Magnetic bead technology system for amplifying signal of nucleic acid detection based on CRISPR technology, and use thereof

Abstract

Provided are reporting magnetic beads, the reporting magnetic beads comprising magnetic beads, nucleotides, and links to an enzyme having high catalytic activity. Further provided are a magnetic bead

Description

CROSS-REFERENCE TO RELATED APPLICATION

[0001] The present application claims priority to the Chinese Patent Application No. 202010793936.X, filed with the China National Intellectual Property Administration (CNIPA) on August 10, 2020, and entitled "Clustered regularly interspaced short palindromic repeats (CRISPR)-based signal amplification magnetic bead system for nucleic acid detection and use thereof', which is incorporated herein by reference in its entirety. TECHNICAL FIELD

[0002] The present disclosure belongs to the field of biotechnology and particularly relates to a clustered regularly interspaced short palindromic repeats (CRISPR) technology-based signal amplification magnetic bead system for nucleic acid detection and use thereof. BACKGROUND

[0003] CRISPR-based nucleic acid detection technology can be used for the detection of DNA or RNA molecules derived from plants, animals, microorganisms, and viruses. The proteins currently used for CRISPR-based nucleic acid detection include Cas 13a, Cas 12a, Cas 14, Cas 12b, Cas 13b, and Csm6 and other Cas proteins with a collateral nucleic acid cleavage activity.

[0004] A Cast3a protein molecule can recognize specific single-stranded RNA molecules, activate the collateral nucleic acid cleavage activity, and non-specifically cleave any singlestranded RNA molecule.

[0005] A crRNA nucleic acid molecule can bind to the Cas 13a protein molecule to form a crRNA-Casl3a complex. When the crRNA nucleic acid molecule matches a target RNA molecule, Casl3a specifically cleaves the target RNA and thus activates the collateral nucleic acid cleavage activity of Cas 13a, thereby cleaving any encountered single-stranded RNA molecule efficiently and non-specifically. The target RNA molecule can activate a Casl3a protein, and the activated Cast3a protein can cleave a large number of optional single-stranded RNA molecules. Taking advantage of this, the Cast 3a protein can be used to specifically detect a certain fragment of the RNA sequence. A specifically binding crRNA is designed for target RNA molecules. An RNA molecule to be detected, a specific crRNA molecule, a Cast3a protein molecule, and a reporter RNA molecule are added to a reaction system. A commonly used reporter RNA molecule is an oligonucleotide with a fluorophore (HEX) attached to one end and a quenching group (BHQ1) attached to the other end. An intact reporter RNA molecule does not 1 fluoresce due to quenching. When the RNA molecule to be detected matches crRNA-Casl3a, the crRNA-Casl3a may specifically cleave the RNA molecule to be detected, and then activate nonspecific RNA hydrolase activity of Cast3a (collateral nucleic acid cleavage activity), thereby cleaving the reporter RNA molecule, such that the fluorophore can get rid of the quenching group to release fluorescence. In this way, the presence or absence of the target RNA molecule can be detected by a fluorescence signal. If the target RNA molecule is not present in the system, a fluorescent gene of the reporter molecule does not express. Only when there is a target RNA molecule in the system, the non-specific RNA hydrolase activity (the collateral nucleic acid cleavage activity) of Casl3a is activated, and the fluorophore gets rid of the quenching group and emits the fluorescence signal. The detection sensitivity can reach an nM concentration level (10-9 M).

[0006] To improve the detection sensitivity, it is necessary to conduct nucleic acid amplification on the molecule to be detected before the reaction of Cas 13a. Commonly used nucleic acid amplification methods include RPA amplification, LAMP amplification, PCR amplification, ligase chain reaction, branched DNA amplification, NASBA, SDA, transcription-mediated amplification, rolling circle amplification, HDA, SPIA, NEAR, TMA, and SMAP2. An amplified and enriched molecule to be detected is subjected to a Casl3a reaction, with the detection sensitivity reaching an aM concentration level (10-18 M), namely 1,000 copies / mL to 10,000 copies / mL.

[0007] The Cast3a protein can be used to detect RNA molecules as well as DNA molecules. If the molecule to be detected is DNA, then the DNA molecule is amplified and enriched by RPA to obtain a large number of double-stranded DNA molecules. If the molecule to be detected is RNA, then RNA is reverse-transcribed into cDNA and then enriched by RPA (RT-RPA) to obtain a large number of double-stranded DNA molecules. After the RPA or RT-RPA, the molecule to be detected is greatly enriched to form double-stranded DNA molecules, which constitutes the first round of signal amplification. The double-stranded DNA molecules are converted into single-stranded RNA molecules through in vitro transcription (such as T7 transcription). When the single-stranded RNA molecule matches crRNA-Casl3a, crRNA-Casl3a may specifically cleave the RNA molecule to be detected, and then activate non-specific RNA hydrolase activity of Cas 13a (a collateral nucleic acid cleavage activity), thereby cleaving the reporter RNA molecule, such that the fluorophore can get rid of the quenching group to release fluorescence. In this way, the presence or absence of the target molecule can be detected by fluorescence signal. A single Cast3a molecule can cleave a large number of reporter RNA molecules, which constitutes the second round of signal amplification. Through two rounds of signal amplification (nucleic acid amplification + Cast3a cleavage), the detection sensitivity can reach an aM concentration level (10-18 M), namely 1,000 copies / mL to 10,000 copies / mL.

[0008] The process includes:

[0009] preparing DNA molecules to be detected »> conducting nucleic acid amplification »> conducting in vitro transcription »> conducting cleavage on reporter RNA molecules by Cast3a »> releasing fluorescence; alternatively, preparing RNA molecules to be detected »> conducting reverse transcription >conducting nucleic acid amplification »> conducting in vitro transcription »> conducting cleavage on reporter RNA molecules by Cast3a »>emiting fluorescence.

[0010] The Cas 12a protein molecule can recognize specific single-stranded DNA molecules or double-stranded DNAs, activate the collateral nucleic acid cleavage activity, and non-specifically cleave any single-stranded DNA molecule; and

[0011] The Cas 12a system differs from the Cast3a system in that: the Cas 12a specifically recognizes a single-stranded DNA molecule or a double-stranded DNA molecule and cleaves the single-stranded DNA molecule non-specifically. Therefore, a reporter molecule in the Casl2a system needs to be replaced with a single-stranded DNA molecule.

