Immortalization of canine taste cells

Immortalized canine taste cells provide a solution for ethical and long-term study of canine taste mechanisms, enabling the development of targeted drugs and food products by maintaining functional characteristics over multiple generations.

FR3164724A1Pending Publication Date: 2026-01-23EKTAH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
FR2024007870
Authority / Receiving Office
FR · FR
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-07-18
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

The lack of a canine taste cell line hinders the study of the canine gustatory system, making it difficult to develop ethical alternatives for characterizing taste mechanisms and developing suitable drugs and food products, particularly for conditions like obesity and diabetes, due to the ethical concerns of using live dogs in testing.

Method used

Development of immortalized canine taste cells derived from circumvallate papillae, which can be cultured indefinitely and maintain their functional and morphological characteristics, allowing for long-term studies and the development of specific molecules for targeted pathologies.

Benefits of technology

Enables reproducible, ethical, and long-term studies of canine taste mechanisms, facilitating the development of drugs and food products tailored to canine physiological or pathophysiological conditions, and allowing for toxicity and genotoxicity studies of new molecules.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0001_ABST
    Figure 00000000_0001_ABST
  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The invention relates to immortalized canine taste cells and their derived cells, as well as in vitro processes using said cells. Figure 10
Need to check novelty before this filing date? Find Prior Art

Description

Title of the invention: Immortalization of canine taste cells FIELD OF INVENTION

[0001] The present invention relates to newly identified and immortalized canine taste cells, namely the cells registered under CNCM number 1-6070 or taste cells derived therefrom. The invention also relates to the use of these new canine taste cell lines in research, as a drug, or in in vitro methods for screening biomolecules involved in canine taste signaling. Furthermore, the invention also relates to in vitro methods for analyzing the signaling response of canine taste cells to test molecules or in vitro methods for identifying molecules of interest for modulating canine taste cell signaling responses. STATE OF THE ART

[0002] Taste is one of the most fundamental sensory experiences in the daily lives of many species in the animal kingdom, influencing the appreciation of food and the relationship with food. Taste, considered as a sensory modality, allows us to identify and consume nutrients while avoiding toxins and indigestible substances. Among the species for which this modality is most developed, taste is often described as a complex combination of sensations perceived by the taste buds, going beyond the simple detection of the basic flavors of sweet, salty, sour, bitter, and umami (each contributing its own distinctive quality to the foods and dishes consumed). Indeed, taste is also influenced by other factors, such as fat (considered by some researchers to be the sixth taste modality), metallic taste, and even the texture, temperature, and aroma of food.

[0003] The study of taste perception, taste modalities, and the cellular mechanisms involved in taste signaling is essential for at least the following reasons: understanding food and nutrition, identifying food compounds, exploring the diversity of flavors, and developing medical and industrial applications. Regarding this last reason specifically, a better understanding of taste signaling mechanisms can, in particular, lead to the development of therapies for disorders related to taste and food detection. Furthermore, in the food industry, knowledge of consumers' taste preferences can can be used to develop new food products and improve existing formulations.

[0004] The study of certain gustatory systems, such as the human gustatory system, has already been the subject of numerous scientific studies. Conversely, the mechanisms involved in the orosensory perception of the different canine taste modalities are not, to date, precisely described in the scientific literature. Consequently, the canine gustatory system remains largely unknown, despite the fact that certain related pathologies (such as obesity) are particularly prevalent. Indeed, in France, approximately 39% of dogs are obese, and this proportion rises to 50% in the United States and the United Kingdom.

[0005] The characterization of the canine taste system is therefore essential in order to ultimately develop drugs and / or food products adapted to the physiological or pathophysiological situation of the dog.

[0006] However, no canine taste cell line is currently known, making the study of the canine taste system and the development of new molecules particularly difficult. Indeed, taste cells, like any other cell, become senescent and can die as the animal ages. The killing of these animals then becomes necessary to carry out the experiments required to characterize the canine taste system, which is unacceptable for obvious ethical reasons. Furthermore, in the context of developing new molecules (pharmaceutical or food), the preliminary testing phases required to obtain marketing authorization from approved bodies involve significant risks of poisoning for the dogs on which these new molecules are tested.Here again, such unethical practices need to be replaced by alternatives that are more respectful of the health of the dogs involved.

[0007] There is therefore, at present, a real need to identify and develop ethical alternatives for characterizing the canine gustatory system, particularly with a view to developing suitable medicines and / or food products. DESCRIPTION OF THE INVENTION

[0008] The inventors have developed, unexpectedly and surprisingly, a line of immortalized canine taste cells, derived from circumvallate papillae of the dog's tongue.

[0009] An objective of the present invention is to enable the study and characterization of the canine taste system in order to enable the development of suitable drugs and / or food products.

[0010] Thus, the present invention relates to canine taste cells, said cells being the cells filed under number CNCM 1-6070 or canine taste cells derived from the cells filed under number CNCM 1-6070.

[0011] The present invention therefore offers several advantages, including:

[0012] - to enable the long-term cultivation of taste cells with a high capacity proliferation and thus propose continuous cell lines that resemble the mature phenotype of canine taste cells responsible for taste perception in vivo,

[0013] - to allow the reproducible, long-term study of the mechanisms and responses of complex signaling processes involved in the canine gustatory system, in an ethical manner that is more respectful of the health of the animals concerned,

[0014] - to allow the development of specific molecules, which may be of the type Agonists or antagonists of taste receptors, for the treatment of targeted pathologies, for example: obesity, diabetes, inflammation, metabolic syndrome, etc.

[0015] - to allow for a more in-depth study of the mechanisms involved in perception of different canine taste modalities by genetically modifying these cells (overexpression or conditional expression of a gene),

[0016] - to enable the performance of toxicity and / or genotoxicity studies of new molecules or drugs that could not be produced for ethical reasons in dogs.

[0017] In the context of the invention, the term "canine taste cells" refers to sensory cells capable of detecting at least one of the molecules involved in canine taste signaling. Such cells reside in the taste buds present in the various taste papillae (circumvallate, fungiform, and foliate) of the dog's tongue and are type I, II, or III cells. Type I cells are primarily the supporting cells within the taste buds. They surround and protect the other types of taste cells. In addition to their supporting role, type I cells actively participate in the degradation of neurotransmitters released in the taste bud. A crucial role of type I cells is their involvement in the detection of salty tastes.This function is mediated by epithelial sodium channels (ENaCs) present on their membrane, which allow the influx of sodium ions (Na+) when salty substances are consumed. This influx of sodium ions leads to depolarization of the cell membrane and the transmission of the taste signal to afferent neurons. Type II cells are known, particularly in humans, to be specialized in the detection of sweet, bitter, and umami tastes, as well as fat. They express specific G protein-coupled receptors (GPCRs) for each type of taste. type of taste they detect. Unlike type III cells, type II cells do not form classical synapses with nerve fibers. Instead, they release neurotransmitters, including adenosine triphosphate (ATP), which activate nearby taste neurons by binding to their purinergic receptors. This ATP release allows the paracrine transmission of the taste signal to sensory neurons. Type III cells are primarily involved in detecting sour tastes. They can also contribute to the detection of salty tastes at higher concentrations. Type III cells are distinguished by their ability to form classical synapses with gustatory nerve fibers. They release neurotransmitters such as serotonin, which directly activate taste neurons by binding to their postsynaptic receptors.This direct synapse allows for rapid and efficient transmission of the taste signal to the central nervous system.

[0018] In the context of the invention, the expression "canine taste cells deposited under deposit accession number CNCM 1-6070" refers to any sensory cell capable of detecting at least one of the molecules involved in canine taste signaling, present in the cells deposited with the National Collection of Microorganism Cultures (CNCM) under deposit accession number CNCM 1-6070.

[0019] In the context of the invention, the expression "canine taste cells derived from cells filed under CNCM number 1-6070" refers to any sensory cell capable of detecting at least one of the molecules involved in canine taste signaling that is derived from one of the cells filed under CNCM number 1-6070.

[0020] In the context of the invention, the expression "canine taste cells are immortalized" refers to a process by which taste cells isolated from canine taste buds are modified to acquire the ability to divide indefinitely in culture. This process includes the isolation of taste cells, their transfection with gene vectors incorporating immortalization genes, and the subsequent selection of the transfected cells. The cells thus selected are cloned to obtain stable cell lines expressing the immortalization genes. These immortalized cell lines retain the morphological and functional characteristics of primary taste cells, including the expression of taste cell-specific markers and the ability to respond to taste stimuli.The canine taste cells of the present invention are immortalized and capable of proliferation, that is to say, they are proliferating cells (which can also be referred to as "self-renewing cells"). Consequently, the cells of the present invention... are capable of going through numerous cell division cycles (also referred to hereafter as "generations") and can also be described as "stabilically proliferating cells". Preferably, the proliferating canine taste cells of the present invention retain their phenotype in culture for at least 10 generations, thus including: at least 11 generations, at least 12 generations, at least 13 generations, at least 14 generations, at least 15 generations, at least 16 generations, at least 17 generations, at least 18 generations, at least 19 generations, at least 20 generations, at least 21 generations, at least 22 generations, at least 23 generations, at least 24 generations, and preferably at least 25 generations.More preferably, the proliferating canine taste cells of the present invention retain their phenotype in culture for at least 26 generations, at least 27 generations, at least 28 generations, at least 29 generations and even more preferably at least 30 generations, at least 35 generations, at least 40 generations, at least 45 generations. at least 50 generations, at least 55 generations, at least 60 generations, at least 65 generations, at least 70 generations, at least 75 generations, at less than 100 generations and even more preferably at least 150 generations. Advantageously, the proliferating canine taste cells of the present invention retain their phenotype in culture for an unlimited period.

[0021] In the context of the invention, the expression "retain their phenotype in culture" refers to the ability of canine taste cells to maintain, over a given period, their morphological, functional, and molecular characteristics when cultured in the laboratory. These characteristics include the expression of taste cell-specific markers, such as taste receptors, as well as the ability to respond to taste stimuli in a manner similar to primary taste cells.

[0022] In the context of the invention, the term "signaling response" refers to the way in which cells interpret and respond to signals from their environment or from within their own system. In multicellular organisms, cells communicate with each other and with their environment through chemical, electrical, or mechanical signals. These signals can be produced by other cells, molecules released into the extracellular environment, or even physical changes in the cellular environment. Once a cell receives a signal, it can respond in various ways, including changes in its metabolic activity, growth, division, migration, or the production of additional signaling molecules. The signaling response can be rapid and transient, or it can trigger lasting changes in the cell's behavior or function..

