Spatial transcriptomics library preparation materials and methods

Improved methods for in situ capture of RNA transcripts in spatial transcriptomics libraries address inefficiencies in existing preparations, enabling more accurate disease diagnosis and treatment planning.

HK40134661APending Publication Date: 2026-07-10ILLUMINA INC

Patent Information

Authority / Receiving Office
HK · HK
Patent Type
Applications
Current Assignee / Owner
ILLUMINA INC
Filing Date
2026-04-09
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

Existing methods for preparing spatial transcriptomics RNA libraries are inefficient in capturing RNA transcript information from tissue samples, limiting their ability to accurately identify genetic characteristics associated with diseases such as cancer, hereditary diseases, and autoimmune diseases.

Method used

Improved methods for in situ capture of RNA transcript information from tissue samples using spatial transcriptomics libraries, enhancing the preparation of RNA libraries to improve diagnostic accuracy.

Benefits of technology

Enhances the identification of genetic characteristics relevant to diseases, thereby improving diagnostic precision and treatment outcomes for individuals at risk.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000087_0000
    Figure 00000087_0000
  • Figure 00000088_0000
    Figure 00000088_0000
  • Figure 00000089_0000
    Figure 00000089_0000
Patent Text Reader

Abstract

The present disclosure relates, in general, to methods for improving preparation of a spatial transcriptomics RNA, library, for example a mRNA library, by improving capture of RNA transcript information from a tissue sample in situ. The spatial transcriptomics library from a tissue sample is useful to determine a genetic profile and help diagnose a person who has or is at risk of having a disease, such as cancer, genetic disease, autoimmune disease, and other indications, and improve treatment of the subject.
Need to check novelty before this filing date? Find Prior Art

Description

Abstract of Materials and Methods for Spatial Transcriptomics Library Preparation This disclosure, in general, relates to methods for optimizing the preparation of spatial transcriptomics RNA libraries (e.g., mRNA libraries) by improving the in situ capture of RNA transcript information from tissue samples. Spatial transcriptomics libraries from tissue samples help identify genetic characteristics and assist in the diagnosis of individuals who have or are at risk of developing certain diseases (e.g., cancer, hereditary diseases, autoimmune diseases, and other indications), thereby improving treatment outcomes for subjects.

Claims

What is claimed is:1 . A method of preparing a mRNA transcript expression library from a tissue sample comprising, a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence, a spatial barcode sequence (SBC) and a first universal adapter sequence; b) contacting the tissue sample with i) a plurality of 5‘ gene specific probes comprising a sequence complementary to the first universal adapter sequence and a 5’ gene specific primer; and ii) a plurality of 3’ gene specific probes comprising a 3’ gene specific primer, a unique molecular index, and a second universal adapter sequence, under conditions such that one or more 5‘ gene specific probe and one or more 3‘ gene specific probe hybridizes to one or more mRNA transcript in the tissue sample; c) contacting the tissue sample in (b) with ligation reagents such that a 5‘ gene specific probe and a 3‘ gene specific probe hybridized to the mRNA transcript in proximity to each other are ligated together to form one or more ligated gene specific probe pairs; d) removing the mRNA transcript hybridized to the ligated gene specific probe pairs and leaving a ligated gene specific probe pair oligonucleotide sequence; e) capturing the ligated gene specific probe pair oligonucleotide of (d) on the substrate by binding of the sequence complementary to the first universal adapter sequence in the 5’ gene specific probe to the first universal adapter sequence of the capture oligonucleotide.

2. A method of determining mRNA transcript expression in a tissue sample comprising, a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence, a spatial barcode sequence (SBC) and a first universal adapter sequence; b) contacting the tissue sample with i) a plurality of 5‘ gene specific probes comprising a sequence complementary to the first universal adapter sequence and a 5’ gene specific primer; and ii) a plurality of 3’ gene specific probes comprising a 3’ gene specific primer, a unique molecular index, and a second universal adapter sequence , under conditions such that one or more 5‘ gene specific probe and one or more 3‘ gene specific probe hybridizes to one or more mRNA transcript in the tissue sample;c) contacting the tissue sample in (b) with ligation reagents such that a 5‘ gene specific probe and a 3‘ gene specific probe hybridized to the mRNA transcript in proximity to each other are ligated together to form one or more ligated gene specific probe pairs; d) removing mRNA transcripts hybridized to ligated gene specific probe pairs and leaving ligated gene specific probe pair oligonucleotide sequences; e) capturing the ligated gene specific probe pair oligonucleotide of (d) on the substrate by binding of the sequence complementary to the first universal adapter sequence in the 5’ gene specific probe to the first universal adapter sequence of the capture oligonucleotide.

