Sodium decanoate for use in alleviating intestinal oxidative stress in marine fish larvae

Sodium decanoate in a feed additive composition addresses oxidative stress in marine fish larvae by enhancing their resistance, reducing malondialdehyde content, and improving antioxidant enzyme activity, thereby promoting growth and survival.

GB2630659BActive Publication Date: 2026-02-16OCEAN UNIV OF CHINA
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
GB2023016400
Authority / Receiving Office
GB · GB
Patent Type
Patents
Current Assignee / Owner
Priority Date
2023-06-01
Filing Date
2023-10-26
Publication Date
2026-02-16
Estimated Expiration
2043-10-26

AI Technical Summary

Technical Problem

Marine fish larvae are highly susceptible to oxidative stress due to their underdeveloped digestive systems, leading to intestinal health issues and high mortality rates, particularly in species like Larimichthys crocea, which is crucial for intensive farming.

Method used

Sodium decanoate, a medium chain fatty acid salt, is formulated into a feed additive composition with microcrystalline cellulose and high-gluten flour to directly enter fish cells, enhancing their resistance to oxidative stress through P-oxidation properties.

Benefits of technology

The composition effectively reduces malondialdehyde content, improves antioxidant enzyme activity, and promotes growth and survival of marine fish larvae by alleviating oxidative stress.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000001_0000
    Figure 00000001_0000
  • Figure 00000001_0001
    Figure 00000001_0001
  • Figure 00000002_0000
    Figure 00000002_0000
Patent Text Reader

Abstract

Use of sodium decanoate in preparation of a product for alleviating intestinal oxidative stress in marine fish larvae, preferably said product is a feed additive / feed. The marine fish larvae may be La
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present disclosure belongs to the technical field of aquatic feeds and feed additives, and specifically relates to sodium decanoate for use in alleviating intestinal oxidative stress in marine fish larvae. BACKGROUND

[0002] Oxidative stress represents an imbalance between oxidation and antioxidation within an organism. During this process, excessive accumulation of reactive oxygen species (ROS) leads to intracellular DNA damages, protein denaturation, and lipid peroxidation, eventually causing cell apoptosis and necrosis. Environmental conditions (dissolved oxygen, ammonia nitrogen, and temperature), stocking density, physiological state (disease and inflammation), nutrient intake, and exogenous pathogens / toxic and hazardous substances can cause oxidative stress in fish. Oxidative stress can significantly inhibit the gastrointestinal functions of fish, causing damage to the intestinal mucosal immune system and then leading to chronic inflammation. Larvae stage of marine fish is an early stage of development where the larvae are more sensitive to changes in ambient environment. Moreover, since the digestive system is not yet fully developed, the intestines of marine fish larvae are extremely susceptible to oxidative stress, which results in damage to intestinal health and then threatens the growth and survival of the marine fish larvae. Therefore, the development of corresponding functional additives that improve the resistance of marine fish larvae to oxidative stress is crucial for intestinal health of larvae.

[0003] Larimichthys crocea is a marine fish species with the maximum breeding output in China. With the rapid development of intensive farming, the demand for its high-quality fry is also increasing annually. However, intestinal health problems due to oxidative stress are increasingly prominent during fry culture, resulting in excessive mortality. SUMMARY

[0004] An objective of the present disclosure is to provide sodium decanoate for use in alleviating intestinal oxidative stress in marine fish larvae. The sodium decanoate can effectively improve the ability of the marine fish larvae to resist oxidative stress.

[0005] The present disclosure provides sodium decanoate for use in alleviating intestinal oxidative stress in marine fish larvae. 09 06 25

[0006] In some embodiments, the sodium decanoate is in the form of a product comprising a feed additive and / or a feed.

[0007] In some embodiments, the marine fish larvae includes Larimichthys crocea larvae.

[0008] In some embodiments, the sodium decanoate is in the form of a composition containing the following components in mass percentage:

[0009] 3.57% to 28.57% of the sodium decanoate, 0% to 25% of microcrystalline cellulose, and high-gluten flour as a balance.

[0010] In some embodiments, the sodium decanoate and the microcrystalline cellulose independently have an analytical purity of not less than 98%.

[0011] In some embodiments, the composition containing sodium decanoate has a particle size of 75 pm to 125 pm (120 mesh to 200 mesh).