[0023] In the context of the invention, the expression "a substantially identical response" refers to the type of response rather than the intensity of the response, for example, the increase in intracellular free calcium levels, which is considered the early event in the activation of a membrane receptor. Therefore, when a known flavor molecule causes, for example, an increase in intracellular free calcium levels, a substantially identical response is obtained when the tested compound also causes an increase in intracellular calcium levels, regardless of whether other effects are also elicited. The intensity of the signal, for example, the relative increase in intracellular calcium levels, need not be identical.However, it is preferable that the signal intensity be of the same order of magnitude, that is, less than 20% of the signal intensity obtained using the known molecule, preferably less than 10%, and even more preferably less than 5% of the signal intensity obtained using the known molecule. When the type of signaling response and the signal intensity are the same as when using the known molecule, the signaling response is considered identical.

[0024] In the context of the invention, the expression "a canine taste cell signaling response activator" refers to any substance or agent (e.g., an agonist) capable of triggering the cascade of intracellular signals within canine taste cells in response to a taste stimulus. This activator interacts with specific taste receptors coupled to signaling to initiate or amplify a signaling response, resulting in taste cell activation, modulation of gene expression, and physiological changes leading to taste perception. Activators may include chemical compounds, peptides, proteins, nutrients, natural extracts, or synthetic analogs (e.g., agonists).

[0025] In the context of the invention, the term "a modulator of a canine taste cell signaling response" refers to any substance or agent capable of altering, regulating, or amplifying the cascade of intracellular signals within canine taste cells in response to a taste stimulus. This modulator can interact with taste receptors, signaling proteins (including glycoproteins), or other components of signaling pathways to adjust the intensity, duration, or nature of the signaling response. Modulators may include chemical compounds, peptides, proteins, nutrients, natural plant extracts, or synthetic analogs.Therefore, the modulator is not necessarily a molecule directly involved in taste signaling, but it interacts with an underlying protein domain of the receptor involved in taste signaling, thus modifying its effect on the taste cell. This is referred to as... This can result in positive or negative allosteric modulation. This ligand-receptor interaction can, for example, lead to the inhibition of a particular taste signaling pathway or to the amplification (i.e., an increase in signaling) of a specific signaling pathway. Furthermore, this interaction can lead to a delay in the onset of the signaling response or a prolonged or shortened signaling response—that is, a response of longer or shorter duration compared to the signal elicited by the known molecule involved in taste signaling in the absence of the tested compound.

[0026] In the context of the invention, the expression "cellular biomolecule involved in canine taste signaling" refers to any molecule produced by canine taste cells that plays an essential role in the detection and transmission of taste signals from the tongue to the brain. These biomolecules include, but are not limited to, taste receptors, intracellular signaling proteins, enzymes, ions, and neurotransmitters.

[0027] Preferably, the present invention relates to canine taste cells having the following technical characteristics, taken alone or in combination: - the canine taste cells are immortalized and retain their phenotype in culture for at least 10 generations,

[0028] - taste cells derived from cells filed under CNCM number 1-6070 are genetically modified cells derived from cells deposited under number CNCM 1-6070,

[0029] - the genetically modified cells include in their genome at least a nucleic acid molecule added and chosen from the group consisting of a nucleic acid molecule encoding a protein taste receptor, a nucleic acid molecule encoding a hormone receptor, a nucleic acid molecule encoding a molecule involved in canine taste signaling, a nucleic acid molecule encoding a compound promoting anti-senescence and immortalization, and a nucleic acid molecule encoding an inhibitor.

[0030] The invention also relates to a method for in vitro analysis of a signaling response of canine taste cells to a molecule involved in canine taste signaling, the method comprising the following steps:

[0031] a) bringing canine taste cells into contact according to any of the preceding variants and said molecule involved in taste signaling, and

[0032] b) determining the signaling response triggered by said molecule in canine taste cells.

[0033] The invention also relates to a method for the in vitro identification of an activator of a signaling response in canine taste cells, the method comprising the following steps:

[0034] a) bringing canine taste cells into contact, according to any of the preceding variants, with a molecule to be tested,

[0035] b) measuring the signaling response triggered in the cells following contact according to step a), and

[0036] c) the comparison between the signaling response measured in step b) and a known signaling response triggered in said canine taste cells according to any of the preceding variants by one or more known molecules,

[0037] wherein an identical or substantially identical signaling response between the signaling responses compared in step c) indicates that the tested molecule is an activator of the canine taste cell signaling response.

[0038] The invention also relates to a method for the in vitro identification of a modulator of a signaling response in canine taste cells, the method comprising the following steps:

[0039] a) bringing canine taste cells into contact, according to any of the preceding variants, with a known molecule that triggers a known signaling response in said canine taste cells and with a molecule to be tested,

[0040] b) measuring the signaling response triggered in the cells following contact according to step a),

[0041] c) comparing the signaling response measured in step b) with the known signaling response triggered by said known molecule,

[0042] wherein a difference between the signaling responses compared in step c) indicates that the tested molecule is a modulator of the signaling response of canine taste cells.

[0043] Advantageously, for the methods according to the invention, as previously described, the signaling response is chosen from:

[0044] - intracellular calcium signaling,

[0045] - the cell membrane potential,

[0046] - the release of neurotransmitters and / or hormones,

[0047] - the phosphorylation of protein kinase cascades, such as MAP kinases, protein kinase-C, preferentially downstream of the activation of a taste receptor.

[0048] The invention also relates to a method for in vitro identification of a cellular biomolecule involved in canine taste signaling, the method comprising the step of detecting said cellular biomolecule within canine taste cells according to any one of the preceding variants.

[0049] Advantageously, the detection step of said cellular biomolecule is carried out by immunofluorescence, by western-blot or by transgenesis (using a reporter gene).

[0050] The invention also relates to a kit comprising canine taste cells according to any one of the preceding variants.

[0051] The invention also relates to the use of canine taste cells according to any of the preceding variants for use as a medicinal product.

[0052] The invention also relates to the use of canine taste cells according to any of the preceding variants for the in vitro screening of molecules involved in canine taste signaling. Brief description of the drawings

[0053] [Fig-1]: represents a schematic representation of the papilla isolation protocol gustatory. (1-3) Circumvallate papillae are counted, and then the tongues are incubated in complete Tyrode containing calcium for 15 minutes. (4) An enzyme mixture of elastase and dispase is injected under the gustatory epithelium, and then the tongues are incubated in complete Tyrode without calcium (5-6). (7-8a) Each papilla is removed and then cryopreserved in liquid nitrogen. Papillae intended for histological study are incubated in formalin (2), and those intended for cell isolation are stored in a 1.5 mL tube containing DMEM with complete glucose (8b).

[0054] [Fig.2]: represents a diagram of the preparation of immunofluorescence slides on fabrics.

[0055] [Fig.3]: represents a diagram of the protocol for isolating taste cells canine and sublingual papillae. (1-3) The papillae are centrifuged to remove the culture medium and are held in an enzyme mixture, the digestion of which is facilitated by the use of scissors. (4-5) After incubation, the cells have settled, and the supernatant is transferred to a new tube for centrifugation. (6-7) The pellet is then resuspended in culture medium and incubated while the supernatant is returned to the original tube to continue digestion of the settled tissue. This last step is repeated 2 to 3 times, and the incubated tubes are filtered and combined in a 10 mL tube for centrifugation. (8) The supernatant is discarded, and the pellet is resuspended in DMEM with complete glucose containing Primocin. (9) The cells are seeded in a 12- or 16-well plate.

[0056] [Fig.4]: represents a schematic representation of the cell thawing process Canine taste tests, (a) the cells are thawed in a 10 mL tube of DMEM with complete glucose. (2-4) They are then centrifuged, the supernatant is discarded, and the cell pellet is resuspended in 6 mL of DMEM. (5-7) The cells are distributed in 3 T25 flasks (2 mL / flask) and incubated at 37°C / 5%CO2. In cases where cells are urgently needed, thawing can be done in a single T25 flask. The cells will be confluent 24 to 48 hours after inoculation.

[0057] [Fig.5]: represents a schematic of the progression of a dose-response of linoleic acid by studying the release of intracellular calcium in dTBCs. (1-7) main steps of the experiment taking as an example 50 and 100 pM of linoleic acid.

[0058] [Fig. 6]: represents a schematic representation of the procedure for measuring intracellular calcium release in canine taste cells following stimulation with linoleic acid in the presence of inhibitors. The table on the left shows the first 3 columns of a 24-well plate. The timeline on the right shows the chronology of incubations and injections for one column (LA: linoleic acid; SSO: Sulfo-N-succinimidyl Oleate; AH: AH-7614).

[0059] [Fig. 7]: represents an example of a plate design for stimulation of dTBCs by 4 different concentrations of linoleic acid. The cells are stimulated alternately by 50 and 100 (Plate 1 left) and by 200 and 400 pM (Plate 2 right) of linoleic acid.

[0060] [Fig. 8]: represents a qPCR program used according to BioRad recommendations on a QuantStudio 3 real-time PCR system, Applied Biosystems. The qPCR is performed in a final volume of 20 pL for a total duration of 56 minutes.

[0061] [Fig. 9]: represents a graph demonstrating that weight and age appear to influence the number of papillae in female beagles. The Spearman correlation test comparing weight and age with the number of circumvallate papillae was performed using GraphPad Prism version 9.0.0.

[0062] [Fig. 10]: Represents the morphology and identification of the different taste buds on the beagle's tongue. (A) is a schematic representation of the beagle's tongue. Photograph (B) was taken with a camera and images (C) and (D) with a binocular microscope. Circumvallate papillae are circled in black (B) and fungiform papillae in black dotted lines (B) and (D).

[0063] [Fig. 11]: represents the difference between a simple and a complex circumvallate papilla. The photograph of the simple papilla (A) and the complex papilla (B) was taken using a binocular microscope. The primary sulcus is indicated by a dotted line.

[0064] [Fig. 12]: Represents the identification of circumvallate papillae and taste buds by H&E staining. Acquisition of the entire papilla, simple (A) and complex (B), was performed using the ZEISS Primovert microscope coupled with a Moticam camera (Moticam 1080 HDMI & USB) at 2x magnification. The buds were observed using the Zeiss Axio Image M2 microscope. The images were processed using Zen 3 software. The buds are circled by dotted lines at different resolutions xlOO (C), x200 (D), x630 (E). Thin arrows indicate the primary trench and thick ones, the secondary furrows.

