Novel compositions having tissue-specific targeting motifs and compositions containing same

Abstract

Provided herein are compositions comprising a targeting peptide conjugated to or inserted into a targeting protein of a recombinant vector having at least one exogenous peptide comprising the amino acid sequence Nx-(T / I / V / A)-(K / R) (SEQ ID NO: 47). Uses of such compositions providing such conjugates, targeting peptides, or recombinant vectors with mutant capsid or envelope proteins are provided.

Description

Background Art

[0001] Adeno-associated virus (AAV) is currently the optimal gene therapy vector. This is because AAV can deliver a transgene that is stably expressed from a non-integrating genome for decades, and because AAV is significantly safe and non-immunogenic. However, AAV gene therapy is currently limited to a small number of diseases due to issues in delivery and tropism. This is particularly true for disorders of the central nervous system (CNS). Direct delivery of an AAV gene therapy vector is possible by injecting the vector directly into the cerebrospinal fluid (CSF), but this method typically transduces less than 1% of brain cells. Furthermore, most of that transduction is concentrated in cells that are in direct contact with the CSF. Cells in the "deep brain" are rarely transduced. This limits the number of CNS disorders that can be treated by gene therapy.

[0002] In contrast to the CSF network, the vasculature of the brain reaches almost all cells in the CNS. This is due to the high demand these tissues have for glucose, oxygen, and other nutrients. However, cells in the brain and spinal cord are protected from the circulatory system by specialized vascular units, the blood-brain barrier (BBB). The BBB restricts the diffusion of large molecules such as viral vectors and proteins, and even many small molecule drugs, through a complex network of tightly joined cells that surround the blood vessels of the brain and spinal cord. Thus, a major challenge in gene therapy delivery to the CNS has been the engineering of AAV variants that can efficiently cross the BBB and transduce cells in the deep brain.

[0003] A single AAV capsid developed at the California Institute of Technology (CalTech) has seven amino acid peptides inserted into the hypervariable loop 8 (HVR8) on an AAV9 capsid to generate an rAAV called AAV9-PHP.B, which has been reported to mediate interaction with Ly6a, a GPI-anchored receptor on the cerebral vascular structure of several mouse strains. (U.S. Patent Publication Application 2017 / 0166926A1). This interaction drives the transport of AAV9-PHP.B across the blood-brain barrier, resulting in approximately 50 times higher transduction of brain cells than AAV9. However, this finding has not been translated into larger animals or humans.

[0004] The need remains for vectors that can specifically target selected tissues and cell types. [Overview of the project]

[0005] In certain embodiments, recombinant adeno-associated virus particles (rAAV) are provided, having a capsid containing an amino acid sequence comprising the motif Nx-(T / I / V / A)-(K / R) (SEQ ID NO: 47). Preferably, the amino acid sequence is a vector genome packaged within a capsid containing a nucleic acid sequence encoding a gene product under the control of a sequence that directs its expression, but the capsid is not a mutant AAV2 capsid containing the NDBRAVS (SEQ ID NO: 48) sequence. In certain embodiments, an amino acid sequence containing the Nx-(T / I / V / A)-(K / R) motif, optionally adjacent to 2-7 amino acids at the amino-terminus and / or carboxy-terminus of the motif, is inserted into the AAV capsid vp3 region. In certain embodiments, the sequences inserted into the capsid are (a) SSNTVKLTSGH (SEQ ID NO: 40), (b) EFSSNTVKLTS (SEQ ID NO: 38), (c) GGVLTNIARGEYMRGG (SEQ ID NO: 46), (d) GGIEINATRAGTNLGG (SEQ ID NO: 43), (e) GGSSNTVKLTSGHGG (SEQ ID NO: 39), (f) IENATRAGTNL (SEQ ID NO: 42) ), or (g)SANFIKPTSY (SEQ ID NO: 41). In certain embodiments, the amino acid sequence of the motif is NTVK, which optionally occupies 2 to 7 amino acids at its carboxyl and / or amino termini and is inserted between amino acids 588 and 589 of the AAV9 capsid protein, based on the numbering of amino acid sequence:SEQ ID NO: 44.

[0006] In certain embodiments, rAAV has an inserted sequence of NTVK in its capsid, which optionally occupies 2 to 7 amino acids at its carboxyl and / or amino termini and is inserted between amino acids 588 and 589 of the AAV9 capsid protein, based on the numbering of amino acid sequence:SEQ ID NO: 44.

[0007] In certain embodiments, the composition comprises an rAAV having an inserted motif and any adjacent arrays, and one or more physiologically compatible carriers, excipients, and / or aqueous suspension bases.

[0008] In certain embodiments, endothelial cell-targeting peptides are provided, the peptides comprising the amino acid sequence Nx-(T / I / V / A)-(K / R)(SEQ ID NO: 47), optionally flanked by 2 to 7 amino acids at the amino and / or carboxyl terminals of the motif, and optionally further conjugated to nanoparticles, a second molecule, or a viral capsid protein. In certain embodiments, the endothelial cell-targeting peptides include (a) SSNTVKLTSGH(SEQ ID NO: 40), (b) EFSSNTVKLTS(SEQ ID NO: 38), (c) GGVLTNIARGEYMRGG(SEQ ID NO: 46), (d) GGIEINATRAGTNLGG(SEQ ID NO: 43), (e) GGSSNTVKLTSGHGG(SEQ ID NO: 39), (f) IEINATRAGTNL(SEQ ID NO: 42), or (g) SANFIKPTSY(SEQ ID NO: 41). In certain embodiments, the amino acid sequence of the motif is NTVK. In certain embodiments, a composition is provided comprising an endothelial cell-targeting peptide and one or more physiologically compatible carriers, excipients, and / or aqueous suspension bases.

[0009] In certain embodiments, a fusion polypeptide or protein is provided herein, comprising a brain endothelial cell-targeting peptide and a fusion partner comprising at least one polypeptide or protein. In certain embodiments, a composition comprising the fusion polypeptide or protein described in claim 11 and one or more physiologically compatible carriers, excipients, and / or aqueous suspension bases.

[0010] This specification provides compositions and methods for using rAAV, endothelial cell-targeting peptides, fusion polypeptides or proteins, and / or compositions described herein to deliver therapeutic agents to patients in need. In certain embodiments, the therapeutic agent is targeted to brain endothelial cells.

[0011] In certain embodiments, compositions and methods are provided for treating Alan-Herndon-Dudley disease by delivering the rAAV described herein to a subject in need of treatment, wherein the encoded gene product is the MCT8 protein.

[0012] In certain embodiments, a method is provided for targeting a therapy to the lungs, which includes administering the rAAV described herein to a patient requiring targeting.

[0013] In a particular embodiment, a method for treating a lung disease by delivering an rAAV having a capsid along with an inserted targeted peptide to a subject in need of treatment, wherein the encoded gene product is a soluble Ace2 protein, an anti-SARS antibody, an anti-SARS-CoV2 antibody, an anti-influenza antibody, or a cystic fibrosis antibody. A method is provided for transmembrane proteins.

[0014] In certain embodiments, a method is provided for increasing the transduction of AAV-producing cells in vitro, comprising inserting the Nx-(T / I / V / A)-(K / R) motif into the AAV capsid. In certain embodiments, the producing cells are 293 cells.

[0015] These and other embodiments and advantages of the present invention will become apparent from the specification, including a detailed description of the invention, without limitation. [Brief explanation of the drawing]

[0016] [Figure 1A-1B] The enrichment scores of the highest-performing peptide hits in mouse brains during screening are shown, along with the reference peptide. Figure 1A shows the enrichment scores for C57BL / 6J mice. Figure 1B shows the enrichment scores for Balb / c mice. [Figure 2A-2B] The highest performance enrichment scores in NHP tissue during screening are shown. Figure 2A shows the enrichment scores for NHP brain tissue. Figure 2B shows the enrichment scores for NHP spinal cord tissue. [Figure 3A-3D] This shows secondary validation of the transduction level for the highest performance peptide hit in AAV capsids containing a GFP reporter transgene. The results are plotted against AAV9 transduction. Figure 3A shows secondary validation screening of selected peptide targeting in brain tissue in Balb / c mice. Figure 3B shows secondary validation screening of selected peptide targeting in brain tissue in C57BL / 6 mice. Figure 3C shows secondary validation screening of selected peptide targeting in liver tissue in Balb / c mice. Figure 3D shows secondary validation screening of selected peptide targeting in liver tissue in C57BL / 6 mice. [Figure 4] This shows the amino acid sequence alignment regions of various AAV capsid proteins, AA9, AAV8, AAV7, AAV6, AAV5, AAV4, AAV3B, AAV2, and AAV1, focusing on the HVRVIII region where targeted peptides can be inserted (based on structural analysis). [Figure 5]This study demonstrates that the "NxTK" motif is an important motif for the in vivo distribution of SAN insertions in the brain and shows the average effect of substitution (magnitude change from the original sequence). [Figure 6] This study demonstrates that the "NxTK" motif controls the conversion from plasmid to AAV in SAN peptide insertions and shows the average effect of substitution (a multiplicative change from the original sequence). [Figures 7A-7D] This shows that the "NxTK" motif confers broad transduction benefits across cell lines. Figure 7A shows the relative transduction levels compared to AAV9 capsid in 293 cells. Figure 7B shows the relative transduction levels compared to AAV9 capsid in NIH3T3 cells. Figure 7C shows the relative transduction levels compared to AAV9 capsid in HUH7 cells. Figure 7D shows the transduction levels at 3DPT and 7DPT post-transduction in macaque primary airway cells. [Figure 7E] Microscopic analysis of macaque primary airway epithelial cells in control samples treated with a carrier (i.e., without a vector) is shown. [Figure 7F] Microscopic analysis of primary airway epithelial cells of macaques after transduction with an AAV9-GFP vector is shown. [Figure 7G] Microscopic analysis of primary macaque airway epithelial cells after transduction with an AAV9-GFP vector containing EFS peptide insertion is shown. [Figure 7H] Microscopic analysis of macaque primary airway epithelial cells after transduction with AAV9-GFP including SAN peptide insertion is shown. [Figure 8] This shows a preliminary transduction test with a GFP vector in cultured human cells (nose, bronchi, and trachea), plotted as the ratio of mRNA copy number to micrograms of total mRNA. [Modes for carrying out the invention]

[0017] Targeted peptide sequences are provided herein. Fusion proteins, modified proteins, mutant viral capsids, and other moieties operably bound to the exogenous targeted peptide motif Nx-(T / I / V / A)-(K / R)(SEQ ID NO: 47) are also provided herein. In certain embodiments, this exogenous motif confers modifications to these compositions to the innate tissue specificity of the source (parent) protein, viral vector, or other moieties. In certain embodiments, the targeted peptide in this motif provides enhanced or modified endothelial cell targeting. In certain embodiments, the targeted peptide in this motif provides enhanced or modified lung, bronchi, trachea, and / or nasal epithelium targeting. In certain embodiments, a viral vector having a modified capsid having this motif exhibits increased transduction of AAV-producing cells in vitro.

[0018] Targeted peptides can bind to recombinant proteins (e.g., for enzyme replacement therapy) or polypeptides (e.g., immunoglobulins) to target desired tissues (e.g., CNS or lungs) to form fusion proteins or conjugates. In addition, targeted peptides can bind to peptide-coated liposomes and / or nanoparticles (lipid nanoparticles, LNPs) to form desired tissues. The sequence encoding at least one copy of the targeted peptide and any binding sequence can fused in-frame with the coding sequence of a recombinant protein and co-expressed with the protein or polypeptide to provide a fusion protein or conjugate. Alternatively, other synthetic methods can be used to form conjugates with proteins, polypeptides, or other moieties (e.g., DNA, RNA, or small molecules). In certain embodiments, multiple copies of the targeted peptide are present in the fusion protein / conjugate. A preferred method for conjugating a targeted peptide to a recombinant protein comprises: modifying the amino(N) terminus and one or more residues on a recombinant human protein (e.g., an enzyme) using a first crosslinking agent to produce a first crosslinking agent-modified recombinant human protein; modifying the amino(N) terminus of a short elongation linker region preceding the targeted peptide using a second crosslinking agent to produce a second crosslinking agent-modified variant targeted peptide; and then conjugating the first crosslinking agent-modified recombinant human protein to a second crosslinking agent-modified variant targeted peptide containing a short elongation linker. Another preferred method for conjugating a targeted peptide to a recombinant protein comprises conjugating a first crosslinker-modified recombinant human protein to one or more second crosslinker-modified variant targeted peptides, wherein the first crosslinker-modified recombinant protein comprises a recombinant protein characterized as having a chemically modified N-terminus and one or more modified lysine residues, and the one or more second crosslinker-modified variant targeted peptides comprises one or more variant targeted peptides containing a modified N-terminal amino acid of a short extension linker preceding the targeted peptide. Yet another preferred method may be selected for conjugating the targeted peptide to a protein, polypeptide, nanoparticle, or another biologically useful chemical moiety.For example, see U.S. Patent No. 9,545,450B2 (NHS-phosphine crosslinking agents, NHS-azide crosslinking agents) and U.S. Published Patent Application No. 2018 / 0185503A1 (aldehyde-hydrazide crosslinking).

[0019] In certain embodiments, the targeted peptide may be inserted into a suitable site within a protein or polypeptide (e.g., a viral capsid protein). In certain embodiments and certain other embodiments, the targeted peptide may be flanked by a short elongation linker at its carboxy(COO-) and / or amino(N) terminus. Such a linker may be 1 to 20 amino acid residues long, or about 2 to 20 amino acid residues, or about 1 to 15 amino acid residues, or about 2 to 12 amino acid residues, or 2 to 7 amino acid residues long. The short elongation linker may also be about 10 amino acid residues long. The presence and length of the N-terminal linker are determined by the carboxyl The presence and length of the carboxyl-terminal linker are selected independently of the N-terminal linker. Suitable short extension linkers can be provided using a 5-amino acid flexible GS extension linker (glycine-glycine-glycine-glycine-serine), a 10-amino acid extension linker containing two flexible GS linkers, a 15-amino acid extension linker containing three flexible GS linkers, a 20-amino acid extension linker containing four flexible GS linkers, or any combination thereof.

[0020] In certain embodiments, compositions useful for targeting endothelial cells are provided. The composition is a mutant capsid, a fusion protein, or another conjugate comprising at least one exogenous targeted peptide, optionally comprising the amino acid sequence Nx-(T / I / V / A)-(K / R)(SEQ ID NO: 47) flanked by 2 to 7 amino acids at the amino and / or carboxyl terminals of the motif, and optionally further conjugated to a nanoparticle, a second molecule, or a viral capsid protein. Targeted peptides comprising the following sequences having any binding sequence: (a) SSNTVKLTSGH (Sequence ID 40), (b) EFSSNTVKLTS (Sequence ID 38), (c)GGVLTNIARGEYMRGG (Sequence No. 46) (d) GGIEINATRAGTNLGG (Sequence No. 43), (e)GGSSNTVKLTSGHGG (Sequence ID 39), (f)IEINATRAGTNL (SEQ ID NO: 42), or (g)SANFIKPTSY (Sequence ID 41).

[0021] In certain embodiments, the targeted peptide motif is (a) agcagcaacaccgtgaagctgaccagcggacac (Sequence ID 54), (b) gagttcagcagcaacaccgtgaagctgaccagc (Sequence ID 50), (c) ggaggagtgctgaccaacatcgctagaggagagtacatgagaggagga (SEQ ID NO: 56), (d) ggaggaatcgagatcaacgctacgagctggaaccaacctgggagga (SEQ ID NO: 52), (e)ggaggaagcagcaacaccgtgaagctgaccagcggacacggagga (Sequence ID 55) (f)atcgagatcaacgctaccagagctggaaccaacctg (SEQ ID NO: 51), or Encoded by a nucleic acid sequence selected from (g)agcgctaacttcatcaagcctaccagctac (SEQ ID NO: 53).

[0022] In certain embodiments, the targeted peptide is encoded by the nucleic acid sequence of SEQ ID NO: 50, or a sequence that is at least about 70% identical thereto. In certain embodiments, the targeted peptide is encoded by the nucleic acid sequence of SEQ ID NO: 51, or a sequence that is at least about 70% identical thereto. In certain embodiments, the targeted peptide is encoded by the nucleic acid sequence of SEQ ID NO: 52, or a sequence that is at least about 70% identical thereto. In certain embodiments, the targeted peptide is encoded by the nucleic acid sequence of SEQ ID NO: 53, or a sequence that is at least about 70% identical thereto. In certain embodiments, the targeted peptide is encoded by the nucleic acid sequence of SEQ ID NO: 54, or a sequence that is at least about 70% identical thereto. In certain embodiments, the targeted peptide is encoded by the nucleic acid sequence of SEQ ID NO: 55, or a sequence that is at least about 70% identical thereto. In certain embodiments, the targeted peptide is encoded by the nucleic acid sequence of SEQ ID NO: 56, or a sequence that is at least about 70% identical thereto. In some embodiments, the nucleic acid sequence encoding the targeted peptide motif is optionally the 5' and 5' of the nucleic acid sequence of the motif. / or adjacent to a 6-21 nucleotide elongation linker at the 3' end.

[0023] In certain embodiments, the targeted peptide is NTVK. In certain embodiments, the targeted peptide is NTVR. In certain embodiments, two or more copies of the targeted peptide within this motif are provided in a conjugate or modified protein (e.g., a parvovirus capsid). In certain embodiments, two or more different targeted peptides are present.