[0012] Beneficial effects:

[0013] The present disclosure provides sodium decanoate for use in alleviating intestinal oxidative stress in marine fish larvae. In the present disclosure, the sodium decanoate is a sodium salt of decanoic acid (a typical medium chain fatty acid). The sodium decanoate can directly enter cells and be quickly absorbed by the marine fish larvae, thereby improving an ability of the marine fish larvae to resist oxidative stress through P-oxidation properties.

[0014] The sodium decanoatemay be in the form of a composition including the following components in mass percentage: 3.57% to 28.57% of the sodium decanoate, 0% to 25.0% of microcrystalline cellulose, and high-gluten flour as a balance. The sodium decanoate is reasonably proportioned to the microcrystalline cellulose and the high-gluten flour, or to the high-gluten flour to obtain a composition. The composition effectively alleviates the oxidative stress of marine fish larvae including Larimichthys crocea larvae, and reduces the content of malondialdehyde. In this way, the activity of antioxidant enzymes in the marine fish larvae is improved, which is beneficial to growth and survival of the marine fish larvae. Meanwhile, the composition containing sodium decanoate has a low raw material cost, a high economic efficiency, and strong operability. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] To illustrate the examples of the present disclosure or the technical solutions in the prior art more clearly, the accompanying drawings required in the examples will be briefly introduced below.

[0016] FIG. 1 shows a detection result of a malondialdehyde content in intestinal segments of each group of Larimichthys crocea larvae in Use Example 1; 09 06 25

[0017] FIG. 2 shows a detection result of a superoxide dismutase activity in intestinal segments of each group of Larimichthys crocea larvae in Use Example 1;

[0018] FIG. 3 shows a detection result of a catalase activity in intestinal segments of each group of Larimichthys crocea larvae in Use Example 1;

[0019] FIG. 4 shows a detection result of a total antioxidant capacity in intestinal segments of each group of Larimichthys crocea larvae in Use Example 1;

[0020] FIG. 5 shows a detection result of a reduced glutathione content in intestinal segments of each group of Larimichthys crocea larvae in Use Example 1; and

[0021] FIG. 6 shows a detection result of an antioxidant-related gene in intestinal segments of each group of Larimichthys crocea larvae in Use Example 1. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0022] The present disclosure provides sodium decanoate for use in alleviating intestinal oxidative stress in marine fish larvae.

[0023] In the present disclosure, the product includes preferably a feed additive and / or a feed, more preferably the feed additive and the feed. The marine fish includes preferably Larimichthys crocea. In the present disclosure, the sodium decanoate is a sodium salt of decanoic acid (a typical medium chain fatty acid). The sodium decanoate can directly enter cells and be quickly absorbed by the marine fish larvae, thereby improving an ability of the marine fish larvae to resist oxidative stress through P-oxidation properties.

[0024] Based on the above advantages, the present disclosure further provides a composition containing sodium decanoate, including the following components in mass percentage:

[0025] 3.57% to 28.57% of the sodium decanoate, 0% to 25% of microcrystalline cellulose, and high-gluten flour as a balance.

[0026] In the present disclosure, the composition containing sodium decanoate includes 3.57% to 28.57%, more preferably 7.14% to 14.285% of the sodium decanoate by mass percentage. The sodium decanoate has an analytical purity of preferably not less than 98%. The sodium decanoate has an effect of alleviating oxidative stress.

[0027] In the present disclosure, the composition containing sodium decanoate includes 0% to 25%, more preferably 14.285% to 21.43% of the microcrystalline cellulose based on the mass percentage of the sodium decanoate. The microcrystalline cellulose has an analytical purity of preferably not less than 98%. The microcrystalline cellulose has a particle size of preferably 75 pm to 125 pm (120 mesh to 200 mesh), more preferably 75 pm (200 mesh). The 09 06 25 microcrystalline cellulose has an effect of promoting intestinal peristalsis.

[0028] In the present disclosure, in addition to the sodium decanoate and the microcrystalline cellulose, high-gluten flour is used to make up the remaining mass percentage in the composition containing sodium decanoate. The high-gluten flour acts as a diluent.