[0065] [Fig. 13]: Depicts the colocalization of type I and III cells with canine receptor taste cells in the circumvallate papillae by immunofluorescence. Nuclei were stained with Hoechst (AC). Dashed areas delineate the buds. Images were acquired using the Zeiss Axio Imager MZ microscope at 400x magnification and processed with Zen 3.8 software.

[0066] [Fig. 14]: shows graphs demonstrating that taste and presynaptic cells are predominant in circumvallate papillae. The expression of mRNAs of type I (GLAST and ENTPD2), type II (GNAT3, PLCB2, TRPM5), and type III (SNAP25 and PKD2L1) markers was measured by RT-qPCR in circumvallate and fungiform papillae compared to the sublingual epithelium. The results are normalized by beta-actin (* (p<0.05), ** (p<0.01), *** (p<0.001), **** (p<0.0001)).

[0067] [Fig. 15]: Represents the identification of lipid and glutamic taste receptors in beagle circumvallate papillae by immunofluorescence. Lipid receptors (A), T1R1 and (B) T1R3, as well as the negative control IgG (B), have been stained. The dotted areas delineate the taste buds. The images were acquired using the Zeiss Axio Imager MZ microscope at 400x magnification and processed with Zen 3.8 software.

[0068] [Fig. 16]: Represents the colocalization of lipid taste receptors with GNAT3. The alpha subunit of gustducin is labeled with one color, while CD36, GPR120, and GPR84 are labeled with a different color. The dotted areas delineate the buds. The images were acquired using the Zeiss Axio Imager MZ microscope at 400x magnification and processed with Zen 3.8 software.

[0069] [Fig. 17]: Represents the colocalization of GNAT3 and CD36 in a complex circumvallate papilla. A tilescan of the papilla at 10x magnification is located in the center of the figure. The squares delineate the areas where the images of the buds on the left and right were taken at 400x magnification. (AE) correspond to the secondary groove of the complex structure. The images were acquired using the Zeiss Axio Imager MZ microscope and processed with Zen 3.8 software.

[0070] [Fig. 18]: Represents the colocalization of CD36 with GNAT3 and GPR120 at the periphery of circumvallate papillae. Colocalization occurs at the basal (A), medial (B)(D), and apical (EG) levels of a primary circumvallate papilla sulcus. The dotted lines delineate the areas of fluorescence of interest. The images were acquired using the Zeiss Axio Imager MZ microscope at magnifications of 1x00 (E), 200x (F), and 400x (AE and G) and were processed using Zen 3.8 software.

[0071] [Fig. 19]: shows graphs demonstrating the expression of lipid receptor mRNAs and TIRs. This was measured by RT-qPCR in circumvallate and fungiform papillae compared to the sublingual epithelium. The results are normalized by beta-actin (* (p<0.05), ** (p<0.01), *** (p<0.001), **** (p<0.0001)).

[0072] [Fig. 20]: Represents the location of T1R1 outside the gustatory epithelium. (A) Tilescan of the lamina propria of a circumvallate papilla at 1x100 magnification. The dotted lines delimit the 200x magnification area (B). The images were taken using the Zeiss Axio Imager MZ microscope and processed with Zen 3.8 software.

[0073] [Fig. 21]: Represents primary canine taste cells expressing CD36 and GNAT3 by immunofluorescence. Single labeling of CD36 and GNAT3 (A) and double labeling (B). Images were acquired using the Zeiss Axio Imager MZ microscope at 200x magnification and processed with Zen 3.8 software.

[0074] [Fig. 22]: Represents graphs and fluorescence images demonstrating the effectiveness of canine taste cell immortalization. Expression of mRNAs of immortalization and muscle markers by RT-qPCR in taste and sublingual cells compared to muscle tissue (TM). Results are normalized with beta-actin (A) (* (p<0.05), ** (p<0.01), *** (p<0.001), **** (p<0.0001)). Verification of the presence of the skeletal muscle marker MY0D1 in taste cells. Images were acquired using the Zeiss Axio Imager MZ microscope at 400x magnification and processed with Zen 3.8 software (Insert).

[0075] [Fig. 23]: Represents the colocalization of different cellular markers (Glial-like and presynaptic) with GNAT3. TRPM5 monolabeling in immortalized cells. Scale bars are 50 µm (B). Images were acquired using the Zeiss Axio Imager MZ microscope at 200x magnification and processed with Zen 3.8 software.

[0076] [Fig. 24]: Represents the localization of lipid and glutamic taste receptors in canine dTBC taste cells by immunofluorescence. The fluorescence intensity of the proteins of interest (A) was compared to negative controls (B). Images were acquired using the Zeiss Axio Imager MZ microscope at 400x magnification and processed with Zen 3.8 software.

[0077] [Fig. 25]: Represents the colocalization of lipid taste receptors in taste cells. CD36 mouse is used for double labeling with GPR120 so that the host is not the same. Scale bars represented by a white line on the magnified images are 20 µm. The images were taken using the Zeiss Axio Imager MZ microscope at 400x magnification and processed with Zen 3.8 software.

[0078] [Fig. 26]: represents graphs demonstrating the expression of mRNAs of Taste markers and receptors in canine taste cells dTBC by RT-qPCR. Glial-like, taste, and presynaptic cell mRNA expression is shown in (A), lipid taste receptors in (B), and TIRs in (C). Results are normalized by beta-actin (* (p<0.05), ** (p<0.01), *** (p<0.001), **** (p<0.0001)).

[0079] [Fig.27]: represents graphs demonstrating the dose-effect of linoleic acid in canine taste cells (dTBC). Fluorescence intensity is reported relative to cell surface area and multiplied by a factor of 1000 to reduce decimal places. The difference between maximum and minimum fluorescence (max-min) as a function of linoleic acid concentrations is shown in (A) and the EC50 curve in (B). Different colored dots distinguish the two sets of experiments, each performed in duplicate. Results are normalized to background (ns (not significant), * (p<0.05), ** (p<0.01), *** (p<0.001), **** (p<0.0001)).

[0080] [Fig. 28]: represents graphs and images obtained by fluorescence presenting An example of the dose-response of linoleic acid on dTBC canine taste cells. The quantitative response is shown graphically on the left, while the qualitative representations are shown on the right (before (t=0), after (center image), and at the end of injection (t approximately 5 minutes)). Arrows indicate the time of injection, and circles indicate cells where fluorescence has disappeared. The calcium response is measured on a minimum of 8 cells per concentration. The graphs were generated using GraphPad Prism 9.0.0 software. The video captures are from live cell recording using NIS ELEMENT AR software - Nikon.

[0081] [Fig.29]: represents graphs and images obtained by fluorescence showing The effect of SSO and AH-7614 on dTBC canine taste cells (the series). The quantitative response is shown graphically on the left, while qualitative representations are shown on the right (before (t=0), after (center image), and at the end of injection (t approximately 5 minutes)). Arrows indicate the time of injection. The calcium response is measured on a minimum of 7 cells per condition. Video captures are from live cell recording using NIS ELEMENT AR software - Nikon (A). Fluorescence intensity is reported per cell surface area and multiplied by a factor of 1000 to reduce decimal places. The difference between maximum and minimum fluorescence (max-min) for each condition is shown in (B). Graphs and histograms were generated using GraphPad Prism 9.0.0 software.

[0082] [Fig.30]: represents graphs and images obtained by fluorescence showing an example of the response of the effect of SSO and AH-7614 on taste cells Canines dTBC (2nd series). The quantitative response is represented graphically on the left, while qualitative representations are shown on the right (before (t=0), after (center image), and at the end of the injection (t approximately 5 minutes)). The arrows indicate the time of injection. The calcium response is measured on a minimum of 10 cells per condition. The video captures are from the live recording of the cells using NIS ELEMENT AR software - Nikon (A). Fluorescence intensity is reported per cell surface area and multiplied by a factor of 1000 to reduce the number of decimal places. The difference between maximum and minimum fluorescence (max-min) according to the conditions is shown in (B). The graphs and histograms were generated using GraphPad Prism 9.0.0 software.

[0083] [Fig. 31]: represents a graph showing the dose-response effect of monosodium glutamate (MSG) in dTBC canine taste cells. Fluorescence intensity is normalized to background noise. The difference between maximum and minimum fluorescence (max-min) as a function of MSG concentrations is indicated in (A) (ns (not significant), * (p<0.05), ** (p<0.01), *** (p<0.001), **** (p<0.0001)).

[0084] [Fig. 32]: Represents graphs and fluorescence images showing an example of the dose-response of MSG on dTBC canine taste cells. The quantitative response is shown graphically on the left, while the qualitative representations are shown on the right (before (t=0), after (center image), and at the end of the injection (t approximately 5-7 minutes)). The arrows indicate the time of injection. The calcium response is measured on a minimum of 16 cells per concentration. The graphs were generated using GraphPad Prism 9.0.0 software. The video captures are from the live recording of the cells using NIS ELEMENT AR software - Nikon.

[0085] The present invention is illustrated in a non-limiting way by the following examples. EXAMPLES OF ACHIEVEMENTS Example 1: Materials and methods Animals and diets

[0086] The chosen model, the beagle (Canis Lupus Familiarisé), is commonly used in the laboratory, particularly in the study of obesity (Xue et al. 2022; Manens et al. 2012). It is a dog of normal build, docile and predisposed to obesity.

[0087] The tongue and other tissues (liver, muscle tissue and ileum) of the Beagles were collected by the veterinary clinic of the Marshall Bioressources department - Bio2M (Mézilles, France).

[0088] The animals were euthanized for ethical reasons (non-contagious diseases compatible with the request for tongue sampling, animals exhibiting behavioral problems...

[0089] The euthanasia procedure was carried out in accordance with European regulations (European Directive 2010 / 63 / EU). It initially consisted of administering deep sedation using an α2-agonist (Medomedine or Xylasine) followed by the intravenous (IV) injection of pentobarbital (Dolethal or Euthasol). These procedures were approved by the company's internal ethics committee.