3. The method of claim 1 or 2, wherein the 3’ gene specific probe comprises one or more ribobases.

4. A method of preparing a mRNA transcript expression library from a tissue sample comprising, a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence, a spatial barcode sequence (SBC) and a first universal adapter sequence; b) contacting the tissue sample with i) a plurality of 5‘ gene specific probes comprising a sequence complementary to the first universal adapter sequence and a 5’ gene specific primer; and ii) a plurality of 3’ gene specific probes comprising a 3’ gene specific primer, a unique molecular index, and a second universal adapter sequence, under conditions such that one or more 5‘ gene specific probe and one or more 3‘ gene specific probe hybridizes to one or more mRNA transcript in the tissue sample, wherein hybridization of the 5‘ gene specific probe and 3‘ gene specific probe on the mRNA transcript results in a nucleotide gap between the hybridized molecules; c) contacting the tissue sample in (b) with nucleotide bases and ligation reagents such that the nucleotide gap between the 5‘ gene specific probe and 3‘ gene specific probe hybridized to the mRNA transcript is filled with nucleotide bases complementary to the mRNA transcript, and a 5‘ gene specific probe and a 3‘ gene specific probe are ligated together to form one or more ligated gene specific probe pairs; d) removing mRNA transcripts hybridized to ligated gene specific probe pairs and leaving ligated gene specific probe pair oligonucleotide sequences;e) capturing the ligated gene specific probe pair oligonucleotide sequences of (d) on the substrate by binding of the sequence complementary to the first universal adapter sequence in the 5’ gene specific probe to the first universal adapter sequence of the capture oligonucleotide.

5. A method of isolating mRNA transcript expression in a tissue sample comprising, a) mounting the tissue sample on a substrate comprising a plurality of capture oligonucleotides, wherein the capture oligonucleotides comprise a first clustering sequence, a spatial barcode sequence (SBC) and a first universal adapter sequence; b) contacting the tissue sample with i) a plurality of 5‘ gene specific probes comprising a sequence complementary to the first universal adapter sequence and a 5’ gene specific primer; and ii) a plurality of 3’ gene specific probes comprising a 3’ gene specific primer, a unique molecular index, and a second universal adapter sequence , under conditions such that one or more 5‘ gene specific probe and one or more 3‘ gene specific probe hybridizes to one or more mRNA transcript in the tissue sample, wherein hybridization of the one or more 5‘ gene specific probe and one or more 3‘ gene specific probe on the mRNA transcript results in a nucleotide gap between the hybridized molecules; c) contacting the tissue sample in (b) with nucleotide bases and ligation reagents such that the nucleotide gap between a 5‘ gene specific probe and a 3‘ gene specific probe hybridized to the mRNA transcript is filled with nucleotide bases complementary to the mRNA transcript, and the 5‘ gene specific probe and 3‘ gene specific probe are ligated together to form one or more ligated gene specific probe pairs; d) removing mRNA transcripts hybridized to the ligated gene specific probe pairs and leaving ligated gene specific probe pair oligonucleotide sequences; e) capturing the ligated gene specific probe pair oligonucleotide sequences of (d) on the substrate by binding of the sequence complementary to the first universal adapter sequence in the 5’ gene specific probe to the first universal adapter sequence of the capture oligonucleotide.

6. The method of claim 4 or 5 wherein the nucleotide gap is from 1 to 50 or more nucleotides.

7. The method of any one of claims 1 to 6 further comprising indexing and sequencing the ligated gene specific probe pairs comprising, f) performing extension reactions and PCR on the oligonucleotide of (e) to yield a PCR template representative of one or more mRNA transcripts in the tissue sample; g) eluting the PCR template; h) carrying out an indexing PCR to generate a double stranded PCR product comprising the first strand PCR product and a second strand complementary to the first strand PCR product.

