Aav vector for use

Abstract

AAV vectors which encode for DNAJB1, particularly of a AAV9 serotype or variant thereof are claimed. The AAV vectors are used in a method of treatment of a disease, wherein the disease is ALS and / or F

Description

Background Frontotemporal dementia (FTD) and amyotrophic lateral sclerosis (ALS) are related neurodegenerative diseases characterised by degeneration of neurons in the brain and spinal cord which can co-occur and may present as ALS / FTD. ALS is the most frequent motor neuron disease whilst FTD is the second most common cause of early-onset dementia and most FTD patients die 5-10 years after symptom onset. In ALS, neuronal loss affects upper and lower motor neurons (MNs), leading to a rapidly progressive deterioration of muscle function and ultimately death due to respiratory failure. In FTD, frontal and temporal cortical neurons are preferentially lost, inducing cognitive impairment with language and behavioural changes. -50% of FTD cases and >95% of ALS cases are characterised by a mis-localisation of TDP-43 in the brain and / or spinal cord at post-mortem. The C9orf72 gene mutation provides a link between FTD and ALS. This mutation is characterised by a repeat expansion of (GGGGCC)n in the non-coding region of the C9orf72 gene, and is the most common genetic cause of both diseases. The non-ATG (RAN) translation of the expanded repeats can generate dipeptide repat proteins (DPRs) which are toxic to cells. This leads to three non-mutually exclusive potential disease mechanisms: 1) loss of function of wildtype C9orf72 protein, 2) toxicity of the repeat RNA and 3) toxicity of the dipeptide repeat protein generated by translation of the expanded repeat (Balendra and Isaacs., 2018). There is currently no cure for ALS, FTD and / or ALS / FTD, nor are there many effective therapies to reverse neuronal damage as the disease(s) progress. There is therefore a need for more effective treatment for ALS, FTD and / or ALS / FTD to improve outcomes and increase the quality of life for those diagnosed or at risk of developing the disease(s). Summary of Invention In a first aspect, there is provided an AAV vector which encodes for DNAJB1 for use in the treatment of a disease, wherein the disease is ALS and / or FTD. In a second aspect, there is provided a pharmaceutical composition comprising an AAV vector which encodes for DNAJB1 for use in the treatment of a disease, wherein the disease is ALS and / or FTD. In a third aspect, there is provided an AAV vector which encodes for DNAJB1 for use in the treatment of a disease, wherein the disease is characterised by accumulation of one or more dipeptide repeat proteins (DPRs). Also disclosed herein is a pharmaceutical composition comprising an AAV vector which encodes for DNAJB1 for use in the treatment of a disease, wherein the disease is characterised by accumulation of one or more dipeptide repeat proteins (DPRs). In a fourth aspect, there is provided an AAV vector that encodes for DNAJB1, particularly wherein the AAV vector is of AAV9 serotype or variant thereof (e.g., AAV PHP.eB). Also disclosed herein is a pharmaceutical composition comprising an AAV vector that encodes for DNAJB1, wherein the AAV vector is of AAV9 serotype or variant thereof (e.g., AAV PHP.eB). The present inventors demonstrate for the first time that an AAV vector encoding for DNAJB1 can rescue C9orf72 repeat toxicity and neurodegeneration. DNAJB1 overexpression was observed in mice after 6 months treatment supporting a therapeutic in vivo. An AAV vector encoding for DNAJB1 in accordance with this invention is found to significantly rescue neuronal loss in the cortex of (6462)149 mice, a reliable disease model for ALS and / or FTD. Since the C9orf72 mutation is the most common genetic cause for ALS / FTD, such AAV vectors can be used to provide an effective treatment for ALS and / or FTD. To the present inventor’s knowledge, an AAV vector expressing DNAJB1 for use in ALS / FTD has not been previously demonstrated, let alone in an in-vivo mouse model and certainly not in a C9orf72 mutation context. AAV9 mediated vectors were also shown to successfully express DNAJB1 in the cortex of mice. In support of this effect, it is also shown that overexpression of DNAJ1 (the orthologue of DNAJB1 in flies) was also found to extend the lifespan, improve the motor activity and reduce transcriptional alterations caused by neuronal expression of (6462)36 in adult flies. DNAJB1 was also found to extend the survival of 69orf72 patient human iPS6-motor neurons. The present inventors also provide data indicating that DNAJB1 can reduce the levels of dipeptide repeat proteins in mammalian cells, which can be formed by translation of the (666666) repeat. An AAV vector encoding for DNAJB1 was also found to reduce poly(6R) in the cortex of (6462)149 mice. Overexpression of DNAJB1 in HEK cells also led to a significant reduction in poly-(6R) and poly-(PR) and showed a more marked effect than DNAJB4 or DNAJB2a. This provides evidence that DNAJB1 can act through its canonical chaperone function to reduce the levels of toxic dipeptide repeat proteins. This provides support that an AAV vector encoding DNAJB1 can treat diseases associated with accumulation of dipeptide repeat proteins, including ALS and / or FTD. Described below are preferred embodiments of the aspects of the invention. In some embodiments, the ALS and / or FTD can be characterized by a mutation in the C9orf72 gene. In some embodiments, the mutation in the C9orf72 gene is characterized by a hexanucleotide repeat expansion (GGGGCC)nin the non-coding region of the C9orf72 gene, wherein n is >30. In some embodiments, n >100. In some embodiments, the C9orf72 mutation can be determined by genetic testing. In some embodiments or aspects, the ALS and / or FTD may be characterized by accumulation of one or more dipeptide repeat proteins (DPRs). In some embodiments, the DPRs comprise poly(GR), poly (GA), poly (GP), poly (PA), and poly (PR), or any combination thereof. In some embodiments, the dipeptide repeat proteins (DPRs) comprise poly(GR) and / or poly(PR). In some embodiments, the dipeptide repeat proteins (DPRs) comprise poly(GR). n some embodiments, the disease is FTD. In some embodiments, the disease is ALS. In some embodiments, the disease is FTD and ALS. In some embodiments, the disease is familial or sporadic. In some embodiments, the DNAJB1 is human DNAJB1. In some embodiments, the sequence which encodes for DNAJB1 is at least 90%, or at least 95%, or 100% identical with SEQ ID NO: 9. In some embodiments, the DNAJB1 is human DNAJB1. In the fourth aspect, and in an embodiment of the first, second and third aspects, the AAV is of an AAV9 serotype or variant thereof (e.g., AAV PHP.eB). In some embodiments, the AAV vector comprises a CAG promoter. In some embodiments, the AAV vector comprises a sequence with at least 95% sequence identity to SEQ ID NO: 13. In some embodiments, the AAV vector comprises a WPRE post-transcriptional element. In some embodiments, the AAV vector comprises a sequence, from 5- -> 3’, comprising a 5’-ITR sequence, a promoter, preferably a CAG promoter, a sequence encoding for DNAJB1, optionally a post-transcriptional regulatory element, preferably WPRE, a poly A signal, and a 3’-ITR sequence. Also disclosed herein, is a method of treating a disease, wherein the disease is ALS and / or FTD, the method comprising administering to a subject an effective amount of an AAV vector which encodes for DNAJB1. The AAV vector may be as described herein. Also disclosed herein is the use of an a AAV vector which encodes for DNAJB1 for the manufacture of a medicament for the treatment of ALS and / or FTD. The AAV vector may be as described herein. Also disclosed herein, is a method of treating a disease characterised by accumulation of dipeptide repeat proteins (DPRs), the method comprising administering to a subject an effective amount of an AAV vector which encodes for DNAJB1. In some embodiments, the DPRs comprise poly(GR), poly (GA), poly (GP), poly (PA), and poly (PR), or any combination thereof. In some embodiments, the dipeptide repeat proteins (DPRs) comprise poly(GR) and / or poly(PR). The AAV vector may be as described herein. Also disclosed herein is the use of an a AAV vector which encodes for DNAJBIfor the manufacture of a medicament for the treatment of a disease characterised by accumulation of dipeptide repeat proteins (DPRs). In some embodiments, the DPRs comprise poly(GR), poly (GA), poly (GP), poly (PA), and poly (PR), or any combination thereof. In some embodiments, the dipeptide repeat proteins (DPRs) comprise poly(GR) and / or poly(PR). In some embodiments, the dipeptide repeat proteins (DPRs) comprise poly(GR). The AAV vector may be as described herein. Also disclosed herein, is an AAV vector which encodes for DNAJB1 for use in the treatment of a disease characterised by a mutation in the C9orf72 gene. The AAV vector may be as described herein. Also disclosed herein, is a method of treating a disease characterised by a C9orf72 mutation, the method comprising administering to a subject an effective amount of an AAV vector which encodes for DNAJB1. The AAV vector may be as described herein. Also disclosed herein is use of an a AAV vector which encodes for DNAJBIfor the manufacture of a medicament for the treatment of a disease characterised by a mutation in the C9orf72 gene. The AAV vector may be as described herein. Also disclosed herein, is a method of reducing the toxicity of dipeptide repeat proteins (DPRs) in a cell, the method comprising administering to a cell an effective amount of an AAV vector which encodes for DNAJB1. In some embodiments, the cell may be a neuron cell (e.g., a neuronal cell), i.e., a motor-neuron cell. In some embodiments, the cell may be a glial cell. In some embodiments, the cell may be a brain glial cell and / or a spinal cord glial cell. In some embodiments, the DPRs comprise poly(GR), poly (GA), poly (GP), poly (PA), and poly (PR), or any combination thereof. In some embodiments, the dipeptide repeat proteins (DPRs) comprise poly(GR) and / or poly(PR). The method may be in vitro or in vivo. The AAV vector may be as described herein. Also disclosed herein, is a method of reducing toxicity caused by a mutation in the C9orf72 gene in a cell, the method comprising administering to a cell an effective amount of an AAV vector which encodes for DNAJB1, or a pharmaceutical composition comprising an AAV vector which encodes for DNAJB1. The cell may be a neuron cell (e.g., a neuronal cell), i.e., a motor-neuron cell. In some embodiments, the cell may be a glial cell. In some embodiments, the cell may be a brain glial cell and / or a spinal cord glial cell. The method may be in vitro or in vivo. The AAV vector may be as described herein. Also disclosed herein, is an AAV vector which encodes for DNAJB1 for use in the treatment of a disease characterised by TDP-43 proteinopathy and / or TDP-43 mislocalization. In some embodiments, the disease is ALS and / or FTD characterised by TDP-43 proteinopathy and / or TDP-43 mislocalization. The AAV vector may be as described herein. Also disclosed herein, is a method of treating a disease characterised by TDP-43 proteinopathy or TDP-43 mislocalization, the method comprising administering to a subject an effective amount of an AAV vector which encodes for DNAJB1. The AAV vector may be as described herein. Also disclosed herein is the use of an a AAV vector which encodes for DNAJB1 for the manufacture of a medicament for the treatment of a disease characterised by TDP-43 proteinopathy or TDP-43 mislocalization. The AAV vector may be as described herein. Brief Description of Figures Figure 1 A+B shows a control AAV vector and an example AAV vector of PHP.eB serotype. The Example AAV vectors are used to express DNAJB1 in vivo. Figure 1C shows an example AAV9 vector detailed in Example 2. The ITR is an Inverted Terminal Repeat of AAV2, WPRE is the Woodchuck hepatitis virus Posttranscriptional Regulatory Element. Figure 2 shows overexpression of DnaJ-1, the Drosophila orthologue of DNAJB1 rescues multiple phenotypes in C9orf72 repeat Drosophila. (A) A primary screen was carried out by crossing males from each of 2048 FlyORF over-expression lines to virgin females UAS-36R; elavGS. 100 lines were screened at a time, and a control line was run with each cohort. The lifespan of 100 female offspring for each line were scored for 12 days. 188 suppressors were identified. A secondary screen of the 188 suppressor lines identified in the primary screen was performed to confirm suppression. 58 lines still showed strong suppression in the secondary screen. The 58 lines were backcrossed for 6 generations to a homogeneous background to remove any potential effects of genetic background on survival. Backcrossed lines were then crossed to C9 expressing flies and full lifespans were carried out, where 120-150 flies were screened per line, and the lifespans were run to completion. 19 lines overexpression lines, including DnaJ-1 still showed suppression. These 19 genes are highly reproducible and robust suppressors of C9orf72 repeat toxicity in Drosophila. (B) Survival curves of female C9 expressing flies with and without DnaJ-1 (N>120 per line) shows that DnaJ-1 significantly extends the survival of C9 flies, p=4.5E-59, log-rank test. (C) Survival curves of female GR36 expressing flies with and without DnaJ-1 (N>120 per line) shows that DnaJ-1 significantly extends the survival of GR366 flies, p=3.1E-40, log-rank test. (D) Survival curves of control female flies expressing DnaJ-1 (N>120 per line) shows DnaJ-1 does not extend the survival of control flies. (E) Total activity counts of female C9 expressing flies with and without DnaJ-1 at day 7 (N=32 per line). The transgenes (C9 and DnaJ-1) are driven by the elav-GeneSwitch neuron-specific inducible driver, which is switched on using Rll. When the C9 repeat transgene is turned on (C9 +RU), locomotor activity is reduced as compared to control flies in which the C9 repeats are not turned on (C9-RII). Over-expression of DnaJ-1 (09 + DnaJ1 +RU) restoes locomotor activity. *p=0.032, ****p<0.0001, ANOVA.. (F) Proportion of fly brain cells where Drosophila TDP-43 (dTDP-43) is mis-localised to the cytoplasm after 7 days of induction of expression of 09 repeats (+RU) and their control (-RU), without and with co-expression of DnaJ-1. Expression of 09 repeats (C9+RII) cases mis-localisation of dTDP-43, which is rescued by over-expression of DnaJ-1 (09 + DnaJ1 +RU). *p<0.05, ANOVA (G) Survival curves of female 09 expressing flies with and without human DNAJB1 (two independent human DNAJB1 expressing lines, N>120 per line) shows that both DNAJB1 overexpression lines significantly extend the survival of 09 flies. Line 1 p=0.002, line 2 p=0.02. Figure 3 shows DNAJB1 overexpression rescues excitotoxicity in C9orf72 repeat patient iPSC-motor neurons. C9orf72 patient iPSCs were differentiated into motor neurons as described in (Selvaraj et al., 2018) and transduced with lentiviruses (LV) expressing DNAJBI-mApple or mApple as a control on day 16 of differentiation. After 3 weeks of differentiation the motor neurons were labelled with 4pM Calcein-AM (Invitrogen) for 5 min and imaged using Zeiss Observer Z1. This was followed by treatment for 24 hours with either AM PA (100 pM), to cause AMPA-induced excitotoxicity, or AMPA / CNQX (30 pM). CNQX is a specific AMPA receptor antagonist which prevents excitotoxicity thus confirming the specificity of the cell death as AMPA-induced excitotoxicity. Following treatment, cells were labelled again with Calcein AM and reimaged. Cell counts (double positive for Calcein and m-Apple) before and after