Method for preparing multisubunit SCF E3 ligase with fusion protein through in vitro reconstitution, and use of multisubunit SCF E3 ligase

Abstract

A method for preparing a multisubunit SCF E3 ligase with a fusion protein through in vitro reconstitution, and a use of the multisubunit SCF E3 ligase. The method for preparing a multisubunit SCF E3 l

Description

1 JtLVJHLIn Jr JLJtLJL / JU

[0001] The present disclosure belongs to the field of biotechnology, and relates to a method for preparing a multisubunit SCF E3 ligase with a fusion protein through in vitro reconstitution, and a use of the multisubunit SCF E3 ligase. 04 04 25 BACKGROUND

[0002] Protein degradation plays an important role in maintaining normal function of cells and organisms. In eukaryotes, there are two major pathways for protein degradation: lysosomedependent pathway and ubiquitin-proteasome dependent pathway. The ubiquitin-proteasome dependent pathway is composed of substrate ubiquitination and subsequent degradation by proteasome, and plays essential roles in regulating various biological processes, including cell proliferation, cell differentiation, apoptosis, DNA replication and repair, transcription, signal transduction, and protein quality control. In plants, many proteins that control important cell biological processes are regulated by the ubiquitin-proteasome system (UPS), such as the key factor TIR1 in the auxin signaling pathway, the key factor COI1 in the jasmonic acid (J A) signaling pathway, the key factor GID2 in the gibberellin (GA) signaling pathway, and the key factors D14 and D53 in the strigolactone (SL) signaling pathway. Protein ubiquitination requires the concerted reactions of ubiquitin-activating enzyme (UAE, El), ubiquitin-conjugating enzyme (UCE, E2), and ubiquitin ligase (E3). The multisubunit SCF E3 ligase consists of SKP1, Cullinl, RBX1, and an interchangeable F-box protein. In higher plants, multisubunit SCF E3 ligases play a crucial role in regulation of plant growth and development and responses to environmental stresses.

[0003] In vitro ubiquitination analysis system plays an important role in elucidating molecular mechanism of an E3 ligase or a substrate protein in plant growth and development. So far, there has been still no research on the preparation of functional multisubunit E3 ligases in vitro in plants, which greatly limits the investigation of molecular mechanisms of multisubunit E3 ligases. In order to elucidate the mechanism of multisubunit SCF E3 ligase, it is necessary to establish and optimize an in vitro reconstitution system of multisubunit SCF E3 ligase. However, in vitro reconstitution of functional multisubunit SCF E3 ligase remains a challenge, mainly due to difficulties in achieveing active subunits of complex SCF E3 ligase with high purity. Establishing the in vitro reconstitution platform for multisubunit SCF E3 ligase using an engineered SKP1-Cullinl-RBXl fusion protein (eSCR) is of great biological significance, and also provides a powerful tool to elucidate molecular mechanisms of multisubunit E3 ligase in plants. 04 04 25 SUMMARY

[0004] The technical problem to be solved by the present disclosure is to prepare an active multisubunit SCF E3 ligase in vitro.

[0005] In order to solve the technical problem above, the present disclosure first provides a preparation method of an active multisubunit SCF E3 ligase, including: addition of an eSCR fusion protein to a reaction with an F-box protein in the reaction system to achieve active multisubunit SCF E3 ligases.

[0006] The eSCR fusion protein is selected from the group consisting of Al), A2), and A3):

[0007] Al) a fusion protein with an amino acid sequence from position 10 to position 1062 of SEQIDNO: 2;

[0008] A2) a protein that is obtained through substitution and / or deletion and / or addition of one or more amino acid residues based on the amino acid sequence from position 10 to position 1062 of SEQ ID NO: 2 and has the same function as the amino acid sequence from position 10 to position 1062 of SEQ ID NO: 2; and

[0009] A3) a fusion protein obtained by linking a tag to an N-terminus and / or a C-terminus of Al) or A2).

[0010] A sequence from position 10 to position 184 of SEQ ID NO: 2 is an amino acid sequence of the SKP1 protein; a sequence from position 189 to position 932 of SEQ ID NO: 2 is an amino acid sequence of the Cullinl protein; a sequence from position 937 to position 1062 of SEQ ID NO: 2 is an amino acid sequence of the RBX1 protein; a sequence from position 185 to position 188 of SEQ ID NO: 2 is a linker sequence between the SKP1 protein and the Cullinl protein; and a sequence from position 933 to position 936 of SEQ ID NO: 2 is a linker sequence between the Cullinl protein and the RBX1 protein.

[0011] To facilitate the purification of the protein in Al), a tag shown in Table 1 can be linked to an N-terminus or C-terminus of the protein with an amino acid sequence from position 10 to position 1062 of SEQ ID NO: 2 in the sequence listing.

[0012] Table 1 Tag sequences

[0013] Tag Residue Sequence Poly-Arg 5 to 6 (usually 5) RRRRR (SEQ ID NO: 3) Poly-His 2 to 10 (usually 6) TTTTTTTTTTTT / C T7 T TA X11111111111 IL* NO: 4) Flag 8 DYKDDDDK (SEQ ID NO: 5) Strep-tag II 8 WSHPQFEK (SEQ ID NO: 6) c-myc 10 EQKLISEEDL (SEQ ID NO: 7) 04 04 25

[0014] The eSCR fusion protein described in A2) has 75% or more identity with the amino acid sequence from position 10 to position 1062 of SEQ ID NO: 2 and has the same function as the eSCR fusion protein. The 75% or more identity refers to 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity.

[0015] The eSCR fusion protein described in A2) can be artificially synthesized, or a coding gene of the fusion protein can be first synthesized and then the fusion protein is biologically expressed.

[0016] The coding gene of the eSCR fusion protein described in A2) can be obtained by deletion of codon(s) of one or more amino acid residues from a DNA sequence from position 28 to position 3186 of SEQ ID NO: 1, and / or missense mutation of one or more base pairs from the DNA sequence, and / or linking a coding sequence of a tag shown in Table 1 to a 5'-terminus and / or a 3'-terminus of the DNA sequence. A DNA sequence from position 28 to position 3186 of SEQ ID NO: 1 encodes the eSCR fusion protein from position 10 to position 1062 of SEQ ID NO: 2.

[0017] A sequence from position 28 to position 552 of SEQ ID NO: 1 is a nucleotide sequence encoding the SKP1 protein; a sequence from position 565 to position 2796 of SEQ ID NO: 1 is a nucleotide sequence encoding the Cullinl protein; a sequence from position 2809 to position 3186 of SEQ ID NO: 1 is a nucleotide sequence encoding the RBX1 protein; and a sequence from position 553 to position 564 of SEQ ID NO: 1 and a sequence from position 2797 to position 2808 of SEQ ID NO: 1 are nucleotide sequences encoding linker sequences.

[0018] Specifically, the fusion protein described in A3) may be a protein shown in SEQ ID NO: 2.

[0019] In the method described above, the reaction system may further include 50 mM Tris-HCl buffer (pH 7.4), MgCk, DTT, and / or ATP;

[0020] and / or, the reaction may be conducted at 22°C to 37°C, such as 28°C; and

[0021] and / or, the reaction may be conducted for 1 h to 2 h.

[0022] Specifically, the reaction system may be obtained by adding MgCE, ATP, DTT, the eSCR fusion protein to 50 mM Tris-HCl buffer (pH 7.4), and a content of each component in the reaction system may be as follows: MgCh: 10 mM, DTT: 2 mM, ATP: 5 mM, and eSCR fusion protein: 0.8 pg / 30 pL.

[0023] In an embodiment of the present disclosure, the F-box protein is D3 or D3 with a tag. 04 04 25

[0024] In an embodiment of the present disclosure, the F-box protein is GID2 or GID2 with a tag.

[0025] In an embodiment of the present disclosure, the F-box protein is FBXL18 or FBXL18 with a tag.

[0026] In an embodiment of the present disclosure, the F-box protein is CDC4 or CDC4 with a tag.

[0027] An E3 ligase prepared by the preparation method of a multisubunit SCF E3 ligase also falls within the protection scope of the present disclosure.

[0028] The present disclosure also provides a preparation method of a polyubiquitin chain, including: subjecting the eSCR fusion protein, an F-box protein, a UAE El, a UCE E2, and a ubiquitin monomer to the reaction system to obtain the polyubiquitin chain. The polyubiquitin chain (or ubiquitin chain) refers to a ubiquitin chain formed by two or more ubiquitin moieties.

[0029] The present disclosure also provides an in vitro preparation method of a ubiquitinated target protein, including: subjecting a target protein, the eSCR fusion protein described above, an F-box protein, a UAE El, a UCE E2, and a ubiquitin monomer to the reaction system to obtain the ubiquitinated target protein.

[0030] In the method described above, the reaction system may further include 50 mM Tris-HCl buffer (pH 7.4), MgCh, DTT, and / or ATP;

[0031] and / or, the reaction may be conducted at 22°C to 37°C, such as 28°C; and

[0032] and / or, the reaction may be conducted for 1 h to 2 h.

[0033] Specifically, the reaction system for preparing the ubiquitin chain may be obtained by adding MgCh, DTT, ATP, the eSCR fusion protein, an F-box protein, an UAE El, an UCE E2, and an ubiquitin monomer to 50 mM Tris-HCl buffer (pH 7.4), and a content of each component in the reaction system may be as follows: MgCh: 10 mM, DTT: 2 mM, ATP: 5 mM, eSCR fusion protein: 0.8 pg / 30 pL, UAE El: 50 ng / 30 pL, UCE E2: 200 ng / 30 pL, and Ubiquitin: 5 pg / 30 pL.

[0034] Specifically, the reaction system for preparing the ubiquitinated target protein may be obtained by adding MgCh, DTT, ATP, the eSCR fusion protein, an F-box protein, an UAE El, an UCE E2, an ubiquitin monomer, and a target protein to 50 mM Tris-HCl buffer (pH 7.4), and a content of each component in the reaction system may be as follows: MgCh: 10 mM, DTT: 2 mM, ATP: 5 mM, eSCRfusion protein: 0.8 pg / 30 pL, UAE El: 50 ng / 30 pL, UCEE2: 200 ng / 30 pL, Ubiquitin: 5 pg / 30 pL, and target protein: 100 ng / 30 pL.

[0035] In an embodiment of the present disclosure, the UAE El is Oryza sativa L. El.

[0036] In an embodiment of the present disclosure, the UAE El is human El.

[0037] In an embodiment of the present disclosure, the UCE E2 is OsUBC14.

[0038] In an embodiment of the present disclosure, the UCE E2 is HsUbcH5C.

[0039] In an embodiment of the present disclosure, the UCE E2 is HsCDC34. 04 04 25

[0040] The ubiquitin monomer may be a ubiquitin monomer of a corresponding species.

[0041] In an embodiment of the present disclosure, the target protein may be D53-HA.

[0042] In an embodiment of the present disclosure, the target protein may be Sic 1-HA.

[0043] The present disclosure also provides a reagent kit, including the eSCR fusion protein and the F-box protein.

[0044] The reagent kit may further include 50 mM Tris-HCl buffer (pH 7.4), MgCh, DTT, ATP, UAE El, UCE E2, and / or a ubiquitin monomer.

[0045] The reagent kit may be composed only of the eSCR fusion protein and the F-box protein, and may also be composed of the eSCR fusion protein, the F-box protein, and at least one selected from the group consisting of the following: 50 mM Tris-HCl buffer (pH 7.4), MgCh, DTT, ATP, UAE El, UCE E2, and a ubiquitin monomer.

[0046] The reagent kit may be used to prepare an E3 ligase, and may also be used to prepare a ubiquitin chain or a ubiquitinated target protein.

[0047] The eSCR fusion protein or a biological material associated with the eSCR fusion protein also belongs to the protection scope of the present disclosure, where the biological material is any one selected from the group consisting of Bl) to B5):

[0048] Bl) a nucleic acid encoding the eSCR fusion protein;

[0049] B2) an expression cassette carrying the nucleic acid described in Bl);

[0050] B3) a recombinant vector carrying the nucleic acid described in Bl) or a recombinant vector carrying the expression cassette described in B2);

[0051] B4) a recombinant microorganism carrying the nucleic acid described in Bl), a recombinant microorganism carrying the expression cassette described in B2), or a recombinant microorganism carrying the recombinant vector described in B3); and

[0052] B5) a cell line carrying the nucleic acid described in B1), a cell line carrying the expression cassette described in B2), or a cell line carrying the recombinant vector described in B3).

[0053] The nucleic acid described in Bl) may be selected from the group consisting of bl 1), bl2), b 13), bl4), or bl5):

[0054] b 11) a cDNA or DNA molecule with a coding sequence from position 28 to position 3186 of SEQ ID NO: 1 in the sequence listing;

[0055] b 12) a DNA molecule from position 28 to position 3186 of SEQ ID NO: 1 in the sequence listing;

[0056] b 13) a DNA molecule shown in SEQ ID NO. 1 in the sequence listing;

[0057] bl4) a cDNA or DNA molecule that has 75% or more identity with the nucleotide sequence defined in bl 1), bl2), or b 13) and encodes the eSCR fusion protein; and

[0058] bl5) a cDNA or DNA molecule that can hybridize with the nucleotide sequence defined 04 04 25 in bl 1), b 12), bl3), or bl4) under strict conditions and encodes the eSCR fusion protein.