[0090] The dogs are housed in kennels of a size that meets regulatory requirements and have access to the outdoors. They have unlimited access to water and Teklad Global Diets® 2025C kibble (26.3% protein, 10.5% fat, 34.6% carbohydrates, 8% ash, 5.6% minerals, 3% crude fiber, and 11.5% insoluble fiber). All animals receive a standard care and preventative treatment program. In addition, an enrichment and socialization program is in place.

[0091] Seven males and 34 females aged 2 to 8 years and in good health were obtained. The Internal and external prophylaxis is prior to one week and general antibiotic therapy prior to 4 weeks before sample collection.

[0092] The tongue was sampled from the epiglottis by qualified veterinarians in such a way as to preserve the caudal portion of the tongue containing the circumvallate papillae. Once collected, the samples are sent within 24 hours or less in bottles containing sterile culture medium (DMEM with glucose). "Ex vivo" study

[0093] Macroscopic study of the Beagle's tongue

[0094] The tongues were initially observed with the naked eye to identify the different papillae and then to count the circumvallate papillae. The distribution and size of the fungiform papillae were observed under a binocular microscope.

[0095] Isolation of canine taste buds

[0096] The protocol for isolating canine papillae and then taste cells is based on previous work carried out in mice and rats (Miyamoto et al. 1996; Ruiz et al. 2001).

[0097] After observing the tongues, they are incubated in Tyrode buffer with calcium (120 mM NaCl, 5 mM KCl, 1 mM CaCl₂, 1 mM MgCl₂, 10 mM Hepes, pH 7.4) supplemented with 10 mM glucose and 10 mM sodium pyruvate at 4°C for approximately 15 minutes. The volume of Tyrode used is approximately 200 mL per tongue so as to immerse the taste epithelium. An enzyme mixture containing elastase (8 mg / mL; ref: LS002294; Wothington) and dispase (8 mg / mL; (ref: D4693-1G; Worthington) dissolved in complete Tyrode with calcium was used to dissociate the lingual epithelium from the tongue. The injection was performed peripherally and in the outer fossa of the circumvallate papilla and randomly on the second caudal third of the tongue in order to collect the maximum number of fungiform papillae ([Fig. 1] - step 4). The tongues were then incubated for 1 hour 30 minutes to 1 hour 45 minutes at 37°C in calcium-free Tyrode (140 mM NaCl, 5 mM KCl, 10 mM Hepes, 2 mM EGTA, pH 7.4) supplemented with 10 mM glucose and 10 mM sodium pyruvate. After incubation, the taste epithelium containing the fungiform papillae is gently removed with flat and curved forceps, while the circumvallate papillae are removed with a scalpel and kept in complete DMEM culture medium (ref: L0104-500; Dutcher). As for the sublingual epithelium, it is removed with a scalpel without injection, taking care not to remove the muscle tissue ([Fig.l]- step 7) At this stage, the papillae are either used for the isolation of taste cells or stored at -80°C in 1.5 mL tubes with a hole drilled in the cap.

[0098] Histology

[0099] Circumvallate papillae are harvested along with muscle tissue to facilitate their embedding in a buffer containing 10% formaldehyde (ref. BAF-6000-08A; CellPath). After tissue harvesting, slides are prepared using the ImaFlow platform (Faculty of Medicine, University of Burgundy, Dijon) up to the dewaxing and unmasking steps. The samples are then embedded in paraffin in cassettes. Sections of the paraffin block are made with a microtome to obtain 5 µm thick slices.

[0100] Once the tissues have been embedded and the slides deparaffinized in toluene / xylene-ethanol baths for 30 minutes, they are either stained with hematoxylin and eosin (HE) or used for immunofluorescence.

[0101] Immunofluorescence - Antibody selection by bioinformatics

[0102] Most commercially available antibodies are primarily produced for use in rodents (mice, rats, hamsters), humans, goats, or rabbits. Some less common species such as frogs, cows, or chimpanzees are also available. However, few antibodies are produced specifically for recognizing canine epitopes.

[0103] The strategy adopted was to perform a sorting of all antibodies of interest by bioinformatics using the blastp (protein-protein blast) sequence analysis tool.

[0104] The antigen sequence of the protein of interest is compared to non-redundant databases (GenBank, Protein Data Bank, SwissProt, Protein Information Resource, Protein Research Foundation), using the following criteria: • Enter FASTA sequence(s): Antigen sequence • DataBase: Non-redundant protein sequences (nr) • Organism: Canis lupus familiaris (taxis: 9615).

[0105] Antibodies were then selected based on various factors: the Query Cover, which corresponds to the alignment score, the percentage of identity, and the description of the protein of interest, which must correspond to the sequence used (Table 1). For example, a CD36 sequence to be analyzed should only yield CD36 sequences among the first results.

[0106] The antigenic sequence of T1R3 was not provided by the supplier. The use of this antibody is based on the technical data sheet, which recommends it for the detection of this canine receptor.

[0107] [Tables] X ' -OGAV ' .5 ' S ' S ' " 'S'!- ; S- S ' OÏ O ' ' ' 5 l^iks^s. ,S«^B£e F^TA as ræ&gæ&e Fastssa-iï Qim to« ms ^MAMAMAMAMAM «g S'isfeatSï £-PyJ2$ sQSNTLS $ SSPiSKOS 300-10-220 a'kk. CA 'd 2E HvS'd'Q 1SKLFR'LFL2 F(D'\>Ï $¢-355 À® ŒSîssBss Fi^VExTZ?" -"7E 3 '-VîE' 25P '-2>SSO "OZO^-IQ >. ", £W~.S 353-455 S® ®;; •CES-S^sas* ssnos^ ■OO SC CSSÆsSÇæW 3Ï-I3S7K ZO'OZO'O VTSJ>L C'-s0004.02 O' GO 302202.0010 'i 012^0034 "02 730 SA® g® 35 X® TÎ5Î5Ü5 îsEPiÆÏ^4 VJ" IZ. \ O ô JC Cl •ce çssnos- oo ïz-ctoStoe: KASf SS T1S SOA F&œ: :-2C?KS-§JÆ' ' ^53¾¾¾. £1^32, SijüSSg EN i ïEN. ?A>mgs P£ 23 -A' / CO-c: 20 _<H,i ZOO- AS.„Y -£,4 d / - A-3> ?ZX.''Î1E iST YJ 22-0 34 CL. 2^530000 OT 4AÏS g® 35-¾^ GLAST <^24542 J.-: s<-224.55: «Tse.-224® HAâ-SSsS Fkh-s îa-^r^'Æ I ILS >KX' I irJ S'i^ciSE. sss Fsw^:\ï3>K2^\imr S?. S^i^LiAQDN'TPEKP ¥Ârs<rFTfC: G,X* S> <s œï2S:.* x^542 *: x- scc '.ai ç slï R® SS2 3£ïiE8Î &ï ii*£, CxJâfïf w SKÀ325-sÿsspsâsràsî çîæOS.U giAj-S"®® ?-<=.4PAi^>x< / s>ÇAQÜQFS.SJL4Kig?Xi V^KN'ZKiaEaZG.AÏC.'lS' o”o<r.YrT ^T^ÇVDEVVIS-æ’ÇN \T-K\IEFXGmESDPJ> . LlCÇAG.CÇraTSACZ:: KKLOVKXLKia: 53-^5 g® 5-2.97 SSAPS- ViS i. £W155S,$ ■ N? ISS SXAT3 33.-244^. nrx?.K>rgnyF. <c-xKÏSÎæN V » 5 ?7«liK^31<H5K A VHX3d\dCHV7_CO Hb'Ç-tGPLÎÎY'A SA SX Kl OC£PXOT2S£FÔ KlKO^SAb K- SXC120 EÈCSOTVM. 354-913 51:-:.55- X® Ï5< î® .

[0108] Immunofluorescence - Protocol

[0109] Antigen unmasking step: After the deparaffinization step, the slides are immersed in 10X citrate buffer (ref. C9999-1000 mL, 10X, pH 6, Sigma-Aldrich), which is heated to 95°C for 30 minutes. During paraffin embedding, the embedding and dehydration steps damage or mask the antigen epitope. The use of citrate buffer and the increase in temperature facilitate antigen-antibody recognition by removing excess paraffin (unmasking). Once cooled to room temperature, the slides are washed with Tris (TBS) IX saline buffer (0.137 M sodium chloride, 2.1 mM potassium chloride, and 0.025 M Tris / Tris-HCl) (3 times 2 minutes). Non-specific sites are blocked with a saturation solution composed of TBS IX and 10% Fetal Bovine Serum (FBS) for 1h at room temperature (RT: Room Temperature) under agitation.The edges of the samples are dried to allow the use of a hydrophobic pen (PAP Pen, ref. 49001, Dutscher) to delineate the application area, reduce the amount of antibody used, and maximize antibody-antigen binding ([Fig. 2]). The slides are then incubated overnight at 4°C with shaking and 100 pL of primary antibodies (Table 2: List of primary and secondary antibodies used for immunofluorescence on cells and tissues (Table 2)) diluted according to the manufacturer's recommendations in a 1X / 1% TBS solution. The following day, the slides are washed with TBS IX and incubated for 2 hours with secondary antibodies (Table 2) diluted 1 / 500 in 1X / 1% TBS, at room temperature in the dark.