[0029] In the present disclosure, the sodium decanoate is reasonably proportioned to the microcrystalline cellulose and the high-gluten flour, or to the high-gluten flour to obtain a composition. The composition effectively alleviates the oxidative stress of marine fish larvae including Larimichthys crocea larvae, and reduces a content of malondialdehyde. In this way, the activity of antioxidant enzyme in the marine fish larvae is improved, which is beneficial to growth and survival of the marine fish larvae.

[0030] The present disclosure further provides a preparation method of the composition containing sodium decanoate, including the following steps: mixing the sodium decanoate, the microcrystalline cellulose, and the high-gluten flour, and pulverizing an obtained mixture to obtain the composition containing sodium decanoate.

[0031] In the present disclosure, the sodium decanoate, the microcrystalline cellulose, and the high-gluten flour are mixed to obtain a mixture. In some embodiments, the sodium decanoate and the microcrystalline cellulose are mixed and then mixed with the high-gluten flour. This mixing process adopts a mixing method based on step-by-step amplification, which can make each component more uniformly mixed and help improve the uniformity of the mixture.

[0032] In the present disclosure, the mixture is pulverized to obtain the composition containing sodium decanoate. The pulverization is preferably ultrafine pulverization. The composition containing sodium decanoate has a particle size of preferably 75 pm to 125 pm (120 mesh to 200 mesh), more preferably 75 pm (200 mesh). The composition containing sodium decanoate in the particle size has an effect of alleviating oxidative stress and can promote intestinal peristalsis to a certain extent.

[0033] The present disclosure further provides the composition containing sodium decanoate or a composition containing sodium decanoate for use in alleviating intestinal oxidative stress of marine fish larvae. The feed is more preferably a feed that alleviates intestinal oxidative stress in Larimichthys crocea larvae. In the use, the composition containing sodium decanoate accounts for preferably 2.8% of the feed for alleviating intestinal oxidative stress of marine fish larvae by mass. A method for using the feed for alleviating intestinal oxidative stress of marine fish larvae preferably include feeding 7 times a day, where each feeding is preferably feeding to satiation.

[0034] The present disclosure further provides an aquatic feed, including a basic feed and the composition containing sodium decanoate or a composition containing sodium decanoate 09 06 25 prepared by the preparation method. In the present disclosure, the composition containing sodium decanoate accounts for preferably 2.8% of the aquatic feed by mass. There is no special limitation on components and specific sources of the basic feed, and the basic feed with conventional components in the art and commercially available sources can be used. For example, the basic feed used in an example includes the following components by mass percentage: 35.00% of white fish meal, 20.00% of krill meal, 6.00% of yeast extract, 5.00% of squid meal, 5.00% of corn gluten meal, 8.55% of a-starch, 2.00% of sodium alginate, 5.60% of fish oil, 0.20% of choline chloride, 5.00% of soybean lecithin, 0.20% of L-ascorbate-2-phosphate, 2.00% of calcium dihydrogen phosphate, 1.50% of multi-vitamin, 1.00% of multi-mineral, 0.05% of mould inhibitor, 0.05% of an antioxidant, and 0.05% of lycopene.

[0035] In order to further illustrate the present disclosure, the technical solutions provided by the present disclosure will be described in detail below in conjunction with accompanying drawings and examples, but they should not be construed as limiting the protection scope of the present disclosure.

[0036] Example 1

[0037] 1) A composition containing sodium decanoate included the following components:

[0038] 3.57% of sodium decanoate, 25.0% of microcrystalline cellulose, and 71.43% of high-gluten flour, where the sodium decanoate had an analytical purity of >98% and the microcrystalline cellulose had an analytical purity of >98%;

[0039] Specifically, 3.57 g of the sodium decanoate, 25.0 g of the microcrystalline cellulose, and 71.43 g of the high-gluten flour were used; the following examples or comparative examples all adopted this formula and were not described again.

[0040] 2) A preparation method of the composition containing sodium decanoate included the following steps:

[0041] the sodium decanoate was mixed with the microcrystalline cellulose, and then mixed with the high-gluten flour in step 1) to obtain a mixture, and the mixture was ultrafinely pulverized to 75 pm (200 mesh) to obtain the composition containing sodium decanoate.

[0042] Example 2

[0043] 1) A composition containing sodium decanoate included the following components:

[0044] 7.14% of sodium decanoate, 21.43% of microcrystalline cellulose, and 71.43% of high-gluten flour, where the sodium decanoate had an analytical purity of >98% and the microcrystalline cellulose had an analytical purity of >98%.