[0024] In certain embodiments, compositions useful for targeting nasal epithelial and / or lung epithelial cells are provided. The composition is a variant capsid, a fusion protein, or another conjugate comprising at least one exogenous targeted peptide, optionally comprising the amino acid sequence Nx-(T / I / V / A)-(K / R)(SEQ ID NO: 47) flanked by 2 to 7 amino acids at the amino and / or carboxyl terminals of the motif, and optionally further conjugated to a nanoparticle, a second molecule, or a viral capsid protein. The targeted peptides include (a) SSNTVKLTSGH (SEQ ID NO: 40), (b) EFSSNTVKLTS (SEQ ID NO: 38), (c) GGVLTNIARGEYMRGG (SEQ ID NO: 46), (d) GGIEINATRAGTNLGG (SEQ ID NO: 43), (e) GGSSNTVKLTSGHGG (SEQ ID NO: 39), (f) IEINATRAGTNL (SEQ ID NO: 42), or (g) SANFIKPTSY (SEQ ID NO: 41).

[0025] In certain embodiments, the targeted peptide is NTVK. In certain embodiments, the targeted peptide is NTVR, optionally adjacent to a spacer amino acid as described herein. In certain embodiments, two or more copies of the targeted peptide within this motif are provided in a conjugate or modified protein (e.g., a parvovirus capsid). In certain embodiments, two or more different targeted peptides are present.

[0026] Examples of suitable proteins, including enzymes for targeting, immunoglobulins, therapeutic proteins, immunogenic polypeptides, nanoparticles, DNA, RNA, and other moieties (e.g., small molecules), are described in more detail below. These, as well as other biological and chemical moieties, are suitable for use with the targeted peptides provided herein.

[0027] In certain embodiments, the composition is a nucleic acid sequence molecule, the nucleic acid sequence being a DNA or RNA molecule, such as naked DNA, naked plasmid DNA, or messenger RNA (mRNA), containing a targeted peptide sequence motif bound to the nucleic acid molecule. In some embodiments, the nucleic acid molecule is further bound to a variety of compositions and nanoparticles, including, for example, micelles, liposomes, cationic lipid-nucleic acid compositions, polyglycan compositions, and other polymers, lipid and / or cholesterol-based nucleic acid conjugates, as well as other constructs as described herein. For example, see WO2014 / 089486, US2018 / 0353616A1, US2013 / 0037977A1, WO2015 / 074085A1, US9670152B2, and US8,853,377B2, X. Su et al, Mol. Pharmaceutics, 2011, 8(3), pp774-787; published online: March 21, 2011; WO2013 / 182683, WO2010 / 053572, and WO2012 / 170930, all of which are incorporated herein by reference. In certain embodiments, a targeted peptide motif is chemically bound to the surface of a nanoparticle, and the nanoparticle encapsulates a nucleic acid molecule. In some embodiments, nanoparticles containing a surface-bound targeted peptide are designed for targeted tissue-specific delivery. In some embodiments, two or more different targeted peptides are bound to the surface of nanoparticles. Suitable chemical bonding or crosslinking methods include those known to those skilled in the art.

[0028] Capsid In certain embodiments, recombinant parvoviruses are provided having a modified parvovirus capsid with at least one exogenous peptide derived from the Nx-(T / I / V / A)-(K / R) targeting motif. Such recombinant parvoviruses may be hybrid bocavirus / AAV or recombinant AAV vectors. In other embodiments, other viral vectors may be generated having one or more exogenous targeting peptides from the Nx-(T / I / V / A)-(K / R) motif (which may be the same, different, or a combination thereof) in the exposed capsid protein in order to modulate and / or modify the targeting specificity of the viral vector compared to the parent vector.

[0029] The targeted peptide can be inserted into the hypervariable loop (HVR) VIII at any preferred location. For example, based on the numbering of the AAV9 capsid, the peptide can be inserted between amino acids 588 and 589 (QA) of the AAV9 capsid protein, based on the numbering of the AAV9 VP1 amino acid sequence: SEQ ID NO: 44. See also WO2019 / 168961, published on September 6, 2019, and WO2020 / 160582, filed on September 7, 2018, which include Table G providing the deamide patterns of AAV9. The amino acid residue positions are identical in AAVhu68 (SEQ ID NO: 45). However, a different site within HVRVIII may be selected. Alternatively, another exposed loop HVR (e.g., HVRIV) may be selected for insertion. Equivalent HVR regions may be selected in other capsids. In certain embodiments, the positions of HVRVIII and HVRIV are determined using algorithms and / or alignment techniques described in U.S. Patent Publication No. 9,737,618B2 (columns 15, rows 3-23) and U.S. Patent Publication No. 10,308,958B2 (columns 15, rows 46-16, row 6), which are incorporated herein by reference in their entirety. In certain embodiments, the AAV1 capsid protein is selected as the parent capsid, and a targeted peptide having a linker of varying lengths is inserted into a preferred position in the HVRVIII region at amino acids 582-585 or the HVRIV region at amino acids 456-459, based on vp1 numbering (Gurda, BL., et al., Capsid Antibodies to Different Adeno-Associated Virus Serotypes Bind Common Regions, 2012, Journal of Virology, June). See 12,2013,87(16):9111-91114. In certain embodiments, AAV8 is selected as the parent capsid, and a targeted peptide having a linker of varying lengths is inserted at a preferred position in the HVRVIII region between amino acids 586-591 (e.g., 590-591(NT)) or the HVRIV region between amino acids 456-460, based on VP1 numbering (Gurda, BL., et al., Mapping). See "A Neutralizing Epitope onto the Capsid of Adeno-Associated Virus Serotype 8, 2012, Journal of Virology, May 16, 2012, 86(15):7739-7751". In certain embodiments, AAV7 is selected as the parent capsid, and a targeted peptide having linkers of varying lengths is inserted at a preferred position between amino acids 589 and 590 (NT). In certain embodiments, AAV6 is selected as the parent capsid, and a targeted peptide having linkers of varying lengths is inserted at a preferred position between amino acids 588 and 589 (ST). In certain embodiments, AAV5 is selected as the parent capsid, and a targeted peptide having linkers of varying lengths is inserted at a preferred position between amino acids 577 and 578 (TT). In certain embodiments, AAV4 is selected as the parent capsid, and the targeted peptide having linkers of varying lengths is inserted at a preferred position between amino acids 586 and 587 (SN). In certain embodiments, AAV3B is selected as the parent capsid, and the targeted peptide having linkers of varying lengths is inserted at a preferred position between amino acids 588 and 589 (NT). In certain embodiments, AAV2 is selected as the parent capsid, and the targeted peptide having linkers of varying lengths is inserted at a preferred position between amino acids 587 and 588 (NR). In certain embodiments, AAV1 is selected as the parent capsid, and a targeted peptide having a linker of varying lengths is inserted at a preferred position between amino acids 589 and 589 (ST). See also Figure 4.

[0030] In certain embodiments, the parental capsid, modified to contain an Nx-(T / I / V / A)-(K / R) motif having any adjacent sequences, is selected from parvoviruses that naturally target CNS (e.g., clade F AAV (e.g., AAVhu68 or AAV9), clade E (e.g., AAV8), or specific clade A AAV (e.g., AAV1, AAVrh91)) capsids or non-parvovirus capsids (e.g., herpes simplex virus) to enhance the expression of CNS-targeted cells and / or otherwise modulate their type. In other embodiments, the capsid is selected from parvoviruses that do not naturally target CNS (e.g., clade F AAV, e.g., AAVhu68 or AAV9, or specific clade A AAV, e.g., AAV1, AAVrh91) capsids or non-parvovirus capsids (e.g., herpes simplex virus (HSV)). See, for example, WO2020 / 223231 (including a table with rh91, deamide pattern), published on November 5, 2020; U.S. Provisional Patent Application No. 63 / 065,616, filed on August 14, 2020; and U.S. Provisional Patent Application No. 63 / 109734, filed on November 4, 2020. In certain embodiments, the capsid is selected from AAV clade F AAVhu95 and AAVhu96 capsids. See, for example, U.S. Provisional Patent Application No. 63 / 251,599, filed on October 2, 2201.

[0031] In certain embodiments, the parental capsid modified to contain the Nx-(T / I / V / A)-(K / R) motif is selected from viruses (e.g., AAVs) that naturally target nasal epithelial cells, nasopharyngeal cells, and / or lung cells to enhance targeting compared to parental AAVs (e.g., clade A AAVs, e.g., AAV1, AAVrh32,33, AAV6,2, AAV6, AAVrh91), or AAV5, or specific clade F AAVs, e.g., AAVhu68 or AAV9, capsid, or non-parvovirus capsids (e.g., adenoviruses, HSV, RSV, etc.). See, for example, WO2020 / 223231 (including a table with rh91, deamide pattern), published on November 5, 2020; U.S. Provisional Patent Application No. 63 / 065,616, filed on August 14, 2020; and U.S. Provisional Patent Application No. 63 / 109734, filed on November 4, 2020.

[0032] In certain embodiments, the AAV capsid is not a mutant AAV2 capsid containing the NDNVRAVS (SEQ ID NO: 48) sequence.

[0033] For example, a capsid from an AAV of clade F, such as AAVhu68 or AAV9, may be selected. Methods for generating vectors having an AAV9 capsid or an AAVhu68 capsid, and / or a chimeric capsid derived from AAV9 are described. See, for example, US7,906,111, which is incorporated herein by reference. Other AAV serotypes that transduce nasal cells or other suitable targets (e.g., muscle or lung) may be selected as sources of capsid for AAV viral vectors, including, for example, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAV8, AAV9, rh10, AAVrh64R1, AAVrh64R2, rh8, and AAVrh32.33 (see, for example, U.S. Published Patent Application No. 2007-0036760-A1, U.S. Published Patent Application No. 2009-0197338-A1, and EP1310571). See also WO2003 / 042397 (AAV7 and other monkey AAVs), U.S. Patent Nos. 7790449 and 7282199 (AAV8), WO2005 / 033321 (AAV9), and WO2006 / 110689, or if you have not yet found any Non-recombinant AAVs, or recombinant AAVs based on them, can be used as a source of AAV capsids. See, for example, WO2020 / 223232A1 (AAV rh90), WO2020 / 223231A1, and International Application No. PCT / US21 / 45945 (AAV rh91), filed on 13 August 2021, and WO2020 / 223236A1 (AAV rh92, AAV rh93, AAV rh9193), which are incorporated herein by reference in their entirety. These documents also describe other AAVs that may be selected to generate AAVs and are incorporated herein by reference. In some embodiments, AAV capsids (caps) for use in viral vectors can be generated by mutagenesis (i.e., insertion, deletion, or substitution) of one of the aforementioned AAV capsids or their coding nucleic acids. In some embodiments, the AAV capsid is a chimera containing two, three, four, or more domains of the aforementioned AAV capsid protein. In some embodiments, the AAV capsid is a mosaic of Vp1, Vp2, and Vp3 monomers derived from two or three different AAVs or recombinant AAVs. In some embodiments, the rAAV composition contains two or more of the aforementioned caps.

[0034] As used herein, the term “clade” in relation to a group of AAVs refers to a group of AAVs that are systematically related to one another, determined using a neighbor-joining algorithm based on the alignment of the AAV vp1 amino acid sequence, with at least 75% bootstrap values ​​(out of at least 1000 copies) and Poisson-corrected distance measurements of 0.05 or less. The neighbor-joining algorithm is described in the literature. For example, see M. Nei and S. Kumar, Molecular Evolution and Phylogenetics (Oxford University Press, New York (2000)). Computer programs are available that can be used to implement this algorithm. For example, the MEGA v2.1 program implements the modified Nei-Gojobori method. Using these techniques and computer programs, as well as the sequences of AAV vp1 capsid proteins, those skilled in the art can easily determine whether a selected AAV belongs to one of the clades identified herein, another clade, or outside of these clades. For example, see G Gao, et al, J Virol, 2004 Jun;78(12):6381-6388, which identifies clades A, B, C, D, E, and F and provides nucleic acid sequences of novel AAVs, GenBank accession numbers AY530553~AY530629. Also see WO2005 / 033321.

[0035] As used herein, “AAV9 capsid” is a self-assembled AAV capsid composed of multiple AAV9 vp proteins. AAV9 vp proteins are typically expressed as alternative splice variants encoded by nucleic acid sequences encoding the vp1 amino acid sequence of GenBank accession:AAS99264. These splice variants result in proteins of different lengths. In certain embodiments, “AAV9 capsid” comprises an AAV that is 99% identical to or has a 99% identical amino acid sequence to AAS99264. See also WO2019 / 168961, published 6 September 2019, which includes Table G providing deamide patterns of AAV9; see also US7906111 and WO2005 / 033321. As used herein, “AAV9 variant” includes, for example, those described in WO2016 / 049230, US8,927,514, US2015 / 0344911, and US8,734,809.

[0036] rAAVhu68 consists of the AAVhu68 capsid and vector genome. The AAVhu68 capsid contains heterologous populations of vp1, vp2, and vp3 protein. It is an aggregate of heterogeneous groups. As used herein, when used to refer to vp capsid proteins, the term “heterogeneous” or any grammatical variation thereof refers to a group of non-identical elements having vp1, vp2, or vp3 monomers (proteins) having different modified amino acid sequences, for example. Also, “Adeno-Associated Please refer to PCT / US2018 / 019992, WO2018 / 160582, titled “Virus (AAV) Clade F Vector and Uses Therefor,” which are incorporated herein by reference in their entirety.

[0037] For other recombinant viral vectors, a suitable exposed portion of the viral capsid or envelope protein involved in targeting specificity is selected for insertion of the targeted peptide. For example, in adenoviruses, modification of the hexon protein may be desirable. In lentiviruses, the envelope fusion protein may be modified to contain one or more copies of the targeted motif. In vaccinia viruses, the major glycoprotein may be modified to contain one or more copies of the targeted motif. Preferably, these recombinant viral vectors have replication defects for safety purposes.

[0038] Expression cassettes and vectors The vector genome sequence, packaged in an AAV capsid and delivered to host cells, typically consists of at least the transgene and its regulatory sequences, as well as AAV inverted terminal repeats (ITRs). Both single-stranded AAVs and self-complementary (sc)AAVs are included in rAAVs. The transgene is a nucleic acid coding sequence heterogeneous to the vector sequence that encodes the polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor), or other gene product of interest. The nucleic acid coding sequence is operably bound to regulatory elements in a manner that enables transcription, translation, and / or expression of the transgene in cells of the target tissue.

[0039] The AAV sequence of the vector typically contains cis-acting 5' and 3' inverted terminal repeat (ITR) sequences (see, e.g., B.J. Carter, in “Handbook of Parvoviruses”, ed., P. Tijsser, CRC Press, pp. 155-168 (1990)). The ITR sequence is approximately 145 base pairs (bp) in length. Preferably, a substantially complete sequence encoding the ITR is used in the molecule, but some minimal modification of these sequences is acceptable. The ability to modify these ITR sequences is within the scope of those skilled in the art (e.g., Sambrook et al., “Molecular Cloning. A Laboratory Manual”, 2nd ed., Cold Spring Harbor Laboratory, New York (1989), and K. Fisher et al., J. Virol., 70:520). See 532 (1996). An example of such molecules used in the present invention is a “cis-acting” plasmid containing a transgene, where the selected transgene sequence and associated regulatory elements are adjacent to 5' and 3' AAV ITR sequences. In one embodiment, the ITR is derived from a different AAV than the one supplying the capsid. In one embodiment, the ITR sequence is derived from AAV2. A shortened version of the 5' ITR, referred to as ΔITR, is described, with a deletion of the D sequence and terminal segregation sites (trs). In certain embodiments, the vector genome (e.g., of a plasmid) contains a 130-base pair shortened AAV2 ITR with a deletion of the outer A element. The shortened ITR can be packaged in a capsid using the inner A element as a template to form a viral particle, and then reverted to the 145-base pair wild-type length during vector DNA amplification. In other embodiments, full-length AAV 5' and 3' ITRs are used. However, ITRs derived from other AAV sources may be selected. If the ITR source is AAV2 and the AAV capsid is from another AAV source, the resulting vector may be referred to as a pseudotype. However, other configurations of these elements may also be preferable.

[0040] In addition to the key elements described above for recombinant AAV vectors, the vector also includes necessary conventional regulatory elements operably bound to the transgene in such a manner that it enables its transcription, translation, and / or expression in cells transfected with a plasmid vector or infected with a virus produced by the present invention. As used herein, “operably bound” sequences include both expression regulatory sequences that are sequential with the gene of interest and expression regulatory sequences that act in or away from the gene of interest to control it.

[0041] The regulatory element typically includes a promoter sequence located, for example, between a selected 5'ITR sequence and a coding sequence, as part of an expression control sequence. Constitutive promoters, regulated promoters [see, e.g., WO2011 / 126808 and WO2013 / 04943], tissue-specific promoters, or promoters responsive to physiological hints may be used in the vectors described herein.