8. The method of claim 7 further comprising sequencing the PCR product of (h) and determining the location of the mRNA transcript in the tissue based on the spatial barcode of (a).

9. The method of claim 7 or 8, wherein the double stranded PCR product comprises a second clustering sequence on the second strand complementary to the first strand PCR product and, optionally, an index sequence.

10. The method of any one of claims 1-9, wherein the 5’ gene specific probe and / or the 3’ gene specific probe is between 10-50 nucleotides.11 . The method of any one of claims 1-10, wherein the first clustering sequence comprises a P7 sequence.

12. The method of any one of claims 1-11 , wherein the first universal adapter sequence comprises GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 19).

13. The method of any one of claims 1-12, wherein the second universal adapter sequence comprises AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTG (SEQ ID NO: 20).

14. The method of any one of claims 1-13, wherein the 5’ gene specific probe and / or the 3’ gene specific probe have a melting temperature (Tm) of about 50-55° C.

15. The method of any one of claims 1-14, wherein the capture oligonucleotides have a melting temperature (Tm) of about 40-42° C.

16. The method of any one of claims 1-15, wherein step (b) is carried out at approximately 50-55° C.

17. The method of any one of claims 1-16, wherein step (e) is carried out at approximately 40-42° C.

18. The method of any one of claims 1-17, wherein contacting the tissue sample with the substrate correlates a position of a capture site on the substrate with a position in the tissue sample, wherein the substrate comprises a plurality of capture sites comprising a plurality of capture probes immobilized on a surface, wherein the capture probes comprise a spatial address region.

19. The method of any one of claims 1-18, wherein the sample is from a mammal.

20. The method of any one of claims 1-19, wherein the sample is from a human.21 . The method of any one of claims 1-20, wherein the tissue sample is a tumor biopsy.

22. The method of any one of claims 1 -21 , wherein the tissue sample is formalin- fixed paraffin embedded (FFPE) tissue or fresh frozen (FF) tissue.

23. A method of identifying a genetic variation in a subject having or at risk of having a disease comprising, i) generating a sample mRNA library from a tissue sample from the subject according to the methods of any one of claims 1 -21 , i) comparing the genetic information from the sample mRNA library to a control mRNA library, and iii) identifying a genetic variation in the sample mRNA library associated with the disease.

24. The method of claim 23, wherein the disease is a genetic defect, cancer, an autoimmune disease, or a metabolic disorder.

25. The method of claim 23 or 24, wherein the disease is cancer.

26. A method for preparing a spatially barcoded RNA library from a tissue sample comprising,(a) contacting the tissue sample with a plurality of RNA capture probes that hybridize with RNA in the tissue sample, wherein each of the RNA capture probes comprises an RNA capture oligonucleotide sequence complementary to an RNA in the sample and a first substrate capture oligonucleotide complementary to a first domain of a plurality of splint oligonucleotides;(b) hybridizing the RNA capture oligonucleotide of the RNA capture probes with RNA in the tissue sample to form RNA-RNA capture probe hybrids;(c) carrying out extension of the RNA capture oligonucleotide of the RNA-RNA capture probe hybrids using reverse transcriptase to form a plurality of first strand cDNA molecules, wherein each of the first strand cDNA molecules comprises the RNA capture oligonucleotide and the first substrate capture oligonucleotide;(d) capturing the first strand cDNA molecules on a substrate, wherein the substrate comprises a plurality of substrate capture probes each comprising a spatial barcode and a second substrate capture oligonucleotide complementary to a second domain of the splint oligonucleotides, and wherein the capturing comprises hybridizing the splint oligonucleotides with the first substrate capture oligonucleotide of the first strand cDNA molecules and the second substrate capture oligonucleotide of the substrate capture probes; and(e) ligating the captured first strand cDNA molecules to the substrate capture probes, thereby forming spatially barcoded first strand cDNA molecules.

