Lipid nanoparticles for delivering nucleic acids and related methods of use - Patent Application 20070122997

JP2023553343A5Active Publication Date: 2026-03-13AKAGERA MEDICINES INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2021-11-24
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

Existing ionizable cationic lipids used in lipid nanoparticles (LNPs) for nucleic acid delivery are susceptible to oxidative degradation during storage, compromising their stability and efficacy.

Method used

Development of cationic lipids with polyene hydrocarbon chains separated by at least two methylene groups, which reduces oxidative degradation by up to 95% compared to controls, maintaining high transfection activity.

Benefits of technology

The modified cationic lipids enhance the stability and potency of LNPs, ensuring effective delivery of nucleic acids while minimizing oxidative byproducts.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present disclosure provides an improved composition of ionized lipid nanoparticles for delivering therapeutic nucleic acids to cells. The cationic ionized lipids are engineered to improve stability against oxidative degradation during storage while retaining high intracellular transfection activity or efficacy. These lipids are designed to be biodegradable, thereby improving the tolerability of the nanoparticles formed by them in vivo. In addition, the inclusion of antibody conjugates against cell surface receptors provides highly specific targeting of these nanoparticles to dendritic cells.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related Applications This patent application claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 118,534, filed November 25, 2020, the entire contents of which are incorporated herein by reference.

[0002] Sequence Listing Reference This specification includes a Sequence Listing submitted herewith, including a file entitled 191016-010403_ST25.txt, created on November 24, 2021, and having a size of 7,061 bytes, the contents of which are incorporated herein by reference.

[0003] Field The present disclosure relates to cationic ionizable lipids and lipid nanoparticles (LNPs). In some embodiments, LNPs comprising one or more cationic ionizable lipids are useful for targeting dendritic cells or delivering nucleic acid compounds for the method of using these LNP compositions as vaccines. In some embodiments, LNPs may comprise bioreducible ionizable cationic lipids or non-conjugated polyolefinic ionizable cationic lipids. [Background technology]

[0004] Lipid nanoparticles (LNPs) are used to deliver therapeutic nucleic acids into cells. For example, LNP pharmaceutical compositions are used in vaccines to deliver mRNA therapeutics. LNP formulations typically contain ionizable cationic lipids (ICLs). However, it is known in the art that certain ICL compounds are undesirably susceptible to oxidation during storage. Therefore, there is a need for improved ICL compounds that have improved stability against oxidative degradation during storage, while also providing desirable transfection activity or efficacy in cells when incorporated into LNPs with therapeutic agents such as nucleic acids.

[0005] SNALP compositions are useful for delivering nucleic acid therapeutics for various infectious diseases. Infectious diseases such as tuberculosis, HIV / AIDS, malaria, and COVID-19 pose serious challenges to human health. For example, Mycobacteria is the bacterial genus responsible for tuberculosis (TB). According to the World Health Organization, TB is one of the top ten causes of death worldwide and is the leading cause of death from a single pathogen. Despite current best efforts, the development of effective vaccines for the prevention of many infectious diseases has presented significant challenges. New efforts in identifying individual antigenic peptides or combinations of antigenic peptides have helped improve vaccine efficacy. Nevertheless, great potential remains in engineering adjuvants to aid in the efficient delivery and presentation of these antigenic sequences to professional antigen-presenting cells, such as dendritic cells. mRNA coding of antigenic peptides or proteins in combination with ionized cationic lipid nanoparticles represents a particularly promising strategy for vaccine development. Safe and effective therapies involving SNALP pharmaceutical compositions (including vaccine compositions) for the delivery of mRNA for the treatment and prevention of various diseases are needed. Summary of the Invention

[0006] In some embodiments, ionizable cationic lipids (ICLs) are provided. The cationic lipids are engineered to improve stability against oxidative degradation during storage while retaining high intracellular transfection activity or potency. Aspects of the present disclosure are based in part on the discovery that undesirable oxidation and / or degradation of ionizable lipids having polyene chains can be improved by including two or more methylene groups between a pair of alkynyl double bonds. The lipids disclosed herein include at least two carbon-carbon double bonds (olefins) spaced apart by at least two methylene or substituted methylene groups, where the substituted methylene groups are C(R1)(R2)-, where R1 and R2 are independently H, alkyl, or halogen. The lipids disclosed herein include two symmetrical polyene hydrocarbon chains, each with two carbon-carbon double bonds (olefins) on either side of two, three, or four methylene groups. The olefins in the lipid tail separated by at least two methylene groups make the compounds described herein highly resistant to oxidation, compared to compounds separated by one methylene group, such as DLin-MC3-DMA, which is considered the gold standard in ionizable cationic lipid design and has been reported to have stability issues. In some embodiments, the compounds provided herein have a greater than 30%, 50%, 75%, 90%, and 95% reduction in oxidation by-products compared to control LNPs containing DLin-KC2-DMA lipids. In some embodiments, the compounds provided herein have a greater than 30%, 50%, 75%, 90%, and 95% reduction in oxidation by-products compared to control LNPs containing DLin-KC2-DMA lipids.

[0007] In some embodiments, an ionizable cationic lipid composition is provided. In some embodiments, the ionizable cationic lipid can comprise two polyene hydrocarbon chains, each of which comprises one or two alkenyl double bond moieties. In some embodiments, the ionizable cationic lipid can comprise two polyene hydrocarbon chains, each of which comprises two or more methylene groups between the two alkenyl double bond moieties. In some embodiments, the ionizable cationic lipid can comprise two C 16 or C 18 It may contain polyene hydrocarbon chains.

[0008] In some embodiments, a pair of linear polyenes C each containing an unsaturated linear ethylene, n-propylene, or n-butylene between two adjacent unsaturated alkynyl double bonds in each polyene hydrocarbon chain. 16 or C 18 Liposome compositions are provided that include ionizable cationic lipids with hydrocarbon chains. In some embodiments, the liposome compositions can include ionizable lipids having a chemical structure consisting of a pair of 16- or 18-carbon linear polyunsaturated lipid tails covalently attached to a head group comprising a dialkylamino group with a pKa of 6-7, wherein the head group comprises a heterocyclyl or alkyl moiety covalently attached to the dialkylamino group and optionally further comprises a phosphate group, each polyunsaturated lipid tail being unsaturated except for at least two olefins separated by at least two methylene groups along the length of the lipid tail, and each lipid tail optionally comprising a single acyl group at the end covalently attached to the head group. In some embodiments, each lipid tail is identical, each having a total of two olefins separated only by unsubstituted ethylene, n-propyl, or n-butyl. In some embodiments, each lipid tail further comprises an acyl group that combines with an oxygen in the head group to form an ester.

[0009] In some embodiments, the dialkylamino moiety of the head group of the ionizable cationic lipid has the dialkylamino chemical structure of formula (IV-A):

[0010] [ka] [wherein n in formula (IV-A) is 2, 3 or 4, and R in formula (IV-A) 10 and R 12 are each independently selected from an alkyl group selected from the group consisting of methyl, ethyl, and n-propyl; R 10 and R 12 wherein the alkyl is optionally substituted with one or more hydroxyl groups. In some embodiments, R in formula (IV-A) 10 and R 12 are each independently methyl, ethyl, —(CH)(CH)OH, or (CH)(CH)OH.

[0011] In some embodiments, the ionizable cationic lipid is [ka] wherein R 22 is the first end of the lipid tail, [ka] indicates the linkage of the head group to the dialkylamino chemical structure of the head group. In some embodiments, the ionizable cationic lipid comprising the chemical substructure of formula (IV-A) is [ka] wherein R 22 is the first end of the lipid tail, [ka] indicates the attachment of the head group to the dialkylamino chemical structure of the head group.

[0012] In some embodiments, the ionizable cationic lipid further comprises a pair of lipid tails linked to the head group, wherein each lipid tail comprises a hydrocarbon chain having the chemical structure of Formula A or Formula B.

[0013] [ka] [wherein, in Formula A, a is 1, 2, 3, or 4; b is 2, 3, or 4; and in Formula A, c is 3, 4, 5, 6, or 7]

[0014] [ka] [wherein, in Formula B, a is 5, 6, or 7, and in Formula B, c is 3, 4, or 5] In some embodiments, b is 4 and the sum of a, b, and c in Formula A is 10, 11, 12, or 13. In some embodiments, the ionizable cationic lipid is R 22 In some embodiments, the ionizable cationic lipid comprises a lipid tail of formula A, wherein [ka] is the R in the chemical structure shown above. 22 In some embodiments, the ionizable cationic lipid comprises a lipid tail of formula B, wherein [ka] is the R in the chemical structure shown above. 22 Indicates the position of the connection.

[0015] In some embodiments, the ionizable cationic lipid has the chemical structure of formula (IA):

[0016] [ka] [In the formula, a is 1, 2, 3, 4, 5, or 6; b is 2, 3, or 4; c is 3, 4, 5, 6, or 7; the sum of a, b, and c is 10 or 12; q is 1, 2, 3, or 4; and R 10 and R 12 each is independently a (C1-C4) alkyl optionally substituted with one or more hydroxyl; L is [ka] where v is 0 or 1, q is 1, 2 or 3, and q2 is 1 or 2. In some embodiments, in formula IA, when v is 0, q is 1, 2, or 3; when v is 1, q is 1, 2, 3, or 4.

[0017] In some embodiments, v in formula IA is 0. In some embodiments, v in formula IA is 0 and q is 1, 2, or 3. In some embodiments, v in formula IA is 0 and q is 1 or 2. In some embodiments, the ionizable lipid is a cationic lipid selected from the group consisting of compounds 17-19, and 23-25.

[0018] [ka]

[0019] In some embodiments, the ionizable lipid is a cationic lipid selected from the group consisting of AKG-UO-1, AKG-UO-2, AKG-UO-4, and AKG-UO-5. In some embodiments, the ionizable lipid is AKG-UO-1.

[0020] [ka] In some embodiments, the ionizable lipid is AKG-UO-1A.

[0021] [ka] In some embodiments, the ionizable lipid is AKG-UO-1B.

[0022] [ka] In some embodiments, the ionizable lipid is AKG-UO-2.

[0023] [ka] In some embodiments, the ionizable lipid is AKG-UO-4.

[0024] [ka] In some embodiments, the ionizable lipid is AKG-UO-4A.

[0025] [ka] In some embodiments, the ionizable lipid is AKG-UO-5.

[0026] [ka] In some embodiments, the ionizable lipid is AKG-UO-6, AKG-UO-7, AKG-UO-7, AKG-UO-8, AKG-UO-9, or AKG-UO-10.

[0027] [ka] In some embodiments, the ionizable lipid comprises a head group comprising a methylated phosphate moiety. In some embodiments, the ionizable lipid has a chemical structure of formula IA, where v is 1. In some embodiments, the ionizable lipid has a chemical structure of formula IA, where v is 1 and q is 3 or 4. In some embodiments, the ionizable lipid is [ka] In some embodiments, the ionizable lipid is AKG-UO-3.

[0028] [ka]

[0029] In some embodiments, the ionizable lipid has the chemical structure of formula II-A:

[0030] [ka] wherein a is 1, 2, 3, 4, 5 or 6, b is 2, 3 or 4, and c is 4, 5, 6, 7 or 8; R2 is [ka] and q is 1 or 2, R 10 and R 12 each independently is a (C1-C4) alkyl optionally substituted with one or more hydroxyl groups.

[0031] In some embodiments, the ionizable lipid is selected from the group consisting of compounds 1-3 and compounds 5-8.

[0032] [ka]

[0033] In some embodiments, the ionizable lipid is selected from the group consisting of compounds 1-8.

[0034] [ka]

[0035] In some embodiments, the ionizable lipid has the chemical structure of formula II-A:

[0036] [ka] wherein a is 1, 2, 3, 4, 5 or 6, b is 2, 3 or 4, and c is 4, 5, 6, 7 or 8; R2 is [ka] and q' is 1 or 2, R 10 and R 12 each independently is a (C1-C4) alkyl optionally substituted with one or more hydroxyl groups.

[0037] In some embodiments, the ionizable lipid is a compound selected from the group consisting of compounds 9-19.

[0038] [ka]

[0039] In some embodiments, the ionizable lipid has the chemical structure of formula II-A:

[0040] [ka] wherein a is 1, 2, 3, 4, 5 or 6, b is 2, 3 or 4, and c is 4, 5, 6, 7 or 8; R2 is [ka] and L is [ka] where v is 0 or 1, q is 1, 2, 3 or 4, q2 is 1 or 2, and R 10 and R 12 each independently is a (C1-C4) alkyl optionally substituted with one or more hydroxyl groups. In some embodiments, in Formula II-A, when v is 0, q is 1, 2, or 3; or when v is 1, q is 3 or 4.

[0041] In some embodiments, the lipids are designed to be biodegradable, thus improving the tolerability of the nanoparticles formed therefrom in vivo.

[0042] In some embodiments, the ionizable lipid has the chemical structure of formula II-B:

[0043] [ka] wherein a is 5, 6, or 7, and c is 3, 4, or 5; R2 is [ka] and q and q' are each independently 1 or 2; R 10 and R 12 are each (C1-C4) alkyl optionally substituted with hydroxyl.

[0044] In some embodiments, the ionizable cationic lipid is a compound selected from the group consisting of compounds 29-34.

[0045] [ka]

[0046] In some embodiments, the ionizable lipid is a bioreducible cationic lipid. In some embodiments, the ionizable lipid is a bioreducible cationic lipid comprising a sterol chemical structure. In some embodiments, the ionizable lipid has the formula (VI-A): [ka] wherein q is 3 or 4, and R3 is [ka] or a pharmaceutically acceptable salt thereof. In some embodiments, the ionizable cationic lipid is selected from the group consisting of compounds 35-38.

[0047] [ka]

[0048] In some embodiments, the lipidic nanoparticle composition comprises a lipid and a nucleic acid, wherein the lipidic nanoparticles comprise an ionized lipid of Formula I, II, III, IV, or a combination thereof, or a pharmaceutically acceptable salt thereof. In some embodiments, the lipidic nanoparticle composition comprises a lipid and a nucleic acid, wherein the lipidic nanoparticles comprise an ionized lipid of Formula IA, II-A, II-B, IV-A, or VI-A, or a combination thereof, or a pharmaceutically acceptable salt thereof. In some embodiments, the lipidic nanoparticle composition comprises a lipid and a nucleic acid, wherein the lipidic nanoparticles comprise an ionized lipid comprising a polyene hydrocarbon chain of Formula A, Formula A', Formula A", or Formula B, or a combination thereof, or a pharmaceutically acceptable salt thereof.

[0049] In some embodiments, the present disclosure also provides lipid nanoparticle (LNP) compositions for delivering therapeutic nucleic acids to cells. Aspects of the present disclosure are based, in part, on the discovery that LNP compositions combining various ionizable cationic lipids with specific low-molecular-weight phosphatidyl-L-serine at less than 20 mol% of the total lipids in the composition (e.g., 2.5-10 mol% of the total lipids in the composition) surprisingly demonstrated highly enhanced targeting of the encapsulated nucleic acid.

[0050] In some embodiments, the LNP composition comprises (a) a nucleic acid, (b) an ionizable cationic lipid, (c) a sterol (e.g., cholesterol or a cholesterol derivative, or a plant sterol such as beta-sitosterol), (d) a phospholipid comprising phosphatidylserine (e.g., a mixture of phosphatidylserine and DSPC), and (e) a complex lipid (e.g., PEG-DMG). In one aspect, the LNP composition comprises (a) a nucleic acid, (b) an ionizable cationic lipid, (c) a sterol (e.g., cholesterol or a cholesterol derivative, or a plant sterol such as beta-sitosterol), (d) a phospholipid comprising phosphatidylserine lipid and an additional phospholipid (e.g., DSPC) in a total amount of 1-10 mol% (e.g., 2.5-10 mol%, 3-9 mol%, 5.0-7.5 mol%) of the total lipid in the composition, and (e) a complex lipid (e.g., PEG-DMG). In one embodiment, the LNP composition comprises: (a) a nucleic acid; (b) an ionizable cationic lipid; (c) a sterol (e.g., cholesterol or a cholesterol derivative, or a plant sterol such as beta-sitosterol); (d) a phospholipid comprising a phosphatidylserine lipid and an additional phospholipid (e.g., DSPC) in a total amount of 1-10 mol% (e.g., 2.5-10 mol%, 3-9 mol%, 5.0-7.5 mol%) of the total lipid in the composition; and (e) a complex lipid (e.g., PEG-DMG) in a total amount of 0.5-4.5 mol% (e.g., 0.5-2.5 mol%, 1.5 mol%) of the total lipid in the composition. In one embodiment, the LNP composition comprises: (a) a nucleic acid; (b) an ionizable cationic lipid in a total amount of 40-65 mol% (e.g., 50 mol%) of the total lipid in the composition; (c) a sterol (e.g., cholesterol or a cholesterol derivative, or a plant sterol such as beta-sitosterol) in a total amount of 25-40 mol% (e.g., 38.5 mol%) of the total lipid in the composition; (d) a phospholipid comprising a phosphatidylserine lipid and an additional phospholipid (e.g., DSPC) in a total amount of 1-10 mol% (e.g., 2.5-10 mol%, 3-9 mol%, 5.0-7.5 mol%) of the total lipid in the composition; and (e) a complex lipid (e.g., PEG-DMG) in a total amount of 0.5-4.5 mol% (e.g., 0.5-2.5 mol%, 1.5 mol%) of the total lipid in the composition.In one embodiment, the LNP composition comprises: (a) a nucleic acid; (b) an ionizable cationic lipid in a total amount of 40-65 mol% (e.g., 50 mol%) of the total lipid in the composition; (c) a sterol (e.g., cholesterol or a cholesterol derivative, or a plant sterol such as beta-sitosterol) in a total amount of 25-40 mol% (e.g., 38.5 mol%) of the total lipid in the composition; (d) a phospholipid in a total amount of 5-25 mol% of the total lipid in the composition, wherein the phospholipid comprises a phosphatidylserine lipid in a total amount of 1-10 mol% (e.g., 2.5-10 mol%, 3-9 mol%, 5.0-7.5 mol%) of the total lipid in the composition, and an additional phospholipid (e.g., DSPC) (e.g., 10 mol%) of the total lipid in the composition; and (e) a complex lipid (e.g., PEG-DMG) in a total amount of 0.5-4.5 mol% (e.g., 0.5-2.5 mol%, 1.5 mol%) of the total lipid in the composition.

[0051] In one embodiment, an LNP composition comprises (a) a nucleic acid, (b) a pair of linear polyenes C, each of which comprises an unsaturated linear ethylene, n-propylene, or n-butylene group between two adjacent unsaturated alkynyl double bonds in each polyene hydrocarbon chain. 16 or C 18(c) an ionizable cationic lipid having a hydrocarbon chain, the ionizable cationic lipid being present in the composition in a total amount of 40 to 65 mol% of the total lipid in the composition; (d) a phospholipid in a total amount of 5 to 25 mol% of the total lipid in the composition, the phospholipid comprising a phosphatidylserine lipid (e.g., a phosphatidyl-L-serine lipid) in a total amount of 1 to 10 mol% of the total lipid in the composition and an additional phospholipid (e.g., DSPC in a total amount of 10 mol% of the total lipid in the composition); and (e) a complex lipid (e.g., PEG-DMG) in a total amount of 0.5 to 2.5 mol% of the total lipid in the composition. In one embodiment, the LNP composition comprises: (a) an mRNA nucleic acid; (b) an ionizable cationic lipid of Formula (IA), Formula (II-A), or Formula (II-B) where v is 0, in a total amount of 40-65 mol% of the total lipid in the composition; (c) cholesterol in a total amount of 25-40 mol% of the total lipid in the composition; (d) L-serine phosphatidylserine lipid (e.g., DPPS or DSPS) in a total amount of 1-10 mol% (e.g., 2.5-10 mol%, 3-9 mol%, 5.0-7.5 mol%) of the total lipid in the composition, and DSPC in a total amount of 5-25 mol% of the total lipid in the composition; and (e) a complex lipid (e.g., PEG-DMG) in a total amount of 0.5-2.5 mol% of the total lipid in the composition. In one embodiment, the LNP composition comprises: (a) an mRNA nucleic acid; (b) an ionizable cationic lipid of formula (IA) where v is 0 in a total amount of 40-65 mol% of the total lipid in the composition; (c) cholesterol in a total amount of 25-40 mol% of the total lipid in the composition; (d) an L-serine phosphatidylserine lipid (e.g., DPPS or DSPS) in a total amount of 3-9 mol% of the total lipid in the composition, and DSPC in a total amount of 5-25 mol% of the total lipid in the composition; and (e) a complex lipid (e.g., PEG-DMG) in a total amount of 0.5-2.5 mol% of the total lipid in the composition.

[0052] In some embodiments, the composition comprises (a) a polyunsaturated ionized cationic lipid, and (b) a charged phospholipid phosphatidylserine lipid.

[0053] In some embodiments, a composition comprises (a) an ionizable cationic lipid of formula IV-A, and (b) an anionic phospholipid targeting moiety selected from the group consisting of DSPS (L isomer), DPPS (L isomer), DMPS (L isomer), DOPS (L isomer), DSPS (D isomer), DSPG, DPPG, N-Glu-DSPE, and N-Suc-DSPE. In some embodiments, a composition comprises (a) an ionizable cationic lipid of formula IV-A, and (b) an anionic phospholipid targeting moiety of formula VA. In some embodiments, a composition comprises (a) an ionizable cationic lipid of formula IV-A, and (b) an anionic phospholipid targeting moiety selected from the group consisting of DSPS (L isomer) and DPPS (L isomer).

[0054] In some embodiments, a composition comprises (a) an ionizable cationic lipid of formula IV and (b) an anionic phospholipid targeting moiety of formula VA. In some embodiments, a composition comprises (a) an ionizable cationic lipid of formula IV and (b) an anionic phospholipid targeting moiety selected from the group consisting of DSPS (L-isomer), DPPS (L-isomer), DMPS (L-isomer), DOPS (L-isomer), DSPS (D-isomer), DSPG, DPPG, N-Glu-DSPE, and D-Suc-DSPE. In some embodiments, a composition comprises (a) an ionizable cationic lipid of formula IV and (b) an anionic phospholipid targeting moiety of formula VA. In some embodiments, a composition comprises (a) an ionizable cationic lipid of formula IV-A and (b) an anionic phospholipid targeting moiety selected from the group consisting of DSPS (L-isomer) and DPPS (L-isomer).

[0055] In one embodiment, the LNP composition comprises: (a) an mRNA nucleic acid; (b) an ionizable cationic lipid selected from the group consisting of AKG-KC2-OA, AKG-KC3-OA, Dlin-KC2-DMA, and Dlin-KC3-DMA, in a total amount of 40-65 mol% of the total lipid in the composition; (c) cholesterol (or a derivative thereof) in a total amount of 25-40 mol% of the total lipid in the composition; (d) a mixture of two or more phospholipids in a total amount of 5-25 mol% of the total lipid in the composition, wherein the phospholipid comprises an L-serine phosphatidylserine lipid (e.g., DPPS or DSPS) in a total amount of 3-9 mol% (e.g., 5.0-7.5 mol%) of the total lipid in the composition; and (e) a complex lipid (e.g., PEG-DMG) in a total amount of 0.5-2.5 mol% of the total lipid in the composition.

[0056] [ka]

[0057] In one embodiment, a nucleic acid-lipid nanoparticle (LNP) composition comprises a nucleic acid, an ionizable cationic lipid AKG-UO-1, and (L-serine)PS lipids in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition. In some embodiments, the nucleic acid is mRNA, the PS lipids are (L-serine)DSPS, (L-serine)DPPS, or a mixture thereof, and the LNP composition further comprises cholesterol and a second phospholipid selected from the group consisting of DSPC, DPPC, and DOPC. The LNP composition further comprises 0.5-1.5 mol% of PEG-DMG or PEG-DSG relative to the total lipid content of the LNP composition.

[0058] In one aspect, a nucleic acid-lipid nanoparticle (LNP) composition comprises a nucleic acid, an ionizable cationic lipid selected from KC2OA, KC2, KC2-01, ALC-0315, and SM102, and (L-serine)PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition. In some embodiments, the LNP composition has an N / P ratio of 3-8 (e.g., a ratio of 5-7 or 5).

[0059] In one embodiment, a nucleic acid-lipid nanoparticle (LNP) composition comprises a nucleic acid, an ionizable cationic lipid selected from AKG-UO-6 and AKG-UO-7, and (L-serine)PS lipid in a total amount of 2.5-10 mol% of the total lipid content of the LNP composition. In some embodiments, the N / P ratio is 3-8 (e.g., 5-7 or a ratio of 5 or 7).

[0060] In one embodiment, a nucleic acid-lipid nanoparticle (LNP) vaccine composition comprises an mRNA nucleic acid having an N / P ratio of 3 to 8, ALC-0315 ionizable cationic lipid in a total amount of 46 to 65 mol% of the total lipid content of the LNP composition, cholesterol in a total amount of 25 to 40 mol% of the total lipid content of the LNP composition, (L-serine)PS lipid in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition, DSPC phospholipid in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition, and PEG-DMG in a total amount of 0 to 2.5 mol% of the total lipid content of the LNP composition.

[0061] In one embodiment, a nucleic acid-lipid nanoparticle (LNP) vaccine composition comprises an mRNA nucleic acid having an N / P ratio of 3 to 8, Dlin-KC2-DMA ionized cationic lipid in a total amount of 40 to 65 mol% of the total lipid content of the LNP composition, cholesterol in a total amount of 25 to 40 mol% of the total lipid content of the LNP composition, (L-serine)PS lipid in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition, DSPC phospholipid in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition, and PEG-DMG in a total amount of 0 to 2.5 mol% of the total lipid content of the LNP composition.

[0062] In one embodiment, a lipid nanoparticle (LNP) vaccine composition comprises an mRNA nucleic acid having an N / P ratio of 3 to 8, a KC3-OA ionized cationic lipid in a total amount of 40 to 65 mol% of the total lipid content of the LNP composition, cholesterol in a total amount of 25 to 40 mol% of the total lipid content of the LNP composition, (L-serine)PS lipid in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition, DSPC phospholipid in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition, and PEG-DMG in a total amount of 0 to 2.5 mol% of the total lipid content of the LNP composition.

[0063] In one embodiment, a nucleic acid-lipid nanoparticle (LNP) vaccine composition comprises an mRNA nucleic acid having an N / P ratio of 3 to 8, an ionized cationic lipid in a total amount of 40 to 65 mol% of the total lipid content of the LNP composition, cholesterol in a total amount of 25 to 40 mol% of the total lipid content of the LNP composition, (L-serine)PS lipid in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition, and DSPC phospholipid in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition, and PEG-DMG in a total amount of 0 to 2.5 mol% of the total lipid content of the LNP composition.

[0064] One aspect of the present disclosure relates to the use of (L-serine) PS lipids in LNPs in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition for targeting the LNP to dendritic cells. In some embodiments, the LNPs comprise mRNA. In some embodiments, the LNPs further comprise cholesterol. In some embodiments, the LNPs further comprise an ICL. In some embodiments, the LNPs further comprise one or more additional phospholipids, including DSPC. In some embodiments, the LNPs further comprise a complex lipid. In some embodiments, the LNPs comprise an mRNA nucleic acid having an N / P ratio of 3 to 8, an ionizable cationic lipid (ICL) in a total amount of 40 to 65 mol% of the total lipid content of the LNP composition, cholesterol in a total amount of 25 to 40 mol% of the total lipid content of the LNP composition, (L-serine) PS lipid in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition, DSPC phospholipid in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition, and complex lipids in a total amount of 0 to 2.5 mol% of the total lipid content of the LNP composition. [Brief explanation of the drawings]

[0065] [Figure 1] FIG. 1 is a diagram of the oxidative degradation mechanism of lipid esters of linoleic acid containing conjugated multiple unsaturations that are particularly susceptible to oxidation. [Figure 2] Figure 1 shows the reaction of the reduced C-terminal cysteine ​​of a Fab' antibody fragment with maleimide-terminated poly(ethylene glycol) 2000-derivatized distearoylphosphatidylethanolamine. R1 and R2 are stearic acid. The final antibody-lipopolymer conjugate is an intermediate that subsequently inserts into the lipid outer layer of lipid nanoparticles for active targeting. [Figure 3A]The effect of 0 to 2.5 mol% DSPS content on the transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNPs formulated with DLin-KC2-DMA as the ionizable cationic lipid. The ICL, cholesterol, and PEG-DMG were maintained at 50 mol%, 38.5 mol%, and 1.5 mol%, respectively, while the DSPS content was varied. DSPS was included by reducing the DSPC content by the same mol% as the added DSPS. Cells were incubated for 24 hours with each formulation at a concentration of 1 μg mRNA / mL. UT samples correspond to cells without added LNPs. Lipofect refers to lipofectamine-treated samples. [Figure 3B] The effect of 0 to 7.5 mol% DSPS content on the transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNPs formulated with DLin-KC2-DMA as the ionizable cationic lipid. The ICL, cholesterol, and PEG-DMG were maintained at 50 mol%, 38.5 mol%, and 1.5 mol%, respectively, while the DSPS content was varied. DSPS was included by reducing the DSPC content by the same mol% as the added DSPS. Cells were incubated for 24 hours with each formulation at a concentration of 1 μg mRNA / mL. UT samples correspond to cells without added LNPs. Lipofect refers to lipofectamine-treated samples. [Figure 3C] The effect of 0 to 7.5 mol% DSPS content on the transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNPs formulated with DLin-KC2-DMA as the ionizable cationic lipid. The ICL, cholesterol, and PEG-DMG were maintained at 50 mol%, 38.5 mol%, and 1.5 mol%, respectively, while the DSPS content was varied. DSPS was included by reducing the DSPC content by the same mol% as the added DSPS. Cells were incubated with each formulation at a concentration of 0.3 μg mRNA / mL for 24 hours. UT samples correspond to cells without added LNPs. [Figure 3D]The effect of 0 to 7.5 mol% DSPS content on the transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNPs formulated with DLin-KC2-DMA as the ionizable cationic lipid. The ICL, cholesterol, and PEG-DMG were maintained at 50 mol%, 38.5 mol%, and 1.5 mol%, respectively, while the DSPS content was varied. DSPS was included by reducing the DSPC content by the same mol% as the added DSPS. Cells were incubated with each formulation at a concentration of 0.1 μg mRNA / mL for 24 hours. UT samples correspond to cells without added LNPs. [Figure 4] Transfection of murine dendritic cells (MutuDC1940) with LNPs containing various ICLs (KC2, KC2-OA, KC3-OA, and SM-102) and 5 mol% DSPS, and comparison with LNPs containing Glu-DSPE or Suc-DSPE rather than DSPS. UT samples correspond to cells without added LNPs. [Figure 5] DSPS or DPPS increases mCherry LNP transfection with ICLs containing KC2, KC2-01, KC2-PA, KC3-01, and KC3-OA. UT samples correspond to cells to which no LNPs were added. [Figure 6A] Comparison of various chemical forms of phosphatidylserine and AKG-UO-1-containing LNPs in transfecting mouse dendritic cells. UT samples correspond to cells to which no LNPs were added. Lipo refers to Lipofectamine MessengerMax (ThermoFisher) used according to the manufacturer's instructions at the same dosage level as LNPs. [Figure 6B] Comparison of DSPS and other negatively charged phospholipids in transfecting mouse dendritic cells using AKG-UO1-containing LNPs. UT samples correspond to cells to which no LNPs were added. Lipo refers to Lipofectamine MessengerMax (ThermoFisher) used according to the manufacturer's instructions at the same dosage level as LNPs. [Figure 7] Effect of DSPS concentration in AUG-UO-1-containing LNPs on the transfection of dendritic cells. The UT sample corresponds to cells to which no LNPs were added. [Figure 8] Effect of PEG-DMG concentration in AUG-UO-1-containing LNPs with and without 5 mol% DSPS on dendritic cell transfection. The Y-axis indicates the % PEG used in the composition after which mRNA concentrations (0.11, 0.33, or 1 μg / mL) were added to the cells. The UT sample corresponds to cells to which no LNPs were added. [Figure 9A] Oxidative degradation of lipid suspensions of ICLs with a single methylene between the two olefins (KC2, KC3, and O-11769) and ICLs with four methylenes between the two olefins (KC2-01, KC3-01, and UO-1). [Figure 9B] Oxidative degradation of liposomes containing O-11769 (an ICL with a single methylene between the two olefins) and UO-1 (an ICL with four methylenes between the two olefins). [Figure 10A] Effect of N / P on mCherry expression in mouse dendritic cells containing 1 μg / mL of KC2-01-containing LNPs. The UT sample corresponds to cells to which no LNPs were added. [Figure 10B] Effect of N / P on mCherry expression in mouse dendritic cells from 0.33 μg / mL KC2-01-containing LNPs. The UT sample corresponds to cells to which no LNPs were added. [Figure 11] Transfection efficiency of LNPs containing different ionized cationic lipids with and without DSPS (7.5 mol %). The UT sample corresponds to cells to which no LNPs were added. [Figure 12] Transfection efficiency of LNP formulations containing various concentrations of DOPS (0, 10, and 25 mol% as % of total lipids) and mCherry mRNA in mouse dendritic cells. [Figure 13A-1]VRN-029 mRNA sequence, SARS-COV2 spike protein producing sequence. [Figure 13A-2] VRN-029 mRNA sequence, SARS-COV2 spike protein producing sequence. [Figure 13B] Effect of PEG-DMG(C14) concentration (mol%) on LNP vaccine immunogenicity. Total anti-spike antibody titers and CD4 responses in mice immunized with mRNA-LNP using the ionizable lipid UO1 with increasing mol% of 7.5% DSPS and PEG-DPPE. The middle graph shows the endpoint antibody titers at day 34. The right graph shows the corresponding CD4 T cell responses. [Figure 13C] Effect of PEG-DPPE(C16) concentration (mol%) on LNP vaccine immunogenicity. Total anti-spike antibody titers in mice immunized with mRNA-LNP using the ionizable lipid UO1 with 7.5% DSPS and increasing mol% of PEG-DMG. The middle graph shows the endpoint antibody titers at day 34. The mol% of PEG-DPPE oppositely affected antibody levels. The right graph shows the corresponding CD4 T cell responses. [Figure 13D] Total anti-spike antibody titers and CD4 responses in mice immunized with mRNA-LNP using the ionizable lipid KC2OA with 7.5% DSPS and 1.5 mol% of either PEG-DMG(14C) or PEG-DSG(18C). The graph on the left shows the endpoint antibody titers on day 34. The graph on the right shows the corresponding CD4 T cell responses. [Figure 13E] Total anti-spike antibody titers and CD4 responses in mice immunized with mRNA-LNP using the ionized lipid UO1 with 7.5% DSPS and 1.5 mol% of either PEG-DMG(14C) or PEG-DSG(18C). The graph on the left shows the endpoint antibody titers on day 34. The graph on the right shows the corresponding CD4 T cell responses. [Figure 13F]Effect of phosphatidylserine incorporation on mRNA-LNP immunogenicity. Total anti-spike antibody titers (A) and spike-specific CD4 T cell responses in mice immunized with mRNA-LNP using various ionizable lipids and PEG-lipid plus / minus 7.5 mol% DSPS. Antibody data were log-transformed and analyzed using two-way ANOVA with Sidak multiple comparison test. CD4 T cell data were analyzed using a REML mixed-effects model with Sidak multiple comparison test. [Figure 13G] Effect of phosphatidylserine lipid tail (DPPS vs. DSPS) composition on mRNA-LNP priming of B (Panel A) and T cell (Panel B) responses. Antibody data were log-transformed prior to analysis. Data were analyzed using one-way ANOVA with Tukey's multiple comparison test. [Figure 14A] Comparison of mCherry expression for 24 hours at 1 μg / mL mRNA in KC2-01 LNP, 7.5 mol% DSPS (D isomer), and DSPS (L isomer). [Figure 14B] Comparison of mCherry expression for 24 hours at 0.33 μg / mL mRNA in KC2-01 LNP, 7.5 mol% DSPS (D isomer) and DSPS (L isomer). [Figure 15] Comparison of mCherry expression between KC2 LNPs, those with 5 and 7.5 mol% DSPS (L isomer), and LNPs prepared with SM-102 or ALC-0315 (1 μg / mL mRNA, 24 h). The Y-axis is mean fluorescence intensity (MFI). The UT sample corresponds to cells without added LNPs. [Figure 16] Comparison of mCherry expression in UO1, UO6, and UO7 formulations alone or supplemented with 7.5 mol% D isomer of DSPS (1 μg / mL mRNA, 24 h). The UT sample corresponds to cells without added LNPs. [Figure 17]Comparison of mCherry expression in UO1, SM102, and ALC-0315 formulations alone or with DSPS (1 μg / mL mRNA, 24 h). Lipo refers to Lipofectamine MessengerMax (ThermoFisher) used according to the manufacturer's instructions at the same dosage level as LNP. UT samples correspond to cells without LNP. DETAILED DESCRIPTION OF THE INVENTION

[0066] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the compositions and methods of the present disclosure.