[0059] The nucleic acid can be DNA, such as cDNA, genomic DNA (gDNA), or recombinant DNA; and the nucleic acid can also be RNA, such as mRNA or hnRNA.

[0060] Those of ordinary skill in the art can easily conduct mutation on the nucleotide sequence encoding the eSCR fusion protein of the present disclosure using a known method such as site-directed mutation. As long as those artificially-modified nucleotide sequences that have 75% or more identity with the nucleotide sequence encoding the eSCR fusion protein isolated in the present disclosure can encode the eSCR fusion protein and have the function of the eSCR fusion protein, they are all derived from and equivalent to the nucleotide sequence of the present disclosure.

[0061] The term "identity" used herein refers to sequence similarity to a natural nucleic acid sequence. The "identity" includes 75% or more, 85% or more, 90% or more, or 95% or more identity with the nucleotide sequence encoding the eSCR fusion protein of the present disclosure. The identity can be evaluated by naked eyes or computer software. When computer software is used, the identity among two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity among related sequences.

[0062] The strict conditions may be as follows: hybridizing at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO4, and 1 mM ethylenediaminetetraacetic acid (EDTA), and rinsing at 50°C with 2 x saline sodium citrate (SSC) and 0.1% SDS; the strict conditions may also be as follows: hybridizing at 50°C in a mixed solution of 7% SDS, 0.5 MNaPO4, and 1 mM EDTA, and rinsing at 50°C with 1 x SSC and 0.1% SDS; the strict conditions may also be as follows: hybridizing at 50°C in a mixed solution of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and rinsing at 50°C with 0.5 x SSC and 0.1% SDS; the strict conditions may also be as follows: hybridizing at 50°C in a mixed solution of 7% SDS, 0.5 MNaPO4, and 1 mMEDTA, and rinsing at 50°C with 0.1 x SSC and 0.1% SDS; the strict conditions may also be as follows: hybridizing at 50°C in a mixed solution of 7% SDS, 0.5 M NaPO4, and 1 mM EDTA, and rinsing at 65°C with 0.1 x SSC and 0.1% SDS; the strict conditions may also be as follows: hybridizing at 65°C in a solution of 6 x SSC and 0.5% SDS, and then rinsing with 2 x SSC and 0.1% SDS once and with 1 x SSC and 0.1% SDS once; the strict conditions may also be as follows: hybridizing at 68°C in a solution of 2 x SSC and 0.1% SDS, then rinsing at 68°C for 5 min twice, hybridizing at 68°C in a solution of 0.5 x SSC and 0.1% SDS, and rinsing at 68°C for 15 min twice; and the strict conditions may also be as follows: hybridizing at 65°C in a solution of 0.1 x SSPE (or O.lxSSC) and 0.1% SDS, and then rinsing.

[0063] The 75% or more identity mentioned above may be 80%, 85%, 90%, or 95% or more identity. 04 04 25

[0064] The expression cassette carrying the nucleic acid encoding the eSCR fusion protein (eSCR gene-expressing cassette) described in B2) refers to DNA capable of expressing the eSCR fusion protein in a host cell, which may include a promoter to initiate the transcription of the eSCR gene and a terminator to terminate the transcription of the eSCR gene. Further, the expression cassette may further include an enhancer sequence.

[0065] The recombinant vector carrying the eSCR gene-expressing cassette may be constructed using the existing expression vector.

[0066] In the use above, the vector may be selected from the group consisting of a plasmid, a bacmid, a phage, and a viral vector. The plasmid may be specifically a pFastBac Dual vector.

[0067] The recombinant vector described in B3) may be specifically a Flag-SKPl-Cullinl-RBXl-myc vector. The Flag-SKPl-Cullin 1-RBXl-myc vector may be a recombinant vector obtained by substituting a DNA fragment between EcoVX and Spel endonuclease recognition sequences of the pFastBac Dual vector with the eSCR fusion gene from position 1 to position 3219 of SEQ ID NO: 1 in the sequence listing.

[0068] The microorganism may be selected from the group consisting of yeast, bacteria, algae, and fungi.

[0069] The cell line may be a Sf9 insect cell line. The cell line does not include a propagating material.

[0070] The present disclosure also provides any use selected from the group consisting of the following, which also fall within the protection scope of the present disclosure:

[0071] XI) a use of the multisubunit SCF E3 ligase in the preparation of a ubiquitin chain or a ubiquitinated target protein;

[0072] X2) a use of the multisubunit SCF E3 ligase in the production of a product for preparing a ubiquitin chain or a ubiquitinated target protein;

[0073] X3) a use of the reagent kit in the preparation of a multi subunit SCF E3 ligase;

[0074] X4) a use of the reagent kit in the production of a product for preparing a multisubunit SCF E3 ligase;

[0075] X5) a use of the reagent kit in the preparation of a ubiquitin chain or a ubiquitinated target protein;

[0076] X6) a use of the reagent kit in the production of a product for preparing a ubiquitin chain or a ubiquitinated target protein;

[0077] X7) a use of the eSCR fusion protein or the biological material in the preparation of a multisubunit SCF E3 ligase;

[0078] X8) a use of the eSCR fusion protein or the biological material in the production of a product for preparing a multisubunit SCF E3 ligase; 04 04 25

[0079] X9) a use of the eSCR fusion protein or the biological material in the preparation of a ubiquitin chain or a ubiquitinated target protein; and

[0080] XI0) a use of the eSCR fusion protein or the biological material in the production of a product for preparing a ubiquitin chain or a ubiquitinated target protein.

[0081] Different multisubunit SCF E3 ligases are successfully prepared with the eSCR fusion protein through in vitro reconstitution in the present disclosure; the E3 ligase has biological activity; and the present disclosure has a wide range of potential applications in elucidating molecular mechanism of a multisubunit SCF E3 ligase.

[0082] The present disclosure will be described in further detail below with reference to specific examples. The examples given are only for the purpose of illustrating the present disclosure, and are not intended to limit the scope of the present disclosure. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and are not intended to limit the present disclosure in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0083] FIGs. 1A-B are schematic diagrams of a fusion protein Flag-eSCR-myc, where FIG. 1A shows a schematic diagram of the fusion protein Flag-SKPl-Cullinl-RBXl-myc (Flag-eSCR-myc); FIG. IB shows the amino acid sequence information of the fusion protein Flag-SKPl-Cullinl-RBXl-myc; and Flag-eSCR-myc represents an engineered fusion protein Flag-SKPl-Cullinl-RBXl-myc.

[0084] FIGs. 2A-C show the purification and quantification of a fusion protein, the detection of NEDD8 modification, and the detection results of self-ubiquitination activity, where FIG. 2A shows the Coomassie brilliant blue (CBB) staining quantification (left panel) and western blotting (WB) (right panel) results of the fusion protein expressed and purified in the baculovirus expression system; FIG. 2B shows the NEDD8 modification on the Cullinl protein in the fusion protein eSCR, and the experimental results show that the fusion protein eSCR has the NEDD8 modification, while the NEDD8 modification on the eSCK688AR fusion protein is deleted, indicating that the fusion protein eSCR used in this study is biologically active; and FIG. 2C shows the experimental results of detecting the self-ubiquitination activity of the fusion protein eSCR in an in vitro activity assay system (the anti-Ub antibody can recognize a signal of NEDD8 through a cross reaction, and the Cullinl protein in the Flag-eSCR-myc protein has the NEDD8 modification and thus can also be recognized by the anti-Ub antibody), and the experimental results show that the fusion protein Flag-eSCR-myc does not have self-ubiquitination activity in the in vitro activity assay system.

[0085] FIG. 3 shows the interaction between the fusion protein eSCR and the protein D3 verified 04 04 25 by GST-Pulldown, where the experimental results show that there is an interaction between the fusion protein eSCR and the protein D3; and Flag-eSCR-myc represents Flag-SKPl-Cullinl-RBXl-myc.

[0086] FIG. 4 shows the preparation of a multisubunit SCFD3 E3 ligase with the fusion protein Flag-eSCR-myc through in vitro reconstitution, where the experimental results show that, in the presence of OsEl, OsUbiquitin, and OsUBC14, compared with the preparation of wild-type SCFD3 E3 ligase (WT SCFD3 E3 ligase) through in vitro reconstitution using the SKP1 protein, Cullinl protein, RBX1 protein, and D3 protein, an engineered SCFD3E3 ligase (eSCFD3E3 ligase) can also be effectively reconstituted using the fusion protein eSCR and the protein D3 to form a polyubiquitin chain.

[0087] FIGs. 5A-B shows the experimental results of D53’s ubiquitination by the eSCFD3 E3 ligase obtained through in vitro reconstitution using a fusion protein Flag-eSCR-myc and a protein D3, where FIG. 5 A shows the experimental results of D53 ’ s ubiquitination by the eSCFD3 E3 ligase, and the experimental results show that the eSCFD3 E3 ligase can effectively ubiquitinate the protein D53 in the presence of OsEl, OsUbiquitin, and OsUBC14; and FIG. 5B shows that, addition of strigolactone receptor protein TRX-D14 and strigolactone analog rac-GR24, the ubiquitination level of D53 by the eSCFD3 E3 ligase is enhanced, and the experimental results show that the eSCFD3E3 ligase has the same sensitivity as the WT SCFD3E3 ligase and thus can be used to detect the strigolactone signal transduction, which provides a powerful technical analysis platform for studying the strigolactone signaling pathway.

[0088] FIG. 6 shows the interaction between the fusion protein Flag-eSCR-myc and the protein GID2 verified by GST-Pulldown, where the experimental results show that there is an interaction between the fusion protein Flag-eSCR-myc and the protein GID2.

[0089] FIG. 7 shows the preparation of a multisubunit eSCFGID2 E3 ligase with the fusion protein Flag-eSCR-myc through in vitro reconstitution, where the experimental results show that, in the presence of OsEl, OsUbiquitin, and OsUBC18, the eSCFGID2E3 ligase can be effectively prepared with the fusion protein Flag-eSCR-myc and the protein GID2 through in vitro reconstitution and a polyubiquitin chain can be formed.

[0090] FIGs. 8A-B show the preparation of an active eSCF E3 ligase with the fusion protein Flag-eSCR-myc and an F-box protein derived from other species through reconstitution, where FIG. 8A shows the preparation of an eSCFFBXL18 E3 ligase with the fusion protein Flag-eSCR-myc and a human-derived FBXL18 protein through in vitro reconstitution, and the experimental results show that, in the presence of HsEl, HsUbiquitin, and HsUbcH5C, the eSCFFBXL18E3 ligase can be effectively prepared with the fusion protein Flag-eSCR-myc and the protein FBXL18 through reconstitution and a polyubiquitin chain can be formed; and FIG. 8B shows the preparation of an 04 04 25 eSCFCDC4 E3 ligase with the fusion protein Flag-eSCR-myc and human-derived CDC4 through in vitro reconstitution, and the experimental results show that, in the presence of HsEl, HsUbiquitin, and HsCDC34, the eSCFCDC4 E3 ligase can be effectively prepared with the fusion protein Flag-eSCR-myc and the protein CDC4 through in vitro reconstitution to form a polyubiquitin chain.

[0091] FIG. 9 shows the experimental results of ubiquitination of the substrate protein Sic 1-HA by the eSCFCDC4 E3 ligase obtained through in vitro reconstitution using a fusion protein Flag-eSCR-myc and a protein CDC4, where the experimental results show that the eSCFCDC4 E3 ligase can catalyze the ubiquitination of the substrate protein Sicl-HA.

[0092] In the figures, Ub represents ubiquitin. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0093] Unless otherwise specified, the experimental methods described in the following examples are all conventional methods. The methods will be conducted in accordance with the techniques or conditions described in the literature in the art or in accordance with the product specification. All materials, reagents, and instruments used in the following examples may be commercially available, unless otherwise specified. All quantitative tests in the following examples are set to run in triplicate, and the results are averaged. In the following examples, unless otherwise specified, the first nucleotide of each nucleotide sequence in the sequence listing is a 5'-terminus nucleotide of the corresponding DNA / RNA, and the last nucleotide is a 3'-terminus nucleotide of the corresponding DNA / RNA.

[0094] 50 mM Tris-HCl buffer (pH 7.4): Tris is dissolved in water, and a pH is adjusted with HC1 to 7.4, where a concentration of Tris is 50 mM.

