buffer and loaded into a flat-bottom microplate (Microtest Plate 96 well, Ref 82.1581001 from Starsted). Eight technical replicates were prepared.The emitted fluorescence is read using a fluorometer (BIOTEK, Synergy Hl, Microplate Reader) with the following wavelengths: 485 nm (excitation) and 514 nm (emission). Results

[0114] Insilico analysis of the promoters _ P gad CB P gadR2 and the gadR2 regulatory genes of the EIP3I and NCDO2118 strains

[0115] Sequence alignment showed that the P-gadCB promoters of strains EIP3I and NCDO2118 are identical.

[0116] However, the alignment of the PgadR2 promoter sequences of the EIP3I and NCDO2118 strains shows 2 differences: 1 SNP (single nucleotide polymorphism) upstream of box -10 (T in the EIP3I sequence instead of A in the NCDO2118 sequence), and the insertion of an A upstream of the RBS for the EIP3I strain sequence. These results are illustrated in [Fig. 3].

[0117] Alignment of the gadR2 gene sequences shows that they are identical for strains EIP3I and NCDO2118.

[0118] Comparison of the activity of the P gadCB promoters of the L. lactis _ EIP3I and NCDO2118 strains under the control of their respective gadR2 regulator.

[0119] The activity level of the different PgadCB promoters was studied by fusion with the fluorescent marker eGFP. The different constructs carried by replicative plasmids in Lactococcus lactis were introduced by transformation into the IL1403 strain, a low-GABA-producing strain used as a reference. The results are shown in [Fig. 4].

[0120] Fluorescence measurement showed that 1. The gadR2 regulatory gene is required for the activation of the PgadCB promoter (activation by a factor of 268 for PgadCB Eip3 and by a factor of 70 for PgadCB 2118) 2. Activation of the PgadCB EIP3I promoter under the control of its regulator gadR2 EIP3I is 3 times greater than activation of the PgadCB 2ii8 promoter under the control of its regulator gadR2 2nS. 3. Since the sequences of the PgadCB EIP3I and PgadCB 2II8 promoters are identical, as are the gadR2 genes in these two strains, the observed differences must arise from the level of activation of the PgadR2 promoters.

[0121] Comparison of the activity of the P gadR2 promoters of the EIP3I and NCDO2118 strains

[0122] The activity level of the different Pgad R2 promoters was studied by fusion with the fluorescent marker eGFP.

[0123] The results are shown in [Fig.5].

[0124] The PgadR2 promoter of strain EIP3I is 14 times stronger than the PgadR2 promoter of strain NCDO2118. It therefore appears that the sequence differences between these 2 promoters (inversion of an A to a T upstream of box -10 and / or insertion of an A for strain EIP3I) allow it to express the regulator more strongly.

[0125] Study of the impact of P gadR2 from the L. lactis strain EIP3I on GABA production in different L. lactis strains

[0126] The study was set up to illustrate the overproduction of GABA in 2 different strains: the IL1403 strain which produces very little GABA and the NCDO2118 strain whose gadCB operon is already well functional. Materials and methods

[0127] Six transformed strains were studied: 1- EIP3I carrying the pTRKH3-R2E1P31 plasmid, 2- EIP3I carrying the control plasmid pTRKH3-eGFP, 3- NCDO2118 carrying the pTRKH3-R2E1P31 plasmid, 4- NCDO2118 carrying the control plasmid pTRKH3-eGFP, 5- IL1403 carrying the pTRKH3-R2E1P31 plasmid and 6- IL1403 carrying the control plasmid pTRKH3-eGFP. They were cultured on M17 medium with 20 g / L glucose and 5 pg / mL erythromycin under static conditions at 30°C and harvested during the exponential growth phase (optical density at 580 nm, D058o ~ 2), aliquoted into 2 mL cryotubes in the presence of 20% v / v glycerol, and stored at -80°C. These stocks were used for precultures and cultures in the bioreactor.

[0128] Microbial cultures were performed in duplicate in 2 L bioreactors (BiostatB plus, Sartorius, Melsungen, Germany) with M17 medium (Table 3) supplemented with 5 g / L glutamic acid, 50 g / L glucose, and 5 pg / mL erythromycin. Incubation was carried out at 30°C with stirring (250 rpm) under microaerobic conditions (initial aeration of the medium followed by cessation of gas exchange with the medium). The pH was maintained at 6.6 with 10 N KOH for 7 h, then adjusted to 4.6 by the addition of orthophosphoric acid.