[0110] The slides are rinsed with TBS IX and counterstained with HOECHST 33342 (ref. 66249, Thermo Scientific) to stain the nuclei according to the manufacturer's recommendations. The slides are rinsed, then mounted and sealed with mounting medium (Fluoromount-G™, ref: 00-4958-02; Invitrogen). The histological sections are then observed by fluorescence microscopy (Zeiss Axio Imager M2) and analyzed with Zen Lite software. [YES] [Tables 2] rëjsfesti 2 : i.isii <?: ifeS sPîtSiiSSiSl PSJSPÜSSSÿ <?i ÿSÎSiSSfeSf:r »S§&•'S ««SS LireStiSnijlisrereStre^^ ssifeies si issré® Hôte ÜSRBEité Hèterewe Fowitissews âmsoresPTOWBirs GSAT3 His. M, Rt, Ca Chèvre Aalycisr®! Living room Nm-2æ26. 8» CD36 Am, Hti, M Lapin FolyctanBf FAÎ-16814 Thermof-sher €D3fi ns H Soarij MorwtSonBi N8110-SS724 LSovvs Sic GPR12B Hu, M, Ri Lapin Sslycfonsl N3PL-5GS5S Sio Lfovus Huors LapinW15! fW2-S£494 HoS'IlSS Si® T1R1 Hu; Hv, C», Eq Rabbit AalycsOtSâi KLS1394 itous Sis T1R3 H b. M, Ri Chèvre Aslycisna! St-22458 and Sc- 22459 Santa Cruz GPRSA St, Ca, 8v.Sh, Eq, ML Lapin FalyctanBi BS-135Q7R SiOSS Antibotiies jTherinsiïsher} SLAST Hu, M, Rs Lapin Sclÿdonal AÀ5-72895 ENTPD2 Hu Lapin Folyctonsl SA5-Î10829 Thermsfisher S?«?2S Hu, fU Sentis SiSenocSonai MA5-17609 AntkofpsSeaartdaines Qs-èwe Ane Fclyciatsat A323L4 Atexa 5S8 Qævre Ane F&lyctanat A-Î10S7 Atesa 568 Lapin Ane Aolyci&tsat A-im? Irsviïrogest Aiexa488 lapin Ane i\slyci®rsai A-2120S A5esra488 Souris Aise PsIyctenB) A-21202 CsRtrâies négatifs fgG m Souris Souris Ÿ Sc-2825 !§G sis ispsn Lapin ÿ< MSl-ltWG Santa irez îgQgt Ctiéwe Chèvre / ..•S - <,c'v5:-àL si -. âsiihSiS^ i, Lii : £CïA*ç Shl . In vitro approach

[0112] Isolation of canine gustatory and sublingual cells

[0113] Once isolated, the circumvallate papillae and sublingual epithelium are centrifuged (600 g; 1 min; 4 °C) and the supernatant is discarded. The papillae are transferred to a 1.5 mL tube containing an enzyme mixture (8 mg / mL elastase, 4 mg / mL collagenase, and 4 mg / mL trypsin inhibitor). Mechanical cutting with scissors is performed to facilitate enzymatic digestion. The dissociated taste and sublingual cells are separated from the undigested tissue using a 30 µm pre-separation filter (ref: 130-041-407; Miltenyi Biotec). After 10 minutes of incubation at 37°C and sieving the cells, centrifugation (2000 rpm; 1 minute 30 seconds) allows for the recovery of the taste and sublingual cells. The cell pellet is resuspended in complete DMEM containing Primocin®, and the cells are then inoculated into T25 flasks (25 cm²) at 37°C, 5% CO₂. Primocin® is a broad-spectrum antibiotic commonly used in primary culture to prevent microbial contamination, particularly by mycoplasmas. It is used until the immortalization process.

[0114] Primary cell maintenance

[0115] Before immortalization, the isolated cells are cultured in T25 flasks containing DMEM medium (ref: L0104-500; Dutscher) and a PSA mixture (penicillin, streptomycin, amphotericin B; ref: P06-07300; PAN Biotech), and Primocin® (ref: ant-pm-1; InvivoGen). The medium is supplemented with uncomplemented fetal bovine serum (FBS, ref: P30-3306; PAN Biotech).

[0116] The cells adhere by forming confluence zones. They are then distributed uniformly in a new flask by subculturing.

[0117] Cell subculturing consists of removing the culture medium and disposing of the residual medium using 2 x 10 mL of PBS (ref: L0615-500; Dutscher). Trypsin IX (ref: X0930-100; Dutscher) is added (1 mL for T25 and 2 mL for T75) to break the bonds between the cells and the support. The flask is incubated for 5 minutes at 37°C / 5% CO2. The enzyme is then inactivated by adding complete culture medium (containing SVF) to bring the volume up to 10 mL. The cells are centrifuged for 5 minutes at 2000 rpm. The cell pellet is resuspended in 10 mL of medium and distributed into different flasks. This step is designated J0.

[0118] Immortalization of the first culture

[0119] On day 1, the sublingual and gustatory cells adhered and were transferred into A level 2 (L2) laboratory allows the handling of human pathogens. Cells are immortalized using lentiviruses encoding simian virus 40 (SV40) and human tert (h-TERT) (ref: CILV01 and CILV02 respectively; ALSTEM bio) according to the supplier's recommendations. The use of the telomerase catalytic subunit (tert) restores its activity within the cell and maintains telomere length, thus preventing cellular senescence. The advantage of this method is the preservation of the cell phenotype (Gire 2005). The T antigen of Simian Virus 40 is an oncogene that prevents cell death by inhibiting the p53 transcription factor (López et al. 2020).

[0120] These agents are solubilized in Lubrol (Hexadimethrin bromide ref. H9268; Merck) (1 mg / mL), facilitating the entry of the agents into the cell (4 pL / 64 pL of Lubrol / T25) by permeabilizing the membrane. The culture medium is replaced 24 h (D2) and 48 h (D3) after infection.

[0121] From day 3, the cells are cultured in medium without Primocin®. When the cells reach approximately 90% confluence, they are subcultured into a 75 cm2 flask (T75) according to the protocol ([Fig.3]).

[0122] Cell conservation

[0123] Freezing: At the end of cell subculturing, during the final centrifugation step, the pellet is homogenized in a preservation medium containing 90% FBS and 10% DMSO sterilized through a 0.2 pM filter. Cryotubes are prepared at a minimum concentration of 1 million cells / mL and are placed at -80°C for short- and medium-term use, from a few weeks up to 6 months. Beyond this period, some of the tubes are transferred to plates maintained at -195°C by liquid nitrogen.

[0124] Thawing: The cell ampoules are thawed according to the protocol ([Fig. 4]). The choice of flask after thawing will depend on the size of the pellet and the experimental requirement. Indeed, a large pellet can be transferred and distributed into T75 flasks, while a T25 flask will be preferentially used for a small pellet (1 million cells).

[0125] Immunofluorescence on cells

[0126] During the subculturing step, the cells are counted using a Malassez counting chamber and inoculated into a sterile, flat-bottomed, transparent 24-well plate in which 12 mm diameter coverslips (ref. 10040, KNITTEL, Dutscher) have been previously arranged and sterilized with 95% ethanol. The cells are incubated in 1 mL of complete DMEM medium per well at 37°C / 5% CO2. The following day, the morphology and confluence of the cells are checked. If they have adhered and are elongated, the fixation step is carried out; otherwise, an additional 24 hours are allowed.

[0127] The cells are washed three times with sterile PBS IX and then fixed with cold pure methanol (stored at -20°C) for 20 min at -20°C, so as to cover the coverslips. They are washed three times with TBS IX and incubated for 1 hour at room temperature in TBS 1X-10% FBS saturation buffer. After saturation, the coverslips are transferred to a humid chamber and approximately 50 pL of primary antibody is applied to each coverslip. The cells are incubated overnight at 4°C.

[0128] The following day, the cells are re-plated 24 times and then washed 3 times for 5 minutes in TBS IX and incubated for 1 hour at room temperature with the secondary antibody diluted 1 / 500th. In the case of monolabeling, the procedure is as follows: Proceed directly to nuclear staining with HOECHST 33342 (ref. 66249, Thermo Scientific) (10 min at room temperature) and slide and coverslip mounting (Fluoromount-G™, ref: 00-4958-02; Invitrogen). In the case of double staining, the steps of primary and secondary antibody incubation, nuclear staining, and histological section mounting must be repeated.

[0129] Calcium signaling - Preparation of buffers and reagents

[0130] - The probe: Fluo-4 DirectTM (ref: F10471, Molecular Probes®, InvitrogenTM).

[0131] The probe is prepared 2X according to the supplier's recommendations: the red probe or compound A (Fluo-4 Direct reagent) is solubilized using a vortex mixer (2 x 30 seconds) in 10 mL of Fluo-4 Direct calcium assay buffer. It is then aliquoted to a volume of 1 mL and stored at -20°C.

[0132] - Calcium buffers (pH 7.4)

[0133] [Tables3] 1OB % Calcium: Molar Concentration 0% Calcium Molar Concentration Molar Mass (mM) (mM) (g / mol) 110 110 58.44 5.5 :5.5 74.56 NaHCO3 25 25 84.01 as 0.8 203.3 K₂PO₄ 0.4 0.4 136.03 2H₂O | 0.33 0.33 177.39 CaCl₂ : 1.2 0 147.02 30 20 238.3 rᵣ 0 1 468.3

[0134] - Stimuli: Linoleic acid, Monosodium Glutamate (MSG)

[0135] Monosodium glutamate is dissolved and linoleic acid diluted in 0% calcium buffer. Stock concentrations are initially prepared: 2 mM and 10 mM for low and high concentrations, respectively (LA), and 4 M (MSG). The solutions to be injected are prepared at a concentration five times higher in 0% calcium buffer to account for the dilution factor (50 pL in 200 pL). A range of 0.78 to 800 pM linoleic acid and 25 to 800 mM monosodium glutamate is used to stimulate canine taste cells.

[0136] - Preparation of CD36 and GPR120 receptor inhibitors: SSO (ref. Sc-208408, Santa Cruz) and AH-7614 (ref. 5256, Tocris, Biotechne®) respectively.

[0137] The inhibitors are initially dissolved in DMSO at a concentration of 25.9 mM for SSO and 25 mM for AH-7614 according to the supplier's recommendations, then to a final 50 pM in 0% calcium buffer during cell incubation.

[0138] Calcium signaling - Plate preparation

[0139] At the end of the subculturing step, the cells are seeded and cultured in 24-well, flat-bottom, transparent, black-bordered plates (ref. 82426, Ibidi®) at a concentration of 10,000 cells / well. The following day, cell confluence and morphology are checked under a microscope.

[0140] The culture medium is removed and the cells are incubated for 1 hour at 37°C / 5%CO2 with 200 pL of Fluo-4 IX probe diluted in complete DMEM culture medium.

[0141] After incubation, the medium is removed and the cells are washed once with 200 pL of 100% calcium buffer and the stimulated well is incubated in 0% buffer while the other wells are kept in 100% buffer in order to limit cell stress.

[0142] Example of a 50 and 100 pM linoleic acid stimulation ([Fig. 5]): After removing the probe, all wells are washed with 200 pL of 100% calcium buffer. Wells Bl, Cl, and DI are then maintained in 100% buffer, while 200 pL of 0% buffer is injected into well Al ([Fig. 5] - step 1). The cells are stimulated after approximately 1 minute to allow the signal to stabilize. The 50 pL injection is performed using a 100 pL pipette. Recordings last on average 10 minutes, but it is preferable to significantly increase the time parameters to anticipate a possible response delay and thus signal loss.