[0095] Example 1 Preparation of an Oryza sativa L.-derived eSCFD3 E3 ligase with a fusion protein Flag-eSCR-myc through in vitro reconstitution, and a use of the Oryza sativa L.-derived eSCFD3 E3 ligase

[0096] In this example, in the presence of OsEl, OsUbiquitin, and OsUBC14, a fusion protein eSCR and a protein D3 were used to prepare an Oryza sativa L.-derived multisubunit SCF E3 ligase through in vitro reconstitution, and specific steps were as follows:

[0097] In this example, in order to simplify an in vitro active reconstitution system for a multisubunit SCFD3E3 ligase, the three proteins SKP1, Cullinl, and RBX1 were fused in tandem to obtain a fusion protein Flag-SKPl-Cullinl-RBXl-myc (Flag-eSCR-myc), and a schematic diagram and an amino acid sequence of the fusion protein were shown in FIGs. 1A-B, respectively. An active fusion protein eSCR was prepared as follows:

[0098] 1.1 Preparation of a recombinant vector

[0099] A Flag-SKPl-Cullinl-RBXl-myc-expressing vector was constructed with a pFastBac 04 04 25 Dual vector (ThermofisherR™, catalog No.: 10712024), and a nucleotide sequence for Flag-SKPl-Cullinl-RBXl-myc was synthesized by Beijing Shengyuan Kemeng Gene Biotechnology Co., Ltd. With a synthesized Flag-SKPl-Cullinl-RBXl-myc gene fragment as a template, a plasmid was constructed using primers PHSCRFLAGF and PHSCRMYCR (Table 2), and a corresponding promoter was a PH promoter. Specifically, a DNA fragment between EcoRI and Spel endonuclease recognition sequences of the pFastBac Dual vector was substituted with the eSCR fusion gene from position 1 to position 3219 of SEQ ID NO: 1 in the sequence listing to obtain a vector Flag-SKPl-Cullinl-RBXl-myc, which could express the fusion protein Flag-eSCR-myc with a sequence from position 1 to position 1072 of SEQ ID NO: 2. The obtained recombinant vector was denoted as pFastBac Dual-pPH: Flag-SKPl-Cullinl-RBXl-myc.

[0100] Table 2 Sequence information of primers

[0101] Primer name Sequence (5'-3') PHSCRFLAGF TTTGAATTCATGGACTACAAAGACGATGACGACAAGATGGCGGCCGAGGCGGAG (SEQ ID NO: 8) PHSCRMYCR TTTACTAGTCTACAGATCCTCTTCTGAGATGAGTTTTTGTTCGTGCCCATATTTCTGAAA (SEQ ID NO: 9) CUL1K688AF fTTATffAATTCTfirCTATTATG fTY'; A PTPPP A A A PT A TTPPPTP A TP / ^l.'nlDWY 1A\ AJVd 1 Pdd 1 1 AT 1 AtA^AT Id 1 1 d 1 AJ Al A. AT TA kJ 1 A.AJA.dddAJ Id 1 1 AIvTAJ 1 ATA 1 A- ( lU IN Az. 1V J CUL1K688AR GATGACCCAATACTTTGCGACTCGCCATAATACGCACAATTGATGC (SEQ ID NO: 11) M13F GTTTTCCCAGTCACGAC (SEQ ID NO: 12) M13R CAGGAAACAGCTATGAC (SEQ ID NO: 13) GWOSUBF GGGGACAAGTTTGTACAAAAAAGCAGGCTTTATGCAGATCTTTGTGAAGACAT (SEQ ID NO: 14) GWOSUBR PPPPAPP A PTTTPT AP A a PA a AflCTf’rGf’rTTTT APPP APP APPP A PPPPPAPP TITI HA MA-U\JUkJ / ALv / \vl 1 1 AT 1 / \VddAJdddvJV 1 AJATAJ1 1 1 IdAIAvdvvdvAJAJ.AAJAJvUAI / AAIAJ q'EQ LU 1NAJ. 15) Q^OSUBC14F GGGGACAAGTTTGTACAAAAAAGCAGGCTTTATGGCGTCAAAGAGGATACAGAAGGAG (SEQ ID NO: 16) GWOSUBC14R GGGGACCACTTTGTACAAGAAAGCTGGGTTCTACATGGCGTACCTCTGAGTCCAG (SEQ ID NO: 17) GWOSUBC18F GGGGACAAGTTTGTACAAAAAAGCAGGCTTTATGGCAAGCAAAAGGATTCAGAAGG (SEQ ID NO: 18) nWOSiT IRC' 1 QR VJ W A / 0 IJIJA.1 Oltx. PPPPAPP APTTTPTAP A A PA A APPTPPPTTPTA A PPP A TTPPPT A TTTPTPPPTP ZQT7P TIA ATAJATAJdVA-dA-1 1 1 AT 1 dAAdAJdddAJA 1 AJATAJ llv 1 rmAvv / 11 1 ATA^AT Id 1 1 1 V 1 AJATAJ 1 A JU NO: 19) GWOSE1F GGGGACAAGTTTGTACAAAAAAGCAGGCTTTATGCTTCCGACGAAGAGAGCGAACG (SEQ ID NO: 20) GWOSE1R GGGGACCACTTTGTACAAGAAAGCTGGGTTCTACCGGAAGTAAATGGAGATGAGA (SEQ ID NO: 21) GWD14F PPPPAPA APTTTPTAP A A A A A A PP A PPPTTT A TPPTPPP A TPP A PPP A TPPPPPP fQRP TIT AJAJAJAJdWddAJ 1 1 1 AJ 1 dAYVVVVVAUvdAJAJAH 1 1 d 1 AIW 1 ATA. Aid 1 A-AJdA^ATA^d 1 A^A-AJA^A^AJ yOLLAc LU NO: 22) GWD14R GGGGACCACTTTGTACAAGAAAGCTGGGTTTTAGTACCGGGCGAGAGCGCGGCG (SEQ ID NO: 23) 04 04 25 GWD3F GGGGACAAGTTTGTACAAAAAAGCAGGCTTTATGGCGGAAGAGGAGGAGGTGGAGG (SEQ ID NO: 24) GWD3R GGGGACCACTTTGTACAAGAAAGCTGGGTTCTAATCATCAATTTGCCGGCTGTTC (SEQ ID NO: 25) PHD3FF TTTGGATCC ATGGCGGAAGAGGAGGAG (SEQ ID NO: 26) PHD3FR TTTGAATTCCTACTTGTCGTCATCGTCTTTGTAGTCATCATCAATTTGCCGGCTG (SEQ ID NO: 27) PHCUL1FF TTTGAATTC ATGGCGACCCACGAGCGGA (SEQ ID NO: 28) PHCUL1FR TTTACTAGTTCACTTGTCGTCATCGTCTTTGTAGTCAGCCAAGTATCTGTACACA (SEQ ID NO: 29) GWSKP1F GGGGACAAGTTTGTACAAAAAAGCAGGCTTTATGGCGGCCGAGGCGGAGACGAAGGCGAT GATCA (SEQ ID NO: 30) GWSKP1R GGGGACCACTTTGTACAAGAAAGCTGGGTTTCATTCGAAGGCCCACTGGTTCTCCCTCCTCA C (SEQ ID NO: 31) P10SKP1F TTTGCTAGC ATGGCGGCCGAGGCGGAG ( S| q ID NO: 32) P10SKP1R TTTGGTACCTCA TTCGAAGGCCCACTGGT (SEQ ID NO: 33) GWRBX1F GGGGACAAGTTTGTACAAAAAAGCAGGCTTTATGTCGGCCATGGAGACCGACATCAAC (SEQ ID NO: 34) GWRBX1R GGGGACCACTTTGTACAAGAAAGCTGGGTTCTAGTGCCCATATTTCTGAAATTCC (SEQ ID NO: 35) P10RBX1F TTTr^nT a fin ATnTnnnrYVATn.nAnAf yvia fcnn tu mo- qm 111 vTk. 1 / \\.Tv. / 11 kJ 1 v.-vJvTv. V.- / A 1 VTvJ / AvJ / Av^k^vJ7A 11 J INvz. JO) P10RBX1R ^^^^Cccta GTGCCCATATTTCTGAAA (SEQ ID NO: 37) GWGID2F GGGGACAAGTTTGTACAAAAAAGCAGGCTTTATGAAGTTCCGCTCTGATTCGTC (SEQ ID NO: 38) GWGID2R GGGGACCACTTTGTACAAGAAAGCTGGGTTCTACCCGCATTGGCCCCCTCCATTC (SEQ ID NO: 39) PHGID2FF TTTGAATTCATGAAGTTCCGCTCTGATTCGTCAG (SEQ ID NO: 40) PHGID2FR TTTTCTAGATCACTTGTCGTCATC GTCTTTGTy\.GTCCCCGC2AkTTGGCCCCCTCCjATTC 1'1 AlTC (SEQ ID NO: 41) PHD53INF CATCGGGCGCGGATCCATGCCCACTCCGGTGGCCGCCGCG (SEQ ID NO: 42) PHD53INHAR GTAGGCCTTTGAATTCTCAAGCGTAATCTGGAACATCGTATGGGTAACAATCTAGAATT ATTCTTGGC (SEQ ID NO: 43) PHHsSiclF CGACGAGCTCACTAGTATGGACGGGACTATTAAGGAGGCT (SEQ ID NO: 44) PHHsSic 1HAR GACTGCAGGCTCTAGATCAAGCGTAATCTGGAACATCGTATGGGTAGTAGTAGCTGCCTAA GTGTGAAGG (SEQ ID NO: 45)

[0102] In SEQ ID NO: 1, a sequence from position 1 to position 27 was a DNA sequence of Flag, a sequence from position 28 to position 552 was a DNA sequence of SKP1, a sequence from position 565 to position 2796 was a DNA sequence of Cullinl, a sequence from position 2809 to position 3186 was a DNA sequence of RBX1, and a sequence from position 3187 to position 3219 was a DNA sequence of myc; and in SEQ ID NO: 2, a sequence from position 1 to position 9 was an amino acid sequence of Flag, a sequence from position 10 to position 184 was an amino acid sequence of SKP1, a sequence from position 189 to position 932 was an amino acid sequence of 04 04 25 Cullinl, a sequence from position 937 to position 1062 was an amino acid sequence of RBX1, and a sequence from position 1063 to position 1072 was an amino acid sequence of myc. In addition, in order to obtain a functional fusion protein eSCR, linker sequences were added among the protein SKP1, protein Cullinl, and protein RBX1 to ensure the effective interaction among the proteins. In SEQ ID NO: 1, a sequence from position 553 to position 564 and a sequence from position 2797 to position 2808 were DNA sequences encoding linkers; and in SEQ ID NO: 2, a sequence from position 185 to position 188 and a sequence from position 933 to position 936 were amino acid sequences of the linkers.

[0103] 1.2 Expression of the fusion protein Flag-eSCR-myc

[0104] Cultivation conditions for adherent growth of Sf9 insect cells (NovagenR™, catalog No: 71104-1 ML): static cultivation at 26°C to 28°C; and cultivation conditions for suspended growth of Sf9 insect cells: suspended cultivation at 26°C to 28°C and a low rotational speed (generally 130 rpm to 150 rpm). The pFastBac Dual-pPH : Flag-SKP 1 -Cullinl-RBX1 -myc plasmid was transformed into ^.Escherichia coli (E. coll) strainDHlOBac, blue-white screening was conducted, and white-spot signal clones were picked and cultivated under shaking; and Bacmid DNA was extracted and identified by PCR with M13F and M13R primers (Table 2) for later use (main operations could be found in the Operation Guide for Bac-to-Bac BaculovirusExpression System of InvitrogenRTM).

[0105] Sf9 insect cells growing adherently were transfected with Bacmid DNA expressing the Flag-SKPl-Cullinl-RBXl-myc (abbreviated as Flag-eSCR-myc) fusion protein according to instructions of the Cellfectin II Reagent (InvitrogenR™, catalog No.: 10362-100) to prepare a Pl insect baculovirus, and 72 h after the cell transfection, a Pl virus was collected. The Pl insect baculovirus was used to infect Sf9 insect cells growing adherently to obtain a P2 insect baculovirus. P3 and P4 insect baculoviruses were acquired in the same way (main operations could be found in the Operation Guide for Bac-to-Bac BaculovirusExpression System of InvitrogenR™).

[0106] An active Flag-eSCR-myc fusion protein was acquired by an insect baculovirus expression system: Sf9 insect cells in suspended growth were infected with the P4 insect baculovirus (a growth density of virus-infected cells was generally 2 * 10'7mL) to allow the expression of a target protein, and generally, 48 h after the viral infection, the insect cells were collected through centrifugation for protein purification.

[0107] 1.3 Purification of the fusion protein Flag-eSCR-myc

[0108] Sf9 insect cells infected with the P4 insect baculovirus obtained in step 1.2 were resuspended with a pre-cooled protein-extracting solution I (formula: 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 10 mM NaF, 2 mM EDTA (pH 8.0), 10% (v / v, volume percentage) glycerol, 0.5% (v / v, volume percentage) Nonidet P-40, and ingredients added before use: 1 mM PMSF and 1 mM 04 04 25 DTT), then disrupted by a high-pressure cell disruptor (JNBIO, model: JN-3000Plus), and then centrifuged at 4°C and 15,000 g for 20 min, and a resulting protein supernatant was collected.