[0042] Examples of suitable constitutive promoters for controlling the expression of therapeutic products include, but are not limited to, the chicken β-actin (CB) promoter, CB7 promoter, human cytomegalovirus (CMV) promoter, ubiquitin C promoter (UbC), early and late promoters of monkey virus 40 (SV40), U6 promoter, metallothionein promoter, EFLα promoter, ubiquitin promoter, hypoxanthine phosphoribosyltransferase (HPRT) promoter, dihydrofolate reductase (DHFR) promoter (Scharfmann et al., Proc. Natl. Acad. Sci. USA 88:4626-4630 (1991)), adenosine deaminase promoter, phosphoglycerol kinase (PGK) promoter, pyruvate kinase promoter, phosphoglycerol mutase promoter, and β-actin promoter (Lai et al. Examples of suitable tissue-specific or cell-specific promoters for use in the present invention include, but are not limited to, endothelial cells, FoxJ1 (targeting ciliated cells), endothelin-I (ET-I), and Flt-I. Other examples of suitable tissue-specific promoters for use in the present invention include, but are not limited to, liver-specific promoters. Examples of liver-specific promoters include, for example, thyroid hormone-binding globulin (TBG), albumin, Miyatake et al., (1997) J. Virol., 71:5124 32, hepatitis B virus core promoter, Sandig et al., (1996) Gene Ther., 3:1002 9, or human alpha-1 antitrypsin, phosphoenolpyruvate carboxykinase (PECK), or alpha-fetoprotein (AFP), Arbuthnot et al., (1996) Hum. Gene Ther., 7:1503 14.Preferably, such promoters are of human origin.

[0043] Suitable inducible promoters for controlling the expression of therapeutic products include promoters that respond to exogenous agents (e.g., pharmacological agents) or physiological cues. These response elements include, but are not limited to, hypoxia response elements (HREs) that bind to HIF-Iα and β, metal-ion response elements as described by Mayo et al. (1982, Cell 29:99-108), Brinster et al. (1982, Nature 296:39-42), and Searle et al. (1985, Mol. Cell. Biol. 5:1480-1489), or heat shock response elements as described by Nouer et al. (Heat Shock Response, ed. Nouer, L., CRC, Boca Raton, Fla., pp. I67-220, 1991).

[0044] In one embodiment, the expression of a gene product is controlled by a regulatory promoter that provides strict control over the transcription of a sequence encoding the gene product, for example, a pharmacological agent or pharmacological formulation, or, in an alternative embodiment, a transcription factor activated by a physiological cue. A promoter system that is leak-free and allows for strict control is preferred.

[0045] Examples of regulatory promoters, which are ligand-dependent transcription factor complexes, that may be used in the present invention include, without limitation, members of the nuclear receptor superfamily activated by their respective ligands (e.g., glucocorticoids, estrogens, progestins, retinoids, eczyzones, and their analogs and mimetic compounds), and rTTA activated by tetracyclines. In one aspect of the present invention, the gene switch is an EcR-based gene switch. Examples of such systems include, without limitation, the systems described in U.S. Patent Nos. 6,258,603 and 7,045,315, U.S. Published Patent Applications 2006 / 0014711 and 2007 / 0161086, and International Publication Application 01 / 70816. Examples of chimeric ecdysone receptor systems are described in U.S. Patent No. 7,091,038, U.S. Published Patent Applications No. 2002 / 0110861, 2004 / 0033600, 2004 / 0096942, 2005 / 0266457, and 2006 / 0100416, and International Publication Applications No. 01 / 70816, 02 / 066612, 02 / 066613, 02 / 066614, 02 / 066615, 02 / 29075, and 2005 / 108617, each of which is incorporated herein by reference in whole. An example of a nonsteroidal eczyne agonist regulatory system is the RheoSwitch® Mammalian Inducible Expression System (New England Biolabs, Ipswich, MA).

[0046] Other promoter systems, though not limited to these, include tetracycline (tet) response elements (such as those described by Gossen & Bujard (1992, Proc. Natl. Acad. Sci. USA 89:5547-551)) or Lee et al. (1981, Nature294:228-232), Hynes et al. This may include hormonal response elements such as those described by al. (1981, Proc. Natl. Acad. Sci. USA 78:2038-2042), Klock et al. (1987, Nature 329:734-736), and Israel & Kaufman (1989, Nucl. Acids Res. 17:2589-2604), as well as other inducible promoters known in the art. Using such promoters, the expression of soluble hACE2 constructs can be controlled in, for example, the Tet-on / off system (Gossen et al., 1995, Science 268:1766-9, Gossen et al., 1992, Proc. Natl. Acad. Sci. USA., 89(12):5547-51), the TetR-KRAB system (Urrutia R., 2003, Genome Biol., 4(10):231, Deuschle U et al., 1995, Mol Cell Biol. (4):1907-14), the mifepristone (RU486) regulatory system (Geneswitch, Wang Y et al., 1994, Proc. Natl. Acad. Sci. USA., 91(17):8180-4, Schillinger et al.) It can be controlled by the humanized tamoxifen-dep regulatory system (Roscilli et al., 2005, Proc. Natl. Acad. Sci. US A. 102(39): 13789-94) and the humanized tamoxifen-dep regulatory system (Roscilli et al., 2002, Mol. Ther. 6(5): 653-63).

[0047] In another embodiment, the gene switch is based on the heterodimerization of FK506-binding protein (FKBP) by FKBP-rapamycin-associated protein (FRAP) and is regulated through rapamycin or its non-immunosuppressive analogues. An example of such a system is: Without limitation, ARGENT® Transcriptional Technology (ARIAD Pharmaceuticals, Cambridge, Mass.), and U.S. Patent Nos. 6,015,709, 6,117,680, 6,479,653, 6,187,757, and 6,649,595, U.S. Patent Application No. 2002 / 0173474, U.S. Patent Application No. 200910100535, U.S. Patent Nos. 5,834,266, 7,109,317, 7,485,441, and 5,830,462, U.S. Patent U.S. Patent No. 5,869,337, U.S. Patent No. 5,871,753, U.S. Patent No. 6,011,018, U.S. Patent No. 6,043,082, U.S. Patent No. 6,046,047, U.S. Patent No. 6,063,625, U.S. Patent No. 6,140,120, U.S. Patent No. 6,165,787, U.S. Patent No. 6,972,193, U.S. Patent No. 6,326,166, U.S. Patent No. 7,008,780, U.S. Patent No. 6,133,456, U.S. Patent No. 6,150,527, U.S. Patent No. 6,5 U.S. Patent No. 06,379, U.S. Patent No. 6,258,823, U.S. Patent No. 6,693,189, U.S. Patent No. 6,127,521, U.S. Patent No. 6,150,137, U.S. Patent No. 6,464,974, U.S. Patent No. 6,509,152, U.S. Patent No. 6,015,709, U.S. Patent No. 6,117,680, U.S. Patent No. 6,479,653, U.S. Patent No. 6,187,757, U.S. Patent No. 6,649,595, U.S. Patent No. 6,984,635, U.S. Patent No. 7,067,5 The system described in U.S. Patent No. 26, 7,196,192, 6,476,200, 6,492,106, WO94 / 18347, WO96 / 20951, WO96 / 06097, WO97 / 31898, WO96 / 41865, WO98 / 02441, WO95 / 33052, WO99110508, WO99110510, WO99 / 36553, WO99 / 41258, and WO01114387, is the ARGENT® Regulated Transcription Retrovirus Kit, Version 2.Examples include 0(9109102), and ARGENT® Regulated Transcription Plasmid Kit, Version 2.0(9109 / 02), each of which is incorporated herein by reference in whole. The Ariad system is designed to be induced by rapamycin and its analogues referred to as “rapalog.” Suitable examples of rapamycin are provided in the literature listed above in connection with the description of the ARGENT® system. In one embodiment, the molecule is rapamycin [e.g., commercially available by Pfizer as Rapamune®]. In another embodiment, a rapalog known as AP21967[ARIAD] is used. Examples of these dimerizing molecules that can be used in the present invention include, but are not limited to, rapamycin, FK506, FK1012 (a homodimer of FK506), and rapamycin analogs ("rapalogs") readily prepared by chemical modification of natural products to add "bumps" that reduce or eliminate affinity for endogenous FKBP and / or FRAP. Examples of rapagons, though not limited to these, include AP26113 (Ariad), AP1510 (Amara, JF, et al., 1997, Proc. Natl. Acad. Sci. USA, 94(20):10618-23), AP22660, AP22594, AP21370, AP22594, AP23054, AP1855, AP1856, AP1701, AP1861, AP1692, and AP1889, which have a “bump” designed to minimize interaction with endogenous FKBP. Other rapagons, such as AP23573 [Merck], may also be selected. In certain embodiments, rapamycin or a preferred analogue may be delivered topically to AAV-transfected cells in the nasopharynx. This topical delivery may be performed by intranasal injection, or by local injection into the cells via a bolus, cream, or gel. Please refer to U.S. Patent Application US2019 / 0216841A1, which is incorporated herein by reference.

[0048] Other suitable enhancers include those appropriate for the desired target tissue indication. In one embodiment, the expression cassette comprises one or more expression enhancers. In one embodiment, expression The cassette contains two or more expression enhancers. These enhancers may be the same or different from one another. For example, the enhancer may include a CMV pre-initial enhancer. This enhancer may be present in two copies located adjacent to each other. Alternatively, the duplicate copies of the enhancer are separated by one or more sequences. In yet another embodiment, the expression cassette further contains an intron, for example, a chicken beta-actin intron. Other suitable introns include those known in the art, such as those described in WO2011 / 126808. Examples of suitable polyadenylated (polyA) sequences include, for example, rabbit-binding globulin (also known as rabbit beta-globulin, or rBG), SV40, SV50, bovine growth hormone (bGH), human growth hormone, and synthetic polyA. Optionally, one or more sequences may be selected to stabilize the mRNA. An example of such a sequence is the modified WPRE sequence, which can be manipulated upstream of the polyA sequence and downstream of the coding sequence (see, for example, MA Zanta-Boussif, et al, Gene Therapy (2009) 16:605-619).

[0049] AAV viral vectors may contain multiple transgenes. In certain situations, different transgenes may be used to encode each subunit of the protein (e.g., immunoglobulin domain, immunoglobulin heavy chain, immunoglobulin light chain). In one embodiment, cells produce a multi-subunit protein after infection / transfection with a virus containing each of the different subunits. In another embodiment, different subunits of the protein may be encoded by the same transgene. IRESs are preferable when the size of the DNA encoding each subunit is small, e.g., the total size of the DNA encoding the subunits and the IRESs is less than 5 kilobases. As an alternative to IRESs, the DNA may be separated by a sequence encoding a 2A peptide that self-cleaves in the post-translational event. For example, ML Donnelly, et al, (Jan 1997) J. Gen. Virol., 78(Pt1):13-21, S. Furler, S See et al., (June 2001) Gene Ther., 8(11):864-873 and H. Klump, et al., (May 2001) Gene Ther., 8(10):811-817. This 2A peptide is significantly smaller than IRES and is very suitable for use when space is a limiting factor. More often, when the transgene is large, consists of multiple subunits, or two transgenes are delivered simultaneously, it becomes possible to concatenate them in vivo to form a single vector genome by co-administering rAAVs having the desired transgene or subunit. In such embodiments, for co-expression in host cells, the first AAV may have an expression cassette expressing a single transgene, and the second AAV may have an expression cassette expressing different transgenes. However, the transgene of choice may encode any biologically active product or other product (e.g., a product desirable for study).

[0050] In addition to the elements identified above for expression cassettes, the vector also includes conventional regulatory elements operably bound to the coding sequence in a manner that enables transcription, translation, and / or expression of encoded products (e.g., soluble hACE2 constructs, anti-influenza antibodies, anti-COVID19 antibodies) in cells transfected with plasmid vectors or infected with viruses produced by the present invention. Examples of other suitable transgenes are provided herein. As used herein, “operably bound” sequences include both expression regulatory sequences that are sequential with the gene of interest and expression regulatory sequences that act trans or detached to control the gene of interest.

[0051] Expression regulatory sequences include appropriate enhancers, transcription factors, transcription terminators, promoters, splicing and polyadenylation (polyA) signals, and other efficient RNA processing signals, as well as sequences that stabilize cytoplasmic mRNA, such as woodchuck pneumonia virus. (WHP) includes post-transcriptional regulatory elements (WPREs), sequences that enhance translation efficiency (i.e., Kozak consensus sequences), sequences that enhance protein stability, and, if necessary, sequences that enhance the secretion of the encoded product. In one embodiment, the regulatory sequence is selected such that the total rAAV vector genome is approximately 2.0 to 5.5 kilobases in size. In another embodiment, it is desirable that the rAAV vector genome approximate the size of the natural AAV genome. Therefore, in one embodiment, the regulatory sequence is selected such that the total rAAV vector genome is approximately 4.7 kb in size. In yet another embodiment, the total rAAV vector genome is less than approximately 5.2 kb in size. The size of the vector genome may be manipulated based on the size of the regulatory sequence, including the promoter, enhancer, introns, poly(A), etc. (Wu et al, Mol. Ther., Jan) See 2010 18(1):80-6, which is incorporated herein by reference.

[0052] Therefore, in one embodiment, the intron is included in the vector. Preferred introns include chicken beta-actin introns and human beta-globin IVS2 (Kelly Examples include the Promega chimeric intron (Almond, B. and Schenborn, ETA Comparison of pCI-neo Vector and pcDNA4 / HisMax Vector), and the hFIX intron. Various introns preferred herein include, without limitation, those known in the art and found at bpg.utoledo.edu / ~afedorov / lab / eid.html, which are incorporated herein by reference. See also Shepelev V., Fedorov A. Advances in the Exon-Intron Database. Briefings in Bioinformatics 2006, 7:178-185, which are incorporated herein by reference.

[0053] Several different viral genomes were generated in the studies described herein. However, it will be understood by those skilled in the art that other genomic configurations may be selected, including promoters, enhancers, and other regulatory sequences that can be substituted for other coding sequences.

[0054] rAAV vector production For use in the production of AAV virus vectors (e.g., recombinant(r)AAV), the expression cassette can be supported on any suitable vector, e.g., a plasmid, to be delivered to a packaging host cell. Plasmids useful for the present invention can be engineered to be particularly suitable for replication and packaging in vitro into prokaryotic cells, insect cells, and mammalian cells. Suitable transfection techniques and packaging host cells are known and / or can be readily designed by those skilled in the art.

[0055] In certain embodiments, the inclusion of at least one copy of the Nx-(T / I / V / A)-(K / R) motif into the AAV capsid provides an advantage in production compared to a method without the inclusion of at least one copy of the motif in the AAV capsid, with the producing cells being 293 cells.

[0056] Methods for preparing AAV-based vectors (e.g., having AAV9 or another AAV capsid) are known. See, for example, U.S. Published Patent Application No. 2007 / 0036760 (February 15, 2007), incorporated herein by reference. The present invention is not limited to the use of AAV9 or other clade F AAV amino acid sequences, but includes, for example, those prepared by chemical synthesis, other synthetic techniques, or other methods already known in the art. This includes peptides and / or proteins containing terminal β-galactose bonds, which are produced by other known methods. Any sequence of AAV capsids provided herein can be readily produced using a variety of techniques. Suitable production techniques are well known to those skilled in the art. See, for example, Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (Cold Spring Harbor, NY). Alternatively, peptides can also be synthesized by well known solid-phase peptide synthesis methods (Merrifield, (1962) J. Am. Chem. Soc., 85:2149; Stewart and Young, Solid Phase Peptide Synthesis (Freeman, San Francisco, 1969) pp. 27-62). These methods may include, for example, culturing a host cell containing a nucleic acid sequence encoding an AAV capsid, a functional rep gene, a minigene consisting of at least an AAV inverted terminal repeat (ITR) and a transgene, and sufficient helper function to enable the packaging of the minigene into an AAV capsid protein. These and other suitable production methods are within the scope of the knowledge of those skilled in the art and are not limitations of the present invention.

[0057] The components that need to be cultured in host cells to package the AAV minigene into an AAV capsid can be supplied to the host cells in trans. Alternatively, one or more of the required components (e.g., minigene, rep sequence, cap sequence, and / or helper function) can be supplied by a stable host cell manipulated to contain one or more of the required components using methods known to those skilled in the art. Most preferably, such a stable host cell would contain the required components under the control of an inductive promoter. However, the required components may be under the control of a constitutive promoter. Examples of suitable inductive and constitutive promoters are provided herein in consideration of suitable regulators for use with transgenes. As yet another alternative, a selected stable host cell may contain selected components under the control of a constitutive promoter and other selected components under the control of one or more inductive promoters. For example, a stable host cell can be generated that is derived from 293 cells (containing the E1 helper function under the control of a constitutive promoter) but contains the rep and / or cap proteins under the control of an inductive promoter. Yet another stable host cell can be generated by those skilled in the art.

[0058] These rAAVs are particularly well-suited for gene delivery for therapeutic purposes and for the prevention of psoriasis. Furthermore, the compositions of the present invention can be used to produce desired gene products in vitro. For in vitro production, the desired product (e.g., a protein) can be obtained from the desired culture after transfecting host cells with an rAAV containing a molecule encoding the desired product and culturing the cell culture under conditions that allow expression. The expressed product can then be purified and isolated, if desired. Suitable techniques for transfection, cell culture, purification, and isolation are known to those skilled in the art. Methods for producing and isolating AAVs suitable for use as vectors are known in the art. See, for example, Grieger & Samulski, 2005, “Adeno-associated virus as a gene therapy vector: Vector development, production and clinical applications,” Adv. Biochem.Engin / Biotechnol. 99:119-145, Buning et al., 2008, “Recent developments in adeno-associated virus vector technology,” J.Gene Med. 10:717-733, and the references cited below (each of these is incorporated herein by reference in its entirety). To package the transgene into a virion, the ITR is the only AAV component required in cis within the same construct as the nucleic acid molecule containing the expression cassette. The cap and rep genes may be supplied trans.