27. The method of claim 26, wherein the substrate capture probe further comprises a substrate anchor moiety.

28. The method of claim 26 or 27, wherein the surface oligonucleotide further comprises a P7 adapter and the RNA capture probe primer for reading the spatial barcode sequence.

29. A method for preparing a spatially barcoded RNA library from a tissue sample comprising,(a) contacting the tissue sample with a plurality of RNA capture probes that hybridize with RNA in the tissue sample, wherein the RNA capture probes comprise an RNA capture oligonucleotide complementary to an RNA in the sample and a handle sequence;(b) hybridizing the RNA capture oligonucleotide of the RNA capture probes with RNA in the tissue sample to form RNA-RNA capture probe hybrids;(c) carrying out extension of the RNA capture oligonucleotide of the RNA-RNA capture probe hybrids using reverse transcriptase to form a plurality of first strand cDNA molecules, wherein each of the first strand cDNA molecules comprises the RNA capture oligonucleotide and the handle sequence;(d) adding a 3’ end oligonucleotide to the 3’ end of each first strand cDNA molecule, wherein the 3’ end oligonucleotide comprises a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein each of the plurality of substrate capture probes comprises, in the 5’ to 3’ orientation, a substrate anchor sequence, a spatial barcode, and the first domain;(e) hybridizing the substrate capture oligonucleotide of the first strand cDNA molecules with the first domain of the substrate capture probes; and(f) carrying out extension of the first domain of the hybridized substrate capture probes to form a plurality of spatially barcoded first strand cDNA molecules.

30. The method of claim 29, wherein the handle sequence is a PCR handle sequence, a molecular identifier, a UMI, or any combination thereof.31 . The method of claim 29 or 30, wherein the handle sequence is a P5 adapter sequence.

32. The method of any one of claims 29-31 , wherein the 3’ end oligonucleotide is added by tagmentation.

33. The method of any one of claims 29-32, wherein the 3’ end oligonucleotide is added by click chemistry, or oNTP-directed adapterization.

34. The method of claim 33, wherein the 3’OH is added by terminating the extension reaction with a click labeled nucleotide.

35. The method of claim 34, wherein the click labeled nucleotide is an azide or alkyne labeled oligonucleotide.

36. The method of claim 34 or 35, wherein the extension reaction adds a poly A sequence to the 3’ extended sequence.

37. The method of any one of claims 29-36, wherein the first strand cDNA is captured with a polyT sequence on the surface capture oligonucleotide.

38. A method for preparing a spatially barcoded RNA library from a tissue sample comprising,(a) contacting the tissue sample with a plurality of RNA capture probes that hybridize with RNA in the tissue sample, wherein the RNA capture probes comprise an RNA capture oligonucleotide complementary to an RNA in the sample and a handle sequence;(b) hybridizing the RNA capture oligonucleotide of the RNA capture probes with RNA in the tissue sample to form RNA-RNA capture probe hybrids;(c) carrying out extension of the RNA capture oligonucleotide of the RNA-RNA capture probe hybrids using reverse transcriptase to form a plurality of first strand cDNA molecules, wherein each of the first strand cDNA molecules comprises the RNA capture oligonucleotide and the handle sequence;(d) adding a 3’ end oligonucleotide to the 3’ end of each first strand cDNA molecule, via template switching, comprising contacting the first strand cDNA molecule with a reverse transcriptase (RT) and a template switch oligonucleotide (TSO), wherein the RT incorporates untemplated cytosine nucleotides at the 3’ end of the first cDNA and the TSO comprises a sequence capable of hybridizing to the untemplated cytosine nucleotides, wherein the 3’ end oligonucleotide is appended to the 3’ end of the first cDNA and the RT extends to generate a TSO complement; wherein the 3’ end oligonucleotide comprises a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein each of the plurality of substrate capture probes comprises, in the 5’ to 3’ orientation, a substrate anchor sequence, a spatial barcode, and the first domain;(e) hybridizing the substrate capture oligonucleotide of the first strand cDNA molecules with the first domain of the substrate capture probes; and(f) carrying out extension of the first domain of the hybridized substrate capture probes to form a plurality of spatially barcoded first strand cDNA molecules.