[0045] 2) A preparation method of the composition containing sodium decanoate was the same as that of Example 1. 09 06 25

[0046] Example 3

[0047] 1) A composition containing sodium decanoate included the following components:

[0048] 14.285% of sodium decanoate, 14.285% of microcrystalline cellulose, and 71.43% of high-gluten flour, where the sodium decanoate had an analytical purity of >98% and the microcrystalline cellulose had an analytical purity of >98%.

[0049] 2) A preparation method of the composition containing sodium decanoate was the same as that of Example 1.

[0050] Example 4

[0051] 1) A composition containing sodium decanoate included the following components:

[0052] 28.57% of sodium decanoate and 71.43% of high-gluten flour, where the sodium decanoate had an analytical purity of >98%.

[0053] 2) A preparation method of the composition containing sodium decanoate included the following steps:

[0054] the sodium decanoate was mixed with the high-gluten flour in step 1) to obtain a mixture, and the mixture was ultrafinely pulverized to 75 pm (200 mesh) to obtain the composition containing sodium decanoate.

[0055] Comparative Example 1

[0056] 1) A composition included the following components:

[0057] 28.57% of microcrystalline cellulose and 71.43% of high-gluten flour, where the microcrystalline cellulose had an analytical purity of >98%.

[0058] 2) A preparation method of the composition included the following steps:

[0059] the microcrystalline cellulose was mixed with the high-gluten flour in step 1) to obtain a mixture, and the mixture was ultrafinely pulverized to 75 pm (200 mesh) to obtain the composition.

[0060] Examples 5 to 8 and Comparative Example 2

[0061] A feed for Larimichthys crocea larvae, including a basic feed for the Larimichthys crocea larvae and the composition in any one of Examples 1 to 4 and Comparative Example 1, where the feed in Example 5 included the composition in Example 1 (designated as Feed 2); the feed in Example 6 included the composition in Example 2 (designated as Feed 3); the feed in Example 7 included the composition in Example 3 (designated as Feed 4); the feed in Example 8 included the composition in Example 4 (designated as Feed 5); and the feed in Comparative Example 2 included the composition in Comparative Example 1 (designated as Feed 1). The specific feed formulas are shown in Table 1. In any one of Examples 5 to 8 and Comparative Example 2, the composition accounted for 2.8% of a total mass of the feed.

[0062] Table 1 Formulas of feeds in Examples 5 to 8 and Comparative Example 2

[0063] 09 06 25 Raw materials (%, feed dry weight) Feed 1 Feed 2 Feed 3 Feed 4 Feed 5 White fish meal 35.00 35.00 35.00 35.00 35.00 Krill meal 20.00 20.00 20.00 20.00 20.00 Yeast extract 6.00 6.00 6.00 6.00 6.00 Squid meal 5.00 5.00 5.00 5.00 5.00 Com gluten meal 5.00 5.00 5.00 5.00 5.00 a-starch 8.55 8.55 8.55 8.55 8.55 Sodium alginate 2.00 2.00 2.00 2.00 2.00 Fish oil 5.60 5.60 5.60 5.60 5.60 Choline chloride 0.20 0.20 0.20 0.20 0.20 Soyabean lecithin 5.00 5.00 5.00 5.00 5.00 L-ascorbate-2-phosphate 0.20 0.20 0.20 0.20 0.20 Calcium dihydrogen phosphate 2.00 2.00 2.00 2.00 2.00 Multi-vitamin1 1.50 1.50 1.50 1.50 1.50 Multi-mineral2 1.00 1.00 1.00 1.00 1.00 Mould inhibitorl 0.05 0.05 0.05 0.05 0.05 Antioxidant 0.05 0.05 0.05 0.05 0.05 Lycopene 0.05 0.05 0.05 0.05 0.05 Composition 2.80 2.80 2.80 2.80 2.80

[0064] 'Multi-vitamin (mg / kg): Retinal acetate, 32; a-tocopherol, 240; menadione, 10; vitamin Bl, 25; pyridoxine hydrochloride, 20; vitamin B12, 10; riboflavin, 45; pantothenic acid, 60; vitamin D3, 5; folic acid, 20; niacin, 200; biotin, 60; inositol, 800; microcrystalline cellulose, 13,473.