[0129] [Tables3] Ingredients g / L Tryptone 2.5 Peptic digestion of animal tissues 2.5 Soybean meal digest 5 Meat extract 5 Yeast extract 2.5 Ascorbic acid 0.5 Magnesium sulfate 0.5 Sodium glycerophosphate 19

[0130] Composition of medium M17

[0131] The cultures were inoculated with cells from precultures in Erlenmeyer flasks in a similar medium but without glutamic acid. They were harvested during the exponential phase and concentrated to obtain an initial optical density (OD) at 580 nm of 0.25 in the fermenter.

[0132] Growth was monitored by measuring absorbance at 580 nm (Libra SI 1, Biochom, one unit of absorbance is equivalent to 0.3 g / L).

[0133] Samples were collected every 30 min for 15 h and then at the 24 h point, stored at -20°C after removal of biomass by centrifugation (4 min at 13,000 rpm at 4°C) for subsequent quantification of GABA concentrations by HPLC according to the method described by Laroute V, Yasaro C, Narin W, Mazzoli R, Pessione E, Cocaign-Bousquet M, et al. GABA Production in Lactococcus lactis Is Enhanced by Arginine and Co-addition of Malate. Front Microbiol. 2016;T. doi: 10.3389 / fmicb.2016.01050. • Preparation of the pTRKH3-R2F|P3i plasmid and control plasmid (TRKH3-eGFP)

[0134] cf § Construction of the different plasmids used in the study, part A1 and E1 Results

[0135] The results are shown in [Table 4] below.

[0136] GABA represents the concentration of GABA (mM) measured at 12 hours of culture.

[0137] [Tables4] T12h GABA (mM) EIP3I T- (pTRKH3-eGFP) 16.83 ± 3.05 EIP3I with pTRKH3-R2E1P31 plasmid 25.22 ± 2.21 NCDO2118 T- (pTRKH3-eGFP) 1.74 + 0.29 NCDO2118 with pTRKH3-R2E1P31 plasmid 31.71 + 2.56 IL1403 T- (pTRKH3-eGFP) 0.40 + 0.01 IL1403 with pTRKH3-R2E1P31 plasmid 36.40 + 1.09

[0138] PgadR2 of strain EIP3I allows overexpression of the regulatory gene g adR2 of EIP3I which allows to increase the production of GABA of this hyper-producing strain under fermentation conditions.

[0139] Overexpression of the EIP3I gadR2 regulatory gene in strain NCDO2118 confers the ability to produce larger quantities of GABA.

[0140] Overexpression of the EIP3I g adR2 regulatory gene in strain IL1403 confers the ability to produce greater amounts of GABA.

Claims

Demands

1. Promoter region of the gadR2 regulatory gene capable of inducing overexpression of gadR2 said promoter region comprising or consisting of: (a) The polynucleotide sequence comprising or consisting of SEQIDN°1; (b) A polynucleotide sequence at least 80% identical to SEQ ID N°1 and which permits overexpression of the gadR2 regulatory gene; or (c) A sequence complementary to the polynucleotide sequences (a) or (b), in which the complementary sequence and the polynucleotide sequence have the same number of nucleotides and are 100% complementary.

2. Promoter region according to claim 1, wherein the gadR2 regulatory gene comprises or consists of the polynucleotide sequence comprising or consisting of a sequence at least 80% identical to SEQ ID No.

2.

3. gadR2 regulatory cassette comprising a gadR2 regulatory gene as defined in claim 2 and its promoter region as defined in claim 1.

4. Use of a regulatory cassette according to claim 3, to induce positive regulation of the gadCB promoter.

5. Plasmid comprising a gadR2 regulatory cassette according to claim 3.

6. Transformed lactic acid bacteria comprising the plasmid as defined in claim 5.

7. Use of a plasmid according to claim 5 or of a transformed lactic acid bacterium according to claim 6, to induce an overproduction of gamma-aminobutyric acid (GABA).

8. A method for producing GABA comprising culturing a lactic acid bacterium transformed according to claim 6.

9. A method for producing a genetically modified GABA-producing lactic acid bacterium comprising introducing into said lactic acid bacterium a plasmid according to claim 5.

Images