[0109] Flag-eSCR-myc was subjected to affinity purification with Anti-Flag M2 affinity gel (SigmaR™, catalog No.: A2220-5ML) according to instructions; a Flag-eSCR-myc protein obtained after the affinity purification was further purified with an anion-exchange column CaptoHiRes Q5 / 50 (GE HealthcareR™, catalog No.: 29-2758-78), and fractions with high purity and concentration for the Flag-eSCR-myc protein were combined, subjected to buffer exchange with a corresponding ultrafiltration (UF) tube (MilliporeR™, catalog No.: UFC503096), and placed in a Nonidet P-40-free protein-extracting solution I (formula: 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 10 mM NaF, 2 mM EDTA (pH 8.0), 10% (v / v, volume percentage) glycerol, and ingredients added before use: 1 mM PMSF and 1 mM DTT); and a resulting solution of the fusion protein Flag-eSCR-myc was then dispensed and cryopreserved at - 80°C for later use. The purified fusion protein Flag-eSCR-myc was tested and quantified through CBB staining and WB analysis (FIG. 2A). An antibody used for WB analysis was an anti-myc antibody (Cell Signaling Technology11™, catalog No.: 2276).

[0110] 1.4 Verification of whether the fusion protein Flag-eSCR-myc has biological activity

[0111] The NEDD8 modification on the Cullin 1 protein is essential for the biological activity of the Cullinl protein, and the NEDD8 modification occurs at the Lysine 688 (K688) site of the Cullin 1 protein in rice. Therefore, to determine the biological activity of the obtained fusion protein, it is necessary to detect whether the Cullinl protein in the fusion protein has NEDD8 modification. WB analysis results showed that the purified fusion protein Flag-eSCR-myc obtained in step 1.3 had NEDD8 modification, while the fusion protein Flag-SCK688AR-myc did not have an NEDD8 modification signal (In FIG. 2B), indicating that the fusion protein Flag-eSCR-myc was biologically active. Antibodies used for WB analysis were an anti-Flag antibody (SigmaR™, catalog No.: A8592) and an anti-NEDD8 antibody (Cell signaling technology11™, catalog No.: 2745).

[0112] The fusion protein Flag-SCK688AR-myc was prepared through the following steps:

[0113] With pFastBac Dual-pPH: Flag-SKP1-Cullin 1-RBXl-myc as a template, CUL1K688AF and CUL1K688AR primers (Table 2) and QuikChange Site-Directed Mutagenesis Kit (StratageneR™, catalog No.: 200518) were used to mutate a nucleotide for encoding the Lysine 688 site to obtain a recombinant vectorpFastBac Dual-pPH: Flag-SKP 1-Cullin 1K688A-RBX1-my c for encoding the fusion protein Flag-SKP 1-CullinlK688A-RBXl-myc; and then the fusion protein Flag-SKP 1-Cullin I K688A-RBXl-myc was subjected to expression, purification, and detection according to step 1.2 and step 1.3. Compared with the WT fusion protein Flag-eSCR-myc, an amino acid at position 688 (namely, position 876 of SEQ ID NO: 2) of Cullinl in Flag-eSCK688AR- 04 04 25 myc was mutated from lysine to alanine, and there was no NEDD8 modification on the Flag-SCK688AR_myc (In FIG. 2B). Experimental results showed that the fusion protein Flag-eSCR-myc used in this experiment was biologically active. [0H4] 1.5 Verification of whether the fusion protein Flag-eSCR-myc has self-ubiquitination activity in an in vitro ubiquitination modification system

[0115] A self-ubiquitination reaction system was obtained by adding MgCh (SigmaR™, catalog No.: M2670), DTT (SigmaR™, catalog No.: D0632), ATP (SigmaR™, catalog No.: A7699), His-OsEl, His-OsUBC14, His-OsUbiquitin, and the Flag-eSCR-myc obtained in step 1.3 to 50 mM Tris-HCl buffer (pH 7.4), a reaction system usually had a volume of 30 pL, and a content of each component in the system was as follows: MgCk: 10 mM, DTT: 2 mM, ATP: 5 mM, His-OsEl: 50 ng, His-OsUBC14: 200 ng, His-OsUbiquitin: 5 pg, and the Flag-eSCR-myc obtained in step 1.3: 0.8 pg. A system without Flag-eSCR-myc was adopted as a negative control.

[0116] The reaction system was subjected to a reaction at 28°C for 2 h. After the reaction was completed, WB analysis was conducted with an anti-Ubiquitin antibody (a product of Cell Signaling Technology11™).

[0117] Experimental results showed that the fusion protein Flag-eSCR-myc had no self-ubiquitination activity in the in vitro reconstitution system (In FIG. 2C).

[0118] The His-OsEl protein, His-OsUBC 14 protein, and His-OsUbiquitin protein were prepared as follows:

[0119] al) With cDNA of a stem base of an Oryza sativa L. Nipponbare seedling as a template, GWOsElF and GWOsEIR primers, GWOsUBC14F and GWOsUBC14R primers, and GWOSUBF and GWOSUBR primers (Table 2) were used to acquire an OsEl gene-containing DNA fragment, an OsUBC14 gene-containing DNA fragment, and an OsUb gene-containing DNA fragment through PCR amplification, respectively.

[0120] a2) The OsEl, OsUBC14, and OsUb gene fragments each were homologously recombined to an intermediate vector pDONR221 (InvitrogenR™, catalog No.: 12535-019) using GatewayBP clonase (InvitrogenR™, catalog No.: P / N56481) to obtain plasmids pDONR221-OsEl, pDONR221-OsUBC14, andpDONR221-OsUb, respectively.

[0121] a3) A gene fragment on the plasmid pDONR221-OsEl was recombined to the terminal protein expression vector pET-55-DEST (NovagenR™, catalog No.: 71846, which had a His tag at a C-terminus and a Strep-tag at an N-terminus) using Gateway LR clonase (InvitrogenR™, catalog No.: P / N56484); gene fragments on pDONR221-OsUBC14 and pDONR221-OsUb each were homologously recombined to the terminal protein expression vector pET-61-DEST (NovagenR™, catalogNo.: 71852, which had a Hi stag at an N-terminus) by the same method; and sequencing was conducted for confirmation to obtain plasmids pET-5 5-DEST-OsEl, pET-61- 04 04 25 DEST-OsUBC 14, and pET-61-DEST-OsUb for the overexpression of the protein OsEl, protein OsUBC14, and protein OsUb, respectively. Genes encoding the protein OsEl, protein OsUBC14, and protein OsUb had accession numbers of LOC Os03gl8380 (update date: 2021.7.1), LOC Os01g46926 (update date: 2021.7.1), and LOC Os05g42424 (update date: 2021.7.1) (http: / / rice.plantbiology.msu.edu / ), respectively.

[0122] a4) The plasmids pET-55-DEST-OsEl, pET-61-DEST-OsUBC 14, and pET-61-DEST-OsUb each were transformed into a protein-expressing E. coll strain BL21 (DE3)', monoclones were picked, inoculated into 10 mL of an LB liquid medium (formula: 10 g / L Tryptone, 5 g / L yeast extract, and 10 g / L NaCl), and cultivated overnight at 37°C for bacterial activation; an activated bacterial culture was subjected to expanded cultivation at 37°C according to a ratio of 1:100 and cultured until ODeoo was 0.8, then isopropyl-P-D-thiogalacto side (IPTG) was added at a final concentration of 0.3 mM, and the protein expression was induced at 16°C and 180 rpm generally for 16 h to 20 h; and bacteria were collected through centrifugation to obtain His-OsEl protein-expressing bacteria, His-OsUBC14 protein-expressing bacteria, and His-OsUb proteinexpressing bacteria.

[0123] a5) The His-OsEl protein-expressing bacteria, His-OsUBC 14 protein-expressing bacteria, and His-OsUb protein-expressing bacteria each were resuspended with a protein-extracting solution I (formula: 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 10 mM NaF, 20 mM imidazole, 10% (v / v) Glycerol, 0.5% (v / v) Nonidet P-40, and ingredients added before use: 1 mM PMSF and 1 mM DTT), disrupted with a high-pressure cell disruptor (JNBIO, model: JN-3000Plus), and centrifuged at 4°C and 15,000 g for 20 min; resulting protein supernatants each were collected and incubated with the Ni Sepharose 6 Fast Flow resin packing (GE Healthcare1*™, catalog No.: 17-5318-01) according to instructions; and after the incubation was completed, resin packings combining the His-OsEl protein, His-OsUBC14 protein, and His-OsUb protein each were rinsed with a protein-extracting solution II, and then the His-OsEl protein, His-OsUBC14 protein, and His-OsUb protein each were eluted and collected with 50 mM imidazole, 100 mM imidazole, 250 mM imidazole, and 500 mM imidazole to obtain the His-OsEl protein, His-OsUBC 14 protein, and His-OsUb protein.

[0124] 1.6 Verification of an interaction between the fusion protein Flag-eSCR-myc and the protein D3

[0125] A GST-D3 protein was prepared through the following steps:

[0126] bl) With cDNA of a stem base of an Oryza saliva L. Nipponbare seedling as a template, GWD3F and GWD3R primers (Table 2) were used to clone a D3 gene fragment to the terminal protein overexpression plasmid pET-60-DEST (NovagenR™, catalog No.: 71851, which had a GST tag at an N-terminus) according to steps al) to a3) in 1.5 to obtain a plasmid pET-60-DEST- 04 04 25 D3, where a gene encoding the protein D3 had an accession number of LOC 0s06g06050 (update date: 2021.7.1) (http: / / rice.plantbiology.msu.edu / ). b2) The protein GST-D3 was expressed and purified according to steps a4) and a5) in 1.5, where the protein GST-D3 was purified with a Glutathione Sepharose 4 Fast Flow (GE HealthcareR™, catalog No.: 17-5132-01) resin packing; bacteria were resuspended with a protein-extracting solution II (formula: 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 10 mM NaF, 2 mM EDTA (pH 8.0), 10% (v / v) Glycerol, 0.5% (v / v) Nonidet P-40, and ingredients added before use: 1 mM PMSF and 1 mM DTT); and the resulting GST-D3 agarose gel could be used for a GST-D3 pulldown test.

[0127] The fusion protein Flag-eSCR-myc obtained from steps 1.1 to 1.3 was taken, the agarose gel including 1 mg of the protein GST-D3 were mixed with 100 pL of a Flag-eSCR-myc fusion protein lysate, and a resulting mixture was incubated at 4°C and 10 rpm for 1 h to 2 h. After the incubation was completed, the mixture was centrifuged at a low speed, a resulting supernatant was removed, and the agarose gel were washed with a protein-extracting solution I (formula: 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 10 mM NaF, 2 mM EDTA (pH 8.0), 10% (v / v, volume percentage) Glycerol, 0.5% (v / v, volume percentage) Nonidet P-40, and ingredients added before use: 1 mM PMSF and 1 mM DTT) 4 to 5 times. WB analysis was conducted with an anti- myc antibody (Cell Signaling TechnologyR™, catalog No.: 2276).

[0128] The interaction between the fusion protein eSCR and the protein D3 was verified by the GST-D3 Pulldown assay, and results showed that there was an interaction between the fusion protein eSCR and the protein D3 (FIG. 3).

[0129] 1.7 Preparation of an eSCFD3 E3 ligase with the fusion protein Flag-eSCR-myc through in vitro reconstitution

[0130] A system for preparing the eSCFD3 E3 ligase with the fusion protein Flag-eSCR-myc through in vitro active reconstitution was obtained by adding MgCh, DTT, ATP, His-OsEl, His-OsUBC14, His-OsUbiquitin, D3-Flag, and the Flag-eSCR-myc obtained in step 1.3 to 50 mM Tris-HCl buffer (pH 7.4), a reaction system usually had a volume of 30 pL, and a content of each component in the reaction system was as follows: MgCh: 10 mM, DTT: 2 mM, ATP: 5 mM, His-OsEl: 50 ng, His-OsUBC14: 200 ng, His-OsUbiquitin: 5 pg, D3-Flag: 0.5 pg, and Flag-eSCR-myc: 0.8 pg. In order to ensure a consistent start time for parallel reactions, the components were added in the following order during the activity analysis test: His-OsUBC14, His-OsUbiquitin, an eSCFD3 complex (including the two components of D3-Flag and Flag-eSCR-myc, where an addition order of the components was not strictly restricted), His-OsEl, and 20 x reaction buffer (formula: 1 M Tris (pH 7.4), 200 mM MgCh, 100 mM ATP, and 40 mM DTT). The three proteins of Cullinl-Flag, His-SKPl, and His-RBXl each were used as controls instead of Flag-eSCR-myc.