[0143] At the end of the acquisition of the first well, the 100% calcium buffer in well B1 is replaced with 0% and the injection continues as before ([Fig. 5] - step 2). That is, the cells are stimulated after approximately one minute of signal stabilization. This sequence of steps is repeated until the last well ([Fig. 5] - steps 3-7).

[0144] Calcium signaling - Signal acquisition

[0145] Intracellular calcium release is measured using a Nikon Ti Eclipse microscope with a 40X S-fluor oil immersion objective. The microscope is set to the emission and excitation wavelengths of the Fluo-4 probe, which is similar to the FITC probe, namely 494 nm excitation and 516 nm emission. The signals are processed and recorded using NIS-Element AR software.

[0146] The cells are chosen randomly, taking care to ensure that they are not arranged in clumps. The recording is then stopped using the software's "stop" icon, and at least 8 cells are selected using the ROI (Region of Interest) tool. The intercellular space is defined as the background using the same tool. Fluorescence intensity is measured using the "time measurement" function, which records fluorescence intensity as a function of time with an exposure of 300 ms.

[0147] Calcium signaling - Signal acquisition in the presence of inhibitors

[0148] Regarding the use of inhibitors, the experiment is carried out according to the protocol ([Fig.6]):

[0149] The first incubation of well Al in 0% calcium buffer is necessary because the inhibitors are prepared in 0% calcium buffer. In order to observe only the effect of the inhibitor, it is necessary to proceed in this manner.

[0150] Calcium signaling - Acquisition processing

[0151] The raw results are recorded in Excel (.xls) format, and the difference in fluorescence intensity between the baseline state before injection and the maximum response (max-min) is exported to a PowerPoint file. Both are then analyzed using GraphPad Prism 9.0 software. Video capture is also performed to better visualize the release of intracellular calcium as a function of the different concentrations used. Two agonist concentrations are tested twice per 24-well plate column. This method reduces the time gap between concentrations for analysis. Indeed, a maximum of 8 minutes of recording and 5 minutes of data export are required for each concentration. Consequently, the next well remains in the 100% calcium buffer for 10 minutes, and the following well for 20 minutes.Although the cells are kept in 100% calcium buffer before injection, it would be more difficult to compare the first wells with the following ones ([Fig.7]). RT-qPCR

[0152] RT-qPCR was performed on previously isolated and immortalized canine taste and sublingual cells. Liver, ileum, and muscle tissue were provided by veterinarians from the Marshall company. Approximately 50 mg of tissue is used for RNA extraction. This tissue is stored at -80°C.

[0153] RNA extraction

[0154] Cell lysis: During the initial extractions, cell lysis was performed after subculturing the cells. A portion of the pellet was solubilized in 500 pL of Trizol (ref. 15596018; Thermo Fisher, USA). At this stage, lysis could be stopped, and the samples were stored at -80°C.

[0155] For subsequent extractions, cells were seeded in T25 flasks or 6-well plates until 100% confluence was achieved. After removing the culture medium, the cells were washed with PBS, and 500 pL of Trizol was added per well or flask. Scrapers (ref. 009902- Dutscher) were used to facilitate cell lysis by the Trizol. Finally, the cell lysate was transferred into 1.5 mL tubes (DNase and RNase-free) using a 1000 pL micropipette with a back-and-forth motion to complete cell lysis.

[0156] Tissue lysis: The first step is simply to transfer the samples into tubes (ref: E1420-2330 + ref of the caps: E1480-0100; StarLab) Compatible with the Precellys® 24 touch homogenizer (ref: P002391-P24T0-A.0; Bertin Technologies) using grinding beads (ref: 110791 lOsc; Biospec Products). The program used to lyse the samples is as follows: 4 cycles of 15 seconds of grinding at 6000 rpm + 30 seconds of ice break between each cycle (2 additional 30-second cycles can be added for grinding circumvallate papillae).

[0157] In both types of lysis, chloroform (200 pL) is added to the lysate. After centrifugation (12,000 g at 4°C) for 15 minutes, three distinct phases are obtained: the uppermost (translucent) phase containing the RNA is collected and precipitated after centrifugation with 500 pL of isopropanol. The RNA pellet is washed three times with 70% ethanol. The remaining ethanol is removed with a 100 pL pipette, and the pellets are dried for 30 minutes under a fume hood.

[0158] Quantification

[0159] RNA is quantified using a UV-visible nanophotometer (NanoPhotometer™ N50 touch; Implen™). The quality of the ribonucleic acid is verified by calculating the ratio of absorbances measured at 260 and 280 nm. A ratio between 1.8 and 2 is considered to indicate good quality. Next, reverse transcription is performed on 0.3–1 pg according to the manufacturer's recommendations (High-Capacity RNA-to-cDNA™, ref: 4387406; Thermo Fisher Scientific). Generally, reverse transcriptions have been performed on 1 pg of RNA. qPCR is performed with a quantity of cDNA of 10 ng / then for a final volume of 20 pL containing 10 pL of SyberGreen (2X iTaq™ Universal SYBR® Green Supermix; Biorad), 1 pL of 20X primer (PrimePCR™ SYBR® Green Assay; Biorad), 7 pL of RNase and DNase-free water and 2 pL of cDNA.

[0160] Bio-Rad primers are created by an algorithm and are provided without details. The sequence of the sense and antisense primers is not indicated on the tube. The specificity of the primers was therefore verified using the blastn nucleotide sequence alignment tool (Table 4). The query cover and percentage of identity are 100% for all primers except for the transcriptional amplification factor TEAD1 (SV40). Indeed, this factor is not recognized for the organism Canis lupus familiairis (taxid: 9615). Gene Reference (link) Amplified sequence Fragment size (bp) [Table CD36 TTATGATTTCATACTGTGCATGCAGATC Çpay.^ïaiCR AAAGGGAAAÆAGATAAGCAGTAAATG Assi-y «a TAï:îÀ5A ; AGAniAACCl TTAATGTACCAGCTACG 129 IJÈJaaa ..G.EGGa; AC AGGACCIG1G11 AC LAI 1GGCC 4AC AAGATAAAGACTTAATATGC • :> > ■; x ' •• > ■: GTCCACAAACTTCLACTGAGGCCTTO AAFCR GAGCAGGTCAlAAGCCTrGAGCTCTGT PLCB2 > -Ce.- atou GAAGGACGAGATGACATAACTTCGGTT Rrn-Rnd Cl TCTGGGCAGAGAGCTCGAAGGAGA H 9 1 1 I A 1 G A G v INA G ■ A ...... GGGGACATATCCAGGA.GCTGTGATTCT --------- .................. GLSTDIC1NE -GNAT3 ..... .. . . bivuua uik mjuiauiaauuia '7 ' ? ' '.oViXG'X'W'.GÜUiCVGAKii CCïTTCAA^UtAGGCCTGAACTCC 105 ..^xx.. ..... . CCGGGAGGGCAAGGGGTGGÏT1CTTTTI Where? gagGGCTGCACTAGAGGTAGGGGAAG • GTTGGTGTGTCCATAGGGCCTT GPR40FFAR1 lTML:Ja .àaiaaâ.1' LaL&üaa.œiCCCAAGTAGCCAGTCACCAGTGG ,v WVÎS GTTTAGCACCACGCTCCAAGœœ^ gægagccxcagittccgcca^ TCCTAKGCGGGGCGCAGGAAGCCAG CCACGTTGGAGGCATTGTAAGGTCCTA AGCAGAACAGCA 145 ACTIVE ACTIVE: F: Â>: Pimn-PCE J GCTGCArGAGTGAATTCCGAAGIATAA ATrFGCCCTGGCA X < \HG\] \t \< < il \>( 1 1 W Tt \ C BRI AAACTGGAALAA GCCTTTGAÆAAGAAATTTGTCCTTGAA 148 GCnGTAGATCAGCAGGAGAGA GPR43 FFAR2 .' : / Uvc •• : ï Âf-* G': GCCATTCTCACTTGTGACATCATTATGG ,v xV!^GTTGAGTTCCAGTACTGGCCGATGATC SJ?: ACGAI'GfHACAGTGAœGAAGGACAr uM 'Ci A<GGCGATC / GCCGATC Cj(.CitL\CV ( rrGCGGGACAGCT IGTACTGCACGGGGA 149 GRP120 FFAR4 - ^;À Aæiâal LrG..SAAiSA CGCACGCTCTTCCTŒTCATGATCTCCT TCTTC.ATTATGTGGAGC.CCCATCATCAT CACCAT^^CCAT^CCAT CTTCAAGCAAGACTrGGTCATCIGGCC 114 AFCC ATCTACTTCGTGCTGGGTCTCAGCAGCAGC GFRS4 ■ PœaePCR GTTCiGCGrCTTCTATTGCCTCATCCACC GPR84 Asssy «a<rRsiAAte i GCCAGGTGAAGCGAGCAGCCCAGGCG 111 1' 'A . ei(.> GAB'GC!-Af-..vU>CU:G< AAGCGT CCGC . 4] [Tables4] r « .... - « ............. Reference Gene (link) Amplified Sequence î'ailie fragment (pb) TAS1R2 ? CÏÜpî <î : ' TCC^GÂŒÂcUaWCCÂCTAC GTGCCCCGTGTGTTGGCœTCAT TGGCCCTGACAACTCCGAGTCCA CTACTACTGTGGCCCATTTCCTCT CACTCTTCCTCCTTCCACAGATC ACCTACAGCGCCATC 131 TAS1R3 . L Ôc 7. À . ~. .1 ;. ATGCTGGGCTACTTCATCACCTG GATCTCCTTTGTCCCTCTCTTTGC CAATGTGCAFGTGGCCTACCAGC CCACTGTGC:AG <GGCCG€’CATC 93 TAS1R1 •lÀb : jx.x ” Este Â? ;13 AC i A L9:;E3G CCAGCTGTATGACGTGTGCTCAG AGTCAGCCAATGTGTACGCCACA CTCAACGTACTCTCCACGCTGGG GACACATCACAIAGAGATCCAAG CAGACCCFTCCCACTATTCC 117 GC h-TERT GCAGGAGGATCTTGTAGATGTTG GTGCACACCGTCTGGAGGCTGTT CACCTGCAAATCCAGAAACAGG CTGTGACACIICAGCCGGAAGAC CCCAAAGAGTnGCGACGCATGT TCCTCCCAGCCTTGAAGCCGCGG T TGAAGGÏ G AG AC TGGC1C1 GAI' GGAGGTCCGGGCATAGCTGGA 181 SV40 TGCAG1AITCAGGATGATGCCGG GGCTTTTTATGGTGEAACGAGTC AGTACGAGAGCTCTGAAAACATG ACCGTCACCTGTTCCACCAAAGT GTGCTCCTTTGGGAAŒA 110 \ fv •''¥> "¥ Yx •• - • . ... CCTCTGCAACTTCGCCTCGGCGG zATGATTTCTACGATGACCCGTGTT M¥OD1 .A TCGACTCCCCGGACCTGCGTTTC TTCGAGGACCTGGACCCGC'GCCT 97 CGTG CI>34 TGGACGTGGCCTGGCCGGrCCCG ITCTCCTGAŒCCCTCCKHTCAC ACTGGCCTn'CCCTGAŒCTCAG GGGAGGCCCCAGGGCCTGAGCT AIAGCCCTGGCCTCCACCGTTC1' CCGTGTAAÏAAGGGTCTTCGCCC AGCCTT 143 PAX7 ùkS^:..THERE?A??.lA^ CCmGTCGCCCAGGATGCCATC GATCÆTGTGCTTGœTTTCTTCTC GCCGTCCTCCTCCTTCTTGTCCG CTTCGTCCTCCTCCTCTTTCTTCC CGAACTTGATTCTGAGCACGCGG CTAATCGAACTCACTAAACC 137 .