[0012] The crRNA nucleic acid molecule can bind to the Cas 12a protein molecule to form a crRNA-Casl2a complex. When the crRNA nucleic acid molecule matches a target DNA molecule (single-stranded DNA or double-stranded DNA), Cas 12a specifically cleaves the target DNA (single-stranded DNA or double-stranded DNA) and thus activates the collateral nucleic acid cleavage activity of Cas 12a, thereby cleaving any single-stranded DNA molecule encountered efficiently and non-specifically. The target DNA molecule can activate a Casl2a protein, and the activated Cas 12a protein can cleave a large number of optional single-stranded DNA molecules. Therefore, a reporter molecule in the Cas 12a system needs to be replaced with a single-stranded DNA molecule. The reporter DNA molecule is attached to a fluorescein at one end and a quencher to the other end and has a mechanism similar to that of the Casl3a.

[0013] Since Cas 12a can recognize double-stranded DNA molecules, RPA amplification can be used directly in a Cas 12a cleavage reaction without the need for in vitro transcription.

[0014] The process includes: preparing DNA molecules to be detected »> conducting nucleic acid amplification (such as RPA) »> conducting cleavage on reporter DNA molecules by Cas 12a »>emitting fluorescence; alternatively, preparing RNA molecules to be detected »> conducting reverse transcription> conducting nucleic acid amplification (such as RPA) »> conducting cleavage on reporter DNA molecules by Cas 12a »>emitting fluorescence.

[0015] The Cas 14 protein molecule can recognize specific single-stranded DNA molecules, activate the collateral nucleic acid cleavage activity, and non-specifically cleave any singlestranded DNA molecule. The Cas 14 system differs from the Cast3a system in that: Cas 14 specifically recognizes a single-stranded DNA molecule and cleaves the single-stranded DNA molecule non-specifically. The reporter molecule in the Casl4 system is a single-stranded DNA molecule.

[0016] The crRNA nucleic acid molecule can to the Cas 14 protein molecule to form a crRNA-Casl4 complex. When the crRNA nucleic acid molecule matches a target single-stranded DNA molecule, Cas 14 specifically cleaves the target single-stranded DNA molecule and thus activates a collateral nucleic acid cleavage activity of Cas 14, thereby cleaving any single-stranded DNA molecule encountered efficiently and non-specific. The single-stranded DNA molecule can activate a Cas 14 protein and the activated Cas 14 protein can cleave a large number of optional single-stranded DNA molecules. The reporter molecule in the Casl4 system is a single-stranded DNA molecule. The reporter DNA molecule is attached to fluorescein at one end and a quencher at the other end and has a mechanism similar to that of the Casl3a.

[0017] Since Casl4 recognizes single-stranded DNA molecules, a double-stranded DNA after RPA needs to be single-stranded (for example, the single-stranded DNA can be obtained by T7 exonuclease degradation), followed by conducting a Cas 14 cleavage reaction.

[0018] The process includes: preparing DNA molecules to be detected »> conducting nucleic acid amplification (such as RPA) »> conducting single-stranded treatment »> conducting cleavage on reporter DNA molecules by Cas 14 »> emitting fluorescence; alternatively, preparing RNA molecules to be detected »> conducting reverse transcription> conducting nucleic acid amplification (such as RPA) »> conducting single-stranded treatment »> conducting cleavage on reporter DNA molecules by Cas 14 »> emitting fluorescence.

[0019] Cas 12b, Cas 13b, and Csm6 each have a similar principle to the above Cas proteins, and may not be described again. However, whether it is Casl3a, Casl2a, Casl4, Casl2b, Casl3b, or Csm6, the detection sensitivity of nucleic acids can only reach the aM concentration level (10-18 M, namely 1,000 copies / mL to 10,000 copies / mL). When the molecule to be detected has a concentration of lower than 1,000 copies / mL, missed detection is prone to occur, resulting in false negative results. Many clinical tests require sensitivity at a zM concentration level (10-21 M, or 1 copy / mL to 10 copies / mL) to meet the requirements. SUMMARY

[0020] The purpose of the present disclosure is to improve the sensitivity of the existing specific nucleic acid detection based on the CRISPR technology from an aM concentration level (1,000 copies / mL to 10,000 copies / mL) to a zM concentration level (1 copy / mL to 10 copies / mL). To achieve the purpose of the present disclosure, a catalytic enzyme is introduced as a third-level signal amplification system based on an original two rounds of signal amplification including nucleic acid amplification and non-specific random cleavage by a Cas protein. Therefore, the present disclosure provides a CRISPR technology-based signal amplification magnetic bead system for nucleic acid detection. The present disclosure further provides a method for identifying a target nucleotide molecule using the system. The sequence of the target nucleotide molecule is detected from samples of various sources and various detection kits and methods are constructed. The cell detection technology realizes high-sensitivity detection and can detect a large number of samples and nucleic acid molecules of extremely low content, with high sensitivity.

[0021] To solve the above problems, the present disclosure provides a reporter magnetic bead including a magnetic bead, a nucleotide, and an enzyme with a high catalytic activity, which are ligated in sequence.

[0022] The nucleotide is one or more selected from the group consisting of single-stranded DNA, double-stranded DNA, and single-stranded RNA.

[0023] The nucleotide is biotin-ligated ssDNA.

[0024] Two ends of the ssDNA molecule are labeled with digoxin and biotin, respectively.

[0025] The enzyme with high catalytic activity includes but is not limited to P-Gal enzyme, and the P-Gal enzyme can also be replaced with horseradish peroxidase (HRP). Therefore, by observing a color change with naked eye, it can be determined whether a sample includes the target molecule, which can get rid of the dependence on fluorescence measuring instruments and is used for rapid screening in the community. The P-Gal enzyme can also be replaced with other phosphatases such as alkaline phosphatase (AP), carboxylate hydrolase, glycoside hydrolase, and protease; the P-Gal enzyme can also be replaced with oxidoreductases such as tyrosinase, monoamine oxidase, nitroreductase (NTR), and thioredoxinreductase; and the P-Gal enzyme can also be replaced with transferases such as y-glutamyltransferase (GGT).