[0059] In one embodiment, the expression cassette described herein is engineered into a genetic element (e.g., a shuttle plasmid) that introduces an immunoglobulin construct sequence carried thereon into a packaging host cell in order to produce a viral vector. In one embodiment, the selected genetic element may be delivered to the AAV packaging cell by any preferred method, including transfection, electroporation, liposome delivery, membrane fusion techniques, fast DNA coated pellets, viral infection, and protoplast fusion. A suitable AAV packaging cell may also be prepared. Alternatively, the expression cassette may be used to generate viral vectors other than AAV, or for the production of antibody mixtures in vitro. Methods used to prepare such constructs are known to those skilled in the art of nucleic acid manipulation and include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Molecular Cloning: A Laboratory Manual, ed. Green and Sambrook, Cold Spring Harbor Press, Cold Spring Harbor, NY (2012).

[0060] The term “AAV intermediate” or “AAV vector intermediate” refers to an assembled rAAV capsid that lacks the desired genomic sequence packaged within it. These may also be referred to as “empty” capsids. Such capsids may not contain a detectable genomic sequence for the expression cassette, or they may contain only a partially packaged genomic sequence that is insufficient to achieve gene product expression. These empty capsids are nonfunctional for introducing the gene of interest into a host cell.

[0061] The recombinant AAV described herein may be produced using known techniques. See, for example, WO2003 / 042397, WO2005 / 033321, WO2006 / 110689, and US7588772B2. Such methods involve culturing host cells containing a nucleic acid sequence encoding an AAV capsid, a functional rep gene, an expression cassette comprising at least an AAV inverted terminal sequence (ITR) and a transgene, and sufficient helper function to allow the expression cassette to be packaged into an AAV capsid protein. Methods for generating the capsid, and therefore the coding sequence, and for the production of rAAV viral vectors have been reported. See, for example, Gao, et al, Proc. Natl. Acad. Sci. USA100(10), 6081-6086(2003), and US2013 / 0045186A1.

[0062] In one embodiment, cells are produced in a suitable cell culture (e.g., HEK293 cells). Methods for producing gene therapy vectors described herein include methods well known in the art, such as generating plasmid DNA used for gene therapy vector production, vector production, and vector purification. In some embodiments, the gene therapy vector is an AAV vector, and the produced plasmids are an AAV cis-plasmid encoding the AAV genome and the gene of interest for packaging into a capsid, an AAV trans-plasmid containing the AAV rep and cap genes, and an adenovirus helper plasmid. The vector production process may include method steps such as initiating cell culture, subculturing cells, seeding cells, transfection of cells with plasmid DNA, changing the medium to serum-free medium after transfection, and recovering the vector-containing cells and culture medium. The recovered vector-containing cells and culture medium are referred to herein as crude cell recoveries. In yet another system, the gene therapy vector is introduced into insect cells by infection with a baculovirus-based vector. For an overview of these production systems, see Zhang et al., 2009, “Adenovirus-adeno-associated virus hybrid for large-scale recombinant adeno-associated virus production,” Human Gene Therapy2. See 0:922–929, which are incorporated herein by reference in their entirety. Methods for fabricating and using these and other AAV production systems are also described in the following U.S. Patents, the contents of each of which are incorporated herein by reference in their entirety: 5,139,941, 5,741,683, 6,057,152, 6,204,059, 6,268,213, 6,491,907, 6,660,514, 6,951,753, 7,094,604, 7,172,893, 7,201,898, 7,229,823, and 7,439,065. In certain embodiments, methods for constructing and using an AAV production system include using pseudorabies virus (rPRV) as described in U.S. Patent Application No. 63 / 016,894, filed April 28, 2020, which is incorporated herein by reference.

[0063] The crude cell recovery can then be subjected to method steps such as concentration of the vector recovery, diafiltration of the vector recovery, microfluidization of the vector recovery, nuclease digestion of the vector recovery, filtration of the microfluidized intermediate, crude purification by chromatography, crude purification by ultracentrifugation, buffer exchange by tangential flow filtration, and / or formulation and filtration for the preparation of a bulk vector.

[0064] The vector drug product is purified and empty capsids removed by a two-step affinity chromatography purification at high salt concentrations, followed by anion exchange resin chromatography. These methods are described in detail in International Patent Application PCT / US2016 / 065970, filed on 9 December 2016, entitled "Scalable Purification Method for AAV9," which is incorporated by reference. The methods for purifying AAV8, International Patent Application No. PCT / US2016 / 065976, filed on 9 December 2016; the method for purifying rh10, International Patent Application No. PCT / US16 / 66013, filed on 9 December 2016, entitled "Scalable Purification Method for AAVrh10," also filed on 11 December 2015; and the method for purifying AAV1, International Patent Application No. PCT / US2016 / 065974, filed on 9 December 2016, entitled "Scalable Purification Method for AAV1," also filed on 11 December 2015, are all incorporated herein by reference.

[0065] To calculate the empty and packed particle content, the vp3 band volume for the selected sample (e.g., in the example herein, a preparation purified with an iodixanol gradient, GC count = number of particles) is plotted against the loaded GC particles. The resulting linear equation (y = mx + c) is used to calculate the number of particles in the band volume of the test material peak. The number of particles per 20 μL loaded (pt) is then multiplied by 50 to obtain particles (pt) / mL. Pt / mL is divided by GC / mL to obtain the ratio of particles to genome copies (pt / GC). Pt / mL - GC / mL gives the empty pt / mL. The percentage of empty particles is obtained by dividing empty pt / mL by pt / mL and multiplying by 100.

[0066] In general, methods for assaying AAV vector particles containing empty capsids and packaged genomes are known in the art. See, for example, Grimm et al., Gene Therapy (1999) 6:1322-1330 and Sommer et al., Molec. Ther. (2003) 7:122-128. To test for denatured capsids, the method comprises subjecting a treated AAV stock to SDS-polyacrylamide gel electrophoresis (e.g., a gradient gel containing 3-8% trisacetate in buffer) of any gel capable of separating three capsid proteins, then trialing the gel until the sample material is separated, and blotting the gel on a nylon or nitrocellulose membrane, preferably nylon. The anti-AAV capsid antibody is then used to test for denatured capsid proteins, preferably anti A primary antibody is used, most preferably a B1 anti-AAV-2 monoclonal antibody, which binds to the primary antibody (Wobus et al., J. Virol. (2000) 74:9281-9293). A secondary antibody is then used, which binds to the primary antibody and includes means for detecting binding to an anti-IgG antibody containing a detection molecule covalently bound to the primary antibody, more preferably to the antibody, most preferably to a sheep anti-mouse IgG antibody covalently bound to horseradish peroxidase. To semi-quantitatively determine the binding between the primary and secondary antibodies, a method for detecting binding is used, preferably a detection method capable of detecting radioisotope radiation, electromagnetic radiation, or a colorimetric change, most preferably a chemiluminescence detection kit. For example, for SDS-PAGE, a sample may be taken from a column fragment and heated in an SDS-PAGE loading buffer containing a reducing agent (e.g., DTT) to resolve the capsid protein on a precast gradient polyacrylamide gel (e.g., Novex). Silver staining may be performed using SilverXpress (Invitrogen, CA) according to the manufacturer's instructions, or other preferred staining methods, namely SYPRO ruby ​​or Coomassi staining, may be used. In one embodiment, the concentration of the AAV vector genome (vg) in the column fraction can be measured by quantitative real-time PCR (Q-PCR). The sample is diluted and digested with DNase I (or another preferred nuclease) to remove exogenous DNA. After nuclease inactivation, the sample is further diluted and amplified using a TaqMan® fluorescence-generating probe specific to the DNA sequence between primers and primers. The number of cycles required to reach a specified level of fluorescence (threshold cycle, Ct) is measured for each sample on an Applied Biosystems Prism7700 sequence detection system. A standard curve for the Q-PCR reaction is generated using plasmid DNA containing the same sequence as that contained in the AAV vector. The vector genome titer is determined by normalizing the cycle threshold (Ct) value obtained from the sample to the Ct value of the plasmid standard curve.Endpoint assays based on digital PCR are also available.

[0067] In addition, another example of measuring the air-to-perfect particle ratio is known in the art. The sedimentation velocity, measured by an analytical ultracentrifuge (AUC), can detect aggregates and other minor components and provide good quantification of the relative amounts of different particle species based on their different sedimentation coefficients. This is an absolute method based on fundamental units of length and time and does not require a standard molecule as a reference. The vector sample is loaded into cells having a two-channel charcoal-epon centerpiece with a 12 mm optical path length. The supplied dilution buffer is loaded into the reference channel of each cell. The loaded cells are then placed in an AN-60Ti analytical rotor and subjected to a Beckman-Coulter oscilloscope equipped with both absorbance and RI detectors. Load the ProteomeLab XL-I analytical ultracentrifuge. After complete temperature equilibrium at 20°C, set the rotor to the final operating speed of 12,000 rpm. 280 Scans are recorded approximately every 3 minutes for about 5.5 hours (110 total scans for each sample). The raw data is analyzed using the c(s) method and implemented in the analysis program SEDFIT. The resulting size distribution is graphed and the peaks are merged. The percentage value associated with each peak represents the peak area fraction of the total area under all peaks, and based on the raw data generated at 280 nm, many laboratories use these values ​​to calculate the empty:perfect particle ratio. However, since empty and perfect particles have different extinction coefficients at this wavelength, the raw data can be adjusted accordingly. The empty-perfect particle ratio is determined using the ratio of the empty particle and perfect monomer peak values ​​before and after extinction coefficient adjustment.

[0068] In one embodiment, an optimized q-PCR method is used that utilizes a broad-spectrum serine protease, such as protease K (e.g., commercially available from Qiagen). More specifically, the optimized qPCR genome titer assay is similar to the standard assay, except that after DNase I digestion, the sample is diluted with proteinase K buffer. The sample is then treated with proteinase K and subsequently thermally inactivated. Preferably, the sample is diluted with an amount of proteinase K buffer equal to the sample size. The protease K buffer can be concentrated to more than 2 times. Typically, the proteinase K treatment is about 0.2 mg / mL, but can vary from 0.1 mg / mL to about 1 mg / mL. The treatment step is generally carried out at about 55°C for about 15 minutes, but may be carried out at a lower temperature (e.g., about 37°C to about 50°C) for a longer time (e.g., about 20 minutes to about 30 minutes), or at a higher temperature (e.g., up to about 60°C) for a shorter time (e.g., about 5 to 10 minutes). Similarly, thermal inactivation is generally carried out at about 95°C for about 15 minutes, but the temperature may be lowered (e.g., about 70 to about 90°C) and the time may be extended (e.g., about 20 minutes to about 30 minutes). The sample is then diluted (e.g., 1000-fold) and subjected to TaqMan analysis as described in standard assays. Quantification can also be performed using ViroCyt or flow cytometry.

[0069] Additionally, or alternatively, droplet digital PCR (ddPCR) may be used. For example, a method for determining single-stranded and self-complementary AAV vector genome titers by ddPCR has been described. See, for example, M. Lock et al, Hu Gene Therapy Methods, Hum. Gene Ther. Methods. 2014 Apr;25(2):115-25. doi:10.1089 / hgtb.2013.131.Epub2014 Feb 14.

[0070] Therapeutic proteins and delivery systems The targeted motifs, fusion partners, conjugate partners, and recombinant vectors containing the Nx-(T / I / V / A)-(K / R) motif provided herein are useful for a variety of different therapeutic proteins, polypeptides, nanoparticles, and delivery systems. Examples of compositions and proteins and compounds useful for targeted delivery provided herein include: Viral vectors, nanoparticles, and other delivery systems will be understood to contain sequences encoding selected proteins (or conjugates) for in vivo expression.

[0071] In certain embodiments, the protein is the MCT8 protein (SLC16A2 gene) and other compounds for treating Alan-Herndon-Dudley disease and its symptoms.

[0072] In certain embodiments, the protein is selected from diseases associated with transport defects, such as cystic fibrosis (cystic fibrosis transmembrane regulator), alpha-1-antitrypsin (hereditary emphysema), FE (hereditary hemochromatosis), tyrosinase (oculocutaneous albinism), protein C (protein C deficiency), complement C inhibitor (hereditary angioedema type I), alpha-D-galactosidase (Fabry disease), beta-hexosaminidase (Taysax), sucrase-isomaltase (congenital sucrase-isomaltase deficiency), UDP-glucoronosyl-transferase (Krigler-Nadjar type II), insulin receptor (diabetes mellitus), and growth hormone receptor (Laron syndrome). Other examples of genes and proteins include, among others, spinal muscular atrophy (SMA, SMN1), Huntington's disease, Rett syndrome (e.g., methyl-CpG binding protein 2 (MeCP2), UniProtKB-P51608), amyotrophic lateral sclerosis (ALS), Duchenne muscular dystrophy, Friedreich's ataxia (e.g., frataxin), spinocerebellar ataxia-associated ATXN2 type 2 (SCA2) / ALS, ALS-associated TDP-43, and progranulin (PRGN) (associated with non-Alzheimer's brain degeneration, including frontotemporal dementia (FTD), progressive non-fluent aphasia (PNFA), and semantic dementia). See, for example, www.orpha.net / consor / cgi-bin / Disease_Search_List.php;rarediseases.info.nih.gov / diseases. Further exemplary genes that can be delivered via rAAV include However, these include, but are not limited to, glucose-6-phosphatase associated with glycogen storage disorder or type 1A deficiency (GSD1), phosphoenolpyruvate-carboxykinase (PEPCK) associated with PEPCK deficiency, cyclin-dependent kinase-like 5 (CDKL5), also known as serine / threonine kinase 9 (STK9), associated with seizures and severe neurodevelopmental disorders, galactose-1-phosphate uridyltransferase associated with galactosemia, phenylalanine hydroxylase (PAH) associated with phenylketonuria (PKU), and hydro Gene products associated with primary hyperoxaluria type 1, including xylate oxidase 1 (GO / HAO1) ​​and AGXT; branched chain α-keto acid dehydrogenases (including BCKDH, BCKDH-E2, BAKDH-E1a, and BAKDH-E1b) associated with maple syrup urine disease; fumarylacetoacetate hydrolase associated with tyrosinemia type 1; methylmalonyl-CoA mutase associated with methylmalonic acidemia; medium-chain acyl-CoA dehydrogenase associated with medium-chain acetyl-CoA deficiency; and ornithine transcarbamylase associated with ornithine transcarbamylase deficiency. Carbamylase (OTC), argininosuccinate synthetase (ASS1) associated with citrullinemia, lecithin-cholesterol acyltransferase (LCAT) deficiency, amethylmalonic acidemia (MMA), NPC1 associated with Niemann-Pick disease (type C1), propion academia (PA), TTR associated with transthyretin (TTR)-related hereditary amyloidosis, low-density lipoprotein receptor (LDLR) protein associated with familial hypercholesterolemia (FH), LDLR variants described in WO2015 / 164778, PC SK9, ApoE and ApoC proteins associated with dementia, UDP-glucouronosyltransferase associated with Crigler-Nadjar disease, adenosine deaminase associated with severe combined immunodeficiency, hypoxanthine guanine phosphoribosyltransferase associated with gout and Lesch-Niang syndrome, biothymidase associated with biothymidase deficiency, α-galactosidase A (α-GalA) associated with Fabry disease, β-galactosidase (GLB1) associated with GM1 gangliosidosis, ATP7B associated with Wilson's disease,Beta-glucocerebrosidase associated with Gaucher disease types 2 and 3, peroxisome membrane protein 70kDa associated with Zellweger syndrome, arylsulfatase A (ARSA) associated with metachromatic leukodystrophy, galactocerebrosidase (GALC) enzyme associated with Krabbe disease, alpha-glucosidase (GAA) associated with Pompe disease, sphingomyelinase (SMPD1) gene associated with Niemann-Pick disease type A, argininosuccinate synthase associated with adult-onset type II citrullinemia (CTLN2), carbamoyl phosphate synthase 1 (CPS1) associated with urea cycle disorders, survival motor neuron (SMN) protein associated with spinal muscular atrophy, ceramidase associated with Faber lipogranulomatosis, and B-hexopropyl alcohol associated with GM2 gangliosidosis, Tay-Sachs disease, and Sandhoff disease. Examples include saminidase, aspartylglucosaminidase associated with aspartylglucosamiuria, α-fucosidase associated with fucosidosis, α-mannosidase associated with α-mannosidosis, porphobilinogen deaminase associated with acute intermittent porphyria (AIP), α-1 antitrypsin for the treatment of α-1 antitrypsin deficiency (emphysema), erythropoietin for the treatment of anemia due to thalassemia or renal failure, vascular endothelial growth factor, angiopoietin-1, and fibroblast growth factor for the treatment of ischemic diseases, such as inhibitors of the thrombomodulin and tissue factor pathways for the treatment of occluded vessels seen in atherosclerosis, thrombosis, or embolism, and aromatic amino acid decarboxylase (AADC) and tyrosine hydroxylase (TH) for the treatment of Parkinson's disease.

[0073] Examples of compositions and proteins and compounds useful in targeted delivery provided herein include therapeutic proteins and other compounds, as well as vaccine protein derivatives for the following respiratory-associated infectious diseases, and direct passive immunoglobulins against these infectious diseases. Suitable examples of therapeutic proteins include, for example, alpha-1-antitrypsin, cystic fibrosis transmembrane protein, and their variants, and surfactant-B This includes bone morphogenetic protein receptor type II (associated with pulmonary hypertension), as well as various cancer treatments.