[0131] The in vitro ubiquitination assay sample was subjected to a reaction at 28°C for 2 h^ after 04 04 25 the reaction was completed, 6 x SDS sample loading buffer was added to terminate the reaction; and an active reaction sample was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and WB analysis, then incubated with an anti-Ubiquitin antibody (Cell Signaling Technology11™, catalog No.: 3936) and an anti-mouse-HRP antibody (GE HealthcareR™, catalog No.: NA931V) successively, and subjected to development. Experimental results showed that, compared with the WT SCFD3 E3 ligase obtained through reconstitution (namely, a ligase obtained through the reconstitution of Cullinl-Flag, His-SKPl, and His-RBXl with D3-Flag), the eSCFD3 E3 ligase obtained through the reconstitution of the fusion protein Flag-eSCR-myc with the protein D3 also has E3 ligase activity (FIG. 4).

[0132] The protein D3-Flag and the protein Cullinl-Flag each were prepared through the following steps:

[0133] Construction of a plasmid co-expressing the protein Cullinl-Flag and the protein RBX1 and a plasmid co-expressing the protein D3-Flag and the protein SKP1: Because the protein RBX1 could promote the NEDD8 modification of the protein Cullinl to enhance the activity of the protein Cullinl, the plasmid co-expressing the protein Cullinl-Flag and the protein RBX1 was constructed. Because the protein SKP1 could stabilize the protein F-box, a plasmid co-expressing the protein D3-Flag and the protein SKP1 was constructed.

[0134] cl) With cDNA of a stem base of an Oryza sativa L. Nipponbare seedling as a template, the P10RBX1F and P10RBX1R primers and the PHCUL1FF and PHCUL1FR primers (Table 2) were used to acquire gene fragments RBX1 and Cullinl-Flag through PCR amplification, respectively; the gene fragment RBX1 and a pFastBac Dual vector (Therm ofisherR™, catalog No.: 10712024) each were subjected to double enzyme digestion with endonucleases Kpnl and Nhel, and a gene fragment RBX1 and a pFastBac Dual vector obtained after the double enzyme digestion were recovered and then ligated with a Ligation High kit (TOYOBOR™, catalog No.: LGK-201) to obtain a plasmidpFastBac Dual-pPIO : RBX1\ and the gene fragment Cullinl-Flag and the pFastBac Dual-pPIO : RBX1 plasmid each were subjected to double enzyme digestion with endonucleases Leo RI and Spel, and a gene fragment Cullinl-Flag and apFastBac Dual-pPIO : RBXl plasmid obtained after the double enzyme digestion were recovered and then ligated with a Ligation High kit to obtain the plasmid pFastBac Dual-pPIO : RBXl-pPH : Cullinl-Flag coexpressing the protein Cullinl-Flag and the protein RBX1. With cDNA of a stem base of an Oryza sativa L. Nipponbare seedling as a template, the P10SKP1F and P10SKP1R primers and the PHD3FF and PHD3FR primers (Table 2) were used to acquire gene fragments SKP1 and D3-Flag through PCR amplification; and the same molecular cloning method was used to construct the plasmid pFastBac Dual-pPIO : SKPl-pPH: D3-Flag co-expressing the protein D3-Flag and the protein SKP1, where endonucleases Kpnl and Nhel were used for the double enzyme digestion of 04 04 25 the gene fragment SKP1, and endonucleases BamHI and EcoRi were used for the double enzyme digestion of the gene fragment D3-Flag. Genes encoding the protein Cullinl, protein RBX1, protein D3, and protein SKP1 had accession numbers of LOG Os01g27150 (update date: 2021.7.1), LOG OsOlgO 1700 (update date: 2021.7.1), LOG 0s06g06050 (update date: 2021.7.1), and LOC_Os09g36830 (update date: 2021.7.1) (http: / / rice.plantbiology.msu.edu / ).

[0135] c2) Preparation and identification of Bacmid DNA: The plasmids pFastBac Dual-pPIO : RBXl-pPH : Cullinl-Flag and pFastBac Dual-pPIO : SKPl-pPH : D3-Flag each were transformed into an E. coli strain DHIOBac, blue-white screening was conducted, and white-spot signal clones were picked and cultivated under shaking; and Bacmid DNA was extracted and identified by PCR with M13F and M13R primers for later use (main operations could be found in the Operation Guide for Bac-to-Bac BaculovirusExpression System of InvitrogenR™).

[0136] c3) Preparation of insect baculoviruses expressing the protein Cullinl-Flag and the protein D3-Flag: Cultivation conditions for adherent growth of Sf9 insect cells (NovagenR™, catalog No.: 71104-1ML) were as follows: static cultivation at 26°C to 28°C; and cultivation conditions for suspended growth of Sf9 insect cells were as follows: suspended cultivation at 26°C to 28°C and a low rotational speed (generally 130 rpm to 150 rpm). Sf9 insect cells growing adherently were transfected with the Bacmid DNA co-expressing the protein Cullinl-Flag and the protein RBX1 and the Bacmid DNA co-expressing the protein D3-Flag and the protein SKP1 obtained in step c2) according to instructions of the Cellfectin II Reagent (InvitrogenR™, catalog No.: 10362-100) to prepare Pl insect baculoviruses, and 72 h after the cell transfection, Pl viruses were collected. The Pl insect baculoviruses each were used to infect Sf9 insect cells growing adherently to obtain P2 insect baculoviruses. P3 and P4 insect baculoviruses were acquired in the same way (operations could be found in the Operation Guide for Bac-to-Bac Baculovirus Expression System of InvitrogenRTM).

[0137] c4) Acquisition of active proteins Cullinl-Flag and D3-Flag by an insect baculovirus expression system: Suspended Sf9 insect cells were infected with the P4 insect baculovirus (a growth density of virus-infected cells was generally 2 x 106 / mL) to allow the expression of a target protein, and generally, 48 h after the viral infection, the insect cells were collected through centrifugation for protein purification.

[0138] c5) The cells were resuspended with a pre-cooled protein-extracting solution I, then disrupted with a high-pressure cell disruptor (JNBIO, model: JN-3000Plus), and then centrifuged at 4°C and 15,000 g for 20 min, and a resulting protein supernatant was collected.

[0139] c6) The protein supernatant was subjected to purification with Anti-Flag M2 affinity gel (SigmaR™, catalog No.: A2220-5ML) according to instructions; and the protein D3-Flag and the protein Cullinl-Flag each were eluted with a protein eluent (formula: 20 mM Tris-HCl (pH 7.5), 04 04 25 500 ng / mL 3 x Flag peptide (SigmaR™, catalog No.: F4799-25MG), and 10 mM NaCl).

[0140] c7) The protein D3-Flag and the protein Cullinl-Flag obtained after the expression and purification in c3) to c6) each were further purified with an anion-exchange column Capto HiRes Q5 / 50 (GE HealthcareR™, catalog No.: 29-2758-78), and fraction components obtained after the purification of the anion-exchange column were tested by SDS-PAGE and CBB staining.

[0141] c8) According to the CBB staining results in c7), fractions with high purity and high concentration were combined, and a corresponding UF tube (MilliporeR™, catalog No.: UFC503096) was used to replace the protein buffer with a protein-extracting solution I.

[0142] c9) The proteins obtained in c8) were tested and quantified by SDS-PAGE and CBB staining, and then the purified proteins D3-Flag and Cullinl-Flag each were dispensed and stored at - 80°C for later use.

[0143] The protein His-SKPl and the protein His-RBXl each were prepared through the following steps:

[0144] dl) With cDNA of a stem base of an Oryza sativa L. Nipponbare seedling as a template, the GWSKP1F and GWSKP1R primers and the GWRBX1F and GWSRBX1R primers (Table 2) were used to clone gene fragments SKP1 and RBX1 to the terminal protein overexpression plasmid pET-61-DEST (NovagenR™, catalog No.: 71852, which had a His tag at an N-terminus) according to steps al) to a3) to obtain plasmidspET-61-DEST-SKP1 andpET-61-DEST-RBX1, respectively.

[0145] d2) The protein His-SKPl and the protein His-RBXl each were expressed and purified according to steps a4) and a5), and the purified proteins His-SKPl and His-RBXl were dispensed and stored at - 80°C for later use.

[0146] 1.8 Ubiquitination analysis of a protein D53

[0147] The ubiquitination of the protein D53 was analyzed with an in vitro reconstitution system for a multisubunit SCFD3 E3 ligase, where the in vitro reconstitution system was obtained by adding MgCh, DTT, ATP, His-OsEl, His-OsUBC14, His-OsUbiquitin, D3-Flag, Flag-eSCR-myc, and D53-HA to 50 mM Tris-HCl buffer (pH 7.4), a reaction system usually had a volume of 30 pL, and a content of each component in the reaction system was as follows: MgCh: 10 mM, DTT: 2 mM, ATP: 5 mM, His-OsEl: 50 ng, His-OsUBC14: 200 ng, His-OsUbiquitin: 5 pg, D3-Flag: 0.5 pg, Flag-eSCR-myc: 0.8 pg, and D53-HA: 100 ng. In order to ensure a consistent start time for parallel reactions, the components were added in the following order during the activity analysis test: His-OsUBC14, His-OsUbiquitin, D53-HA, SCFD3 complex (including D3-Flag, Cullinl-Flag, His-SKPl, and His-RBXl or Flag-eSCR-myc, where an addition order of the components was not strictly restricted), His-OsEl, and 20 x reaction buffer (formula: 1 M Tris (pH 7.4), 200 mM MgCh, 100 mM ATP, and 40 mM DTT).

[0148] The in vitro ubiquitination assay sample was conducted at 28°C for 2 h’ after the reaction 04 04 25 was completed, 6 x SDS sample loading buffer was added to terminate the reaction; and an active reaction sample was subjected to SDS-PAGE and WB analysis, then incubated with an an anti-Ubiquitin antibody or an anti-HA antibody (RocheR™, catalog No.: 11867423001) and an anti-mouse-HRP antibody successively, and subjected to development.

[0149] Experimental results showed that both the WT SCFD3 ligase obtained through in vitro reconstitution and the SCFD3 E3 ligase obtained through reconstitution with the fusion protein Flag-eSCR-myc could ubiquitinate the protein D53 (In FIG. 5A); and in the presence of the strigolactone receptor protein D14 (a concentration of the protein TRX-D14 in the system was 0.5 pg / 30 pL) and strigolactone analog rac-GR24 (ChiralixR™, catalog No.: CX23880, where a concentration of rac-GR24 in the system was 56 pM), the ubiquitination of the protein D53 by the SCFD3 E3 ligase obtained through in vitro reconstitution was enhanced (In FIG. 5B). The above results also showed that the SCFD3 E3 ligase obtained through reconstitution with the fusion protein eSCR had the same biological activity as the WT SCFD3 E3 ligase obtained through reconstitution, could effectively catalyze the ubiquitination of the substrate protein D53, and had high sensitivity for studying strigolactone signal transduction.

[0150] The protein D53-HA was prepared through the following steps:

[0151] el) With cDNA of a stem base of an Oryza sativa L. Nipponbare seedling as a template, the PHD53INF and PHD53INHAR primers (Table 2) were used to clone the gene fragment D53-HA with the tag encoding the HA fusion protein to a pFast BacDual vector according to the step cl) to obtain a plasmid pFastBac Dual-pPH: D53-HA, where endonucleases Bam HI and EcoRA were used to construct the plasmid; and a gene encoding the protein D53 had an accession number of LOCOsllg01330 (update date: 2021.7.1) (http: / / rice.plantbiology.msu.edu / ).

[0152] e2) The protein D53-HA was expressed with an insect baculovirus expression system according to steps c2) to c4) and purified according to steps c5) to c9), where anti-HA agarose (SigmaR™, catalog No.: A2095) was used for the purification of the protein D53-HA and 500 ng / mL 1 x HA peptide (SigmaR™, catalog No.: 12149) was used for the elution of the protein D53-HA; and the purified protein D53-HA was finally dispensed and stored at - 80°C for later use.

[0153] The protein TRX-D14 was prepared through the following steps:

[0154] el) With cDNA of a stem base of an Oryza sativa L. Nipponbare seedling as a template, GWD14F and GWD14R primers (Table 2) were used to clone a D14 gene fragment to a terminal protein over expression plasmid pET-59-DEST (NovagenR™, catalog No.: 71850, which had tags His and TRX at an N-terminus) according to steps al) to a3) to obtain a plasmid pET-59-DEST-D14, where a gene encoding the protein D14 had an accession number of LOG_Os03gl0620 (update date: 2021.7.1) (http: / / rice.plantbiology.msu.edu / ).

[0155] e2) The protein His-TRX-D14 (abbreviated as protein TRX-D14) was expressed and 04 04 25 purified according to steps a4) and a5), and the purified protein TRX-D14 was dispensed and stored at - 80°C for later use.