39. The method of claim 38, wherein the first domain is a poly T sequence.

40. A method for preparing a spatially barcoded RNA library from a tissue sample comprising,(a) contacting the tissue sample with a plurality of RNA capture probes that hybridize with RNA in the tissue sample, wherein the RNA capture probes comprise an RNA capture oligonucleotide complementary to an RNA in the sample and a handle sequence;(b) hybridizing the RNA capture oligonucleotide of the RNA capture probes with RNA in the tissue sample to form RNA-RNA capture probe hybrids;(c) carrying out extension of the RNA capture oligonucleotide of the RNA-RNA capture probe hybrids using reverse transcriptase to form a plurality of first strand cDNA molecules, wherein each of the first strand cDNA molecules comprises the RNA capture oligonucleotide and the handle sequence;(d) adding a 3’ end oligonucleotide to the 3’ end of each first strand cDNA molecule, via template switching, comprising contacting the first strand cDNA molecule with a reverse transcriptase (RT) and a template switch oligonucleotide (TSO), wherein the RT incorporates untemplated cytosine nucleotides at the 3’ end of the first cDNA and the TSO comprises a sequence capable of hybridizing to the untemplated cytosine nucleotides, wherein the 3’ end oligonucleotide is appended to the 3’ end of the first cDNA and the RT extends to generate a TSO complement; wherein the 3’ end oligonucleotide comprises a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein each of the plurality of substrate capture probes comprises, in the 5’ to 3’ orientation, a substrate anchor sequence, a second handle, a spatial barcode, and the first domain;(e) releasing the substrate capture probes from the substrate;(f) hybridizing the substrate capture oligonucleotide of the first strand cDNA molecules with the first domain of the substrate capture probes; and(g) contacting the first strand with a second strand synthesis mix comprising a TSO primer and extending the TSO primer using the first strand as a template to generate a second strand complementary to the first strand, the second strand comprising the TSO, a second cDNA complementary to the first cDNA, and second strand barcode information comprising a spatial barcode sequence complement (SBC’) that is complementary to the spatial barcode sequence (SBC).41 . The method of claim 40, wherein the first domain is a poly G sequence that hybridizes with the poly C sequence on the TSO.

42. The method of claim 40 or 41 , wherein the handle is a P5 sequence and the second handle is a P7 sequence.

43. A method for preparing a spatially barcoded RNA library from a tissue sample comprising,(a) contacting the tissue sample with a plurality of RNA capture probes that bind RNA in the tissue sample, wherein each of the RNA capture probes comprise a RNA capture oligonucleotide complementary to an RNA in the sample and a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein the RNA capture oligonucleotide complementary to the RNA is blocked on the 3’ end; wherein each of the substrate capture probes comprises, in the 5’ to 3’ orientation, the first domain and a first substrate anchor sequence and is in proximity to one or more barcoded substrate probes on the substrate, and wherein each of the barcoded substrate probes comprises, in the 5’ to 3’ orientation, a second substrate anchor sequence, a spatial barcode, and a random priming sequence;(b) hybridizing the RNA capture oligonucleotide of the RNA capture probes with RNA in the tissue sample to form RNA-RNA capture probe hybrids having a 5’ single-stranded RNA region;(c) hybridizing the substrate capture oligonucleotide of the RNA-RNA capture probe hybrids with the first domain of the substrate capture probes(d) hybridizing the 5’ single-stranded RNA region of the RNA-RNA capture probe hybrids with the random priming sequence of the barcoded substrate probes; and(e) carrying out extension of the random priming sequences hybridized to the 5’ single-stranded RNA regions using reverse transcriptase to form a plurality of spatially barcoded first strand cDNA molecules.

44. The method of claim 43, wherein the nucleotide sequence complementary to RNA in the sample is a polyT oligonucleotide, a randomer, a semi-randomer, or a target specific sequence.

45. The method of claim 43 or 44, wherein the nucleotide sequence complementary to an RNA in the sample is a polyT oligonucleotide.