[0074] Suitable vaccines or passive immunizations include proteins derived from airborne pathogens, including human respiratory coronaviruses, that are associated with severe acute respiratory syndrome (SARS-CoV-1), the common cold, and non-A, B, or C hepatitis. SARS-CoV-2 is the causative agent of COVID-19, and antibodies specific to this virus have been documented. Examples of IgG antibodies described as being useful for binding to the human ACE2 spike protein of SARS-CoV-2 and possessing neutralizing activity include, for example, LY-CoV555 (Eli Lilly), TY027 (Tychon), STI-1499 and STI-2020 (COVI-GUARD, Sorrento), 80R, ADI055689 / 56046 (Adimab) (Renn et al., Trends in Pharmacological Sciences, 2020), BD-217, BD-218, and BD-236 (Cao et al., Cell, 182, 73-84 (2020)).Examples of IgG antibodies described as useful for binding to the receptor-binding domain (RBD) of human ACE2 in SARS-CoV-2 and possessing neutralizing activity include, for example, COV2-2196, COV2-2130, COV2-2165 (Zost et al., Nature, 584, 443-465 (2020)), BD-361, BD-368, BD-368-2 (Cao et al., Cell, 182, 73-84 (2020)), B38, H4 (Y. Wu et al., Science 10.1126 / science.abc2241 (2020), Jahanshahlu and Rezaei, Biomedicine and Pharmacotherapy 129 (2020)), S309, S315, S304 (Pinto et al.) al.,Nature,583,290-311(2020)), CC6.29, CC6.30, CC6.33, CC12.1, CC12.3(Rogers et al.,Science369,956-963(2020)), JS016(Eli (Renn et al., Trends in Pharmacological Sciences, 2020). Examples of IgG antibodies described as useful for binding to the human ACE2 spike protein of SARS-CoV-1 and possessing neutralizing activity include, for example, m396 and CR3104 (Prabakaran et al., Journal of Biological Chemistry, 281, 15829-15836 (2006), ter Meulen et al., PLoS, 3, 7 (2006)). Examples of IgG antibodies described as useful for binding to either the RBD or spike protein of human ACE2 in both SARS-CoV-1 and SARS-CoV-2 and possessing neutralizing activity include, for example, CR3022 and 47D11 (Wang et al., Nature Communications, 11, nature.com / naturecommunications (2020)).

[0075] Other examples of target viruses include influenza viruses from the Orthomyxoviridae family, including influenza A, influenza B, and influenza C. Type A viruses are the most virulent human pathogens. Serotypes of influenza A associated with pandemics include H1N1, which caused the Spanish flu of 1918; swine flu of 2009; H2N2, which caused the Asian flu of 1957; H3N2, which caused the Hong Kong flu of 1968; and H5N1, H7N7, H1N2, H9N2, H7N2, H7N3, and H10N7, which caused avian flu of 2004. Broad-spectrum neutralizing antibodies against influenza A are described. As used herein, “broad-spectrum neutralizing antibody” refers to a neutralizing antibody that can neutralize multiple strains from multiple subtypes. For example, CR6261[The Scripps Institute / Crucell is described as a monoclonal antibody that binds to a wide range of influenza viruses, including the 1918 "Spanish Flu" (SC1918 / H1), and to the H5N1 class virus (Viet04 / H5) of avian influenza that spread from chickens to humans in Vietnam in 2004. CR6261 recognizes a highly conserved helical region in the membrane-proximal stem of hemagglutinin, the dominant protein on the surface of the influenza virus. This antibody is described in WO2010 / 130636, which is incorporated herein by reference. Another neutralizing antibody, F10 [XOMA Ltd], is described as useful against H1N1 and H5N1. [Sui et al, Nature Structural and Molecular Biology (Sui, et al. 2009, 16(3):265-73)] Other antibodies against influenza, such as Fab28 and Fab49, may be selected. See, for example, WO2010 / 140114 and WO2009 / 115972, which are incorporated herein by reference. Further other antibodies, such as those described in WO2010 / 010466, U.S. Published Patent Publication 2011 / 076265, and WO2008 / 156763, can be readily selected.

[0076] Other target pathogenic viruses include arenaviruses (including Junin, Machupo, and Lassa), filoviruses (including Marburg and Ebola), hantaviruses, picornaviridae (including rhinovirus and echovirus), coronaviruses, paramyxoviruses, morbilliviruses, respiratory syncytial viruses, togaviruses, coxsackieviruses, parvovirus B19, parainfluenza, adenoviruses, reoviruses, and poxviruses of the poxvirus family. This includes smallpox and cowpox, as well as varicella (pseudorabies). Viral hemorrhagic fevers are caused by members of the arenavirus family (Lassa fever) (a family also associated with lymphocytic choriomeningitis (LCM)), filovirus (Ebola virus), and hantavirus (premara). Members of the picornavirus (a subfamily of rhinoviruses) are associated with the common cold in humans. The coronavirus family includes infectious bronchitis viruses. The paramyxovirus family includes several non-human viruses such as poultry, porcine gastroenteritis virus (pig), porcine hemagglutinin encephalomyelitis virus (pig), feline infectious peritonitis virus (cat), feline enteric coronavirus (cat), and canine coronavirus (dog). The paramyxovirus family includes parainfluenza virus type 1, parainfluenza virus type 3, bovine parainfluenza virus type 3, rubella virus (mumps virus), parainfluenza virus type 2, parainfluenza virus type 4, Newcastle disease virus (chicken), rinderpest, morbillivirus, morbillivirus including measles and canine distemper, and pneumovirus including respiratory syncytial virus (RSV). The parvovirus family includes feline parvovirus (feline enteritis), feline panleucopeniavirus, canine parvovirus, and porcine parvovirus. The adenovirus family includes viruses that cause respiratory diseases (e.g., AD7, ARD, OB).

[0077] Neutralizing antibody constructs against bacterial pathogens may also be selected for use in the present invention. In one embodiment, the neutralizing antibody construct is directed against the bacteria themselves. In another embodiment, the neutralizing antibody construct is directed against toxins produced by the bacteria. Examples of airborne bacterial pathogens include, for example, Neisseria meningitidis (meningitis), Klebsiella pneumoniae (pneumonia), Pseudomonas aeruginosa (pneumonia), Bacillus melioides (pneumonia), Bacillus grassii (pneumonia), Acinetobacter (pneumonia), Catarrococcus, Moraxella lacunata, Alcaligenes, Cardiobacterium, Haemophilus influenzae (influenza), Haemophilus parainfluenzae, Bordetella pertussis (pertussis), and Tularemia bacillus (pneumonia / fever). Legionnaires' disease, Chlamydia psittacosis (pneumonia), Chlamydia pneumoniae (pneumonia), Mycobacterium tuberculosis (TB), Mycobacterium cansasi (TB), Mycobacterium avium (pneumonia), Nocardia asteroides (pneumonia), Bacillus anthrax (anthrax), Staphylococcus aureus (pneumonia), Streptococcus pyogenes (scarlet fever), Streptococcus pneumoniae (pneumonia), Corynebacterium This includes diphtheria and Mycoplasma pneumoniae. The causative agent of anthrax is a toxin produced by Bacillius anthracis. A neutralizing antibody against the protective agent (PA), one of the three peptides that form the toxoid, is described. The other two polypeptides consist of the lethal factor (LF) and the edema factor (EF). Anti-PA neutralizing antibodies are described as effective for passive immunity against Bacilli. See, for example, U.S. Patent No. 7,442,373, R. Sawada-Hirai et al, J Immune Based Ther Vaccines. 2004;2:5. (online 2004 May 12). Further anti-anthrax toxin neutralizing antibodies are described and / or can be produced. Similarly, non-IgG antibodies described herein can be produced using neutralizing antibodies against other bacteria and / or bacterial toxins.

[0078] Other infectious diseases may be caused by airborne fungi, including, for example, species of Aspergillus, Absidia corymbifera, Rhixpus stolonifer, Mucor plumbeaus, Cryptococcus neoformans, Histoplasm capsulatum, Blastomyces dermatitidis, Coccidioides immitis, species of Penicillium, Micropolyspora faeni, Thermoactinomyces vulgaris, Alternaria alternate, species of Cladosporium, Helminthosporium, and species of Stachybotrys.

[0079] In addition to the airborne diseases affecting humans, many of which are described above, passive immunization according to the present invention can be used to prevent conditions associated with direct inoculation of the nasal cavity, such as those that can be transmitted through direct contact between the fingers and the nasal cavity. These conditions may include fungal infections (e.g., athlete's foot), ringworm, or other pathogens that can be transmitted by direct contact, such as viruses, bacteria, parasites, fungi, and other pathogens. In addition, various conditions affect domestic pets, cattle and other livestock, as well as other animals. For example, in dogs, upper respiratory tract infections due to canine sinus aspergillosis cause serious illness. In cats, upper respiratory tract diseases or feline respiratory complex diseases that occur in the nose can cause illness and death if left untreated. Cattle are susceptible to infections caused by infectious bovine rhinotracheitis (commonly known as IBR or red nose disease), an acute, contagious viral disease of cattle. In addition, cattle are susceptible to bovine respiratory syncytial virus (BRSV), which can cause mild to severe respiratory illness and impair resistance to other diseases. Further pathogens and diseases will be apparent to those skilled in the art.

[0080] Antibodies, particularly neutralizing antibodies, against pathogens specifically identified herein (e.g., anti-SARS-CoV-2, anti-SARS-CoV-1, anti-influenza, anti-Ebola, anti-RSV) may be used to produce class-switching antibodies or non-IgG antibodies. Monoclonal antibodies (mAbs) with broad neutralizing capabilities can be identified using antibody-phage display, and libraries can be screened from donors recently vaccinated with seasonal influenza vaccines, from non-immune humans, or from survivors of natural infections. In the case of influenza, antibodies that neutralize two or more influenza subtypes by blocking viral fusion with host cells have been identified. This technique may be used in conjunction with other infections to obtain neutralizing monoclonal antibodies. See, for example, US5,811,524, which describes the production of anti-respiratory syncytial virus (RSV) neutralizing antibodies. The technique described therein is applicable to other pathogens. Such antibodies may be used intact to produce artificial or recombinant neutralizing antibody constructs, or their sequences (scaffolds) may be modified. Such methods are described [see, for example, WO2010 / 13036, WO2009 / 115972, WO2010 / 140114]. In one embodiment, a mouse, rat, hamster, or other host animal is immunized with an immunizing agent to generate lymphocytes that produce antibodies having binding specificity to the immunizing antigen. In an alternative approach, Phage cells can be immunized in vitro. Human antibodies can be produced using techniques such as phage display libraries (Hoogenboom and Winter, J.Mol.Biol, 1991, 227:381, Marks et al., J.Mol.Biol. 1991, 222:581).

[0081] Composition and Use This specification provides compositions comprising at least one rAAV stock (e.g., rAAV9 or rAAVhu68 variant stock) and an optional carrier, excipient, and / or preservative. The rAAV stock refers to multiple rAAV vectors, which are identical, for example, in the amounts described below in consideration of concentration and dosage units.

[0082] In certain embodiments, the composition may contain at least a second, different rAAV stock. This second vector stock may differ from the first vector stock by having a different AAV capsid and / or a different vector genome. In certain embodiments, the compositions described herein may contain a different vector expressing the expression cassette described herein, or another active ingredient (e.g., an antibody construct, another biopharmaceutical, and / or a small molecule drug).

[0083] As used herein, “carrier” includes any and all solvents, dispersion media, vehicles, coatings, diluents, antimicrobial and antifungal agents, isotonic and absorption retardants, buffers, carrier solutions, suspensions, colloids, etc. The use of such media and agents for pharmaceutically active substances is well known in the art. Supplementary active ingredients may also be incorporated into the composition. The phrase “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce allergic or similar adverse reactions when administered to a host. Delivery vehicles such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, vesicles, etc., may be used to introduce the compositions of the present invention into suitable host cells. In particular, rAAV vector delivery transgenes may be formulated for delivery encapsulated in lipid particles, liposomes, vesicles, nanospheres, or nanoparticles, etc.

[0084] In one embodiment, the composition comprises a final formulation suitable for delivery to a subject, for example, an aqueous liquid suspension buffered to a physiologically compatible pH and salt concentration. Optionally, one or more surfactants are present in the formulation. In another embodiment, the composition may be transported as a concentrate that is diluted for administration to a subject. In yet another embodiment, the composition may be lyophilized and reconstituted at the time of administration.

[0085] Suitable surfactants, or combinations of surfactants, may be selected from non-toxic nonionic surfactants. In one embodiment, for example, a primary hydroxyl-terminated bifunctional block copolymer surfactant such as Pluronic® F68 [BASF], also known as poloxamer 188, which has a neutral pH and an average molecular weight of 8400, may be selected. Other surfactants and other poloxamers, namely nonionic triblock copolymers composed of a central hydrophobic chain of polyoxypropylene (poly(propylene oxide)) adjacent to two hydrophilic chains of polyoxyethylene (poly(ethylene oxide)), such as SOLUTOL HS15 (macrogol-15 hydroxystearate), LABRASOL (polyoxycaprylic acid glyceride), polyoxy-10 oleyl ether, TWEEN (polyoxyethylene sorbitan fatty acid ester), ethanol, and polyethylene glycol may be selected. In one embodiment, the formulation contains a poloxamer. These copolymers are generally named with the letter "P" (in the case of poloxamers) followed by a three-digit number, where the first two digits × 100 give the approximate molecular mass of the polyoxypropylene core, and the last digit × 10 gives the percentage of polyoxyethylene content. In one embodiment, poloxamer 188 is selected. The surfactant is used to a maximum of approximately 0% of the suspension. It may be present in an amount of 0.0005% to approximately 0.001%.

[0086] In one embodiment, the formulation buffer is phosphate-buffered saline (PBS) having a total salt concentration of 200 mM and 0.001% (w / v) Pluronic F68 (final formulation buffer, FFB).

[0087] The vector is administered in an amount sufficient to transfect cells, providing a sufficient level of gene transfer and expression to deliver a therapeutic effect with no excessive adverse effects or with medically acceptable physiological effects, which can be determined by those skilled in the art. In certain embodiments, the vector is formulated for delivery via an intranasal delivery device for targeted delivery to nasal and / or nasopharyngeal epithelial cells. In certain embodiments, the vector is formulated for aerosol delivery devices, for example, via a nebulizer or through other suitable devices. Other conventional and pharmaceutically acceptable routes of administration include, but are not limited to, direct delivery to the desired organ (e.g., lungs), oral inhalation, intrathecal, intratracheal, intra-arterial, intraocular, intravenous, intramuscular, subcutaneous, intracutaneous, and other parenteral routes of administration. In one embodiment, the vector is administered intranasally using an intranasal mucosal spray device (LMA® MAD Nasal®-MAD110). In another embodiment, the vector is administered intrapulmonaryly in atomized form using a Vibrating Mesh Nebulizer (Aerogen® Solo) or a MADgic® Laryngeal Mucosal Atomizer. The administration routes may be combined as desired. The administration routes and their uses for delivering the rAAV vector are also described in the following published U.S. patent applications, the contents of which are incorporated herein by reference in their entirety: US2018 / 0155412A1, US2018 / 0243416A1, US2014 / 0031418A1, and US2019 / 0216841A1.

[0088] The dosage of viral vectors depends primarily on factors such as the condition being treated, the patient's age, weight, and health status, and therefore can vary among patients. For example, the therapeutically effective human dose of viral vectors is generally around 25 to 1000 microliters to 5 mL, or about 10 9 ~4×10 14It is within the range of an aqueous suspension containing the dosage of the AAV vector of GC. The dosage is adjusted to balance the therapeutic benefit against any side effects, and such dosage may vary depending on the therapeutic application in which the recombinant vector is utilized. The expression level of the transgene can be monitored to determine the dosing frequency resulting in a viral vector, preferably an AAV vector containing a mini-gene. Optionally, a dosing regimen similar to that described for therapeutic purposes can be utilized for immunization using the compositions of the present invention.

[0089] The replication-defective virus composition is, for a human patient, about 10 (treating an average subject of 70 kg body weight), including all integers or fractions within the range 9 GC~about 10 16 within the range of GC, preferably 10 12 GC~10 14 It can be formulated into dosage units containing an amount of replication-defective virus within the range of GC. In one embodiment, the composition is at least 10, including all integers or fractions within the range, per dosage 9 、2×10 9 、3×10 9 、4×10 9 、5×10 9 、6×10 9 、7×10 9 、8×10 9 、or 9×10 9 GC. In another embodiment, the composition is at least 10, including all integers or fractions within the range, per dosage 10 、2×10 10 、3×10 10 、4×10 10 、5×10 10 、6×10 10 、7×10 10 、8×10 10 、or 9×10 10 GC. In another embodiment, the composition is at least 10, including all integers or fractions within the range, per dosage 11 、2×10 11 、3×10 11 、4×10 11 、5×1011 , 6×10 11 , 7×10 11 , 8×10 11 , or 9×10 11 The formulation is made to contain GC. In another embodiment, the composition contains all integers or decimals within the range, at least 10 per dose. 12 , 2×10 12 , 3 x 10 12 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , or 9×10 12 Formulated to contain GC In another embodiment, the composition contains all integers or decimals within the range, at least 10 per dose. 13 , 2×10 13 , 3 x 10 13 , 4×10 13 , 5×10 13 , 6×10 13 , 7×10 13 , 8×10 13 , or 9×10 13 The formulation is made to contain GC. In another embodiment, the composition contains all integers or decimals within the range, at least 10 per dose. 14 , 2×10 14 , 3 x 10 14 , 4×10 14 , 5×10 14 , 6×10 14 , 7×10 14 , 8×10 14 , or 9×10 14 The formulation is made to contain GC. In another embodiment, the composition contains all integers or decimals within the range, at least 10 per dose. 15 , 2×10 15 , 3 x 10 15 , 4×10 15 , 5×10 15 , 6×10 15 , 7×10 15 , 8×10 15 , or 9×10 15It is formulated to contain GC. In one embodiment, for human application, the dose is 10 per dose, including all integers or decimals within the range. 10 ~about 10 12 It may be within the GC range. In one embodiment, for human application, the dose is 10 per dose, including all integers or decimals within the range. 9 ~Approx. 7×10 13 It may be within the range of GC. In one embodiment, for human application, the dose is 6.25 × 10 12 GC~5.00×10 13 This is within the GC range. In further embodiments, the dose is approximately 6.25 × 10⁻⁶. 12 GC, approx. 1.25×10 13 GC, approx. 2.50×10 13 GC, or approximately 5.00 × 10 13 It is GC. In certain embodiments, the dose is equally divided in half and administered into each nostril. In certain embodiments, for human application, the dose is administered as two aliquots of 0.2 ml per nostril for a total volume delivered in each subject of 0.8 ml, which is 6.25 × 10⁶. 12 GC~5.00×10 13 This falls under the scope of garbage collection (GC).