[0026] The P-Gal enzyme (P-galactosidase) is labeled with streptavidin and the P-Gal enzyme is coupled to the other end, namely a free end, of the single-stranded DNA (or RNA) molecule through streptavidin-biotin interaction.

[0027] The present disclosure further includes a construction method of the reporter magnetic bead, including the following steps: ligating a magnetic bead with the nucleotide by a covalent bond to obtain a nucleotide-magnetic bead and ligating the enzyme with high catalytic activity with the nucleotide-magnetic bead by streptavidin and biotin to obtain the reporter magnetic bead.

[0028] The present disclosure further includes a CRISPR technology-based signal amplification magnetic bead system for nucleic acid detection, where the signal amplification magnetic bead system includes the reporter magnetic bead.

[0029] The present disclosure further includes the use of the reporter magnetic bead or the signal amplification magnetic bead system in preparation of a reagent or a kit for detection of nucleic acid.

[0030] The present disclosure further includes a nucleic acid detection kit, where the kit includes the reporter magnetic bead or the signal amplification magnetic bead system.

[0031] The present disclosure further includes an ultra-sensitivity nucleic acid detection method based on CRISPR technology, including the following steps:

[0032] 1) subjecting a virus solution to thermal inactivation and lysis to release an RNA molecule of a virus, extracting the RNA molecule in a virus suspension using a nano-nucleic acid magnetic bead to obtain a target molecule, adding the magnetic bead after extraction to an RT-RPA (reverse-transcription recombinase polymerase amplification) isothermal amplification reaction system, and conducting RT-RPA isothermal amplification on the target molecule to obtain a first-level signal amplification;

[0033] 2) extracting a DNA molecule obtained by the first-level signal amplification using the original nano-nucleic acid magnetic beads, adding the DNA molecule to a CRISPR protein with collateral cleavage activity to specifically recognize and cleave a viral target DNA molecule, and activating non-specific cleavage activity of the CRISPR protein with a collateral cleavage activity to initiate a second-level signal amplification; and

[0034] 3) adding the reaction system with the reporter magnetic beads; cleaving an ssDNA molecule by the non-specific cleavage activity of the CRISPR protein with collateral cleavage activity to release a free enzyme with high catalytic activity into a supernatant of the system; adsorbing each magnetic bead with a magnet, collecting a supernatant containing the free enzyme with high catalytic activity and conducting a reaction using a fluorescent substrate, and conducting detection by reading a microplate reader to obtain a detection result.

[0035] The CRISPR protein with a collateral cleavage activity is one or more selected from the group consisting of Casl3a, Casl2a, Casl4, Casl2b, Casl3b, and Csm6.

[0036] The present disclosure not only applies to Cas 12a but also applies to other Cas proteins with collateral nucleic acid cleavage activity, for example. Cas 13a, Cas 14, Cas 12b, Cas 13b, and Csm6. Similarly, the Cas proteins are also suitable for nucleic acid detection in animals, plants, and microorganisms.

[0037] The enzymatic substrate includes but is not limited to the substrate of fluorescein di-P-D-galactopyranoside (FDG) with a CAS number: 17817-20-8. FDG is a highly-sensitive fluorescent substrate of P-galactosidase, which is 100 to 1,000 times more sensitive than radiolabeling detection and can be used for the detection of single-enzyme molecules. The substrate reaction includes: FDG is converted into FMG (with a reaction efficiency of 1.9 pmolemim ^mg'1), and then FMG is converted into a fluorescence signal (with a reaction efficiency of 22.7 gm ole • min-1 • mg'x).

[0038] When the single-stranded DNA (or RNA) molecule is cleaved by the Cas protein, the P-Gal enzyme is detached from the magnetic bead. The P-Gal enzyme in the supernatant is collected and transferred to a reaction solution containing a P-Gal fluorescent probe. One P-Gal enzyme molecule can catalyze to produce 2,000 to 3,000 fluorescent molecules. Accordingly, the detection signal is amplified in the third level to achieve a detection sensitivity of zM concentration level (1 copy / mL to 10 copies / mL). (The first-level amplification is nucleic acid amplification; the second-level amplification is cleavage and amplification of DNA (or RNA) molecules by the Cas protein and the third-level amplification is achieved through the enzymatic action of the P-Gal enzyme molecule on a molecular substrate.

[0039] In the present disclosure, in the signal amplification magnetic bead system, the nucleotides are immobilized on the surface of the magnetic beads by surface immobilization, and the nucleotide has one end immobilized on the surface of the magnetic bead and the other end immobilized with the enzyme of high catalytic activity. The CRISPR protein with collateral cleavage activity binds to a gRNA molecule or a crRNA molecule to form a protein-nucleic acid complex, and the complex specifically recognizes a specific sequence and has the collateral cleavage activity activated by a specific nucleotide molecule. The protein-nucleic acid complex can non-specifically cleave a nucleotide sequence immobilized on the surface of the magnetic bead, and release a highly-active enzyme into the solution system. Meanwhile, the unreleased enzymes can be removed by magnetic beads. The enzyme released into the solution system is detected by a fluorescent substrate, thereby detecting the target nucleotide sequence.

[0040] Preferably, the "third-level signal amplification" means that the first-level amplification is RPA isothermal amplification; the second-level amplification is cleavage and amplification of ssDNA molecules by Casl2a and the third-level amplification is the enzymatic action of the P-galactosidase molecules on a fluorescent probe molecule. Cas 12a can recognize and non-specifically cleave single-stranded "DNA" molecules. One reason is that DNA molecules are more stable. In addition, different crRNAs can be designed for different detection of various viruses or target molecules. In the CRISPR molecular diagnostic technology, the "high specificity" means that as long as there is the mismatch of one or more bases, the cleavage reaction of the Cas protein cannot be conducted, and the "high sensitivity" resolution is the innovative "three-level signal amplification" method introduced in the present disclosure, including RT-RPA isothermal amplification, Casl2a non-specific cleavage activity, and "P-galactosidase: FDG fluorescent probe". The signal at this step is 100 to 1,000 times more sensitive than radio-labeling techniques.