[0156] Example 2 Preparation of an Oryza sativa L.-derived SCFGID2 E3 ligase with a fusion protein Flag-eSCR-myc through in vitro reconstitution

[0157] 2.1 Verification of an interaction between the fusion protein Flag-eSCR-myc and the F-box protein GID2 through GST-GID2 Pulldown

[0158] A protein GST-GID2 was prepared through the following steps:

[0159] fl) With cDNA of a stem base of an Oryza sativa L. Nipponbare seedling as a template, GWGID2F and GWGID2R primers (Table 2) were used to clone a gene fragment GID2 to a terminal protein overexpression plasmid pET-60-DEST (NovagenR™, catalog No.: 71851, which had a GST tag at an N-terminus) according to steps al) to a3) to obtain a plasmid pET-60-DEST-GID2, where a gene encoding the protein GID2 had an accession number of AB 100246.1 (update date: 2021.7.1) (http: / / rice.plantbiology.msu.edu / ).

[0160] f2) The protein GST-GID2 was purified according to the step b2), and the obtained GST-GID2 agarose gel could be used in a GST-GID2 pulldown assay.

[0161] The fusion protein Flag-eSCR-myc obtained from steps 1.1 to 1.3 in Example 1 was taken, agarose gel including I mg of the protein GST-GID2 was mixed with 100 uL of a Flag-eSCR-myc fusion protein lysate, and a resulting mixture was incubated at 4°C and 10 rpm for 1 h to 2 h. After the incubation was completed, the mixture was centrifuged at a low speed, a resulting supernatant was removed, and the agarose gel were washed with a protein-extracting solution I (formula: 50 mM Tris-HCl (pH 7.5), 100 mM NaCl, 10 mM NaF, 2 mM EDTA (pH 8.0), 10% (v / v, volume percentage) Glycerol, 0.5% (v / v, volume percentage) Nonidet P-40, and ingredients added before use: 1 mM PMSF and 1 mM DTT) 4 to 5 times. WB analysis was conducted with an anti-myc antibody (Cell Signaling TechnologyR™, catalog No.: 2276).

[0162] The experimental results showed that there was an interaction between the fusion protein eSCR and the protein GID2 (FIG. 6).

[0163] 2.2 Preparation of an Oryza sativa L.-derived eSCFGID2 E3 ligase with the fusion protein Flag-eSCR-myc through in vitro reconstitution

[0164] A system for preparing the Oryza sativa L.-derived eSCFGID2 E3 ligase with the fusion protein Flag-eSCR-myc through in vitro reconstitution was obtained by adding MgCL, DTT, ATP, His-OsEl, His-OsUBC18, His-OsUbiquitin, GID2-Flag, and the Flag-eSCR-myc obtained in Example 1 to 50 mM Tris-HCl buffer (pH 7.4), a reaction system usually had a volume of 30 pL, and a content of each component in the reaction system was as follows: MgCh: 10 mM, DTT: 2 mM, ATP: 5 mM, His-OsEl: 50 ng, His-OsUBC18: 200 ng, His-OsUbiquitin: 5 pg, GID2-Flag: 0.25 pg, and Flag-eSCR-myc: 0.8 pg. In order to ensure a consistent start time for parallel reactions, 04 04 25 the components were added in the following order during the activity analysis test: His-OsUBC18, His-OsUbiquitin, an SCFGID2 complex (including the two components GID2-Flag and Flag-eSCR-myc, where an addition order of the components was not strictly restricted), His-OsEl, and 20 * reaction buffer (formula: 1 M Tris (pH 7.4), 200 mM MgCU, 100 mM ATP, and 40 mM DTT).

[0165] The in vitro active reconstitution was conducted at 28°C for 2 h; after the reaction was completed, 6 x SDS sample loading buffer was added to terminate the reaction; and an active reaction sample was subjected to SDS-PAGE and WB analysis, then incubated with an anti-Ubiquitin antibody and an anti-mouse-HRP antibody successively, and subjected to development.

[0166] The experimental results showed that, in the presence of OsEl, OsUbiquitin, and OsUBC 18, the SCFGID2 E3 ligase could be effectively prepared with the fusion protein Flag-eSCR-myc and the protein G1D2 through active reconstitution to form a polyubiquitin chain (FIG. 7).

[0167] The protein GID2-Flag was prepared through the following steps:

[0168] gl) With cDNA of a stem base of an Oryza sativa L. Nipponbare seedling as a template, the PHGID2FF and PHGID2FR primers (Table 2) were used to clone the gene fragment GID2-Flag with the tag encoding the Flag fusion protein to a pFastBac Dual vector according to the step cl) to obtain a plasmid pFastBac Dual-pPH: GID2-Flag, where endonucleases EcoRI and Xbal were used to construct the plasmid; and a gene encoding the protein GID2 had an accession number of AB100246.1 (update date: 2013.1) (http: / / rice.plantbiology.msu.edu / ).

[0169] g2) The protein GID2-Flag was expressed with an insect baculovirus expression system according to steps c2) to c4) and purified according to steps c5) to c9); and finally, the purified protein GID2-Flag was dispensed and stored at -80°C for later use.

[0170] The protein His-OsUBC18 was prepared through the following steps:

[0171] hl) GWOsUBC18F and GWOsUBC18R primers (Table 2) were used to clone a gene fragment OsUBC 18 to a terminal protein overexpression plasmid pET-61-DEST (NovagenR™, catalog No.: 71852, which had a His tag at an N-terminus) according to steps al) to a3) to obtain a plasmid pET-61-DEST-OsUBC18^ where a gene encoding the protein OsUBC 18 had an accession number of LOGJJs09gl223 (2021.7.1) (http: / / rice.plantbiology.msu.edu / ).

[0172] h2) The protein His-OsUBCl8 was expressed and purified according to steps a4) and a5), and the purified protein His-OsUBC18 was dispensed and stored at - 80°C for later use.

[0173] Example 3 Preparation of a human-derived eSCFFBXL18 E3 ligase with a fusion protein Flag-eSCR-myc through in vitro reconstitution

[0174] A system for preparing the human-derived eSCFFBXL18 E3 ligase with the fusion protein Flag-eSCR-myc through in vitro reconstitution was obtained by adding MgCh, DTT, ATP, HsEl (BostonBiochemR™, catalog No.: E-305), HsUbcH5C (Boston BiochemR™, catalog No.: E2-627), HsUbiquitin (Boston BiochemR™, catalog No.: U-110), HsFBXL18 (AbnovaR™, catalog No.: 04 04 25 H00080028-P01), and the Flag-eSCR-myc in Example 1 to 50 mM Tris-HCl buffer (pH 7.4), a reaction system usually had a volume of 30 pL, and a content of each component in the reaction system was as follows: MgCE: 10 mM, DTT: 2 mM, ATP: 5 mM, HsEl: 50 ng, HsUbcH5C: 200 ng, HsUbiquitin: 5 pg, FBXL18: 0.5 pg, and Flag-eSCR-myc: 0.8 pg. In order to ensure a consistent start time for parallel reactions, the components were added in the following order during the activity analysis test: HsUbcH5C, HsUbiquitin, SCFFBXL18 complex (including the two components FBXL18 and Flag-eSCR-myc, where an addition order of the components was not strictly restricted), HsEl, and 20 * reaction buffer (formula: 1 M Tris (pH 7.4), 200 mM MgCU, 100 mM ATP, and 40 mM DTT).

[0175] The in vitro ubiquitination assay sample was conducted at 28°C for 2 h; after the reaction was completed, 6 x SDS sample loading buffer was added to terminate the reaction; and an active reaction sample was subjected to SDS-PAGE and WB analysis, then incubated with an anti-Ubiquitin antibody and an anti-mouse-HRP antibody successively, and subjected to development.

[0176] The experimental results showed that, in the presence of HsEl, HsUbiquitin, and HsUbcH5C, the eSCFFBXL18 E3 ligase could be effectively prepared with the fusion protein Flag-eSCR-myc and the protein FBXL18 through active reconstitution to form a polyubiquitin chain (In FIG. 8A).

[0177] Example 4 Preparation of a human-derived eSCFCDC4 E3 ligase with a fusion protein Flag-eSCR-myc through in vitro reconstitution

[0178] 4.1 Preparation of an eSCFCDC4 E3 ligase with the fusion protein Flag-eSCR-myc and a human-derived F-box protein through in vitro reconstitution

[0179] A system for preparing the human-derived SCFCDC4 E3 ligase with the fusion protein Flag-eSCR-myc through in vitro reconstitution was obtained by adding MgCh, DTT, ATP, HsEl, HsCDC34 (AbnovaR™, catalog No.: H00000997-P01), HsUbiquitin, HsCDC4 (AbnovaR™, catalog No.: H00055294-P01), and the Flag-eSCR-myc in Example 1 to 50 mM Tris-HCl buffer (pH 7.4), a reaction system usually had a volume of 30 pL, and a content of each component in the reaction system was as follows: MgCk: 10 mM, DTT: 2 mM, ATP: 5 mM, HsEl: 50 ng, HsCDC34: 200 ng, HsUbiquitin: 5 pg, CDC4: 0.5 pg, and Flag-eSCR-myc: 0.8 pg. In order to ensure a consistent start time for parallel reactions, the components were added in the following order during the activity analysis test: HsCDC34, HsUbiquitin, SCFCDC4 complex (including the two components CDC4 and Flag-eSCR-myc, where an addition order of the components was not strictly restricted), HsEl, and 20 x reaction buffer (formula: 1 M Tris (pH 7.4), 200 mM MgCU, 100 mM ATP, and 40 mM DTT).

[0180] The in vitro ubiquitination assay sample was conducted at 28°C for 2 h; after the reaction was completed, 6 x SDS sample loading buffer was added to terminate the reaction; and an active 04 04 25 reaction sample was subjected to SDS-PAGE and WB analysis, then incubated with an anti-Ubiquitin antibody and an anti-mouse-HRP antibody successively, and subjected to development.

[0181] The experimental results showed that, in the presence of HsEl, HsUbiquitin, and HsCDC34, the eSCFCDC4 E3 ligase could be effectively prepared with the fusion protein Flag-eSCR-myc and the protein CDC4 through active reconstitution to form a polyubiquitin chain (In FIG. 8B).

[0182] 4.2 Analysis of ubiquitination of a protein Sicl with an in vitro reconstitution system for a multi subunit eSCFCDC4 E3 ligase

[0183] The ubiquitination of the protein Sicl was analyzed with an in vitro reconstitution system for a multisubunit eSCFCDC4 E3 ligase, where the in vitro reconstituted ubiquitination assay system was obtained by adding MgCh, DTT, ATP, His-OsEl, His-OsUBC 14, His-OsUbiquitin, D3-Flag, the Flag-eSCR-myc in Example 1, and HsSicl-HA to 50 mM Tris-HCl buffer (pH 7.4), a reaction system usually had a volume of 30 pL, and a content of each component in the reaction system was as follows: MgCh: 10 mM, DTT: 2 mM, ATP: 5 mM, His-OsEl: 50 ng, His-OsUBC14: 200 ng, His-OsUbiquitin: 5 pg, D3-Flag: 0.5 pg, Flag-eSCR-myc: 0.8 pg, and Sicl-HA: 100 ng. In order to ensure a consistent start time for parallel reactions, the components were added in the following order during the activity analysis test: His-OsUBC 14, His-OsUbiquitin, Sicl-HA, SCFCDC4 complex (including CDC4 and Flag-eSCR-myc, where an addition order of the components was not strictly restricted), His-OsEl, and 20 x reaction buffer (formula: 1 M Tris (pH 7.4), 200 mM MgCh, 100 mM ATP, and 40 mM DTT).

[0184] The in vitro ubiquitination assay sample was conducted at 28°C for 2 h; after the reaction was completed, 6 * SDS sample loading buffer was added to terminate the reaction; and an active reaction sample was subjected to SDS-PAGE and WB analysis, then incubated with an anti-HA antibody and an anti-mouse-HRP antibody successively, and subjected to development.

[0185] The experimental results showed that the eSCFCDC4 E3 ligase obtained through reconstitution with the fusion protein Flag-eSCR-myc could ubiquitinate the protein Sicl (FIG. 9). The above results showed that the eSCFCDC4 E3 ligase obtained through reconstitution with the fusion protein Flag-eSCR-myc not only had the biological activity of the E3 ligase, but also could effectively catalyze the ubiquitination of the substrate protein Sicl.

[0186] The HsSicl-HA was prepared through the following steps:

[0187] il) With the synthesized HsSicl gene as a template, PHHsSiclF and PHHsSiclHAR primers (Table 2) were used to clone the gene fragment HsSicl-HA with the tag encoding the HA fusion protein to a pFast Bac Dual vector according to the step cl) to obtain a plasmidpFastBac Dual-pPH: HsSicJ-HA, where endonucleases Spel and Xhal were used to construct the plasmid; and a gene encoding the protein HsSicl had an accession number of AAH01670 (update date: 04 04 25 2013.1) (http: / / www.ncbi.nlm.nih.gov / genbank).

[0188] i2) The protein HsSicl-HA was expressed with an insect baculovirus expression system according to steps c2) to c4) and purified according to steps c5) to c9), where anti-HA agarose (SigmaR™, catalog No.: A2095) was used for the purification of the protein HsSicl-HA and 500 ng / mL 1 x HA peptide (SigmaR™, catalog No.: 12149) was used for the elution of the protein HsSicl-HA; and finally, the purified protein HsSicl-HA was dispensed and stored at - 80°C for later use.