[0090] These aforementioned doses may be administered in carrier, excipient, or buffer formulations of varying volumes ranging from about 25 to about 1000 microliters, or larger, or all numbers within that range, depending on the size of the area being treated, the viral titer used, the route of administration, and the desired effect of the method. In one embodiment, the volume of the carrier, excipient, or buffer is at least about 25 μL. In another embodiment, the volume is about 50 μL. In yet another embodiment, the volume is about 75 μL. In yet another embodiment, the volume is about 100 μL. In yet another embodiment, the volume is about 125 μL. In yet another embodiment, the volume is about 150 μL. In yet another embodiment, the volume is about 175 μL. In yet another embodiment, the volume is about 200 μL. In yet another embodiment, the volume is about 225 μL. In yet another embodiment, the volume is about 250 μL. In yet another embodiment, the volume is about 275 μL. In yet another embodiment, the volume is about 300 μL. In yet another embodiment, the volume is approximately 325 μL. In yet another embodiment, the volume is approximately 350 μL. In yet another embodiment, the volume is approximately 375 μL. In yet another embodiment, the volume is approximately 400 μL. In yet another embodiment, the volume is approximately 450 μL. In yet another embodiment, the volume is approximately 500 μL. In yet another embodiment, the volume is approximately 550 μL. In yet another embodiment, the volume is approximately 600 μL. In yet another embodiment, the volume is approximately 650 μL. In yet another embodiment, the volume is approximately 700 μL. In yet another embodiment, the volume is approximately 700 to 1000 μL.

[0091] In certain embodiments, the recombinant vector may be administered intranasally by using two sprays in each nostril. In one embodiment, the two sprays are administered alternately to each nostril, for example, left nostril spray, right nostril spray, then left nostril spray, right nostril spray. In certain embodiments, there may be a delay between alternating sprays. For example, each nostril may receive multiple sprays spaced apart by about 10–60 seconds, or 20–40 seconds, or about 30 seconds–several minutes, or longer. Such sprays may deliver about 150 μL–300 μL, or about 250 μL, in each spray, achieving a total administered volume of about 200 μL–600 μL, 400 μL–700 μL, or 450 μL–1000 μL.

[0092] In certain embodiments, the recombinant AAV vector is administered, for example, 1 to 4 weeks after the vector administration, or approximately 2 weeks later, and the resulting nasal lavage solution yields 5 to 20 ng / ml. The introduced gene can be administered intranasally to achieve the desired concentration of the gene expression product. The method for obtaining the nasal lavage solution in the subject and the method for quantifying the gene expression product are conventional.

[0093] For other routes of administration, such as intravenous or intramuscular, the dose levels will be higher than for intranasal delivery. For example, such a suspension may reach a maximum dose of approximately 2.5 × 10⁻⁶. 15 The GC dose can range from approximately 1 mL to approximately 25 mL in volume.

[0094] In certain embodiments, the intranasal delivery device provides a spray atomizer that delivers a mist of particles having an average size range of about 30 microns to about 100 microns. In certain embodiments, the average size range is about 10 microns to about 50 microns. Suitable devices are described in the literature, some of which are, for example, LMA MAD NASAL® (Teleflex Medical, Ireland), Teleflex VaxINator® (Teleflex Medical, Ireland), and Controlled Particle from Kurve Technologies. Dispersion® (CPD) is commercially available. See also PG Djupesland, Drug Deliv and Transl. Res (2013) 3:42-62. In certain embodiments, the particle size and volume of delivery are controlled to preferentially target nasal epithelial cells and minimize targeting to the lungs. In other embodiments, the particle mist is about 0.1 microns to about 20 microns or less for delivery to lung cells. Such smaller particle sizes can minimize retention in the nasal epithelium.

[0095] One device atomizes particles to an average diameter of approximately 16 to 22 microns. The mist can be delivered directly to the tracheobronchial tree inserted through the suction channel of a 3.5 mm flexible fiber optic bronchoscope (Olympus, Melville, NY). Other suitable delivery devices may include a laryngotracheal mucosal atomizer that provides administration across the upper airway, passing through the vocal cords. It passes through the vocal cords and down the laryngeal mask or enters the nasal cavity. The droplets are atomized to an average diameter of approximately 30 to 100 microns. A standard device has a tip diameter of approximately 0.18 inches (4.6 mm), a length of approximately 4.5 to 8.5 inches, is inserted through the suction channel, and advances approximately 3 mm beyond the distal tip of the scope. Dosages may be administered with 10 aliquots (approximately 150 μl each) of saline or rAAV sprayed into the left and right main bronchi as a control.

[0096] In one embodiment, a frozen composition containing rAAV in a buffer solution as described herein is provided in a frozen form. Optionally, one or more surfactants (e.g., Pluronic F68), stabilizers, or preservatives are present in the composition. Preferably, for use, the composition is thawed and titrated to the desired volume with a suitable diluent, such as sterile saline or buffered saline.

[0097] In one embodiment, a composition is provided comprising one or more exogenous endothelial cell targeting peptides from motif:Nx-(T / I / V / A)-(K / R)(SEQ ID NO: 47) and an optional adjacent linker sequence, together with one or more physiologically compatible carriers, excipients, and / or aqueous suspension bases. Further, a composition comprising a nucleic acid sequence encoding it is provided. In a particular embodiment, the targeting peptide has SEQ ID NO: 40 and is encoded by the nucleic acid sequence of SEQ ID NO: 54, or a sequence that is at least about 70% identical thereto. In a particular embodiment, the targeting peptide has SEQ ID NO: 38 and is encoded by the nucleic acid sequence of SEQ ID NO: 50, or a sequence that is at least about 70% identical thereto. In a particular embodiment, the targeting peptide has SEQ ID NO: 46 and is encoded by the nucleic acid sequence of SEQ ID NO: 56, or a sequence that is at least about 70% identical thereto. In a particular embodiment, the targeting peptide has SEQ ID NO: 43 and is encoded by the nucleic acid sequence of SEQ ID NO: 52, or a sequence that is at least about 70% identical thereto. In certain embodiments, the targeted peptide has SEQ ID NO: 39 and is encoded by the nucleic acid sequence of SEQ ID NO: 55, or a sequence that is at least about 70% identical thereto. In certain embodiments, the targeted peptide has SEQ ID NO: 42 and is encoded by the nucleic acid sequence of SEQ ID NO: 51, or a sequence that is at least about 70% identical thereto. In certain embodiments, the targeted peptide has SEQ ID NO: 41 and is encoded by the nucleic acid sequence of SEQ ID NO: 53, or a sequence that is at least about 70% identical thereto.

[0098] In another embodiment, a fusion polypeptide or protein is provided that comprises one or more exogenous brain endothelial cell-targeting peptides from the motif:Nx-(T / I / V / A)-(K / R) (SEQ ID NO: 47), wherein the fusion partner comprises at least one polypeptide or protein. Furthermore, a nucleic acid sequence encoding it is provided.

[0099] In certain embodiments, compositions are provided that include a fusion polypeptide or protein, or a nucleic acid sequence encoding a fusion polypeptide or protein, or nanoparticles containing the same. The composition may further comprise one or more physiologically compatible carriers, excipients, and / or aqueous suspension bases.

[0100] In certain embodiments, nucleic acid sequences encoding fusion polypeptide proteins are encapsulated in lipid nanoparticles (LNPs). As used herein, the terms “lipid nanoparticles” or “nanoparticles” refer to a transport vehicle comprising one or more lipids (e.g., cationic lipids, non-cationic lipids, and PEG-modified lipids). Preferably, the lipid nanoparticles are formulated to deliver one or more nucleic acid sequences to one or more target cells (e.g., liver and / or muscle). Examples of suitable lipids include, for example, phosphatidyl compounds (e.g., phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides). The use of polymers as transport vehicles, either alone or in combination with other transport vehicles, is also intended. Suitable polymers may include, for example, polyacrylates, polyalkylcyanoacrylates, polylactides, polylactide-polyglycolide copolymers, polycaprolactones, dextrans, albumin, gelatin, alginates, collagen, chitosan, cyclodextrins, dendrimers, and polyethyleneimines. In one embodiment, the transport vehicle is selected based on its ability to facilitate the transfection of the nucleic acid sequence encapsulated therein into target cells. Lipid nanoparticles useful for nucleic acid sequences include cationic lipids to enhance the encapsulation and / or delivery of such nucleic acid sequences to target cells that function as depots for protein production. As used herein, the term “cationic lipid” refers to any of several lipid species that carry a net positive charge at a selected pH, e.g., physiological pH. The intended lipid nanoparticles may be prepared by comprising a multi-component lipid mixture of varying ratios using one or more cationic lipids, non-cationic lipids, and PEG-modified lipids. Several cationic lipids are described in the literature, many of which are commercially available. For example, see WO2014 / 089486, US2018 / 0353616A1, and US8,853,377B2, which are incorporated by reference.In certain embodiments, LNP formulation is carried out using a conventional procedure involving cholesterol, ionizable lipids, helper lipids, PEG-lipids, and a polymer that forms a lipid bilayer around the encapsulated nucleic acid sequence (Kowalski et al., 2019, Mol.Ther. 27(4):710-728). In some embodiments, the LNP comprises a cationic lipid having the helper lipid DOPE (i.e., N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA), or 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP)). In some embodiments, the LNP comprises the ionizable lipid Dlin-MC3-DMA, or a diketopiperazine-based ionizable lipid (cKK-E12). In some embodiments, the polymer is polyethylene. This includes aminomines (PEI) or poly(β-amino) esters (PBAE). See, for example, WO2014 / 089486, US2018 / 0353616A1, US2013 / 0037977A1, WO2015 / 074085A1, US9670152B2, and US8,853,377B2, which are incorporated by reference.

[0101] In certain embodiments, rAAVs having a composition, for example, a modified capsid, fusion polypeptide or protein having the Nx-(T / I / V / A)-(SEQ ID NO: 47) peptide and any linker sequence, or a conjugate containing nanoparticles or a chemical moiety, are useful for delivering therapeutic agents to patients in need. In certain embodiments, the method is for targeting the therapy to brain endothelial cells. In certain embodiments, the method is for treating Alan-Herndon-Dudley disease by delivering the MCT8 protein (e.g., UniProt ID No.: P36021) or a gene expressing MCT8 in vivo. In other embodiments, the method is for targeting the therapy to the lungs. In certain embodiments, the delivered product is a soluble Ace2 protein (e.g., hAce2 decoy or hAce2 decoy fusion), an anti-SARS antibody, an anti-SARS-CoV2 antibody, an anti-influenza antibody, or a cystic fibrosis transmembrane protein. See also omim.org / entry / 300523, the contents of which are incorporated herein by reference. See also U.S. Provisional Application No. 63 / 143,614, filed January 29, 2021; U.S. Provisional Application No. 63 / 1650,511, filed March 12, 2021; U.S. Patent Application No. 63 / 166,686, filed March 26, 2021; U.S. Provisional Patent Application No. 63 / 215,159, filed June 25, 2021; and U.S. Provisional Application No. 63 / 253,654, filed October 8, 2021, the contents of which are incorporated herein by reference.

[0102] In certain embodiments, rAAV having the modified capsid described herein may be delivered in a co-therapy regimen further comprising one or more other active ingredients. In certain embodiments, the regimen may include co-administration of immunomodulatory components. Such immunomodulatory regimens may include, but are not limited to, immunosuppressants, such as glucocorticoids, steroids, antimetabolists, T-cell inhibitors, macrolides (e.g., rapamycin or rapalog), and cell proliferation inhibitors, including alkylating agents, antimetabolists, cytotoxic antibiotics, antibodies, or agents active against immunophilins. Immunosuppressants may include nitrogen mustard, nitrosourea, platinum compounds, methotrexate, azathioprine, mercaptopurine, fluorouracil, dactinomycin, anthracyclines, mitomycin C, bleomycin, mitramycin, IL-2 receptor (CD25) specific antibodies or CD3 specific antibodies, anti-IL-2 antibodies, cyclosporine, tacrolimus, sirolimus, IFN-β, IFN-γ, opioids, or TNF-α (tumor necrosis factor-α) conjugates. In certain embodiments, immunosuppressive therapy may be initiated before gene therapy administration. Such therapy may involve the co-administration of two or more drugs on the same day (e.g., prednerisone, mycophenolate mofetil (MMF), and / or sirolimus (i.e., rapamycin)). One or more of these drugs may be continued after gene therapy administration at the same or adjusted doses. Such therapy may last for approximately one week, 15 days, 30 days, 45 days, 60 days, or longer, as needed.Furthermore, other co-therapies include, for example, anti-IgG enzymes, which are described as useful for depleting anti-AAV antibodies (and thus may be administered to patients who are tested to have antibodies above a threshold level against a selected AAV capsid), and / or delivery of anti-FcRN antibodies as described in, for example, U.S. Provisional Patent Application No. 63 / 040,381, filed on 17 June 2020, entitled "Compositions and Methods for Treatment of Gene Therapy Patients," and / or (a) steroids or combinations of steroids, and / or (b) IgG cleavage enzymes, (c) Fc-IgE binding inhibitors, (d) Fc-IgM binding inhibitors, (e) Fc-IgA binding inhibitors, and / or (f) gamma. It may contain one or more interferons.

[0103] The antibody "Fc region" refers to a crystalline fragment that is the region of the antibody that interacts with cell surface receptors (Fc receptors). In one embodiment, the Fc region is human IgG1 Fc. In another embodiment, the Fc region is human IgG2 Fc. In yet another embodiment, the Fc region is human IgG4 Fc. In yet another embodiment, the Fc region is an engineered Fc fragment. For example, see Lobner, Elisabeth, et al. "Engineered IgG1-Fc-one fragment to bind them all." Immunological reviews 270.1 (2016):113-131, and Saxena, Abhishek, and Donghui Wu. "Advances in therapeutic Fc engineering-modulation of IgG-Associated effector functions and serum half-life.”Frontiers in immunology7(2016), Irani, Vashti, et al. “Molecular properties of human IgG subclasses and their implications for designing therapeutic See "Monoclonal antibodies against infectious diseases." Molecular Immunology 67.2(2015):171-182, Rath, Timo, et al. "Fc-fusion proteins and FcRn: structural insights for longer-lasting and more effective therapeutics." Critical reviews in biotechnology 35.2(2015):235-254, and Invivogen, IgG-Fc Engineering For Therapeutic Use, invivogen.com / docs / Insight200605.pdf, April 2006, each of which is incorporated herein by reference.

[0104] The antibody "hinge region" is the flexible amino acid portion of the heavy chain of the IgG and IgA immunoglobulin classes, which connects these two chains via disulfide bonds.

[0105] An "immunoglobulin molecule" is a protein containing immunologically active portions of an immunoglobulin heavy chain and an immunoglobulin light chain that are covalently bonded to each other and can specifically combine with an antigen. An immunoglobulin molecule may be any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), a class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or a subclass. The terms "antibody" and "immunoglobulin" may be used interchangeably herein.

[0106] An "immunoglobulin heavy chain" is a polypeptide comprising at least a portion of the antigen-binding domain of an immunoglobulin and at least a portion of the variable region of the immunoglobulin heavy chain or at least a portion of the constant region of the immunoglobulin heavy chain. Therefore, immunoglobulin-derived heavy chains have regions of significant amino acid sequence homology with members of the immunoglobulin gene superfamily. For example, the heavy chain in the Fab fragment is an immunoglobulin-derived heavy chain.

[0107] An "immunoglobulin light chain" is a polypeptide comprising at least a portion of the antigen-binding domain of an immunoglobulin and at least a portion of the variable region or at least a portion of the constant region of the immunoglobulin light chain. Therefore, immunoglobulin-derived light chains have regions of significant amino acid homology with members of the immunoglobulin gene superfamily.

[0108] "Neutralizing antibody titer" (NAb titer) indicates how much neutralizing antibody (e.g., anti-AAV NAb) is produced that neutralizes the physiological effects of its targeted epitope (e.g., AAV). The measurement is as follows: Anti-AAV NAb titer can be measured as described, for example, in Calcedo, R., et al., Worldwide Epidemiology of Neutralizing Antibodies to Adeno-Associated Viruses. Journal of Infectious Diseases, 2009, 199(3): p.381-390, which is incorporated herein by reference.