treatment were analyzed using Imaged. AMPA induced a significant increase in cell death in the C9orf72 patient line that is significantly reduced by DNAJB1 but not the mApple control. N= 3 biological replicates from one patient line, one-way ANOVA with Dunnett’s multiple comparisons test, Shapiro-Wilk normality test. In the bar graph, the left-most bar corresponds to no LV, the middle bar corresponds to an mApple LV and the right-most bar corresponds to a DNAJB1 LV. Figure 4 shows the successful over-expression of human DNAJB1 in the mouse brain 6 months after P0 injection of an example AAV vector. (A) Experimental paradigm: neonatal C57BL / 6J pups received intracerebroventricular co-injections of G4C2 repeat and either DNAJB1 or control tdTomato expressing AAVs at post-natal day 0 (P0). Six months after P0 injection, cortical samples were collected for analysis. ITR = Inverted Terminal Repeat of AAV2, WPRE = Woodchuck hepatitis virus Posttranscriptional Regulatory Element. (B) Representative immunoblots of tdTomato protein expression in cortical samples of 6-month-old mice, p-actin shown as loading control. Note that tdTomato generated by the DNAJB1 constructs also contain the P2A sequence so runs at a higher molecular weight. (C) Protein quantification of tdTomato levels in the cortex of 6-month-old PBS-injected and AAV-treated mice via immunoblotting (n=4-6 per group, run in duplicate). (D) mRNA quantification of tdTomato levels normalised to p-actin in the cortex of 6-month-old PBS-injected and AAV-treated mice (n=6 per group, run in duplicate). (E) Representative immunoblots of DNAJB1 protein expression in cortical samples of 6-month-old mice, p-actin shown as loading control. Note that the antibody recognises endogenous mouse DNAJB1 in the PBS and tdTomato groups, and there is a clear increase in the DNAJB1-injected groups indicating the additional presence of over-expressed human DNAJB1. DNAJB1 is connected to tdTomato via a selfcleaving P2A tag. After cleavage DNAJB1 runs at the expected molecular weight of 40kDa. A small proportion does not cleave giving rise to the larger uncleaved tdTomato-P2A-DNAJB1 band at 70 kDa. (F) Protein quantification of DNAJB1 levels in the cortex of 6-month-old PBS-injected and AAV-treated mice via immunoblotting (n=9-14 per group, run in duplicate). (G) mRNA quantification of DNAJB1 levels normalised to p-actin in the cortex of 6-month-old AAV-treated mice (n=6 per group, run in duplicate). Data represented as mean ± SEM. All results shown are compared to the mean of PBS controls. Both immunoblot and qPCR data were analysed using one-way ANOVA test (two-tailed) in GraphPad Prism (version 9.4.1). *p< 0.05, **p< 0.01, ***p< 0.001. Figure 5 shows that human DNAJB1 is highly expressed in cortical neurons of treated mice at 6-month-old. (A) Representative confocal images of immunofluorescence staining showing neuronal marker NeuN and human DNAJB1 in the cortex of treated mice at 6 months of age. Scale bar = 50 pM (20x magnification). (B) Percentage of human DNAJBI-positive neurons in the cortex of 6-month-old injected mice. (n=5-6 per group). Data represented as mean ± SEM. Data analysed using Kruskal-Wallis with Dunn’s post-hoc multiple comparisons test (two-tailed) in GraphPad Prism (version 9.4.1). nsp> 0.05, *p< 0.05, **p< 0.01. Figure 6 shows that DNAJB1 rescues neurodegeneration in the cortex of 6-month-old (6462)149 mice. (A) Representative cortical images of neuronal marker NeuN immunostaining in 6-month-old mice. Scale bar = 15 pM (20x magnification). (B) Quantification of NeuN-positive cells in the cortex of PBS-injected and AAV-treated mice at 6 months of age (n=9-13 mice per group). Data represented as mean ± SEM. Data analysed using One-way ANOVA with Tukey’s post-hoc multiple comparisons test (two-tailed) in GraphPad Prism (version 9.4.1). nsp> 0.05, *p< 0.05, **p< 0.01, ***p< 0.001, ****p< 0.0001. (C) Quantification of poly(GR) in the cortex of PBS-injected and AAV-treated (6462)149 mice shows that DNAJB1 significantly reduced poly6R levels. Figure 7 shows that DNAJB1 reduces poly6R in HEK cells overexpressing sense 666666 repeats. Here, a previously described nanoluciferase reporter assay was utilised in which 92 666666 repeats were tagged with NanoLuciferase in the poly6R frame (S92R-NL) (as described in https: / / pubmed.ncbi.nlm.nih.gov / 33739284 / and WO2022219200A1). S92RNL was co-transfected in HEK cells with firefly luciferase (FLuc) as a transfection efficiency control and either DNAJB1, DNAJB2a, DNAJB4 or 6FP as a control. Data were normalised to FLuc and compared to the 6FP negative control. DNAJB1 gave the most potent reduction of poly6R levels. N=3 independent biological replicates. Figure 8 shows that DNAJB1 reduces polyPR in HEK cells overexpressing antisense 666666 repeats. Here, a previously described nanoluciferase reporter assay was utilised in which 55 666666 repeats were tagged with NanoLuciferase in the polyPR frame (AS55RNL) described in WO2022219200A1). AS55RNL was co-transfected in HEK cells with firefly luciferase (FLuc) as a transfection efficiency control and either DNAJB1, DNAJB2a, DNAJB4 or 6FP as a control. Data were normalised to FLuc and compared to the 6FP negative control. DNAJB1 gave the most potent reduction of poly6R levels. N=2 independent biological replicates. Figure 9 shows an example AAV9-mediated human DNAJB1 expression in the mouse cortex. The 6A6-DNAJB1 construct, detailed in Example 2, was packaged into AAV9 and delivered to mice via P0 I6V injection. A. Quantification of total DNAJB1 protein levels in the cortex were quantified by first normalising to p-actin and then to the PBS control (n=2-4 mice per group) B. Representative immunoblot showing successful DNAJB1 overexpression in the cortex of AAV-injected mice compared to PBS mice. C. Quantification of human DNABJ1 in neuronal cells in the cortex of either PBS or 1x1010 tot vg DNAJB1-injected mice (n=3 mice per group). D. Representative images of immunofluorescence staining showing co-localisation between human DNAJB1 and neuronal marker NeuN in the cortex of either PBS or AAV-injected mice. DAPI stains nuclei. Scale bar represents 100 pm. Data shown as mean ± SD. Detailed Description Although any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred embodiments, materials and methods are now described. Other features, objects and advantages of the disclosure will be apparent from the description. In the description, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs unless stated otherwise. For any sequence described herein, the complementary sequence or reverse complement is also implicitly disclosed and considered part of the disclosure. The terms "treatment" and "treating" herein refer to an approach for obtaining beneficial or desired results in a subject, which includes a prophylactic benefit and a therapeutic benefit. “Therapeutic benefit” refers to eradication, amelioration or slowing the progression of the underlying disorder being treated. Also, a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the subject, notwithstanding that the patient may still be afflicted with the underlying disorder. “Prophylactic benefit” refers to delaying or eliminating the appearance of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, halting, or reversing the progression of a disease or condition, or any combination thereof. In the context of the present invention, the prophylactic benefit or effect may involve the prevention of the condition or disease. The AAV vector or pharmaceutical composition described herein may be administered to a subject at risk of developing a disease described herein, or to a subject reporting one or more of the physiological symptoms of a disease described herein, even though a diagnosis of this disease may not have been made. The term "effective amount" or "therapeutically effective amount" refers to the amount of the AAV or pharmaceutical composition needed to bring about an acceptable outcome of the therapy as determined by reducing the likelihood of the disease as measurable by clinical, biochemical or other indicators that are familiar to those trained in the art. The therapeutically effective amount may vary depending upon the condition, the severity of the condition, the subject, e.g., the weight and age of the subject and the mode of administration and the like, which can readily be determined by one of ordinary skill in the art. The term "subject" refers to any suitable subject, including any animal, such as a mammal. In preferred embodiments described herein, the subject is a human. In some embodiments, the subject may be a test subject, e.g., selected from mouse, a rat, a canine, a pig, a non-human primate or a guinea pig. The term "comprising" (and related terms such as "comprise" or "comprises" or "having" or "including") includes those embodiments, for example, an embodiment of any composition of matter, composition, method, or process, or the like, that "consist of” or "consist essentially of” the described features. The term “comprises” or “comprising” can be used interchangeably with “includes”. The term “vector” refers to any vehicle that can be used to deliver the nucleic acid material of interest (i.e., DNAJB1) into cells. The term “AAV vector” refers to an adeno-associated virus vector which is used as a delivery mechanism for gene therapy. The AAV vector used may be of any suitable serotype. Preferably, as exemplified herein, the AAV vector is of AAV9 serotype or a variant thereof. In other words, the AAV vector comprises an AAV9 capsid or an AAV9 variant capsid. The term “identical” and “identity” refers to the overall relatedness between polymeric molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of the percent identity of two polynucleotide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, in a preferred embodiment, the percent identity between two nucleotide sequences can be determined using an alignment algorithm, e.g., such as BLAST sequence analysis tool. The term “encode” refers broadly to any process whereby the information in a polymeric vector is used to direct the production of a second molecule that is different from the first. In the context of this invention, an AAV vector that encodes for DNAJB1 refers to an AAV vector comprising a gene (which can also be referred to as a transgene) which specifies the sequence of amino acids for the DNAJB1 protein. The term “expression” of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5' cap formation, and / or 3' end processing); (3) translation of an RNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein. The C9orf72 gene, otherwise known as chromosome 9 open reading frame 72, refers to a gene which encodes for the C9orf72 protein. In humans, the C9orf72 gene is located on the short arm of chromosome 9 open reading frame 72, from base pair 27, 546, 546 to base pair 27, 573, 866 (GRCh38). Its cytogenetic location is at 9p21.2. The C9orf72 mutation disclosed herein refers to a mutation in the non-coding region of the C9orf72 gene starting at 27,573,546. The C9orf72 mutation is implicated in ALS and / or FTD. In some embodiments, the mutation is translated by a non-ATG mechanism. TDP-43 mislocalization disclosed herein refers to mislocalization of TDP-43 in a cell away from the nucleus to the cytoplasm. TDP-43 proteinopathy disclosed herein refers to nuclear depletion of the TDP-43 protein in a cell. AAV vector The AAV vector described herein encodes for DNAJB1 (i.e., the AAV vector comprises a sequence that encodes for DNAJB1). DNAJB1 may be otherwise be known and referred to as DNA J Heat Shock Protein Family (Hsp40) Member B1, DNAJ1 or HSP40 in the art. The sequence which encodes for DNAJB1 may otherwise be referred to as a DNAJB1 gene or DNAJB1 transgene, therefore, the AAV vector described herein may otherwise be described as an AAV vector comprising a DNAJB1 gene or DNAJB1 transgene. In the cell and / or subject, the sequence which encodes for DNAJB1 is transcribed to mRNA, and the mRNA is then translated to form the DNAJB1 protein. In some embodiments, the AAV vector may encode for human DNAJB1 (i.e., the AAV comprises a sequence that encodes for human DNAJB1). In some embodiments, the AAV vector may encode for full-length human DNAJB1. In some embodiments, the AAV vector may comprise a sequence that encodes for all coding regions of DNAJB1. In some embodiments, the AAV vector for use may encode for a sequence that comprises a sequence which is at least 90% identical, or at least 91% identical,, or at least 92% identical,, or at least 93% identical,, or at least 94% identical,, or at least 95% identical,, or at least 96% identical,, or at least 97% identical,, or at least 98% identical,, or at least 99% identical, or at least 99.5% identical, or is identical to SEQ ID NO: 2 and / or SEQ ID NO: 9. In some embodiments, the AAV vector for use may encode for a sequence that comprises a sequence which is at least 90% identical, or at least 91% identical,, or at least 92% identical,, or at least 93% identical,, or at least 94% identical,, or at least 95% identical,, or at least 96% identical,, or at least 97% identical,, or at least 98% identical,, or at least 99% identical, or at least 99.5% identical,, or is identical to SEQ ID NO: 9. The AAV typically comprises a 5’-ITR at the start of the vector and a 3’-ITR at the end of the vector. Any suitable 5’-ITR and 3’-ITR sequences may be used. In some examples, the 5’-ITR and 3’-ITR are from AAV2. In some embodiments, the 5’-ITR has at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO: 4 or is identical to the sequence defined in SEQ ID NO: 4. In some embodiments, the 3’-ITR has at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO: 12, or is identical to the sequence defined in SEQ ID NO: 12. The AAV vector may comprise any suitable promoter, or promoter and enhancer, i.e., upstream of DNAJB1. In some embodiments, the AAV vector may comprise a cytomegalovirus enhancer element, e.g., with at least 95%, sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO 6, or identical to the sequence defined in SEQ ID NO 6. In some embodiments, the AAV vector may comprise the Chicken p-actin promoter, e.g., with at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO 7, or identical to the sequence defined in SEQ ID NO: 7. In some embodiments, the AAV vector may comprise an artificial / chi meric intron, e.g., upstream of DNAJB1. Any suitable artificial / chimeric intron may be used. In some embodiments, the chimeric intron may have at least 95 % sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO 8, or is identical to the sequence defined in SEQ ID NO: 8. The chimeric intron selected led to good expression of DNAJB1. In some embodiments, the AAV vector comprises SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8. In some embodiments, the AAV vector comprises the CAG promoter, e.g., which comprises a combination of the cytomegalovirus enhancer element, the first exon and the first intron of the chicken beta-actin gene and (G) the splice acceptor of the rabbit-beta-globin gene. In some embodiments, the AAV vector comprises a post-transcriptional regulatory element, i.e., downstream of DNAJB1. Any suitable post-transcriptional regulatory element may be used. In some examples, the post-transcriptional regulatory element is the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, the AAV vector may comprise WPRE, e.g., with at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO 10, or is identical to the sequence defined in SEQ ID NO: 10. It is preferred that WPRE is present, as this is included to enhance the expression of DNAJB1. In some embodiments, the AAV vector comprises a polyA