[0067] Stabilized nucleic acid lipid particles (SNALP) are used as vehicles for the systemic delivery of mRNA or other nucleic acid therapeutics. SNALP compositions contain cationic lipids, such as MC3 or KC2, which contain a protonatable tertiary amine head group attached to a pair of linear 18-carbon aliphatic chains (e.g., linoleic acid) containing a pair of carbon-carbon double bonds separated by a single methylene group. However, while the structure of these hydrocarbon chains, each containing a pair of double bonds separated by a single methylene group, confers the desired biological properties of SNALP compositions, this chemical substructure also poses the undesirable problem of increasing the compound's susceptibility to oxidative degradation. For example, Figure 1 illustrates the oxidative degradation mechanism of lipid esters of linoleic acid containing multiple conjugated unsaturations that are particularly susceptible to oxidation. Novel cationic lipids suitable for use in SNALP compositions but with enhanced resistance to oxidative degradation are needed.

[0068] Disclosed herein are compounds, compositions, and methods related to the treatment of bacterial infections. As used herein, the terms "compound," "drug," and "active agent" are used interchangeably. Some aspects of the present disclosure relate to novel ionizable lipids or bioreducible ionizable lipids. These lipids are cationic (i.e., positively charged) at acidic pH and are encountered intracellularly, for example, after endocytosis or phagocytosis by cells. The same lipids and compositions containing them have a nearly neutral charge when present at pH 7.4. These lipids may also have multiple olefins separated by at least two methylene groups present in their alkyl or acyl groups.

[0069] Some aspects of the present disclosure relate to processes for the synthesis of novel ionizable lipids.

[0070] Another aspect relates to a composition comprising lipidic nanoparticles comprising ionizable cationic lipids, wherein the lipidic nanoparticles contain nucleic acids. In some embodiments, the nucleic acids are encapsulated in the lipidic nanoparticles.

[0071] Another aspect of the present disclosure relates to the use of these ionized lipids or lipid-based nanoparticle compositions comprising ionized lipids in vaccines for the prevention of infectious diseases or cancer. In some embodiments, the infectious disease may be a bacterial or viral infection. In some embodiments, the compositions described herein may be used to prevent infections related to tuberculosis, HIV / AIDS, malaria, or coronavirus-related infections such as COVID-19. In other embodiments, the infectious disease is influenza, hepatitis B, hepatitis C, dengue fever, human papillomavirus (HPV), norovirus, mumps, measles, meningococcal disease, pneumococcal disease, polio, rotavirus, respiratory syncytial virus (RSV), rubella, shingles / herpes virus, tetanus, or pertussis.

[0072] In some embodiments, the compounds and compositions described herein can promote efficient uptake and transfection of target cells, including tissue macrophages and dendritic cells. This results in efficient delivery of a nucleic acid encoding an antigen specific to an infectious virus or bacterium and subsequent presentation of the antigen to elicit a desired immune response that protects against the corresponding infection. In some embodiments, the nucleic acid may be a synthetic nucleic acid (e.g., an engineered codon-optimized mRNA) encoding an epitope of a coronavirus, such as SARS-CoV, MERS-CoV, or SARS-CoV-2. In some embodiments, the nucleic acid may be a synthetic nucleic acid (e.g., an engineered codon-optimized mRNA) encoding the S protein (spike protein) or a fragment thereof of a coronavirus, such as SARS-CoV, MERS-CoV, or SARS-CoV-2.

[0073] definition For convenience, certain terms employed in the specification, examples, and appended claims are collected here. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0074] As used herein, the following terms and phrases are intended to have the following meanings:

[0075] The articles "a" and "an" are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0076] As used herein, the terms "comprising" or "comprises" are used in reference to compositions, methods, and individual components thereof that are present in a given embodiment but extend to the inclusion of elements not specified.

[0077] As used herein, the term "consisting essentially of" refers to elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristics of that embodiment of the present disclosure.

[0078] The term "consisting of" refers to compositions, methods, and each component thereof described herein, excluding all elements not recited in the description of the embodiment.

[0079] As used herein, the term "comprising" includes "consisting of" and "consisting essentially of."

[0080] When reference is made to "as described above" or "above" or "above" in the description, this refers to any of the disclosures made in the specification on any of the previous pages.

[0081] References in the description to "as described herein," "described herein," "provided herein," or "as mentioned in this text," or "defined herein" refer to any of the disclosures made in the specification, either on the preceding or following pages.

[0082] As used herein, the term "about" refers to an acceptable variation of within 20%, 10%, and 5% of the specified value. In certain embodiments, "about" can refer to a variation of + / - 1%, 2%, 3%, 4%, 5%, 10%, or 20%.

[0083] As used herein with respect to a compound or composition, the term "effective amount" means the amount of an active compound (also referred to herein as an active agent or active drug) sufficient to produce a bactericidal or bacteriostatic effect. In one embodiment, the effective amount is a "therapeutically effective amount," which means the amount of an active compound sufficient to alleviate the symptoms of the bacterial infection being treated.

[0084] As used herein, the term "subject" (or alternatively, "patient") refers to an animal, preferably a mammal, most preferably a human, who receives either prophylactic or therapeutic treatment.

[0085] As used herein, the terms "administration" or "administering" refer to any means of introducing a compound or pharmaceutical composition into a subject in need thereof, including, but not limited to, oral, intravenous, intramuscular, intraperitoneal, subcutaneous, transdermal, inhalation, buccal, ophthalmic, sublingual, vaginal, and rectal administration. Administration of the compound or composition is preferably parenteral. For example, the compound or composition is preferentially administered intravenously, but can also be administered intraperitoneally or via inhalation, as is currently used in the clinic for liposomal amikacin in the treatment of mycobacterium avium (see Shirley et al., Amikacin Liposome Inhalation Suspension: A Review in Mycobacterium avium Complex Lung Disease. Drugs. 2019 Apr;79(5):555-562).

[0086] As used herein, the terms "treat," "treating," and "treatment" refer to therapeutic or prophylactic measures such as those described herein.

[0087] The term "pharmaceutically acceptable salts" refers to relatively non-toxic, inorganic or organic acid addition salts of compounds of the present disclosure, which salts possess the desired pharmacological activity.

[0088] The term "alkyl" means saturated carbon chains having 1 to 20 carbon atoms which may be linear or branched or combinations thereof, unless the carbon chain is otherwise specified. Examples of alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, sec- and tert-butyl, pentyl, hexyl, heptyl, and octyl, and the like. Unless specified otherwise in the specification, alkyl groups are optionally substituted.

[0089] The term "phosphatidylserine," with any of its acyl chain compositions, refers to the L-isomer of serine in the head group unless otherwise specified in a particular example.

[0090] The term "lipid complex" refers to a complex lipid that inhibits lipid particle aggregation. Such lipid complexes include, but are not limited to, polysarcosine (see, for example, WO2021191265A, which is incorporated herein by reference for all purposes), polyamide oligomers (e.g., ATTA-lipid complexes), PEG-lipid complexes (PEG coupled with dialkyloxypropyl, PEG coupled with diacylglycerol, PEG coupled with cholesterol, PEG coupled with phosphatidylethanolamine, PEG coupled with ceramide, etc.) (see, for example, U.S. Patent No. 5,885,613, which is incorporated herein by reference for all purposes), cationic PEG lipids, and mixtures thereof. PEG can be directly conjugated to lipids, or can be bound to lipids via a linker moiety. Any linker moiety suitable for coupling PEG to lipids (e.g., including non-ester-containing linker moieties and ester-containing linker moieties) can be used. In a preferred embodiment, a non-ester-containing linker moiety is used.

[0091] The abbreviations for ionizable cationic lipids may be truncated from those used in the tables in the examples, for example, AKG-UO-1 or AKG-KC2-01 may be referred to as UO1 or KC2-01.

[0092] The abbreviation UT used in various studies refers to untreated samples.

[0093] The term "lipid nanoparticle" or "LNP" refers to particles with a diameter of approximately 5 to 500 nm. In some embodiments, lipid nanoparticles contain one or more active agents. In some embodiments, lipid nanoparticles contain nucleic acids. In some embodiments, nucleic acids are condensed inside nanoparticles that have an outer lipid coat that interacts with cationic lipids, polymers, or multivalent small molecules and the biological environment. Due to repulsive forces between phosphate groups, nucleic acids are necessarily rigid polymers, favoring an elongated shape. To overcome volume constraints in cells, DNA can pack itself with the aid of ions and other molecules under appropriate solution conditions. DNA condensation is typically defined as the collapse of extended DNA strands into compact, systematic particles containing only one or a few molecules. By binding to phosphate groups, cationic lipids can condense DNA by neutralizing the phosphate charge and allowing close packing.

[0094] In some embodiments, an active agent is encapsulated in the LNP. In some embodiments, the active agent may be an anionic compound, such as, but not limited to, DNA, RNA, natural and synthetic oligonucleotides (including antisense oligonucleotides, interfering RNA, and small interfering RNA), nucleoproteins, peptides, nucleic acids, ribozymes, DNA-containing nucleoproteins, intact or partially deproteinized virus particles (virions), and oligomeric and polymeric anionic compounds other than DNA (e.g., acidic polysaccharides and glycoproteins). In some embodiments, the active agent may be mixed with an adjuvant.

[0095] In LNP vaccine products, the active agent is generally contained within the interior of the LNP. In some embodiments, the active agent comprises a nucleic acid. Typically, the water-soluble nucleic acid is condensed with cationic lipids or polycationic polymers within the interior of the particle, and the surface of the particle is enriched with neutral lipids or PEG-lipid derivatives. Additional ionizable cationic lipids may also be present on the surface, which, by virtue of their positive charge, respond to acidification in the environment and facilitate endosomal escape.

[0096] Ionized lipids may have properties or functions different from LNPs. Due to the pKa of the amino group, lipid molecules may become positively charged under acidic conditions. Under these conditions, lipid molecules can electrostatically bind to the phosphate groups of nucleic acids, allowing LNP formation and encapsulation of nucleic acids. In some embodiments, the pKa may be low enough to render the surface charge of LNPs substantially neutral in biological fluids such as blood at physiological pH values. High LNP surface charge is associated with toxicity, fast elimination from the circulation by sessile and free macrophages, and hemolytic toxicity (including immune activation) (Filion et al. Biochim Biophys Acta. 1997 Oct 23;1329(2):345-56).

[0097] In some embodiments, the pKa may be high enough to allow the ionized cationic lipid to adopt a positively charged conformation at acidic endosomal pH values. In this way, the cationic lipid, in combination with endogenous endosomal anionic lipids, can promote membrane-dissolving non-bilayer structures, such as hexahedral HII phases, resulting in more efficient intracellular transport. In some embodiments, the pKa is in the range of 6.2 to 6.5. For example, the pKa may be about 6.2, about 6.3, about 6.4, or about 6.5. The unsaturated tail also contributes to the lipid's ability to adopt non-bilayer structures (Jayaraman et al., Angew Chem Int Ed Engl. 2012 Aug 20;51(34):8529-33).

[0098] Among other properties such as liposome clearance and circulation half-life, the release of nucleic acids from LNP formulations can be modified by the presence of polyethylene glycol and / or sterols (e.g., cholesterol) or other potential additives in the LNP, as well as the overall chemical structure (including the pKa of any ionizable cationic lipids included as part of the formulation).

[0099] The term "bioreductive" refers to compounds that undergo accelerated degradation in a reducing environment due to the cleavage of disulfide bonds. Unlike other nucleic acid therapeutics, such as siRNA, the success of mRNA-based therapeutics depends on the availability of a safe and efficient delivery vehicle that encapsulates the mRNA. mRNA is fragile and requires a protective coating to remain active until it reaches the target site. mRNA-containing LNPs are a promising vaccine option for COVID-19 immunity (Jackson et al., Preliminary Report. N Engl J Med. 2020 Nov 12;383(20):1920-1931). The efficiency and tolerability of LNPs are attributed to amino lipids. Unlike many biomaterial applications, which can require weeks or months of service, functional LNP-mediated delivery of mRNA occurs within hours, eliminating the need for persistent lipids. Indeed, this becomes particularly important for applications requiring prolonged administration. LNPs have been demonstrated to enter cells via endocytosis and accumulate in endolysosomal compartments. Ionized cationic lipids (ICLs) are susceptible to enzymatic hydrolysis by lipases or hydrolysis induced by the reducing environment of lysosomes in late endosomes / lysosomes, allowing complete biodegradation, but they can efficiently deliver mRNA to the cytosol after endocytosis. The extracellular space is a relatively oxidizing environment, while the intracellular space is a reducing environment, allowing disulfide-bonded molecules to remain intact in the extracellular space but to be rapidly reduced upon internalization (Huang et al., Mol Ther. 2005 Mar;11(3):409-17, 2005). Some embodiments provide bioreducible disulfide-bonded ICL molecules (compounds 29-36 (see Table 2)) that are stable in LNP formulations during circulation but undergo cleavage in the reducing environment of lysosomes. Such compounds and compositions can promote rapid biological breakdown of lipids and prevent the potentially toxic accumulation of ICL lipids, as observed in rats with DLin-MC3-DMA (Sabins et al., Mol Ther. 2018 Jun 6;26(6):1509-1519).

[0100] As used herein, the terms "encapsulation" and "enclosed" refer to the incorporation of mRNA, DNA, siRNA, or other nucleic acid pharmaceuticals into or associated with lipid nanoparticles. As used herein, the term "encapsulated" refers to complete or partial encapsulation. siRNA can selectively knock down or downregulate the expression of a gene of interest. For example, siRNA can be selected to silence a gene associated with a particular disease, disorder, or condition upon administration of a nanoparticle composition containing the siRNA to a subject in need thereof. The siRNA may contain a sequence complementary to an mRNA sequence encoding the gene or protein of interest.

[0101] The term "mol %" in relation to cholesterol refers to the molar amount of cholesterol relative to the sum of the molar amounts of cholesterol and non-PEGylated phospholipids, expressed as percentage points. For example, "55 mol % cholesterol" in a liposome containing cholesterol and HSPC refers to a composition of 55 molar parts cholesterol per 45 molar parts HSPC.

[0102] The related term "mol %" of PEG-lipid refers to the ratio of the molar amounts of PEG-lipid and non-PEGylated phospholipid expressed in percentage points. For example, "5 mol % PEG-DSPE" in an LNP containing HSPC and PEG-DSPE refers to a composition having 5 molar parts of PEG-DSPE per 100 molar parts of HSPC.

[0103] As used herein, the term "pharmaceutically acceptable carrier, diluent, or excipient" includes, but is not limited to, any adjuvant, carrier, excipient, glidant, sweetener, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, or emulsifier approved by the U.S. Food and Drug Administration as acceptable for use in humans or veterinary medicine.

[0104] Various aspects and embodiments are described in further detail in the following subsections.

[0105] compound Provided herein are compounds, compositions, and methods for the treatment or prevention of infectious diseases, including tuberculosis. According to embodiments of the present disclosure, the cationic lipid comprises a compound having Formula I, II, III, or IV, or a pharmaceutically acceptable salt thereof. According to embodiments of the present disclosure, the ionizable cationic lipid comprises a compound having one or more chemical substructures selected from the group consisting of Formula IV, Formula IV-A, Formula A, Formula A', Formula A'', Formula A''', and / or Formula B. In some embodiments of the present disclosure, the ionizable cationic lipid can comprise a compound having Formula I, Formula IA, Formula I-A', Formula I-A'', Formula II, Formula II-A, Formula II-A', Formula II-B, Formula II-B', Formula III, or Formula III-A, or a pharmaceutically acceptable salt thereof. In some embodiments of the present disclosure, the LNP can comprise a compound having Formula V or Formula VA, or a pharmaceutically acceptable salt thereof. In some embodiments of the present disclosure, the LNP can comprise a compound having Formula VI or Formula VI-A, or a pharmaceutically acceptable salt thereof. In some embodiments of the present disclosure, the LNPs can comprise a compound having Formula VII or a pharmaceutically acceptable salt thereof. In some embodiments of the present disclosure, the LNPs can comprise a compound having Formula VIII or a pharmaceutically acceptable salt thereof. According to aspects of the present disclosure, the cationic lipid comprises (a) an ionizable cationic lipid selected from a compound of Formula I, Formula IA, Formula I-A', Formula I-A'', Formula II, Formula II-A, Formula II-A', Formula II-B, Formula II-B', Formula III, or Formula III-A, or a sterol lipid of Formula VI-A, or a branched lipid of Formula VIII, and (b) a compound having a sterol of Formula VI, and optionally further comprising (c) an alkylene glycol lipid of Formula VII. In some embodiments, the LNPs further comprise a phospholipid of Formula V or Formula VA. In some embodiments, the LNPs further comprise an anionic phospholipid targeting moiety of Table 3.

[0106] Also provided herein are compounds, compositions and methods for treating or preventing infectious diseases, including tuberculosis.According to an aspect of the present disclosure, cationic lipid comprises the compound having formula A or its pharmaceutically acceptable salt.In some embodiments, cationic lipid comprises two fatty acyl groups as in formula II, II, III or IV:

[0107] Disclosed herein are compounds of Formula I, II, III, or IV, or pharmaceutically acceptable salts thereof, that are useful in the preparation of vaccines. Also disclosed herein are compositions comprising cationic lipids of Formula I, II, III, or IV, or pharmaceutically acceptable salts thereof. In some embodiments, the vaccines are used for the prevention of mycobacterium infections. In some embodiments, the vaccine is directed against tuberculosis, nontuberculous mycobacteria (NTM), nontuberculous pulmonary disease, leprosy, Mycobacterium avium-intracellulare, Mycobacterium kansasii, Mycobacterium marinum, Mycobacterium ulcerans, Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium abscessus, and other infectious diseases, such as coronaviruses (COVID-19, SARS-CoV-2 ... It can be used to prevent CoV2, SARS-CoV, MERS-CoV, diphtheria, Ebola, influenza, hepatitis, Hib disease, HIV / AIDS, HPV (human papillomavirus), malaria, measles, meningococcal disease, mumps, norovirus, plague, pneumococcal disease, polio, respiratory syncytial virus (RSV), rotavirus, rubella (rubella), shingles (herpes), tetanus (tetanus), whooping cough (pertussis), and Zika.

[0108] Provided herein are compounds, compositions and methods for treating or preventing infectious diseases, including tuberculosis.According to an aspect of the present disclosure, cationic lipid comprises the compound of formula I, II, III or IV or their pharmaceutically acceptable salts.In some embodiments, cationic lipid comprises two fatty acyl groups of formula I, II, III or IV.

[0109] One aspect of the present disclosure provides a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula A:

[0110] [ka] wherein a is 1, 2, 3, or 4, b is 2, 3, or 4, and c is 3, 4, 5, 6, or 7. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains, where b is 4. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A, where the sum of a, b, and c is 10, 11, 12, or 13. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A, where a is 4, b is 4, and c is 4 or 5. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A, where a is 1, 2, or 3, b is 4, and c is 3, 4, 5, 6, or 7. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A, where a is 5 or 6, b is 2, 3, or 4, and c is 3, 4, 5, 6, or 7. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A, where the sum of a, b, and c is 10, 11, 12, or 13. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A, where the sum of a, b, and c is 12. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A, where b is 2 and the sum of a, b, and c is 12. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A, where b is 3 and the sum of a, b, and c is 12. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A, where b is 4 and the sum of a, b, and c is 12. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A.

[0111] One aspect of the present disclosure provides a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula A:

[0112] [ka] wherein a is 1, 2, or 3; b is 2, 3, or 4; and c is 3, 4, 5, 6, or 7. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains, where b is 4. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A', where the sum of a, b, and c is 10, 11, 12, or 13.

[0113] One aspect of the present disclosure provides a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula A″.

[0114] [ka] wherein a is 4, b is 4, and c is 4 or 5. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A″, where the sum of a, b, and c is 12.

[0115] One aspect of the present disclosure provides a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula A'''.

[0116] [ka]

[0117] wherein a is 5 or 6, b is 2, 3, or 4, and c is 3, 4, 5, 6, or 7. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A'", where the sum of a, b, and c is 10, 11, 12, or 13. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A'", where the sum of a, b, and c is 12. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A'", where b is 2 and the sum of a, b, and c is 12. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A'", where b is 3 and the sum of a, b, and c is 12. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A'", where b is 4 and the sum of a, b, and c is 12. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A'".

[0118] One aspect of the present disclosure provides a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula B:

[0119] [ka] wherein a is 5, 6, or 7, and c is 3, 4, or 5. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains, where b is 4. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula B, where the sum of a and c is 9, 10, or 11.

[0120] In some embodiments, the ionizable lipid has the chemical structure of formula (IV-A): [ka] or a pharmaceutically acceptable salt thereof, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', or formula A''', or formula B; R 10 and R 12 Each of is independently (C1-C4) alkyl optionally substituted with hydroxyl.

[0121] In some embodiments, R in formula (IV-A) 22 is a polyene hydrocarbon chain of formula A. In some embodiments, R in formula (IV-A) 22 is a polyene hydrocarbon chain of formula A'. In some embodiments, R in formula (IV-A) 22 is a polyene hydrocarbon chain of formula A″. In some embodiments, R in formula (IV-A) 22 is a polyene hydrocarbon chain of formula A'". In some embodiments, R in formula (IV-A) 22 is a polyene hydrocarbon chain of formula B.

[0122] In some embodiments, in formula (IV-A), R 10 and R 12 are each independently selected from methyl, ethyl, propyl, —(CH)(CH)OH, and —(CH)(CH)OH. In some embodiments, in Formula (IV-A), R 10 and R 12 are each independently methyl. In some embodiments, in formula (IV-A), R 10 and R 12 are each independently ethyl. In some embodiments, in formula (IV-A), R 10 and R 12 In some embodiments, in Formula (IV-A), at least one of R is n-propyl optionally substituted with hydroxyl. 10 is methyl and R 12 is selected from methyl, ethyl, —(CH)(CH)OH, and —(CH)(CH)OH. In some embodiments, in formula (IV-A), R 10is methyl and R 12 is selected from —(CH)(CH)OH, and —(CH)(CH)OH. In some embodiments, in the compound comprising the chemical structure of formula (IV-A), R 10 is methyl and R 12 is selected from —(CH)(CH)OH, and —(CH)(CH)OH. In some embodiments, in formula (IV-A), R 10 and R 12 is independently selected from methyl or ethyl, optionally substituted with one or more hydroxyl. In some embodiments, in Formula (IV-A), R 10 and R 12 In some embodiments, one or both of R in Formula (IV-A) is —(CH)(CH)OH, or —(CH)(CH)OH. 10 is methyl and R 12 is methyl or ethyl substituted with hydroxyl. In some embodiments, R in formula (IV-A) 10 One or both of R 12 is —(CH)(CH)OH in formula (IV-A). In some embodiments, R in formula (IV-A) 10 One or both of R 12 is —(CH2)2(CH2)OH in formula (IV-A).

[0123] In some embodiments, the ionizable lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently attached to the Y moiety of formula (IV-A), where Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A''', or formula B, and R 10 and R 12each independently is a (C1-C4) alkyl optionally substituted with hydroxyl. In some embodiments, the ionizable lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently attached to the Y moiety of formula (IV-A), wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', or formula A''', and R 10 and R 12 each independently is a (C1-C4) alkyl optionally substituted with hydroxyl. In some embodiments, the ionizable lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently attached to the Y moiety of formula (IV-A), wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula B, and R 10 and R 12 Each of is independently (C1-C4) alkyl optionally substituted with hydroxyl.

[0124] In some embodiments, the ionizable lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently attached to the Y moiety of formula (IV-A), where Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A''', or formula B, and R 10 and R 12 each independently is a (C1-C4) alkyl optionally substituted with hydroxyl. In some embodiments, the ionizable lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently attached to the Y moiety of formula (IV-A), wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', or formula A''', and R 10 and R 12 each independently is a (C1-C4) alkyl optionally substituted with hydroxyl. In some embodiments, the ionizable lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently attached to the Y moiety of formula (IV-A), wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula B, and R 10 and R 12 Each of is independently (C1-C4) alkyl optionally substituted with hydroxyl.

[0125] In some embodiments, the ionizable lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently attached to the Y moiety of formula (IV-A), where Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A''', or formula B, and R 10 and R 12 each independently is a (C1-C4) alkyl optionally substituted with hydroxyl. In some embodiments, the ionizable lipid comprises one or more polyunsaturated polyene hydrocarbon chains of formula (IV-A) or a pharmaceutically acceptable salt thereof, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22is a polyene hydrocarbon chain of formula A, formula A', formula A'', or formula A''', and R 10 and R 12 Each of is independently (C1-C4) alkyl optionally substituted with hydroxyl.

[0126] In some embodiments, the ionizable lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently attached to the Y moiety of formula (IV-A), where Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A''', or formula B, and R 10 and R 12 Each of is independently (C1-C4) alkyl optionally substituted with hydroxyl.

[0127] In some embodiments, the ionizable lipid comprises one or more polyunsaturated polyene hydrocarbon chains covalently attached to the Y moiety of formula (IV-A), where Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A''', or formula B, and R 10 and R 12 Each of is independently (C1-C4) alkyl optionally substituted with hydroxyl.

[0128] In some embodiments, the ionizable lipid has formula (IV): [ka] or a pharmaceutically acceptable salt thereof, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of Formula A, Formula A', Formula A'', Formula A''', or Formula B. In some embodiments, the ionizable lipid is of Formula (IV): [ka] or a pharmaceutically acceptable salt thereof, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A. In some embodiments, the ionizable lipid has formula (IV): [ka] or a pharmaceutically acceptable salt thereof, wherein Y is [ka] where n is an integer equal to 2, and R 22 is a polyene hydrocarbon chain of formula A'.

[0129] One aspect of the disclosure provides a compound of Formula I, or a pharmaceutically acceptable salt thereof:

[0130] [ka] wherein Y is independently a methyl or ethyl group; where the two fatty acyl groups have 16-18 carbons and contain two non-conjugated olefins.

[0131] Another aspect of the present disclosure provides a composition comprising an ionizable lipid, wherein the lipidic nanoparticles comprise an ionizable lipid of Formula I, or a pharmaceutically acceptable salt thereof.

[0132] [ka] wherein Y is independently a methyl or ethyl group; where the two fatty acyl groups have a total of 16-18 carbons and contain two olefins separated by 2-4 methylene groups.

[0133] In some embodiments, the two fatty acyl groups have 16 carbons. In some embodiments, the two fatty acyl groups have 17 carbons. In some embodiments, the two fatty acyl groups have 18 carbons.

[0134] In some embodiments, an ionizable lipid of formula IA or a pharmaceutically acceptable salt thereof is provided:

[0135] [ka] wherein a is 1, 2, 3, 4, 5, or 6; b is 2, 3, or 4; c is 3, 4, 5, 6, or 7; the sum of a, b, and c is 10 or 12; and L is [ka] and R 10 and R 12 each independently is a (C1-C4) alkyl optionally substituted with hydroxyl; v is 0 or 1; q is 1, 2, 3, or 4; and q2 is 1 or 2. In some embodiments, in the ionizable lipid of formula IA, v is 0, q is 1, 2, or 3, and the sum of a, b, and c is 12. In some embodiments, in the ionizable lipid of formula IA, v is 1, q is 3 or 4, and the sum of a, b, and c is 12. In some embodiments, in the ionizable lipid of formula IA, R 10 and R 12is independently selected from methyl, ethyl, and propyl, each of which is optionally substituted with a single hydroxyl. In some embodiments, the sum of a, b, and c is 12, and R 10 and R 12 is independently selected from methyl, ethyl, —(CH)(CH)OH, and —(CH)(CH)OH.

[0136] In some embodiments, an ionizable lipid of formula IA', or a pharmaceutically acceptable salt thereof, is provided.

[0137] [ka] wherein a is 1, 2 or 3, c is 3, 4, 5, 6 or 7, and L is [ka] wherein Y' is methyl or ethyl, v is 0 or 1, q is 2, 3 or 4, and q2 is 1 or 2. In some embodiments, in the ionizable lipid of formula I-A', v is 0, q is 1, 2, or 3, and the sum of a and c is 6 or 8. In some embodiments, in the ionizable lipid of formula I-A', v is 1, q is 3 or 4, and the sum of a and c is 6 or 8.

[0138] In some embodiments, an ionizable lipid of formula I-A″, or a pharmaceutically acceptable salt thereof, is provided.

[0139] [ka] wherein a is 4, 5, or 6; b is 2, 3, or 4; c is 3, 4, 5, 6, or 7; and L is [ka] and R 10 and R 12each independently is a (C1-C4) alkyl optionally substituted with hydroxyl; v is 0 or 1; q is 1, 2, 3, or 4; and q2 is 1 or 2. In some embodiments, in the ionizable lipid of formula I-A", v is 0, q is 1, 2, or 3, and the sum of a, b, and c is 12. In some embodiments, in the ionizable lipid of formula I-A", v is 1, q is 3 or 4, and the sum of a, b, and c is 12. In some embodiments, R 10 and R 12 are independently selected from methyl, ethyl, and propyl, each optionally substituted with a single hydroxyl, in the ionizable lipid of formula I-A″. In some embodiments, the sum of a, b, and c is 12, and R 10 and R 12 is independently selected from methyl, ethyl, —(CH)(CH)OH, and —(CH)(CH)OH.

[0140] Another aspect of the present disclosure provides a compound of Formula II, or a pharmaceutically acceptable salt thereof:

[0141] [ka] wherein R is a dialkylamino group-containing substituent of the structure shown above, and the two fatty acyl groups have 16-18 carbons and contain two olefins separated by at least two methylene groups.

[0142] In some embodiments, the two fatty acyl groups have 16 carbons. In some embodiments, the two fatty acyl groups have 17 carbons. In some embodiments, the two fatty acyl groups have 18 carbons.

[0143] Another aspect of the present disclosure provides a compound of formula II-A, or a pharmaceutically acceptable salt thereof:

[0144] [ka] wherein a is 1, 2, 3, 4, 5, or 6, b is 2, 3, or 4, c is 4, 5, 6, 7, or 8, and R2 is [ka] wherein q and q' are each independently 1 or 2; R 10 and R 12 are methyl or ethyl, respectively. In some embodiments, in the ionizable lipid of formula IA, the sum of a, b, and c is 11 or 13. In some embodiments, the ionizable lipid of formula IA is characterized by one or more of the following: a is 1, 2, or 3, q ​​is 2, q' is 1, and R 10 or R 12 At least one of is ethyl. In some embodiments, in the ionizable lipid of Formula II-A, b is 4. In some embodiments, in the ionizable lipid of Formula II-A, a is 4, b is 4, and c is 4. In some embodiments, in the ionizable lipid of Formula II-A, a is 1, b is 4, and c is 8. In some embodiments, in the ionizable lipid of Formula II-A, a is 2, b is 4, and c is 5.

[0145] Another aspect of the present disclosure provides a compound of formula II-A' or a pharmaceutically acceptable salt thereof:

[0146] [ka] wherein a is 1, 2 or 3, b is 2, 3 or 4, c is 4, 5, 6, 7 or 8, and R2 is [ka] wherein q and q' are each independently 1 or 2; R 10 and R 12 are methyl or ethyl, respectively. In some embodiments, in the ionizable lipid of formula I-A', the sum of a, b, and c is 11 or 13. In some embodiments, the ionizable lipid of formula IA is characterized by one or more of the following: q is 2, q' is 1, and R 10 or R 12 At least one of is ethyl. In some embodiments, in the ionizable lipid of Formula II-A', b is 4. In some embodiments, in the ionizable lipid of Formula II-A', a is 4, b is 4, and c is 4. In some embodiments, in the ionizable lipid of Formula II-A', a is 1, b is 4, and c is 8. In some embodiments, in the ionizable lipid of Formula II-A', a is 2, b is 4, and c is 5.

[0147] Another aspect of the present disclosure provides a compound of formula II-B, or a pharmaceutically acceptable salt thereof:

[0148] [ka] wherein a is 5, 6, or 7, c is 3, 4, or 5, and R2 is [ka] wherein q and q' are each independently 1 or 2; R 10 and R 12 are methyl or ethyl, respectively. In some embodiments, in the ionizable lipid of formula IB, the sum of a and c is 9 or 11. In some embodiments, the ionizable lipid of formula IB is characterized by one or more of the following: q is 2, q' is 1, and R 10 or R 12 In some embodiments, the ionizable lipid of formula IB is characterized by one or more of the following: q is 1, q' is 2, and R 10 and R 12are each methyl. In some embodiments, in the ionizable lipid of Formula II-B, c is 4. In some embodiments, in the ionizable lipid of Formula II-B, a is 5 or 7 and c is 4. In some embodiments, in the ionizable lipid of Formula II-B, a is 5 and c is 4. In some embodiments, in the ionizable lipid of Formula II-B, a is 7 and c is 4.

[0149] Another aspect of the present disclosure provides a compound of formula II-B' or a pharmaceutically acceptable salt thereof:

[0150] [ka] wherein a is 5 or 7, c is 3 or 4, and R2 is [ka] wherein q and q' are each independently 1 or 2; R 10 and R 12 are methyl] In some embodiments, in the ionizable lipid of formula I-B', the sum of a and c is 9 or 11. In some embodiments, in the ionizable lipid of formula I-B', c is 4. In some embodiments, in the ionizable lipid of formula II-B', a is 5 or 7 and c is 4. In some embodiments, in the ionizable lipid of formula II-B', a is 5 and c is 4. In some embodiments, in the ionizable lipid of formula II-B', a is 7 and c is 4. In some embodiments, in the ionizable lipid of formula II-B, a is 5 and c is 3. In some embodiments, in the ionizable lipid of formula II-B', a is 7 and c is 3.