[0041] In the present disclosure, compared with a "fluorescence-DNA-quenching group" method previously used in other CRISPR nucleic acid detection organizations, the last-level P-galactosidase signal detection provides an additional one-level molecular signal amplification of enzymatic reactions, and ability of P-galactosidase to catalyze a substrate is much higher than a cleavage efficiency of Cas 12a.

[0042] In the whole reaction, the nano-magnetic bead nucleic acid extraction technology involved is mature and easy to automate, and related magnetic bead extraction automation equipment is of low cost. If there is a small batch size, a simple manual operation that requires a magnetic rod only may be used. Moreover, viral RNA molecules from the virus in the first extraction may allow all viral nucleic acids to be fully utilized, and DNA molecules for the RT-RPA isothermal amplification in the second extraction can ensure that all specifically-activated molecules are completely collected to improve the detection sensitivity.

[0043] In subsequent use of the reporter magnetic bead of magnetic bead-nucleic acid DNA-P-galactosidase, a large amount of the free P-galactosidase can be released due to the non-specific cleavage of Cas 12a. Meanwhile, with the help of magnetic beads, the reaction system can be controlled at 20 pL to 200 pL, thereby greatly increasing the concentration ofp-galactosidase released by cleaving DNA on the magnetic beads. The reaction substrate FDG is added for incubation, reading the results using a microplate reader, and sensitivity can be increased to zM level (5 copies / mL to 50 copies / mL).

[0044] Preferably, the present disclosure further includes an ultra-sensitivity nucleic acid detection method based on CRISPR technology, including the following steps:

[0045] 1) subjecting a virus solution to thermal inactivation and lysis to release a RNA molecule of a virus, extracting the RNA molecule in an virus suspension using nano-nucleic acid magnetic beads to obtain a target molecule, adding the magnetic beads after extraction to an RT-RPA (reverse-transcription recombinase polymerase amplification) isothermal amplification reaction system, and conducting RT-RPA isothermal amplification on the target molecule to obtain a first-level signal amplification;

[0046] 2) extracting a DNA molecule obtained by the first-level signal amplification using the original nano-nucleic acid magnetic beads, adding the DNA molecule to a Cas 12a protein to specifically recognize and cleave a viral target DNA molecule, and activating non-specific cleavage activity of Cas 12a protein to initiate the second-level signal amplification; where the specific cleavage-activated Cas 12a molecule can non-specifically cleave 108 to 109 nucleic acid molecules. After the two rounds of signal amplification, the detection sensitivity at this stage can reach a level of 1 aM to 10 aM; and

[0047] 3) adding the reaction system with a magnetic bead with the reporter of "ssDNA-P-galactosidase"; cleaving an ssDNA molecule by the non-specific cleavage activity of Casl2a to release free P-galactosidase into a supernatant of the system; adsorbing each magnetic bead with a magnet, collecting a supernatant containing the free P-galactosidase and conducting a reaction using a substrate, and conducting detection by reading a microplate reader to obtain a detection result.

[0048] Due to the non-specific cleavage of Cas 12a, P-galactosidase can be released. Meanwhile, with the aid of magnetic beads, the reaction system can be controlled to a volume of 20 pL to 200 pL, thereby greatly increasing a concentration of P-galactosidase released by cleaving DNA on the magnetic beads. The reaction substrate FDG fluorescent probe is added, and one molecule of P-galactosidase can catalyze 103 to 104 molecules of FDGs to emit fluorescence, the results are read using a microplate reader. After the signal is subject to the third-level amplification, and RNA virus molecule has been amplified to a detectable fluorescence signal molecule level of 1019 to 1021, with the sensitivity reaching a level of 1 zM to 10 zM.

[0049] In the first-level signal amplification, in addition to the RT-RPA isothermal amplification, other nucleic acid amplification methods can also be used, including but not limited to, LAMP amplification, PCR amplification, ligase chain reaction, branched DNA amplification, NASBA, SDA, transcription-mediated amplification, rolling circle amplification, HD A, SPIA, NEAR, TMA, and SMAP2.

[0050] Compared with the prior art, the present disclosure has the following advantages: a third-level signal amplification system (reporter magnetic bead) is introduced based on a two-round signal amplification including nucleic acid amplification and non-specific random cleavage by a Cas protein, such that the sensitivity is increased from an aM concentration level (1,000 copies / mL to 10,000 copies / mL) to a zM concentration level (1 copy / mL to 10 copies / mL). BRIEF DESCRIPTION OF THE DRAWINGS

[0051] FIG. 1 shows the structure of a traditional reporter molecule;

[0052] FIG. 2 shows a schematic diagram of a method for the detection of coronavirus RNA constructed with a Casl2a-based system;

[0053] FIG. 3 shows a schematic diagram of the working principle of the present disclosure;

[0054] FIG. 4 shows a schematic diagram of the working principle of an amplification system of the present disclosure;

[0055] FIG. 5 shows a schematic diagram of the working principle of a reporter magnetic bead of the present disclosure;

[0056] FIG. 6 shows a schematic diagram of the detection process of the signal amplification magnetic bead system of the present disclosure;

[0057] FIG. 7 shows the experimental results of Example 1 of the present disclosure;

[0058] FIG. 8 shows the experimental results of Example 2 of the present disclosure; and

[0059] FIG. 9 shows the experimental results of Example 3 of the present disclosure. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0060] The present disclosure will be further described below by referring to the accompanying drawings.

[0061] Pseudovirus is a class of chimeric virus particles expressing a recombinant glycoprotein of another virus on the surface of a replication-deficient virus (viral vector), which can be used as a control sample for nucleic acid detection. For example, a pseudovirus used in the COVID-19 research is to package a specific nucleic acid sequence of SARS-CoV-2 into a retrovirus or bacteriophage to construct a protein-encapsulated RNA structure, producing an RNA extraction effect that is theoretically the same as that of the original virus. In the present disclosure, all nucleotide sequences are synthesized by Nanjing GenScript Biotechnology Co., Ltd. The reporter magnetic beads are synthesized by Beaver Biosciences Inc.