signal, i.e., downstream of DNAJB1. Any suitable polyA signal may be used. The polyA signal may be downstream of the post-transcriptional regulatory element. In an example, the polyA signal is a SV40 polyA signal (simian virus 40 polyA signal). In some embodiments, the AAV vector may comprise the SV40 Poly A signal, e.g., with at least 95% sequence identity, or at least 96% sequence identity, or at least 97% sequence identity, or at least 98% sequence identity, or at least 99% sequence identity to SEQ ID NO 11, or is identical to the sequence defined in SEQ ID NO: 11. In some embodiments, the AAV vector encodes only for the DNAJB1 protein. In some embodiments, the AAV vector may also comprise a sequence that encodes for a second protein, different to DNAJB1. This is an optional feature, and in some preferred embodiments, (e.g., in a AAV vector used for therapy), the AAV does not encode for a second protein different to DNAJB1 (i.e., the AAV vector encodes only for DNAJB1). In some embodiments, the second protein is a diagnostic protein. In some embodiments, the diagnostic protein is selected from a fluorescent protein, a luminescent protein, or a protein with a detectable antibodybinding tag. This is such that the vector can be monitored (e.g., visually in a cell). In some embodiments, the diagnostic is fluorescent protein. Any suitable fluorescent protein may be used. In some embodiments, the fluorescent protein is a green fluorescent protein (GFP), yellow fluorescent protein (YFP) or red fluorescent protein (RFP). In an example, the fluorescent protein is TdTomato. In such embodiments where the AAV encodes for a second protein, the AAV may further comprise a self-cleaving peptide. Any suitable self-cleaving peptide may be used. In an example, the self-cleaving peptide is a P2A self-cleaving peptide. In some embodiments, (e.g., in the AAV vector used for therapy), the AAV does not comprise a self-cleaving peptide. In some embodiments, the AAV vector may comprise an epitope tag, e.g., for detection and / or purification of the AAV vector. Any suitable epitope tag may be used. In an example, the epitope tag is a V5 tag. In some embodiments, the AAV does not comprise an epitope tag. The AAV vector may be of any suitable serotype. Preferably, the serotype is of AAV9 serotype or a variant thereof (e.g., AAV PHP.eB). AAV9 and variants thereof are preferred as they have higher expression than other serotypes (e.g., AAV5) in the brain. In some embodiments, the AAV vector comprises dsDNA, e.g., circular dsDNA. In some embodiments, the AAV vector comprises or encodes for ssDNA, e.g., linear single-stranded DNA (ssDNA) AAV vector. In some embodiments, the AAV vector comprises a sequence that is at least 90% identical, or at least 91% identical, or at least 92% identical, or at least 93% identical, or at least 94% identical, or at least 95% identical, or at least 96% identical, or at least 97% identical, or at least 98% identical, or at least 99% identical to SEQ ID NO: 13, or is identical to SEQ ID NO: 13. In an example described herein, the AAV vector is of serotype AAV9. In an example described herein, the AAV vector is of serotype AAV PHP.eB. The AAV vector may be of any suitable size. In some embodiments, the AAV vector (i.e., from ITR to ITR) has a size of greater than 1800 bp, or greater than 2000 bp, or greater than 2500 bp, or greater than 3000 bp, or greater than 3500 bp. In some embodiments, the AAV vector has a size less than 4000bp. In some embodiments, the AAV vector has a size between 1800 bp to 5500 bp, and in some examples between 3000 and 4000 bp, or from 3500 bp to 4000 bp. In some embodiments, the AAV vector comprises a sequence from 5’ -> 3’ comprising: A 5’-ITR sequence, e.g., an AAV2 ITR sequence, e.g., SEQ ID NO: 4 A sequence encoding for DNAJB1, e.g., SEQ ID NO: 9 A 3’-ITR sequence, e.g., an AAV2 ITR sequence, e.g., SEQ ID NO: 12. In some embodiments, the AAV vector comprises a sequence from 5’ -> 3’ comprising: A 5’-ITR sequence, e.g., an AAV2 ITR sequence such as SEQ ID NO: 4 A sequence encoding for DNAJB1, e.g., SEQ ID NO: 9 A poly A signal, e.g., SEQ ID NO: 11 and A 3’-ITR sequence, e.g., an AAV2 ITR sequence, e.g., SEQ ID NO: 12. The AAV vector is preferably of AAV9 serotype or variant thereof. In some embodiments, the AAV vector comprises a sequence from 5’ -> 3’ comprising: A 5’-ITR sequence, e.g., an AAV2 ITR sequence, such as SEQ ID NO: 4 A promoter sequence, e.g., a CAG promoter, such as comprising SEQ ID NO: 6 and 7 A sequence encoding for DNAJB1, e.g., SEQ ID NO: 9 A poly A signal, e.g., SEQ ID NO: 11 and A 3’-ITR sequence, e.g., an AAV2 ITR sequence, e.g., SEQ ID NO: 12. The AAV vector is preferably of AAV9 serotype or variant thereof. In some embodiments, the AAV vector comprises a sequence from 5’ -> 3’ comprising: A 5’-ITR sequence, e.g., an AAV2 ITR sequence, such as SEQ ID NO: 4 A promoter, e.g., a CAG promoter, such as comprising SEQ ID NO: 6 and 7 A sequence encoding for DNAJB1, e.g., SEQ ID NO: 9 A post-transcriptional regulatory element, e.g., WPRE, such as comprising SEQ ID NO: 10 A poly A signal, e.g., SEQ ID NO: 11 and A 3’-ITR sequence, e.g., an AAV2 ITR sequence, e.g., SEQ ID NO: 12. The AAV vector is preferably of AAV9 serotype or variant thereof. In some embodiments, the AAV vector comprises a sequence from 5’ -> 3’ comprising: A 5’-ITR sequence, e.g., an AAV2 ITR sequence, such as SEQ ID NO: 4 A promoter, e.g., a CAG promoter, such as comprising SEQ ID NO: 6 and 7 A chimeric intron, e.g., comprising SEQ ID NO: 8 A sequence encoding for DNAJB1, such as SEQ ID NO: 9 A post-transcriptional regulatory element, e.g., WPRE such as SEQ ID NO: 10 A poly A signal, e.g., SEQ ID NO: 11 and A 3’-ITR sequence, e.g., an AAV2 ITR sequence, e.g., SEQ ID NO: 12. The AAV vector is preferably of AAV9 serotype or variant thereof. In some embodiments, the AAV vector forms part of a plasmid, and / or is a pAAV vector. In some embodiments, the plasmid comprises a sequence that is at least 90% identical, or at least 91% identical, or at least 92% identical, or at least 93% identical, or at least 94% identical, or at least 95% identical, or at least 96% identical, or at least 97% identical, or at least 98% identical, or at least 99% identical to SEQ ID NO: 14, or is identical to SEQ ID NO: 14. The combination of one or more or all of the above sequence elements is particularly effective, as demonstrated in the application Examples in combination with an AAV9 serotype or variant thereof. These example AAV vectors were shown to (i) effectively express DNAJB1 in the brain of test subjects, and (ii) effectively rescue C9orf72 repeat toxicity and neurodegeneration. Disease The AAV vector and pharmaceutical composition disclosed herein are for use in a method of treatment of a disease. In some embodiments, and in the first aspect of the present invention, the disease is ALS and / or FTD. In some embodiments, the disease is ALS. Amyotrophic lateral sclerosis (ALS) defined herein may be otherwise known as motor neuron disease (MND) or Lou’ Gehrig’s disease. The non-exhaustive symptoms of ALS may include one or more of muscle weakness, muscle atrophy, muscle cramps, spasticity (i.e., tight and stiff muscles) muscle twitches, muscle wasting, dementia, slurred speech, dysphagia (i.e., difficulty swallowing), dysarthria (i.e., difficulty speaking or forming words) respiratory problems and respiratory failure. In some embodiments, the AAV vector or pharmaceutical composition for use reverses one or more of these symptoms. In some embodiments, the ALS may be familial ALS or sporadic ALS. In some embodiments, the ALS is characterised as classic ALS, primary lateral sclerosis (PLS) or progressive muscular atrophy (PMA). ALS may be diagnosed by an experienced clinician, electromyogram, by a nerve conduction study, by MRI, by blood and urine tests, by lumbar puncture, a muscle biopsy, a nerve biopsy, or by genetic testing (e.g., by detecting the C9orf72 mutation). In an embodiment, the ALS may or may not be an ALS-FUS and ALS-SOD1 form of ALS which are genetically-defined forms of ALS. ALS-FUS and ALS-SOD1 ALS may be determined by genetic testing. In some embodiments, the disease is FTD. Frontotemporal dementia (FTD) defined herein may otherwise be known as frontotemporal degeneration disease (FTDD) or frontotemporal neurocognitive disorder, Pick’s disease, primary progressive aphasia, progressive aphasia, and semantic dementia. Frontotemporal dementia (FTD) may include frontotemporal lobar degeneration (FTLD). The non-exhaustive symptoms of FTD may include one or more behavioural and personality changes, impaired judgement, neuronal loss, repetitive or obsessive behaviours, language problems, memory problems distractibility, increasing dependence, frequent mood changes, lack of organisation food cravings, loss of inhibition, a loss of motivation, apathy, a lack of empathy and / or physical symptoms such as slow or stiff movements, incontinence, muscle weakness and / or difficulty swallowing. In some embodiments, the FTD may be familial FTD. In some embodiments, the FTD may be sporadic FTD. In some embodiments, the FTD may be frontal variant FTD (e.g., also known as behaviour variant FTD) or primary progressive aphasia (PPA). In some embodiments, the disease is FTD / ALS, that is, where the symptoms of FTD and ALS co-present. In some embodiments and aspects of the present invention, the disease may be characterised by repeat expansion in a gene. In some embodiments, the repeat expansion may be in a noncoding region of the gene. In some embodiments, the repeat expansion is a hexanucleotide repeat expansion. In some embodiments, the hexanucleotide repeat expansion is (GGGGCC)n. In some embodiments, the hexanucleotide repeat expansion (GGGGCC)n occurs in the non-coding region of the C9orf72 gene. In some embodiments, n >20, or greater than n >25. In preferred embodiments n >30, or n >35, or n> 40, or n> 45, or n >50, or n >55, or n >60, or n >65, or n >70, or n >75, or n >80, or n >85, or n >90, or n >95, or n >100, or n >125, or n >150, or n >175, or n >200, or n >225, or n >250, or n >275, or n >300. The disease may be ALS and / or FTD. In some embodiments, the repeat expansion in a gene may be determined by genetic testing. Genetic testing may be performed using PGR and / or DNA sequencing or Southern blotting. In some embodiments and aspects of the present invention, the disease may be characterised by a C9orf72 mutation. The disease may be a neurodegenerative disease characterised by a C9orf72 mutation. In some embodiments, the disease is ALS and / or FTD characterised by a C9orf72 mutation (termed C9ALS / FTD). The C9orf72 mutation is characterised by a hexanucleotide repeat expansion (GGGGCC)n in the non-coding region of the C9orf72 gene. In some embodiments, n >20, or greater than n >25. In preferred embodiments, n >30, or n >35, or n> 40, or n> 45, or n >50, or n >55, or n >60, or n >65, or n >70, or n >75, or n >80, or n >85, or n >90, or n >95, or n >100, or n >125, or n >150, or n >175, or n >200, or n >225, or n >250, or n >275, or n >300. In some embodiments, the C9orf72 mutation may be determined by genetic testing. Genetic testing may be performed using PGR and / or DNA sequencing. In some embodiments and aspects of the present invention, the disease may be characterised by production of one or more dipeptide repeat proteins (DPRs). The disease may be a neurodegenerative disease characterised by production of one or more dipeptide repeat proteins (DPRs). Dipeptide repeat proteins may be referred to as DPRs elsewhere herein. In some embodiments, the disease is ALS and / or FTD characterised by production or detection of one or more dipeptide repeat proteins. In some embodiments, the dipeptide repeat proteins may be produced due to a mutation in the C9orf72 gene. In some embodiments, the mutation in the C9orf72 gene corresponds to a hexanucleotide repeat expansion (GGGGCC)n in the non-coding region of the gene. In some embodiments, n >20, or greater than n >25. In some embodiments, n >30, or n >35, or n> 40, or n> 45, or n >50, or n >55, or n >60, or n >65, or n >70, or n >75, or n >80, or n >85, or n >90, or n >95, or n >100, or n >125, or n >150, or n >175, or n >200, or n >225, or n >250, or n >275, or n >300. In some embodiments, the dipeptide repeat proteins may be produced by a mutation in the spinocerebellar ataxia type 36 (SCA36) gene. In some embodiments, the dipeptide repeat proteins may comprise one or more of poly(GR), poly(GA), poly (GP), poly(PA), poly(PR) or any combination thereof. Poly(GR) refers to poly-(glycine-arginine), Poly(GA) refers to poly-(glycine-alanine), poly(GP) refers to poly(-glycine-proline), Poly(PA) refers to poly-(proline-alanine) and poly(PR) refers to poly(proline-arginine). In some embodiments, the one or more dipeptide repeat proteins comprises poly(GR) and / or poly(PR), or poly(GR). A disease characterised by production of one or more dipeptide repeat proteins may be determined by detecting the presence of one or more dipeptide repeat proteins in a biological sample of a patient, such as, in cerebrospinal fluid (CSF). The detection or presence of one or more dipeptide repeat (DPR) proteins may be achieved by any suitable method, including, ELISA or electrochemiluminescence. In some embodiments, the amount of dipeptide repeat proteins in the sample of a patient is higher than in a healthy subject or the mean amount in a plurality of healthy subjects. In some embodiments and aspects of the present invention, the disease is characterised by TDP-43 proteinopathy or TDP-43 mislocalization. In some embodiments, the disease is ALS and / or FTD associated with TDP-43 proteinopathy or TDP-43 mislocalization. Pharmaceutical Composition Also disclosed herein is a pharmaceutical composition comprising an AAV vector disclosed herein. The pharmaceutical composition may comprise the AAV vector in combination with one or more pharmaceutical carrier, diluent or excipient. The pharmaceutical compositions may additionally comprise a pharmaceutically acceptable excipient, which, as used herein, includes, but is not limited to, any and all solvents including water, dispersion media, diluents, or other liquid vehicles, dispersion or suspension aids, surface active agents, isotonic agents, a solubilizing agent, a tonicity agent, a pH adjuster, a buffering agent, thickening or emulsifying agents, preservatives, and the like, as suited to the particular dosage form desired. AAVs for use in a method of treatment and other methods described herein The AAV vector or pharmaceutical composition may be for use in a method of treatment as described herein. The AAV vector or pharmaceutical composition may be administered to any suitable subject. In some embodiments, the subject is a mammalian subject, and preferably a human subject. The subject may be of any suitable age. In some embodiments, the human subject is older than 18 years, or older than 20 years, or older than 25 years, or older than 30 years, or older than 40 years, or older than 50 years, or older than 60 years, or older than 70 years, or older than 80 years, or older than 90 years, or older than 100 years. In some embodiments, the human subject is between 18 and 100 years, or between 40 and 100 years. In some embodiments, the subject is a test subject, such as a mouse, a rat, a canine, a pig, a non-human primate or a guinea pig. In some embodiments, the subject has a C9orf72 mutation (i.e., as described elsewhere herein). This may have been determined by genetic testing. In some embodiments, the mutation in the C9orf72 gene corresponds to a hexanucleotide repeat expansion (GGGGCC)n in the non-coding region of the gene. In some embodiments, n >20, or greater than n >25. In some embodiments, n >30, or n >35, or n> 40, or n> 45, or n >50, or n >55, or n >60, or n >65, or n >70, or n >75, or n >80, or n >85, or n >90, or n >95, or n >100, or n >125, or n >150, or n >175, or n >200, or n >225, or n >250, or n >275, or n >300. In some embodiments, the genetic testing is determined by PGR or DNA sequencing or Southern blotting. In some embodiments, dipeptide repeat proteins have been identified or detected in a biological sample of the subject. This may be identified or detected using a method as described elsewhere herein. The biological sample may be any suitable biological sample (e.g., CSF fluid). The AAV vector or pharmaceutical composition may be administered using any suitable method. In some embodiments, the AAV vector or pharmaceutical composition is delivered to the cell of a subject. In some embodiments, the cell is a brain cell. In some embodiments, the cell is a neuronal cell (i.e., a neuron), more specifically a motor-neuron cell. In some embodiments, the cell is a glial cell. In some embodiments, the cell is a glial cell wherein the AAV vector or pharmaceutical composition is delivered to a glial cell in the brain and / or spinal cord. In some embodiments, the AAV vector or pharmaceutical composition, once administered, leads to increased protein expression of DNAJB1. In some embodiments, the increased protein expression of DNAJB1 is increased by at least 50%, or at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 100%, or at least 125%, or at least 150%, or at least 175%, or at least 200%,or at least 300%, or at least or up to 350%, compared with the level of DNAJB1 protein expression prior to administration. In some embodiments, the increased protein expression of DNAJB1 is increased by up to 400% compared with the level of DNAJB1 protein expression prior to administration, optionally increased by 50% to 400%, or increased by 100% to 400%, or by 200% to 400% compared with the level of DNAJB1 protein expression prior to administration. Protein expression may be determined by any suitable method, e.g., by immunological based methods (e.g., ELISA, blotting (e.g., western-blotting) or dot blotting, immunohistochemistry, immunostaining), proteomics, chromatography, fluorescent-imaging microscopy, or any combination thereof. In some embodiments, the AAV vector or pharmaceutical composition, once administered, leads to increased gene expression of DNAJB1. In some embodiments, the increased gene expression of DNAJB1, as determined by DNAJB1 mRNA transcripts, is increased by at least 50%, or at least 75%, or at least 100%, or at least 200% compared with the level of DNAJB1 gene expression prior to administration. Gene expression may be measured by any suitable method, e.g., by PCR or by RNA sequencing. In some embodiments, the AAV vector or pharmaceutical composition, once administered, provides a neuroprotective effect and / or reduces the toxicity of the C9orf72 mutation. In some embodiments, the AAV vector or pharmaceutical composition, once administered, provides a protective effect in a cell. In some embodiments, the neuroprotective effect is demonstrated by reduced cell death (i.e., in neurons, less neuronal loss) as compared with a level prior to administration of the AAV vector or pharmaceutical composition. In some embodiments, the AAV vector or pharmaceutical composition, once administered, reduces the accumulation of dipeptide repeat proteins (i.e., as compared with the level of accumulation prior to treatment) as compared with the level prior to administration. The level of dipeptide repeat proteins can be determined using the methods as described elsewhere herein. Examples Example 1 An example AAV construct used in the following example has the following sequence as shown in Figure 1B . This example AAV construct used for testing in the following example is of the AAV PHP.eB serotype. The example vector sequence comprises from 5’ -> 3’: a 5’-ITR (inverted terminal repeat of AAV2), a CAG promoter, a tdTomato tag, a P2A self-cleaving sequence, a V5 tag, a sequence encoding for human DNAJB1 WPRE - Woodchuck hepatitis virus post-transcriptional regulatory element, a polyA sequence and a 3’ ITR (inverted terminal repeat of AAV2). The vector incorporated a tdTomato tag separated from DNAJB1 by a self-cleaving P2A sequence in order to allow visualisation of transduced cells. The complete sequence of the plasmid containing an example AAV vector is shown below as SEQ ID NO: 1 SEQ ID NO: 1 CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAA GCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGA GCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCC GCACGCGTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGG TCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAA ATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATA ATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAAT GGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATC ATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCT GGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACA TCTACGTATTAGTCATCGCTATTACCATGGGTCGAGGTGAGCCCCACGTTC TGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATTTAT TTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGG CGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAG GCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTT CCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCG CGCGGCGGGCGGGAGTCGCTGCGTTGCCTTCGCCCCGTGCCCCGCTCCG CGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCA CAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTT GGTTTAATGACGGCTCGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTAAAGG GCTCCGGGAGGGCCCTTTGTGCGGGGGGGAGCGGCTCGGGGGGTGCGT GCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGCGGCCCGCGCTGCCCGG CGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCGTG TGCGCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGG GCTGCGAGGGGAACAAAGGCTGCGTGCGGGGTGTGTGCGTGGGGGGGT GAGCAGGGGGTGTGGGCGCGGCGGTCGGGCTGTAACCCCCCCCTGCACC CCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGCGGGGCTCCG TGCGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCA GGTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCT CGGGGGAGGGGCGCGGCGGCCCCGGAGCGCCGGCGGCTGTCGAGGCG CGGCGAGCCGCAGCCATTGCCTTTTATGGTAATCGTGCGAGAGGGCGCAG GGACTTCCTTTGTCCCAAATCTGGCGGAGCCGAAATCTGGGAGGCGCCGC CGCACCCCCTCTAGCGGGCGCGGGCGAAGCGGTGCGGCGCCGGCAGGA AGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCT TCTCCATCTCCAGCCTCGGGGCTGCCGCAGGGGGACGGCTGCCTTCGGG GGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCT CTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCT GGGCAACGTGCTGGTTGTTGTGCTGTCTCATCATTTTGGCAAAGGCGCGC CATCGATGCGGCCGCACCGCCACCATGGTGTCTAAGGGTGAGGAAGTAAT TAAGGAGTTTATGAGATTCAAAGTTAGAATGGAGGGTAGCATGAACGGGCA CGAGTTTGAAATTGAAGGTGAGGGTGAAGGAAGACCATATGAGGGCACAC AAACCGCCAAGCTCAAGGTTACCAAAGGTGGCCCCCTTCCTTTCGCCTGG GACATCCTCAGCCCTCAATTCATGTACGGTAGCAAGGCTTACGTCAAACAC CCTGCTGATATACCTGATTACAAAAAACTGTCATTTCCTGAAGGATTTAAGT GGGAACGAGTAATGAATTTTGAGGATGGTGGGCTGGTCACTGTCACGCAA GACTCCTCTCTGCAGGACGGCACCCTGATTTACAAGGTGAAGATGCGCGG AACAAATTTTCCCCCCGATGGCCCCGTGATGCAGAAGAAGACCATGGGGT GGGAGGCCTCTACAGAACGACTGTACCCCCGCGATGGCGTTCTTAAAGGC GAAATCCATCAGGCGCTTAAACTCAAAGATGGCGGGCACTACCTGGTTGAG TTCAAAACTATATATATGGCCAAAAAGCCGGTTCAGCTGCCTGGCTACTACT ACGTGGACACCAAGTTGGACATCACGAGTCACAACGAGGACTACACAATC GTCGAGCAGTACGAACGCTCAGAAGGTCGGCATCACCTGTTCTTGTATGG CATGGATGAGCTGTATAAGGATAACGGAAGCGGAGCCACTAACTTCTCCCT GTTGAAACAAGCAGGGGATGTCGAAGAGAATCCCGGGCCAGGTAAGCCTA TCCCTAACCCTCTCCTCGGTCTCGATTCTACGATGGGTAAAGACTACTACC AGACGTTGGGCCTGGCCCGCGGCGCGTCGGACGAGGAGATCAAGCGGGC CTACCGCCGCCAGGCGCTGCGCTACCACCCGGACAAGAACAAGGAGCCC GGCGCCGAGGAGAAGTTCAAGGAGATCGCTGAGGCCTACGACGTGCTCA GCGACCCGCGCAAGCGCGAGATCTTCGACCGCTACGGGGAGGAAGGCCT AAAGGGGAGTGGCCCCAGTGGCGGTAGCGGCGGTGGTGCCAATGGTACC TCTTTCAGCTACACATTCCATGGAGACCCTCATGCCATGTTTGCTGAGTTCT TCGGTGGCAGAAATCCCTTTGACACCTTTTTTGGGCAGCGGAACGGGGAG GAAGGCATGGACATTGATGACCCATTCTCTGGCTTCCCTATGGGCATGGGT GGCTTCACCAACGTGAACTTTGGCCGCTCCCGCTCTGCCCAAGAGCCCGC CCGAAAGAAGCAAGATCCCCCAGTCACCCACGACCTTCGAGTCTCCCTTGA AGAGATCTACAGCGGCTGTACCAAGAAGATGAAAATCTCCCACAAGCGGCT AAACCCCGACGGAAAGAGCATTCGAAACGAAGACAAAATATTGACCATCGA AGTGAAGAAGGGGTGGAAAGAAGGAACCAAAATCACTTTCCCCAAGGAAG GAGACCAGACCTCCAACAACATTCCAGCTGATATCGTCTTTGTTTTAAAGGA CAAGCCCCACAATATCTTTAAGAGAGATGGCTCTGATGTCATTTATCCTGCC AGGATCAGCCTCCGGGAGGCTCTGTGTGGCTGCACAGTGAACGTCCCCAC TCTGGACGGCAGGACGATACCCGTCGTATTCAAAGATGTTATCAGGCCTGG CATGCGGCGAAAAGTTCCTGGAGAAGGCCTCCCCCTCCCCAAAACACCCG AGAAACGTGGGGACCTCATTATTGAGTTTGAAGTGATCTTCCCCGAAAGGA TTCCCCAGACATCAAGAACCGTACTTGAGCAGGTTCTTCCAATATAGGAATT CGTCGACAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATT CTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTT TGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAA TCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGT GGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCAT TGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTAT TGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGG GCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATC GTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGA CGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCC GCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCT CAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGATACCGAGC GCTGCTCGAGAGATCTACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCC TCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAAT AAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGG GGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTG TAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAAT CTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTC AGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAAT TTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTC CAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGG ATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTTCTGATTTTGTAGGTA ACCACGTGCGGACCGAGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGC CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGG TCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGC GCGCAGCTGCCTGCAGGGGCGCCTGATGCGGTATTTTCTCCTTACGCATC TGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTG TAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACC GCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCC TTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTC CCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTT GATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTT CGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAA CTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGAT TTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTA ACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGG GGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATAT GTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATAGCACCTA GATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTG CACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTG GGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAG CGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTG AATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGG GCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGAC TGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCT TGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGC ATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCA TCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGAT CTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGC TCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGAT GCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGC Illi CTGGATTCATC GACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGG CTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTC CTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTAT CGCCTTCTTGACGAGTTCTTCTGAATTATTAACGCTTACAATTTCCTGATGC GGTA Illi CTCCTTACGCATCTGTGCGGTATTTCACACCGCATCAGGTGGC ACI I I I CGGGGAAAI G I GCGCGGAACCCCIA I I IGI I IAI I I I I CTAAATAC ATTCAAATATGTATCCGCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTT CCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCC I I I I I I I CTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCA GCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTA ACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCG TAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCT CTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTT ACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGG CTGAACGGGGGGGTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTAC ACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCC CGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACA GGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAG TCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTC GTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTAC GGTTCCTGGCCI I I I GO IGGCC Illi GCTCACATGT The example AAV vector comprises a sequence that encodes for human DNAJB1, an example sequence of which is SEQ ID NO:2. SEQ ID ATGGGTAAAGACTACTACCAGACGTTGGGCCTGGCCCGCGGCGCGTCGGA NO: 2 CGAGGAGATCAAGCGGGCCTACCGCCGCCAGGCGCTGCGCTACCACCCG GACAAGAACAAGGAGCCCGGCGCCGAGGAGAAGTTCAAGGAGATCGCTG AGGCCTACGACGTGCTCAGCGACCCGCGCAAGCGCGAGATCTTCGACCG CTACGGGGAGGAAGGCCTAAAGGGGAGTGGCCCCAGTGGCGGTAGCGGC GGTGGTGCCAATGGTACCTCTTTCAGCTACACATTCCATGGAGACCCTCAT GCCATGTTTGCTGAGTTCTTCGGTGGCAGAAATCCCTTTGACACCTTTTTTG GGCAGCGGAACGGGGAGGAAGGCATGGACATTGATGACCCATTCTCTGGC TTCCCTATGGGCATGGGTGGCTTCACCAACGTGAACTTTGGCCGCTCCCG CTCTGCCCAAGAGCCCGCCCGAAAGAAGCAAGATCCCCCAGTCACCCACG ACCTTCGAGTCTCCCTTGAAGAGATCTACAGCGGCTGTACCAAGAAGATGA AAATCTCCCACAAGCGGCTAAACCCCGACGGAAAGAGCATTCGAAACGAA GACAAAATATTGACCATCGAAGTGAAGAAGGGGTGGAAAGAAGGAACCAAA ATCACTTTCCCCAAGGAAGGAGACCAGACCTCCAACAACATTCCAGCTGAT ATCGTCTTTGTTTTAAAGGACAAGCCCCACAATATCTTTAAGAGAGATGGCT CTGATGTCATTTATCCTGCCAGGATCAGCCTCCGGGAGGCTCTGTGTGGCT GCACAGTGAACGTCCCCACTCTGGACGGCAGGACGATACCCGTCGTATTC AAAGATGTTATCAGGCCTGGCATGCGGCGAAAAGTTCCTGGAGAAGGCCT CCCCCTCCCCAAAACACCCGAGAAACGTGGGGACCTCATTATTGAGTTTGA AGTGATCTTCCCCGAAAGGATTCCCCAGACATCAAGAACCGTACTTGAGCA GGTTCTTCCAATATAG This design also allowed us to use an AAV expressing tdTomato tag alone as a control (see Figure 1A). This vector contains all the same elements as the example vector apart from the P2A, V5 and DNAJB1 sequences (see Figure 1A). 