[0189] The above examples show that the establishment of an in vitro reconstituted ubiquitination assay system for a multisubunit SCF E3 ligase using the fusion protein Flag-eSCR-myc simplifies the composition of the active system, enables the cross-species compatibility, makes the system have promising application prospects, and is of important biological significance for studying the molecular mechanism between a multisubunit SCF E3 ligase and a substrate protein thereof in eukaryotes.

[0190] The present disclosure has been described in detail above. Without departing from the purpose and scope of the present disclosure and without unnecessary experimental conditions, the present disclosure can be implemented by those skilled in the art in a wide range under equivalent parameters, concentrations, and conditions. Although specific examples of the present disclosure have been given, it should be understood that the present disclosure can be further modified. In summary, according to the principle of the present disclosure, the present disclosure is intended to encompass any change to, use of, or modification to the present disclosure, including changes made using conventional techniques known in the art, which have departed from the scope disclosed in the present disclosure. Application of some basic features can be done in accordance with the scope of the following appended claims. 04 04 25 Sequence Listing Information: DTD Version: Vl_3 File Name: GWP20221202193_seqlist.xml Software Name: WIPO Sequence Software Version: 2.2.0 Production Date: 2023-04-23 General Information: Current application / Applicant file reference: GWP20221202193 Earliest priority application / IP Office: CN Earliest priority application / Application number: 202210696862.7 Earliest priority application / Filing date: 2022-06-20 Applicant name: Institute of Genetics and Developmental Biology, CAS Applicant name / Language: en Invention title: METHOD FOR PREPARING MULTISUBUNIT SCF E3 LIGASE WITH FUSION PROTEIN THROUGH IN VITRO RECONSTITUTION, AND USE OF MULTISUBUNIT SCF E3 LIGASE ( en ) Sequence Total Quantity: 45 Sequences: Sequence Number (ID): 1 Length: 3219 Molecule Type: DNA Features Location / Qualifiers: - source, 1..3219 > mol type, other DNA > note, eSCR fusion gene > organism, synthetic construct Residues: atggactaca aagacgatga cgacaagatg gcggccgagg cggagacgaa ggcgatgatc 60 accctccgca gctgcgaggg ccaggtgttc gaggtcgcgg aggccgtggc catggagtcc 120 cagaccatcc gccacatgat cgaggacaag tgcgccgaca ccggcatccc gctccccaac 180 gtctccgcca agatcctctc caaggtaatc gagtactgca gcaagcacgt cgaggcgcgc 240 ggcggggcgg ccgccgccgc cgacggcgac gcccccgccc ccgccgccgt ggaggccaac 300 aaggccgtcg aggacgagct caagacgttc gacgccgagt tcgtcaaggt cgaccagtcc 360 accctcttcg atctcatcct ggctgcaaac tacctcaaca tcaagggact gctggatctg 420 acctgccaga ccgtggctga catgatcaag gggaagacac cagaggagat ccgcaagacc 480 04 04 25 ttcaacatca agaatgactt cacccccgag gaagaagagg aggtgaggag ggagaaccag 540 tgggccttcg aaggaggatc aggaatggcg acccacgagc ggaagacgat cgatctggag 600 caggggtggg agttcatgca gaagggcatc accaagctga agaacatcct cgaggggaag 660 cccgaacccc agttcagctc cgaggactac atgatgctct acacgacgat ttacaacatg 720 tgcacgcaga agccgccgca cgactactcg cagcagctct acgagaagta ccgcgagtcc 780 ttcgaggagt acatcacgtc catggtctta ccttcattaa gagagaaaca tgatgagttt 840 atgctgagag agctagtaaa acggtggtca aaccataaag tgatggttcg gtggctatca 900 cgcttcttcc attatcttga tcggtacttt atttcaagga ggtccctacc acaactaagt 960 gaagttgggc ttagctgttt ccgggatctg gtatatcaag agatcaaagg aaaagtaaaa 1020 agtgcggtga tatccttgat agatcaagaa cgtgagggtg aacaaattga tagggccctg 1080 ttaaagaatg ttctggatat atttgttgag attggcttga ctagcatgga ctactacgaa 1140 aatgattttg aagatttctt gctcaaagat actgcagact attactctat aaaagcccag 1200 acctggattc ttgaggactc ttgtccagat tacatgttaa aggcagagga gtgtctgaaa 1260 agggagaaag agcgagttgc tcattatttg cactccagta gtgaacagaa gttgttggag 1320 aaagtgcaac atgagttgct aactcaatac gcaagtcagc tcctggagaa ggagcattct 1380 ggatgccatg cattgcttcg tgatgacaag gttgatgatc tctctagaat gtacaggctc 1440 ttttccagaa taactcgtgg tttagaacct gtttctcaaa tatttaagca gcatgttact 1500 aatgagggca ctgccttagt gaagcaagcc gaagatgctg ctagtaataa gaagccagag 1560 aagaaggaga tagttggttt acaggaacag gtttttgtcc ggaaaatcat tgagcttcat 1620 gacaagtatg tagcttatgt tacggattgt tttcaggggc acactctctt ccataaggca 1680 cttaaggagg cttttgaagt tttttgcaac aaaggtgttt ctggcagttc aagtgctgaa 1740 ttactagcta ccttctgtga caatatctta aagaaaggcg gtagtgaaaa gcttagtgat 1800 gaagcaattg aagataccct tgagaaggtt gtaaggttac ttgcctacat tagtgacaag 1860 gacttgtttg ctgagttcta tagaaagaag cttgcaagga gattgctttt tgacaagagt 1920 gctaatgatg aacatgagag aagcatcctt accaagctaa agcaacaatg tggagggcag 1980 ttcacttcca aaatggaggg catggttact gatctcactg tggcaagaga tcaccaggct 2040 aaatttgaag agttcataag cacacactca gagttgaatc ctggaatagc cttagctgtt 2100 actgtcctca caacaggatt ttggccaagt tacaaatctt ttgatataaa tctacctgca 2160 gaaatggtga aatgtgtaga ggttttcaag gagttttacc aaacaagaac aaaacacagg 2220 aaacttacct ggatttattc actgggaacc tgtaatatta atgctaaatt tgaggccaaa 2280 actattgagc tcattgttac aacttatcag gctgcattgc tgctgctgtt taatggagtt 2340 gatagactca gctattctga gattgtgaca cagttaaatc tctcagatga tgatgttgtt 2400 cgattgctcc attctctatc ttgtgcaaaa tacaagattc ttagcaaaga accaaataat 2460 agatctattt caccaaatga tgtcttcgag ttcaactcaa agtttactga caagctgcga 2520 agattaaaga tacctcttcc tccagttgat gagaagaaga aagtagttga agatgttgat 2580 04 04 25 aaggatcgca gatacgcaat tgatgcatca attgtgcgta ttatgaagag tcgcaaagta 2640 ttgggtcatc agcaacttgt gatggaatgt gtggagcagc ttggacgcat gtttaagcct 2700 gacttcaagg caataaagaa gcgaattgag gatcttatca caagggatta cttggagagg 2760 gataaagaca acccaaatgt gtacagatac ttggctggag gatcaggaat gtcggccatg 2820 gagaccgaca tcaacgcgcc gccgcccccc gcccccgccc ccgccggcgc cggcgaggga 2880 tcctcctctg ccgccggccc ctcctcccgc aagcccaaca agcgcttcga gatcaagaag 2940 tggaacgccg tcgcgctctg ggcatgggat atcgtcgtcg acaactgcgc catctgccgc 3000 aaccacatca tggatctatg catcgagtgc caggcgaacc aggccagcgc caccagtgag 3060 gagtgcactg tcgcttgggg tgtctgtaat catgcttttc acttccattg catcagcagg 3120 tggctcaaga ctcgccaagt gtgcccgtta gataacagtg aatgggaatt tcagaaatat 3180 gggcacgaac aaaaactcat ctcagaagag gatctgtag 3219 Sequence Number (ID): 2 Length: 1072 Molecule Type: AA Features Location / Qualifiers: - source, 1..1072 > moltype, protein > note, eSCR fusion protein > organism, synthetic construct Residues: MDYKDDDDKM AAEAETKAMI TLRSCEGQVF EVAEAVAMES QTIRHMIEDK CADTGIPLPN 60 VSAKILSKVI EYCSKHVEAR GGAAAAADGD APAPAAVEAN KAVEDELKTF DAEFVKVDQS 120 TLFDLILAAN YLNIKGLLDL TCQTVADMIK GKTPEEIRKT FNIKNDFTPE EEEEVRRENQ 180 WAFEGGSGMA THERKTIDLE QGWEFMQKGI TKLKNILEGK PEPQFSSEDY MMLYTTIYNM 240 CTQKPPHDYS QQLYEKYRES FEEYITSMVL PSLREKHDEF MLRELVKRWS NHKVMVRWLS 300 RFFHYLDRYF ISRRSLPQLS EVGLSCFRDL VYQEIKGKVK SAVISLIDQE REGEQIDRAL 360 LKNVLDIFVE IGLTSMDYYE NDFEDFLLKD TADYYSIKAQ TWILEDSCPD YMLKAEECLK 420 04 04 25 REKERVAHYL HSSSEQKLLE KVQHELLTQY ASQLLEKEHS GCHALLRDDK VDDLSRMYRL 480 FSRITRGLEP VSQIFKQHVT NEGTALVKQA EDAASNKKPE KKEIVGLQEQ VFVRKIIELH 540 DKYVAYVTDC FQGHTLFHKA LKEAFEVFCN KGVSGSSSAE LLATFCDNIL KKGGSEKLSD 600 EAIEDTLEKV VRLLAYISDK DLFAEFYRKK LARRLLFDKS ANDEHERSIL TKLKQQCGGQ 660 FTSKMEGMVT DLTVARDHQA KFEEFISTHS ELNPGIALAV TVLTTGFWPS YKSFDINLPA 720 EMVKCVEVFK EFYQTRTKHR KLTWIYSLGT CNINAKFEAK T1EL1VTTYQ AALLLLFNGV 780 DRLSYSEIVT QLNLSDDDW RLLHSLSCAK YKILSKEPNN RSISPNDVFE FNSKFTDKLR 840 RLKIPLPPVD EKKKVVEDVD KDRRYAIDAS IVRIMKSRKV LGHQQLVMEC VEQLGRMFKP 900 DFKAIKKRIE DLITRDYLER DKDNPNVYRY LAGGSGMSAM ETD1NAPPPP APAPAGAGEG 960 SSSAAGPSSR KPNKRFEIKK WNAVALWAWD IVVDNCAICR NHIMDLCIEC QANQASATSE 1020 ECTVAWGVCN HAFHFHCISR WLKTRQVCPL DNSEWEFQKY GHEQKLISEE DL 1072 Sequence Number (ID): 3 Length: 5 Molecule Type: AA Features Location / Qualifiers: - source, 1..5 > mol type, protein > note, Poly-Arg tag > organism, synthetic construct Residues: RRRRR 5 Sequence Number (ID): 4 04 04 25 Length: 6 Molecule Type: AA Features Location / Qualifiers: - source, 1..6 > moltype, protein > note, Poly-His tag > organism, synthetic construct Residues: HHHHHH Sequence Number (ID): 5 Length: 8 Molecule Type: A A Features Location / Qualifiers: - source, 1..8 > mol Jype, protein > note, Flag tag > organism, synthetic construct Residues: DYKDDDDK Sequence Number (ID): 6 Length: 8 Molecule Type: A A Features Location / Qualifiers: - source, 1..8 > mol Jype, protein > note, Strep-tag II > organism, synthetic construct Residues: WSHPQFEK Sequence Number (ID): 7 Length: 10 Molecule Type: A A 04 04 25 Features Location / Qualifiers: - source, 1..10 > moltype, protein > note, c-myc tag > organism, synthetic construct Residues: EQKLISEEDL 10 Sequence Number (ID): 8 Length: 54 Molecule Type: DNA Features Location / Qualifiers: - source, 1..54 > mol type, other DNA > note, Primer PHSCRFLAGF > organism, synthetic construct Residues: tttgaattca tggactacaa agacgatgac gacaagatgg cggccgaggc ggag Sequence Number (ID): 9 Length: 60 Molecule Type: DNA Features Location / Qualifiers: - source, 1..60 > mol type, other DNA > note, Primer PHSCRFLAGR > organism, synthetic construct Residues: tttactagtc tacagatcct cttctgagat gagtttttgt tcgtgcccat atttctgaaa 60 Sequence Number (ID): 10 Length: 46 Molecule Type: DNA Features Location / Qualifiers: - source, 1..46 54 04 04 25 > moltype, other DNA > note, Primer CUL1K688AF > organism, synthetic construct Residues: gcatcaattg tgcgtattat ggcgagtcgc aaagtattgg gtcatc 46 Sequence Number (ID): 11 Length: 46 Molecule Type: DNA Features Location / Qualifiers: - source, 1..46 > mol type, other DNA > note, Primer CUL1K688AR > organism, synthetic construct Residues: gatgacccaa tactttgcga ctcgccataa tacgcacaat tgatgc 46 Sequence Number (ID): 12 Length: 17 Molecule Type: DNA Features Location / Qualifiers: - source, 1..17 > mol type, other DNA > note, Primer M13F > organism, synthetic construct Residues: gttttcccag tcacgac 17 Sequence Number (ID): 13 Length: 17 Molecule Type: DNA Features Location / Qualifiers: - source, 1..17 > mol type, other DNA > note, Primer M13R > organism, synthetic construct 04 04 25 Residues: caggaaacag ctatgac 17 Sequence Number (ID): 14 Length: 53 Molecule Type: DNA Features Location / Qualifiers: - source, 1..53 > mol type, other DNA > note, Primer GWOSUBF > organism, synthetic construct Residues: ggggacaagt ttgtacaaaa aagcaggctt tatgcagatc tttgtgaaga cat Sequence Number (ID): 15 Length: 52 Molecule Type: DNA Features Location / Qualifiers: - source, 1..52 > mol Jype, other DNA > note, Primer GWOSUBR > organism, synthetic construct Residues: ggggaccact ttgtacaaga aagctgggtt ttagccacca cggaggcgga gg Sequence Number (ID): 16 Length: 58 Molecule Type: DNA Features Location / Qualifiers: - source, 1..58 > mol type, other DNA > note, Primer GWOSUBC14F > organism, synthetic construct Residues: 53 52 ggggacaagt ttgtacaaaa aagcaggctt tatggcgtca aagaggatac agaaggag 58 04 04 25 Sequence Number (ID): 17 Length: 55 Molecule Type: DNA Features Location / Qualifiers: - source, 1..55 > moltype, other DNA > note, Primer GWOSUBC14R > organism, synthetic construct Residues: ggggaccact ttgtacaaga aagctgggtt ctacatggcg tacctctgag tccag 55 Sequence Number (ID): 18 Length: 56 Molecule Type: DNA Features Location / Qualifiers: - source, 1..56 > mol type, other DNA > note, Primer GWOSUBC18F > organism, synthetic construct Residues: ggggacaagt ttgtacaaaa aagcaggctt tatggcaagc aaaaggattc agaagg 56 Sequence Number (ID): 19 Length: 55 Molecule Type: DNA Features Location / Qualifiers: - source, 1..55 > mol type, other DNA > note, Primer GWOSUBC18R > organism, synthetic construct Residues: ggggaccact ttgtacaaga aagctgggtt ctaacccatt gcgtatttct gggtc 55 04 04 25 Sequence Number (ID): 20 Length: 56 Molecule Type: DNA Features Location / Qualifiers: - source, 1..56 > moltype, other DNA > note, Primer GWOSE1F > organism, synthetic construct Residues: ggggacaagt ttgtacaaaa aagcaggctt tatgcttccg acgaagagag cgaacg 56 Sequence Number (ID): 21 Length: 55 Molecule Type: DNA Features Location / Qualifiers: - source, 1..55 > moltype, other DNA > note, Primer GWOSE1R > organism, synthetic construct Residues: ggggaccact ttgtacaaga aagctgggtt ctaccggaag taaatggaga tgaga 55 Sequence Number (ID): 22 Length: 55 Molecule Type: DNA Features Location / Qualifiers: - source, 1..55 > mol type, other DNA > note, Primer GWD14F > organism, synthetic construct Residues: ggggacaagt ttgtacaaaa aagcaggctt tatgctgcga tcgacgcatc cgccg 55 Sequence Number (ID): 23 Length: 54 04 04 25 Molecule Type: DNA Features Location / Qualifiers: - source, 1..54 > mol type, other DNA > note, Primer GWD14R > organism, synthetic construct Residues: ggggaccact ttgtacaaga aagctgggtt ttagtaccgg gcgagagcgc ggcg 54 Sequence Number (ID): 24 Length: 56 Molecule Type: DNA Features Location / Qualifiers: - source, 1..56 > moltype, other DNA > note, Primer GWD3F > organism, synthetic construct Residues: ggggacaagt ttgtacaaaa aagcaggctt tatggcggaa gaggaggagg tggagg 56 Sequence Number (ID): 25 Length: 55 Molecule Type: DNA Features Location / Qualifiers: - source, 1..55 > mol type, other DNA > note, Primer GWD3R > organism, synthetic construct Residues: ggggaccact ttgtacaaga aagctgggtt ctaatcatca atttgccggc tgttc 55 Sequence Number (ID): 26 Length: 27 Molecule Type: DNA Features Location / Qualifiers: - source, 1..27 > moltype, other DNA > note, Primer PHD3FF > organism, synthetic construct Residues: tttggatcca tggcggaaga ggaggag 27 04 04 25 Sequence Number (ID): 27 Length: 55 Molecule Type: DNA Features Location / Qualifiers: - source, 1..55 > mol type, other DNA > note, Primer PHD3FR > organism, synthetic construct Residues: tttgaattcc tacttgtcgt catcgtcttt gtagtcatca tcaatttgcc ggctg 55 Sequence Number (ID): 28 Length: 28 Molecule Type: DNA Features Location / Qualifiers: - source, 1..28 > mol type, other DNA > note, Primer PHCUL1FF > organism, synthetic construct Residues: tttgaattca tggcgaccca cgagcgga 28 Sequence Number (ID): 29 Length: 55 Molecule Type: DNA Features Location / Qualifiers: - source, 1..55 > mol type, other DNA 04 04 25 > note, Primer PHCUL1FR > organism, synthetic construct Residues: tttactagtt cacttgtcgt catcgtcttt gtagtcagcc aagtatctgt acaca 55 Sequence Number (ID): 30 Length: 65 Molecule Type: DNA Features Location / Qualifiers: - source, 1..65 > moltype, other DNA > note, Primer GWSKP1F > organism, synthetic construct Residues: ggggacaagt ttgtacaaaa aagcaggctt tatggcggcc gaggcggaga cgaaggcgat 60 gatca 65 Sequence Number (ID): 31 Length: 63 Molecule Type: DNA Features Location / Qualifiers: - source, 1..63 > mol type, other DNA > note, Primer GWSKP1R > organism, synthetic construct Residues: ggggaccact ttgtacaaga aagctgggtt tcattcgaag gcccactggt tctccctcct 60 cac 63 Sequence Number (ID): 32 Length: 27 Molecule Type: DNA Features Location / Qualifiers: - source, 1..27 > mol type, other DNA 04 04 25 > note, Primer Pl0SKP1F > organism, synthetic construct Residues: tttgctagca tggcggccga ggcggag 27 Sequence Number (ID): 33 Length: 29 Molecule Type: DNA Features Location / Qualifiers: - source, 1..29 > moltype, other DNA > note, Primer Pl0SKP1R > organism, synthetic construct Residues: tttggtacct cattcgaagg cccactggt 29 Sequence Number (ID): 34 Length: 58 Molecule Type: DNA Features Location / Qualifiers: - source, 1..58 > mol type, other DNA > note, Primer GWRBX1F > organism, synthetic construct Residues: ggggacaagt ttgtacaaaa aagcaggctt tatgtcggcc atggagaccg acatcaac Sequence Number (ID): 35 Length: 55 Molecule Type: DNA Features Location / Qualifiers: - source, 1..55 > mol type, other DNA > note, Primer GWRBX1R > organism, synthetic construct 58 04 04 25 Residues: ggggaccact ttgtacaaga aagctgggtt ctagtgccca tatttctgaa attcc 55 Sequence Number (ID): 36 Length: 29 Molecule Type: DNA Features Location / Qualifiers: - source, 1..29 > moltype, other DNA > note, Primer PlORBXIF > organism, synthetic construct Residues: tttgctagca tgtcggccat ggagaccga 29 Sequence Number (ID): 37 Length: 30 Molecule Type: DNA Features Location / Qualifiers: - source, 1..30 > mol type, other DNA > note, Primer PlORBX 1R > organism, synthetic construct Residues: tttggtaccc tagtgcccat atttctgaaa 30 Sequence Number (ID): 38 Length: 54 Molecule Type: DNA Features Location / Qualifiers: - source, 1..54 > mol type, other DNA > note, Primer GWGID2F > organism, synthetic construct Residues: ggggacaagt ttgtacaaaa aagcaggctt tatgaagttc cgctctgatt cgtc 54 04 04 25 Sequence Number (ID): 39 Length: 55 Molecule Type: DNA Features Location / Qualifiers: - source, 1..55 > mol type, other DNA > note, Primer GWGID2R > organism, synthetic construct Residues: ggggaccact ttgtacaaga aagctgggtt ctacccgcat tggccccctc cattc 55 Sequence Number (ID): 40 Length: 34 Molecule Type: DNA Features Location / Qualifiers: - source, 1..34 > moltype, other DNA > note, Primer PHGID2FF > organism, synthetic construct Residues: tttgaattca tgaagttccg ctctgattcg tcag 34 Sequence Number (ID): 41 Length: 63 Molecule Type: DNA Features Location / Qualifiers: - source, 1..63 > mol type, other DNA > note, Primer PHGID2FR > organism, synthetic construct Residues: ttttctagat cacttgtcgt catcgtcttt gtagtccccg cattggcccc ctccattctt 60 ate 63 04 04 25 Sequence Number (ID): 42 Length: 40 Molecule Type: DNA Features Location / Qualifiers: - source, 1..40 > moltype, other DNA > note, Primer PHD53INF > organism, synthetic construct Residues: catcgggcgc ggatccatgc ccactccggt ggccgccgcg 40 Sequence Number (ID): 43 Length: 68 Molecule Type: DNA Features Location / Qualifiers: - source, 1..68 > moltype, other DNA >note, Primer PHD53INHAR >organism, synthetic construct Residues: gtaggccttt gaattctcaa gcgtaatctg gaacatcgta tgggtaacaa tctagaatta 60 ttcttggc 68 Sequence Number (ID): 44 Length: 40 Molecule Type: DNA Features Location / Qualifiers: - source, 1..40 > mol type, other DNA > note, Primer PHHsSiclF > organism, synthetic construct Residues: cgacgagctc actagtatgg acgggactat taaggaggct 40 Sequence Number (ID): 45 Length: 70 Molecule Type: DNA Features Location / Qualifiers: - source, 1..70 > moltype, other DNA > note, Primer PHHsSiclHAR > organism, synthetic construct Residues: gactgcaggc tctagatcaa gcgtaatctg gaacatcgta tgggtagtag tagctgccta 60 agtgtgaagg 70 END 04 04 25 13 1224