[0151] Another aspect of the present disclosure provides a compound of formula III, or a pharmaceutically acceptable salt thereof:

[0152] [ka] wherein Y is a methyl or ethyl group; The two fatty acyl groups are disulfide fatty acyl groups having 16-18 carbons and containing a single olefin.

[0153] In some embodiments, the two fatty acyl groups have 16 carbons. In some embodiments, the two fatty acyl groups have 17 carbons. In some embodiments, the two fatty acyl groups have 18 carbons.

[0154] Another aspect of the present disclosure provides a compound of formula III-A, or a pharmaceutically acceptable salt thereof:

[0155] [ka] wherein a is 5, 6, or 7, c is 3, 4, or 5, q is 2 or 3, and R 10 and R 12 is methyl or ethyl] In some embodiments, the ionizable lipid can comprise a compound of formula III-A, where a is 5 or 7. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A, where the sum of a and c is 8, 9, or 10.

[0156] Another aspect of the present disclosure provides a compound of formula III-A' or a pharmaceutically acceptable salt thereof:

[0157] [ka] wherein a is 5 or 7, c is 3, 4 or 5, q is 2 or 3, and R 10 and R 12 is methyl or ethyl] In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains, where c is 3. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula III-A', where the sum of a and c is 8 or 10. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula III-A', where q is 2 and the sum of a and c is 8 or 10. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula III-A', where q is 2 and R 10 and R 12 and a and c are each methyl, and the sum of a and c is 8 or 10. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula III-A', where q is 2 and R 10 and R 12 and c is 3.

[0158] In some embodiments, the compounds in Formulae I-III have a pKa of 6 to 7. In some embodiments, the lipidic nanoparticle composition comprises a lipid and a nucleic acid, and the lipidic nanoparticle comprises a compound of Formula I, II, III, a combination thereof, or a pharmaceutically acceptable salt thereof.

[0159] In some embodiments, the LNP has formula (IV): [ka] or a pharmaceutically acceptable salt thereof, wherein Y is [ka] and each R 22 are independently alkyl, alkenyl, alkynyl, or heteroalkyl, each optionally being R B is replaced by each R Bis independently alkyl, halo, hydroxy, amino, cycloalkyl, or heterocyclyl, and n is an integer from 1 to 10, inclusive; [ka] indicates the point of attachment.

[0160] In some embodiments, Y is [ka] is.

[0161] In some embodiments, the compound of formula IV has a pKa of 6-7.

[0162] In some embodiments, the ionizable lipid has formula (IV-A): [ka] or a pharmaceutically acceptable salt thereof, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', or formula A''', and R 10 and R 12 Each of R is independently (C1-C4) alkyl optionally substituted with hydroxyl. 10 and R 12 is independently selected from methyl, ethyl, —(CH)(CH)OH and —(CH)(CH)OH.

[0163] In some embodiments, the ionizable lipid has formula (IV-A); [ka] or a pharmaceutically acceptable salt thereof, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A'', or formula A''', or formula B, and R 10 and R 12 Each of R is independently (C1-C4) alkyl optionally substituted with hydroxyl. 10 and R 12 is independently selected from methyl, ethyl, —(CH)(CH)OH and —(CH)(CH)OH.

[0164] In some embodiments, the ionizable lipid has formula (IV-A): [ka] or a pharmaceutically acceptable salt thereof, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A'', or formula A''', or formula B, and R 10 and R 12 Each of R is independently (C1-C4) alkyl optionally substituted with hydroxyl. 10 and R 12 is independently selected from methyl, ethyl, —(CH)(CH)OH and —(CH)(CH)OH.

[0165] In some embodiments, the ionizable lipid has formula (IV-A): [ka] or a pharmaceutically acceptable salt thereof, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A'', or formula A''', or formula B, and R 10 and R 12 Each of R is independently (C1-C4) alkyl optionally substituted with hydroxyl. 10 and R 12 is independently selected from methyl, ethyl, —(CH)(CH)OH and —(CH)(CH)OH.

[0166] In some embodiments, the ionizable lipid has formula (IV-A): [ka] or a pharmaceutically acceptable salt thereof, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A, formula A', formula A'', formula A'', or formula A''', or formula B, and R 10 and R 12 Each of R is independently (C1-C4) alkyl optionally substituted with hydroxyl. 10 and R 12 is independently selected from methyl, ethyl, —(CH)(CH)OH and —(CH)(CH)OH.

[0167] In some embodiments, the compound has the structure of a compound listed in Table 1 or Table 2.

[0168] Table 1A shows examples of cationic lipids. Table 2 shows examples of bioreducible cationic lipids.

[0169] JPEG2023553343000098.jpg180170

[0170] JPEG2023553343000099.jpg162170

[0171] JPEG2023553343000100.jpg151170

[0172] JPEG2023553343000101.jpg163170

[0173] JPEG2023553343000102.jpg184170

[0174] JPEG2023553343000103.jpg141170

[0175] JPEG2023553343000104.jpg110170

[0176] In some embodiments, the ionizable lipid encapsulates the nucleic acid. In some embodiments, the ionizable lipid encapsulates the nucleic acid in the LNP formulation. In some embodiments, the nucleic acid is an siRNA molecule. In some embodiments, the nucleic acid is an mRNA molecule. In some embodiments, the nucleic acid is a DNA molecule.

[0177] In some embodiments, compositions are provided that further comprise a ligand, such as an antibody conjugate to a cell surface receptor, to target the lipid nanoparticle to dendritic cells in a highly specific manner. In some embodiments, the composition further comprises a targeting ligand, which is oriented on the exterior of the nanoparticle. In some embodiments, the targeting ligand is an antibody.

[0178] In some embodiments, the lipid-based nanoparticles are in an aqueous medium.

[0179] In some embodiments, nucleic acid is encapsulated in lipid nanoparticles together with compounds disclosed herein, including compounds of formula I, II, III, IV, or combinations thereof, and nucleic acid is either RNA or DNA.In some embodiments, nucleic acid is encapsulated in lipid nanoparticles together with compounds disclosed herein, including compounds of formula I, IA, II, II-A, II-B, III, III-A, IV, IV-A, IV-B, V, VA, VI-A, VII, VIII, or combinations thereof, and nucleic acid is either RNA or DNA.In some embodiments, nucleic acid is mRNA.In some embodiments, nucleic acid is siRNA.In some embodiments, nucleic acid is DNA.

[0180] In some embodiments, the lipidic nanoparticles comprise a membrane comprising phosphatidylcholine and a sterol. In some embodiments, the sterol is cholesterol. In some embodiments, the lipidic nanoparticles comprise a membrane comprising phosphatidylcholine and an ionizable cationic lipid (ICL). In some embodiments, the ICL has a structure of Formula I, II, III, or IV, and cholesterol, and the membrane separates the interior of the lipidic nanoparticle from the aqueous medium. In some embodiments, the ICL has a structure shown in Tables 1A and 2. In some embodiments, the ICL has a structure shown in Table 1B. In some embodiments, the phosphatidylcholine is distearoylphosphatidylcholine (DSPC) or hydrogenated soybean phosphatidylcholine (HSPC). In some embodiments, the molar ratio of the ionizable cationic lipid to cholesterol is about 65:35 to 40:60. In some embodiments, the molar ratio of the ICL to cholesterol is about 60:40 to about 45:55.

[0181] In some embodiments, the molar ratio of phosphatidylcholine to cholesterol is about 1:5 to about 1:2.

[0182] In some embodiments, the membrane further comprises a polymer-conjugated lipid.

[0183] In some embodiments, the lipidic nanoparticles comprise ICL, DSPC, cholesterol, and polymer-conjugated lipid in a molar ratio of about 49.5:10.3:39.6:2.5.

[0184] In some embodiments, the polymer-conjugated lipid is PEG(2000)-dimyristoylglycerol (PEG-DMG) or PEG(molecular weight 2,000)-dimyristoylphosphatidylethanolamine (PEG-DMPE).

[0185] In some embodiments, the percentage of ionized lipid oxidative degradation products is less than 50% of the DLin-KC2-DMA or DLin-MC3-DMA control formulation.

[0186] In some embodiments, the composition is a liquid pharmaceutical formulation for parenteral administration.

[0187] In some embodiments, the composition is a liquid pharmaceutical formulation for subcutaneous, intramuscular, or intradermal administration.

[0188] In some embodiments, the composition is in the form of a lyophilized powder that is subsequently reconstituted with an aqueous medium prior to administration.

[0189] Another aspect of the present disclosure relates to a method of preventing a bacterial or viral infection, comprising administering to a subject in need thereof an effective amount of a composition provided herein to generate an immune response. Some embodiments provide a method of vaccinating a subject in need thereof, comprising administering a composition comprising a nucleic acid encoding an antigenic protein.

[0190] In some embodiments, the composition is administered subcutaneously, intramuscularly, or intradermally.

[0191] In some embodiments, the bacterial infection is a Mycobacterium tuberculosis infection. In some embodiments, the bacterial infection is a form of nontuberculosis mycobacterium.

[0192] In some embodiments, the viral infection is a coronavirus. In some embodiments, the coronavirus is SARS-CoV, MERS-CoV, or SARS-CoV-2.

[0193] In some embodiments, the viral infection is HIV / AIDs.

[0194] In some embodiments, the lipid nanoparticles are administered parenterally.

[0195] In some embodiments, the lipid-based nanoparticle composition is administered as part of a single dose.

[0196] The present disclosure features lipid nanoparticles containing nucleic acids, such as DNA, mRNA, siRNA, antisense oligonucleotides, CRISPR components, such as guide RNA (gRNA or sgRNA) and CRISPR-associated endonucleases (Cas proteins), and lipids. Exemplary lipids include ionizable cationic lipids (ICLs), phospholipids, sterol lipids, alkylene glycol lipids (e.g., polyethylene glycol lipids), sphingolipids, glycerolipids, glycerophospholipids, prenol lipids, glycolipids, fatty acids, and polyketides. In some embodiments, LNPs contain a single type of lipid. In some embodiments, LNPs contain multiple (e.g., two or more) lipids. LNPs may contain one or more of ionizable cationic lipids, phospholipids, sterols, or alkylene glycol lipids (e.g., polyethylene glycol lipids).

[0197] In one embodiment, the LNP comprises an ionizable cationic lipid. As used herein, the terms "ionizable cationic lipid," "ionizable lipid," and "ICL" are used interchangeably. An ICL is a lipid comprising an ionizable moiety that can bear a charge (e.g., a positive charge, e.g., a cationic lipid) under certain conditions (e.g., under physiological conditions, e.g., within a certain pH range). The ionizable moiety may comprise an amine, preferably a substituted amine. The ionizable lipid may be a cationic lipid or an anionic lipid. In addition to the ionizable moiety, the ionizable lipid may contain, for example, an alkyl or alkenyl group greater than 6 carbon atoms in length (e.g., greater than about 8 carbons, 10 carbons, 12 carbons, 14 carbons, 16 carbons, 18 carbons, 20 or more carbons in length). Additional ionizable lipids that can be included in the LNPs described herein are disclosed in Jayaraman et al. (Angew. Chem. Int. Ed. 51:8529-8533 (2012)), Semple et al. Nature Biotechnol. 28:172-176 (2010)), and U.S. Patent Nos. 8,710,200 and 8,754,062, each of which is incorporated herein by reference.

[0198] In some embodiments, the LNP has formula (IV): [ka] or a pharmaceutically acceptable salt thereof, wherein Y is [ka] and each R 22 is independently alkyl, alkenyl, alkynyl, or heteroalkyl, each of which optionally is R B Each R is replaced by B is independently alkyl, halo, hydroxy, amino, cycloalkyl, or heterocyclyl, and n is an integer from 1 to 10, inclusive; [ka] indicates the point of attachment.

[0199] In some embodiments, Y is [ka] is.

[0200] In some embodiments, the LNP comprises an ionizable lipid having the structure of formula (IV-A) or a pharmaceutically acceptable salt thereof.

[0201] [ka] [In the formula, R 10 and R 12 each independently is a (C1-C4) alkyl optionally substituted with hydroxyl, v is 0 or 1, q1 is 1 or 2, and Y is [ka] and R 22 teeth [ka] where a is 1, 2, 3, 4, or 5, and c is 4, 5, 6, 7, or 8.

[0202] In some embodiments, v of the compound of Formula (IV-B) is equal to 0. In some embodiments, v of the compound of Formula (IV-B) is equal to 1. In some embodiments, v of the compound of Formula (IV-A) is equal to 1 and q1 is equal to 1. In some embodiments, v of the compound of Formula (IV-B) is equal to 1 and q1 is equal to 2.

[0203] In some embodiments, R of the compound of formula (IV-B) 22 wherein the sum of a and c is 6, 7, 8, or 9. In some embodiments, R 22wherein the sum of a and c is 6. In some embodiments, R 22 wherein the sum of a and c is 7. In some embodiments, R 22 In the middle, the sum of a and c is 9.

[0204] In some embodiments, R of the compound of formula (IV-B) 22 wherein v is equal to 0 and the sum of a and c is 6, 7, 8, or 9. In some embodiments, R 22 wherein v is equal to 0 and the sum of a and c is 6. In some embodiments, R 22 wherein v is equal to 0 and the sum of a and c is 7. In some embodiments, R 22 In the middle, v is equal to 0 and the sum of a and c is 9.

[0205] In some embodiments, in compounds of formula (IV-B), R 10 and R 12 is independently selected from methyl, ethyl, —(CH)(CH)OH, and —(CH)(CH)OH. In some embodiments, R of the compound of Formula (IV-B) 22 Medium, R 10 and R 12 are each methyl, and the sum of a and c is 6, 7, 8, or 9. In some embodiments, R 22 Medium, R 10 and R 12 are each methyl, v is 0, and the sum of a and c is 6, 7, 8, or 9.

[0206] In some embodiments, in compounds of Formula (IV-B), v is equal to 0 and R 22 teeth [ka] In some embodiments, in compounds of formula (IV-B), v is equal to 0 and R 22 teeth [ka] and the sum of a and c is 8. In some embodiments, in compounds of Formula (IV-B), v is equal to 0 and R 22 teeth [ka] and a is 1 and c is 7. In some embodiments, in compounds of formula (IV-B), v is equal to 0 and R 22 teeth [ka] where a is 2 and c is 4.

[0207] In some embodiments, in compounds of Formula (IV-B), v is equal to 1 and R 22 teeth [ka] In some embodiments, in compounds of formula (IV-B), v is equal to 1 and R 22 teeth [ka] and the sum of a and c is 8. In some embodiments, in compounds of Formula (IV-B), v is equal to 1 and R 22 teeth [ka] where a is 1 and c is 7.

[0208] In some embodiments, in compounds of Formula (IV-B), v is equal to 0 and R 22 teeth [ka] In some embodiments, in compounds of formula (IV-B), v is equal to 0 and R 22 teeth [ka] and the sum of a and c is 7 or 9. In some embodiments, in compounds of formula (IV-B), v is equal to 0 and R 22 teeth [ka] and a is 4 and c is 5. In some embodiments, in compounds of formula (IV-B), v is equal to 0 and R 22 teeth [ka] and a is 1 and c is 8. In some embodiments, in compounds of formula (IV-B), v is equal to 0 and R 22 teeth [ka] where a is 2 and c is 5.

[0209] In some embodiments, in compounds of Formula (IV-B), v is equal to 0 and R 22 teeth [ka] In some embodiments, in compounds of formula (IV-B), v is equal to 0 and R 2 2 is [ka] and the sum of a and c is 7 or 9. In some embodiments, in compounds of formula (IV-B), v is equal to 0 and R 22 teeth [ka] and a is 4 and c is 5. In some embodiments, in compounds of formula (IV-B), v is equal to 0 and R 22 teeth [ka] and a is 1 and c is 8. In some embodiments, in compounds of formula (IV-B), v is equal to 0 and R 22 teeth [ka] where a is 2 and c is 5.

[0210] LNPs may contain ionized lipids at a concentration of, for example, greater than about 0.1 mol% of the total lipid content of the LNP. In one embodiment, LNPs contain ionized lipids at a concentration of, for example, greater than about 1 mol%, about 2 mol%, about 4 mol%, about 8 mol%, about 20 mol%, about 40 mol%, about 50 mol%, about 60 mol%, or about 80 mol% of the total lipid content of the LNP. In one embodiment, LNPs contain ionized lipids at a concentration of, for example, about 1 mol% to about 95 mol% of the total lipid content of the LNP. In one embodiment, LNPs contain ionized lipids at a concentration of, for example, about 2 mol% to about 90 mol%, about 4 mol% to about 80 mol%, about 10 mol% to about 70 mol%, about 20 mol% to about 60 mol%, or about 40 mol% to about 55 mol% of the total lipid content of the LNP. In one embodiment, the LNPs comprise an ionizable lipid at a concentration of about 20 mol% to about 60 mol%. In one embodiment, the LNPs comprise an ionizable lipid at a concentration of about 40 mol% to about 55 mol%.

[0211] In one embodiment, the LNP comprises a phospholipid. A phospholipid is a lipid comprising a phosphate group and at least one alkyl, alkenyl, or heteroalkyl chain. The phospholipid may be natural or non-natural (e.g., synthetic phospholipid). The phospholipid may comprise an amine, amide, ester, carboxyl, choline, hydroxyl, acetal, ether, carbohydrate, sterol, or glycerol. In some embodiments, the phospholipid may comprise a phosphocholine, a phosphosphingolipid, or a plasmalogen. Exemplary phospholipids include 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), hydrogenated soy phosphatidylcholine (HSPC), 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1-myristoyl-2-oleoyl-sn-glycero-3-phosphocholine (MOPC), 1,2- These include diarachidonoyl-sn-glycero-3-phosphocholine (DAPC), 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphatidylcholine (PLPC), 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC), 1-stearoyl-2-myristoyl-sn-glycero-3-phosphocholine (SMPC), 1-palmitoyl-2-myristoyl-sn-glycero-3-phosphocholine (PMPC), bis(monoacylglycerol)phosphate (BMP), L-α-phosphatidylcholine, 1,2-diheptadecanoyl-sn-glycero-3-phosphorylcholine (DHDPC), and 1-stearoyl-2-arachidonoyl-sn-glycero-3-phosphocholine (SAPC).Additional phospholipids that can be included in the LNPs described herein are disclosed in Li, J. et al. (Asian J. Pharm. Sci. 10:81-98 (2015)), which is incorporated herein by reference.

[0212] In some embodiments, the LNP has formula (V): [ka] or a pharmaceutically acceptable salt thereof, wherein each R 23 is independently alkyl, alkenyl, or heteroalkyl, and each alkyl, alkenyl, or heteroalkyl is optionally joined to R C Each R is replaced by 25 are independently hydrogen or alkyl, and R 24 is absent, hydrogen, or alkyl, and each R C is independently alkyl, halo, hydroxy, amino, cycloalkyl, or heterocyclyl; m is an integer from 1 to 4 (inclusive); and u is 2 or 3.

[0213] In some embodiments, each R 23 are independently alkyl (e.g., C to C 32 Alkyl, C4-C 28 Alkyl, C8-C 24 Alkyl, C 12 ~C 22 Alkyl, or C 16 ~C 20 alkyl). In some embodiments, each R 23 are independently alkenyl (e.g., C to C 32 Alkyl, C4-C 28 Alkenyl, C8-C 24 Alkenyl, C 12 ~C 22 Alkenyl, or C 16 ~C 20 alkenyl). In some embodiments, each R 23 are independently heteroalkyl (e.g., C4-C28 Heteroalkyl, C8-C 24 Heteroalkyl, C 12 ~C 22 Heteroalkyl, C 16 ~C 20 In some embodiments, each R 23 independently, C 16 ~C 20 In some embodiments, each R 23 independently, C 17 In some embodiments, each R 23 is independently heptadecyl. In some embodiments, each R 23 are the same. In some embodiments, each R 23 In some embodiments, each R 23 is optionally R C In some embodiments, R C is independently alkyl, halo, hydroxy, amino, cycloalkyl, or heterocyclyl.

[0214] In some embodiments, R 25 In some embodiments, one of R 25 In some embodiments, one of R 25 In some embodiments, one of R 25 is independently alkyl. In some embodiments, each R 25 is independently methyl. In some embodiments, each R 25 is independently methyl and u is 2. In some embodiments, each R 25 are independently methyl and u is 3.

[0215] In some embodiments, R 24 is absent and the oxygen to which it is attached is negatively charged. 24 is hydrogen.

[0216] In some embodiments, m is an integer from 1 to 10, 1 to 8, 1 to 6, or 1 to 4. In some embodiments, m is 1, 2, 3, or 4. In some embodiments, m is 1. In some embodiments, m is 2. In some embodiments, m is 3.

[0217] In some embodiments, a composition is provided that includes a targeting moiety of both a cationic ionizable lipid and an anionic phospholipid. In some embodiments, the anionic phospholipid is a composition of formula (VA).

[0218] [ka] wherein a is 14 or 16 and z is an amide, glycol, or amidyl-alkyl-carboxylic acid moiety. In some embodiments, Z is [ka] wherein m is 2 or 3. In some embodiments, the anionic phospholipid targeting moiety is selected from the group consisting of DSPS (L isomer), DPPS (L isomer), DMPS (L isomer), DOPS (L isomer), DSPS (D isomer), DSPG, DPPG, N-Glu-DSPE, and N-Suc-DSPE.

[0219] In some embodiments, the phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC). In some embodiments, the phospholipid is 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC). In some embodiments, the phospholipid is 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC). In some embodiments, the phospholipid is 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).

[0220] Phosphatidylserine uptake LNPs (e.g., as described herein) may comprise the following components: (i) an ionizable cationic lipid (ICL) containing a C16 alkyl or C16 alkenyl group or a C18 alkyl or C18 alkenyl group at a concentration of about 1 mol% to about 95 mol% (or any value therebetween, e.g., about 20 mol% to about 80 mol%); (ii) a phospholipid that also contains a C16 or C18 alkyl or alkenyl group at a concentration of 0.1 mol% to about 20 mol% (or any value therebetween, e.g., about 2.5 mol% to about 10 mol%); (iii) a phospholipid that also contains a C16 or C18 alkyl or alkenyl group at a concentration of about 1 mol% to about 95 mol% (or any value therebetween, e.g., about 20 mol% to about 80 mol%); (iv) phosphatidylserine (PS) or phosphatidylglycerol (PG) added to the LNP lipid formulation at a concentration of about 0.5 mol% to about 20 mol%, about 2.5 mol% to about 10 mol%, about 4 mol% to about 8 mol%, or any value therebetween of the total lipid content of the LNP; or (v) polyethylene glycol (PEG)-2000-containing lipids (e.g., DPG-PEG2000, DPPE-PEG2000, DMPE-PEG2000, DMG-PEG2000) at a concentration of about 0.1 mol% to about 5 mol% (or any value therebetween, e.g., about 1 mol% to about 2.5 mol%). In one embodiment, the LNP comprises two of (i)-(v). In one embodiment, the LNP comprises three of (i)-(v). In one embodiment, the LNP comprises four of (i)-(v). In one embodiment, the LNP comprises each of (i) through (v). In some embodiments, the LNP comprises (i) and (ii). In some embodiments, the LNP comprises (i) and (iii). In some embodiments, the LNP comprises (i) and (v). In some embodiments, the LNP comprises (ii) and (iii). In some embodiments, the LNP comprises (ii) and (v). In some embodiments, the LNP comprises (iii) and (iv). In some embodiments, the LNP comprises (iii) and (v). In some embodiments, the LNP comprises (i), (ii), and (iii). In some embodiments, the LNP comprises (i), (ii), and (v).In some embodiments, the LNP comprises (ii), (iii), and (v). In some embodiments, the LNP comprises (ii), (iii), (iv), and (v). In one embodiment, the LNP consists of, or consists essentially of, four of (i) through (v). In one embodiment, the LNP consists of, or consists essentially of, each of (i) through (v). In some embodiments, the LNP consists of, or consists essentially of (i) and (ii). In some embodiments, the LNP consists of, or consists essentially of (i) and (iii). In some embodiments, the LNP consists of, or consists essentially of (i) and (v). In some embodiments, the LNP consists of, or consists essentially of (ii) and (iii). In some embodiments, the LNP comprises (ii) and (v). In some embodiments, the LNP consists of, or consists essentially of (iii) and (iv). In some embodiments, the LNP consists of, or consists essentially of (iii) and (v). In some embodiments, the LNP consists of or consists essentially of (i), (ii), and (iii). In some embodiments, the LNP consists of or consists essentially of (i), (ii), and (v). In some embodiments, the LNP comprises (ii), (iii), and (v). In some embodiments, the LNP consists of or consists essentially of (ii), (iii), (iv), and (v).

[0221] The LNP may comprise phospholipids at a concentration of, for example, greater than about 0.1 mol% of the total lipid content of the LNP. In one embodiment, the LNP comprises phospholipids at a concentration of, for example, greater than about 0.5 mol%, about 1 mol%, about 1.5 mol%, about 2 mol%, about 3 mol%, about 4 mol%, about 5 mol%, about 6 mol%, about 8 mol%, about 10 mol%, about 12 mol%, about 15 mol%, about 20 mol%, or about 50 mol% of the total lipid content of the LNP. In one embodiment, the LNP comprises phospholipids at a concentration of, for example, about 1 mol%, about 5 mol%, or greater than about 10 mol%. In one embodiment, the LNP comprises phospholipids at a concentration of, for example, about 0.1 mol% to about 50 mol% of the total lipid content of the LNP. In one embodiment, the LNP comprises phospholipids at a concentration of, for example, about 0.5 mol% to about 40 mol%, about 1 mol% to about 30 mol%, about 5 mol% to about 25 mol%, about 10 mol% to about 20 mol%, about 10 mol% to about 15 mol%, or about 15 mol% to about 20 mol% of the total lipid content of the LNP. In one embodiment, the LNP comprises phospholipids at a concentration of about 5 mol% to about 25 mol%. In one embodiment, the LNP comprises phospholipids at a concentration of about 10 mol% to 20 mol%.

[0222] In one embodiment, the LNP comprises a sterol or ionized sterol molecule. A sterol is a lipid containing a polycyclic structure and optional hydroxyl or ether substituents, and may be natural or unnatural (e.g., synthetic sterols). A sterol may contain zero, a single, or multiple double bonds. A sterol may further comprise an alkyl, alkenyl, halo, ester, ketone, hydroxyl, amine, polyether, carbohydrate, or cyclic moiety. A sterol may further contain a bioreducible disulfide bond between the dialkylamino group and the polycyclic portion of the molecule (see Table 2, compounds 35-38). An exemplary list of sterols includes cholesterol, dehydroergosterol, ergosterol, campesterol, β-sitosterol, stigmasterol, lanosterol, dihydrolanosterol, desmosterol, brassicasterol, lathosterol, zymosterol, 7-dehydrodesmosterol, avenasterol, campestanol, lupeol, and cycloartenol. In some embodiments, the sterol comprises cholesterol, dehydroergosterol, ergosterol, campesterol, β-sitosterol, or stigmasterol. Additional sterols that can be included in the LNPs described herein are disclosed in Fahy, E. et al. (J. Lipid. Res. 46:839-862 (2005)).

[0223] Ionized sterols In some embodiments, the LNP has formula (VI): [ka] or a pharmaceutically acceptable salt thereof, wherein R 26 is hydrogen, alkyl, heteroalkyl, or -C(O)R D and R 27 is hydrogen, alkyl, or -OR E and R D and R Eeach is independently hydrogen, alkyl, alkenyl, heteroalkyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl, wherein each alkyl, alkenyl, heteroalkyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl is optionally substituted with alkyl, halo, or carbonyl; [ka] is either a single or double bond, and each carbon atom participating in the single or double bond is bonded to 0, 1, or 2 hydrogens, allowing for a valence.

[0224] In some embodiments, [ka] is a single bond. [ka] is a double bond. [ka] are single bonds. In some embodiments, [ka] In some embodiments, two of [ka] is a single bond. In some embodiments, each [ka] is a double bond.

[0225] In some embodiments, the sterol is cholesterol. In some embodiments, the sterol is dehydroergosterol. In some embodiments, the sterol is ergosterol. In some embodiments, the sterol is campesterol. In some embodiments, the sterol is β-sitosterol. In some embodiments, the sterol is stigmasterol. In some embodiments, the sterol is a corticosteroid (e.g., corticosterone, hydrocortisone, cortisone, or aldosterone).

[0226] In some embodiments, the LNP has formula (VI-A): [ka] or a pharmaceutically acceptable salt thereof, wherein q is 3 or 4, and R3 is [ka] is.

[0227] Another aspect of the present disclosure provides a composition comprising an anionic phospholipid of formula (VA) and a branched ionizable lipid of formula (VIII).

[0228] [ka] wherein d is 2, 3, or 4; e and f are each independently 5, 6, or 7; Z1 and Z2 are each independently -OC(O)- or -C(O)-O-; R 14 and R 15 are each independently linear or branched (C 10 ~C 20 ) alkyl] In some embodiments, R in Formula VII 14 and R 15 are respectively, C 14 or C 16In some embodiments, R 14 is C 11 is a linear alkyl, and R 15 is C 14 or C 16 In some embodiments, R in Formula VII is a branched alkyl. 14 is C 11 is a linear alkyl, and R 15 is C 14 or C 16 In some embodiments, R in Formula VII is a straight chain alkyl. 14 and / or R 15 are each independently [ka] wherein g and h are each independently 5, 6, or 7. In some embodiments, R in Formula VII 14 and R 15 are each independently [ka] wherein g and h are both the same and are 5, 6, or 7. In some embodiments, R in Formula VII 14 is a linear C 11 alkyl, and R in Formula VII 15 teeth [ka] wherein g and h are both the same and are 5, 6, or 7.

[0229] In some embodiments, the ionizable lipid may be a branched ionizable lipid selected from ALC-0315 and SM-102.

[0230] [ka]

[0231] The LNP may comprise a sterol at a concentration of, for example, greater than about 0.1 mol% of the total lipid content of the LNP. In one embodiment, the LNP comprises a sterol at a concentration of, for example, greater than about 0.5 mol%, about 1 mol%, about 5 mol%, about 10 mol%, about 15 mol%, about 20 mol%, about 25 mol%, about 35 mol%, about 40 mol%, about 45 mol%, about 50 mol%, about 55 mol%, about 60 mol%, about 65 mol%, or about 70 mol% of the total lipid content of the LNP. In one embodiment, the LNP comprises a sterol at a concentration of, for example, greater than about 10 mol%, about 15 mol%, about 20 mol%, or about 25 mol%. In one embodiment, the LNP comprises a sterol at a concentration of, for example, between about 1 mol% and about 95 mol% of the total lipid content of the LNP. In one embodiment, the LNP comprises a sterol at a concentration of, for example, about 5 mol% to about 90 mol%, about 10 mol% to about 85 mol%, about 20 mol% to about 80 mol%, about 20 mol% to about 60 mol%, about 20 mol% to about 50 mol%, or about 20 mol% to about 40 mol% of the total lipid content of the LNP. In one embodiment, the LNP comprises a sterol at a concentration of about 20 mol% to about 50 mol%. In one embodiment, the LNP comprises a sterol at a concentration of about 30 mol% to about 60 mol%.

[0232] In some embodiments, the LNP comprises an alkylene glycol-containing lipid. The alkylene glycol-containing lipid is a lipid containing at least one alkylene glycol moiety, such as a methylene glycol or ethylene glycol moiety. In some embodiments, the alkylene glycol-containing lipid comprises polyethylene glycol (PEG). The alkylene glycol-containing lipid may be a PEG-containing lipid. The polymer-conjugated lipid may comprise a poly(ethylene glycol)-conjugated (PEGylated) phospholipid (PEG-lipid), such as PEG (molecular weight 2,000) methoxy-poly(ethylene glycol)-1,2-distearoyl-sn-glycerol (PEG-DSG), PEG (molecular weight 2,000) methoxy-poly(ethylene glycol)-1,2-palmitoyl-sn-glycerol (PEG-DPG), PEG (molecular weight 2,000) 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG-DSPE), or N-palmitoyl-sphingosine-1-{succinyl[methoxy(polyethylene glycol)2000]} (PEG-ceramide). The molecular weight of the PEG moiety in the PEG-lipid component can also vary from 500 to 10,000 g / mol, 1,500 to 6,000 g / mol, but is preferably about 2,000 MW. Other polymers used for conjugation to lipid anchors include poly(2-methyl-2-oxazoline) (PMOZ), poly(2-ethyl-2-oxazoline) (PEOZ), poly-N-vinylpyrrolidone (PVP), polyglycerol, poly(hydroxyethyl L-asparagine) (PHEA), and poly(hydroxyethyl L-glutamine) (PHEG).

[0233] PEG-containing lipid can further comprise amine, amide, ester, carboxyl, phosphate, choline, hydroxyl, acetal, ether, heterocycle or carbohydrate.For example, in addition to PEG moiety, PEG-containing lipid can comprise at least one alkyl or alkenyl group, for example, with a length of more than 6 carbon atoms (for example, a length of more than about 8 carbon atoms, 10 carbon atoms, 12 carbon atoms, 14 carbon atoms, 16 carbon atoms, 18 carbon atoms, 20 carbon atoms or more).In one embodiment, PEG-containing lipid comprises a PEG moiety that comprises at least 20 PEG monomers, for example, at least 30 PEG monomers, 40 PEG monomers, 45 PEG monomers, 50 PEG monomers, 100 PEG monomers, 200 PEG monomers, 300 PEG monomers, 500 PEG monomers, 1000 PEG monomers or 2000 PEG monomers. Exemplary PEG-containing lipids include PEG-DMG (e.g., DMG-PEG2k), PEG-c-DMG, PEG-DSG, PEG-DPG, PEG-DSPE, PEG-DMPE, PEG-DPPE, PEG-DOPE, and PEG-DLPE. In some embodiments, the PEG-lipids include PEG-DMG (e.g., DMG-PEG2k), PEG-c-DMG, PEG-DSG, and PEG-DPG. Additional PEG-lipids that can be included in the LNPs described herein are disclosed in Fahy, E. et al. (J. Lipid. Res. 46:839-862 (2005)), which is incorporated herein by reference.

[0234] In some embodiments, the LNP has formula (VII): [ka] or a pharmaceutically acceptable salt thereof, wherein each R 28 are independently alkyl, alkenyl, or heteroalkyl, each optionally being R FA is absent, O, CH, C(O), or NH; E is absent, alkyl, or heteroalkyl, wherein the alkyl or heteroalkyl is optionally substituted with carbonyl; and each R F is independently alkyl, halo, hydroxy, amino, cycloalkyl, or heterocyclyl, and z is an integer from 10 to 200, inclusive.

[0235] In some embodiments, each R 28 is independently alkyl. In some embodiments, each R 28 is independently heteroalkyl. In some embodiments, each R 28 is independently alkenyl.

[0236] In some embodiments, A is O or NH. In some embodiments, A is CH. In some embodiments, A is carbonyl. In some embodiments, A is absent.