[0161] Table 4: Canine nucleotide sequences amplified by Bio-Rad primers.

[0162] The qPCR program was executed as follows: an enzymatic activation step at 95°C for 2 minutes. Then the denaturation and hybridization steps were carried out for 40 cycles, 5 seconds at 95°C and 30 seconds at 60°C respectively ([Fig.8]). Statistical Analysis

[0163] The results are analyzed using GraphPad Prism 9.0.0 software. The graphs are expressed as mean only (Calcium signal) and the histograms as mean ± SEM.

[0164] Spearman's correlation test was used because, according to the Agostino and Pearson test, the samples do not follow a normal distribution.

[0165] To compare mRNA expression in the different tissues (goblet papillae, fungiform papillae, and sublingual epithelium), a one-way ANOVA followed by Dunn's multiple comparison test was used. For immortalized cells, the Mann-Whitney U test was used on n=6 samples. A p-value less than or equal to 0.05 was considered statistically significant.

[0166] For all analyses except the preliminary results concerning the dose-response effect of monosodium glutamate, the experiments were performed 3 times. The mean of these independent experiments is used for the statistical analysis. Example 2: Results of Canine Taste Bud Characterization

[0167] Identification of the different types of taste bud cells - No correlation is observed between the number of circumvallate papillae and gender, age and body weight

[0168] Correlation tests were performed only on females, as the number of males was insufficient for this test. Among females, a moderate positive correlation was observed between the number of papillae and weight. Furthermore, it appeared that the number of papillae decreased as the dog aged ([Fig.9]).

[0169] Identification of the different types of taste bud cells - Morphology and identification of the different taste papillae in the Beagle tongue

[0170] A general diagram of the beagle's tongue was created based on the morphology of the different tongues observed (Fig. 10A). Circumvallate papillae are located in the first caudal third of the beagle's tongue (Fig. 10A). Modified conical papillae are also present around the circumvallate papilla (Fig. 10C). Simple circumvallate papillae consist of a single opening located in the center of the secondary papilla (Fig. 11A), in contrast to complex papillae, which have several openings (Fig. 11B). Fungiform papillae are surrounded by several filiform papillae, which are easily identifiable by their fin-like shape (Fig. 10D).

[0171] Identification of the different types of cells in the taste bud - Identification of circumvallate papillae and taste buds

[0172] Circumvallate papillae are identifiable by the deep groove (thick arrow) and an invagination in the center of the papilla (thin arrow) due to the presence of the secondary papilla (Figure 12A B). Unlike a circumvallate papilla with a simple structure ([Fig. 12] A), several invaginations can be observed in a complex structure ([Fig. 12] B). The taste buds (dotted lines) are located in the taste epithelium and more specifically in the primary groove of the papilla ([Fig. 12] CE). No buds are present in the taste epithelium of the secondary structure of the circumvallate papilla.

[0173] Identification of the different cell types of the taste bud - Different cell types are observed in the circumvallate papillae

[0174] GNAT3 is localized in certain canine taste cells ([Fig. 13] insert). There is no colocalization between the alpha subunit of gustducin and the type I markers GLAST and ENTPD2. GLAST appears to be expressed in the nucleus ([Fig. 13] B) compared to ENTPD2, which appears to be membrane-bound ([Fig. 13] C). Based on the fluorescence distribution within the buds, it would seem that type I cells are more numerous than type IL cells. The type III cell marker, SNAP25, is localized less specifically than the first two markers. In addition to being present in the taste buds, SNAP25 is also localized at the periphery of the papilla. Indeed, this marker is present in the gustatory epithelium, but its expression is not observed in the lamina propria ([Fig. 13] D).

[0175] Identification of the different types of cells in the taste bud - Taste and presynoptic cells are predominant in circumvallate papillae

[0176] No significant difference was observed in the expression of the type I markers GLAST and ENTPD2 between the circumvallate, fungiform, and sublingual epithelium. However, type II markers were significantly more highly expressed in the circumvallate papillae compared to the other two tissues. This was also the case for the presynaptic cell marker, SNAP25. PKD2L1 was highly expressed in the circumvallate papillae compared to the sublingual epithelium. However, no significant difference was observed between the circumvallate and fungiform papillae ([Fig. 14]).

[0177] Identification of lipid and glutamic (umami) taste receptors - Long and medium chain fatty acid receptors and T1R1 / T1R3 are present in circumvallate papillae

[0178] CD36 is expressed in taste buds compared to GPR120, which is expressed in the periphery ([Fig.15] A). The absence of fluorescence within the buds This allows for easy identification. Furthermore, the fluorescence intensity is greater on the apical side of the bud, i.e., at the papillary sulcus. Unlike these two receptors, GPR84 is absent in the taste buds (Figure 15A).

[0179] Regarding umami taste receptors, T1R1 is expressed both in the buds and in the taste epithelium. This expression is much less visible for T1R3 ([Fig. 15] B).

[0180] Identification of lipid and glutamic (umami) taste receptors - Beagle circumvallate taste cells express CD36

[0181] CD36 expression appears to be less specific compared to the previous labeling. CD36 and GNAT3 are colocalized within taste buds. It would seem that two additional cell types are present in the buds: cells expressing only CD36 and cells expressing only GNAT3. The difference in localization is more defined with regard to GPR120 and GPR84. Indeed, these receptors are expressed at the periphery of the buds compared to GNAT3. A high fluorescence intensity at the papillary lumen is also observed in the GPR120 / GNAT3 condition ([Fig. 16]).

[0182] Identification of lipid and glutamic (umami) taste receptors - Other cell types are identified outside of taste buds

[0183] CD36 and GNAT3 appear to be colocalized in the fossa of the circumvallate papilla ([Fig. 17] AE) and at the edge of the taste epithelium ([Fig. 18] AG). Some cells co-express both receptors ([Fig. 17] CE), while others are exclusively taste-expressing ([Fig. 17] AB). A fluorescence zone corresponding to GPR120 expression and the colocalization of CD36 and GPR120, respectively, delineates the circumvallate papilla ([Fig. 18] DG). GPR120 is localized along the entire length of the papilla, whereas CD36 is present only in the first basal third of the papilla's edge. In addition, all cells expressing CD36 are colocalized with GPR120, resulting in bright fluorescence, but some cells express only GPR120 ([Fig. 18] EG).

[0184] Identification of lipid and glutamic (umami) taste receptors - Expression of TIR receptors and long and medium chain fatty acids in the taste buds of beagles

[0185] Long- and medium-chain fatty acid receptors (cd36, gprl20, and gpr84), tlr, and tlr2 are more highly expressed in the circumvallate papillae compared to the sublingual epithelium. Although the difference in expression is not significant, gpr40, gpr43, and tlr3 appear to be more highly expressed in the circumvallate papillae compared to the other two tissues ([Fig. 19]).

[0186] Furthermore, no significant difference is observed between circumvallate and fungiform papillae for these receptors except with regard to the expression of cd36 and tlr2 ([Fig. 19]).

[0187] Identification of lipid and glutamic (umami) taste receptors - Unconventional localization of the T1 RI receptor

[0188] When the circumvallate papilla is monolabeled with the T1R1 receptor, a strong area of ​​fluorescence is observed in the lamina propria, below the primary sulci of the papillae. These structures, also observed when the slides are stained with hematoxylin and eosin ([Fig. 12]), appear to correspond to salivary glands. Moreover, this fluorescence intensity is greater in these glands compared to taste buds ([Fig. 20]).

[0189] Characterization of canine taste cells: development of the dTBC (dog taste buds cells) cell line

[0190] Canine primary taste cells express CD36 and GNAT3

[0191] Isolated and cultured taste cells are composed of cells taste buds and cells expressing CD36 ([Fig.21] A). In addition, they express CD36 which is predominantly located at the cell membrane ([Fig.21] B).

[0192] Immortalization and identification of taste receptors in dTBCs - Efficiency of canine taste cell immortalization

[0193] During immortalization, taste bud and sublingual cells were infected with two lentiviruses expressing htert and sv40. Furthermore, contamination by lingual muscle tissue can occur during papilla harvesting. Therefore, the presence of muscle cell markers was checked and compared to the muscle tissue. This tissue was also used as a negative control to verify cell infection.

[0194] Infection of taste cells with htert functioned significantly compared to sublingual epithelium and muscle tissue. However, sv40 was not expressed in any of the infected cells ([Fig. 22] A). The muscle markers myodl, cd34, and pax7 were not expressed in sublingual cells. Regarding the cell line, the expression of these genes was lower compared to muscle tissue, but not significant. Furthermore, MY0D1 was absent in taste cells of the cell line ([Fig. 22] insert).

[0195] Immortalization and identification of taste receptors in dTBCs - dTBCs are composed of different cell types

[0196] TRPM5 is expressed in the cytoplasm of dTBCs ([Fig. 23] A). Receptor taste cells appear to express the type I cell marker GLAST in the nucleus, while the other type I marker, ENTPD2, is absent in these cells. Regarding type III cells, two populations are identifiable by immunofluorescence, taste cells expressing SNAP25 at the membrane and cytoplasmic level and cells expressing only the type III marker ([Fig.23] B).