5 The sequence of the control vector is detailed below as SEQ ID NO: 3 SEQ ID CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAA NO: 3 GCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGA GCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGCGGCC GCACGCGTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGG TCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAA ATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATA ATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAAT GGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATC ATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCT GGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACA TCTACGTATTAGTCATCGCTATTACCATGGGTCGAGGTGAGCCCCACGTTC TGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAA Illi GTATTTAT TTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGG CGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAG GCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTT CCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCG CGCGGCGGGCGGGAGTCGCTGCGTTGCCTTCGCCCCGTGCCCCGCTCCG CGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCA CAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTT GGTTTAATGACGGCTCGTTTC Illi CTGTGGCTGCGTGAAAGCCTTAAAGG GCTCCGGGAGGGCCCTTTGTGCGGGGGGGAGCGGCTCGGGGGGTGCGT GCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGCGGCCCGCGCTGCCCGG CGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCGTG TGCGCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGG GCTGCGAGGGGAACAAAGGCTGCGTGCGGGGTGTGTGCGTGGGGGGGT GAGCAGGGGGTGTGGGCGCGGCGGTCGGGCTGTAACCCCCCCCTGCACC CCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGCGGGGCTCCG TGCGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCA GGTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCT CGGGGGAGGGGCGCGGCGGCCCCGGAGCGCCGGCGGCTGTCGAGGCG CGGCGAGCCGCAGCCATTGCC Illi ATGGTAATCGTGCGAGAGGGCGCAG GGACTTCCTTTGTCCCAAATCTGGCGGAGCCGAAATCTGGGAGGCGCCGC CGCACCCCCTCTAGCGGGCGCGGGCGAAGCGGTGCGGCGCCGGCAGGA AGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCT TCTCCATCTCCAGCCTCGGGGCTGCCGCAGGGGGACGGCTGCCTTCGGG GGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGCGGCT CTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCCTACAGCTCCT GGGCAACGTGCTGGTTGTTGTGCTGTCTCATCA Illi GGCAAAGGCGCGC CATCGATGCGGCCGCACCGCCACCATGGTGTCTAAGGGTGAGGAAGTAAT TAAGGAGTTTATGAGATTCAAAGTTAGAATGGAGGGTAGCATGAACGGGCA CGAGTTTGAAATTGAAGGTGAGGGTGAAGGAAGACCATATGAGGGCACAC AAACCGCCAAGCTCAAGGTTACCAAAGGTGGCCCCCTTCCTTTCGCCTGG GACATCCTCAGCCCTCAATTCATGTACGGTAGCAAGGCTTACGTCAAACAC CCTGCTGATATACCTGATTACAAAAAACTGTCATTTCCTGAAGGATTTAAGT GGGAACGAGTAATGAATTTTGAGGATGGTGGGCTGGTCACTGTCACGCAA GACTCCTCTCTGCAGGACGGCACCCTGATTTACAAGGTGAAGATGCGCGG AACAAATTTTCCCCCCGATGGCCCCGTGATGCAGAAGAAGACCATGGGGT GGGAGGCCTCTACAGAACGACTGTACCCCCGCGATGGCGTTCTTAAAGGC GAAATCCATCAGGCGCTTAAACTCAAAGATGGCGGGCACTACCTGGTTGAG TTCAAAACTATATATATGGCCAAAAAGCCGGTTCAGCTGCCTGGCTACTACT ACGTGGACACCAAGTTGGACATCACGAGTCACAACGAGGACTACACAATC GTCGAGCAGTACGAACGCTCAGAAGGTCGGCATCACCTGTTCTTGTATGG CATGGATGAGCTGTATAAGTGAGAATTCGTCGACAATCAACCTCTGGATTA CAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGC TATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTAT GGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAG GAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGC TGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTC CGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCG CCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAAT TCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGT GTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGC CCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGC CTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGG CCGCCTCCCCGCATCGATACCGAGCGCTGCTCGAGAGATCTACGGGTGGC ATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACT CCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTG ACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCA AGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAA CCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTC CTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCA GGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGG TTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTAC CCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCC TTCCCTGTCCTTCTGATTTTGTAGGTAACCACGTGCGGACCGAGCGGCCGC AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCG CTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCC GGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCGCC TGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACG TCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGG TGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGC CCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCC CCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTT ACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGG GCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTT CTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCG GTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAA AAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGC TTACAATTTAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTG TTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCT GATAAATGCTTCAATAATAGCACCTAGATCAAGAGACAGGATGAGGATCGT TTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGG GTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTC TGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTG TCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAAGACGAGGCAGCG CGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGA CGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGG GGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCA TGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCA TTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGA AGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCG CGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGA GGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGG AAAATGGCCGC Illi CTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCG GACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTT GGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCC CGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAATT ATTAACGCTTACAATTTCCTGATGCGGTA Illi CTCCTTACGCATCTGTGCG GTATTTCACACCGCATCAGGTGGCAC Illi CGGGGAAATGTGCGCGGAAC CCCTATTTGTTTAT Illi CTAAATACATTCAAATATGTATCCGCTCATGACCA AAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAA AGATCAAAGGATCTTCTTGAGATCC I I I I I I I CTGCGCGTAATCTGCTGCTT GCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGA GCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACC AAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCT GTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCT GCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTA CCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGGTCGTGCACACAGC CCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAG CTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCC GGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGG GGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTT GAGCGTCGAT Illi GTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAA CGCCAGCAACGCGGCCI I I I IACGGI ICCIGGCCI I I IGCIGGCCI I I IGC TCACATGT Results DNAJB1 rescues multiple phenotypes in C9orf72 repeat Drosophila models A fruit fly model was generated expressing expanded GGGGCC repeats, more particularly, 36 (GGGGCC) repeats. This has been shown to dramatically reduce the survival of flies (Mizielinska et al., 2014). We performed an unbiased screen of 2046 individual Drosophila lines all over-expressing a single gene (Figure 2A). Through robust secondary and tertiary screening (Figure 2A), we identified only 17 genes that were capable of extending the survival of Drosophila expressing expanded GGGGCC repeats, including DnaJ-1, which is the Drosophila orthologue of human DNAJB1. We confirmed this effect by showing that DnaJ-1 extends the survival of Drosophila expressing expanded GGGGCC repeats (Figure 2B), or expressing the specific dipeptide repeat protein polyGR (Figure 2C) that we and others have shown to be one of the drivers of C9orf72 repeat toxicity (Balendra &Isaacs, 2018). Expression of DnaJ-1 did not extend the survival of wildtype Drosophila (Figure 2D), showing that the pro-survival effect of DnaJ-1 is specific for protecting neurons undergoing neurodegeneration. We also showed that overexpression of DnaJ-1 can rescue the motor impairment present in Drosophila expressing expanded GGGGCC repeats (Figure 2E). Furthermore, DnaJ-1 also rescued the mislocalisation of TDP-43 present in the brains of Drosophila expressing expanded GGGGCC repeats (Figure 2F). Thus DnaJ-1 rescues several different phenotypes caused by expanded GGGGCC repeats. To confirm that this protective effect extends to the human orthologue of DnaJ-1, DNAJB1, we over-expressed human DNAJB1 using two independent overexpression lines and both extended the lifespan of Drosophila expressing expanded GGGGCC repeats (Figure 2G). Drosophila DNAJ1 has two mammalian orthologues, DNAJB1 and DNAJB4. It was next tested whether DNAJB1 and DNAJB4 can reduce the levels of the dipeptide repeat proteins (DPRs) generated by repeat associated non-ATG (RAN) translation of the expanded C9orf72 GGGGCC repeats. We generated nanoluciferase reporters for poly-GR and the antisense encoded poly-PR. These consisted of either (GGGGCC)92 followed by nanoluciferase without an ATG start codon in the GR frame, or (GGCCCC)so followed by nanoluciferase without an ATG start codon in the PR frame. We focused on poly-GR and poly-PR as these DPRs have previously been shown to be most toxic in these fly models. We tested DNAJB1, DNAJB4, the unrelated chaperone DNAJB2a or GFP as a control. Each gene was co-transfected in HEK cells with either the GR or PR nanoluciferase reporter and a firefly luciferase reporter to control for non-specific effects. After normalisation to firefly signal DNAJB1 led to highly significant reduction in poly-GR (-90% reduction) and poly-PR (-60% reduction) and had a greater effect than DNAJB4 or DNAJB2a. This suggests that DNAJB1 can act through its canonical chaperone function to reduce the levels of toxic DPRs. This is demonstrated in Figures 7 and 8. Nevertheless, data in flies shows that DNAJ1 is protective without lowering polyGR levels. This implies a dual benefit, where DNAJ1 decreases GR but also improves cellular proteostasis making the cells healthier and more resistant to GR induced toxicity. DNAJB1 extends the survival of C9orf72 patient iPSC-motor neurons. It was next tested whether DNAJB1 can increase the survival of human patient iPSC-motor neurons. C9orf72 patient iPSCs were differentiated into motor neurons as described in (Selvaraj et al., 2018) and transduced with lentiviruses (LV) expressing DNAJBI-mApple or mApple as a control on day 16 of differentiation. After 3 weeks of differentiation the motor neurons were labelled with 4pM Calcein-AM (Invitrogen) for 5 min and imaged using Zeiss Observer Z1. This was followed by treatment for 24 hours with either AM PA (100 pM), to cause AMPA-induced excitotoxicity, or AMPA / CNQX (30 pM). CNQX is a specific AMPA receptor antagonist which prevents excitotoxicity thus confirming the specificity of the cell death as AMPA-induced excitotoxicity. Following treatment, cells were labelled again with Calcein AM and reimaged. Cell counts (double positive for Calcein and m-Apple) before and after treatment were analyzed using Imaged. AMPA induced a significant increase in cell death in the C9orf72 patient line that is significantly reduced by DNAJB1 but not the mApple control. N= 3 biological replicates from one patient line, one-way ANOVA with Dunnett’s multiple comparisons test, Shapiro-Wilk normality test. DNAJB1 expression in a C9orf72 repeat expansion patient line significantly reduced excitotoxic cell death (see Figure 3). This shows that DNAJB1 is protective in human C9orf72 repeat expansion neurons. DNAJB1 rescues neurodegeneration in vivo in a mouse model of C9orf72 repeat expansion The AAV vector described in Example 1 was generated to determine whether DNAJB1 has a therapeutic effect in vivo. Delivery of human DNAJB1 to the brains of C9orf72 repeat ALS / FTD model mice To determine in vivo efficacy we utilised the (6462)149 mouse model (Chew et al., 2019). This model is generated by injecting an AAV vector encoding 149 GGGGCC repeats into the brain of neonatal pups by intracerebroventricular injection (Chew et al., 2019). This model exhibits several pathological hallmarks of C9ALS / FTD, which include neuronal loss, gliosis, RNA foci formation, accumulation of both sense and antisense dipeptide repeat proteins (DPRs), and aberrant phosphorylated TDP-43 aggregation (Chew et al., 2019). (G4C2)2 mice are used as healthy controls. (G4C2)i49mice display age-dependent neurodegeneration from 6 months of age, making this model a robust paradigm for investigating interventions aimed at preventing C9orf72 repeat-induced neurodegeneration. Thus, C57BL / 6J neonates received intracerebroventricular (ICV) co-injections at post-natal day 0 (P0) of either (G4C2)2 or (G4C2)i49 combined with either DNAJB1 or tdTomato. Five different conditions were prepared and injected: (1) (G4C2)2 + tdTomato, (2) (G4C2)2 + DNAJB1, (3) (G4C2)i49 + tdTomato, (4) (G4C2)i49 + DNAJB1, and (5) PBS (sham control). Mice were treated for 6 months, after which brains were collected and analysed. Confirmation of human DNAJB1 over-expression in the brain after 6 months of treatment We first confirmed expression of DNAJB1 and tdTomato in the brains of treated mice. Immunoblotting and quantitative qPCR (qPCR) of the cortex of 6-month treated mice showed robust RNA and protein expression of tdTomato in all groups except PBS injected mice, where no signal was observed (Figure 4A-D). Next, using an antibody that detects both human and mouse DNAJB1, immunoblotting revealed an approximately 2-fold overexpression of DNAJB1, as compared to endogenous mouse DNAJB1, in the cortex of DNAJB1-treated groups (Figure 4E,F). Human DNAJB1 over-expression was further confirmed by qP6R (Figure 4G). Next, we quantified the percentage of neurons expressing human DNABJ1 in the cortex of 6-month-old mice by immunofluorescence (Figure 5A). Approximately 40% of cortical NeuN-positive neurons showed expression of DNAJB1 in both (G4C2)2-DNAJB1 and (6462)149-DNAJB1 groups (Figure 5B), whereas no human DNAJB1 expression was detected in the PBS or tdTomato injected mice. Thus, these results show that human DNAJB1 is expressed in cortical neurons of AAV-treated mice, a brain region typically affected by neurodegeneration in the (6462)149 model. DNAJB1 rescues neurodeqeneration in the cortex of 6-month-old (6462)149 mice Having confirmed that human DNAJB1 is widely expressed in cortical neuronal cells, we assessed whether DNAJB1 overexpression protects against neurodegeneration in the (6462)149 mouse model. Immunostaining against the neuronal marker NeuN was used to quantify cortical neuronal cells (Figure 6A). Similar to previous findings reported by 6hew et al. (2019), 6-month-old (6462)i49-tdTomato injected micedisplayed a significant 25% reduction in cortical neuron count (p=0.0014) compared to (6462)2-tdTomato injected healthy controls (Figure 6B). By contrast, human DNAJB1 over-expression significantly rescued cortical neuronal loss in (6462)149-DNAJB1 mice compared to (6462) 149-tdTomato mice (p=0.0366), with mean values restored back to control levels as compared to both PBS-injected (p=0.9615) and (6462)2-tdTomato mice (p=0.7680) (Figure 6B). Moreover, no DNAJBI-related effect on neuronal count was observed when overexpressing DNAJB1 in (6462)2 mice compared to PBS (p=0.9929) and (6462)2-tdTomato controls (p=0.6328) (Figure 6B), indicating no adverse effect of DNAJB1 over-expression on neuron numbers in controls. Human DNAJB1 also reduced poly(6R) in the cortex of (6462)149 mice (Figure 66). Example 2 An example AAV construct used in the following study comprises the sequence as shown in Figure 16 . The example AAV construct used was of AAV9 serotype. This may be referred to as the AAV-6A6-DNAJB1 construct herein. The AAV9-6A6-DNAJB1 is similar to the vector in Example 1 with the exception that we removed the tdTomato reporter, making it suitable for clinical use, and this is packaged as an AAV9 virus. This 6A6-DNAJB1 construct was packaged into AAV9 and delivered to mice via P0 I6V injection. The results are demonstrated in Figure 9, showing AAV9 mediated human DNAJB1 expression in the mouse cortex. A. Quantification of total DNAJB1 protein levels in the cortex were quantified by first normalising to p-actin and then to the PBS control (n=2-4 mice per group) B. Representative immunoblot showing successful DNAJB1 overexpression in the cortex of AAV-injected mice compared to PBS mice. C. Quantification of human DNABJ1 in neuronal cells in the cortex of either PBS or 1x1O10 tot vg DNAJBI-injected mice (n=3 mice per group). D. Representative images of immunofluorescence staining showing co-localisation between human DNAJB1 and neuronal marker NeuN in the cortex of either PBS or AAV-injected mice. DAPI stains nuclei. Scale bar represents 100 pm. Data shown as mean ± SD. The example vector sequence comprises a sequence from 5’ -> 3’ comprising: a 5’-ITR (inverted terminal repeat of AAV2), a CAG promoter, (comprising CMV enhancer and Chicken B-actin promoter) a chimeric intron a sequence encoding for human DNAJB1 WPRE - Woodchuck hepatitis virus post-transcriptional regulatory element, a polyA sequence and a 3’ ITR (inverted terminal repeat of AAV2). This combination of these sequence elements led to effective expression of DNAJB1 in the mouse cortex, as compared to vectors with alternative sequences and with alternative sequence elements. The sequences of each individual element are provided below: SEQ ID NO: 4 5’ ITR CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCC GGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCT CAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCA TCACTAGGGGTTCCT SEQ ID NO: 5 Cloning site CTCCTCGAGTCAGAATTCTTATAAGCGGCCGC SEQ ID NO: 6 CMV enhancer GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGT CATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTA CGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCC CATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATA GGGACTTTCCATTGACGTCAATGGGTGGACTATTTACGGTAAAC TGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGC CCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTAT GCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACAT CTACGTATTAGTCATCGCTATTACCATG SEQ ID NO: 7 Chicken p-actin promoter TCGAGGTGAGCCCCACGTTCTGCTTCACTCTCCCCATCTCCCC CCCCTCCCCACCCCCAATTTTGTATTTATTTATTTTTTAATTATTT TGTGCAGCGATGGGGGCGGGGGGGGGGGGGGGGCGCGCGC CAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGAG GCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCC GAAAGTTTCCI I I I ArGGCGAGGCGGCGGCGGCGGCGGCCCT ATAAAAAGCGAAGCGCGCGGCGGGCG SEQ ID NO: 8 Chimeric intron GGAGTCGCTGCGTTGCCTTCGCCCCGTGCCCCGCTCCGCGCC GCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTC CCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGT AATTAGCGCTTGGTTTAATGACGGCTCGTTTC Illi CTGTGGCT GCGTGAAAGCCTTAAAGGGCTCCGGGAGGGCCCTTTGTGCGG GGGGGAGCGGCTCGGGGGGTGCGTGCGTGTGTGTGTGCGTG GGGAGCGCCGCGTGCGGCCCGCGCTGCCCGGCGGCTGTGAG CGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCGTGTGC GCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGG GGGGGCTGCGAGGGGAACAAAGGCTGCGTGCGGGGTGTGTG CGTGGGGGGGTGAGCAGGGGGTGTGGGCGCGGCGGTCGGGC TGTAACCCCCCCCTGCACCCCCCTCCCCGAGTTGCTGAGCACG GCCCGGCTTCGGGTGCGGGGCTCCGTGCGGGGCGTGGCGCG GGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAGGTGGGGGT GCCGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCG GGGGAGGGGCGCGGCGGCCCCGGAGCGCCGGCGGCTGTCGA GGCGCGGCGAGCCGCAGCCATTGCC Illi ATGGTAATCGTGCG AGAGGGCGCAGGGACTTCCTTTGTCCCAAATCTGGCGGAGCCG AAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGGG CGAAGCGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAG GGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCTCCATCTCC AGCCTCGGGGCTGCCGCAGGGGGACGGCTGCCTTCGGGGGG GACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTGACCGGC GGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTC CTACAG SEQ ID NO: 9 Human DNAJB1 GTAAAGACTACTACCAGACGTTGGGCCTGGCCCGCGGCGCGT CGGACGAGGAGATCAAGCGGGCCTACCGCCGCCAGGCGCTGC GCTACCACCCGGACAAGAACAAGGAGCCCGGCGCCGAGGAGA AGTTCAAGGAGATCGCTGAGGCCTACGACGTGCTCAGCGACCC GCGCAAGCGCGAGATCTTCGACCGCTACGGGGAGGAAGGCCT AAAGGGGAGTGGCCCCAGTGGCGGTAGCGGCGGTGGTGCCAA TGGTACCTCTTTCAGCTACACATTCCATGGAGACCCTCATGCCA TGTTTGCTGAGTTCTTCGGTGGCAGAAATCCCTTTGACACCTTT TTTGGGCAGCGGAACGGGGAGGAAGGCATGGACATTGATGAC CCATTCTCTGGCTTCCCTATGGGCATGGGTGGCTTCACCAACG TGAACTTTGGCCGCTCCCGCTCTGCCCAAGAGCCCGCCCGAAA GAAGCAAGATCCCCCAGTCACCCACGACCTTCGAGTCTCCCTT GAAGAGATCTACAGCGGCTGTACCAAGAAGATGAAAATCTCCC ACAAGCGGCTAAACCCCGACGGAAAGAGCATTCGAAACGAAGA CAAAATATTGACCATCGAAGTGAAGAAGGGGTGGAAAGAAGGA ACCAAAATCACTTTCCCCAAGGAAGGAGACCAGACCTCCAACAA CATTCCAGCTGATATCGTCTTTG Illi AAAGGACAAGCCCCACA ATATCTTTAAGAGAGATGGCTCTGATGTCATTTATCCTGCCAGG ATCAGCCTCCGGGAGGCTCTGTGTGGCTGCACAGTGAACGTCC CCACTCTGGACGGCAGGACGATACCCGTCGTATTCAAAGATGT TATCAGGCCTGGCATGCGGCGAAAAGTTCCTGGAGAAGGCCTC CCCCTCCCCAAAACACCCGAGAAACGTGGGGACCTCATTATTG AGTTTGAAGTGATCTTCCCCGAAAGGATTCCCCAGACATCAAGA ACCGTACTTGAGCAGGTTCTTCCAATATAG SEQ ID NO: 10 WPRE AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATT CTTAACTATGTTGCTCC Illi ACGCTATGTGGATACGCTGCTTTA ATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCA I I I I C TCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTG TGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTG CTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCA GCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGG CGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGG CTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAA ATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGA TTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAA TCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCG GCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATC TCCCTTTGGGCCGCCTCCCCGC SEQ ID NO: 11 SV40 Poly A AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGC ATCACAAATTTCACAAATAAAGCAI I I I I I I CACTGCATTCTAGTT GTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATC SEQ ID NO: 12 3’-ITR AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGC TCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACG CCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCG CAGCTGCCTGCAGG The 5’-ITR to 3’-ITR sequence of the example AAV vector is shown below in SEQ ID NO: 13 SEQ ID NO: 13 CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAG CCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGC GCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTCTCCTCGAGT CAGAATTCTTATAAGCGGCCGCGACATTGATTATTGACTAGTTATTAATAGTA ATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACAT AACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCAT TGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCAT TGACGTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACATC AAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATG GCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGG CAGTACATCTACGTATTAGTCATCGCTATTACCATGTCGAGGTGAGCCCCAC GTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAATTTTGTATT TATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGGGGGGGGG GGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGGGCGGGGCGA GGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGCTCCGAAAGTTT CCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAAAAGCGAAGCGC GCGGCGGGCGGGAGTCGCTGCGTTGCCTTCGCCCCGTGCCCCGCTCCGCG CCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGCGTTACTCCCACAG GTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTAATTAGCGCTTGGTT TAATGACGGCTCGTTTCTTTTCTGTGGCTGCGTGAAAGCCTTAAAGGGCTCC GGGAGGGCCCTTTGTGCGGGGGGGAGCGGCTCGGGGGGTGCGTGCGTGT GTGTGTGCGTGGGGAGCGCCGCGTGCGGCCCGCGCTGCCCGGCGGCTGT GAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGCGCTCCGCGTGTGCGCGA GGGGAGCGCGGCCGGGGGCGGTGCCCCGCGGTGCGGGGGGGCTGCGAG GGGAACAAAGGCTGCGTGCGGGGTGTGTGCGTGGGGGGGTGAGCAGGGG GTGTGGGCGCGGCGGTCGGGCTGTAACCCCCCCCTGCACCCCCCTCCCCG AGTTGCTGAGCACGGCCCGGCTTCGGGTGCGGGGCTCCGTGCGGGGCGTG GCGCGGGGCTCGCCGTGCCGGGCGGGGGGTGGCGGCAGGTGGGGGTGC CGGGCGGGGCGGGGCCGCCTCGGGCCGGGGAGGGCTCGGGGGAGGGGC GCGGCGGCCCCGGAGCGCCGGCGGCTGTCGAGGCGCGGCGAGCCGCAGC CATTGCCTTTTATGGTAATCGTGCGAGAGGGCGCAGGGACTTCCTTTGTCCC AAATCTGGCGGAGCCGAAATCTGGGAGGCGCCGCCGCACCCCCTCTAGCG GGCGCGGGCGAAGCGGTGCGGCGCCGGCAGGAAGGAAATGGGCGGGGAG GGCCTTCGTGCGTCGCCGCGCCGCCGTCCCCTTCTCCATCTCCAGCCTCGG GGCTGCCGCAGGGGGACGGCTGCCTTCGGGGGGGACGGGGCAGGGCGGG GTTCGGCTTCTGGCGTGTGACCGGCGGCTCTAGAGCCTCTGCTAACCATGT TCATGCCTTCTTCTTTTTCCTACAGGTAAAGACTACTACCAGACGTTGGGCCT GGCCCGCGGCGCGTCGGACGAGGAGATCAAGCGGGCCTACCGCCGCCAG GCGCTGCGCTACCACCCGGACAAGAACAAGGAGCCCGGCGCCGAGGAGAA GTTCAAGGAGATCGCTGAGGCCTACGACGTGCTCAGCGACCCGCGCAAGC GCGAGATCTTCGACCGCTACGGGGAGGAAGGCCTAAAGGGGAGTGGCCCC AGTGGCGGTAGCGGCGGTGGTGCCAATGGTACCTCTTTCAGCTACACATTC CATGGAGACCCTCATGCCATGTTTGCTGAGTTCTTCGGTGGCAGAAATCCCT TTGACACCTTTTTTGGGCAGCGGAACGGGGAGGAAGGCATGGACATTGATG ACCCATTCTCTGGCTTCCCTATGGGCATGGGTGGCTTCACCAACGTGAACTT TGGCCGCTCCCGCTCTGCCCAAGAGCCCGCCCGAAAGAAGCAAGATCCCCC AGTCACCCACGACCTTCGAGTCTCCCTTGAAGAGATCTACAGCGGCTGTACC AAGAAGATGAAAATCTCCCACAAGCGGCTAAACCCCGACGGAAAGAGCATTC GAAACGAAGACAAAATATTGACCATCGAAGTGAAGAAGGGGTGGAAAGAAG GAACCAAAATCACTTTCCCCAAGGAAGGAGACCAGACCTCCAACAACATTCC AGCTGATATCGTCTTTGTTTTAAAGGACAAGCCCCACAATATCTTTAAGAGAG ATGGCTCTGATGTCATTTATCCTGCCAGGATCAGCCTCCGGGAGGCTCTGTG TGGCTGCACAGTGAACGTCCCCACTCTGGACGGCAGGACGATACCCGTCGT ATTCAAAGATGTTATCAGGCCTGGCATGCGGCGAAAAGTTCCTGGAGAAGG CCTCCCCCTCCCCAAAACACCCGAGAAACGTGGGGACCTCATTATTGAGTTT GAAGTGATCTTCCCCGAAAGGATTCCCCAGACATCAAGAACCGTACTTGAGC AGGTTCTTCCAATATAGAATCAACCTCTGGATTACAAAATTTGTGAAAGATTG ACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTT AATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTT GTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGG CAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGG GGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCC CTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAG GGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCAT CGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGA CGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCG CGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCA GACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCAACTTGTTTATTGCAGC TTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATT TTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCA TGTCTGGATCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGC GCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGG CTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG The complete sequence of the plasmid containing the example AAV vector is shown below in SEQ ID NO: 14. This includes the GABRA 1 intron stuffer with the sequence as detailed in SEQ ID NO: 15 SEQ ID NO: 14 GTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCT GCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGG ATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGC AGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAA GAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGT GGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGAC GATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGGTCGTG CACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTAC AGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGA CAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAG CTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCAC CTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCT ATGGAAAAACCTATTAAAAAAACAATTACTAATTGTTTATAAAGCTTAATCAT AGTCAAAATATGTTCTAATGATCCAATCAAGCATGTGAAATTAATATAATAGA AACTATTTACATGACTAAGTATAGCAGATTTTTCTTTATCTGCTTTTGTATTTC TTGTGTTAGCTATTCCTGTGACCCATAAGAAGGTCAGACATATAATAAAAAC ATGAGTTTATTCAAAATGTAATGGCAAGGGAACTCTTAAGAGTTAAGATAGG GAGATGGAATAGTCTGGAAAGACATATGAATTTAGGAAGATTTATTTTAATT CAGAAGTTTTCTGTTGTTGTTTTTTGCTATTGTGTATGGTAAACACTGACAG ACAGGCATTATTATCAGATATCCTTAATGAGAGAAGTTAAATGTCTTTACTG CTTTTGAAAAATTATATGAAGTGTTACTATTGCAATGACCTGTAGATGGAGT TAGTGCACAGTGTTTTATTATATAGTGGTTCATATGGAGCCAGCAACGCGG CCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTCCTGCAG GCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGG CGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCA GAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTCTCCTCGAGTCAGA ATTCTTATAAGCGGCCGCGACATTGATTATTGACTAGTTATTAATAGTAATC AATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAA CTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATT GACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCAT TGACGTCAATGGGTGGACTATTTACGGTAAACTGCCCACTTGGCAGTACAT CAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAA TGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACT TGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGGTCGAGGTGAG CCCCACGTTCTGCTTCACTCTCCCCATCTCCCCCCCCTCCCCACCCCCAAT TTTGTATTTATTTATTTTTTAATTATTTTGTGCAGCGATGGGGGCGGGGGGG GGGGGGGGGCGCGCGCCAGGCGGGGCGGGGCGGGGCGAGGGGCGGG GCGGGGCGAGGCGGAGAGGTGCGGCGGCAGCCAATCAGAGCGGCGCGC TCCGAAAGTTTCCTTTTATGGCGAGGCGGCGGCGGCGGCGGCCCTATAAA AAGCGAAGCGCGCGGCGGGCGGGAGTCGCTGCGTTGCCTTCGCCCCGTG CCCCGCTCCGCGCCGCCTCGCGCCGCCCGCCCCGGCTCTGACTGACCGC GTTACTCCCACAGGTGAGCGGGCGGGACGGCCCTTCTCCTCCGGGCTGTA ATTAGCGCTTGGTTTAATGACGGCTCGTTTCTTTTCTGTGGCTGCGTGAAA GCCTTAAAGGGCTCCGGGAGGGCCCTTTGTGCGGGGGGGAGCGGCTCGG GGGGTGCGTGCGTGTGTGTGTGCGTGGGGAGCGCCGCGTGCGGCCCGC GCTGCCCGGCGGCTGTGAGCGCTGCGGGCGCGGCGCGGGGCTTTGTGC GCTCCGCGTGTGCGCGAGGGGAGCGCGGCCGGGGGCGGTGCCCCGCGG TGCGGGGGGGCTGCGAGGGGAACAAAGGCTGCGTGCGGGGTGTGTGCGT GGGGGGGTGAGCAGGGGGTGTGGGCGCGGCGGTCGGGCTGTAACCCCC CCCTGCACCCCCCTCCCCGAGTTGCTGAGCACGGCCCGGCTTCGGGTGC GGGGCTCCGTGCGGGGCGTGGCGCGGGGCTCGCCGTGCCGGGCGGGG GGTGGCGGCAGGTGGGGGTGCCGGGCGGGGCGGGGCCGCCTCGGGCC GGGGAGGGCTCGGGGGAGGGGCGCGGCGGCCCCGGAGCGCCGGCGGC TGTCGAGGCGCGGCGAGCCGCAGCCATTGCCTTTTATGGTAATCGTGCGA GAGGGCGCAGGGACTTCCTTTGTCCCAAATCTGGCGGAGCCGAAATCTGG GAGGCGCCGCCGCACCCCCTCTAGCGGGCGCGGGCGAAGCGGTGCGGC GCCGGCAGGAAGGAAATGGGCGGGGAGGGCCTTCGTGCGTCGCCGCGC CGCCGTCCCCTTCTCCATCTCCAGCCTCGGGGCTGCCGCAGGGGGACGG CTGCCTTCGGGGGGGACGGGGCAGGGCGGGGTTCGGCTTCTGGCGTGTG ACCGGCGGCTCTAGAGCCTCTGCTAACCATGTTCATGCCTTCTTCTTTTTCC TACAGCTCCTGGGACCACCGCCACCATGGGTAAAGACTACTACCAGACGTT GGGCCTGGCCCGCGGCGCGTCGGACGAGGAGATCAAGCGGGCCTACCG CCGCCAGGCGCTGCGCTACCACCCGGACAAGAACAAGGAGCCCGGCGCC GAGGAGAAGTTCAAGGAGATCGCTGAGGCCTACGACGTGCTCAGCGACCC GCGCAAGCGCGAGATCTTCGACCGCTACGGGGAGGAAGGCCTAAAGGGG AGTGGCCCCAGTGGCGGTAGCGGCGGTGGTGCCAATGGTACCTCTTTCAG CTACACATTCCATGGAGACCCTCATGCCATGTTTGCTGAGTTCTTCGGTGG CAGAAATCCCTTTGACACCTTTTTTGGGCAGCGGAACGGGGAGGAAGGCA TGGACATTGATGACCCATTCTCTGGCTTCCCTATGGGCATGGGTGGCTTCA CCAACGTGAACTTTGGCCGCTCCCGCTCTGCCCAAGAGCCCGCCCGAAAG AAGCAAGATCCCCCAGTCACCCACGACCTTCGAGTCTCCCTTGAAGAGATC TACAGCGGCTGTACCAAGAAGATGAAAATCTCCCACAAGCGGCTAAACCCC GACGGAAAGAGCATTCGAAACGAAGACAAAATATTGACCATCGAAGTGAAG AAGGGGTGGAAAGAAGGAACCAAAATCACTTTCCCCAAGGAAGGAGACCA GACCTCCAACAACATTCCAGCTGATATCGTCTTTGTTTTAAAGGACAAGCCC CACAATATCTTTAAGAGAGATGGCTCTGATGTCATTTATCCTGCCAGGATCA GCCTCCGGGAGGCTCTGTGTGGCTGCACAGTGAACGTCCCCACTCTGGAC GGCAGGACGATACCCGTCGTATTCAAAGATGTTATCAGGCCTGGCATGCG GCGAAAAGTTCCTGGAGAAGGCCTCCCCCTCCCCAAAACACCCGAGAAAC GTGGGGACCTCATTATTGAGTTTGAAGTGATCTTCCCCGAAAGGATTCCCC AGACATCAAGAACCGTACTTGAGCAGGTTCTTCCAATATAGGAATTCGTCG AACCGGTCAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTAT TCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCT TTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAA ATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACG TGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCA TTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTA TTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGG GCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATC GTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGA CGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCC GCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCT CAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCGCTAGCGGCTAAA ACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAAT TTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACT CATCAATGTATCTTATCATGTCTGGATCAGCGGCCGCAGGAACCCCTAGTG ATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGG GCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTG AGCGAGCGAGCGCGCAGCTGCCTGCAGGGGCGCCTGATGCGGTATTTTCT CCTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAG TACGCGCCCTGTAGCGGCCACTCAACCCTATCTCGGTCTATTCTTTTGATTT ATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAA CAAAAATTTAACGCGAATTTTAACAAAATATTAACGCTTACAATTTAGGTGGC ACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATAC ATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATA ATAGCACCTAGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACA AGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCG GCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTC CGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTC CGGTGCCCTGAATGAACTGCAAGACGAGGCAGCGCGGCTATCGTGGCTG GCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGC GGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTG TCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATG CGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGC GAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCG ATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTG TTCGCCAGGCTCAAGGCGAGCATGCCCGACGGCGAGGATCTCGTCGTGAC CCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTC TGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACA TAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCT GACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCAT CGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAATTATTAACGCTTACAAT TTCCTGATGCGGTA Illi CTCCTTACGCATCTGTGCGGTATTTCACACCGCA TCAGGTGGCAC Illi CGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTT TTCTAAATACATTCAAATATGTATCCGCTCATGACCAAAATCCCTTAACGTG AG I I I ICGTTCCACTGAGCGTCAGACCCC SEQ ID NO: 15 CTATTAAAAAAACAATTACTAATTGTTTATAAAGCTTAATCATAGTCAAAATAT GTTCTAATGATCCAATCAAGCATGTGAAATTAATATAATAGAAACTATTTACA TGACTAAGTATAGCAGAI I I I I C I I I A l CI GO I I I IGTATTTCTTGTGTTAGC TATTCCTGTGACCCATAAGAAGGTCAGACATATAATAAAAACATGAGTTTAT TCAAAATGTAATGGCAAGGGAACTCTTAAGAGTTAAGATAGGGAGATGGAA TAGTCTGGAAAGACATATGAATTTAGGAAGATTTAI I I IAA I ICAGAAG Illi CTGTTGTTGTTTTTTGCTATTGTGTATGGTAAACACTGACAGACAGGCATTA TTATCAGATATCCTTAATGAGAGAAGTTAAATGTCTTTACTGC Illi GAAAAA TTATATGAAGTGTTACTATTGCAATGACCTGTAGATGGAGTTAGTGCACAGT G I I I IATTATATAGTGGTTCATATGGA Materials and Methods - AAV plasmid design and synthesis 5 To generate pAAV-CAG-tdTomato, PCR was used to amplify and insert Miu and Sall restriction sites onto the CAG-tdTomato fragment of the PCAGGS-CAG-tdTomato. The resultant CAG-tdTomato fragment was subsequently digested and ligated into an empty pAAV backbone containing MIul and Sall restriction sites between 5’ and 3’ AAV2 inverted terminal repeats (ITRs). Alternatively, to generate the pAAV-CAG-tdTomato-P2A-V5-DNAJB1 construct, a 10 pMA-CAG-tdTomato-P2A-V5-DNAJB1 plasmid was synthesized by GeneArt customized DNA synthesis service (ThermoFisher) and the CAG-tdTomato-P2A-V5-DNAJB1 fragment was subcloned into the empty pAAV backbone using MIul and Sall. To generate pAAV-CAG-DNAJB1, the entire construct was synthesised by Genscript. Generation of AAV particles The (6462)2 and (6462)149 repeat-containing AAV2 / 9 viruses were generated as previously described (6hew et al., 2019). The 6A6-tdTomato and 6A6-tdTomato-P2A-V5-DNAJB1 constructs were packaged into the AAV9 variant PHP.eB (6han et al., 2017) and viral particles purified using a discontinuous iodixanol gradient (15%, 25%, 40%, 60%), and the genomic titre (vg / mL) of each virus determined by quantitative P6R using the AAVpro® Titration Kit (Takara), using our previously described methods (Qiu et al., 2022). Neonatal intracerebroventricular injections 657BL / 6J pups were anesthetised with isoflurane gas (2%, 200 mL / min) at postnatal day 0 (P0). Bilateral intracerebroventricular (I6V) co-injections were conducted using AAV2 / 9-(6462)(1 (3x1010 vg per hemisphere) and AAV2 / PHP.eB (1x1012 vg per hemisphere) with viruses combined and diluted in PBS before administration. Sham control pups were injected with PBS only. A 33-gauge needle (#7803-05, 12mm custom length, point style 4, 12 degrees, Hamilton company) attached to a 10 pl syringe (6AL7648-01, Hamilton 6ompany) was inserted into each lateral ventricle. 3.5 pl of solution was injected into each lateral ventricle approximately 2mm deep and at two-fifths of the distance between bregma and each eye. Following injection, pups were placed on a heated blanket and returned to their home cage once recovered from anaesthesia. Animals All animal experiments were performed in accordance with the Animals (Scientific Procedures) Act 1986 and approved by the local Animal Welfare and Ethical Review Body (AWERB) committee. Pregnant 657BL / 6J female mice were sourced from ENVI60 and Shades River UK. All mice were housed at 18-25 °6 and 55 ± 10 % relative humidity under a 12:12h lightdark cycle. Food and water were provided ad libitum. Experimenters were blind to treatment throughout the study. Tissue collection Mice were terminally anesthetized with intraperitoneal pentobarbital (200mg / ml, Pentoject®, XVD132, Animal 6are UK), and transcardially perfused using ice-cold PBS. Brain was hemisected and the left hemisphere was fixed in 4% paraformaldehyde in PBS for 24-h at 4°6. Tissue was then transferred to PBS, processed using an automated tissue processor (ASP300, Leica Biosystems) and paraffin-embedded (E61150H / E611506, Leica Biosystems). Serial sagittal sections (5 pM) were cut using a rotatory microtome (RM2125 / 2135, Leica Biosystems) and stored at room temperature until further use. Right brain hemisphere samples were dissected into regions of interest (including the cortex), snap-frozen on dry ice and stored at -80°C until further processing. Immunoblotting Cortical mouse tissue was homogenised and lysed in ice-cold RIPA buffer (R0278, Sigma Aldrich) supplemented with 2% SDS, complete Mini EDTA-free protease inhibitors (11836170001, Roche Diagnostics), and PhosStop phosphatase inhibitors (Roche Diagnostics). Samples were sonicated at 30% Amp for 20-sec at 4 °C and centrifuged at 13,000g for 20 minutes at room temperature (RT), after which the supernatant was retrieved. Total protein concentration per sample was determined using the Pierce™ BCA protein assay (#23227, Thermo Fisher Scientific). Protein lysates were mixed with 2x Laemmli buffer (sc-286962, Santa Cruz Biotechnology), incubated at 95 °C for 5 minutes and briefly spun down to remove debris. 30 pg of total protein per sample was separated by SDS-PAGE electrophoresis and transferred to nitrocellulose membranes. Membranes were subsequently blocked with 5% non-fat dry milk for hour at RT and incubated overnight at 4 °C with mouse anti-HSP40 (1:2000, ab223610, Abeam), rabbit anti-RFP (1:2000, 600-401-379, Rockland) or P-actin (1:5000, A2228, Sigma). After washing, membranes were incubated with goat antimouse (P0260, Dako) or goat anti-rabbit (AQ132P, Merck) HRP-conjugated secondary antibodies for 1 hour at room temperature. Images were acquired via chemiluminescence (WBLUF0500, Millipore) using the Amersham Imager 680 system. Image Studio™ Lite software (LI-COR Biosciences) was used to quantify band intensity (n = 4-14 per group, run in duplicate). RNA extraction and qPCR Total RNA was extracted using the ReliaPrep™ RNA Tissue Miniprep System (Z6111, Promega), as per manufacturer’s instructions, and quantified via UV-Vis spectrophotometry (Nanodrop™, Thermo Fisher Scientific). 1000 ng of RNA of each sample was then reverse transcribed to cDNA using the Superscript™ IV VILO Master mix (Thermo Fisher Scientific). Real-time quantitative PCR was performed with the LightCycler® SYBR Green I Master mix (Roche Diagnostics) using 2 ng of total cDNA per sample. Ct values of each gene were normalized to the internal control (P-actin) and relative mRNA expression was calculated using the 2-AACt method (n = 6 per group, run in duplicate). Primers used in quantitative PCR for human DNAJB1 were: forward primer 5’-CACCCGGACAAGAACAAGGAGC-3’ (SEQ ID NO: 16) and reverse primer 5’-ACTCCCCTTTAGGCCTTCCTCC-3’ (SEQ ID NO: 17). Primers used for tdTomato were: forward primer 5’- AGCTGCCTGGCTACTACTACGTG-3’ (SEQ ID NO: 18) and reverse primer 5’-AGGTGATGCCGACCTTCTGAGC-3’ (SEQ ID NO: 19). Primers for mouse p -actin were: forward primer 5’-CATTGCTGACAGGATGCAGAAGG-3’ (SEQ ID NO: 20) and reverse primer 5’-TGCTGGAAGGTGGACAGTGAGG-3’ (SEQ ID NO: 21). Immunohistochemistry Five micron-thick sections were deparaffinized in xylene and rehydrated through a series of ethanol solutions, followed by antigen retrieval for 90-min in a Tris-based buffer (pH 7.8) at 95°C. Tissue sections were blocked with Discovery S Block (760-4212, Roche Diagnostics) for 8 minutes at room temperature. Sections were then immunostained with mouse monoclonal antibody against NeuN (1:2000, MAB377, Millipore) using the Ventana Discovery XT Autostainer (Roche Diagnostics, USA) and ROCHE Ventana reagents (DAB map kit, 760-124, Roche Diagnostics). Sections were incubated with primary antibody for 30 minutes at RT, followed by PBS washes and secondary biotin-conjugated anti-mouse antibody incubation (1:100, ab98668, Abeam) for 1 hour at RT. Sections were counterstained with haematoxylin (760-2021, Roche Diagnostics), dehydrated through a series of ethanol and xylene washes, and coverslipped using HistoCore SPECTRA CV X1 mounting medium (3801733, Leica Biosystems). Slides were scanned with a Zeiss AxioScan Z1 microscope at20x magnification. NeuN-positive neurons were quantified using a custom-designed threshold count algorithm on Imaged (Fiji) software. The output parameter was the number of NeuN-positive neurons per mm2 of the annotated cortical region (n = 9-13 per group, using 2-3 technical replicates). Immunofluorescence Brain sections were deparaffinized in xylene and rehydrated through a series of ethanol solutions (100%, 95%, and 70% ethanol). Antigen retrieval was performed in sodium citrate buffer pH 6.0 for 30-min at 95°C. Slides were cooled by running distilled water into the slide holder for 20 minutes, washed in 1xPBS-T and permeabilised with 0.2% Triton X-100 (9036-19-5, Sigma-Aldrich) at 4°C for 10 minutes. Tissue sections were then blocked (5% bovine serum albumin + 5% normal goat serum in 1xPBS-T) for 1-hour at room temperature. Primary antibodies used were mouse anti-HSP40 (1:100; SCT, sc-398766) and chicken anti-NeuN (1:200; Millipore, ABN91). Sections were incubated with primary antibodies in blocking solution overnight at 4 °C. The following day, slides were washed and incubated with respective secondary antibodies conjugated with Alexa 488 (A11001, Thermo Fisher Scientific) and Alexa 633 (A21103, Thermo Fisher Scientific) for 1 hour at RT. Slides were then incubated with Sudan-Black (0.1% in 70% EtOH / 30% dH20; 199664-25G, Sigma-Aldrich) to reduce autofluorescence, washed and coverslipped with Prolong™ Gold Antifade mounting media with DAPI (P36931, Thermo Fisher Scientific). Confocal Z-stacks were acquired using a confocal laser scanning microscope (Leica MICA, Leica Microsystems) at 20x magnification. Maximum projections of the frontal cortex were processed and percentage of DNAJBI-positive neurons per region was quantified using Imaged software (FIJI, N.I.H.). Briefly, red, green, and blue channels were split and the threshold for each channel was adjusted to omit the background. Individual channels cell count and the overlapping cell count of both red and green channels were determined using the Analyse Particles function. All images were processed using identical settings for each channel for background subtraction and thresholding (n = 5-6 per group, run in duplicate). The percent colocalization of DNAJB1 and NeuN was calculated using the following equation: % colocalization = (overlapping cells I total NeuN positive cells) x 100. Measurement of poly(GR) Poly(GR) protein levels in the cortex of AAV-treated mice were measured using the Meso Scale Discovery (MSD) immunoassay and an anti-poly(GR) antibody (GR661, custom-made by Eurogentec). Briefly, cortical tissue was lysed using RIPA buffer (R0278, Sigma Aldrich) with 2% SDS and protease inhibitors (Roche complete™ mini EDTA-free, 11836170001) and sonicated at 30% Amp for 20 seconds at 4°C. Following centrifugation at 13,000g for 20 min at RT, the supernatant was collected, and protein concentration was determined by BCA protein assay (Pierce™ BCA assay kit, Thermo Fisher Scientific). MSD immunoassay was performed in multi-array 96-well plates, as previously described (Simone et al, 2018 -https: / / pubmed.ncbi.nlm.nih.gov / 29113975 / ). Plates were coated overnight at 4°C with the capture anti-poly(GR) antibody (GR661, 2 pg / mL, Eurogentec), washed with TBS-T (TBS, 0.2% Tween-20) and blocked the following day for 2 hours with 3% milk (in 1xTBS-T 0.2%) at room temperature. 180 pg of total protein per sample was then loaded in duplicate and incubated overnight at 4°C. Freshly extracted samples were used, avoiding freeze-thaw cycles. Following incubation with a detection biotinylated antibody (GR661, 1 pg / mL) for 2 hours at room temperature, samples were washed and labelled with SULFO-TAG™ streptavidin (R32AD-1, MSD) for 1 hour at room temperature. Plates were read at 620 nm using the MSD reading buffer (R92TC-1; MSD) in the MSD Sector Imager 2400 plate reader. Intensity signals of emitted light detected upon electrochemical stimulation were background corrected and interpolated against a standard curve of GR7.5 peptide (n = 7-8 per group, run in duplicate). Statistical Analyses Normality was tested for each dataset using the Shapiro-Wilk test using GraphPad Prism (version 9.4.1). All data are represented as individual values and respective mean ± standard error of the mean (SEM). Statistical analyses of protein expression via immunoblotting were performed using one-Way ANOVA (GraphPad Prism, version 9.4.1). For immunofluorescence, co-localisation data was analysed using Kruskal-Wallis with Dunn’s post-hoc multiple comparisons test (GraphPad Prism, version 9.4.1). Neuronal count data was analysed using one-way ANOVA with Tukey’s post-hoc multiple comparisons test in GraphPad Prism (version 9.4.1). Data were considered significant when p<0.05 (two-tailed). References Balendra, R., &Isaacs, A. M. (2018). C9orf72-mediated ALS and FTD: multiple pathways to disease. Nature Reviews Neurology, 14(9), 544-558. https: / / doi.org / 10.1038 / s41582-018-0047-2 Chan, K. Y., Jang, M. J., Yoo, B. B., Greenbaum, A., Ravi, N., Wu, W. L., Sanchez-Guardado, L., Lois, C., Mazmanian, S. K., Deverman, B. E., &Gradinaru, V. (2017). Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous systems. Nature Neuroscience, 20(8), 1172-1179. https: / / doi.org / 10.1038 / NN.4593 Chew, J., Cook, C., Gendron, T. F., Jansen-West, K., Del Rosso, G., Daughrity, L. M., Castanedes-Casey, M., Kurti, A., Stankowski, J. N., Disney, M. D., Rothstein, J. D., Dickson, D. W., Fryer, J. D., Zhang, Y. J., &Petrucelli, L. (2019). Aberrant deposition of stress granule-resident proteins linked to C9orf72-associated TDP-43 proteinopathy. Molecular Neurodegeneration, 14(1). https: / / doi.Org / 10.1186 / s13024-019-0310-z Mizielinska, S., Grdnke, S., Niccoli, T., Ridler, C. E., Clayton, E. L., Devoy, A., Moens, T., Norona, F. E., Woollacott, I. O. C., Pietrzyk, J., Cleverley, K., Nicoll, A. J., Pickering-Brown, S., Dols, J., Cabecinha, M., Hendrich, 0., Fratta, P., Fisher, E. M. C., Partridge, L., &Isaacs, A. M. (2014). C9orf72 repeat expansions cause neurodegeneration in Drosophila through arginine-rich proteins. Science (New York, N.Y.), 345(Q201), 1192-1194. https: / / d0i.0rg / l 0.1126 / science. 1256800 Qiu, Y., O’Neill, N., Maffei, B., Zourray, C., Almacellas-Barbanoj, A., Carpenter, J. C., Jones, S. P., Leite, M., Turner, T. J., Moreira, F. C., Snowball, A., Shekh-Ahmad, T., Magloire, V., Barral, S., Kurian, M. A., Walker, M. C., Schorge, S., Kullmann, D. M., &Lignani, G. (2022). On-demand cell-autonomous gene therapy for brain circuit disorders. Science (New York, N.Y.), 378(6619), 523-532. https: / / doi.org / 10.1126 / SCIENCE.ABQ6656 Selvaraj, B. T., Livesey, M. R., Zhao, C., Gregory, J. M., James, O. T., Cleary, E. M., Chouhan, A. K., Gane, A. B., Perkins, E. M., Dando, 0., Lillico, S. G., Lee, Y. B., Nishimura, A. L., Poreci, U., Thankamony, S., Pray, M., Vasistha, N. A., Magnani, D., Borooah, S., ... Chandran, S. (2018). C9ORF72 repeat expansion causes vulnerability of motor neurons to Ca2+-permeable AMPA receptor-mediated excitotoxicity. Nature Communications, 9(1). https: / / doi.Org / 10.1038 / S41467-017-02729-0