[0237] In some embodiments, E is alkyl. In some embodiments, E is heteroalkyl. In some embodiments, A and E are both absent. In some embodiments, A is absent. In some embodiments, E is absent. In some embodiments, either A or E is absent. In some embodiments, both A and E are independently absent.

[0238] In some embodiments, z is an integer of 10 to 200 (e.g., 20 to 180, 20 to 160, 20 to 120, 20 to 100, 40 to 80, 40 to 60, 40 to 50).

[0239] In some embodiments, the PEG-lipid is PEG-DMG (e.g., DMG-PEG2k). In some embodiments, the PEG-lipid is α-(3'-{[1,2-di(myristyloxy)propanoxy]carbonylamino}propyl)-ω-methoxy, polyoxyethylene (PEG-c-DMG). In some embodiments, the PEG-lipid is PEG-DSG. In some embodiments, the PEG-lipid is PEG-DPG.

[0240] The LNP may comprise alkylene glycol-containing lipids at a concentration of, for example, greater than about 0.1 mol% of the total lipid content of the LNP. In one embodiment, the LNP comprises alkylene glycol-containing lipids at a concentration of, for example, greater than about 0.5 mol%, about 1 mol%, about 1.5 mol%, about 2 mol%, about 3 mol%, about 4 mol%, about 5 mol%, about 6 mol%, about 8 mol%, about 10 mol%, about 12 mol%, about 15 mol%, about 20 mol%, or about 50 mol% of the total lipid content of the LNP. In one embodiment, the LNP comprises alkylene glycol-containing lipids at a concentration of, for example, about 1 mol%, about 4 mol%, or greater than about 6 mol%. In one embodiment, the LNP comprises alkylene glycol-containing lipids at a concentration of, for example, about 0.1 mol% to about 50 mol% of the total lipid content of the LNP. In one embodiment, the LNP comprises an alkylene glycol-containing lipid at a concentration of, for example, about 0.5 mol% to about 40 mol%, about 1 mol% to about 35 mol%, about 1.5 mol% to about 30 mol%, about 2 mol% to about 25 mol%, about 2.5 mol% to about 20 mol%, about 3 mol% to about 15 mol%, about 3.5 mol% to about 10 mol%, or about 4 mol% to about 9 mol% of the total lipid content of the LNP. In one embodiment, the LNP comprises an alkylene glycol-containing lipid at a concentration of about 4 mol% to 9 mol%.

[0241] In some embodiments, the LNPs comprise at least two types of lipids. In one embodiment, the LNPs comprise two of an ionizable lipid, a phospholipid, a sterol, and an alkylene glycol-containing lipid. In some embodiments, the LNPs comprise at least three types of lipids. In one embodiment, the LNPs comprise three of an ionizable lipid, a phospholipid, a sterol, and an alkylene glycol-containing lipid. In some embodiments, the LNPs comprise at least four types of lipids. In one embodiment, the LNPs comprise each of an ionizable lipid, a phospholipid, a sterol, and an alkylene glycol-containing lipid.

[0242] LNPs (e.g., as described herein) may comprise one or more of the following components: (i) ionized cationic lipids at a concentration of about 1 mol% to about 95 mol% (e.g., about 20 mol% to about 80 mol%); (ii) phospholipids at a concentration of about 0.1 mol% to about 50 mol% (e.g., about 2.5 mol% to about 20 mol%); (iii) sterols at a concentration of about 1 mol% to about 95 mol% (e.g., about 20 mol% to about 80 mol%); and (iv) PEG-containing lipids at a concentration of about 0.1 mol% to about 50 mol% (e.g., about 2.5 mol% to about 20 mol%). In one embodiment, the LNP comprises one of (i) to (iv). In one embodiment, the LNP comprises two of (i) to (iv). In one embodiment, the LNP comprises three of (i) to (iv). In one embodiment, the LNP comprises each of (i) to (iv). In some embodiments, the LNP comprises (i) and (ii). In some embodiments, the LNP comprises (i) and (iii). In some embodiments, the LNP comprises (i) and (iv). In some embodiments, the LNP comprises (ii) and (iii). In some embodiments, the LNP comprises (ii) and (iv). In some embodiments, the LNP comprises (iii) and (iv). In some embodiments, the LNP comprises (i), (ii), and (iii). In some embodiments, the LNP comprises (i), (ii), and (iv). In some embodiments, the LNP comprises (ii), (iii), and (iv).

[0243] LNPs (e.g., as described herein) may comprise one or more of the following components: (i) ionized cationic lipid at a concentration of about 1 mol% to about 95 mol% (e.g., about 20 mol% to about 80 mol%); (ii) DSPC at a concentration of about 0.1 mol% to about 50 mol% (e.g., about 2.5 mol% to about 20 mol%); (iii) cholesterol at a concentration of about 1 mol% to about 95 mol% (e.g., about 20 mol% to about 80 mol%); or (iv) DMG-PEG2k at a concentration of about 0.1 mol% to about 50 mol% (e.g., about 2.5 mol% to about 20 mol%). In one embodiment, the LNP comprises two of (i) to (iv). In one embodiment, the LNP comprises three of (i) to (iv). In one embodiment, the LNP comprises each of (i) to (iv). In some embodiments, the LNP comprises (i) and (ii). In some embodiments, the LNP comprises (i) and (iii). In some embodiments, the LNP comprises (i) and (iv). In some embodiments, the LNP comprises (ii) and (iii). In some embodiments, the LNP comprises (ii) and (iv). In some embodiments, the LNP comprises (iii) and (iv). In some embodiments, the LNP comprises (iii) and (iv). In some embodiments, the LNP comprises (i), (ii), and (iii). In some embodiments, the LNP comprises (i), (ii), and (iv). In some embodiments, the LNP comprises (ii), (iii), and (iv).

[0244] In one embodiment, the LNPs have an ionizable lipid to phospholipid ratio of about 50:1 to about 1:1 (e.g., 40:1, 32:3, 6:1, 7:1, 5:1, 24:5, 26:5, 10:3, 15:2, 16:7, 18:1, 3:1, 3:2, or 1:1). In one embodiment, the LNPs have an ionizable lipid to phospholipid ratio of about 15:2. In one embodiment, the LNPs have an ionizable lipid to phospholipid ratio of about 5:1. In one embodiment, the LNP has an ionizable lipid to sterol ratio of about 10:1 to about 1:10 (e.g., 9:1, 8:1, 8:7, 7:1, 7:5, 7:3, 6:1, 6:5, 5:1, 5:3, 4:1, 4:3, 3:1, 2:1, 1:1, 1:2, 1:3, 3:4, 1:4, 3:5, 1:5, 4:5, 1:6, 5:6, 7:6, 7:8, or 8:9). In one embodiment, the LNP has a ratio of ionizable lipid to alkylene-containing lipid of about 1:10 to about 10:1 (e.g., 1:9, 1:8, 7:8, 7:1, 7:5, 7:3, 6:1, 6:5, 5:1, 5:3, 4:1, 4:3, 3:1, 2:1, 1:1, 1:2, 1:3, 3:4, 1:4, 3:5, 1:5, 4:5, 1:6, 5:6, 7:6, 7:8, or 8:9). In one embodiment, the LNP has a ratio of phospholipid to alkylene-containing lipid of about 10:1 to about 1:10 (e.g., 9:1, 8:1, 8:7, 7:1, 7:5, 7:3, 6:1, 6:5, 5:1, 5:3, 4:1, 4:3, 3:1, 2:1, 1:1, 1:2, 1:3, 3:4, 1:4, 3:5, 1:5, 4:5, 1:6, 5:6, 7:6, 7:8, or 8:9). In one embodiment, the LNP has a sterol to alkylene-containing lipid ratio of about 50:1 to about 1:1 (e.g., 40:1, 32:3, 6:1, 7:1, 5:1, 24:1, 22:1, 20:1, 22:5, 24:5, 26:5, 10:3, 15:2, 16:7, 18:1, 3:1, 3:2, or 1:1).

[0245] In one embodiment, the LNP (e.g., as described herein) comprises two of an ionizable lipid, a phospholipid, a sterol, and an alkylene glycol-containing lipid (e.g., a PEG-containing lipid). In another embodiment, the LNP (e.g., as described herein) comprises three of an ionizable lipid, a phospholipid, a sterol, and an alkylene glycol-containing lipid (e.g., a PEG-containing lipid). In one embodiment, the LNP (e.g., as described herein) comprises each of an ionizable lipid, a phospholipid, a sterol, and an alkylene glycol-containing lipid (e.g., a PEG-containing lipid).

[0246] In some embodiments, the LNPs described herein have a diameter of 5 to 500 nm, e.g., 10 to 400 nm, 20 to 350 nm, 25 to 325 nm, 30 to 300 nm, 50 to 250 nm, 60 to 200 nm, 75 to 190 nm, 80 to 180 nm, 100 to 200 nm, 200 to 300 nm, and 150 to 250 nm. The diameter of the LNPs can be determined by any method known in the art, such as dynamic light scattering, transmission electron microscopy (TEM), or scanning electron microscopy (SEM). In some embodiments, the LNPs have a diameter of 50 to 100 nm, 70 to 100 nm, and 80 to 100 nm. In one embodiment, the LNPs have a diameter of about 90 nm. In some embodiments, the LNPs described herein have a diameter of greater than about 30 nm. In some embodiments, the LNPs have a diameter of greater than about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 60 nm, about 70 nm, about 80 nm, about 90 nm, about 100 nm, about 120 nm, about 140 nm, about 160 nm, about 180 nm, about 200 nm, about 225 nm, about 250 nm, about 275 nm, or about 300 nm. In one embodiment, the LNPs have a diameter of greater than about 70 nm. In one embodiment, the LNPs have a diameter of greater than about 90 nm. In one embodiment, the LNPs have a diameter of greater than about 180 nm.

[0247] In some embodiments, the LNPs described herein have an average diameter ranging from about 40 nm to about 180 nm. In some embodiments, the LNPs described herein have an average diameter ranging from about 50 nm to about 150 nm. In some embodiments, the LNPs described herein have an average diameter ranging from about 50 nm to about 120 nm. In some embodiments, the LNPs described herein have an average diameter ranging from about 60 nm to about 120 nm. In some embodiments, the LNPs have an average diameter of about 40 nm, about 45 nm, about 50 nm, about 60 nm, about 70 nm, about 80 nm, about 90 nm, about 100 nm, about 120 nm, about 140 nm, about 160 nm, or about 180 nm.

[0248] In some embodiments, a nanoparticle or nanoparticles described herein have an average neutral to negative surface charge of less than -100mv, e.g., less than -90mv, -80mv, -70mv, -60mv, -50mv, -40mv, -30mv, and -20mv. In some embodiments, a nanoparticle or nanoparticles have a neutral to negative surface charge of -100mv to 100mv, -75mv to 0, or -50mv to -10mv.

[0249] In some embodiments, at least 5% (e.g., at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%) of the nanoparticles have an average neutral to negative surface charge of less than -100mv. In some embodiments, the nanoparticle or nanoparticles have an average surface charge of -20mv to +20, -10mv to +10mv, or -5mv to +5mv at pH 7.4. Neutral LNPs have improved pharmacokinetics and biological performance compared to cationic LNPs.

[0250] Generation of lipid nanoparticles (LNPs) The method for producing LNPs can include mixing a first solution with a second solution. Mixing can be achieved using standard liquid mixing techniques, such as propeller mixing, vortexing the solution, or preferably by microfluidic mixing or high-efficiency T-mixing. In some embodiments, the first solution contains one or more lipids and nucleic acids, and all components are solubilized in a water / solvent system. The solvent can be any water-miscible solvent (e.g., ethanol, methanol, isopropanol, acetonitrile, dimethylformamide, dimethyl sulfoxide, dioxane, or tetrahydrofuran). In some embodiments, the first solution contains a small proportion of water or pH-buffered water. The first solution may contain at least up to 60% water by volume, e.g., at least about 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, or up to 60% water by volume. In one embodiment, the first solution contains between about 0.05% and 60% water by volume, e.g., between about 0.05% and 50%, between about 0.05% and 40%, or between about 5% and 20% water by volume.

[0251] In some embodiments, the first solution contains a single type of lipid, such as an ionizable lipid, a phospholipid, a sterol, or a PEG-containing lipid. In some embodiments, the first solution contains a plurality of lipids. In some embodiments, the plurality includes an ionizable lipid, a phospholipid, a sterol, or a PEG-containing lipid. In some embodiments, the plurality of lipids includes cholesterol, 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dimyristoyl-rac-glycero-3-methylpolyoxyethylene 2000 (DMG-PEG2k) or α-(3'-{[1,2-di(myristyloxy)propanoxy]carbonylamino}propyl)-ω-methoxy, polyoxyethylene (PEG2000-C-DMG), and an ionizable lipid. The plurality of lipids can be present in any ratio. In one embodiment, the plurality of lipids comprises ionizable lipids or sterols, phospholipids, sterols, PEG-containing lipids of the above lipids, or combinations thereof, in specific ratios (eg, ratios described herein).

[0252] In some embodiments, the second solution is water. In some embodiments, the second solution is an aqueous buffer solution having a pH of 3 to 6 (e.g., a pH of about 3, about 4, about 5, or about 6). The second solution may contain a loading component, such as a nucleic acid (e.g., mRNA). The second solution may contain a minor proportion of a water-miscible organic solvent. The second solution may contain up to at least 60% by volume of at least one water-miscible organic solvent, for example, at least about 0.05%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or any volume percentage therebetween of at least one organic solvent (e.g., a water-miscible organic solvent). In one embodiment, the second solution contains about 0.05% to 60% by volume of an organic solvent, e.g., about 0.05% to 50% by volume, about 0.05% to 40% by volume, or about 5% to 20% by volume of an organic solvent (e.g., a water-miscible organic solvent). The aqueous buffer solution may be an aqueous solution of a citrate buffer. In some embodiments, the aqueous buffer solution is a citrate buffer having a pH of 4 to 6 (e.g., a pH of about 4, about 5, or about 6). In one embodiment, the aqueous buffer solution is a citrate buffer having a pH of about 6.

[0253] In some embodiments, the solution comprising a mixture of the first and second solutions comprising the LNP suspension may be diluted. In some embodiments, the pH of the solution comprising a mixture of the first and second solutions comprising the LNP suspension may be adjusted. Dilution or pH adjustment of the LNP suspension may be achieved by adding water, an acid, a base, or an aqueous buffer. In some embodiments, the LNP suspension is not diluted or pH adjusted. In some embodiments, the LNP suspension is both diluted and pH adjusted.

[0254] In some embodiments, excess reagents, solvents, and unencapsulated nucleic acids can be removed from the LNP suspension by tangential flow filtration (TFF) (e.g., hemodiafiltration). Organic solvents (e.g., ethanol) and buffers can also be removed from the LNP suspension by TFF. In some embodiments, the LNP suspension undergoes dialysis and does not undergo TFF. In some embodiments, the LNP suspension undergoes TFF and does not undergo dialysis. In some embodiments, the LNP suspension undergoes both dialysis and TFF.

[0255] In one aspect, the disclosure features a method that includes treating an LNP sample containing nucleic acid with a fluid containing a detergent (e.g., Triton X-100, or an anionic detergent (such as, but not limited to, sodium dodecyl sulfate (SDS)), or a non-ionic detergent (such as, but not limited to, β-octylglucoside), or an amphoteric detergent 3-14) for a period of time suitable to release the encapsulated and / or entrapped nucleic acid by degrading the lipid layer. In one embodiment, the method further includes analyzing the sample for the presence, absence, and / or amount of released nucleic acid.

[0256] Ligand-containing LNPs Some aspects of the present disclosure relate to LNPs that comprise a ligand (also referred to herein as a targeting ligand) that has binding specificity for a cell surface antigen, where binding of the ligand to the antigen triggers internalization of the ligand. Some embodiments relate to compositions that include LNPs that comprise the ligands described herein.

[0257] In some embodiments, the targeting ligand is coupled to the lipid complex. For example, the lipid complex may be a hydrophilic polymer-lipid complex, such as, but not limited to, PEG(2000)-DSPE or PEG(2000)-DSG. Coupling can be achieved by various chemistries known in the art (see, for example, Bioconjugates Techniques (Greg T. Hermanson), 3rd Edition, 2013, Elsevier). In some embodiments, the targeting ligand is coupled to the lipid complex via a linker. The linker molecule generally contains a hydrophilic polymer chain, such as a lipid domain (phospholipid or sterol) linked to a PEG terminus, and contains a thiol-reactive functional group, such as maleimide, at the terminus. Linkers containing phosphatidylethanolamine (PE) lipid anchors of various sizes and hydrocarbon chain lengths, and PEG spacers with terminal maleimide or iodoacetate groups, are currently commercially available from Avanti Polar Lipids (Alabama, USA) and NOF Corporation (Japan). One commonly used strategy involves coupling proteins to a thiol-reactive lipopolymer linker, such as 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[maleimide(polyethylene glycol)-2000] (Mal-PEG-DSPE). Preferably, the protein of interest is engineered to contain a single C-terminal cysteine ​​to ensure single-point conjugation. Alternatively, F(ab)2 or Fab' can be enzymatically generated from IgG by reduction of the disulfide bond with a reducing agent, such as dithiothreitol (DTT), mercaptoethylamine, or (tris(2-carboxyethyl)phosphine)TCEP-HCl, which is reactive to cysteine ​​thiol groups, for coupling to Mal-PEG-DSPE. The reaction of Mal-PEG-DSPE via reduction of the cysteine ​​occurs in an aqueous buffer solution at pH 5.5-7.5, e.g., pH 5.5, 6, 6.5, 7, or 7.5, preferably pH 6.0. The reaction is typically complete within 4 hours.Adding a small amount of cysteine ​​or mercaptoethanol quenches the coupling reaction by reacting with any unreacted maleimide groups. While it is not necessary to remove unconjugated protein prior to the subsequent membrane insertion step, it is useful to purify the complex for storage purposes and to enable more precise characterization. Due to the large size of the lipopolymer micelles (equivalent molecular weight of 850 kDa, Nellis et al., 2005a), size-exclusion chromatography (SEC) is a convenient method. Characterization of such protein complexes can be achieved by a variety of techniques. For example, purity is determined by SEC, molecular weight by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), protein melting point by differential scanning calorimetry (DSC), isoelectric point by capillary electrophoresis, and target binding affinity by surface plasmon resonance (BIAcore) and biolayer interferometry (ForteBio).

[0258] Examples of targeting ligands may be antibodies or antibody fragments against cell surface receptors, including Her2 receptor, epidermal growth factor receptor (EGFR), ephrin A2 receptor, CLEC9A receptor, DEC205 receptor, CLEC4A receptor, XCR1 receptor, CD141 receptor, HLA-DR receptor, transferrin receptor type 1, transferrin receptor type 2, VEGF receptor, PDGF receptor, integrins, NGF receptor, CD19, CD20, CD22, CD33, CD43, CD38, CD56, CD69, prostate-specific membrane antigen (PSMA) or a variety of other cell surface receptors, or glycoconjugates, proteoglycans, glycoproteins, and glycolipids, such as glycoconjugate N-acetylgalactosamine (GalNAc) ligands that bind the asialoglycoprotein receptor (ASGPR), or small molecule conjugates, such as folate PEG-DSPE, that target the folate receptor.

[0259] In one embodiment, the targeting ligand is an anti-DEC205 antibody. DEC205 (CD205) is a type I cell surface protein expressed primarily by dendritic cells (DCs). It is found on interdigitating DCs in the T cell region of lymphoid tissues, bone marrow-derived DCs, Langerhans cells, and at low levels on macrophages and T cells, and is significantly upregulated during DC maturation. DEC-205 expression is positively correlated with CD8a expression, both of which are found at high levels on lymphoid DCs and at low levels on bone marrow DCs. DEC-205 is also expressed at moderate levels by B cells and is upregulated during the transition from pre-B cells to B cells. Recombinant anti-human DEC205 antibody is commercially available from Creative Biolabs.

[0260] In one embodiment, antigen-specific targeting on LNPs is achieved by co-incubating LNPs with a targeting ligand-lipid complex to prepare a ligand-targeted LNP. The targeting ligand-lipid complex may be prepared before preparing the LNPs (see Nellis et al. Biotechnol Prog. 2005 Jan-Feb;21(1):205-20).

[0261] In one embodiment, LNPs are co-incubated with antibody or fragment-PEG-phospholipid micelle or other ligand conjugates and heated at 37°C overnight to promote insertion of the antibody conjugate into the LNP outer membrane (Nellis et al. Biotechnol Prog. 2005 Jan-Feb;21(1):221-32). In another embodiment, insertion can be achieved by heating at an elevated temperature for a shorter period of time, e.g., 0.5-8 hours at 37°C, or preferably 0.5-2 hours at 37°C. Micelle insertion can be stopped by placing the LNPs on ice (which can then be stored in a refrigerator at 4°C) to rapidly cool the temperature. The total amount of lipid conjugate added can be 0.02%-2%, or preferably 0.1%-1%, or preferably 0.1%-0.5% of the total lipid. The uptake efficiency of antibody-lipid complexes can be measured by SDS-PAGE after LNP dissociation with SDS or other detergents (compared to a standard curve of the same protein) (Nellis et al. Biotechnol Prog. 2005 Jan-Feb;21(1):205-20). The uptake efficiency of other target ligands can be measured by ultra-high performance liquid chromatography with evaporative light scattering detection (UPLC-ELSD) (Gauthier et al., J Mol Sci. 2019 Nov 12;20(22):5669).

[0262] Figure 2 shows the reaction of the reduced C-terminal cysteine ​​of a Fab' antibody fragment with maleimide-terminated poly(ethylene glycol) 2000-derivatized distearoylphosphatidylethanolamine. R1 and R2 are stearic acid. The final antibody-lipopolymer conjugate is an intermediate that is subsequently inserted into the outer lipid layer of lipid nanoparticles for active targeting.

[0263] Targeting of LNPs can also be achieved by adding lipids to the formulation. For example, phosphatidylserine is known to redistribute to the outer surface of the plasma membrane during apoptosis and is a molecular stimulus for phagocytic cell attraction (Fadok et al. Curr Biol. 2003 Aug 19;13(16):R655-7). Phosphatidylserine (PS) and phosphatidylglycerol (PG) are recognized by dendritic cells and can induce dendritic cell uptake and activation. Targeting of LNPs can also be achieved by adding specific anionic phospholipids to the formulation (Table 3). For example, phosphatidylserine is known to redistribute to the outer surface of the plasma membrane during apoptosis and is a molecular stimulus for phagocytic cell attraction (Fadok et al. Curr Biol. 2003 Aug 19;13(16):R655-7). Phosphatidylserine (PS) and phosphatidylglycerol (PG) can be recognized by dendritic cells and induce their uptake and activation (Caronni et al., Nat Comm. 2021 April 14;12:2237-2253; Ischihashi et al., PLOS One 2013). Although anionic phospholipids have been previously used in the context of liposomes, their inclusion in lipidic nanoparticles containing condensed nucleic acids is unexpected because the anionic headgroup may compete for the binding sites of ionized cationic lipids with the phosphate backbone of mRNA, inhibit intracellular egress by altering surface charge, or lead to aggregation of LNPs during formation or storage.

[0264] JPEG2023553343000148.jpg195170

[0265] In one embodiment, the anionic targeting ligand is selected from the group consisting of phosphatidylserine (PS), phosphatidylglycerol (PG), N-glutaryl-phosphatidylethanolamine (N-glu-PE), or N-succinyl-phosphatidylethanolamine (N-Suc-PE). In one embodiment, the anionic phospholipid used is phosphatidylserine. In another embodiment, the phosphatidylserine contains the L-isomer of serine. In another embodiment, the acyl chain of the phosphatidylserine is fully saturated, such as in the case of dimyristoylphosphatidyl-L-serine (DMPS), dipalmitoylphosphatidyl-L-serine (DPPS), or distearoylphosphatidyl-L-serine (DSPS). In a preferred embodiment, the PS used is the L-isomer of either DPPS or DSPS. Phosphatidylserine may also contain asymmetric acyl chain compositions, for example, where one acyl chain is stearic acid and the other is palmitic acid.

[0266] In one embodiment, PS or PG is added to the LNP lipid formulation at a concentration of about 0.1 mol% to about 20 mol%, about 0.1 mol% to about 10 mol%, about 0.1 mol% to about 5 mol%, about 0.5 mol% to about 20 mol%, about 0.5 mol% to about 10 mol%, about 0.5 mol% to about 5 mol%, about 1 mol% to about 20 mol%, about 1 mol% to about 10 mol%, or about 1 mol% to about 5 mol% of the total lipid content of the LNP. In one embodiment, PS is added to the LNP lipid formulation at a concentration of about 1 mol% to about 20 mol%, about 2.5 mol% to about 10 mol%, about 3 mol% to about 9 mol%, or about 4 mol% to about 8 mol% of the total lipid content of the LNP.

[0267] In one embodiment, the PS lipids are included in an LNP composition that includes ionizable cationic lipids known in the art, including DODAP, AKG-OA-DM2, O-11769, DLin-MC3-DMA, DLin-KC2-DMA, DLin-KC3-DMA, ALC-0315, and SM-102.

[0268] In another embodiment, the PS lipid is included in an LNP composition comprising an ICL of Formula I, II, III, a combination thereof, or a pharmaceutically acceptable salt thereof. In another embodiment, the PS lipid is included in the LNP composition using an N / P ratio of 3-8, 4-7, or 5-6.

[0269] In some embodiments, a method of delivering a nucleic acid to a cell is provided, comprising contacting the cell with a composition comprising an LNP that comprises a ligand (also referred to herein as a targeting ligand) having binding specificity for a cell surface antigen, wherein binding of the ligand to the antigen triggers internalization of the ligand. In some embodiments, the targeting ligand may be, but is not limited to, an internalizing antibody or fragment thereof, a small molecule conjugate, or a glycoconjugate. In some embodiments, binding of the targeting ligand to a specific cell surface antigen triggers internalization of the LNP, and when contacted and incubated with a cell under internalizing conditions, the targeting ligand linked to the cell expresses at least 100,000 or at least 1,000,000 antigen molecules.

[0270] JPEG2023553343000149.jpg212170

[0271] JPEG2023553343000150.jpg78170

[0272] composition In some embodiments, the lipidic nanoparticle composition comprises a lipid and a nucleic acid, and the lipidic nanoparticle comprises a compound of Formula I, II, III, a combination thereof, or a pharmaceutically acceptable salt thereof.

[0273] In some embodiments, the LNP comprises an ionizable lipid having the structure of formula (IV).

[0274] In some embodiments, the composition further comprises a pharmaceutical excipient.

[0275] In some embodiments, the lipid-based nanoparticles are in an aqueous medium.

[0276] In some embodiments, nucleic acid is encapsulated in lipid nanoparticles with the compound of formula I, II, III, IV or combinations thereof, and nucleic acid is either RNA or DNA.In some embodiments, nucleic acid is mRNA.In some embodiments, nucleic acid is siRNA.In some embodiments, nucleic acid is DNA.

[0277] In some embodiments, the lipidic nanoparticles comprise a membrane comprising phosphatidylcholine and a sterol. In some embodiments, the sterol is cholesterol. In some embodiments, the lipidic nanoparticles comprise a membrane comprising phosphatidylcholine and an ionizable cationic lipid (ICL). In some embodiments, the ICL has a structure of Formula I, II, III, or IV and cholesterol, and the membrane separates the interior of the lipidic nanoparticle from the aqueous medium. In some embodiments, the ICL has a structure shown in Tables 1A and 2. In some embodiments, the ICL has a structure shown in Table 1B. In some embodiments, the phosphatidylcholine is distearoylphosphatidylcholine (DSPC) or hydrogenated soybean phosphatidylcholine (HSPC). In some embodiments, the molar ratio of the ionizable cationic lipid to cholesterol is about 65:35 to 40:60. In some embodiments, the molar ratio of the ICL to cholesterol is about 60:40 to about 45:55.

[0278] In some embodiments, the molar ratio of phosphatidylcholine to cholesterol is about 1:5 to about 1:2.

[0279] In some embodiments, the membrane further comprises a polymer-conjugated lipid.

[0280] In some embodiments, the lipidic nanoparticles comprise ICL, DSPC, cholesterol, and polymer-conjugated lipid in a molar ratio of about 49.5:10.3:39.6:2.5.

[0281] In some embodiments, the polymer-conjugated lipid is PEG(2000)-dimyristoylglycerol (PEG-DMG) or PEG(molecular weight 2000)-dimyristoylphosphatidylethanolamine (PEG-DMPE).

[0282] The compositions of the present disclosure can be administered by a variety of routes, for example, intravenously, parenterally, intraperitoneally, or locally, for systemic delivery. The compositions can be administered to a subject intravenously, subcutaneously, or intraperitoneally. In some embodiments, the present disclosure provides methods for in vivo delivery of nucleic acids to a subject.

[0283] In some embodiments, the composition is a liquid pharmaceutical formulation for oral administration.

[0284] In some embodiments, the composition is a liquid pharmaceutical formulation for subcutaneous, intramuscular, or intradermal administration.

[0285] In some embodiments, the composition is in the form of a lyophilized powder, which is subsequently reconstituted with an aqueous medium prior to administration.

[0286] How to use Targeting dendritic cells Dendritic cells (DCs) are specialized antigen-presenting cells that play a central role in initiating and regulating adaptive immunity. Due to their potent antigen (Ag) presentation and ability to generate unique T cell responses, efficient and specific delivery of Ags to DCs is the basis for generating Ag-specific effector and memory cells against tumors or pathogens.

[0287] Dendritic cells can be generated from human blood monocytes by differentiating monocyte-derived DCs in vitro with the addition of granulocyte-macrophage colony-stimulating factor (GM-CSF), IL-4, and IFN-gamma. In culture, the cells exhibit both dendritic and veiled morphologies, the former being attached and the latter being suspended. Phenotypically, these are CD1a- / dim, CD11a+, CD11b++, CD11c+, CD14dim / -, CD16a- / dim, CD18+, CD32dim / -, CD33+, CD40+, CD45R0+, CD50+, CD54+, CD64- / dim, CD68+, CD71+, CD80dim, CD86+ / ++, MHC class I++ / , HLA-DR++ / , HLA-DP+, and HLA-DQ (Geiseler et al. Dev Immunol. 1998;6(1-2):25-39).

[0288] Alternatively, human primary blood dendritic cell lines have been developed and are commercially available from Creative Biolabs.

[0289] CD8+ T cells can produce cytokines known to have important functions during M. tuberculosis infection, including IL2, IFN-γ, and TNF. Importantly, CD8+ T cells possess cytolytic functions to kill M. tuberculosis-infected cells via granule-mediated mechanisms (perforin, granzymes, and granulysin) or Fas-Fas ligand interactions to induce apoptosis. In humans, CD8+ T cells can produce granulysin, which can directly kill M. tuberculosis. Therefore, it is anticipated that antigen-generating mRNA LNPs delivered to DCs will stimulate CD8+ T cell responses to combat M. tuberculosis infection.

[0290] CD8+ T cells can recognize tuberculosis (M. tuberculosis)-specific antigens (as peptides) presented by classical and non-classical MHC molecules. Classically restricted CD8+ T cells have been identified that recognize antigens presented by antigen-presenting cells in the context of classical MHC Ia (HLA-A, B, C) molecules. Non-classically restricted CD8+ T cells include CD8+ T cells that can recognize Mg antigens in the context of MHC I-related molecules (MR1), such as HLA-E molecules (non-MHC Ia), glycolipids associated with group 1 CD1 molecules, and mucosal-associated invariant T cell (MAIT) molecules. Finally, γδ T cells represent a distinct population of CD8 (and CD4) T cells with both innate and adaptive functions in response to M. tuberculosis infection. CD8+ T cells have been shown to function directly in response to M. tuberculosis infection but also play an important role in coordinating many different functions in the overall host immune response, such as their interactions to provide optimal CD4 T cell function.

[0291] In one embodiment, LNPs can be added to cultured human dendritic cells at an appropriate concentration (e.g., 1-5 μg / mL mRNA). After allowing time for cellular uptake and antigen expression, human T cells (HemaCare) can be added, and the cell culture medium is sampled at various time points for INF-γ by ELISA (R&D Systems, DIF50C). Alternatively, cells can be analyzed by flow cytometry for CD8+ markers or intracellular INF-γ production (PE anti-human IFN-γ antibody, Biolegend).

[0292] In one embodiment, LNPs can be administered to a subject at a dose of 0.01 to 5 mg / kg mRNA via any of the routes summarized above. According to some embodiments, a proportion of LNPs are taken up by DC cells, but most accumulate in the liver and spleen. DC cells express antigenic peptides, process them for MHC I presentation, and can migrate to lymph nodes to present them to naive T cells, which induces memory T cell education against the antigen.

[0293] In one embodiment, LNPs modified with a targeting ligand, such as anti-DEC205-PEG-DSPE, can be administered to a subject at a dose of 0.01 to 5 mg / kg mRNA. According to some embodiments, a higher percentage of LNPs can be taken up by DC cells, increasing the production of antigenic peptides compared to non-targeted LNPs and enabling more effective vaccination against pathogens. Additional targeting ligands for dendritic cells include, but are not limited to, CLEC9A, CLEC4A, XCR1, CD141, and HLD-DR. For example, assessment of CD8+ reactivity to in vivo-generated antigens can be achieved by measuring IFN-gamma plasma levels using species-specific IFN-gamma Quantikine ELISA Kits (R&D Systems).

[0294] In some embodiments, the LNP compositions provide desirable pharmacokinetic properties, such as extended plasma half-life and stable encapsulation of mRNA. Plasma half-life can be measured as the percentage of the injected dose (ID) remaining in the blood 6 or 24 hours after intravenous injection in immunocompetent mice. Plasma mRNA encapsulation stability over 24 hours can be determined by the change in the mRNA to lipid ratio (mRNA / L ratio) after intravenous administration in mice. In some embodiments, the percentage of encapsulated mRNA remaining in the blood is greater than 20%, preferably greater than 30%, and most preferably greater than 40% of the injected dose at 6 hours. The percentage retained in the blood after 24 hours is preferably greater than 10%, more preferably greater than 20% of the injected dose.

[0295] Disclosed herein are methods for preventing mycobacterial infections, such as Mycobacterium tuberculosis, or Gram-positive bacteria, such as methicillin-resistant Staphylococcus aureus (MRSA). Additional mycobacteria and gram-positive bacteria include, but are not limited to, Mycobacterium avium complex, Mycobacterium leprae, Mycobacterium gordonae, Mycobacterium abscessus, Mycobacterium abscessus, Mycobacterium mucogenicum, streptococci, vancomycin-resistant enterococci (VRE), Staphylococcus pneumoniae, Enterococcus faecium, Streptococcus agalactiae, Streptococcus pneumoniae, and Streptococcus faecium. pneumoniae, Streptococcus pyogenes (pyogenes streptococcus), viridans group streptococci, Listeria monocytogenes, Nocardia, and Corynebacterium.