46. The method of claim 43, wherein the RNA is removed from the sample.

47. The method of claim 46, wherein the RNA is removed from the sample after extension to form first strand cDNA.

48. The method of claim 47, wherein the RNA is removed by enzymatic or thermal methods.

49. A method for preparing a spatially barcoded RNA library from a tissue sample comprising,(a) contacting the tissue sample with a plurality of RNA capture probes that hybridize with RNA in the tissue sample, wherein each of the RNA capture probes comprises an RNA capture oligonucleotide complementary to an RNA in the sample and a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein each of the substrate capture probes comprises, in the 5’ to 3’ orientation, a substrate anchor sequence, the first domain, a linker, a spatial barcode, and a random priming sequence;(b) hybridizing the RNA capture probes with the RNA in the tissue sample to form RNA-RNA capture probe hybrids having a 5’ single-stranded RNA region;(c) hybridizing the substrate capture oligonucleotide of the RNA-RNA capture probe hybrids with the first domain of the substrate capture probes;(d) hybridizing the 5’ single-stranded RNA regions of the RNA-RNA capture probe hybrids with the random priming sequence of the substrate capture probes; and(e) carrying out extension of the random priming sequences hybridized to the 5’ single-stranded RNA regions using reverse transcriptase to form a plurality of spatially barcoded first strand cDNA molecules.

50. The method of claim 49, wherein the linker is a linker that cannot be read through by a polymerase.51 . A method for preparing a spatially barcoded RNA library from a tissue sample comprising,(a) contacting the tissue sample with a plurality of RNA capture probes that bind RNA in the tissue sample, wherein each of the RNA capture probes comprise an RNA capture oligonucleotide complementary to an RNA in the sample and a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate; wherein each of the substrate capture probes comprises, in the 5’ to 3’ orientation, the first domain and a first substrate anchor sequence and is in proximity to at least one of a plurality of barcoded substrate probes on the substrate, and wherein each barcoded substrate probe comprises, in the 5’ to 3’ orientation, a spatial barcode and a second substrate anchor sequence;(b) hybridizing the RNA capture oligonucleotide of the RNA capture probes with RNA in the tissue sample to form RNA-RNA-capture probe hybrids;(c) capturing the RNA-RNA capture probe hybrids on the substrate by hybridizing substrate capture oligonucleotide of the RNA-RNA capture probe hybrids with the first domain of the substrate capture probes;(d) carrying out extension of the RNA capture oligonucleotide of the captured RNA- RNA capture probe hybrids using reverse transcriptase to form a plurality of first strand cDNA molecules; and(e) ligating each of the first strand cDNA molecules to the proximal barcoded substrate probe, thereby forming spatially barcoded first strand cDNA molecules.

52. A method for preparing a spatially barcoded RNA library from a tissue sample comprising,(a) contacting the tissue sample with a plurality of RNA capture probes that bind RNA in the tissue sample, wherein each of the RNA capture probes comprise an RNA capture oligonucleotide complementary to an RNA in the sample and a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein the RNA capture oligonucleotide complementary to the RNA is blocked on the 3’ end; wherein each of the substrate capture probes comprises, in the 5’ to 3’ orientation, the first domain and a first substrate anchor sequence and is in proximity to at least one of a plurality of barcoded substrate probes on the substrate, and wherein each barcoded substrate probe comprises, in the 5’ to 3’ orientation, a polyT sequence, a spatial barcode and a second substrate anchor sequence;(b) hybridizing the RNA capture oligonucleotide of the RNA capture probes with RNA in the tissue sample to form RNA-RNA-capture probe hybrids;(c) capturing the RNA-RNA capture probe hybrids on the substrate by hybridizing substrate capture oligonucleotide of the RNA-RNA capture probe hybrids with the first domain of the substrate capture probe;(d) polyadenylating the RNA in the sample at the 3’ end; and(e) carrying out extension of the RNA capture oligonucleotide of the captured RNA- RNA capture probe hybrids using reverse transcriptase to form a plurality of first strand cDNA molecules.