[0062] Example 1

[0063] The specific technical solution of the present disclosure is explained by taking a coronavirus RNA detection method constructed by a Casl2a-based magnetic bead system for signal amplification as an example:

[0064] 1. Test sample: pseudovirus (as a control substance)

[0065] Product name: COVID-19-pseudovirus (or called 2019-nCOV pseudovirus)

[0066] Product number: 11900ES08 (Yeasen Biotechnology (Shanghai) Co., Ltd.)

[0067] Specification: 5x1 mL

[0068] Target value = 1 x 108 copies / mL

[0069] 2. Sequence to be detected:

[0070] ggttatggctgtagttgtgatcaactccgcgaacccatgcttcagtcagctgatgcacaatcgtttttaaacgggtttgcggtgtaa gtgcagcccgtcttacaccgtgcggcacaggcactagtactgatgtcgtatacagggcttttgacatc (SEQ ID NO: 5)

[0071] 3. Synthesis of isothermal amplification primers

[0072] RPA-F primer: GGTTATGGCTGTAGTTGTGATCAACTCCGC (SEQ ID NO: 2)

[0073] RPA-R primer: GATGTCAAAAGCCCTGTATACGACATCAGTAC (SEQ ID NO: 3)

[0074] 4. Design and synthesis of crRNA

[0075] A crRNA sequence was designed and synthesized as AGACGGGCUGCACUUACACCG (SEQ ID NO: 4).

[0076] 5. Design and preparation of reporter magnetic beads

[0077] 5.1. Design and synthesis of reporter DNA: design and synthesis of reporter DNA molecule 1: 5'- / HEX / AATGGCAAATGGCA (SEQ ID NO: l) / BHQl / -3' (as a control group to detect the effect of existing CRISPR nucleic acid detection technology (two-level signal amplification)).

[0078] Design and synthesis of reporter DNA molecule 2: 5'- / amino group / AATGGCAAATGGCA (SEQ ID NO: l) / 3Bio_SA_P-Gal / -3'.

[0079] 5.2. Design and preparation of reporter magnetic beads

[0080] The reporter DNA molecule 2 was covalently bound to magnetic beads to obtain the reporter magnetic beads:

[0081] magnetic bead (carboxyl group)- / 5' amino group / AATGGCAAATGGCA (SEQ ID NO: 1) / 3' Bio_SA_P-Gal (as an experimental group to detect the effect of improved CRISPR nucleic acid detection technology (third-level signal amplification) of the present disclosure).

[0082] 6. LbCasl2a protein

[0083] Plasmid: pMBP-LbCasl2a;

[0084] Source: Chen et al. Science. Apr 27, 2018; 360 (6387): 436-439.

[0085] 7. Extraction of pseudovirus RNA

[0086] 7.1. The pseudovirus was subjected to gradient dilution to obtain the following 6 concentration gradients:

[0087] 500,000 copies / mL(800 aM); 50,000 copies / mL(80 aM); 5,000 copies / mL(8 aM); 500 copies / mL(800 zM); 50 copies / mL(80 zM); 5 copies / mL(8 zM).

[0088] 7.2. After step 7.1, pseudovirus samples with 6 concentration gradients were obtained, and 1 mL of each sample was taken for extraction of nucleic acid; two parallel experiments were conducted for each concentration gradient, and a total of 12 nucleic acid samples with the 6 concentrations of pseudoviruses were obtained.

[0089] Nucleic acid extraction kit: a viral DNA / RNA extraction kit (using a magnetic bead method)

[0090] Brand: Beaver Biosciences

[0091] Product number: 70406-20

[0092] 8. Isothermal amplification (RT-RPA)

[0093] RPA kit: TwistAmp Basic RT

[0094] Brand: TwistDx

[0095] Product number: TABSRT01 KIT

[0096] RT-RPA was conducted on 12 RNAs of the 6 concentrations of pseudoviruses extracted in the above step 7.2 separately.

[0097] Reaction system: the total reaction volume was 100 pL; 0.48 pM of the RPA-F primer; 0.48 pM of the RPA-R primer; Ixrehydration buffer; 4 mM of magnesium acetate; RPAMix, and the viral RNA extracted in step 7.2.

[0098] Reaction temperature: 37°C

[0099] Reaction time: 10 min.

[0100] 9. Twelve isothermal amplification products of the 6 concentrations of pseudoviruses obtained in step 8 were concentrated and purified with a purification reagent for amplification product (by the magnetic bead method)

[0101] Brand: Beaver Biosciences

[0102] Product number: PCR-5G

[0103] 10. Cleavage reaction of Casl2a

[0104] Twelve purified products of the pseudoviruses with 6 concentrations obtained in step 9 were divided into a control group and an experimental group.

[0105] Control group:

[0106] Reaction system: the purified products of pseudoviruses with 6 concentrations obtained in step 9; 0.5 pM of pMBP-LbCasl2a; 1 pM of crRNA; 1 pM of reporter DNA molecule 1; the total reaction volume was 50 pL.

[0107] Reaction temperature: 37°C

[0108] Reaction time: 30min.

[0109] Experimental group:

[0110] Reaction system: the purified products of the pseudoviruses with 6 concentrations obtained in step 9; 0.5 pM of LbCasl2a; 1 pM of crRNA; reporter magnetic bead (containing 1 pM of the reporter DNA molecule 2); total reaction volume was 50 pL.

[0111] Reaction temperature: 37°C

[0112] Reaction time: 30min.

[0113] 11. Determination of fluorescence signal of the control group

[0114] 50 pL of reaction solution in the control group was added to a 96-well plate, and the fluorescence signal was detected using a microplate reader (with an excitation light at 535 nm and an emission light at 556 nm).

[0115] 12. Collection of supernatant of the experimental group

[0116] Due to the non-specific cleavage activity of Cas 12a, the reporter DNA molecule 2 on the magnetic beads was cleaved to release free P-galactosidase into the supernatant of the system, each magnetic bead was adsorbed by a magnetic rod, and the supernatant containing the free P-galactosidase was collected.

[0117] 13. Collection of supernatant of the experimental group for enzymatic reaction

[0118] Reaction system: 100 mM of sodium phosphate; 1 mM of MgCh; 50 mM of P-mercaptoethanol; 3 mg / mL of FDG; 50 pL of the supernatant in step 12; total volume of the reaction system was 100 pL.