[0296] Administration of the vaccine to elicit a second immune response can provide an MHC class II-presented epitope capable of inducing a CD4+ helper T cell response against cells expressing an antigen that induces the MHC-presented epitope. Alternatively, or in addition, administration of the vaccine to elicit a second immune response can provide an MHC class I-presented epitope capable of inducing a CD8+ T cell response against cells expressing an antigen that induces the MHC-presented epitope. Furthermore, administration of the vaccine to elicit a second immune response can provide one or more neo-epitopes (including known neoepitopes) and one or more epitopes that do not contain cancer-specific somatic mutations but are expressed by cancer cells, and preferably elicit an immune response against the cancer cells, preferably a cancer-specific immune response. In one embodiment, administration of the vaccine to induce a second immune response provides neo-epitopes that are MHC class II-presented epitopes and / or that can induce a CD4+ helper T cell response against cells expressing an antigen that induces the MHC-presented epitope, as well as epitopes that are MHC class I-presented epitopes and / or that can induce a CD8+ T cell response against cells expressing an antigen that induces the MHC-presented epitope, and that do not contain cancer-specific somatic mutations. In one embodiment, the epitopes do not contain cancer-specific somatic mutations.

[0297] The terms "cellular immune response," "cellular response," "cellular response to antigen," or synonyms are meant to include cellular responses directed toward cells characterized by the presentation of antigens with class I or class II MHC. Cellular responses involve cells called T cells or T-lymphocytes, which act as either "helper cells" or "killer cells." Helper T cells (also called CD4+ T cells) play a central role by orchestrating the immune response, while killer cells (also called cytotoxic T cells, cytolytic T cells, CD8+ T cells, or CTLS) kill abnormal cells, such as cancer cells, and prevent the production of more abnormal cells. In a preferred embodiment, the present disclosure calls for the stimulation of an anti-tuberculosis CTL response against mycobacteria expressing one or more expressed antigens, preferably presenting the expressed antigens with class I MHC.

[0298] An "antigen" according to the present disclosure encompasses any substance that elicits an immune response. In particular, "antigen" refers to any substance, preferably a peptide or protein, that specifically reacts with antibodies or T-lymphocytes (T cells). As used herein, the term "antigen" includes any molecule that contains at least one epitope. Preferably, an antigen in the context of the present disclosure is a molecule that, optionally after processing, elicits an immune response, preferably specific to the antigen (including cells that express the antigen). According to the present disclosure, any suitable antigen that is a candidate for an immune response (preferably a cellular immune response) may be used. In the context of the embodiments of the present disclosure, the antigen is preferably presented by cells, preferably antigen-presenting cells, including abnormal cells, particularly cancer cells, and an immune response against the antigen occurs in the context of MHC molecules. The antigen is preferably a product corresponding to or derived from a natural antigen. Such natural antigens may include tumor antigens.

[0299] As used herein, "antigenic peptide" refers to a portion or fragment of an antigen that can stimulate an immune response, preferably a cellular response, against an antigen or cells characterized by antigen expression, preferably antigen presentation, such as abnormal cells, particularly cancer cells. Preferably, the antigenic peptide is capable of stimulating a cellular response against cells characterized by antigen presentation with class I MHC, preferably capable of stimulating antigen-responsive cytotoxic T lymphocytes (CTLs). Preferably, the antigenic peptide according to the present disclosure is an MHC class I- and / or class II-presented peptide, or can be processed to generate an MHC class I- and / or class II-presented peptide. Preferably, the antigenic peptide comprises an amino acid sequence substantially corresponding to the amino acid sequence of a fragment of the antigen. Preferably, the fragment of the antigen is an MHC class I- and / or class II-presented peptide. Preferably, the antigenic peptide according to the present disclosure comprises an amino acid sequence substantially corresponding to the amino acid sequence of the fragment, and is processed to generate the fragment, i.e., an MHC class I- and / or class II-presented peptide derived from the antigen. When the peptides are presented directly, i.e. without processing, and in particular without cleavage, they have a length suitable for binding to MHC molecules, in particular class I MHC molecules, and are preferably 7 to 20 amino acids in length, more preferably 7 to 12 amino acids in length, more preferably 8 to 11 amino acids in length, in particular 9 or 10 amino acids in length.

[0300] The main type of professional antigen-presenting cell is the dendritic cell, which has the broadest range of antigen presentation, and is perhaps the most important antigen-presenting cell, along with macrophages, B cells, and certain activated epithelial cells. Dendritic cells (DCs) are a population of leukocytes that present antigens captured in peripheral tissues to T cells via the MHC class II and I antigen presentation pathways. Dendritic cells are potent inducers of immune responses, and activation of these cells is well known to be a critical step for eliciting antitumor immunity. Dendritic cells are conveniently classified as "immature" and "mature" cells, which can be used as a simple way to distinguish between two well-characterized phenotypes.

[0301] However, this nomenclature should not be interpreted as excluding all possible intermediate stages of differentiation. Immature dendritic cells are characterized as antigen-presenting cells with a high capacity for antigen uptake and processing, which correlates with high expression of Fcγ receptors and mannose receptors. The mature phenotype is typically characterized by low expression of these markers, while high expression of cell surface molecules involved in T cell activation, such as class I and class II MHC, adhesion molecules (e.g., CD54 and CD11), and costimulatory molecules (e.g., CD40, CD80, CD86, and 4-1BB), is present. Dendritic cell maturation is referred to as the state of dendritic cell activation, in which antigen-presenting dendritic cells lead to T cell priming, while presentation by immature dendritic cells leads to tolerance. Dendritic cell maturation is primarily triggered by innate receptors (bacterial DNA, viral RNA, endotoxin, etc.), inflammatory cytokines (TNF, IL-1, IFN), ligation of CD40 on the dendritic cell surface by CD40L, and biomolecules bearing microbial characteristics detected by substances released from cells undergoing stressful cell death. Dendritic cells can be induced in vitro by culturing bone marrow cells with cytokines such as granulocyte-macrophage colony-stimulating factor (GM-CSF) and tumor necrosis factor alpha. Non-professional antigen-presenting cells do not constitutively express MHC class II proteins, which are required for interaction with naive T cells; these proteins are expressed only upon stimulation of non-professional antigen-presenting cells with specific cytokines such as IFNγ. "Antigen-presenting cells" can be loaded with MHC class I-presented peptides by transducing the cells with nucleic acids, preferably mRNA, encoding the peptide or polypeptide containing the peptide to be presented, e.g., a nucleic acid encoding an antigen.

[0302] In some embodiments, a pharmaceutical composition containing a gene delivery vehicle targeting dendritic cells or other antigen-presenting cells can be administered to a patient, resulting in transfection occurring in vivo. As used herein, "nucleic acid" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), more preferably RNA, most preferably in vitro transcribed RNA (IVT RNA) or synthetic RNA. According to the present disclosure, nucleic acid includes genomic DNA, cDNA, mRNA, recombinantly produced, and chemically synthesized molecules. According to the present disclosure, nucleic acids can exist as single- or double-stranded, linear, or covalently closed circular molecules. According to the present disclosure, nucleic acids can be isolated. The term "isolated nucleic acid" means that the nucleic acid has been (i) amplified in vitro, e.g., via polymerase chain reaction (PCR), (ii) produced by recombinant technology by cloning, (iii) purified, e.g., by cleavage and separation by gel electrophoresis, or (iv) synthesized, e.g., by chemical synthesis. Nucleic acids can be used for introduction into cells, i.e., for transfection of cells, especially in the form of RNA, which can be prepared by in vitro transcription from a DNA template. Furthermore, the RNA can be modified before application by sequence stabilization, capping, and polyadenylation.

[0303] As used herein, the term "RNA" refers to a molecule comprising, preferably entirely or substantially composed of, ribonucleotide residues. "Ribonucleotide" refers to a nucleotide having a 2' hydroxyl group of a BD-ribofuranosyl group. The term "RNA" includes double-stranded RNA, single-stranded RNA, isolated RNA (e.g., partially or entirely purified RNA), essentially pure RNA, synthetic RNA, and RNA produced by recombinant technology (e.g., modified RNA that differs from natural RNA by the addition, deletion, substitution, and / or modification of one or more nucleotides). Such modifications can include the addition of non-nucleotide material, for example, at one or more nucleotides of the RNA, for example, at the end or within the RNA. Nucleotides in RNA molecules can also include non-standard nucleotides, such as unnatural or chemically synthesized nucleotides or deoxynucleotides. These modified RNAs can be referred to as analogs or analogs of natural RNA.

[0304] As used herein, the term "RNA" includes and preferably relates to "mRNA." The term "mRNA" refers to "messenger RNA" and refers to a "transcript" generated using a DNA template and encodes a peptide or polypeptide. Typically, mRNA includes a 5'-UTR, a protein-coding region, and a 3'-UTR. mRNA has a limited half-life within cells and in vitro. In the context of the present disclosure, mRNA can be generated by in vitro transcription from a DNA template. As used in the present disclosure, the term "modified" in the context of RNA includes any modification of RNA that is not naturally present in the RNA. In one embodiment of the present disclosure, RNA used in accordance with the present disclosure does not have uncapped 5'-triphosphates. Removal of such uncapped 5'-triphosphates can be achieved by treating the RNA with a phosphatase. RNA according to the present disclosure can have modified ribonucleotides to improve its stability and / or reduce cytotoxicity. For example, in one embodiment, in the case of cytidine in an RNA used in accordance with the present disclosure, 5-methylcytidine is partially or fully substituted, preferably fully substituted. Alternatively or additionally, in one embodiment, in the case of uridine in an RNA used in accordance with the present disclosure, pseudouridine is partially or fully substituted, preferably fully substituted.

[0305] In one embodiment, the term "modification" refers to producing RNA with a 5'-cap or 5'-cap analog. The term "5'-cap" refers to a cap structure present at the 5'-end of an mRNA molecule, generally consisting of a guanosine nucleotide attached to the mRNA via a non-normal 5'-5 triphosphate linkage. In one embodiment, the guanosine is methylated at the 7 position. The term "conventional 5'-cap" refers to a natural RNA 5'-cap, preferably a 7-methylguanosine cap (m'G). As used herein, the term "5'-cap" includes 5'-cap analogs that resemble the RNA cap structure and are preferably modified to have the ability to stabilize RNA in vivo and / or in cells and / or enhance translation of RNA (when attached to RNA).

[0306] According to the present disclosure, the stability and translation efficiency of RNA may be modified as needed. For example, RNA can be stabilized and its translation can be increased by one or more modifications having a stabilizing effect on RNA and / or improved translation efficiency. Such modifications are described, for example, in PCT / EP2006 / 009448, which is incorporated herein by reference. To increase the expression of RNA used according to the present disclosure, modifications can be made within the coding region, i.e., the sequence encoding the expressed peptide or protein, preferably without modifying the sequence of the expressed peptide or protein, to increase the GC content and perform codon optimization to improve mRNA stability and thus enhance intracellular translation.

[0307] Aspects of the present disclosure relate to methods of preventing bacterial or viral infections, comprising administering to a subject in need thereof an effective amount of a composition produced herein to elicit an immune response.

[0308] Aspects of the present disclosure provide a method for vaccinating a subject, comprising administering to the subject a single dose of a composition described herein, comprising a nucleic acid (e.g., mRNA) encoding a polypeptide in an amount effective to vaccinate the subject. In some embodiments, the nucleic acid is formulated in cationic lipid nanoparticles. In some embodiments, the lipid nanoparticle composition is administered by a single injection.

[0309] In some embodiments, the bacterial infection is a Mycobacterium tuberculosis infection.

[0310] In some embodiments, the viral infection is a coronavirus. In some embodiments, the coronavirus is SARS-CoV, MERS-CoV, or SARS-CoV-2.

[0311] In some embodiments, the viral infection is HIV / AIDS.

[0312] In some embodiments, the lipid nanoparticles are administered parenterally.

[0313] Generally, administration to patients can be by intradermal injection. However, injection can also be performed intramuscularly into lymph nodes (Maloy et al. (2001), Proc Natl Acad Sci USA 98:3299-3033). The resulting cells present the target complex and are recognized by autologous cytotoxic T lymphocytes, which then proliferate.

[0314] In some embodiments, the composition is administered by inhalation, hi some embodiments, the composition is formulated as a nasal spray and / or aerosol.

[0315] Actual dosage levels of the active agents in the pharmaceutical compositions disclosed herein may be varied to obtain an amount of the active agent that is effective to achieve the desired therapeutic response for a particular patient, composition, and method of administration without causing toxicity to the patient.

[0316] As used herein in the context of administration, "parenteral" means modes of administration other than enteral and topical administration, usually by injection, and includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intrathecal, epidural, and intrasternal injection and infusion.

[0317] As used herein, the phrases "parenteral administration" and "administered parenterally" refer to methods of administration other than enteral (i.e., via the digestive tract) and topical administration, usually by injection or infusion, and include, but are not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, inhalation, subcapsular, subarachnoid, respiratory mucosal, intrathecal, epidural, and intrasternal injection and infusion. Intravenous injection and infusion are often (but not exclusively) used to administer liposomal drugs.

[0318] Dosage regimens can be adjusted to provide the optimum desired response (e.g., therapeutic response). For example, one or more doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation.

[0319] In some embodiments, the dose comprises 0.01 to 5 mg / kg of nucleic acid. In some embodiments, the dose comprises 0.01 to 5 mg / kg of mRNA. In some embodiments, the dose comprises 0.01 to 3 mg / kg of nucleic acid. In some embodiments, the dose comprises 0.01 to 3 mg / kg of mRNA. In some embodiments, the dose comprises 0.01 to 1 mg / kg of nucleic acid. In some embodiments, the dose comprises 0.01 to 1 mg / kg of mRNA. In some embodiments, the dose comprises 0.01 to 0.5 mg / kg of nucleic acid. In some embodiments, the dose comprises 0.01 to 0.5 mg / kg of mRNA. In some embodiments, the dose comprises 0.01 to 1 mg / kg of mRNA. In some embodiments, the dose comprises 0.01 to 0.1 mg / kg of nucleic acid. In some embodiments, the dose comprises 0.01 to 0.05 mg / kg of mRNA. In some embodiments, the dose comprises 0.01 to 0.1 mg / kg of nucleic acid. In some embodiments, the dose comprises 0.01 to 0.05 mg / kg of mRNA.

[0320] The dosage of the compound and / or its pharmaceutically acceptable salt or LNP comprising the compound and / or its pharmaceutically acceptable salt can vary within wide limits and should necessarily be adjusted in each particular case to suit the individual condition and pathogen to be controlled.

[0321] Additional Embodiments 1. A compound of formula I or a pharmaceutically acceptable salt thereof.

[0322] 2. A compound of formula II or a pharmaceutically acceptable salt thereof:

[0323] 3. A compound of formula III or a pharmaceutically acceptable salt thereof:

[0324] 4. A compound of formula IV or a pharmaceutically acceptable salt thereof:

[0325] 5. Compounds having the structure in Table 1A.

[0326] 6. A bioreductive compound having the structure in Table 2.

[0327] 7. A compound having a pKa of 6 to 7, the compound of any one of embodiments 1 to 6 above.

[0328] 8. A lipidic nanoparticle composition comprising an ionizable lipid of formula I or a pharmaceutically acceptable salt thereof, and a nucleic acid.

[0329] 9. A lipidic nanoparticle composition comprising an ionizable lipid of formula II or a pharmaceutically acceptable salt thereof, and a nucleic acid.

[0330] 10. A lipidic nanoparticle composition comprising an ionizable lipid of formula III or a pharmaceutically acceptable salt thereof, and a nucleic acid.

[0331] 11. A lipidic nanoparticle composition comprising an ionizable lipid of formula IV or a pharmaceutically acceptable salt thereof, and a nucleic acid.

[0332] 12. The composition of any one of embodiments 8 to 11 above, wherein the ionizable lipid encapsulates the nucleic acid.

[0333] 13. The composition of any one of embodiments 8 to 11, wherein the nucleic acid is an siRNA.

[0334] 14. The composition of any one of embodiments 8 to 11, wherein the nucleic acid is DNA.

[0335] 15. The composition of any one of embodiments 8 to 11, wherein the nucleic acid is mRNA.

[0336] 16. The composition of any one of embodiments 8-11, further comprising a sterol, a phosphatidylcholine, or a combination thereof.

[0337] 17. The composition of embodiment 16, wherein the sterol is cholesterol.

[0338] 18. The composition of embodiment 17, wherein the molar ratio of ionizable lipid to cholesterol is from about 65:35 to about 40:60.

[0339] 19. The composition of embodiment 17, wherein the molar ratio of ionizable lipid to cholesterol is from about 60:40 to about 45:55.

[0340] 20. The composition of embodiment 17, wherein the molar ratio of phosphatidylcholine to cholesterol is from about 1:5 to about 1:2.

[0341] 21. The composition of embodiment 17, further comprising a polymer-conjugated lipid.

[0342] 22. The composition of embodiment 21, wherein the polymer-conjugated lipid comprises PEG(2000)-dimyristoylglycerol (PEG-DMG) or PEG(molecular weight 2,000)-dimyristoylphosphatidylethanolamine (PEG-DMPE).

[0343] 23. The composition of any one of embodiments 8-11, further comprising a targeting ligand, wherein the targeting ligand is oriented on the exterior of the nanoparticle.

[0344] 24. The composition of embodiment 23, wherein the targeting ligand is an antibody.

[0345] 25. The composition of any one of embodiments 8 to 11, which is a liquid pharmaceutical formulation.

[0346] 26. The composition of any one of embodiments 8-11, wherein the percentage of oxidative degradation products in the case of ionized lipids is less than 50% of the oxidative degradation products in the case of the DLin-KC2-DMA or DLin-MC3-DMA control formulation.

[0347] 27. A method for preventing a bacterial or viral infection, comprising administering to a subject in need thereof an effective amount of the composition of any one of embodiments 9-26 and a pharmaceutical excipient, wherein the administration induces an immune response.

[0348] 28. The method of embodiment 27, wherein the composition is administered subcutaneously, intramuscularly, or intradermally.

[0349] 29. The method of embodiment 27, wherein the bacterial infection is a Mycobacterium tuberculosis infection.

[0350] 30. The method of embodiment 27, wherein the viral infection is a SARS-CoV, MERS-CoV or SARS-CoV-2 infection.

[0351] 31. The method of embodiment 27, wherein the viral infection is an HIV infection.

[0352] 32. The method of embodiment 27, wherein the infection is of a non-tuberculous form.

[0353] 33. A lipid nanoparticle (LNP) composition comprising an ionizable lipid having a chemical structure consisting of a pair of 16 or 18 carbon linear polyunsaturated lipid tails covalently attached to a head group comprising a dialkylamino group having a pKa of 6-7, the head group comprises a heterocyclyl or alkyl moiety covalently bonded to a dialkylamino group, and optionally further comprises a phosphate group; A composition wherein each polyunsaturated lipid tail is unsaturated except for at least two olefins separated by at least two methylene groups along the length of the lipid tail, and optionally comprises a single acyl group at the terminus covalently bonded to the head group.

[0354] 34. The composition of embodiment 33, wherein each lipid tail is identical and each lipid tail has a total of two olefins separated only by unsubstituted ethylene, n-propyl, or n-butyl.

[0355] 35. The composition of embodiment 34, wherein each lipid tail further comprises an acyl group that bonds with an oxygen of the head group to form an ester.

[0356] 36. Each lipid tail has the formula A: [ka] [wherein in Formula A, a is 1, 2, 3 or 4, b is 2, 3 or 4, and in Formula A, c is 3, 4, 5, 6 or 7] or Formula B: [ka] 35. The composition of embodiment 34, having a chemical structure: wherein in Formula B, a is 5, 6, or 7; and in Formula B, c is 3, 4, or 5.

[0357] 37. The composition of embodiment 36, wherein b is 4.

[0358] 38. Ionized lipids are [ka] wherein R 22 is the first end of the lipid tail, [ka] 37. The composition of claim 36, wherein indicates the attachment of the head group to the dialkylamino portion of the head group.

[0359] 39. The dialkylamino portion of the head group has formula (IV-A): [ka] In formula (IV-A), n is 2, 3 or 4, and in formula (IV-A), R 10 and R 12 are each independently selected from an alkyl group selected from the group consisting of methyl, ethyl, and propyl; R 10 and R 12 The composition of embodiment 38, wherein the alkyl in is optionally substituted with one or more hydroxyl.

[0360] 40. R in formula (IV-A) 10 and R 12is each independently methyl, ethyl, —(CH 2 )(CH 2 )OH, or —(CH 2 ) 2 (CH 2 )OH.

[0361] 41. An ionizable lipid has the formula (IA): [ka] wherein a is 1, 2, 3, 4, 5, or 6, b is 2, 3, or 4, c is 3, 4, 5, 6, or 7, and the sum of a, b, and c is 10 or 12; and R 10 and R 12 each independently is a (C1-C4) alkyl optionally substituted with one or more hydroxyl; and L is [ka] 34. The composition of embodiment 33, wherein v is 0 or 1 and q2 is 1 or 2.

[0362] 42. The composition of claim 41, wherein v is 0.

[0363] 43. The composition of claim 41, wherein v is 1.

[0364] 44. An ionizable lipid has the formula II-A: [ka] wherein a is 1, 2, 3, 4, 5, or 6, b is 2, 3, or 4, c is 4, 5, 6, 7, or 8, and R2 is [ka] q and q' are each independently 1 or 2; R 10 and R 12 The composition of embodiment 33, wherein each is (C1-C4) alkyl optionally substituted with hydroxyl.

[0365] 45. An ionizable lipid has the formula II-A: [ka] wherein a is 5, 6, or 7, c is 3, 4, or 5, and R2 is [ka] q and q' are each independently 1 or 2; R 10 and R 12 The composition of embodiment 33, wherein each is (C1-C4) alkyl optionally substituted with hydroxyl. [Example]

[0366] While the present disclosure has been described in connection with particular embodiments and numerous details have been set forth for illustrative purposes, it will be apparent to those skilled in the art that the present disclosure includes additional embodiments and that some of the details described herein may be varied considerably without departing from the present disclosure. The present disclosure includes such additional embodiments, modifications, and equivalents. In particular, the present disclosure includes any combination of features, terms, or elements of the various exemplary components and examples.

[0367] Unless expressly stated otherwise, the isomeric form of the phosphatidylserine lipid used in the examples is phosphatidyl-L-serine.

[0368] Specific examples are provided below to illustrate various embodiments of the presently disclosed embodiments. Those skilled in the art will appreciate that the presently disclosed embodiments are not limited to these specific illustrative examples.

[0369] [Example 1A] Synthesis of ionizable lipids Scheme 1. Synthesis of acid intermediates for AKG-UO-1 to AKG-UO-3

[0370] [ka]

[0371] The acid intermediates (6Z,12Z)-6,12-octadecadienoic acid and (6Z,12Z)-6,12-hexadecadienoic acid shown below were prepared by general synthesis. (S)-4-(Dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate) (AKG-UO-1, O-11956) (S)-4-(Diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate) (AKG-UO-1A, O-11955) (S)-4-(Dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4, O-12401) (S)-4-(Diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4A, O-12402) (S)-4-(Dimethylamino)butane-1,2-diyl(6Z,6'Z,11Z,11'Z)-bis(octadeca-6,11-dienoate) (AKG-UO-1a)

[0372] [ka] Experimental procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0373] [ka] To a solution of 5-bromo-1-pentanol 1 (3.6 g, 21.6 mmol) in dichloromethane (100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol) at 0 °C was added 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol). The resulting solution was stirred at room temperature for 1 h and then quenched with water. The mixture was extracted with ethyl acetate (2 × 100 mL). The combined organics were washed with brine, then dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 5–10% ethyl acetate in n-hexane as the eluent to give 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (4.5 g, 83%) as a clear oil. 1H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H), 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). Synthesis of 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 4

[0374] [ka] To a solution of 1,7-octadiyne 3 (6 mL, 45.4 mmol) and hexamethylphosphoramide (16 mL, 90.8 mmol) in tetrahydrofuran (100 mL) was added dropwise [2.5 M n-butyllithium in n-hexane] (18 mL, 45.4 mmol) at −78° C. Upon completion of the addition, the solution was stirred at −78° C. for 1 h and then warmed to −20° C. for an additional 1 h. The resulting solution was cooled again to −78° C., at which point a solution of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (5.67 g, 22.7 mmol) in tetrahydrofuran (10 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 h. After 12 h, the reaction was cooled to 0° C. and quenched with water (100 mL). The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran and then diluted with n-hexane. The organics were washed with water and brine (2 × 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil weighing 9 g. The crude oil was purified by chromatography on silica using 5–10% ethyl acetate in n-hexane as eluent to give 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 4 (4.5 g, 72%) as a clear oil. 1H NMR (300 MHz, d6.DMSO): δ ppm 4.544.53 (m, 1H), 3.72-3.61 (m, 1H), 3.60-3.58 (m, 1H), 3.43-3.33 (m, 1H), 3.32-3.29 (m, 1H), 2.77-2.75 (t, J = 5.8 Hz, 1H), 2.16-2.13 (m, 6H), 1.55-1.41 (m, 16H). Representative Procedure for Alkylation of Alkynes Synthesis of 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 7

[0375] [ka] To a solution of 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 4 (7.14 g, 25.86 mmol) and hexamethylphosphoramide (18 mL, 103.4 mmol) in tetrahydrofuran (100 mL) was added dropwise 2.5 M n-butyllithium in n-hexane (41.3 mL, 103.4 mmol) at −78° C. Upon completion of the addition, the solution was stirred at −78° C. for 1 h and then warmed to −20° C. for an additional 1 h. The resulting solution was cooled once more to −78° C., at which point a solution of 1-iodopropane 5 (9.9 mL, 103.4 mmol) in tetrahydrofuran (20 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 h. After 12 h, the reaction was cooled to 0° C. and quenched with water (100 mL). The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran and then diluted with n-hexane. The organics were washed with water and brine (2 x 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil weighing 9 g. The crude oil was purified by chromatography on silica using 5% ethyl acetate in n-hexane as the eluent to give 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 7 (5.9 g, 72%) as a clear oil. 1H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H), 3.50-3.39 (m, 1H), 3.37-3.36 (m, 1H), 2.16-2.11 (m, 8H), 1.59-1.56 (m, 2H), 1.55-1.47 (m, 16H), 0.98-0.93 (t, J = 1.6 Hz, 3H). 2-(octadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 8

[0376] [ka] 1H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.85-3.74 (m, 1H), 3.73-3.70 (m, 1H), 3.50-3.38 (m, 1H), 3.36-3.35 (m, 1H), 2.23-2.12 (m, 8H), 1.61-1.54 (m, 2H), 1.53-1.48 (m, 16H), 1.47-1.46 (m, 4H), 0.90-0.85 (t, J = 1.6 Hz, 3H). Representative Procedure for the Reduction of Alkynes to Alkenes Using P-2Ni Synthesis of 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran 9

[0377] [ka] To a solution of sodium borohydride (0.56 g, 14.8 mmol) in ethanol (80 mL) was added nickel(II) acetate tetrahydrate (3.22 g, 12.98 mmol) under a hydrogen blanket at 0 °C. Upon completion of the addition, the reaction was evacuated under vacuum and flushed with hydrogen. After stirring for 10 min, a solution of ethylenediamine (3.7 mL, 65.6 mmol) and 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 7 (5.9 g, 18.55 mmol) in ethanol (10 mL) was added. The reaction was stirred under a hydrogen balloon at room temperature for 4 h. After 4 h, the reaction mixture was evacuated with hydrogen and then flushed with nitrogen. The crude mixture was filtered over Celite, and the filtrate was concentrated under vacuum to give a crude oil weighing 4 g. The crude oil was purified by chromatography on silica using 5-10% diethyl ether in n-hexane as eluent to give 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran, 9 (4.67 g, 78% yield) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H), 3.51-3.39 (m, 1H), 3.36-3.35 (m, 1H), 2.03-1.98 (m, 8H), 1.57-1.39 (m, 2H), 1.38-1.36 (m, 6H), 1.35-1.32 (m, 10H), 0.91-0.86 (t, J = 1.6 Hz, 3H). 13C NMR (300 MHz, CDCl3): 129.98, 129.85, 98.93, 77.53, 77.10, 76.68, 67.72, 62.43, 30.86, 29.71, 29.70, 29.45, 29.46, 29.44, 27.20, 27.19, 26.01, 25.59, 22.98, 19.78, 13.91. 2-(((6Z,12Z)-octadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran 10

[0378] [ka] 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.76 (m, 1H), 3.74-3.68 (m, 1H), 3.51-3.41 (m, 1H), 3.39-3.36 (m, 1H), 2.14-1.97 (m, 8H), 1.56-1.38 (m, 2H), 1.37-1.35 (m, 6H), 1.34-1.28 (m, 14H), 0.93-0.85 (t, J = 1.6 Hz, 3H). 13C NMR (300 MHz, CDCl3): 130.13, 129.97, 129.84, 129.71, 98.93, 77.53, 77.10, 76.68, 67.71, 62.42, 31.62, 30.86, 29.72, 29.71, 29.47, 29.46, 27.27, 27.18, 26.01, 25.59, 22.67, 19.78, 14.18. Representative procedure for the deprotection of tetrahydropyranyl ethers (THP) Synthesis of (6Z,12Z)-hexadeca-6,12-dien-1-ol 11

[0379] [ka] To a solution of 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran, 9 (4.67 g, 14.5 mmol) in methanol (20 mL) at room temperature was added p-toluenesulfonic acid monohydrate (300 mg, 1.58 mmol). The resulting solution was stirred at room temperature for 3 h and then quenched with water. The mixture was extracted with ethyl acetate (2 × 50 mL). The combined organics were washed with water, then dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil weighing 4 g. The crude oil was purified by chromatography on silica using 5–10% diethyl ether in n-hexane as eluent to give (6Z,12Z)-hexadeca-6,12-dien-1-ol, 11 (2.5 g, 72%) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.34-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.00 (m, 8H), 1.36-1.34 (m, 2H), 1.34-1.25 (m, 10H), 0.89-0.86 (t, J = 0.82 Hz, 3H). (6Z,12Z)-Octadeca-6,12-dien-1-ol 12

[0380] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.01 (m, 8H), 1.36-1.35 (m, 2H), 1.34-1.25 (m, 14H), 0.88-0.85 (t, J = 0.76 Hz, 3H). Representative Procedure for Oxidation of Alcohols to Carboxylic Acids Using Jones Reagent Synthesis of (6Z,12Z)-hexadeca-6,12-dienoic acid 13

[0381] [ka] A mixture of (6Z,12Z)-hexadeca-6,12-dien-1-ol, 11 (2.5 g, 10.5 mmol) and Jones reagent [2 M in sulfuric acid] (10.5 mL, 21 mmol) in acetone (20 mL) was stirred at 0 °C for 2 h. The mixture was quenched with water and extracted with ethyl acetate (2 × 100 mL). The combined organics were dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 20% ​​ethyl acetate in n-hexane as eluent to give (6Z,12Z)-hexadeca-6,12-dienoic acid, 13 (1.7 g, 68%) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.33 (m, 4H), 2.37-2.32 (t, 2H), 2.06-1.98 (m, 8H), 1.64-1.39 (m, 2H), 1.37-1.32 (m, 8H), 0.91-0.87 (t, J = 0.91 Hz, 3H). (6Z,12Z)-Octadeca-6,12-dienoic acid 14

[0382] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 4H), 2.35-2.33 (t, 2H), 2.06-2.01 (m, 8H), 1.64-1.42 (m, 2H), 1.34-1.28 (m, 12H), 0.90-0.85 (t, 3H). Synthesis of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methylbenzenesulfonate 16

[0383] [ka] To a mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethan-1-ol 15 (25 g, 171.1 mmol) in pyridine (30 mL) was added p-toluenesulfonyl chloride (35.8 g, 188.2 mmol) and DMAP (140 mg, 1.14 mmol) at 0 °C, and the reaction was stirred at room temperature overnight. The mixture was diluted with CHCl (500 mL) and washed with saturated NHCl, water, and brine. The organic layer was dried over anhydrous NaSO. The solvent was evaporated, and the crude residue was used in the next step without purification. (43.8 g, 85%) 1H NMR (300 MHz, CDCl3): δ ppm 7.77 (d, J = 8.2 Hz, 2H), 7.34 (d, J = 8.1 Hz, 2H), 4.15-4.01 (m, 3H), 3.65-3.47 (m, 2H), 2.43 (s, 3H), 1.82-1.62 (m, 2H), 1.32 (s, 3H), 1.27 (s, 3H). Representative Procedure for Dialkylamine Substitution Synthesis of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine 19

[0384] [ka] A mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methylbenzenesulfonate 16 (10 g, 33.3 mmol) and dimethylamine solution 17 (166 mL, 333.3 mmol) (2 M in THF) was stirred at room temperature for 2 days. The mixture was concentrated, and the crude residue was diluted with CHCl (500 mL) and washed with saturated NaHCO, water, and brine. The organic layer was dried over anhydrous NaSO. The solvent was evaporated, and the crude residue was purified by flash chromatography (SiO:CHCl = 100% to 10% MeOH in CHCl with 1% NHOH) to give the colorless oily product 19 (2.1 g, 37%). 1H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.52 (dd, J = 7.4, 7.4 Hz, 1H), 2.41-2.23 (m, 2H), 2.21 (s, 6H), 1.82-1.62 (m, 2H), 1.39 (s, 3H), 1.33 (s, 3H). MS (APCI + ): 174.1 (M+1) (S)-2-(2,2-diethyl-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine 20

[0385] [ka] 1H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.48 (dd, J = 7.4, 7.4 Hz, 1H), 2.48-2.43 (m, 6H), 1.82-1.62 (m, 2H), 1.36 (s, 3H), 1.27 (s, 3H), 0.97 (t, J = 7.2 Hz, 6H). MS (APCI+): 202.2 (M+1) Representative Procedure for Ketal Hydrolysis Synthesis of (S)-4-(dimethylamino)butane-1,2-diol hydrochloride 21

[0386] [ka] To a mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine 19 (2 g, 11.54 mmol) in MeOH (10 mL) was added 1N aqueous HCl (17 mL, 17.3 mmol), and the reaction was heated at 80 °C for 45 min. TLC (Rf = 0.1, 10% MeOH in CHCl containing 1% NHOH) showed the reaction was complete. After concentration of the reaction mixture, the crude residue was dissolved in water (5 mL) and lyophilized overnight. A sticky syrup-like product 21 (2.1 g, quantitative yield) was obtained as the HCl salt. 1H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.29-3.22 (m, 2H), 2.85 (s, 6H), 1.92-1.79 (m, 2H). MS (APCI+): 134.1 (M+1) (S)-4-(Diethylamino)butane-1,2-diol hydrochloride 22

[0387] [ka] 1H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.22-3.15 (m, 6H), 1.92-1.74 (m, 2H), 1.24 (t, J = 7.4 Hz, 6H). MS (APCI+): 162.1 (M+1) Representative Procedure for Diesterification Synthesis of (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate) AKG-UO-1 (O-11956)