[0065] 2Multi-mineral: MgSO4 7H2O, 1,200; FeSO4 H2O, 80; ZnSO4 H2O, 50; CuSO4 5H2O, 10; MnSO4 H2O, 45; CoCl2 6H2O, 50; Na2SeO3, 20; H2CaIO4, 60; zeolite powder, 13,485.

[0066] Use Example 1

[0067] Use of the feeds for Larimichthys crocea larvae in Examples 5 to 8 and Comparative Example 2 in Larimichthys crocea larvae culture was as follows: 09 06 25

[0068] 52,500 Larimichthys crocea larvae were selected for the experiment, and were randomly divided into 5 groups, with three replicates in each group, and 3,500 larvae in each replicate. The larvae were subjected to a 30-day feeding and growth experiment, at a breeding water temperature of 23°C to 27°C. The larvae were fed using the feeds of Examples 5 to 8 and Comparative Example 2, 7 times a day, all of which were given full meals, and the feeding times were 06:30, 08:30, 10:30, 13:30, 15:30, 17:30, and 23:00.

[0069] After 30 days of feeding, intestinal tracts and intestinal segments of the Larimichthys crocea larvae in each group were collected, and the following tests were conducted:

[0070] The expression levels of antioxidant-related genes were measured and analyzed by quantitative polymerase chain reaction (q-PCR). The following genes were tested by q-PCR using ChamQ Universal SYBR qPCR Master Mix (Nanjing Vazyme Biotech Co., Ltd.) to obtain the mRNA expression levels, including: Nuclear factor erythroid 2-related factor 2 (nrf2), superoxide dismutase 1 (sodl), superoxide dismutase 2 (sod2), superoxide dismutase 3 (sod3), glutathione peroxidase (gpx), and catalase (cal) genes; while beta-actin (fi-actin) was used as a reference gene. The required q-PCR primers were designed according to nucleotide sequences of the Larimichthys crocea (Table 2).

[0071] Table 2 Primer sequences for q-PCR

[0072] Gene Abbreviatio n Upstream primer (5'-3') SN Downstream primer (5'-3') SN nrf2 TCTGATGTGCGTCTCTCCAG SEQ ID NO.l GCCTCATTCATTTGGTGCTT SEQ ID NO.2 sodl GCGGGACCGTGTTCTTTGA G SEQ ID NO. 3 GCTACCAGCGTTGCCAGTC TTT SEQ ID NO.4 sod2 GGCACTGGCAAAGGGAGA C SEQ ID NO. 5 CACAAGCGGCGATACGAAG SEQ ID NO.6 sod3 CCTGGAGACTTTGGTAACT TTG SEQ ID NO.7 TCCCTATTATACTGCTTATGG TG SEQ ID NO. 8 gP* CTGCTGGAGAAGGTGGATG T SEQ ID NO. 9 TGGAAGTTGTTGAACGGGA TA SEQ ID NO. 10 cat CTTCATCAGGGACGCTCTA CT SEQ ID NO. 11 ATGGCATAATCTGGGTTGGT SEQ ID NO. 12 / i-actin GACCTGACAGACTACCTCA TG SEQ ID NO. 13 AGTTGAAGGTGGTCTCGTG GA SEQ ID NO. 14 09 06 25

[0073] The malondialdehyde content, superoxide dismutase, catalase, total antioxidant capacity, and reduced glutathione were determined using commercial kits. The commercial kits were all purchased from Nanjing Jiancheng Bioengineering Institute. The names of the commercial kits were: malondialdehyde (MDA) assay kit (TBA method) (A003-1-2), total superoxide dismutase (T-SOD) assay kit (hydroxylamine method) (A001-1-2), catalase (CAT) assay kit (visible light method) (ammonium molybdate method) (A007-1-1), total antioxidant capacity (T-AOC) assay kit (FRAP method) microplate method (A015-3-1), and reduced glutathione (GSH) assay kit (spectrophotometry) (A006-1-1).

[0074] The experimental data were statistically analyzed by one-way analysis of variance in SPSS 20.0, and Tukey's multiple comparison was conducted after significant differences were obtained, and a significance level was P <0.05. The experimental data were represented by means ± standard error (means ± S.E.M., n=3).