[0197] Immortalization and identification of taste receptors in dTBCs - dTBCs express lipid and glutamic taste receptors

[0198] The CD36 receptor and the glutamic receptors T1R1 and T1R3 are localized to the membrane and cytoplasm and are absent from the nucleus ([Fig. 24] A), in contrast to GPR 120 and GPR84, which are not specifically expressed within the cell. Indeed, the fluorescence intensity appears to be similar across the entire cell surface, in contrast to CD36, T1R1, and T1R3, where a higher fluorescence intensity is observed at the membrane. The localization of these receptors is specific compared to the negative controls ([Fig. 24] B).

[0199] Immortalization and identification of taste receptors in dTBCs - Colocalization of lipid receptors in canine taste cells (dTBCs)

[0200] The colocalization of the receptors CD36, GPR120, and the type II marker GNAT3 allows for the identification of different cell types. Indeed, some cells express both receptors or one of them. This is the case for taste cells (expressing GNAT3), which can express both CD36 at the membrane and cytoplasmic levels ([Fig. 25] A) or GPR120 at the nuclear level ([Fig. 25] B). Unlike monolabeling, nuclear expression of GPR120 is more visible with dual labeling with GNAT3 ([Fig. 24] A and [Fig. 25] C). In some cells, GPR 120 appears to be localized at the membrane level of cells expressing CD36, resulting in a brightly colored fluorescence zone ([Fig.25] C).

[0201] Immortalization and identification of taste receptors in dTBCs - Expression of cellular markers and lipid and glutamic taste receptors in dTBCs

[0202] The relative expression of mRNAs from the cell line (dTBC) was compared with isolated and immortalized sublingual cells.

[0203] Compared to immunofluorescence, entpd2 mRNA is significantly higher in gustatory cells compared to sublingual cells, while glast expression appears to be higher in these cells, but not significantly so. Among the type II markers, plcb2 and trpm5 are the only ones to be higher in gustatory cells. Snap25 is less expressed in dTBCs compared to sublingual cells, while the other type III cell marker, ppk2ll, appears to be higher in the cell line ([Fig. 26] A).

[0204] Although cd36 was identified by immunofluorescence in the cell line (Figures 16 and 17), mRNA expression is significantly lower in comparison to sublingual cells. Furthermore, gpr!20, gpr40 and gpr84 are more expressed in dTBC while the expression of gpr43 is higher, but not significantly ([Fig.26] B).

[0205] Among the TIR receptors, only tlr3, which is common to the sweet and umami taste modalities, is statistically expressed in the cell line. Indeed, the other two receptors, tlr and tlr2, appear to be more expressed, but not significantly ([Fig.26] C).

[0206] Study of the functionality of the dTBC cell line - Dose effect of linoleic acid in dTBCs

[0207] Immortalized taste cells respond very weakly, but not significantly, to stimulation with linoleic acid at concentrations of 6.25 pM and above. This response becomes statistically significant from 25 pM to 800 pM compared to the response at 12.5 pM. However, the differences are not significant between 25 and 800 pM linoleic acid. The responses from the two sets of independently performed experiments are relatively homogeneous ([Fig. 27] A). Although responses below 12.5 pM are not significant, an efficiency of 50% is observed at approximately 9 pM ([Fig. 27] B).

[0208] Without injection of linoleic acid, i.e. an injection of the 0% calcium buffer only, the absence of response results in a flat signal and an unchanged fluorescence intensity between the basal, post-injection and final phases ([Fig.28]).

[0209] Between 0.78 pM and 3.25 pM, the signal increases after injection and remains stable. This results in an increase in cell fluorescence, which remains stable after injection. From 6.25 pM, the fluorescence decreases slightly after the peak response has been reached. In some cells, this decrease is represented by a loss of fluorescence (circles). From 200 pM, the fluorescence intensity of the cells becomes similar to, or even lower than, the baseline state approximately 1 minute 30 seconds to 2 minutes after injection. The loss of cell fluorescence is also more pronounced. At 800 pM, the signal was prematurely stopped, which explains the absence of the onset of a post-injection plateau, although this is visible at 200 and 400 pM linoleic acid ([Fig. 28]).

[0210] Study of the functionality of the dTBC cell line - CD36 and GPR120 appear not to be involved in the release of intracellular calcium in response to an injection of linoleic acid

[0211] Although EC50 identified a concentration of 9 pM ([Fig.27] B), the inhibitors were used in the presence of 25 pM linoleic acid ([Fig.29]), because it was at this concentration that the effect of the fatty acid became significant ([Fig.27] A).

[0212] In the first series of experiments in the presence of inhibitors, the calcium response appeared to be decreased by AH-7614 and significantly by SSO. Furthermore, in In the presence of the CD36 inhibitor, the fluorescence intensity is unchanged after injection ([Fig. 29] A). The addition of both inhibitors increases the response, which is significantly higher compared to SSO and AH-7614 alone ([Fig. 29] B). Without inhibitors, the calcium response decreases after injection, whereas in the presence of both inhibitors and AH-7614 alone, this signal stabilizes ([Fig. 29] A).

[0213] Regarding the second experiment, the addition of the inhibitors individually or in combination did not alter the calcium response compared to the control condition ([Fig. 30] B). The only difference observed between these conditions was the presence of a plateau after injection for the control and SSO conditions compared to AH-7614 and SSO+AH-7614, where the signal decreased until fluorescence extinction occurred in some cells ([Fig. 30] A).

[0214] Study of the functionality of the dTBC cell line - Dose effect of monosodium glutamate in dTBCs

[0215] The release of intracellular calcium in immortalized canine taste cells following stimulation with monosodium glutamate was studied. Furthermore, measurements were performed in duplicate, i.e., a minimum of 16 responses per concentration in total.

[0216] Between 0 and 100 mM, MSG does not elicit any response in cells. From 200 mM to 800 mM, the calcium response increases significantly compared to the 100 mM concentration. Intracellular calcium release appears to be maximal at 800 mM but is not significant compared to 400 and 200 mM ([Fig. 31]).

[0217] Between 25 and 100 mM, the response profile is similar to that of the control condition (0 pM LA). That is, no difference in fluorescence intensity is observed after injection ([Fig. 32]). At 200 and 400 mM monosodium glutamate, the signal stabilizes 3 to 4 minutes after injection, resulting in an unchanged fluorescence intensity between the post-injection and terminal phases. Whereas at 800 mM, the response is immediate, and the fluorescence intensity is much greater compared to the basal cell state. This intensity decreases approximately 1 minute after injection ([Fig. 32]). Example 3: Conclusions

[0218] The tests and results presented indicate the research steps that led to the obtaining, isolation, and immortalization of canine taste cells according to the invention. These tests and results also demonstrate the ability of these canine taste cells to be used both in research, as a drug, in in vitro methods for screening biomolecules involved in canine taste signaling, in in vitro methods for analyzing the signaling response of canine taste cells to molecules to be tested, and in in vitro processes to identify molecules of interest with a view to modulating the signaling responses of canine taste cells.

Claims

Demands

1. Canine taste cells, said cells being the cells filed under CNCM number 1-6070 or canine taste cells derived from the cells filed under CNCM number 1-6070.

2. Canine taste cells according to claim 1, wherein the canine taste cells are immortalized and retain their phenotype in culture for at least 10 generations.

3. Canine taste cells according to claim 1 or 2, wherein the taste cells derived from the cells filed under CNCM number 1-6070 are genetically modified cells derived from the cells filed under CNCM number 1-6070.

4. Canine taste cells according to claim 3, wherein the genetically modified cells comprise in their genome at least one added nucleic acid molecule selected from the group consisting of a nucleic acid molecule encoding a protein taste receptor, a nucleic acid molecule encoding a hormone receptor, a nucleic acid molecule encoding a molecule involved in canine taste signaling, a nucleic acid molecule encoding a compound promoting anti-senescence and immortalization, and a nucleic acid molecule encoding an inhibitor.

5. Method for in vitro analysis of a signaling response of canine taste cells to a molecule involved in canine taste signaling, the method comprising the following steps: a. bringing canine taste cells according to any one of claims 1 to 4 into contact with said molecule involved in taste signaling, and b. determining the signaling response triggered by said molecule in the canine taste cells.

6. A method for the in vitro identification of an activator of a canine taste cell signaling response, the method comprising the following steps: a. bringing canine taste cells according to any one of claims 1 to 4 into contact with a molecule to be tested, b. the measurement of the signaling response triggered in the cells following contact according to step a), and c. the comparison between the signaling response measured in step b) and a known signaling response triggered in said canine taste cells according to any one of claims 1 to 4 by one or more known molecules, in which an identical or substantially identical signaling response between the signaling responses compared at the step c) indicates that the tested molecule is an activator of the signaling response of canine taste cells.

7. A method for the in vitro identification of a modulator of a canine taste cell signaling response, the method comprising the following steps: a. bringing canine taste cells into contact, according to any one of claims 1 to 4, with a known molecule that triggers a known signaling response in said canine taste cells and with a molecule to be tested, b. the measurement of the signaling response triggered in the cells following contact according to step a), c. comparison of the signaling response measured in step b) with the known signaling response triggered by said known molecule, in which a difference between the signaling responses compared in step c) indicates that the tested molecule is a modulator of the signaling response of canine taste cells.

8. A method according to any one of claims 5 to 7, wherein the signaling response is selected from: - intracellular calcium signaling, - the cellular membrane potential, - the release of neurotransmitters and / or hormones, - phosphorylation of protein kinase cascades, such as MAP kinases, protein kinase-C, preferentially downstream of the activation of a taste receptor.

9. Method for in vitro identification of a cellular biomolecule involved in a canine taste cell signaling response, the method comprising the step of detecting said cellular biomolecule within canine taste cells according to any one of claims 1 to 4.

10. In vitro identification method according to the preceding claim, wherein the detection step of said cellular biomolecule is carried out by immunofluorescence, by western-blot or by transgenesis (using a reporter gene).

11. Kit comprising canine taste cells according to any one of claims 1 to 4.

12. Canine taste cells according to any one of claims 1 to 4 for use as a medicinal product.

13. Use of canine taste cells according to any one of claims 1 to 4 for the in vitro screening of molecules involved in canine taste signaling.