[0388] [ka] Oxalyl chloride (0.33 mL, 3.9 mmol) was added dropwise to a solution of (6Z,12Z)-octadeca-6,12-dienoic acid, 14 (0.36 g, 1.3 mmol) in dichloromethane / DMF (15 mL, 25 mL) at 0°C, and the reaction was warmed to room temperature and stirred for 1 h. After 1 h, the reaction was concentrated to dryness in vacuo. The residue was redissolved in dichloromethane (10 mL) and added to a mixture of N,N-diisopropylethylamine (2.3 mL, 10 mmol), 4-dimethylaminopyridine (317 mg, 2.6 mmol), and (S)-4-(dimethylamino)butane-1,2-diol hydrochloride, 21 (101 mg, 0.6 mmol). The resulting solution was stirred for 24 h. After 24 h, the reaction was cooled to 0°C and quenched with water (10 mL). The reaction mixture was extracted with dichloromethane (2 × 100 mL), and the organics were washed with water and brine (2 × 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 2% methanol in dichloromethane as eluent to give (S)-4-(dimethylamino)butane-1,2-diyl (6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate), AKG-UO-1 (0.12 g, 30%) as a yellow oil. 1H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 12.1, 6.3 Hz, 1H), 2.32-2.26 (m, 6H), 2.20 (s, 6H), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.65-1.58 (m, 4H), 1.42-1.25 (m, 24H), 0.90-0.85 (m, 6H). MS (APCI+): 658.5 (M+1) (S)-4-(Diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate) AKG-UO-1A (O-11955)

[0389] [ka] 1H NMR (300 MHz, CDCl3): 5.37-5.29 (m, 8H), 5.12-5.10 (m, 1H), 4.25 (dd, J = 12.1, 3.6 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.52-2.42 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H)), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.64-1.59 (m, 4H), 1.41-1.19 (m, 24H), 0.99 (t, J = 7.1 Hz, 6H), 0.96-0.87 (m, 6H). MS (APCI+): 686.6 (M+1) (S)-4-(Dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate) AKG-UO-4 (O-12401)

[0390] [ka] 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.13-5.12 (m, 1H), 4.24 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.27 (m, 6H), 2.19 (s, 6H), 2.01-1.99 (m, 16H), 1.75-1.72 (m, 2H), 1.65-1.58 (m, 4H), 1.36-1.31 (m, 16H), 0.91-0.86 (m, 6H). MS (APCI+): 602.5 (M+1) Synthesis of (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate) AKG-UO-4A (O-12402)

[0391] [ka] 1H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.12-5.11 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.54-2.43 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H), 2.11-1.96 (m, 16H), 1.74-1.65 (m, 2H), 1.65-1.59 (m, 4H), 1.39-1.31 (m, 16H), 0.99 (t, J = 7.1 Hz, 6H), 0.91-0.89 (m, 6H). MS (APCI+): 630.5 (M+1). This synthesis involved: i) an initial Wittig reaction of a triphenylphosphonium ylide prepared from 5-bromopentanol and the corresponding aldehyde; ii) conversion of the terminal alcohol to a bromide via mesylation and substitution; iii) repeated ylide synthesis and Wittig reaction; and finally iv) periodate oxidation of the terminal alcohol. The resulting acid intermediate was utilized in the synthesis of AKG-UO-1 to AKG-UO-4, as shown below. Scheme 2. Synthesis of acid intermediate for AKG-UO-5

[0392] [ka] The acid intermediate (9Z,15Z)-9,15-octadecadienoic acid used in the synthesis of AKG-UO-5 was prepared by the general synthesis shown in Scheme 2, which involves i) alkylation of silyl-protected 10-hydroxy-1-decyne with (5Z)-1-bromo-5-octene, ii) catalytic hydrogenation of the alkyne to the cis-alkene, iii) removal of the silyl protection on the alcohol, and finally iv) oxidation of the terminal alcohol to the desired acid. Scheme 3. Synthesis of acid intermediates for AKG-BDG-01 and AKG-BDG-02

[0393] [ka] The synthesis of two disulfate intermediates used to synthesize AKG-BDG-1 and AKG-BDG-2 is shown below. Synthesis of (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,11Z,11'Z)-bis(octadeca-6,11-dienoate) (AKG-UO-1a)

[0394] [ka] Experimental procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0395] [ka] To a solution of 5-bromo-1-pentanol 1 (3.6 g, 21.6 mmol) in dichloromethane (100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol) at 0 °C was added 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol). The resulting solution was stirred at room temperature for 1 h and then quenched with water. The mixture was extracted with ethyl acetate (2 × 100 mL). The combined organics were washed with brine, then dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 5–10% ethyl acetate in n-hexane as the eluent to give 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (4.5 g, 83%) as a clear oil. 1H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H), 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). Synthesis of 2-(dodeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran 4a

[0396] [ka] To a solution of 1,6-heptadiyne 3a (5 g, 54.3 mmol) and hexamethylphosphoramide (19 mL, 108 mmol) in tetrahydrofuran (100 mL) was added dropwise [2.5 M n-butyllithium in n-hexane] (21.7 mL, 54.3 mmol) at −78° C. Upon completion of the addition, the solution was stirred at −78° C. for 1 h and then warmed to −20° C. for an additional 1 h. The resulting solution was cooled again to −78° C., at which point a solution of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (6.8 g, 27.1 mmol) in tetrahydrofuran (10 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 h. After 12 h, the reaction was cooled to 0° C. and quenched with water (100 mL). The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran and then diluted with n-hexane. The organics were washed with water and brine (2 × 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 5–10% ethyl acetate in n-hexane as eluent to give 2-(dodeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran, 4a (4.1 g, 58%) as a clear oil. 1H NMR (300 MHz, CDCl3): δ ppm 4.57-4.56 (m, 1H), 3.96-3.82 (m, 1H), 3.77-3.69 (m, 1H), 3.50-3.41 (m, 1H), 3.39-3.34 (m, 1H), 2.29-2.25 (m, 4H), 2.15-2.12 (m, 2H), 1.95-1.94 (t, J = 5.8 Hz, 1H), 1.73-1.43 (m, 14H). Synthesis of 2-(octadeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran 6a

[0397] [ka] To a solution of 2-(dodeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran, 4a (4.1 g, 15.64 mmol), and hexamethylphosphoramide (11 mL, 62.6 mmol) in tetrahydrofuran (100 mL) was added dropwise 2.5 M n-butyllithium in n-hexane (12.5 mL, 31.3 mmol) at −78° C. Upon completion of the addition, the solution was stirred at −78° C. for 1 h and then warmed to −20° C. for an additional 1 h. The resulting solution was cooled again to −78° C., at which point a solution of 1-iodohexane, 5a (9.5 mL, 62.6 mmol), in tetrahydrofuran (20 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 h. After 12 h, the reaction was cooled to 0° C. and quenched with water (100 mL). The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran and then diluted with n-hexane. The organics were washed with water and brine (2 × 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 5% ethyl acetate in n-hexane as the eluent to give 2-(octadeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran, 6a (3.1 g, 57%) as a clear oil. 1H NMR (300 MHz, CDCl3): 4.58-4.55 (m, 1H), 3.86-3.82 (m, 1H), 3.77-3.69 (m, 1H), 3.51-3.47 (m, 1H), 3.41-3.34 (m, 1H), 2.26-2.21 (m, 6H), 2.14-2.12 (m, 6H), 1.66-1.26 (m, 18H), 0.93-0.85 (t, J = 6.5 Hz, 3H). Synthesis of 2-(((6Z,11Z)-octadeca-6,11-dien-1-yl)oxy)tetrahydro-2H-pyran 7a

[0398] [ka] To a solution of sodium borohydride (0.27 g, 14.8 mmol) in ethanol (50 mL) was added nickel(II) acetate tetrahydrate (1.55 g, 6.25 mmol) under a hydrogen blanket at 0 °C. Upon completion of the addition, the reaction was evacuated under vacuum and flushed with hydrogen. After stirring for 10 minutes, ethylenediamine (1.8 mL, 26.8 mmol) and a solution of 2-(octadeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran, 6a (3.1 g, 8.93 mmol) in ethanol (10 mL) were added. The reaction was stirred under a hydrogen balloon at room temperature for 4 hours. After 4 hours, the reaction mixture was evacuated with hydrogen and then flushed with nitrogen. The crude mixture was filtered over Celite, and the filtrate was concentrated under vacuum to give a crude oil weighing 4 g. The crude oil was purified by chromatography on silica using 5-10% diethyl ether in n-hexane as eluent to give 2-(((6Z,11Z)-octadeca-6,11-dien-1-yl)oxy)tetrahydro-2H-pyran, 7a (2.86 g, 92% yield) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.4-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.82 (m, 1H), 3.74-3.68 (m, 1H), 3.51-3.49 (m, 1H), 3.41-3.36 (m, 1H), 2.06-1.99 (m, 6H), 1.83-1.67 (m, 2H), 1.59-1.51 (m, 6H),1.48-1.32 (m, 16H), 0.92-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,11Z)-octadeca-6,11-dien-1-ol 8a

[0399] [ka] The procedure is described above. 1HNMR (300 MHz, CDCl3): 5.37-5.33 (m, 4H), 3.65-3.61 (m, 1H), 2.06-1.99 (m, 6H), 1.56-1.41 (m, 4H), 1.38-1.27 (m, 14H), 0.88-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,11Z)-octadeca-6,11-dienoic acid 9a

[0400] [ka] The procedure is described above. 1H NMR (300 MHz, CDCl3): 5.38-5.33 (m, 4H), 2.37-2.33 (t, J = 5.6 Hz, 2H), 2.06-1.99 (m, 6H), 1.67-1.59 (m, 2H), 1.41-1.25 (m, 14H), 0.89-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,11Z,11'Z)-bis(octadeca-6,11-dienoate) (AKG-UO-1a)

[0401] [ka] The procedure is described above. 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.06 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.28 (m, 6H), 2.20 (s, 6H), 2.03-2.01 (m, 16H), 1.74-1.64 (m, 2H), 1.62-1.60 (m, 6H), 1.38-1.27 (m, 22H), 0.89-0.85 (m, 6H). MS (APCI+): 658.5 (M+1) The general synthesis of the acid intermediate for AKG-BDG-1 involves i) synthesis of 4-mercaptobutyric acid from 4-bromobutyric acid, ii) reaction of 4-mercaptobutyric acid with DPS to prepare 4-(2-pyridinyldisulfanyl)butanoic acid, iii) catalytic hydrogenation of 3-decyn-1-ol to a cis-alkene, iv) tosylation of the primary alcohol, v) preparation of a terminal thiol by displacement of the tosyl group using thiourea, and finally vi) preparation of a disulfide containing the acid intermediate by coupling of the terminal thiol prepared in step ii above with 4-(2-pyridinyldisulfanyl)butanoic acid. A similar synthetic sequence starting from 3-dodecyn-1-ol was followed to obtain the second acid intermediate used in the synthesis of AKG-BDG-2. Scheme 4. Synthesis of AKG-UO-1, AKG-UO-4, AKG-UO-5, AKG-BDG-1, and AKG-BDG-2

[0402] [ka] The general synthesis of lipids AKG-UO-1, AKG-UO-4, AKG-UO-5, AKG-BDG-1, and AKG-BDG-2, shown in Scheme 4, involves the following steps: i) tosylation of the primary alcohol of a commercially available chiral dioxolane, ii) preparation of a tertiary amine by displacement of the tosyl group using dimethylamine, iii) acid-catalyzed deprotection of the diol, and finally iv) esterification of the diol with the corresponding acid intermediate synthesized according to Schemes 1–3. AKG-UO-2 is prepared following a similar synthetic sequence starting from a different dioxolane and the corresponding acid intermediate, as shown in Scheme 5 below. Scheme 5. Synthesis of AKG-UO-2

[0403] [ka] The general synthesis of the trialkyl phosphate containing lipid AKG-UO-3, shown in Scheme 6, involves the following steps: i) preparation of the corresponding dialkyl chlorophosphite by reaction of the primary alcohol of a commercially available chiral dioxolane with methyl dichlorophosphite; ii) preparation of the corresponding trialkyl phosphite by displacement of the chloride in the dialkyl chlorophosphite by treatment with 3-bromopropanol; iii) acid-catalyzed deprotection of the diol; iv) esterification of the diol with the corresponding acid intermediate synthesized according to Scheme 1; and finally v) preparation of the tertiary amine by displacement of the bromine group using dimethylamine. Scheme 6. Synthesis of AKG-UO-3

[0404] [ka] Alternatively, acid intermediates having two methylene groups between the double bond positions in the hydrocarbon chain are synthesized as described by Caballeira et al., Chem. Phys. Lipids, vol. 100, pp. 33-40, 1999, or as described by D'yakonov et al. (D'yakonov et al., Med. Chem. Res., 2016, vol. 25, pp. 30-39; D'yakonov et al., Chem. Commun. 2013, vol. 49, pp. 8401-8403; D'yakonov et al., 2020, Phytochem. Rev.). (S)-4-(Dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate) (AKG-UO-1, O-11956) (S)-4-(Diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate) (AKG-UO-1A, O-11955) (S)-4-(Dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4, O-12401) (S)-4-(Diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4A, O-12402) (S)-4-(Dimethylamino)butane-1,2-diyl(6Z,6'Z,11Z,11'Z)-bis(octadeca-6,11-dienoate) (AKG-UO-1a)

[0405] [ka] Experimental procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0406] [ka] To a solution of 5-bromo-1-pentanol 1 (3.6 g, 21.6 mmol) in dichloromethane (100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol) at 0 °C was added 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol). The resulting solution was stirred at room temperature for 1 h and then quenched with water. The mixture was extracted with ethyl acetate (2 × 100 mL). The combined organics were washed with brine, then dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 5–10% ethyl acetate in n-hexane as the eluent to give 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (4.5 g, 83%) as a clear oil. 1H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H), 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). Synthesis of 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 4

[0407] [ka] To a solution of 1,7-octadiyne 3 (6 mL, 45.4 mmol) and hexamethylphosphoramide (16 mL, 90.8 mmol) in tetrahydrofuran (100 mL) was added dropwise [2.5 M n-butyllithium in n-hexane] (18 mL, 45.4 mmol) at −78° C. Upon completion of the addition, the solution was stirred at −78° C. for 1 h and then warmed to −20° C. for an additional 1 h. The resulting solution was cooled again to −78° C., at which point a solution of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (5.67 g, 22.7 mmol) in tetrahydrofuran (10 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 h. After 12 h, the reaction was cooled to 0° C. and quenched with water (100 mL). The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran and then diluted with n-hexane. The organics were washed with water and brine (2 × 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil weighing 9 g. The crude oil was purified by chromatography on silica using 5–10% ethyl acetate in n-hexane as eluent to give 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 4 (4.5 g, 72%) as a clear oil. 1H NMR (300 MHz, d6.DMSO): δ ppm 4.544.53 (m, 1H), 3.72-3.61 (m, 1H), 3.60-3.58 (m, 1H), 3.43-3.33 (m, 1H), 3.32-3.29 (m, 1H), 2.77-2.75 (t, J = 5.8 Hz, 1H), 2.16-2.13 (m, 6H), 1.55-1.41 (m, 16H). Representative Procedure for Alkylation of Alkynes Synthesis of 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 7

[0408] [ka] To a solution of 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 4 (7.14 g, 25.86 mmol) and hexamethylphosphoramide (18 mL, 103.4 mmol) in tetrahydrofuran (100 mL) was added dropwise 2.5 M n-butyllithium in n-hexane (41.3 mL, 103.4 mmol) at −78° C. Upon completion of the addition, the solution was stirred at −78° C. for 1 h and then warmed to −20° C. for an additional 1 h. The resulting solution was cooled once more to −78° C., at which point a solution of 1-iodopropane 5 (9.9 mL, 103.4 mmol) in tetrahydrofuran (20 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 h. After 12 h, the reaction was cooled to 0° C. and quenched with water (100 mL). The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran and then diluted with n-hexane. The organics were washed with water and brine (2 x 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil weighing 9 g. The crude oil was purified by chromatography on silica using 5% ethyl acetate in n-hexane as the eluent to give 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 7 (5.9 g, 72%) as a clear oil. 1H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H), 3.50-3.39 (m, 1H), 3.37-3.36 (m, 1H), 2.16-2.11 (m, 8H), 1.59-1.56 (m, 2H), 1.55-1.47 (m, 16H), 0.98-0.93 (t, J = 1.6 Hz, 3H). 2-(octadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 8

[0409] [ka] 1H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.85-3.74 (m, 1H), 3.73-3.70 (m, 1H), 3.50-3.38 (m, 1H), 3.36-3.35 (m, 1H), 2.23-2.12 (m, 8H), 1.61-1.54 (m, 2H), 1.53-1.48 (m, 16H), 1.47-1.46 (m, 4H), 0.90-0.85 (t, J = 1.6 Hz, 3H). Representative Procedure for the Reduction of Alkynes to Alkenes Using P-2 Ni Synthesis of 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran 9

[0410] [ka] To a solution of sodium borohydride (0.56 g, 14.8 mmol) in ethanol (80 mL) was added nickel(II) acetate tetrahydrate (3.22 g, 12.98 mmol) under a hydrogen blanket at 0 °C. Upon completion of the addition, the reaction was evacuated under vacuum and flushed with hydrogen. After stirring for 10 min, a solution of ethylenediamine (3.7 mL, 65.6 mmol) and 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 7 (5.9 g, 18.55 mmol) in ethanol (10 mL) was added. The reaction was stirred under a hydrogen balloon at room temperature for 4 h. After 4 h, the reaction mixture was evacuated with hydrogen and then flushed with nitrogen. The crude mixture was filtered over Celite, and the filtrate was concentrated under vacuum to give a crude oil weighing 4 g. The crude oil was purified by chromatography on silica using 5-10% diethyl ether in n-hexane as eluent to give 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran, 9 (4.67 g, 78% yield) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H), 3.51-3.39 (m, 1H), 3.36-3.35 (m, 1H), 2.03-1.98 (m, 8H), 1.57-1.39 (m, 2H), 1.38-1.36 (m, 6H), 1.35-1.32 (m, 10H), 0.91-0.86 (t, J = 1.6 Hz, 3H). 13C NMR (300 MHz, CDCl3): 129.98, 129.85, 98.93, 77.53, 77.10, 76.68, 67.72, 62.43, 30.86, 29.71, 29.70, 29.45, 29.46, 29.44, 27.20, 27.19, 26.01, 25.59, 22.98, 19.78, 13.91. 2-(((6Z,12Z)-octadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran 10

[0411] [ka] 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.76 (m, 1H), 3.74-3.68 (m, 1H), 3.51-3.41 (m, 1H), 3.39-3.36 (m, 1H), 2.14-1.97 (m, 8H), 1.56-1.38 (m, 2H), 1.37-1.35 (m, 6H), 1.34-1.28 (m, 14H), 0.93-0.85 (t, J = 1.6 Hz, 3H). 13C NMR (300 MHz, CDCl3): 130.13, 129.97, 129.84, 129.71, 98.93, 77.53, 77.10, 76.68, 67.71, 62.42, 31.62, 30.86, 29.72, 29.71, 29.47, 29.46, 27.27, 27.18, 26.01, 25.59, 22.67, 19.78, 14.18. Representative procedure for the deprotection of tetrahydropyranyl ethers (THP) Synthesis of (6Z,12Z)-hexadeca-6,12-dien-1-ol 11

[0412] [ka] To a solution of 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran, 9 (4.67 g, 14.5 mmol) in methanol (20 mL) at room temperature was added p-toluenesulfonic acid monohydrate (300 mg, 1.58 mmol). The resulting solution was stirred at room temperature for 3 h and then quenched with water. The mixture was extracted with ethyl acetate (2 × 50 mL). The combined organics were washed with water, then dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil weighing 4 g. The crude oil was purified by chromatography on silica using 5–10% diethyl ether in n-hexane as eluent to give (6Z,12Z)-hexadeca-6,12-dien-1-ol, 11 (2.5 g, 72%) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.34-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.00 (m, 8H), 1.36-1.34 (m, 2H), 1.34-1.25 (m, 10H), 0.89-0.86 (t, J = 0.82 Hz, 3H). (6Z,12Z)-Octadeca-6,12-dien-1-ol 12

[0413] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.01 (m, 8H), 1.36-1.35 (m, 2H), 1.34-1.25 (m, 14H), 0.88-0.85 (t, J = 0.76 Hz, 3H). Representative Procedure for Oxidation of Alcohols to Carboxylic Acids Using Jones Reagent Synthesis of (6Z,12Z)-hexadeca-6,12-dienoic acid 13

[0414] [ka] A mixture of (6Z,12Z)-hexadeca-6,12-dien-1-ol, 11 (2.5 g, 10.5 mmol) and Jones reagent [2 M in sulfuric acid] (10.5 mL, 21 mmol) in acetone (20 mL) was stirred at 0 °C for 2 h. The mixture was quenched with water and extracted with ethyl acetate (2 × 100 mL). The combined organics were dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 20% ​​ethyl acetate in n-hexane as eluent to give (6Z,12Z)-hexadeca-6,12-dienoic acid, 13 (1.7 g, 68%) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.33 (m, 4H), 2.37-2.32 (t, 2H), 2.06-1.98 (m, 8H), 1.64-1.39 (m, 2H), 1.37-1.32 (m, 8H), 0.91-0.87 (t, J = 0.91 Hz, 3H). (6Z,12Z)-Octadeca-6,12-dienoic acid 14

[0415] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 4H), 2.35-2.33 (t, 2H), 2.06-2.01 (m, 8H), 1.64-1.42 (m, 2H), 1.34-1.28 (m, 12H), 0.90-0.85 (t, 3H). Synthesis of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methylbenzenesulfonate 16

[0416] [ka] To a mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethan-1-ol 15 (25 g, 171.1 mmol) in pyridine (30 mL) was added p-toluenesulfonyl chloride (35.8 g, 188.2 mmol) and DMAP (140 mg, 1.14 mmol) at 0 °C, and the reaction was stirred at room temperature overnight. The mixture was diluted with CHCl (500 mL) and washed with saturated NHCl, water, and brine. The organic layer was dried over anhydrous NaSO. The solvent was evaporated, and the crude residue was used in the next step without purification. (43.8 g, 85%) 1H NMR (300 MHz, CDCl3): δ ppm 7.77 (d, J = 8.2 Hz, 2H), 7.34 (d, J = 8.1 Hz, 2H), 4.15-4.01 (m, 3H), 3.65-3.47 (m, 2H), 2.43 (s, 3H), 1.82-1.62 (m, 2H), 1.32 (s, 3H), 1.27 (s, 3H). Representative Procedure for Dialkylamine Substitution Synthesis of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine 19

[0417] [ka] A mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methylbenzenesulfonate 16 (10 g, 33.3 mmol) and dimethylamine solution 17 (166 mL, 333.3 mmol) (2 M in THF) was stirred at room temperature for 2 days. The mixture was concentrated, and the crude residue was diluted with CHCl (500 mL) and washed with saturated NaHCO, water, and brine. The organic layer was dried over anhydrous NaSO. The solvent was evaporated, and the crude residue was purified by flash chromatography (SiO:CHCl = 100% to 10% MeOH in CHCl with 1% NHOH) to give the colorless oily product 19 (2.1 g, 37%). 1H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.52 (dd, J = 7.4, 7.4 Hz, 1H), 2.41-2.23 (m, 2H), 2.21 (s, 6H), 1.82-1.62 (m, 2H), 1.39 (s, 3H), 1.33 (s, 3H). MS (APCI+): 174.1 (M+1) (S)-2-(2,2-diethyl-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine 20

[0418] [ka] 1H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.48 (dd, J = 7.4, 7.4 Hz, 1H), 2.48-2.43 (m, 6H), 1.82-1.62 (m, 2H), 1.36 (s, 3H), 1.27 (s, 3H), 0.97 (t, J = 7.2 Hz, 6H). MS (APCI+): 202.2 (M+1) Representative Procedure for Ketal Hydrolysis Synthesis of (S)-4-(dimethylamino)butane-1,2-diol hydrochloride 21

[0419] [ka] To a mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine 19 (2 g, 11.54 mmol) in MeOH (10 mL) was added 1N aqueous HCl (17 mL, 17.3 mmol), and the reaction was heated at 80 °C for 45 min. TLC (Rf = 0.1, 10% MeOH in CHCl containing 1% NHOH) showed the reaction was complete. After concentration of the reaction mixture, the crude residue was dissolved in water (5 mL) and lyophilized overnight. A sticky syrup-like product 21 (2.1 g, quantitative yield) was obtained as the HCl salt. 1H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.29-3.22 (m, 2H), 2.85 (s, 6H), 1.92-1.79 (m, 2H). MS (APCI+): 134.1 (M+1) (S)-4-(Diethylamino)butane-1,2-diol hydrochloride 22

[0420] [ka] 1H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.22-3.15 (m, 6H), 1.92-1.74 (m, 2H), 1.24 (t, J = 7.4 Hz, 6H). MS (APCI+): 162.1 (M+1) Representative Procedure for Diesterification Synthesis of (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate) AKG-UO-1 (O-11956)

[0421] [ka] Oxalyl chloride (0.33 mL, 3.9 mmol) was added dropwise to a solution of (6Z,12Z)-octadeca-6,12-dienoic acid, 14 (0.36 g, 1.3 mmol) in dichloromethane / DMF (15 mL, 25 mL) at 0°C, and the reaction was warmed to room temperature and stirred for 1 h. After 1 h, the reaction was concentrated to dryness in vacuo. The residue was redissolved in dichloromethane (10 mL) and added to a mixture of N,N-diisopropylethylamine (2.3 mL, 10 mmol), 4-dimethylaminopyridine (317 mg, 2.6 mmol), and (S)-4-(dimethylamino)butane-1,2-diol hydrochloride, 21 (101 mg, 0.6 mmol). The resulting solution was stirred for 24 h. After 24 h, the reaction was cooled to 0°C and quenched with water (10 mL). The reaction mixture was extracted with dichloromethane (2 × 100 mL), and the organics were washed with water and brine (2 × 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 2% methanol in dichloromethane as eluent to give (S)-4-(dimethylamino)butane-1,2-diyl (6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate), AKG-UO-1 (0.12 g, 30%) as a yellow oil. 1H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 12.1, 6.3 Hz, 1H), 2.32-2.26 (m, 6H), 2.20 (s, 6H), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.65-1.58 (m, 4H), 1.42-1.25 (m, 24H), 0.90-0.85 (m, 6H). MS (APCI+): 658.5 (M+1) (S)-4-(Diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate) AKG-UO-1A (O-11955)

[0422] [ka] 1H NMR (300 MHz, CDCl3): 5.37-5.29 (m, 8H), 5.12-5.10 (m, 1H), 4.25 (dd, J = 12.1, 3.6 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.52-2.42 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H)), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.64-1.59 (m, 4H), 1.41-1.19 (m, 24H), 0.99 (t, J = 7.1 Hz, 6H), 0.96-0.87 (m, 6H). MS (APCI+): 686.6 (M+1) (S)-4-(Dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate) AKG-UO-4 (O-12401)

[0423] [ka] 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.13-5.12 (m, 1H), 4.24 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.27 (m, 6H), 2.19 (s, 6H), 2.01-1.99 (m, 16H), 1.75-1.72 (m, 2H), 1.65-1.58 (m, 4H), 1.36-1.31 (m, 16H), 0.91-0.86 (m, 6H). MS (APCI+): 602.5 (M+1) Synthesis of (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate) AKG-UO-4A (O-12402)

[0424] [ka] 1H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.12-5.11 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.54-2.43 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H), 2.11-1.96 (m, 16H), 1.74-1.65 (m, 2H), 1.65-1.59 (m, 4H), 1.39-1.31 (m, 16H), 0.99 (t, J = 7.1 Hz, 6H), 0.91-0.89 (m, 6H). MS (APCI+): 630.5 (M+1) and finally v) Preparation of the tertiary amine by displacement of the bromide group using dimethylamine. Scheme 7. Synthesis of AKG-UO-3

[0425] [ka] Alternatively, acid intermediates having two methylene groups between the double bond positions in the hydrocarbon chain are synthesized as described by Caballeira et al., Chem. Phys. Lipids, vol. 100, pp. 33-40, 1999, or as described by D'yakonov et al. (D'yakonov et al., Med. Chem. Res., 2016, vol. 25, pp. 30-39; D'yakonov et al., Chem. Commun. 2013, vol. 49, pp. 8401-8403; D'yakonov et al., 2020, Phytochem. Rev.).

[0426] [Example 1B] Synthesis of ionizable lipids (S)-4-(Dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate) (AKG-UO-1, O-11956) (S)-4-(Diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate) (AKG-UO-1A, O-11955) (S)-4-(Dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4, O-12401) (S)-4-(Diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4A, O-12402) (S)-4-(Dimethylamino)butane-1,2-diyl(6Z,6'Z,11Z,11'Z)-bis(octadeca-6,11-dienoate) (AKG-UO-1a)

[0427] [ka] Experimental procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0428] [ka] To a solution of 5-bromo-1-pentanol 1 (3.6 g, 21.6 mmol) in dichloromethane (100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol) at 0 °C was added 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol). The resulting solution was stirred at room temperature for 1 h and then quenched with water. The mixture was extracted with ethyl acetate (2 × 100 mL). The combined organics were washed with brine, then dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 5–10% ethyl acetate in n-hexane as the eluent to give 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (4.5 g, 83%) as a clear oil. 1 H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H), 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). Synthesis of 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 4

[0429] [ka] To a solution of 1,7-octadiyne 3 (6 mL, 45.4 mmol) and hexamethylphosphoramide (16 mL, 90.8 mmol) in tetrahydrofuran (100 mL) was added dropwise [2.5 M n-butyllithium in n-hexane] (18 mL, 45.4 mmol) at −78° C. Upon completion of the addition, the solution was stirred at −78° C. for 1 h and then warmed to −20° C. for an additional 1 h. The resulting solution was cooled again to −78° C., at which point a solution of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (5.67 g, 22.7 mmol) in tetrahydrofuran (10 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 h. After 12 h, the reaction was cooled to 0° C. and quenched with water (100 mL). The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran and then diluted with n-hexane. The organics were washed with water and brine (2 × 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil weighing 9 g. The crude oil was purified by chromatography on silica using 5–10% ethyl acetate in n-hexane as eluent to give 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 4 (4.5 g, 72%) as a clear oil. 1 H NMR (300 MHz, d 6. DMSO): δ ppm 4.544.53 (m, 1H), 3.72-3.61 (m, 1H), 3.60-3.58 (m, 1H), 3.43-3.33 (m, 1H), 3.32-3.29 (m, 1H), 2.77-2.75 (t, J = 5.8 Hz, 1H), 2.16-2.13 (m, 6H), 1.55-1.41 (m, 16H). Representative Procedure for Alkylation of Alkynes Synthesis of 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 7

[0430] [ka] To a solution of 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 4 (7.14 g, 25.86 mmol) and hexamethylphosphoramide (18 mL, 103.4 mmol) in tetrahydrofuran (100 mL) was added dropwise 2.5 M n-butyllithium in n-hexane (41.3 mL, 103.4 mmol) at −78° C. Upon completion of the addition, the solution was stirred at −78° C. for 1 h and then warmed to −20° C. for an additional 1 h. The resulting solution was cooled once more to −78° C., at which point a solution of 1-iodopropane 5 (9.9 mL, 103.4 mmol) in tetrahydrofuran (20 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 h. After 12 h, the reaction was cooled to 0° C. and quenched with water (100 mL). The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran and then diluted with n-hexane. The organics were washed with water and brine (2 x 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil weighing 9 g. The crude oil was purified by chromatography on silica using 5% ethyl acetate in n-hexane as the eluent to give 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 7 (5.9 g, 72%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H), 3.50-3.39 (m, 1H), 3.37-3.36 (m, 1H), 2.16-2.11 (m, 8H), 1.59-1.56 (m, 2H), 1.55-1.47 (m, 16H), 0.98-0.93 (t, J = 1.6 Hz, 3H). 2-(octadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 8

[0431] [ka] 1H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.85-3.74 (m, 1H), 3.73-3.70 (m, 1H), 3.50-3.38 (m, 1H), 3.36-3.35 (m, 1H), 2.23-2.12 (m, 8H), 1.61-1.54 (m, 2H), 1.53-1.48 (m, 16H), 1.47-1.46 (m, 4H), 0.90-0.85 (t, J = 1.6 Hz, 3H). Representative Procedure for the Reduction of Alkynes to Alkenes Using P-2 Ni Synthesis of 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran 9

[0432] [ka] To a solution of sodium borohydride (0.56 g, 14.8 mmol) in ethanol (80 mL) was added nickel(II) acetate tetrahydrate (3.22 g, 12.98 mmol) under a hydrogen blanket at 0 °C. Upon completion of the addition, the reaction was evacuated under vacuum and flushed with hydrogen. After stirring for 10 min, a solution of ethylenediamine (3.7 mL, 65.6 mmol) and 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 7 (5.9 g, 18.55 mmol) in ethanol (10 mL) was added. The reaction was stirred under a hydrogen balloon at room temperature for 4 h. After 4 h, the reaction mixture was evacuated with hydrogen and then flushed with nitrogen. The crude mixture was filtered over Celite, and the filtrate was concentrated under vacuum to give a crude oil weighing 4 g. The crude oil was purified by chromatography on silica using 5-10% diethyl ether in n-hexane as eluent to give 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran, 9 (4.67 g, 78% yield) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H), 3.51-3.39 (m, 1H), 3.36-3.35 (m, 1H), 2.03-1.98 (m, 8H), 1.57-1.39 (m, 2H), 1.38-1.36 (m, 6H), 1.35-1.32 (m, 10H), 0.91-0.86 (t, J = 1.6 Hz, 3H). 13 C NMR (300 MHz, CDCl3): 129.98, 129.85, 98.93, 77.53, 77.10, 76.68, 67.72, 62.43, 30.86, 29.71, 29.70, 29.45, 29.46, 29.44, 27.20, 27.19, 26.01, 25.59, 22.98, 19.78, 13.91. 2-(((6Z,12Z)-オクタデカ-6,12-ジエン-1-イル)オキシ)テトラヒドロ-2H-ピラン10

[0433]

change

[0434] [ka] To a solution of 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetrahydro-2H-pyran, 9 (4.67 g, 14.5 mmol) in methanol (20 mL) at room temperature was added p-toluenesulfonic acid monohydrate (300 mg, 1.58 mmol). The resulting solution was stirred at room temperature for 3 h and then quenched with water. The mixture was extracted with ethyl acetate (2 × 50 mL). The combined organics were washed with water, then dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil weighing 4 g. The crude oil was purified by chromatography on silica using 5–10% diethyl ether in n-hexane as eluent to give (6Z,12Z)-hexadeca-6,12-dien-1-ol, 11 (2.5 g, 72%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.34-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.00 (m, 8H), 1.36-1.34 (m, 2H), 1.34-1.25 (m, 10H), 0.89-0.86 (t, J = 0.82 Hz, 3H). (6Z,12Z)-Octadeca-6,12-dien-1-ol 12

[0435] [ka] 1 H NMR (300 MHz, CDCl3): 5.36-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.01 (m, 8H), 1.36-1.35 (m, 2H), 1.34-1.25 (m, 14H), 0.88-0.85 (t, J = 0.76 Hz, 3H). Representative Procedure for Oxidation of Alcohols to Carboxylic Acids Using Jones Reagent Synthesis of (6Z,12Z)-hexadeca-6,12-dienoic acid 13