[0075] Results were as follows:

[0076] 1) The detection results of malondialdehyde content are shown in FIG. 1. The malondialdehyde contents of Feed 1, Feed 2, Feed 3, Feed 4, and Feed 5 were 62.19, 52.67, 44.29, 44.10, and 52.42 mmol / mg protein, respectively. The results showed that Feed 3 and Feed 4 significantly reduced the malondialdehyde content in the intestinal segments of Larimichthys crocea larvae as compared with Feed 1. This indicated that the composition containing sodium decanoate reduced the level of lipid peroxidation in the intestinal segments of Larimichthys crocea larvae and alleviated the oxidative stress.

[0077] 2) The detection results of superoxide dismutase are shown in FIG. 2. The superoxide dismutase activities of Feed 1, Feed 2, Feed 3, Feed 4, and Feed 5 were 26.20, 33.76, 34.74, 34.09, and 30.37 U / mg protein, respectively. The results showed that Feed 2, Feed 3, and Feed 4 significantly increased the activity of superoxide dismutase in the intestinal segments of Larimichthys crocea larvae, as compared with Feed 1.

[0078] 3) The detection results of catalase were shown in FIG. 3. The catalase activities of Feed 1, Feed 2, Feed 3, Feed 4, and Feed 5 were 9.43, 17.52, 15.66, 17.40, and 19.43 U / mg protein, respectively. The results showed that compared with Feed 1, Feed 2, Feed 3, Feed 4, and Feed 5 significantly increased the catalase activity in the intestinal segments of Larimichthys crocea 09 06 25 larvae.

[0079] 4) The detection results of total antioxidant capacity are shown in FIG. 4. The total antioxidant capacity of Feed 1, Feed 2, Feed 3, Feed 4, and Feed 5 were 0.1231, 0.1814, 0.1710, 0.1739 / and 0.1567 mmol / mg protein, respectively. The results showed that Feed 2, Feed 3, and Feed 4 significantly increased the total antioxidant capacity of the intestinal segments of Larimichthys crocea larvae compared with Feed 1.

[0080] 5) The detection results of reduced glutathione are shown in FIG. 5. The reduced glutathione contents of Feed 1, Feed 2, Feed 3, Feed 4, and Feed 5 were 5.03, 6.04, 7.82, 7.45, and 7.36 mg GSH / mg protein, respectively. The results showed that Feed 3 significantly increased the reduced glutathione content in the intestinal segments of Larimichthys crocea larvae compared with Feed 1.

[0081] 6) The detection results of antioxidant-related genes are shown in FIG. 6. Compared with Feed 1, the antioxidant-related genes (sodl, sod2, sod'3, cat, and gpx) of Feeds 2 to 4 were increased to varying degrees, and the maximum value appeared in Feed 4. There was no significant difference in the expression level of nrf2 among each of the feeds.

[0082] From the above results, it could be concluded that the composition containing sodium decanoate and feed in the present disclosure could effectively alleviate the oxidative stress of Larimichthys crocea larvae, reduce the content of malondialdehyde, and improve the antioxidase activity of marine fish larvae.

[0083] Although the above examples have described the present disclosure in detail, they are only a part of, not all of, the embodiments of the present disclosure. Other examples may also be obtained by persons based on the embodiments without creative efforts, and all of these examples shall fall within the protection scope of the present disclosure.

Claims

09 06 251. Sodium decanoate for use in alleviating intestinal oxidative stress in marine fish larvae.

2. Sodium decanoate for use according to claim 1, wherein the sodium decanoate is in the form of a product comprising a feed additive and / or a feed.

3. Sodium decanoate for use according to claim 1 or 2, wherein the marine fish larvae comprises Larimichthys crocea larvae.

4. Sodium decanoate for use according to claim 1, wherein the sodium decanoate is in the form of a composition containing the following components in mass percentage: 3.57% to 28.57% of the sodium decanoate, 0% to 25% of microcrystalline cellulose, and high-gluten flour as a balance.

5. Sodium decanoate for use according to claim 4, wherein the composition comprising sodium decanoate has a particle size of 75 pm to 125 pm (120 mesh to 200 mesh).

Citation Information

Patent Citations

  • Application of sodium caprylate to larimichthys crocea feed and additive

    CN113854439A

  • Use of natural physiologically active substances against fish parasitic diseases

    EP1123701B1

  • Natural physiologically active material effective on fish diseases and fish food containing the material

    US20030162834A1