Claims

1. An AAV vector which encodes for DNAJB1 for use in a method of treatment ofa disease, wherein the disease is ALS and / or FTD.

2. The AAV vector for the use of claim 1, wherein the disease is characterised bya C9orf72 mutation.

3. The AAV vector for the use of claim 2, wherein the C9orf72 mutation ischaracterized by the hexanucleotide repeat expansion (GGGGCC)n, where n >30, more preferably greater than 100.

4. An AAV vector for the use of any claims 2-3, wherein the C9orf72 mutation isdetermined by genetic testing.

5. The AAV vector for the use according to any preceding claim, wherein thedisease is characterised by production of one or more dipeptide repeat proteins.

6. The AAV vector for the use according to claim 5, wherein the dipeptide repeatproteins comprise one or more of poly(GR), poly (GA), poly (GP), poly (PA), and poly (PR).

7. The AAV for the use according to claim 5, wherein the dipeptide repeat proteincomprises poly(GR) and / or poly(PR), optionally poly(GR).

8. The AAV vector for the use of any preceding claim, wherein the disease is ALS.

9. The AAV vector for the use of any preceding claim, wherein the disease is FTD.

10. The AAV vector for the use of any preceding claim, wherein the disease isfamilial or sporadic.

11. The AAV vector for the use of any preceding claim, wherein the disease ischaracterised by TDP-43 proteinopathy or TDP-43 mislocalization.

12. .An AAV vector which encodes for DNAJB1 for use in a method of treatment ofa disease characterised by production of one or more dipeptide repeat proteins.

13. An AAV vector of AAV9 serotype or variant thereof, which encodes forDNAJB1.

14. The AAV vector for the use of any one of claims 1-12, or the AAV vector ofclaim 13, wherein the DNAJB1 is human DNAJB1.

15. The AAV vector for the use of any one of claims 1-12, or the AAV vector of anyone of claims 13-14, wherein the sequence that encodes for DNAJB1 is at least 90%, or at least 95% identical or 100% identical to SEQ ID NO:

916. The AAV vector for the use of any one of claims 1-12, or the AAV vector of anyone of claims 13-15, wherein the AAV vector comprises a CAG promoter.

17. The AAV vector for the use of any one of claims 1-12, or the AAV vector of anyone of claims 13-16, wherein the AAV vector comprises a WPRE post-transcriptional regulatory element.

18. The AAV vector for the use of any one of claims 1-12, or the AAV vector of anyone of claims 13-17, wherein the AAV vector comprises a sequence from 5’ -> 3’ comprising:a 5’-ITR sequence,a promoter, preferably a CAG promoter,a sequence encoding for DNAJB1,optionally a post-transcriptional regulatory element, preferably WPRE,a poly A signal, anda 3’-ITR sequence.

19. The AAV vector for the use of any one of claims 1-12, or the AAV vector of anyone of claims 13-18, wherein the AAV vector comprises a sequence with at least 90%, or at least 95% sequence identity to SEQ ID NO: 13.

20. The AAV vector for the use of any one of claims 1-12, wherein the AAV vectoris of a AAV9 serotype or a variant thereof.

21. A pharmaceutical composition pharmaceutical composition comprising an AAVvector which encodes for DNAJB1 for use in the treatment of a disease, wherein the disease is ALS and / or FTD.IntellectualPropertyOfficeApplication GB2418800.5Search report under Section 17 of the Patents Act 1977Date search completed: 23 June 2025Claims searched: 1-21International classificationSubclass and subgroup Valid from a61k48 / 00 01 / 01 / 2006 a61p25 / 28 01 / 01 / 2006 c12n15 / 864 01 / 01 / 2006Field of searchWorldwide search of patent documents classified in the following areas of the IPC:C12NDatabases used in the preparation of this search report:SEARCH-NPL; SEARCH-PATENTDocuments considered to be relevantPatent literatureCategory Relevant claims Document of relevance A - WO 2018 / 227212 A1Intellectual Property Office is an operating name of the Patent Office www.gov.uk / ipo45A - US 2024 / 0327477 A1 A - US 20200283800 ANon-patent literatureCategory Relevant claims Document of relevance X,Y X: 13-15 Y: 1,8, 10, 11,20, 21 Migrated NPL Citation, 16 / 06 / 2025, Mol Ther Nucleic Acids., vol 31,2023, "M Zhang et al, "A novel gene therapy for methamphetamine- induced cognitive disorder with a hyperacidified fusion variant of DnaJB1", 703-716, Y 1,8, 10, 11,20, 21 Migrated NPL Citation, 16 / 06 / 2025, PLOS Genet, 2017, Vol 13(5), SK Park et al, "Overexpression of the essential Sis1 chaperone reduces TDP-43 effects on toxicity and proteolysis", e1006805,, A - C9ORF72: What It Is, What It Does, and Why It Matters, J Smeyers et al, 16 / 06 / 2025, Front Cell Neurosci, vol 15, 2021, C9ORF72: What It Is, What It Does, and Why It Matters, 661447,CategoriesLetter or symbol Description X Document indicating lack of novelty or inventive step.Document indicating lack of inventive step, if combined with another document of the same category.Letter or symbol Description & Member of the same patent family. A Document indicating technological background. P Document published on or after the priority date but before the fling date of the present application. E Earlier application published on or after the filing date of the present application.