[0109] As used herein, a “subpopulation” of vp proteins means, unless otherwise specified, a group of vp proteins having at least one defined common feature and consisting of at least one group member and fewer members than all members of the reference group. For example, a “subpopulation” of vp1 proteins is, unless otherwise specified, at least one vp1 protein and fewer than all vp1 proteins in an assembled AAV capsid. A “subpopulation” of vp3 is, unless otherwise specified, at least one vp3 protein and fewer than all vp3 proteins in an assembled AAV capsid. For example, in an assembled AAV capsid, vp1 proteins may be a subpopulation of vp proteins, vp2 proteins may be another subpopulation of vp proteins, and vp3 may be yet another subpopulation of vp proteins. In another example, the vp1, vp2, and vp3 proteins may comprise subpopulations having different modifications in, for example, at least one, two, three, or four highly deamidated asparagines, e.g., asparagine-glycine pairs. Unless otherwise specified, highly deamidated means at least 45%, at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 97%, 99%, and up to approximately 100% deamidation at the reference amino acid position, compared to the predicted amino acid sequence at the reference amino acid position. Such percentages may be determined using 2D gels, mass spectrometry, or other preferred techniques.

[0110] As used herein, a “stock” of rAAVs refers to a population of rAAVs. Despite the heterogeneity of capsid proteins resulting from deamidation, rAAVs within a stock are expected to share the same vector genome. A stock may include, for example, rAAVs having a capsid with a selected AAV capsid protein and a heterogeneous deamidation pattern characteristic of a selected production system. A stock may be produced from a single production system or pooled from multiple runs of a production system. A variety of production systems may be selected, including but not limited to those described herein. See, for example, WO2019 / 168961, published on September 6, 2019, and WO2020 / 160582, filed on September 7, 2018, including Table G, which provides deamidation patterns for AAV9. See also, for example, WO2020 / 223231 (including the table with rh91, deamide pattern), published on November 5, 2020; U.S. Provisional Patent Application No. 63 / 065,616, filed on August 14, 2020; U.S. Provisional Patent Application No. 63 / 109,734, filed on November 4, 2020; and International Patent Application PCT / US21 / 45945, filed on August 13, 2021, all of which are incorporated herein by reference in their entirety.

[0111] The abbreviation "sc" stands for self-complementary. "Self-complementary AAV" refers to a construct in which the coding region supported by the recombinant AAV nucleic acid sequence is designed to form an intramolecular double-stranded DNA template. Upon infection, rather than waiting for cell-mediated synthesis of the second strand, the two complementary components of scAAV will associate to form a single double-stranded DNA (dsDNA) unit ready for immediate replication and transcription. For example, DM McCarty et al., “Self-complementary recombinant adeno-associated virus ( See “scAAV) vectors promote efficient transduction independently of DNA synthesis”, Gene Therapy, (August 2001), Vol. 8, Number 16, Pages 1248–1254. Self-complementary AAVs are described, for example, in U.S. Patents 6,596,535, 7,125,717, and 7,456,683, each of which is incorporated herein by reference in whole.

[0112] As used herein, the term “operably bound” refers to both an expression regulatory sequence that is continuous with the gene of interest and an expression regulatory sequence that acts in or away from the gene of interest to regulate the gene of interest.

[0113] When used in reference to proteins or nucleic acids, the term “heterogeneity” indicates that a protein or nucleic acid contains two or more sequences or subsequences that are not found in the same relationship to each other in nature. For example, nucleic acids having two or more sequences from unrelated genes arranged to create a novel functional nucleic acid are typically produced by recombination. For example, in one embodiment, a nucleic acid has a promoter derived from one gene, which is arranged to direct the expression of a coding sequence from a different gene. Thus, with respect to the coding sequence, the promoter is heterogeneous.

[0114] A “replication-deficient virus” or “viral vector” refers to a synthetic or artificial viral particle in which an expression cassette containing the gene of interest is packaged within a viral capsid or envelope. Any viral genome sequence packaged within the viral capsid or envelope is replication-deficient; that is, it cannot produce progeny virions but retains the ability to infect target cells. In one embodiment, the genome of the viral vector does not contain genes encoding enzymes required for replication (the genome can be manipulated to be “gutless,” containing only the target transgene adjacent to the signals required for amplification and packaging of the artificial genome), but these genes can be supplied during production. Therefore, replication and infection by progeny virions cannot occur without the presence of the viral enzymes required for replication, and thus it is considered safe for use in gene therapy.

[0115] "Recombinant AAV" or "rAAV" is a DNAse-resistant viral particle comprising two elements: an AAV capsid and a vector genome containing at least a non-AAV coding sequence packaged within the AAV capsid. In certain embodiments, the capsid contains approximately 60 proteins, consisting of vp1, vp2, and vp3 proteins, which self-assemble to form the capsid. Unless otherwise specified, "recombinant AAV" or "rAAV" may be used interchangeably with the term "rAAV vector." rAAV is a "defective replication virus" or "viral vector" because it lacks any functional AAV rep gene or functional AAV cap gene and cannot produce offspring. In certain embodiments, the sole AAV sequence is an AAV inverted terminal repeat (ITR), typically located at the 5' and 3' ends of the vector genome to allow genes and regulatory sequences located between the ITRs to be packaged within the AAV capsid.

[0116] The term "nuclease resistance" indicates that the AAV capsid is constructed around an expression cassette designed to deliver the transgene to the host cell, protecting these packaged genomic sequences from degradation (digestion) during the nuclease incubation step, which is designed to remove any contaminating nucleic acids that may be present in the production process.

[0117] As used herein, “vector genome” refers to the parvox that forms the viral particle. This refers to a nucleic acid sequence packaged inside an rAAV (e.g., rAAV) capsid. Such a nucleic acid sequence includes an AAV inverted terminal repeat (ITR). In the examples herein, the vector genome includes, at least from 5' to 3', an AAV5'ITR, a coding sequence (i.e., a transgene), and an AAV3'ITR. An ITR from AAV2, an AAV from a different source than the capsid, or something other than a full-length ITR may be selected. In certain embodiments, the ITR is from the same AAV source as the AAV that provides the rep function or trans-complementary AAV during production. Furthermore, other ITRs, such as self-complementary (scAAV) ITRs, may be used. Both single-stranded AAVs and self-complementary (sc)AAVs are included in rAAVs. The transgene is a nucleic acid coding sequence heterogeneous to the vector sequence that codes for the polypeptide, protein, functional RNA molecule (e.g., miRNA, miRNA inhibitor), or other gene product of interest. The nucleic acid coding sequence is operably bound to a regulatory element in a manner that enables transcription, translation, and / or expression of the transgene in cells of the target tissue. Preferred components of a vector genome are discussed in more detail herein. In one example, a “vector genome” contains, at a minimum, a vector-specific sequence and a nucleic acid encoding the target protein operably bound to a regulatory element (which directs their expression in the target sequence) from at least 5' to 3', where the vector-specific sequence may be a terminal repeat sequence that specifically packages the vector genome to a viral vector capsid or envelope protein. For example, the AAV inverted terminal repeat is used to package AAV and certain other parvovirus capsids.

[0118] As used herein, “operably bound” sequences include both expression regulatory sequences that are sequential to the gene of interest and expression regulatory sequences that act in trans or detached to control the gene of interest.

[0119] In certain embodiments, the non-viral genetic element used in the production of rAAV is referred to as a vector (e.g., a production vector). In certain embodiments, these vectors are plasmids, but the use of other suitable genetic elements is contemplated. Such a production plasmid may encode a sequence expressed during rAAV production, for example, an AAV capsid or rep protein necessary for rAAV production that is not packaged in rAAV. Alternatively, such a production plasmid may carry a vector genome that is packaged in rAAV.

[0120] As used herein, “parental capsid” refers to an unmutated or unmodified capsid selected from a parvovirus or other virus (e.g., AAV, adenovirus, HSV, RSV, etc.). In certain embodiments, the parental capsid includes any naturally occurring AAV capsid containing a wild-type genome encoding a capsid protein (i.e., a vp protein), the capsid protein directing AAV transduction and / or tissue-specific tropism. In some embodiments, the parental capsid is selected from an AAV that naturally targets the CNS. In other embodiments, the parental capsid is selected from an AAV that does not naturally target the CNS.

[0121] As used herein, “variant capsid” or “variant AAV” or “variant AAV capsid” refers to a modified or mutated capsid, where the capsid protein includes the insertion of a tissue-specific targeted peptide.

[0122] As used herein, “expression cassette” refers to a nucleic acid molecule comprising a biologically useful nucleic acid sequence and a regulatory sequence operably bound to the nucleic acid sequence (e.g., a gene cDNA encoding a protein, enzyme, or other useful gene product, such as mRNA) and the transcription, translation, and / or expression of the gene product. As used herein, “operably bound” sequence includes both regulatory sequences that are continuous or discontinuous with the nucleic acid sequence and regulatory sequences that act in trans or cis nucleic acid sequences. A segment sequence typically includes one or more of the following: promoters, enhancers, introns, Kozak sequences, polyadenylated sequences, and TATA signals. Among other elements, an expression cassette may include one or more upstream (5'~) regulatory sequences of the gene sequence, such as promoters, enhancers, and introns, and one or more downstream (3'~) regulatory sequences of the gene sequence, such as enhancers or 3' untranslated regions (3'UTRs) containing polyadenylated sites. In certain embodiments, the regulatory sequences are operably bound to the nucleic acid sequence of the gene product, and the regulatory sequences are separated from the nucleic acid sequence of the gene product by an intervening nucleic acid sequence, i.e., a 5' untranslated region (5'UTR). In certain embodiments, the expression cassette includes the nucleic acid sequences of one or more gene products. In some embodiments, the expression cassette may be a monocistronic or bicistronic expression cassette. In other embodiments, the term “transgene” refers to one or more DNA sequences from an exogenous source inserted into a target cell.

[0123] In the context of this invention, the term "translation" refers to a process in ribosomes in which an mRNA chain controls the assembly of amino acid sequences to produce a protein or peptide.

[0124] The term "expression" is used herein in its broadest sense and includes RNA products, or RNA and protein products. Expression may be transient or stable.

[0125] The terms "substantial homology" or "substantial similarity," when referring to a nucleic acid or a fragment thereof, indicate that when optimally aligned with another nucleic acid (or its complementary strand) by appropriate nucleotide insertions or deletions, the aligned sequence has at least about 95–99% nucleotide sequence identity. Preferably, the homology is across the full-length sequence, or its open reading frame, or another suitable fragment of at least 15 nucleotides in length. Examples of suitable fragments are described herein.

[0126] In the context of nucleic acid sequences, the terms “sequence identity,” “percent sequence identity,” or “percent identical” refer to residues in two sequences that are identical when aligned to the greatest extent possible. The length of the sequence identity comparison may be, and is preferable, over the entire genome, the entire gene coding sequence, or a fragment of at least about 500 to 5000 nucleotides. However, identity between smaller fragments of, for example, at least about 9 nucleotides, typically at least about 20 to 24 nucleotides, at least about 28 to 32 nucleotides, or at least about 36 or more nucleotides may also be desirable. Similarly, “percent sequence identity” can be readily determined for the entire amino acid sequence of a protein or a fragment thereof. Preferably, the fragment is at least about 8 amino acids long and may be up to about 700 amino acids long. Examples of preferred fragments are described herein.

[0127] The terms "substantial homology" or "substantial similarity," when referring to a nucleic acid or a fragment thereof, indicate that when optimally aligned with another nucleic acid (or its complementary chain) by appropriate amino acid insertions or deletions, the aligned sequence has at least about 95–99% amino acid sequence identity. Preferably, the homology extends over the full-length sequence or the protein thereof, for example, an immunoglobulin region or domain, an AAV capsid, or a fragment thereof that is at least 8 amino acids, or more preferably at least 15 amino acids long. Examples of suitable fragments are described herein.

[0128] The term "highly preserved" means at least 80% identity, preferably at least 90% identity, and more preferably more than 97% identity. Identity can be readily determined by those skilled in the art by relying on algorithms and computer programs known to those skilled in the art.

[0129] Generally, when referring to “identity,” “homology,” or “similarity” between two different adeno-associated viruses, “identity,” “homology,” or “similarity” is determined by referring to “aligned” sequences. “Aligned” sequences or “alignment” refer to multiple nucleic acid sequences or protein (amino acid) sequences, often including corrections for missing or additional bases or amino acids compared to a reference sequence. Alignment is performed using one of various publicly or commercially available multiple sequence alignment programs. Examples of such programs include “Clustal Omega,” “Clustal W,” “CAP Sequence Assembly,” “MAP,” and “MEME,” which are accessible through web servers on the Internet. Other sources of such programs are known to those skilled in the art. Alternatively, the Vector NTI utility is also used. Furthermore, several algorithms known in the art exist, including those included in the programs described above, and can be used to measure nucleotide sequence identity. As another example, polynucleotide sequences can be compared using Fasta®, a program from GCG version 6.1. Fasta® provides the best overlap region alignment and sequence identity percentage between query and search sequences. For example, percentage sequence identity between nucleic acid sequences can be determined using Fasta® with its default parameters (word size 6 and NOPAM factor for scoring matrix) provided in GCG Version 6.1, which is incorporated herein for reference. Several sequence alignment programs for amino acid sequences are also available, such as the “Clustal X”, “MAP”, “PIMA”, “MSA”, “BLOCKMAKER”, “MEME”, and “Match-Box” programs. Generally, one of these programs is used with its default settings, but those skilled in the art may change these settings as needed.Alternatively, a person skilled in the art may utilize another algorithm or computer program that provides at least the same level of identity or alignment as that provided by the algorithm and program of reference. See, for example, JDThomson et al, Nucl. Acids. Res., “A comprehensive comparison of multiple sequence alignments”, 27(13):2682-2690 (1999).

[0130] The effective dose may be determined based on animal models rather than human patients.

[0131] As stated above, unless otherwise specified, the term “approximately” means a variation of ±10% from a given reference (e.g., ±1, ±2, ±3, ±4, ±5, ±6, ±7, ±8, ±9, ±10, or values ​​in between).

[0132] In certain cases, the term "E+#" or "e+#" is used to refer to an exponent. For example, "5E10" or "5e10" means 5 × 10⁻¹⁰ 10 These terms can be used synonymously.

[0133] As used throughout this specification and the claims, the terms “comprise,” “contain,” and variations thereof including “comprises,” “comprising,” “contains,” and “containing,” include other components, elements, integers, steps, etc. The terms “consists of” or “consisting of” exclude other components, elements, integers, steps, etc.

[0134] The terms "a" or "an" refer to one or more, for example, "enhancer (an It should be noted that "enhancer)" refers to one or more enhancers. Therefore, the terms "a" (or "an"), "one or more," and "at least one" are used interchangeably in this specification.

[0135] With regard to the description of these inventions, each of the compositions described herein is intended to be useful in the methods of the present invention in a different embodiment. In addition, each of the compositions described herein that is useful in the methods is also intended to be an embodiment of the present invention in a different embodiment.

[0136] Unless otherwise defined herein, the technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention pertains, and by referring to published documents that provide general guidance to those skilled in the art for many of the terms used herein. [Examples]

[0137] The following examples are for illustrative purposes only and do not limit the inventions described herein.

[0138] Example 1. Primary Screening Small peptide insertions into flexible loops on the surface of AAV capsids have been shown to mediate interactions with novel cell receptors. In one example discovered at CalTech (AAV9-PHP.B), a seven-amino acid peptide inserted into the HVR8 loop on AAV9 mediates interaction with Ly6a, a GPI-anchored receptor on the vascular structure of brain cells in several mouse strains. This interaction drives the transport of AAV9-PHP.B across the blood-brain barrier (BBB), resulting in approximately 50-fold higher transduction of brain cells than AAV9 alone. In this study, we search for peptide insertions that can bind to cell membrane targets on the BBB and thus have the potential to drive AAV9 capsids across the BBB.

[0139] We attempted to solve the AAV-BBB problem by first investigating available academic and patent literature regarding peptide sequences that may have the potential to interact with vascular cells in the brain. We found the following sources for these peptides: • Published results of phage display experiments in which phage display libraries were panned against primary brain endothelial cells. • Natural ligand peptides for known BBB (Bloody BB) membrane proteins, • CDR of antibodies targeted by BBB (branched-barrel) membrane proteins, • The viral coat protein of flaviviruses that cause encephalitis, and • Bacterial toxins with cell-binding activity targeting GPI anchoring.

[0140] We generated a library of AAV9 insertion mutants containing hundreds of peptides from these sources, all individually inserted at the HVR8 locus (between positions 588 and 589, based on the amino acid sequence numbering of the AAV9 capsid in SEQ ID NO: 44). Each peptide was present in the library in multiple forms, typically differing by 1) the length of the inserted peptide and 2) the presence of flexible GSG or GG linker sequences on both sides of the peptide. The peptides were also encoded using multiple synonymous codons, so we were able to independently observe their replication activity in screening.

[0141] In addition, we have found that AAVhu68 capsids possessing either known or suspected ligand peptides that target the blood-brain barrier (BBB) ​​receptor (between positions 588 and 589, based on the amino acid sequence numbering of AAVhu68 capsid in SEQ ID NO: 45) are HV A library of insertion variants in R8 has been generated. These include: ●Peptides that bind to mammalian brain endothelium (published phage display data), ● Classical RMT receptor ligands (e.g., Tf), ● CDR of mAbs against RMT receptors (e.g., anti-TfR), and ●It was the coat protein of a flavivirus that causes encephalitis.

[0142] As a control, the PHP.B peptide was also included (positive control for C57 / BL6 and negative control for Balb / c&NHP). Each peptide was encoded in multiple ways (with and without linkers, and in several synonymous DNA sequences).