[0119] Reaction temperature: room temperature

[0120] Reaction time: 15 min

[0121] 14. Determination of fluorescence signal of the experimental group

[0122] 100 pL of reaction solution from step 13 of the experimental group was added to a 96-well plate, and the fluorescence signal was detected using a microplate reader (with an excitation light at 485 nm and an emission light at 530 nm).

[0123] 15. Experimental results (FIG. 7)

[0124] 1) When using the second-level signal amplification system, a lower limit of detection was 5,000 copies / mL, and almost no fluorescence signal was collected from the samples at a concentration below 5,000 copies / mL.

[0125] 2) When using the third-level signal amplification system, the lower limit of detection could reach 5 copies / mL. Compared with the original second-level signal amplification technology (5,000 copies / mL), detection sensitivity was increased by 1,000 times. Therefore, the sensitivity was increased from an aM level to a zM level.

[0126] 3) In high-concentration samples, fluorescence signal values each were close to saturation, therefore the fluorescence signal values collected by the second-level signal amplification system and the third-level signal amplification system did not have an extremely significant difference. However, as the sample concentration decreased, the difference between the fluorescence signal values collected by the two signal amplification systems became increasingly significant.

[0127] Example 2

[0128] A specific technical solution of the present disclosure is explained by taking a SalmonelldDNA. detection method constructed by a Casl3a-based magnetic bead system for signal amplification as an example:

[0129] 1. Test sample: Salmonella standard plasmid (as a control substance)

[0130] The preparation process of the Salmonella standard plasmid included: an invA gene of Salmonella (GenBank: KJ718885.1) that was selected as a specific detection fragment, and a fragment of the invA gene with a size of 287 bp was ligated to a pMD19-T vector to construct a standard plasmid.

[0131] Specification: 10x1 mL

[0132] Target value = 5 x 1010 copies / mL

[0133] 2. Sequence to be detected:

[0134] TGTGAAATTATCGCCACGTTCGGGCAATTCGGTATTGACGATAGCCTGGCGG TGGGTTTTGTTGTCTTCTCTATTGTCACCGTGGTCCAGTTTATCGTTATTACCAAAGG TTCAGAACGCGTCGCGGAAGTCGCGGCCCGATTTTCTCTGGATGGTATGCCCGGTAA ACAGATGAGTATTGATGCCGATTTGAAGGCCGGTATTATTGATGCGGATGCCGCGCG CGAACGGCGAAGCGTACTGGAAAGAGAAAGCCAGCTTTACGGTTCCTTTGACGGTG CGATGAA (SEQ ID NO: 6)

[0135] 3. Design and synthesis of isothermal amplification primers

[0136] RPA-F primer: TTCGGGCAATTCGGTATTGACGATAGCC (SEQ ID NO: 7)

[0137] RPA-R primer: TCGCACCGTCAAAGGAACCGTAAAGCTGG (SEQ ID NO: 8)

[0138] 4. Design and synthesis of crRNA

[0139] crRNA was designed and synthesized as TTGATGCCGATTTGAAGGCCGGTATTAT (SEQ ID NO: 9)

[0140] 5. Design and preparation of reporter magnetic beads

[0141] 5.1. Design and synthesis of reporter RNA

[0142] Design and synthesis of reporter RNA molecule 1: 5'- / HEX / AAUGGCAAAUGGCA (SEQ ID NO: 10) / BHQl / -3' (as a control group to detect the effect of existing CRISPR nucleic acid detection technology (two-level signal amplification)).

[0143] Design and synthesis of reporter RNA molecule 2: 5'- / amino group / AAUGGCAAAUGGCA (SEQ ID NO: 10) / 3Bio_SA_P-Gal / -3'.

[0144] 5.2. Design and preparation of the reporter magnetic beads: the reporter RNA molecule 2 was covalently bound to magnetic beads to obtain the reporter magnetic beads:

[0145] magnetic bead (carboxyl group)- / 5' amino group / AAUGGCAAAUGGCA(SEQ ID NO: 10) / 31 Bio_SA_P-Gal (as an experimental group to detect the effect of improved CRISPR nucleic acid detection technology (third-level signal amplification) of the present disclosure).

[0146] 6. LwaCasl3a protein

[0147] Brand: HuicHBiochem (Shanghai)

[0148] Item number: KX-E-003;

[0149] Specification: 500 pmol / 100 pL.

[0150] 7. Dilution of Salmonella standard plasmid

[0151] The Salmonella standard plasmid was subjected to gradient dilution into the following 6 concentration gradients, and two samples were retained for each concentration gradient for parallel experiments:

[0152] 100,000 copies / mL (160 aM); 10,000 copies / mL(16 aM); 1,000 copies / mL(1.6 aM); 100 copies / mL(160 zM); 10 copies / mL(16 zM); 1 copy / mL(1.6 zM).

[0153] 8. Isothermal amplification (RPA)

[0154] RPA kit: TwistAmp Basic

[0155] Brand: TwistDx

[0156] Product number: TABAS03KIT

[0157] RPA was conducted on 12 DNAs of the Salmonella standard plasmids at 6 concentrations obtained in step 7 separately;

[0158] Reaction system: the total reaction volume was 100 pL; 0.48 pM of the RPA-F primer; 0.48 pM of the RPA-R primer; Ixrehydration buffer; 4 mM of magnesium acetate; RPA Mix, and the Salmonella standard plasmid samples extracted in step 7.

[0159] Reaction temperature: 37°C

[0160] Reaction time: 10 min.

[0161] 9. Twelve isothermal amplification products of the 6 concentrations of Salmonella standard plasmids obtained in step 8 were concentrated and purified.

[0162] Concentration and purification reagent: purification reagent for amplification product (using the magnetic bead method)

[0163] Brand: Beaver Biosciences

[0164] Product number: PCR-5G

[0165] 10. Cleavage reaction of Casl3a

[0166] Twelve purified products of the Salmonella standard plasmids with 6 concentrations obtained in step 9 were divided into a control group and an experimental group.

[0167] Control group:

[0168] Reaction system: the purified products of the Salmonella standard plasmids with 6 concentrations obtained in step 9; 0.5 pM of LwaCasl3a; 1 pM of crRNA; 1 pM of reporter RNA molecule 1; total reaction volume was 50 pL.