Claims

1. An in vitro preparation method of a multisubunit SCF E3 ligase, comprising: subjecting an eSCR fusion protein to a reaction with an F-box protein in a reaction system comprising 50 mM Tris-HCl buffer (pH 7.4), MgCh, DTT, and / or ATP to obtain the E3 ligase,wherein the eSCR fusion protein is selected from the group consisting of Al), and A3):Al) a fusion protein with the amino acid sequence from position 10 to position 1062 of SEQIDNO: 2; andA3) a fusion protein obtained by linking a tag to an N-terminus and / or a C-terminus of Al);and wherein the eSCR fusion protein is prepared in an insect baculovirus expression system.

2. The in vitro preparation method according to claim 1, wherein the reaction is conducted at 22°C to 37°C;and / or, the reaction is conducted for 1 h to 2 h.

3. Use of an E3 ligase prepared by the preparation method according to claim 1 or 2 in validation of a mechanism of the E3 ligase interacting with a substrate thereof.

4. A preparation method of a ubiquitin chain, comprising: subjecting the eSCR fusion protein according to claim 1, an F-box protein, a ubiquitin-activating enzyme (UAE) El, a ubiquitin-conjugating enzyme (UCE) E2, and a ubiquitin monomer to a reaction in a reaction system to obtain the ubiquitin chain, wherein the eSCR fusion protein is acquired by an insect baculovirus expression system.

5. A preparation method of a ubiquitinated target protein, comprising: subjecting a target protein, the eSCR fusion protein according to claim 1, an F-box protein, a UAE El, a UCE E2, and a ubiquitin monomer to a reaction in a reaction system to obtain the ubiquitinated target protein.

6. The preparation method according to claim 4 or 5, wherein the reaction system further comprises 50 mM Tris-HCl buffer (pH 7.4), MgCh, DTT, and / or ATP;and / or, the reaction is conducted at 22°C to 37°C;and / or, the reaction is conducted for 1 h to 2 h.

7. A reagent kit, comprising the eSCR fusion protein and / or the F-box protein according to claim 1.

8. The reagent kit according to claim 7, wherein the reagent kit further comprises 50 mM Tris-HCl buffer (pH 7.4), MgCh, DTT, ATP, UAE El, UCE E2, and / or a ubiquitin monomer.

9. A biological material comprising the eSCR fusion protein according to claim 1 or a nucleic acid encoding the eSCR fusion protein, wherein the biological material is any one selected from the group consisting of an expression cassette, a recombinant microorganism and a cell line.

Images