53. The method of claim 52, wherein the polyadenylation is carried out using polyA polymerase.

54. A method for preparing a spatially barcoded RNA library from a tissue sample comprising,(a) contacting the tissue sample with a plurality of RNA capture probes that hybridize with RNA in the tissue sample, wherein each of the RNA capture probes has a hairpin structure and comprises an DNA capture oligonucleotide complementary to RNA in the sample and a substrate capture oligonucleotide complementary to a first domain of a plurality of substrate capture probes on a substrate, wherein the DNA capture oligonucleotide of the RNA capture probes comprises a single stranded region, and wherein each of the substrate capture probes comprises, in the 5’ to 3’ orientation, a substrate anchor sequence, a spatial barcode, the first domain, and a second domain, wherein the second domain comprises at least one RNA nucleotide or nucleoside;(b) hybridizing the RNA capture probes with the RNA in the tissue sample to form RNA-RNA capture probe hybrids, wherein each of the RNA-RNA capture probe hybrids comprises a 5’ single-stranded RNA end region;(c) capturing the substrate capture oligonucleotide of the RNA-RNA capture probe hybrids on the substrate by hybridizing the substrate capture oligonucleotide of the RNA- RNA capture probe hybrids with the first domain of the substrate capture probes;(d) phosphorylating the 5’ single-stranded RNA end region of the captured RNA-RNA capture probe hybrids and contacting the captured RNA-RNA capture probe hybrids with a 5’ to 3’ riboexonuclease to digest the phosphorylated 5’ single-stranded RNA end region; and(e) ligating the digested 5’ RNA end region of the captured RNA-RNA capture probe hybrids to the second domain of the substrate capture probes to form a plurality of DNA- RNA chimeras on the substrate.

55. The method of claim 54, wherein the ligating is carried out with T4 ligase.

56. The method of claim 54, wherein the RNA of the captured RNA-RNA capture probe hybrids is 5' phosphorylated prior to ligation.

57. The method of claim 56 further comprising generating first strand cDNA from the plurality of DNA-RNA chimeras on the substrate.

58. The method of claim 57, wherein the first strand cDNAs can be hybridized from the surface and processed for sequencing.

59. The method of any one of claims 54-58, wherein the reverse transcription is carried out using a DNA random primer, optionally which comprises P5 adaptor.

60. The method of any one of claims 26-59, wherein the cDNA extension templates can be dehybridized from the RNA in the tissue by chemical, enzymatic, or thermal dehybridization.61 . The method of any one of claims 29-59, wherein the cDNA extension templates can be dehybridized from the RNA on a substrate by chemical, enzymatic, or thermal dehybridization.

62. The method of claim 60 or 61 wherein the dehybridization step occurs before or after the capturing step.

63. The method of any one of claims 26-62, wherein the tissue sample is formalin-fixed paraffin embedded (FFPE) tissue or fresh frozen (FF) tissue.

64. The method of claim 63, further comprising decrosslinking the FFPE sample, optionally wherein the decrosslinking is carried out using TE buffer, pH 9.

65. The method of any one of claims 26-64, wherein the RNA capture probe is selected from the group consisting of a poly-T sequence, a poly-U sequence, a randomer, a semi-random sequence, or a target-specific probe.

66. The method of claim 65, wherein the RNA capture probe is a poly-T sequence.

67. The method of claim 65 or 66, wherein the RNA capture probe comprises at least 10 deoxythymidine residues.

68. The method of claim 67, wherein the target-specific probes comprise a plurality of different target-specific RNA capture probe sequences.

69. The method of claim 68, wherein the target-specific probes comprise at least 10 nucleotides complementary to a nucleotide sequence of a target RNA.

70. The method of claim 68 or 69, wherein the RNA capture probe or surface capture probe is between 8 to 80 nucleotides.71 . The method of any one of claims 26-70, wherein the targeted probe is between 8-80 nucleotides or between 10-50 nucleotides.

72. The method of any one of claims 26-71 , wherein the tissue sample is permeabilized prior to contacting the tissue sample with a plurality of RNA capture probes.

73. The method of any one of claims 26-72, wherein the tissue sample is treated with one or more blocking reagents prior to contacting the tissue sample with a plurality of RNA capture probes).

74. The method of any one of claims 26-73, wherein the tissue sample is permeabilized and treated with one or more blocking reagents prior to contacting the tissue sample with a plurality of RNA capture probes).

75. The method of any one of claims 26-74, wherein the substrate is a bead, a bead array, a spotted array, a substrate comprising a plurality of wells, a flow cell, clustered particles arranged on a surface of a chip, a film, or a plate.