[0169] Reaction temperature: 37°C

[0170] Reaction time: 30min.

[0171] Experimental group:

[0172] Reaction system: the purified products of the Salmonella standard plasmids with 6 concentrations obtained in step 9; 0.5 pM of LwaCasl3a; 1 pM of crRNA; reporter magnetic bead (containing 1 pM of the reporter RNA molecule 2); the total reaction volume was 50 pL.

[0173] Reaction temperature: 37°C

[0174] Reaction time: 30min.

[0175] 11. Determination of fluorescence signal of the control group

[0176] 50 pL of reaction solution in the control group was added to a 96-well plate, and a fluorescence signal was detected using a microplate reader (with an excitation light at 535 nm and an emission light at 556 nm).

[0177] 12. Collection of supernatant of the experimental group

[0178] Due to the non-specific cleavage activity of Cas 13a, the reporter RNA molecule 2 on the magnetic beads was cleaved to release free P-galactosidase into the supernatant of the system, each magnetic bead was adsorbed by a magnetic rod, and the supernatant containing the free P-galactosidase was collected.

[0179] 13. Collection of supernatant of the experimental group for enzymatic reaction

[0180] Reaction system: 100 mM of sodium phosphate; 1 mM of MgCl2; 50 mM of P-mercaptoethanol; 3 mg / mL of FDG; 50 pL of the supernatant in step 12; total volume of the reaction system was 100 pL.

[0181] Reaction temperature: room temperature

[0182] Reaction time: 15 min

[0183] 14. Determination of fluorescence signal of the experimental group

[0184] 100 pL of reaction solution from step 13 of the experimental group was added to a 96-well plate, and the fluorescence signal was detected using a microplate reader (with an excitation light at 485 nm and an emission light at530 nm).

[0185] 15. Experimental results (FIG. 8)

[0186] 1) When using the second-level signal amplification system, a lower limit of detection was 1,000 copies / mL, and almost no fluorescence signal was collected from the samples with a concentration below 1,000 copies / mL.

[0187] 2) When using the third-level signal amplification system, the lower limit of detection could reach 1 copy / mL. Compared with the original second-level signal amplification technology (1,000 copies / mL), detection sensitivity was increased by 1,000 times. Therefore, the sensitivity was increased from an aM level to a zM level.

[0188] 3) In high-concentration samples, fluorescence signal values each were close to saturation, therefore the fluorescence signal values collected by the second-level signal amplification system and the third-level signal amplification system did not have an extremely significant difference. However, as the sample concentration decreased, the difference between the fluorescence signal values collected by the two signal amplification systems became increasingly significant.

[0189] Example 3

[0190] The specific technical solution of the present disclosure is explained by taking a detection method of Schistosomamansoni in water samples of an epidemic area constructed by a Casl2a-based magnetic bead system for signal amplification as an example:

[0191] 1. The samples to be tested were: a water sample confirmed to be slightly contaminated with Schistosomamansoni (A), a water sample confirmed to be moderately contaminated with Schistosomamansoni (B), a water sample confirmed to be free of Schistosomamansoni (C), and a Schistosomamansoni sample (D).

[0192] 2. DNA extraction of the samples to be tested: four DNA samples of A, B, C, and D were obtained by extraction.

[0193] 3. Sequence to be detected:

[0194] CCTTCGGGCATTGCTGAGTGTGGTCGGTTTGTTACTAGCTTCGGCTGGTCGGC TGATGGCTTGGTTTTGTCACGTCGGCGGTTGCGTGTGTGGTTTGCATTGGGCCAATA GTCTGTGGTGTAGTGGTAGACGATCCACCTGACCCGTCTTGAAACACGGACCAAGG AGTTTAACATGTGCGCGAGTCATTGGGTGTTACGAAACCCAAAGGCGAAGTGAAGG TAAAGGTTCGGCTTGTCCGGACTAAGGT(SEQ ID NO: 11).

[0195] 4. Design and synthesis of isothermal amplification primers

[0196] RPA-F primer: CCTTCGGGCATTGCTGAGTGTGGTCGG(SEQ ID NO: 12)

[0197] RPA-R primer: CTTCACTTCGCCTTTGGGTTTCGTAACAC(SEQ ID NO: 13)

[0198] Design and synthesis of crRNA

[0199] A crRNA was designed and synthesized as TTGAAACACGGACCAAGGAG (SEQ ID NO: 14)

[0200] 5. Design and preparation of reporter magnetic beads

[0201] 5.1. Design and synthesis of reporter DNA

[0202] Design and synthesis of reporter DNA molecule 1: 5'- / HEX / AATGGCAAATGGCA(SEQ ID NO: l) / BHQl / -3' (as a control group to detect the effect of existing CRISPR nucleic acid detection technology (two-level signal amplification)).

[0203] Design and synthesis of reporter DNA molecule 2: 5'- / amino group / AATGGCAAATGGCA (SEQ ID NO: l) / 3Bio_SA_P-Gal / -3'.

[0204] 5.2. Design and preparation of the reporter magnetic beads: the reporter DNA molecule 2 was covalently bound to magnetic beads to obtain the reporter magnetic beads:

[0205] magnetic bead (carboxyl group)- / 5' amino group / AATGGCAAATGGCA (SEQ ID NO: 1) / 3' Bio_SA_P-Gal (as an experimental group to detect the effect of improved CRISPR nucleic acid detection technology (third-level signal amplification) of the present disclosure).

[0206] 6. AsCasl2a protein

[0207] Brand: Magigen Biotechnology

[0208] Product number: COO IS;

[0209] Specification: 100 pmol / 50 pL

[0210] 7. Isothermal amplification (RPA)

[0211] RPA kit: TwistAmp Basic

[0212] Brand: TwistDx

[0213] Product number: TABAS03KIT

[0214] The four DNA samples A, B, C, and D obtained in step 2 were subjected to RPA separately, and the reaction system included a total reaction system volume was 100 pL; 0.48 pM of the RPA-F primer; 0.48 pM of the RPA-R primer; Ixrehydration buffer; 4 mM of magnesium acetate; RPA Mix, and the four DNA samples obtained in step 2.

[0215] Reaction temperature: 37°C

[0216] Reaction time: 10 min.