[0143] We injected this library at high doses intravenously (IV) into two mouse strains and one non-human primate. After a survival period of 2-3 weeks, the animals were necropsied and tissues were collected. We extracted the DNA genome of the AAV vector from the CNS and other tissues and subjected them to next-generation sequencing (NGS). The vector variants capsidize their own unique capsid gene variants, allowing us to track capsid activity through the relative abundance of the capsid gene variant in the tissue of interest. We scored the BBB activity ("enrichment score") of each variant in the library by calculating its abundance in the CNS normalized against its abundance in the injected library mixture.

[0144] In mouse studies, the best-enriching HVR8 insert in C57 / BL6 mice was TLAVPFK (SEQ ID NO: 49) (PHP.B), with the positive control PHP.B appearing independently three times as the most enriched hit. Three of the PHP.B peptides with synonymous codons are independently enriched. Several other peptides are also enriched in the brain. Figures 1A and 1B show the enrichment scores of the best-performing mouse brain hits in screening, along with the reference peptide (Figure 1A for C57BL / 6J mice, Figure 1B for Balb / c mice). Figures 2A and 2B show the enrichment scores of the best-performing NHP brain (Figure 2A) and spinal cord (Figure 2B) tissues. [Table 1]

[0145] Example 2. Secondary validation We tracked primary screening in mice by generating GFP reporter vectors for several hit capsids. The vectors were injected into C57BL / 6J mice at high doses IV. Two weeks later, we necropped the mice and collected GFP images of brain sections (data not shown). All hit vectors tested in the GFP study were delocalized from the liver, as evident from liver GFP staining (data not shown).

[0146] Higher magnification imaging revealed that capsid SSN and SAN were significantly localized in the brain but restricted to the endothelium. RCA-lectin was a co-staining marker for brain endothelial cells in these sections (data not shown). These results indicate that the AAV capsids identified in the screening are BBB receptor-binding but do not cross the BBB. A series of mutants showed a range of affinities for the Ly6a receptor. Brain transduction levels decreased in correlation with the observed stronger affinity binding of the peptide to the Ly6a receptor. The observed strong binding reduced transduction, likely due to the genome being fused in the endothelium.

[0147] This endothelial localization may be useful for certain diseases. Furthermore, this activity can be optimized to convert these from brain localization to blood-brain barrier (BBB) ​​cross-pathport vectors. We confirmed the BBB cross-passing and brain localization activity of these barcoded vectors in barcoded vector studies. Briefly, we individually produced vectors containing a GFP reporter gene with a unique DNA barcode using each capsid. The barcoded capsid preparations were mixed in equal proportions and injected into C57BL / 6J or Balb / c mice (Figures 3A-3D). At the end of survival, mouse tissue was subjected to NGS sequencing to count the abundance of each barcode in the vector genome extracted from the tissue. The results confirmed brain localization of the vector genome for all hit capsids identified in the primary screening. In Balb / c mice, secondary validation screening showed brain targeting for all hit sequences found in the primary screening (Figure 3A). In C576BL / 6 mice, secondary validation screening showed brain targeting for all hit sequences found in the primary screening (Figure 3B). In both Balb / c and C57BL / 6 mice, hepatic detargeting of all hit sequences was consistent with affinity for cerebral vascular structures compared to AVA9 (Figures 3C and 3D).

[0148] Example 3. Endothelial-targeting sequence. A barcode study was conducted for secondary validation of NHP (National Health Programme). The study involved 4.5 × 10⁶ barcodes taken 21 days after birth. 13 The study was conducted in two NHPs using injection mixtures of 27 barcoded vectors, including AAV9, at GC / kg. Whole brain tissue homogenates were analyzed. Some vectors showed modestly improved vector biodistribution, but none showed improved whole-brain transduction. Accumulation of vector genomes in the brain (DNA) and expression of vector-derived transcripts (mRNA) were poorly correlated (Table 2). We observed poor mRNA-to-DNA correlation for endothelial-targeting vectors. [Table 2]

[0149] Table 3 below shows the mean relative localization scores for both NHPs in the barcode study, normalized for AAV9 (equal to 1). In line with the brain-focused library design, most vectors exhibit unremarkable localization in non-brain tissues. An exception to this is vector PMK, which significantly relocalized to the spleen compared to both NHPs. [Table 3]

[0150] Table 4 below shows that endothelial hits share a common in vitro transduction profile (measured in 293 transductions) and a common production profile. Importantly, all vectors with endothelial targeting activity show a dramatic increase in relative abundance in the AAV vs. plasmid library as measured by NGS. [Table 4]

[0151] A mutant library of SAN peptides confirms the role of the "NxTK" motif in brain targeting. In this study, all possible single amino acid changes were made to the SAN inserts, and optimized library variants were injected into mice, and in vivo analysis of each variant was performed. Fabric and yield scores were measured. The “NxTK” motif is a key motif for the in vivo distribution of brain in SAN inserts (Table 5 and Figure 5). The “NxTK” motif controls plasmid-to-AAV conversion in SAN peptide inserts (Table 6 and Figure 6). Furthermore, the “NxTK” motif was associated with three properties of these endothelial vectors in the “NxTK” class: endothelial cell transduction, improved 293 cell transduction, and the ability to proliferate during library production. Figures 7A–7D show that the “NxTK” motif confers broad transduction advantages across cell lines. Relative transduction levels were improved when compared to AAV9 capsid in 293 cells (Figure 7A), NIH3T3 cells (Figure 7B), and HUH7 cells (Figure 7C). Figure 7D shows a significant early improvement in transduction at 3 days post-transduction (3DPT) and approximately 10-fold improvement by 7 days post-transduction (7DPT). AAV-GFP vectors containing EFS and SAN peptide inserts showed improved transduction when primary macaque airway epithelial cells were transduced (Figures 7E-7H). [Table 5] [Table 6]

[0152] In summary, all selected amino acid sequences listed in Table 7 contain the functional motif Nx-(T / I / V / A)-(K / R) motif (SEQ ID NO: 47). Beyond the selected sequences shown in Table 7, others were identified during screening. We have data supporting that many substitutions for these insertion sequences also support, or even improve, endothelial targeting activity. In addition, we discovered approximately several thousand sequences that fit this motif from a large, random insertion library—all of which are likely to share improved transduction properties. [Table 7]

[0153] We completed barcode evaluation of primary screening hits in NHP. Brain localization was the most prominent feature of hits from this library, with no significant enhancement in targeting of peripheral tissues, except for spleen targeting by AAV9-PMK. We defined a sequence motif common to all peptide inserts with endothelial targeting activity. We confirmed the activity of this motif in conferring endothelial targeting and broad in vitro transduction benefits. The single sequence motif "NxTK" defines inserts from four unrelated sources that share three properties: (1) Dramatically improved in vitro transduction on 293 and other cell lines, (2) Parasitic growth-"spread" phenotype during library production, and (3) In vivo endothelial distribution in mice and NHP.

[0154] The "NxTK" motif was mapped in systemic mutation screening of SAN and EFS vector insertions. Systemic mutation screening showed that the "NxTK" motif is important for its intracellular distribution in the brain endothelium and its abundance in library production. Plasmid-to-AAV conversion, which represents capsid yield during library production, is controlled by two factors: the presence of parasitic diffusion motifs (major factor) and endogenous capsid yield (minor factor). One of the diffusion motifs was identified as "NxTK," which interacts with the 293 cell surface receptor and is likely to confer transduction advantages. Transduction advantages in 293 occur because library production restricts Cap, potentially leading to the propagation of the vector genome (Cap) to adjacent cells during production; therefore, most cells initially possess all but the Cap gene. The minor factor was only revealed after digital filtering of vectors containing parasitic diffusion motifs.

[0155] Example 4. Operational Strategy for the Development of AAV Capsids for Airway Delivery Current AAV vectors inadequately transduce cells in the nasal cavity and upper respiratory tract, limiting the effectiveness of prophylactic AAV strategies for protection against upper respiratory tract infectious diseases such as influenza or COVID-19. This project aims to manipulate AAV capsids for improved transduction of these tissues, specifically pursuing directed evolution and receptor targeting strategies. Manipulation strategies pursued for AAV airway-specific capsid selection are not limited to these, but include inserts (10 3 ~10 9 The process consists of steps including generating a diverse library of constructs with initial diversity, screening and selection in primary primate or human airway cells, identifying genomic identity (DNA or RNA) of the selected constructs, and conducting additional screening to converge on hits and confirm the validity of improved capsid hits in NHP. Sources of capsid diversity for airway delivery are obtained through two approaches: an unbiased approach and a biased approach. It consists of pursuing the goal. In an unbiased approach, random peptides are inserted into the surface of the AAV capsid, and 10 7 This generates a large library that exceeds variant diversity. In an unbiased approach, peptides with known or suspected airway cell binding activity are inserted into AAV capsids, resulting in approximately 10 3Generate a small library with variant diversity. Sources of such known or suspected airway cell-binding peptides: published phage display results, peptides from viral receptor-binding domains, known ligands to airway receptors, and peptides generated in previous in vitro library screening. For screening of in vitro-generated capsid libraries, an assay in primary airway cells in a gas-liquid interface (ALI) culture is used. The cells used are from human and macaque, and are composed of cells from the nose, trachea, and bronchus. Preliminary transduction tests with GFP vectors in macaque primary airway epithelial cell cultures showed significant early improvements in the transduction of EFS and SAN insertion peptides into AAV capsids (Figures 7D and 7E - 7H). Figure 7E shows a microscopic analysis of macaque primary airway epithelial cells in a control sample treated with a carrier (i.e., without a vector). Figure 7F shows a microscopic analysis of macaque primary airway epithelial cells after transduction with an AAV9-GFP vector. Figure 7G shows a microscopic analysis of macaque primary airway epithelial cells after transduction with an AAV9-GFP vector containing an EFS peptide insertion. Figure 7H shows a microscopic analysis of macaque primary airway epithelial cells after transduction with AAV9-GFP containing a SAN peptide insertion. Preliminary transduction tests with GFP vectors in cultured human cells showed overall lower transduction. On day 7, the equivalent copy number of mRNA relative to total mRNA in micrograms was 1×10 4 (Figure 8) in cultured macaque primary airway epithelial cells and 1×10 6 (Figure 7D) in cultured human cells. The SAN motif showed an advantage in transduction on day 7 when compared with AAV9 transduction (Figure 8). The EFS motif showed less efficient transduction in bronchus and trachea cultured human cells (Figure 8).

[0156] Furthermore, we developed numerous insertion sequences through an in vitro selection scheme for other projects that confer dramatically improved cell binding and transduction activity. The generated AAV insertion vectors were tested against ALI cultures in a barcoded pool. The results showed that all in vitro selected AAV9 insertion vectors performed better than the AAV9 vector (results not shown). Specifically, the Spr3L(NxTK) AAV9 insertion vector was the best in comparison, showing approximately 50 times better transduction than the AAV9 capsid.

[0157] (Sequence Listing Free Text) The following information is a numerical identifier <223> Provides an array containing free text below. [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4] [Table 8-5] [Table 8-6] [Table 8-7] [Table 8-8] [Table 8-9] [Table 8-10] [Table 8-11]

[0158] All documents referenced herein are incorporated herein by reference. U.S. Provisional Application No. 63 / 119,863, filed December 1, 2020, is incorporated herein by reference in its entirety. The sequence listing filed herein under the name "20-9409PCT_ST25," and the sequences and text therein, are incorporated herein by reference. While the present invention has been described with reference to certain embodiments, it will be understood that modifications can be made without departing from the spirit of the invention. Such modifications are intended to be included within the scope of the appended claims.

Claims

1. 1. A recombinant adeno-associated virus particle (rAAV) having a capsid comprising an amino acid sequence comprising the motif N-x-(T / I / V / A)-(K / R) (SEQ ID NO:47), wherein said amino acid sequence is at least a portion of an AAV vp3 protein in said capsid, and wherein a vector genome packaged in said capsid comprises a nucleic acid sequence encoding a gene product under the control of a sequence directing its expression, with the proviso that said capsid is not a mutant AAV2 capsid comprising the sequence NDVRAVS (SEQ ID NO:48).

2. 2. The rAAV of claim 1, wherein the amino acid sequence includes an N-x-(T / I / V / A)-(K / R) motif, optionally flanked by 2 amino acids to 7 amino acids at the amino and / or carboxy terminus of the motif, is inserted into the AAV capsid vp3 region.

3. 2. The rAAV of claim 1, wherein the motif N-x-(T / I / V / A)-(K / R) (SEQ ID NO:47) is optionally flanked by 2 to 7 amino acids at its carboxy and / or amino terminus and is inserted between amino acids 588 and 589 of the AAV9 capsid protein, based on the numbering of the amino acid sequence: SEQ ID NO:

44.

4. 1. An endothelial cell targeting peptide, said endothelial cell targeting peptide comprising a motif comprising the amino acid sequence of N-x-(T / I / V / A)-(K / R) (SEQ ID NO:47), optionally flanked by 2 amino acids to 7 amino acids at the amino and / or carboxy terminus of said motif, and optionally further conjugated to a nanoparticle, a second molecule, or a viral capsid protein.

5. The endothelial cell targeting peptide is (a) SSNTVKLTSGH (SEQ ID NO: 40); (b) EFSSNTVKLTS (SEQ ID NO: 38); (c) GGVLTNIARGEYMRGG (SEQ ID NO: 46), (d) GGIEINATRAGTNLGG (SEQ ID NO: 43); (e) GGSSNTVKLTSGHGG (SEQ ID NO: 39); (f) IEINATRAGTNL (SEQ ID NO: 42), or (g) an rAAV of claim 1 or 2, or an endothelial cell targeting peptide of claim 4, comprising SANFIKPTSY (sequence number 41).

6. 6. The rAAV of claim 1, 2 or 5, or the endothelial cell targeting peptide of claim 4 or 5, wherein the amino acid sequence of the motif is NTVK. (a) an rAAV according to any one of claims 1 to 3, 5 or 6, or (b) a composition comprising an endothelial cell targeting peptide according to any one of claims 4 to 6, and one or more of a physiologically compatible carrier, excipient, and / or aqueous suspension base.

8. A fusion polypeptide or protein comprising a brain endothelial cell targeting peptide according to any one of claims 4 to 6 and a fusion partner comprising at least one polypeptide or protein.

9. A composition comprising the fusion polypeptide or protein of claim 8 and one or more of a physiologically compatible carrier, excipient, and / or aqueous suspension base.

10. An rAAV according to any one of claims 1 to 3, 5 or 6, an endothelial cell targeting peptide according to any one of claims 4 to 6, or a fusion polypeptide or protein according to claim 8, or a composition according to claim 7 or 9, for use in delivering therapy to a patient in need thereof.

11. 6. The rAAV of any one of claims 1 to 5 for use in a method for targeted therapy to brain endothelial cells, wherein the rAAV is administered to a patient in need thereof.

12. 10. The rAAV of any one of claims 1 to 3, 5 or 6 for use in treating Allan Herndon Dudley disease, wherein the rAAV is delivered to a subject in need thereof and the encoded gene product is MCT8 protein.

13. The method according to claims 1 to 3, 5 or 6 for use in a method for targeted therapy to the lungs.

7. The rAAV of any one of claims 6, wherein the rAAV is administered to a patient in need thereof.

14. 10. The rAAV of any one of claims 1 to 3, 5 or 6 for use in treating a lung disease, wherein the rAAV is delivered to a subject in need thereof and the encoded gene product is a soluble Ace2 protein, an anti-SARS antibody, an anti-SARS-CoV2 antibody, an anti-influenza antibody, or a cystic fibrosis transmembrane protein.

15. An rAAV described in any one of claims 1 to 3, 5 or 6 for the manufacture of a pharmaceutical for the treatment of Allan-Herndon-Dudley disease, wherein the encoded gene product is MCT8 protein.

16. An rAAV as described in any one of claims 1 to 3, 5 or 6 for the manufacture of a medicament for the treatment of a pulmonary disease, wherein the encoded gene product is a soluble Ace2 protein, an anti-SARS antibody, an anti-SARS-CoV2 antibody, an anti-influenza antibody, or a cystic fibrosis transmembrane protein.

17. A method for increasing transduction of AAV producing cells in vitro, comprising inserting an N-x-(T / I / V / A)-(K / R) (SEQ ID NO:47) motif into an AAV capsid, optionally wherein the producing cells are 293 cells.

18. A recombinant nucleic acid molecule, the nucleic acid sequence encoding an AAV capsid comprising an amino acid sequence including the motif N-x-(T / I / V / A)-(K / R) (SEQ ID NO:47), wherein said amino acid sequence is at least a portion of an AAV vp3 protein in said capsid, with the proviso that said capsid is not a mutant AAV2 capsid comprising the sequence NDVRAVS (SEQ ID NO:48).

19. A plasmid comprising the recombinant nucleic acid molecule described in claim 18.

20. A method for producing recombinant adeno-associated virus (rAAV) particles in a packaging host cell, comprising culturing a packaging host cell containing: (a) a recombinant nucleic acid molecule comprising a vector genome comprising a nucleic acid sequence encoding a gene product under the control of sequences directing the expression thereof; (b) a recombinant nucleic acid molecule encoding an AAV rep protein; (c) a recombinant nucleic acid molecule of claim 18 encoding an AAV capsid; and (d) helper sequences sufficient to package an expression cassette into the AAV capsid, wherein the packaging host cell expresses the rep and capsid proteins to package the expression cassette into an assembled capsid to produce rAAV particles.

Images