[0436] [ka] A mixture of (6Z,12Z)-hexadeca-6,12-dien-1-ol, 11 (2.5 g, 10.5 mmol) and Jones reagent [2 M in sulfuric acid] (10.5 mL, 21 mmol) in acetone (20 mL) was stirred at 0 °C for 2 h. The mixture was quenched with water and extracted with ethyl acetate (2 × 100 mL). The combined organics were dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 20% ​​ethyl acetate in n-hexane as eluent to give (6Z,12Z)-hexadeca-6,12-dienoic acid, 13 (1.7 g, 68%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.35-5.33 (m, 4H), 2.37-2.32 (t, 2H), 2.06-1.98 (m, 8H), 1.64-1.39 (m, 2H), 1.37-1.32 (m, 8H), 0.91-0.87 (t, J = 0.91 Hz, 3H). (6Z,12Z)-Octadeca-6,12-dienoic acid 14

[0437] [ka] 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 4H), 2.35-2.33 (t, 2H), 2.06-2.01 (m, 8H), 1.64-1.42 (m, 2H), 1.34-1.28 (m, 12H), 0.90-0.85 (t, 3H). Synthesis of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methylbenzenesulfonate 16

[0438] [ka] To a mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethan-1-ol 15 (25 g, 171.1 mmol) in pyridine (30 mL) was added p-toluenesulfonyl chloride (35.8 g, 188.2 mmol) and DMAP (140 mg, 1.14 mmol) at 0 °C, and the reaction was stirred at room temperature overnight. The mixture was diluted with CHCl (500 mL) and washed with saturated NHCl, water, and brine. The organic layer was dried over anhydrous NaSO. The solvent was evaporated, and the crude residue was used in the next step without purification. (43.8 g, 85%) 1 H NMR (300 MHz, CDCl3): δ ppm 7.77 (d, J = 8.2 Hz, 2H), 7.34 (d, J = 8.1 Hz, 2H), 4.15-4.01 (m, 3H), 3.65-3.47 (m, 2H), 2.43 (s, 3H), 1.82-1.62 (m, 2H), 1.32 (s, 3H), 1.27 (s, 3H). Representative Procedure for Dialkylamine Substitution Synthesis of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine 19

[0439] [ka] A mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methylbenzenesulfonate 16 (10 g, 33.3 mmol) and dimethylamine solution 17 (166 mL, 333.3 mmol) (2 M in THF) was stirred at room temperature for 2 days. The mixture was concentrated, and the crude residue was diluted with CHCl (500 mL) and washed with saturated NaHCO, water, and brine. The organic layer was dried over anhydrous NaSO. The solvent was evaporated, and the crude residue was purified by flash chromatography (SiO:CHCl = 100% to 10% MeOH in CHCl with 1% NHOH) to give the colorless oily product 19 (2.1 g, 37%). 1 H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.52 (dd, J = 7.4, 7.4 Hz, 1H), 2.41-2.23 (m, 2H), 2.21 (s, 6H), 1.82-1.62 (m, 2H), 1.39 (s, 3H), 1.33 (s, 3H). MS (APCI + ): 174.1 (M+1) (S)-2-(2,2-diethyl-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine 20

[0440] [ka] 1 H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.48 (dd, J = 7.4, 7.4 Hz, 1H), 2.48-2.43 (m, 6H), 1.82-1.62 (m, 2H), 1.36 (s, 3H), 1.27 (s, 3H), 0.97 (t, J = 7.2 Hz, 6H). MS (APCI + ): 202.2 (M+1) Representative Procedure for Ketal Hydrolysis Synthesis of (S)-4-(dimethylamino)butane-1,2-diol hydrochloride 21

[0441] [ka] To a mixture of (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine 19 (2 g, 11.54 mmol) in MeOH (10 mL) was added 1N aqueous HCl (17 mL, 17.3 mmol), and the reaction was heated at 80 °C for 45 min. TLC (Rf = 0.1, 10% MeOH in CHCl containing 1% NHOH) showed the reaction was complete. After concentration of the reaction mixture, the crude residue was dissolved in water (5 mL) and lyophilized overnight. A sticky syrup-like product 21 (2.1 g, quantitative yield) was obtained as the HCl salt. 1 H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.29-3.22 (m, 2H), 2.85 (s, 6H), 1.92-1.79 (m, 2H). MS (APCI + ): 134.1 (M+1) (S)-4-(Diethylamino)butane-1,2-diol hydrochloride 22

[0442] [ka] 1 H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.22-3.15 (m, 6H), 1.92-1.74 (m, 2H), 1.24 (t, J = 7.4 Hz, 6H). MS (APCI + ): 162.1 (M+1) Representative Procedure for Diesterification Synthesis of (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate) AKG-UO-1 (O-11956)

[0443] [ka] Oxalyl chloride (0.33 mL, 3.9 mmol) was added dropwise to a solution of (6Z,12Z)-octadeca-6,12-dienoic acid, 14 (0.36 g, 1.3 mmol) in dichloromethane / DMF (15 mL, 25 μL) at 0° C. The reaction was warmed to room temperature and stirred for 1 h. After 1 h, the reaction was concentrated to dryness in vacuo. The residue was redissolved in dichloromethane (10 mL) and added to a mixture of N,N-diisopropylethylamine (2.3 mL, 10 mmol), 4-dimethylaminopyridine (317 mg, 2.6 mmol), and (S)-4-(dimethylamino)butane-1,2-diol hydrochloride, 21 (101 mg, 0.6 mmol). The resulting solution was stirred for 24 h. After 24 h, the reaction was cooled to 0° C. and quenched with water (10 mL). The reaction mixture was extracted with dichloromethane (2 × 100 mL), and the organics were washed with water and brine (2 × 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 2% methanol in dichloromethane as eluent to give (S)-4-(dimethylamino)butane-1,2-diyl (6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate), AKG-UO-1 (0.12 g, 30%) as a yellow oil. 1H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 12.1, 6.3 Hz, 1H), 2.32-2.26 (m, 6H), 2.20 (s, 6H), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.65-1.58 (m, 4H), 1.42-1.25 (m, 24H), 0.90-0.85 (m, 6H). MS (APCI + ): 658.5 (M+1) (S)-4-(Diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(octadeca-6,12-dienoate) AKG-UO-1A (O-11955)

[0444] [ka] 1 H NMR (300 MHz, CDCl3): 5.37-5.29 (m, 8H), 5.12-5.10 (m, 1H), 4.25 (dd, J = 12.1, 3.6 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.52-2.42 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H)), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.64-1.59 (m, 4H), 1.41-1.19 (m, 24H), 0.99 (t, J = 7.1 Hz, 6H), 0.96-0.87 (m, 6H). MS (APCI + ): 686.6 (M+1) (S)-4-(Dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate) AKG-UO-4 (O-12401)

[0445] [ka] 1 H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.13-5.12 (m, 1H), 4.24 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.27 (m, 6H), 2.19 (s, 6H), 2.01-1.99 (m, 16H), 1.75-1.72 (m, 2H), 1.65-1.58 (m, 4H), 1.36-1.31 (m, 16H), 0.91-0.86 (m, 6H). MS (APCI + ): 602.5 (M+1) Synthesis of (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12'Z)-bis(hexadeca-6,12-dienoate) AKG-UO-4A (O-12402)

[0446] [ka] 1 H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.12-5.11 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.54-2.43 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H), 2.11-1.96 (m, 16H), 1.74-1.65 (m, 2H), 1.65-1.59 (m, 4H), 1.39-1.31 (m, 16H), 0.99 (t, J = 7.1 Hz, 6H), 0.91-0.89 (m, 6H). MS (APCI + ): 630.5 (M+1) Synthesis of (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,11Z,11'Z)-bis(octadeca-6,11-dienoate) (AKG-UO-1a)

[0447] [ka] Experimental procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0448] [ka] To a solution of 5-bromo-1-pentanol 1 (3.6 g, 21.6 mmol) in dichloromethane (100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol) at 0 °C was added 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol). The resulting solution was stirred at room temperature for 1 h and then quenched with water. The mixture was extracted with ethyl acetate (2 × 100 mL). The combined organics were washed with brine, then dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 5–10% ethyl acetate in n-hexane as the eluent to give 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (4.5 g, 83%) as a clear oil. 1 H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H), 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). Synthesis of 2-(dodeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran 4a

[0449] [ka] To a solution of 1,6-heptadiyne 3a (5 g, 54.3 mmol) and hexamethylphosphoramide (19 mL, 108 mmol) in tetrahydrofuran (100 mL) was added dropwise [2.5 M n-butyllithium in n-hexane] (21.7 mL, 54.3 mmol) at −78° C. Upon completion of the addition, the solution was stirred at −78° C. for 1 h and then warmed to −20° C. for an additional 1 h. The resulting solution was cooled again to −78° C., at which point a solution of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (6.8 g, 27.1 mmol) in tetrahydrofuran (10 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 h. After 12 h, the reaction was cooled to 0° C. and quenched with water (100 mL). The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran and then diluted with n-hexane. The organics were washed with water and brine (2 × 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 5–10% ethyl acetate in n-hexane as eluent to give 2-(dodeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran, 4a (4.1 g, 58%) as a clear oil. 1 H NMR (300 MHz, CDCl3): δ ppm 4.57-4.56 (m, 1H), 3.96-3.82 (m, 1H), 3.77-3.69 (m, 1H), 3.50-3.41 (m, 1H), 3.39-3.34 (m, 1H), 2.29-2.25 (m, 4H), 2.15-2.12 (m, 2H), 1.95-1.94 (t, J = 5.8 Hz, 1H), 1.73-1.43 (m, 14H). Synthesis of 2-(octadeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran 6a

[0450] [ka] To a solution of 2-(dodeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran, 4a (4.1 g, 15.64 mmol), and hexamethylphosphoramide (11 mL, 62.6 mmol) in tetrahydrofuran (100 mL) was added dropwise 2.5 M n-butyllithium in n-hexane (12.5 mL, 31.3 mmol) at −78° C. Upon completion of the addition, the solution was stirred at −78° C. for 1 h and then warmed to −20° C. for an additional 1 h. The resulting solution was cooled again to −78° C., at which point a solution of 1-iodohexane, 5a (9.5 mL, 62.6 mmol), in tetrahydrofuran (20 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 h. After 12 h, the reaction was cooled to 0° C. and quenched with water (100 mL). The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran and then diluted with n-hexane. The organics were washed with water and brine (2 × 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 5% ethyl acetate in n-hexane as the eluent to give 2-(octadeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran, 6a (3.1 g, 57%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 4.58-4.55 (m, 1H), 3.86-3.82 (m, 1H), 3.77-3.69 (m, 1H), 3.51-3.47 (m, 1H), 3.41-3.34 (m, 1H), 2.26-2.21 (m, 6H), 2.14-2.12 (m, 6H), 1.66-1.26 (m, 18H), 0.93-0.85 (t, J = 6.5 Hz, 3H). Synthesis of 2-(((6Z,11Z)-octadeca-6,11-dien-1-yl)oxy)tetrahydro-2H-pyran 7a

[0451] [ka] To a solution of sodium borohydride (0.27 g, 14.8 mmol) in ethanol (50 mL) was added nickel(II) acetate tetrahydrate (1.55 g, 6.25 mmol) under a hydrogen blanket at 0°C. Upon completion of the addition, the reaction was evacuated under vacuum and flushed with hydrogen. After stirring for 10 minutes, a solution of ethylenediamine (1.8 mL, 26.8 mmol) and 2-(octadeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran, 6a (3.1 g, 8.93 mmol) in ethanol (10 mL) was added. The reaction was stirred under a hydrogen balloon at room temperature for 4 hours. After 4 hours, the reaction mixture was evacuated with hydrogen and then flushed with nitrogen. The crude mixture was filtered over Celite, and the filtrate was concentrated under vacuum to give a crude oil weighing 4 g. The crude oil was purified by chromatography on silica using 5-10% diethyl ether in n-hexane as eluent to give 2-(((6Z,11Z)-octadeca-6,11-dien-1-yl)oxy)tetrahydro-2H-pyran, 7a (2.86 g, 92% yield) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.4-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.82 (m, 1H), 3.74-3.68 (m, 1H), 3.51-3.49 (m, 1H), 3.41-3.36 (m, 1H), 2.06-1.99 (m, 6H), 1.83-1.67 (m, 2H), 1.59-1.51 (m, 6H),1.48-1.32 (m, 16H), 0.92-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,11Z)-octadeca-6,11-dien-1-ol 8a

[0452] [ka] The procedure is described above. 1H NMR (300 MHz, CDCl3): 5.37-5.33 (m, 4H), 3.65-3.61 (m, 1H), 2.06-1.99 (m, 6H), 1.56-1.41 (m, 4H), 1.38-1.27 (m, 14H), 0.88-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,11Z)-octadeca-6,11-dienoic acid 9a

[0453] [ka] The procedure is described above. 1 H NMR (300 MHz, CDCl3): 5.38-5.33 (m, 4H), 2.37-2.33 (t, J = 5.6 Hz, 2H), 2.06-1.99 (m, 6H), 1.67-1.59 (m, 2H), 1.41-1.25 (m, 14H), 0.89-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,11Z,11'Z)-bis(octadeca-6,11-dienoate) (AKG-UO-1a)

[0454] [ka] The procedure is described above. 1 H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11.8, 3.3 Hz, 1H), 4.06 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.28 (m, 6H), 2.20 (s, 6H), 2.03-2.01 (m, 16H), 1.74-1.64 (m, 2H), 1.62-1.60 (m, 6H), 1.38-1.27 (m, 22H), 0.89-0.85 (m, 6H). MS (APCI +): 658.5 (M+1)

[0455] [Example 1C] Synthesis of the KC-01 series of ionizable lipids Synthesis of 2-((S)-2,2-di((6Z,12Z)-octadeca-6,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-01, O-12095) 3-((S)-2,2-di((6Z,12Z)-octadeca-6,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-01, O-12096)

[0456] [ka] Synthesis of (6Z,12Z)-1-bromooctadeca-6,12-diene, 2

[0457] [ka] To a solution of (6Z,12Z)-octadeca-6,12-dien-1-ol, 1 (3.6 g, 13.7 mmol), in dichloromethane (50 mL) was added methanesulfonyl chloride (1.26 mL, 16.4 mmol) and triethylamine (3.6 mL, 20.5 mmol) at 0° C. The resulting solution was warmed to room temperature and stirred for 2 h. The mixture was quenched with water and extracted with dichloromethane (2×100 mL). The combined organics were washed with brine, then dried over magnesium sulfate, and filtered. The filtrate was concentrated in vacuo to give a crude oil. The resulting oil was dissolved in diethyl ether (50 mL) and added to a stirred slurry of magnesium bromide ethyl etherate (7 g, 27.4 mmol) in diethyl ether (50 mL) at 0° C. The mixture was warmed to room temperature and stirred for 2 h. The reaction mixture was quenched with water and extracted with ethyl acetate (2 × 100 mL). The combined organics were washed with brine, then dried over magnesium sulfate, and then filtered. The filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 5–10% ethyl acetate in n-hexane as eluent to give (6Z,12Z)-1-bromooctadeca-6,12-diene, 3 (2.9 g, 8.89 mmol, 65%) as a yellow oil. 1 H NMR (300 MHz, CDCl3): 5.36-5.33 (m, 4H), 3.42-3.37 (t, J = 7.5 Hz, 2H), 2.04-1.97 (m, 8H), 1.83-1.83 (m, 2H), 1.37-1.28 (m, 14H), 0.90-0.86 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-ol, 3

[0458] [ka] A solution of (6Z,12Z)-1-bromooctadeca-6,12-diene, 2 (2 g, 6.08 mmol) in ether (10 mL) was added to a mixture of magnesium turnings (162 mg, 6.69 mmol) and iodine in ether (2 mL) at room temperature under argon. The mixture was stirred at room temperature for 90 minutes (the magnesium turnings were consumed), at which point ethyl formate (0.24 mL, 3.04 mmol) was added. After stirring at room temperature for 1 hour, the reaction was quenched with 1N HCl solution. The mixture was extracted with ethyl acetate (2 × 100 mL), and the combined organics were washed with water and then brine. The organics were dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The resulting oil was dissolved in ethanol (10 mL) and added to a solution of potassium hydroxide (260 mg) in water (3 mL). After stirring for 12 hours, the pH of the mixture was adjusted to 4 with 2N HCl. The aqueous solution was extracted with dichloromethane (2x) and combined. The organics were washed with brine, then dried over magnesium sulfate and filtered. The filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified on silica using 10-30% ethyl acetate in n-hexane as the eluent to give (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-ol, 3 (0.29 g, 0.55 mmol, 18%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 8H), 3.57 (bs, 1H), 3.33-3.32, (m, 2H), 2.13-1.97 (m, 16H), 1.36-1.29 (m, 34H), 0.90-0.86 (t, J = 6.6 Hz, 6H). Synthesis of (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-one, 4

[0459] [ka] To a mixture of (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-ol, 3 (0.29 g, 0.55 mmol) and sodium carbonate (3 mg, 0.03 mmol) in dichloromethane at 0 °C, pyridinium chlorochromate (236 mg, 1.1 mmol) was added. The mixture was warmed to room temperature and stirred for 1 h. After 1 h, silica gel (1 g) was added to the reaction, and the mixture was filtered. The filtrate was concentrated, and the resulting oil was purified on silica using 10–20% ethyl acetate in n-hexane as eluent to give (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-one, 4 (0.12 g, 0.23 mmol, 42%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 8H), 3.36-3.32, (m, 1H), 2.40-2.35 (t, J = 6.6 Hz, 3H), 2.14-2.00 (m, 16H), 1.58-1.54 (m, 4H), 1.34-1.29 (m, 28H), 0.90-0.86 (t, J = 6.6 Hz, 6H). Synthesis of 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)ethan-1-ol, 7

[0460] [ka] A mixture of (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-one, 4 (0.12 g, 0.23 mmol), (4S)-(+)-4-(2-hydroxyethyl)-2,2-dimethyl-1,3-dioxolane 5 (0.20 g, 1.38 mmol), and pyridinium p-toluenesulfonate (9 mg) in toluene (10 mL) was heated to reflux under a positive pressure of nitrogen. After 12 h, the mixture was concentrated in vacuo to give a crude oil. The resulting crude oil was purified by chromatography on silica using 20–40% ethyl acetate in n-hexane as the eluent to give 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)ethan-1-ol, 7 (0.11 g, 0.17 mmol, 77%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 8H), 4.25-4.20 (m, 1H), 4.10-4.06 (m, 1H), 3.82-3.77 (m, 1H), 3.54-3.49 (m, 1H), 2.23-2.19 (t, J = 6.6 Hz, 3H), 2.14-2.00 (m, 16H), 1.84-1.78 (m, 2H), 1.62-1.51 (m, 6H), 1.34-1.29 (m, 28H), 0.90-0.86 (t, J = 6.6 Hz, 6H). Synthesis of 3-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)propan-1-ol, 8

[0461] [ka] A mixture of (6Z,12Z,25Z,31Z)-heptatriaconta-6,12,25,31-tetraen-19-one, 4 (0.50 g, 0.95 mmol), (S)-(3)-(2,2-dimethyl-1,3-dioxolan-4-yl)propanol 6 (0.76 g, 4.75 mmol), and pyridinium p-toluenesulfonate (36 mg) in toluene (10 mL) was heated to reflux under a positive pressure of nitrogen. After 12 h, the mixture was concentrated in vacuo to give a crude oil. The resulting crude oil was purified by chromatography on silica using 20–40% ethyl acetate in n-hexane as the eluent to give 3-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)propan-1-ol, 8 (0.48 g, 0.76 mmol, 80%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.34-5.29 (m, 8H), 4.06-4.02 (m, 2H), 3.67-3.47 (m, 2H), 3.45-3.43 (m, 1H), 2.12-2.01 (m, 16H), 1.65-1.62 (m, 8H), 1.34-1.29 (m, 32H), 0.89-0.85 (t, J = 6.6 Hz, 6H). Synthesis of 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-01, O-12095)

[0462] [ka] To a solution of 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)ethan-1-ol, 7 (0.49 g, 0.79 mmol) in dichloromethane (10 mL) at 0 °C was added methanesulfonyl chloride (73 μL, 0.95 mmol) and triethylamine (0.26 mL, 1.2 mmol). The solution was warmed to room temperature and stirred for an additional 1 h. The reaction was quenched with water and extracted with dichloromethane (2 × 100 mL). The organics were washed with brine, then dried over magnesium sulfate and filtered. The filtrate was concentrated in vacuo to give a crude oil. A solution of 2 M dimethylamine (10 mL) was added to the resulting crude oil and stirred for 24 h. The mixture was then quenched with water and extracted with dichloromethane (2 × 100 mL). The combined organics were washed with brine, then dried over magnesium sulfate, and then filtered. The filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by chromatography on silica using 5 to 100% ethyl acetate in n-hexane as eluent to give 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-01, O-12095) (206 mg, 0.32 mmol, 41%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.35-5.32 (m, 8H), 4.08-4.03 (m, 2H), 3.47 (t, J = 6.8 Hz, 1H), 2.36-2.27 (m, 2H), 2.21 (s, 6H), 2.01-1.99 (m, 16H), 1.88-1.77 (m, 2H), 1.68-1.53 ​​(m, 6H), 1.42-1.19 (m, 34H), 0.96-0.86 (t, J = 3.7 Hz, 6H). C 43 H 79 MS(APCI) of NO2: 642.6 Synthesis of 3-((S)-2,2-di((6Z,12Z)-octadeca-6-12-dien-4-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine, AKG-KC3-01, O-12096

[0463] [ka] The procedure is described above. 3-((S)-2,2-di((6Z,12Z)-octadeca-6-12-dien-4-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-01, O-12096) (255 mg, 0.39 mmol, 51%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.39-5.32 (m, 8H), 4.06-4.02 (m, 2H), 3.48-3.44 (m, 1H), 2.35-2.30 (m, 2H), 2.25 (s, 6H), 2.01-1.98 (m, 16H), 1.70-1.51 (m, 12H), 1.35-1.25 (m, 32H), 0.90-0.85 (t, J = 6.6 Hz, 6H). C 44 H 81 MS(APCI) of NO2: 656.6 Synthesis of 2-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-OA, O-11880) 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-PA, O-11879) 3-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-OA, O-11957)

[0464] [ka] Experimental Procedure (see synthesis of AKG-KC2-01 above) Synthesis of (Z)-1-bromooctadec-9-ene 3

[0465] [ka] The procedure is described above. (Z)-1-Bromooctadec-9-ene (6.4 g, 19.33 mmol) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 2H), 3.41 (t, J = 7.5 Hz, 2H), 2.01-1.99 (m, 4H), 1.87-1.82 (m, 2H), 1.44-1.26 (m, 22H), 0.87 (t, J = 6.6 Hz, 3H). (Z)-16-Bromohexadec-7-ene 4

[0466] [ka] 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 2H), 3.42 (t, J = 7.5 Hz, 2H), 2.01-1.99 (m, 4H), 1.87-1.82 (m, 2H), 1.44-1.26 (m, 18H), 0.89 (t, J = 6.6 Hz, 3H). Synthesis of (9Z,28Z)-heptatriaconta-9,28-dien-19-ol 5

[0467] [ka] The procedure is described above. (9Z,28Z)-Heptatriaconta-9,28-dien-19-ol (1.2 g, 2.25 mmol, 47%) as a solid. 1H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 3.57 (bs, 1H), 2.01-1.97 (m, 8H), 1.42-1.26 (m, 53H), 0.89 (t, J = 6.6 Hz, 6H). (7Z,26Z)-Tritriaconta-7,26-dien-17-ol 6

[0468] [ka] 1 H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 3.57 (bs, 1H), 2.01-1.97 (m, 8H), 1.42-1.26 (m, 45H), 0.89 (t, J = 6.6 Hz, 6H). Synthesis of (9Z,28Z)-heptatriaconta-9,28-dien-19-one 7

[0469] [ka] The procedure is described above. (9Z,28Z)-Heptatriaconta-9,28-dien-19-one (0.89 g, 1.67 mmol, 74%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 2.03-1.98 (m, 8H), 1.42-1.26 (m, 52H), 0.90-0.89 (t, J = 6.6 Hz, 6H). (7Z,26Z)-tritriaconta-7,26-dien-17-one 8

[0470] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 2.03-1.98 (m, 8H), 1.42-1.26 (m, 44H), 0.90-0.89 (t, J = 6.6 Hz, 6H). Synthesis of 2-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)ethan-1-ol 9

[0471] [ka] The procedure is described above. 2-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)ethan-1-ol (0.39 g, 0.63 mmol, 74%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.36-5.28 (m, 4H), 4.22-4.10 (m, 1H), 4.08-4.05 (m, 1H), 3.82-3.79 (m, 2H), 3.48 (t, J = 6.8 Hz, 1H), 2.24-2.21 (m, 1H), 2.01-1.99 (m, 8H), 1.81-1.80 (m, 2H), 1.59-1.54 (m, 6H), 1.34-1.26 (m, 45H), 0.87 (t, J = 6.3 Hz, 6H). Synthesis of 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)ethan-1-ol, 10

[0472] [ka] The procedure is described above. 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)ethan-1-ol (1.02 g, 1.65 mmol, 51%) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 4.23-4.10 (m, 1H), 4.07-4.05 (m, 1H), 3.82-3.79 (m, 2H), 3.48 (t, J = 6.6 Hz, 1H), 2.24-2.12 (m, 1H), 2.01-1.97 (m, 8H), 1.84-1.78 (m, 2H), 1.57-1.55 (m, 8H), 1.34-1.29 (m, 35H), 0.87 (t, J = 6.3 Hz, 6H). Synthesis of 3-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)propan-1-ol, 11

[0473] [ka] The procedure is described above. 3-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)propan-1-ol (0.41 g, 0.65 mmol, 76%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.39-5.32 (m, 4H), 4.06-4.03 (m, 2H), 3.71-3.67 (m, 2H), 3.47-3.46 (m, 1H), 2.01-1.99 (m, 10H), 1.66-1.59 (m, 4H), 1.56-1.54 (m, 6H), 1.34-1.26 (m, 44H), 0.87 (t, J = 6.3 Hz, 6H). Synthesis of 2-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-OA, O-11880)

[0474] [ka] The procedure is described above. 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-OA, O-11880) (200 mg, 0.31 mmol, 49%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.38-5.28 (m, 4H), 4.08-4.01 (m, 2H), 3.48 (t, J = 6.8 Hz, 1H), 2.39-2.24 (m, 2H), 2.21 (s, 6H), 2.01-1.97 (m, 8H), 1.82-1.77 (m, 2H), 1.68-1.52 (m, 6H), 1.34-1.26 (m, 46H), 0.87 (t, J = 6.3 Hz, 6H). C 43 H 83 MS(APCI) of NO2: 646.7 Synthesis of 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-PA, O-11879)

[0475] [ka] The procedure is described above. 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-PA, O-11879) (195 mg, 0.33 mmol, 18%) as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.28 (m, 4H), 4.08-4.02 (m, 2H), 3.48 (t, J = 6.6 Hz, 1H), 2.38-2.27 (m, 2H), 2.20 (s, 6H), 2.01-1.99 (m, 8H), 1.97-1.80 (m, 2H), 1.77-1.52 (m, 6H), 1.34-1.29 (m, 38H), 0.87 (t, J = 6.3 Hz, 6H). C 39 H 75 MS(APCI) of NO2: 590.6 Synthesis of 3-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-OA, O-11957)

[0476] [ka] The procedure is described above. 3-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-OA, O-11957) (160 mg, 0.24 mmol, 37%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.39-5.28 (m, 4H), 4.06-4.01 (m, 2H), 3.44 (t, J = 6.8 Hz, 1H), 2.26 (t, J = 6.8 Hz, 2H), 2.20 (s, 6H), 2.01-1.97 (m, 8H), 1.82-1.77 (m, 2H), 1.60-1.43 (m, 8H), 1.34-1.26 (m, 46H), 0.87 (t, J = 6.3 Hz, 6H). C 44 H 85 MS(APCI) of NO2: 660.6

[0477] Example 2: In vitro analysis of cytotoxicity in human hepatocytes or cancer cells LNPs can be tested in vitro using a 10-fold dilution series to determine IC50 values ​​in human hepatocyte / liver (HepG2; ATCC #HB8065) ​​cells. Because these formulations are generally considered nontoxic, a positive control of Lipofectamine™ 3000 (ThermoFisher #L3000015) complexed mRNA (2 μL of reagent / 1 μg of mRNA) is included in all studies. The mRNAs used are CleanCap FLuc, EGFP, or MCherry reporter gene mRNA (5 moU; Trilink #L-7202, #L-7201, or #L-7203). Data are recorded from whole cell viability curves and actual IC50 values ​​are calculated for each compound.

[0478] Adherent cells are grown to approximately 80% confluency. Cells are trypsinized by adding 0.25% trypsin-EDTA (Gibco #25200-072), followed by settling and dispersing the cells with 5 mL of growth medium (MEM medium; Corning #10010CM). Cell density is determined using a hemocytometer. Growth medium (MEM medium containing 10% FBS; Corning #35015CV) is added to the cells to adjust the appropriate cell concentration. Then, 200 μL of cells (5,000 cells / well) are added to a 96-well clear flat-bottom plate (Costar #9804) and incubated in the plate at 37°C in a humidified incubator with 5% CO2 for 24 hours.

[0479] Serial dilutions of the LNP formulations were prepared using growth medium as the solvent. These compounds were produced as sterile aqueous solutions with a concentration of 1 mg / mL mRNA. To make the dilutions, each LNP stock was warmed to room temperature. These were further diluted 4-fold in growth medium to achieve the highest mRNA concentration tested of 250 μg / mL.

[0480] LNPs were serially diluted 1:3 from an initial concentration of 250 μg / mL of each LNP by aspirating the old medium and replacing it with 200 μL of LNP-containing medium. The plates were incubated for 72 hours at 37°C in a humidified incubator with 5% CO2. At the end of the LNP incubation period, the medium in each well was replaced with 100 μL of 1X PrestoBlue Cell Viability Reagent (ThermoFisher catalog #A13261). The plates were incubated for 30 minutes to 2 hours at 37°C in a humidified incubator with 5% CO2. Readings were taken at 30, 60, and 120 minutes. Fluorescence was read at 560 nm excitation and 590 nm emission using a SpectraMax M5 plate reader (Molecular Devices). Background correction was performed by subtracting the RFU of a control containing culture medium only (background control wells) from all sample readings. Calculate the percentage of cytotoxicity using the following formula: %Cytotoxicity=[(RFU 培地 -RFU 処置 ) / RFU 培地 ]×100% IC50 was determined using GraphPad Prism using the following formula: Y=100 / (1+10^((LogIC50-X)*HillSlope)))

[0481] The cytotoxicity of a Lipofectamine™ 3000 (ThermoFisher #L3000015) complexed mRNA (2 μL of reagent / 1 μg of mRNA) positive control can, in some embodiments, be 5-100 times more toxic than the compounds disclosed herein. This demonstrates that the disclosed compounds are less toxic than commercially available transfection reagents in in vitro hepatotoxicity assays. In some embodiments, the compounds described herein form LNPs in vivo that are less toxic than commercially available transfection reagents.

[0482] [Example 3] Determination of pKa of ionized lipids The pKa of ionized cationic lipids can be calculated in several ways. For lipids, this can be difficult because membrane structure and neighboring lipids within the membrane can affect the dissociation properties of the amino groups, potentially resulting in inaccurate values. In this case, in situ measurements are ideal, where the apparent pKa of the ionized lipid is measured while the lipid is in its intended environment as part of an LNP (Jayaraman 2012, Sabins 2018).

[0483] For each LNP formulation, the pKa value of the amino lipid is determined by measuring the fluorescence of 2-(p-toluidino)-6-naphthalenesulfonic acid (TNS) during a titration from pH 3 to 12. TNS is an anionic molecule that does not fluoresce in solution but increases in fluorescence upon interaction with a cationic lipid membrane; this property has traditionally been used to examine membrane surface charge. A master buffer stock (10 mM sodium phosphate, 10 mM sodium borate, 10 mM sodium citrate, 150 mM sodium chloride) is prepared, which is used to prepare buffers of various pH values ​​for determining apparent pKa. Approximately 20 unique buffers of various pH values, ranging from approximately 3 to 12, are prepared from the master buffer stock using 1 M sodium hydroxide and 1 M hydrochloric acid. 300 mM 6-(p-toluidino)-2-naphthalenesulfonic acid sodium salt (TNS reagent) solubilized in dimethyl sulfoxide (DMSO) is used as the stock. LNPs are prepared and purified to obtain a final mRNA concentration of 0.04 mg / mL in buffer at the desired pH. A 96-well plate is pre-inserted with the desired buffer and mRNA-containing LNPs are added to a final mRNA concentration of 0.7 μg / mL. TNS is added to each well to achieve a DMSO concentration of 1% (v / v). After mixing, the fluorescence of TNS in each well is measured (Ex / Em = 331 nm / 445 nm) and a sigmoidal best fit analysis is applied to the fluorescence data. The pKa is determined as the pH that results in a half-width fluorescence intensity. The apparent pKa measured for compounds 1–36 is within the pH range of 6.0–7.0.

[0484] [Example 4] Measurement of cellular uptake of LNP Measurement of cellular uptake of LNPs is achieved by fluorescence imaging and / or fluorescence quantification. Many suitable fluorescent tracers are available, including 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate (DiI), 3,3'-dilinoleyloxacarbocyanine perchlorate (DiO), 1,1'-dioctadecyl-3,3,3',3'-tetramethylindodicarbocyanine perchlorate (DiD), and 1,1'-dioctadecyl-3,3,3',3'-tetramethylindotricarbocyanine iodide (DiR) (Thermo). These lipids are slightly fluorescent in water but highly fluorescent when incorporated into lipid membranes, such as those present in LNPs. It is important that the lipids selected are photostable and have high extinction coefficients.

[0485] LNPs containing these types of lipids are visualized under a fluorescent microscope. In one method, the LNP lipid formulation contains a fluorescent lipid tracer, such as 1,1'-dioctadecyl-3,3,3',3'-tetramethylindodicarbocyanine-5,5'-disulfonic acid (DiI5-DS), at 0.1-0.5 mol% of the total lipid. Cells of interest are grown in suitable cell culture dishes, such as 24-well plates (Corning). Cells are seeded the day before uptake studies at 50% confluency and grown overnight under appropriate conditions, such as 37°C, 5% CO2, and 90-100% humidity. LNPs are added to cell culture medium at 0.1-100 μg / mL mRNA and allowed to interact with the cells for a period of time (4-24 hours). The cells are then washed three times with medium to remove uninternalized LNPs before observation. Cells are observed using a microscope equipped with fluorescence detection capabilities. The relative extent of LNP cellular uptake is determined from the fluorescence intensity signal obtained from the cells, using untreated cells as a background control. Alternatively, quantitative measurement of fluorescent cellular lipids can be achieved by pelleting the cells, solubilizing them with a detergent such as Triton-X100, and quantifying the fluorescence by spectrofluorometer or quantifying the fluorescent lipid tracer by HPLC.