[0217] 8. The isothermal amplification products obtained in step 7 were concentrated and purified.

[0218] Concentration and purification reagent: amplification product purification reagent (using the magnetic bead method)

[0219] Brand: Beaver Biosciences

[0220] Product number: PCR-5G

[0221] 9. Cleavage reaction of Casl2a

[0222] The purified products obtained in step 8 were subjected to a cleavage reaction of Cas 12a.

[0223] Reaction system: the purified products obtained in step 8; 50 nM to 100 nM of AsCasl2a; 10 nM to 50 nM of crRNA; 40 nM of reporter DNA molecule 1; the total reaction volume was 50 pL.

[0224] Reaction temperature: 37°C

[0225] Reaction time: 30min.

[0226] 10. Collection of supernatant of the reaction system

[0227] Due to the non-specific cleavage activity of Cas 12a, the reporter DNA molecule 2 on the magnetic beads was cleaved to release free P-galactosidase into the supernatant of the system, each magnetic bead was adsorbed by a magnetic rod, and the supernatant containing the free P-galactosidase was collected.

[0228] 11. Collection of supernatant for enzymatic reaction

[0229] Reaction system: 100 mM of sodium phosphate; 1 mM of MgCl2; 50 mM of P-mercaptoethanol; 3 mg / mL of FDG; 50 pL of the supernatant in step 10; a total volume of the reaction system was 100 pL.

[0230] Reaction temperature: room temperature

[0231] Reaction time: 15 min

[0232] 12. Determination of fluorescence signal

[0233] 100 pL of reaction solution from step 11 of the experimental group was added to a 96-well plate, and the fluorescence signal was detected using a microplate reader (with an excitation light at 485 nm and an emission light at 530 nm).

[0234] 13. Experimental results (FIG. 9)

[0235] 1) The second-level signal amplification system could not detect the pollution by trace amount of Schistosomamansoni in the water sample.

[0236] 2) The third-level signal amplification system could effectively detect the pollution by trace amount of Schistosomamansoni in the water sample.

[0237] 3) At a high DNA concentration in the sample, the fluorescence signal values of the two systems were not significantly different.

[0238] Although the present disclosure is described in detail in conjunction with the foregoing examples, it is only a part of, not all of, the examples of the present disclosure. Other examples can be obtained by persons of ordinary skill in the art based on these examples without creative efforts, and all of those examples shall fall within the protection scope of the present disclosure.

Claims

1. A nucleic acid detection kit based on CRISPR technology, comprising a signal amplification magnetic bead system and isothermal amplification primers; wherein the signal amplification magnetic bead system comprises a reporter magnetic bead; the reporter magnetic bead comprises a carboxyl-modified magnetic bead, an ssDNA molecule, and streptavidin-labeled P-galactosidase, and two ends of the ssDNA molecule are labeled with an amino group and biotin, respectively; the reporter magnetic bead has a specific structure of magnetic bead (carboxyl group) / 5' amino group-nucleotide sequence shown in SEQ ID NO: 1-3' Bio / SA_P-Gal; and the reporter magnetic bead is constructed using a method compriing the following steps: ligating a magnetic bead with the ssDNA molecule through a covalent bond to obtain an ssDNA-magnetic bead, and ligating P-galactosidase with the ssDNA-magnetic bead through streptavidin and the biotin to obtain the reporter magnetic bead; the isothermal amplification primers comprise an RPA-F primer with a nucleotide sequence shown in SEQ ID NO: 2 and an RPA-R primer with a nucleotide sequence shown in SEQ ID NO: 3; and the detection kit further comprises a Casl2a protein, and crRNA with a nucleotide sequence shown in SEQ ID NO: 4.

2. An ultra-sensitivity method for detecting nucleic acid based on CRISPR technology, comprising the following steps:1) subjecting a virus solution to thermal inactivation and lysis to release an RNA molecule of a virus, extracting the RNA molecule in a virus suspension using a nano-nucleic acid magnetic bead to obtain a target molecule, adding the magnetic bead after extraction to an RT-RPA isothermal amplification reaction system, and conducting RT-RPA isothermal amplification on the target molecule to obtain a first-level signal amplification; wherein the virus solution is a pseudovirus solution, and the pseudovirus is a 2019-nCOV pseudovirus; and primers for the RT-RPA isothermal amplification comprises an RPA-F primer with a nucleotide sequence shown in SEQ ID NO: 2 and an RPA-R primer with a nucleotide sequence shown in SEQ ID NO: 3;2) extracting a DNA molecule obtained by the first-level signal amplification using the original nano-nucleic acid magnetic bead, adding the DNA molecule to a reaction system containing a Cas 12a protein with a collateral cleavage activity to specifically recognize and cleave a viral target DNA molecule, and activating a non-specific cleavage activity of the Cas 12a protein to initiate second-level signal amplification; wherein crRNA bound to the Cas 12a protein has a nucleotide sequence shown in SEQ ID NO: 4; and3) adding a reporter magnetic bead to the reaction system, comprising: magnetic bead (carboxyl group) / 5' amino group-nucleotide sequence shown in SEQ ID NO: 1-3' Bio / SA_P-Gal; non-specifically cleaving an ssDNA using the Cas 12a protein with a collateral cleavage activity to release free P-galactosidase into a supernatant of the system; adsorbing each magnetic bead with a magnet, collecting a supernatant containing free P-galactosidase and adding a fluorescent substrate into the supernatant for reaction, and reading the conducting detection by reading a microplate reader to obtain a detection fluorescence signal; whereinthe reporter magnetic bead comprises a carboxyl-modified magnetic bead, an ssDNA molecule, and streptavidin-labeled P-galactosidase, and two ends of the ssDNA molecule are labeled with an amino group and biotin, respectively; the reporter magnetic bead has a specific structure of magnetic bead (carboxyl group) / 5' amino group-nucleotide sequence shown in SEQ ID NO: 1-3' Bio / SA_P-Gal; and the reporter magnetic bead is a constructed using a method comprising the following steps: ligating a magnetic bead to the ssDNA molecule through a covalent bond to obtain an ssDNA-magnetic bead, and ligating P-galactosidase with the ssDNA-magnetic bead through streptavidin and the biotin to obtain the reporter magnetic bead.

Images