76. The method of claim 75, wherein the substrate comprises a plurality of nanowells or microwells.

77. The method of any one of claims 26-76, wherein the spatially barcoded first strand cDNA molecules are recovered by contacting the spatially barcoded first strand cDNAs on the substrate with a DNA polymerase and one or more primers to generate spatially barcoded second strand cDNAs complementary to the spatially barcoded first strand cDNAs and removing the spatially barcoded second strand cDNAs from the substrate.

78. The method of claim 77, wherein the one or more primers each comprise a random priming sequence.

79. The method of claim 78, wherein the random priming sequences comprises nine random nucleotides.

80. The method of claim 78 or 79, wherein the spatially barcoded second strand cDNAs each comprise a unique molecular identifier (UMI), wherein the UMI comprises an intrinsic sequence and an extrinsic sequence, wherein the extrinsic sequence is a sequencecomplementary to the random priming sequence used to generate the second strand cDNA, and wherein the intrinsic sequence is a sequence complementary to the first strand cDNA template sequence used to generate the second strand cDNA.81 . The method of claim 77, wherein the one or more primers each comprise a molecular identifier barcode.

82. The method of claim 77, wherein the one or more primers each comprise a UM I barcode.

83. The method of any one of claims 77-82, wherein the spatially barcoded second strand cDNAs are removed from the substrate by chemical or physical dehybridization.

84. The method of any one of claims 77-83, wherein the anchor sequence comprises a cleavage site, and hybrids of the spatially barcoded first and second strand cDNAs are removed from the substrate by enzymatic cleavage at the cleavage site.

85. The method of claim 84, wherein the cleavage site is a binding site for a restriction endonuclease.

86. The method of claim 84, wherein the anchor sequence comprises a cleavage site, and wherein the spatially barcoded first strand cDNA molecules are recovered by enzymatic cleavage at the cleavage site.

87. The method of claim 86, wherein the cleavage site is a binding site for a restriction endonuclease.

88. The method of any one of claims 77-87, further comprising sequencing at least a portion of the cDNA libraries to determine the spatial barcode sequence for each molecule.

89. The method of claim 88, further comprising determining the spatial location of one or more cDNA molecules by correlating the spatial barcode sequences of the one or more cDNA molecules with the spatial locations of the surface oligonucleotide molecules on the substrate containing corresponding spatial barcode sequences.

90. The method of any one of claims 26 to 89 further comprising indexing and sequencing spatially barcoded first strand cDNAs, comprising, performing extension reactions and PCR on the spatially barcoded first strand cDNAs to yield a PCR template comprising a first strand PCR product representative of one or more RNA transcripts in the tissue sample; eluting the PCR template; carrying out an indexing PCR to generate a double stranded PCR product comprising the first strand PCR product and a second strand complementary to the first strand PCR product.91 . The method of claim 90 further comprising sequencing the PCR product and determining the location of the RNA transcript in the tissue based on the spatial barcode of first strand cDNA.

92. The method of claim 90 or 91 , wherein the double stranded PCR product comprises a second clustering sequence on the second strand complementary to the first strand PCR product and, optionally, an index sequence.

93. The method of claim 91 or 92, wherein the PCR products are further processed by tagmentation to generate a spatial transcriptomics library.

94. The method of claim 93, wherein the tagmentation comprises on substrate tagmentation.

95. The method of any one of claims 26 to 94, wherein the methods determine RNA expression in a single cell with the tissue sample.

96. The method of claim 95, wherein the methods determine RNA expression in one or more subcellular components in the single cell.

97. The method of claim 96, wherein the subcellular component is a cell nucleus, cytoplasm, or mitochondria.

98. The method of any one of the preceding claims, wherein the substrate or surface of the substrate comprises a material selected from glass, silicon, poly-L-lysinecoated materials, nitrocellulose, polystyrene, cyclic olefin copolymers (COCs), cyclic olefin polymers (COPs), polyacrylamide, polypropylene, polyethylene, or polycarbonate99. The method of any one of claims 26 to 98, wherein the RNA library is an mRNA library.