[0486] Quantification of fluorescently labeled mRNA can be achieved in a similar manner. For example, both dye-labeled enhanced green fluorescent protein (EGFP) and firefly luciferase (FLuc) mRNAs are transcribed with a 1:3 ratio of cyanine 5-UTP:5-methoxy-UTP, currently available from Trilink Biotechnologies. Cyanine 5 has an excitation maximum of 650 nm and an emission maximum of 670 nm. The mRNA obtained by this substitution is easily visualized and can still be translated in cell culture. By capturing the fluorescently labeled mRNA, the intracellular transport of mRNA can be visualized using the above method.

[0487] Intracellular LNP uptake can be achieved by endogenous methods, such as ApoE-mediated uptake, or exogenous methods, such as active targeting. LNP systems containing ionizable cationic lipids have been shown to utilize a "natural" targeting process, adsorbing apolipoprotein E (ApoE) in the blood (Cullis et al., 2017) and then actively taking up into hepatocytes via multiple receptors containing ApoE-binding ligands (Williams et al., 2010). By using non-overlapping fluorophores, it is possible to independently track the intracellular distribution and organelle accumulation kinetics of mRNA and LNP.

[0488] Cellular mRNA expression levels can be quantified using reporter systems such as EGFP, FLuc, or mCherry, available from Trilink Biotechnologies. In one embodiment, EGFP mRNA is encapsulated in LNPs and added to cells of interest at 0.1-100 μg / mL mRNA. After 4-24 hours, the medium may be replaced to wash away any non-internalized LNPs. At 24 hours, the GFP signal is quantified by fluorescence microscopy or flow cytometry. This method allows for differentiation of a panel of LNP formulations based on reporter protein expression levels.

[0489] [Example 5] Transfection selectivity index The transfection selectivity index (TSI) is calculated to determine the relative transfection efficiency in mammalian cells (compared to the relative toxicity in the same cells). The selectivity index was calculated using the following formula: TSI=EF 哺乳類 / I C 50、哺乳類

[0490] In the formula, EF 哺乳類 is the transfection efficiency expressed in terms of protein (ng) / million cells, and IC 50、哺乳類 relates to cell viability of the same formulation converted to half-maximum inhibitory concentration.

[0491] LNPs using compounds (1-36) described herein have a TSI 50% higher than LNPs made using identical but identical LNPs made using the control molecule DLin-MC3-DMA as the ICL.

[0492] [Example 6] Analysis of lipid peroxidation The degree of oxidation can be determined using a forced degradation assay in which LNP samples are treated with 3% HO at 25°C and lipid oxidation products are sampled on days 0, 1, 3, and 5 (Blessy et al. (2014) Journal of Pharmaceutical Analysis 4, 159-165). The oxidation reaction is quenched by adding 0.1 M butylated hydroxytoluene (BHT) in ethanol and stored frozen at -80°C until measurement. Lipid oxidation products can be measured using a 2-thiobarbituric acid (TBA) reactivity assay (Gutteridge (1982) FEBS Letters 150, 454-458) to detect malondialdehyde (MDA), the end product of lipid peroxidation, or by detection using an HPLC assay with evaporative light scattering detection (ELSD) or charged aerosol detection (CAD). Impurity structures of lipid oxidation and isomerization can be assigned based on known literature precedent and are expected to be mixtures of isomers.

[0493] It is generally known in the art that lipids with multiple unsaturations in the acyl chain are more susceptible to oxidation (see Reis and Spickett (2012) Biochim Biophys Acta 1818, 2374-2387).

[0494] Compounds 1-36 described herein are predicted to be less susceptible to oxidative damage or degradation when compared to control LNPs containing DLin-KC2-DMA lipids or when compared to control LNPs containing DLin-MC3-DMA. In some embodiments, the compounds provided herein produce more than 30%, more than 50%, more than 75%, more than 90%, and more than 95% less oxidation by-products when compared to control LNPs.

[0495] Example 7 Preparation of Ligand-Targeted LNPs Antibody ligands in the form of antibody Fab' fragments or single-chain Fv fragments that result in specific uptake of LNPs into target cells, such as immune cells, are prepared by any method known in the art (e.g., as described in Drummond et al., U.S. Patent Application No. 20180271998; Zhou et al., U.S. Patent No. 10,406,225; Marks et al., U.S. Patent No. 8,974,792, which are incorporated herein by reference). To conjugate the ligand to LNPs, the ligand is constructed with a C-terminal sequence (such as CAA or GGSGGC) containing a cysteine ​​residue. The ligand is expressed in bacteria or eukaryotic cells and isolated from the cell mass or growth medium using standard methods, such as protein affinity chromatography or metal chelation chromatography. To activate the thiol group of the terminal cysteine ​​residue, the ligand is incubated for 1 hour in the presence of 15 mM cysteine ​​in 10 mM citrate buffer (pH 6.0-6.2) containing 140 mM NaCl, and purified by gel chromatography on a Sephadex G-25 or similar column using 10 mM citrate buffer (pH 6.0-6.2) containing 140 mM NaCl as the eluent. The protein concentration in the purified cysteine-activated ligand solution is determined using UV spectrophotometry at 280 nm. One to 10 mg / mL of the antibody ligand in the designated buffer is mixed with an aqueous solution of maleimide-terminated PEG-DSPE derivative (mal-PEG(2000)-DSPE, catalog number 880126, Avanti Polar Lipids, AL, USA, or Sunbright® DSPE-020MA, NOF Corporation, Japan) at a protein / lipid molar ratio of 4:1. If a longer distance between the LNP surface and the ligand moiety is desired, Mal-PEG-lipids with PEG spacers of molecular weight 3,400 (Sunbright® DSPE-034MA) or 5,000 (Sunbright® DSPE-050MA), available from NOF Corporation, can be used.The solution is incubated at ambient temperature for 2 hours, adjusted to 0.5 mM cysteine ​​to block unreacted maleimide groups, and the micellar ligand-PEG-DSPE conjugate is purified by gel chromatography on Ultrogel AcA34 (if the ligand is a Fab) or Ultrogel AcA44 (if the ligand is an scFv) using 144 mM NaCl buffered with 10 mM HEPES (pH 7.0-7.4) as the eluent. The conjugated protein is quantified by UV spectrophotometry, and purity is confirmed by SDS gel electrophoresis.

[0496] Ligands are attached to the surface of the LNPs by one of the following methods.

[0497] Method 1: Preformed LNPs (obtained as described in Hope et al., US Pat. No. 10,653,780, incorporated herein by reference) are mixed with a micellar solution of ligand-PEG-DSPE conjugates in HEPES-buffered saline (10 mM HEPES, 140 mM NaCl, pH 7.0-7.2) to achieve the required ligand / lipid ratio per LNP particle in the range of 5-100 (typically 15-30). The mixture is incubated at 37-40°C for 2 hours or at 2-8°C overnight with gentle agitation, during which time the conjugates are incorporated into the outer lipid layer of the LNPs. The ligand-conjugated LNPs are purified from unincorporated ligand-PEG-DSPE by gel chromatography on Sepharose CL-2B or CL-4B (hydrophilic size-exclusion media with the same molecular weight cutoff can also be used), until the LNP fraction emerges around the time the void volume is collected. The amount of ligand conjugated to the particles is determined by SDS gel electrophoresis using Coomassie blue or fluorescent staining and co-run ligand standards.

[0498] Method 2: A solution of the ligand-PEG-DSPE conjugate in 10 mM Na-citrate buffer (pH 4.0), which also contains the nucleic acid component of the LNP, is mixed with a solution of LNP lipids in ethanol to a final ethanol concentration of 40% by volume as described in Semple et al., U.S. Patent No. 8,021,686, incorporated herein by reference. Alternatively, the LNP preparation protocol of Hope et al., U.S. Patent No. 10,653,780, incorporated herein by reference, is used. The amount of ligand-PEG-DSPE is 0.1-1 mol% of the lipid. The mixture is dialyzed against HEPES-buffered saline (10 mM HEPES, 140 mM NaCl, pH 7.0) to remove the ethanol. The ligand-PEG-DSPE is incorporated into the resulting LNPs. Any residual ligand-PEG-DSPE is removed by gel chromatography using Sepharose CL-4B or CL-2B, eluent HEPES-buffered saline, or by buffer exchange into HEPES-buffered saline by tangential flow filtration on a polysulfone membrane (flat or hollow fiber cartridge) with a molecular weight cut-off of 500 KD.

[0499] Method 3: Mal-PEG-DSPE is combined with preformed LNPs in citrate-buffered saline (10 mM Na-citrate buffer (pH 6.0-6.2), 140 mM NaCl) in an amount of 0.1-1 mol% relative to the LNP lipid in the same manner as the ligand-PEG-DSPE in Method 1. The LNPs with incorporated mal-PE-DSPE are purified from unincorporated mal-PEG-DSPE by gel chromatography on Sepharose CL-4B in the same buffer and incubated with thiol-activated antibody ligands (5-100 ligands per LNP particle) for 2-24 hours. The resulting ligand-conjugated LNPs are purified from unconjugated ligand by Sepharose CL-4B gel chromatography using HEPES-buffered saline (pH 7.0) as the eluent.

[0500] Method 4: Mal-PEG-DSPE is incorporated into LNPs at 0.1-1 mol% of the LNP lipids in the same manner as ligand-PEG-DSPE in Method 2. The resulting Mal-PEG-conjugated LNPs are incubated with a thiol-activated ligand and purified as described in Method 3.

[0501] Method 5: The protocol of Method 4 is carried out, except that instead of mal-PEG-DSPE, maleimide-conjugated lipid without a PEG spacer (mal-DSPE, Coatsome® FE-808MA3, NOF Corporation, Japan) is added to the lipid solution. The resulting maleimide-LNPs are conjugated to thiol-activated ligands as in Method 3.

[0502] Method 6 A small molecule ligand (e.g., mannose) is conjugated to the LNP by Method 1 or 2, where mannose-PEG-DSPE (Biochempeg Scientific, Massachusetts, USA, Cat. No. 12169) replaces the antibody ligand-PEG-DSPE.

[0503] Example 8: Determining the optimal ligand density for ligand-targeted LNPs LNP panels with increasing ligand densities in a given range (2-200 ligands per LNP particle or 5-100 ligands per LNP particle) are prepared using either of the methods in Example 7. The LNPs are fluorescently labeled by incorporating fluorescently labeled lipids or fluorescently labeled nucleic acids as described in Example 4. The labeled ligand-conjugated LNPs are tested for cellular uptake according to Example 4 to determine the ligand content corresponding to maximum ligand-specific cellular uptake of the LNPs. The intracellular function of the nucleic acid (such as mRNA expression) can be used as the analytical output (Example 4), in which case the presence of a detectable label on the lipid or nucleic acid is not required.

[0504] [Example 9] Preparation of lipid nanoparticles (LNPs) mRNA modified with 5-methoxyuridine (5moU) and encoding mCherry (Catalog #L-7203) was obtained from Trilink Biotechnologies (San Diego, CA). All uridine nucleosides were replaced with N1-methyl-pseudouridine. To generate mRNA, a synthetic gene encoding the mRNA sequence was cloned into a DNA plasmid. The synthetic gene consisted of an RNA promoter, a 5' untranslated region, the mCherry protein coding sequence, a 3' untranslated region, and a poly(A) tail region of approximately 120 As. The open reading frame sequence of mCherry mRNA from TriLink (Catalog #L-7203) is SEQ ID NO:1: AUGGUGAGCAAGGGCGAGGAGGACAACAUGGCCAUCAUCAAGGAGUUCAUGCGGUUCAAGGUGCACAUGGAGGGCAGCGUGAACGGCCACGAGUUCGAGAUCGAGGGCGAGGGCGAGGCCGGCCCUACGAGGGCACCCAGACCGCCAAGCUGAAGGUGACCAAGGGCGGCCCCCUGCCC UUCGCCUGGGACAUCCUGAGCCCCAGUUCAUGUACGGCAGCAAGGCCUACGUGAAGCACCCCGCCGACAUCCCGGACUACCUGAAGCUGAGCUUCCCCGAGGGCUUCAAGUGGGAGCGGGUGAUGAACUUCGAGGACGGCGGCGUGGACCGUGACCCAGGACAGCAGCCUGCAGGAC GGCGAGUUCAUCUACAAGGUGAAGCUGCGGGGCACCAACUUCCCCAGCGACGGCCCCGUGAUGCAGAAGAAGACCAUGGGCUGGGAGGCCAGCAGCGAGCGGAUGUACCCCGAGGACGGCGCCCUGAAGGGCGAGAUCAAGCAGCGGCUGAAGCUGAAGGACGGCGGCCACUACGACGCC GAGGUGAAGACCACCUACAAGGCCAAGAAGCCCGUGCAGCUGCCCGGCGCCUACAACGUGAACAUCAAGCUGGACAUCACCAGCCACAACGAGGACUACACCAUCGUGGAGCAGUACGAGCGGGCCGAGGGCCGGCACAGCACCGGCGGCAUGGACGAGCUGUACAAGAGCGGCAACUGA is equivalent to

[0505] Stock solutions of each lipid were prepared. Ionized lipids were weighed into a 4 mL glass vial (Thermo B7999-2) and dissolved in ethanol (Sigma-Aldrich 200 standard strength, RNase-free) to a final concentration of 10 mM. Other lipids, including DSPS, cholesterol, and PEG-DMG, were weighed and dissolved in ethanol to a concentration of 1 mM. DSPS was dissolved in methanol (Sulpelco, Omnisolve) to a concentration of 1 mM and gently heated to 70 °C to complete dissolution.

[0506] Lipid mixtures for each individual LNP were prepared by adding the desired volume of each lipid stock solution to a new vial and adding ethanol as needed to achieve a final volume of 1.2 mL. For example, the AKG-UO-1 / DSPC / DSPS / Chol / PEG-DMG (50 / 2.5 / 7.5 / 38.5 / 1.5 mol%) LNP formulation with an N / P ratio of 5 contained 1500 nmol AKG-UO-1, 75 nmol DSPC, 225 nmol DSPS, 1155 nmol Chol, and 45 nmol PEG-DMG for every 100 μg of mRNA used.

[0507] An mRNA solution was prepared by thawing a bottle of frozen mRNA (mCherry mRNA, Trilink) and diluting the mRNA in 6.25 mM sodium acetate (pH 5.0) to a final concentration of 0.033 mg / mL. To prepare LNPs, a NanoAssemblr Benchtop microfluidic device (Precision Nanosystems) was used. If the LNPs contained DSPS, a heating block accessory set at 70 °C was used; otherwise, the LNPs were mixed at room temperature. 3 mL of mRNA solution was loaded into a 3 mL disposable syringe (BD309656), and 1 mL of lipid mixture was loaded into a 1 mL syringe (BD309659). The mixture was placed in the NanoAssemblr heating block for 4 minutes before mixing. LNP formation was achieved by pumping a liquid flow of 3:1 water:alcohol volume ratio through a disposable microfluidic cassette at a mixing rate of 6 mL / min. After mixing, 3.6 mL of the LNP mixture was collected, and the first 0.35 mL of the mixed volume and the final 0.05 mL of the mixture were discarded. Ethanol was removed by buffer exchange using SpectraPor dialysis tubing (12-14k MWCO) in PBS (Cytivia, SH30256.01) or by sequential concentration and dilution using Amion Ultra-4 centrifugal concentrators.

[0508] LNPs were typically exchanged into PBS pH 7.4, then into 15 mM Tris (pH 7.4) 20% sucrose, concentrated to 20-50 μg / mL mRNA, bacterial filtered (Thermo Nalgene 0.2 μm #720-1320), and frozen by immersion in liquid nitrogen for 5 minutes before long-term storage at -20°C.

[0509] Example 10: Characterization of LNPs A. Determination of mRNA concentration and relative encapsulation efficiency with fluorescent conjugated dyes Materials: RiboGreen reagent (Thermo #11491), 3 x 96-well plates with lids, PBS, dissociation buffer (PBS with 10% DMSO and 1% (wt / wt) Zwittergent 3-14 (Sigma-Aldrich #693017)), mRNA, general pipette tips & repeater pipette tips. 1. 5 mL of 2 μg / mL mRNA stock was prepared in DPBS or PBS. 2. Diluted standards were prepared in single wells in a 96-well plate (Plate A) as follows.

[0510] JPEG2023553343000266.jpg561703. Using various wells on Plate A, samples were diluted to fall within the range of the standard curve (one well per sample required). For example, the approximate mRNA concentration should be about 30 ug / mL in the sample, so a 20-fold dilution was performed (dilution factor). (20 uL of sample was added to 380 μL of PBS per well). No lid was used on Plate A. Samples were mixed by gently pipetting up and down. Example of Plate A

[0511] JPEG2023553343000267.jpg641704. Two more plates, plates B and C, were used. Using a multichannel pipettor, 60 μL of each standard 2 was pipetted into each well (duplicate sets), and each was sampled into three wells (triplicate sets). Examples of Plates B and C

[0512] JPEG2023553343000268.jpg651705. Count the number of wells used in each plate and add 4 to this number. For Plate B, prepare PBS with a 1:100 dilution of RiboGreen. For example, for 40 wells, use 44 as the number. You will need 44 x 60 μL = 2.64 mL of RiboGreen solution, so you will have 2.61 mL of PBS with 26.4 μL of RiboGreen. 6. In Plate C, 2.61 mL of dissociation buffer and 26.4 uL of RiboGreen were pipetted. 7. Using a 60 μL repeater pipette set, PBS + RiboGreen was added to each well of Plate B, and 60 μL of Dissociation Buffer + RiboGreen was added to Plate C. Both Plates B and C were mixed on an orbital mixer (120 rpm) for 1 minute. Plate B was placed in the dark for 15 minutes. Plate C was incubated in the dark at 37°C for 10 minutes, followed by 5 minutes at room temperature. 8. Both plates were read alternately using excitation at 465 nm and emission at 530 nm. 9. The standard curve was used to calculate the slope and intercept and, by extrapolation, to calculate the mRNA concentrations of the samples on plates B and C (mean and standard deviation). 10. The percent encapsulation efficiency (%EE) of [mRNA] plate B / [mRNA] plate C × 100 was calculated. 11. Total [mRNA] was calculated by [mRNA] plate C x dilution factor. B. LNP particle size 1. 30 μL of LNP was mixed with 1.5 mL of PBS in a polystyrene cuvette (Sarstedt, #67.754) and analyzed for size using a ZetaSizer Pro (Malvern) with ZS Xplorer software (version number 1.4.0.105). Z-average size and polydispersity index values ​​were recorded. Typically, LNP size measurements were performed after LNP mixing, buffer exchange, and bacterial filtration. C. LNP Zeta Potential 1. 30 μL of LNP was mixed with 1.5 mL of PBS and injected into a disposable pleated capillary cell (Malvern Nanoseries DTS1070), and the zeta potential was measured at 25° C. on a ZetaSizer Pro.

[0513] [Example 11] Determination of transfection efficiency of LNPs in mouse dendritic cells using mCherry mRNA A. Cell Growth, Transfection, Harvesting, and Staining Protocols 1. MutuDC1940 cells (ABM) were grown in T75 flasks according to the supplier's instructions. If necessary, the cells were plated at 180,000 cells / well in 24-well plates one day prior to transfection. 2. 1 μg of LNP in 1 mL of medium was added to each well in triplicate, and after 24 hours, cells were washed once with DPBS (VWR02-0119-1000). 3. Then, 0.2 mL of DPBS (plus 5 mM EDTA (pH 7.4)) was added to facilitate separation. 4. The cells were placed at 37°C for 3 minutes until detached. 5. 0.5 mL of DPBS was added to each well and the liquid was transferred to flow cytometry tubes (Falcon 5 mL #352054). 6. The tube was centrifuged at 1100 rpm for 3-5 minutes and the liquid was discarded. 7. 100 μL of Zombie Violet (Biolegend) (1:500 dilution in PBS) was added to each tube. 8. The tube was gently tapped to resuspend the cells and allowed to stand at room temperature in the dark for 15 minutes. 9. 0.5 mL of (4% paraformaldehyde in PBS:DPBS = 1:1) was added to the cells, the cells were gently tapped to resuspend, and the cells were placed on ice for 30 minutes. An additional 2 mL of PBS was added. 10. Cells were pelleted as above and resuspended in 0.5 mL DPBS with 5% BSA and kept in the refrigerator until needed. B. Cell analysis 1. Cell suspensions were analyzed by an Attune NxT flow cytometer using VL1 and YL2 for live / dead and mCherry fluorescent signals, respectively. Gating analysis was performed with FloJo software.

[0514] [Example 12] Effect of DSPS on the transfection efficiency of dendritic cells using LNPs containing KC2 as an ionized cationic lipid The purpose of this study was to investigate the effect of phosphatidylserine targeting on transfection efficiency in mouse dendritic cells using DSPS. LNPs were prepared as described in Example 9, characterized for particle size and zeta potential as described in Example 10, and evaluated for transfection efficiency in mouse dendritic cells as described in Example 11. All LNPs had a constant N / P ratio of 5 and DLin-KC2-DMA at 50 mol% of total lipids, with PS lipids varying from the initial 0 to 2.5 mol%, DSPC phospholipids varying from 0 to 7.5 mol% (total mol% of DSPC and DSPS was constant at 10 mol%), and cholesterol was constant at 38.5 mol% (total mol% of total lipids). The particle size, polydispersity index (PDI), and encapsulation efficiency of all formulations are shown in Tables 5 and 6 below.

[0515] JPEG2023553343000269.jpg45170

[0516] JPEG2023553343000270.jpg51170

[0517] The initial set of LNPs containing DLin-KC2-DMA and various forms of phosphatidylserine in the form of 0 to 2.5 mol% DSPS showed some transfection at 0 or 0.5 mol% DSPS, but showed an 18-fold increase when DSPS was introduced at 2.5 mol% (Figure 3A). A second series of LNPs prepared with 0 to 7.5 mol% DSPS was evaluated at 0.1, 0.3, and 1 μg / mL mRNA concentrations (Figures 3B, 3C, and 3D). As the mol% of DSPS increased beyond 2.5 mol%, transfection efficiency increased, reaching a maximum of 7.5 mol% at 1 μg / mL mRNA and 5 mol% at both 0.1 and 0.3 μg / mL mRNA. These data demonstrate that inclusion of phosphatidyl-L-serine can dramatically increase the transfection efficiency of mRNA-containing LNPs, with maximal uptake occurring at 5–7.5 mol % of DSPS (as % of total lipid).

[0518] Example 13: Effects of ICLs and anionic phospholipid targeting ligands on mRNA transfection of dendritic cells The purpose of this study was to determine whether other anionic phospholipids could enhance the transfection efficiency of LNPs and how LNPs prepared with various ICLs and PS targeting would transfect dendritic cells. LNPs were prepared as described in Example 9, characterized for particle size and zeta potential as described in Example 10, and evaluated for transfection efficiency in mouse dendritic cells as described in Example 11. LNPs had an N / P ratio of 5 and various ICLs (DLin-KC2-DMA, KC2-OA, KC3-OA, or SM-102) constant at 50 mol% of total lipids, with PS lipids kept constant at 5 mol%, DSPC at 5 mol%, and cholesterol kept constant at 38.5 mol% (total mol% of total lipids). The particle size, PDI, and encapsulation efficiency of all formulations are shown in Table 7 below.

[0519] JPEG2023553343000271.jpg70170

[0520] Transfection results are shown in Figure 4 and demonstrate high transfection rates with LNPs prepared using ICLs from three different KC systems (KC2, KC2-OA, and KC3-OA) and the branched ICL SM-102. Encapsulation efficiency was high for all formulations, including those prepared with alternative anionic phospholipids (Suc-DSPE or Glu-DSPE), with particle sizes below 100 nm. The data demonstrate that substitution of DSPS (L-serine) with either N-glutaryl-distearoylphosphatidylethanolamine (Glu-DSPE) or N-succinyl-distearoylphosphatidylethanolamine (Suc-DSPE) resulted in the same high level of mRNA transfection, despite both phospholipids also containing two negative charges and both containing the same distearoyl (C18:0) fully saturated acyl chain. These studies also clearly demonstrate that the addition of DSPS can result in high transfection efficiency for other ionizable cationic lipids, including those with a single unsaturated acyl chain (KC2-OA or KC3-OA) and those containing branched ICLs such as SM-102. Addition of DSPS to SM-102-containing LNPs, for example, resulted in a 22-fold increase in mCherry expression.

[0521] Example 14: Dependence of PS targeting on ICL and PS structure The purpose of this study was to compare PS-targeted LNPs with KC2- and KC3-based ionizable cationic lipids of various acyl chain compositions. KC2-based lipids with a dimethylaminoethyl head group structure were compared with the KC3-based lipid containing a dimethylaminopropyl-derivatized head group. LNPs contained various ICLs (KC2, KC2-01, KC2-OA, KC2-PA, KC3-OA, and KC3-01) with an N / P ratio of 5 and 50 mol% ICL, and a constant 1.5 mol% PEG-DMG. Cholesterol content was kept constant at 38.5 mol%, and DSPC content was varied against the mol% of DSPS at either 0 or 5 mol% (all lipid concentrations were used as mol% of total lipid). Transfection efficiency was evaluated in mouse dendritic cells as described in Example 11.

[0522] JPEG2023553343000272.jpg107170

[0523] The transfection results are shown in Figure 5 and clearly demonstrate the positive impact of PS targeting on multiple KC-based ICLs. Here, we demonstrate that ICLs containing both unsaturated C16 and C18 ICLs can be targeted with phosphatidyl-L-serine, conferring high transfection rates to dendritic cells. The highest transfection rate occurred when PS and PC contained 5 mol% DPPC and 5 mol% DSPS, an acyl chain composition incompatible with C16 ICL (KC2-PA).

[0524] [Example 15] Effect of phosphatidylserine structure on transfection efficiency of LNP The purpose of this study was to investigate the effect of various anionic phospholipid structures on transfection efficiency in dendritic cells. LNPs were prepared as described in Example 9, characterized for particle size and zeta potential as described in Example 10, and evaluated for transfection efficiency in mouse dendritic cells as described in Example 11. All LNPs had a constant N / P ratio of 5 and AKG-UO-1 at 50 mol% of total lipid. The anionic lipid varied depending on the formulation, in contrast to the DSPC phospholipid. Cholesterol was constant at 38.5 mol% except for the 20 mol% DSPS LNPs (all mol% of total lipid). For samples containing up to 10% phosphatidylserine, the phosphatidylcholine composition was correspondingly reduced by 10 mol%. For example, LNPs with 5 mol% DSPS contained 5 mol% DSPS and 5 mol% DSPC, while those containing 10 mol% DSPS had no DSPC. However, for samples that contained 20 mol % DSPS, no DSPC was present in the formulation and the mol % of cholesterol was reduced by 10 mol % to 28.5 mol %.

[0525] The encapsulation efficiency of all formulations was 84-90%, indicating that mRNA was encapsulated in LNPs with high efficiency.

[0526] JPEG2023553343000273.jpg123170

[0527] Figure 6A evaluates the effects of various phosphatidylserine chemical forms, demonstrating the importance of saturation, acyl chain length, and serine stereochemistry on LNP transfection activity in mouse dendritic cells. PS analogs with oleic acid acyl chains or D-serine stereochemistry (DOPS) yielded LNPs with transfection activity equivalent to that of LNPs prepared without any phosphatidylserine. However, LNPs prepared with PS containing the L-isomer of serine and saturated acyl chains transfected dendritic cells significantly better than LNPs without any PS. Among the saturated series, those with C16 (DPPS) or C18 (DSPS) showed the highest activity, while those with C14 (DMPS) still showed improved but lower activity compared to dendritic cells treated with LNPs without any PS. In Figure 6B, the influence of other anionic phospholipids was evaluated using DSPG-containing formulations (5 or 7.5 mol%), which showed activity similar to background, and N-glutaryl- or N-succinyl-distearoylphosphatidylethanolamine (Glu-DSPE or Suc-DSPE), which showed a more modest 3- to 5-fold enhancement in activity when included in these AKG-UO-1-containing LNPs. This example shows that LNPs prepared with saturated phosphatidyl-L-serine transfect dendritic cells significantly better than those containing unsaturated dioleoylphosphatidyl-L-serine (DOPS) or the D-isomer of DSPS. LNPs containing the L-isomers of DSPS and DPPS showed the highest levels of transfection compared to other forms of PS, anionic N-glutaryl or N-succinyl DSPE analogs, or distearoylphosphatidylglycerol (DSPG) (either 5 or 7.5 mol%).

[0528] [Example 16] Optimization of DSPS density on AKG-UO-1-containing LNP The purpose of this study was to investigate the effect of DSPS density on the transfection efficiency of LNPs. LNPs were prepared as described in Example 9. They contained AKG-UO-1 as an ICL at an N / P ratio of 5 and 0 to 20 mol% DSPS, as well as a constant 1.5 mol% PEG-DMG. The cholesterol content was kept constant at 38.5 mol%, and the DSPC content varied inversely from 0 to 10 mol% DSPS (all lipid concentrations were used as mol% of total lipid). In the 20 mol% DSPS formulation, DSPC was absent, and the cholesterol content was reduced by a total of 10 mol% (from 38.5 mol% to 28.5 mol%). Transfection efficiency was evaluated in mouse dendritic cells as described in Example 11.

[0529] JPEG2023553343000274.jpg84170

[0530] The dependence of LNP composition on DSPS concentration for LNPs containing AKG-UO-1 is shown in Figure 7. This study suggests that the presence of DSPS in the formulation allows for high levels of dendritic cell transfection, with an apparent peak of DSPS of 2.5-10 mol % for LNPs containing AKG-UO-1, and approximately 5-7.5 mol % for LNPs containing AKG-UO-1.

[0531] [Example 17] Effect of PEG on transfection efficiency of AKG-UO-1-containing LNP The purpose of this study was to investigate the effect of PEG-lipid density on the transfection efficiency of non-targeted LNPs and phosphatidyl-L-serine-targeted LNPs. LNPs were prepared as described in Example 9. They contained AKG-UO-1 as an ICL at an N / P ratio of 5, either 0 or 5 mol% DSPS, and 0.5 to 4.5 mol% PEG-DMG. The cholesterol content was kept constant at 38.5 mol%, and the DSPC content was 10 mol% in formulations without DSPS and 5 mol% in formulations with 5 mol% DSPS. At PEG-DMG contents above 1.5 mol%, the total cholesterol content was reduced by the amount of PEG-DMG added; for example, at a PEG-DMG content of 3.5 mol%, the cholesterol content decreased from 38.5 mol% to 36.5 mol%. Particles with 0.5% PEG-DMG exhibited a negative zeta potential at pH 7.4 and a significant shift to a positive zeta potential at pH 5. LNPs with 1.5–3.5 mol% PEG-DMG were essentially neutral at pH 7.

[0532] JPEG2023553343000275.jpg86170

[0533] The effect of PEG-DMG on dendritic cell transfection with DSPS-targeted LNPs containing AKG-UO-1 ICLs is shown in Figure 8. Formulations with 0.5% PEG-DMG exhibited 6-7-fold higher transfection efficiency in the presence of 5% DSPS than those observed with 1.5-2.5% PEG-DMG. Transfection with 1.5% and 2.5% PEG-DMG was similar but dramatically decreased with 3.5% and 4.5% PEG-DMG. The ratio of targeted to nontargeted transfection at each PEG density varied: 12-fold with 0.5% PEG, 7-fold with 1.5% PEG, 37-fold with 2.5% PEG, and less than 5-fold with 3.5 and 4.5% PEG, likely due to the high PEG shielding of the PS targeting moiety. The combination of these data indicates that the optimal PEG density range is 0.5-2.5% PEG-DMG, with the lower end of the range being optimal for overall transfection efficiency and 2.5% being optimal for target specificity.

[0534] [Example 18] Oxidative stability of ICL The objective of this study was to compare the stability of ionized cationic lipids with those containing conjugated olefins (e.g., KC2, KC3, and O-11769) and those with conjugated olefins (e.g., KC2-01, KC3-01, and UO-1) under accelerated oxidation.

[0535] Individual lipid stocks (10 mM) were prepared in ethanol and stored at -20 °C. Prior to the experiment, 5 mM suspensions (KC2, KC2-01, KC3, KC3-01, O-11769, and UO-1) were prepared by mixing 45 μL of 10 mM lipid stock in ethanol (Sigma-Aldrich, catalog #459836) with 45 μL of ultrapure water (Rx Biosciences, catalog #P01-UPW02-1000). Liposome formulations based on AKG-UO-1 and O-11769 ionizable cationic lipids (Table 12) were prepared by combining 1 mL of the desired lipid mixture in ethanol with 3 mL of 6.25 mM sodium acetate (pH 5.0) at 6 mL / min on a NanoAssemblr (Precision Nanosystems). 3.6 mL of the mixture was retained, while 0.35 mL of the initial mixture and 0.05 mL of the final mixture were discarded. Each liposome preparation was concentrated using an Aminon-Ultra 4 centrifugal concentrator at 500 g for 10 minutes at 4°C, and the ethanol was removed by buffer exchange into PBS (pH 7.4) by diluting back to the original volume with PBS. This cycle was repeated multiple times until the ethanol concentration was less than 1%. Finally, the liposomes were sterile filtered through a 0.2 μm PES (Nalgene) syringe filter and sized using a Zetasizer (Malvern). The AKG-UO-1-containing formulation (lot #102021-6) had an average size of 81.8 nm and a PDI of 0.09, while the O-11769-containing formulation had an average size of 86.6 nm and a PDI of 0.10.

[0536] JPEG2023553343000276.jpg70170

[0537] Aliquots of liposome formulations were stored at -80°C and thawed before experiments. A combined stock of 10% HO (Sigma-Aldrich, catalog #H1009) and 1 mM Fe(III)Cl (Sigma-Aldrich, catalog #372870) in water was freshly prepared before treatment. To create a final concentration of 1% HO and 100 μM Fe(III)Cl, 10 μL of 10% HO / 1 mM Fe(III)Cl stock was added to 90 μL of both liposome formulations and individual lipids. The liposomes and individual lipids were incubated with HO / Fe(III)Cl at 37°C, and then 5 μL of each sample was removed at various time points (0, 3, 24, 48, and 72 hours) and dissolved in 90 μL of MeOH for HPLC analysis. The degradation of the major lipid peaks was analyzed using a Thermo Scientific Vanquish Flex UHPLC equipped with a charged aerosol detector (CAD) and a Thermo Scientific Accucore™ C18+ UHPLC column (L = 50 mm, D = 2.1 mm, particle size = 1.5 μm). The UHPLC operating conditions are listed in Table 13.

[0538] JPEG2023553343000277.jpg138170

[0539] Data are presented as the percentage of the major lipid peak measured at various time points relative to the lipid peak measured at time zero.

[0540] JPEG2023553343000278.jpg91170

[0541] As shown in Figures 9A and 9B, all ICLs with olefins having four methylenes between them (KC2-01, KC3-01, and UO-1) demonstrate dramatically superior stability under accelerated oxidation with hydrogen peroxide compared to their counterparts with a single methylene separating the two olefins (KC2, KC3, and O-11769, respectively). Even after 72 hours of treatment with hydrogen peroxide, the major peaks of KC2-01, KC3-01, and UO-1 remain greater than 70% of their initial peaks, whereas KC2, KC3, and O-11769 are completely degraded after 48 hours of incubation with hydrogen peroxide. Two other polysaturated ICLs (UO-6 and UO-7) also exhibited good stability against oxidation, although UO-7, with its hydroxyethyl substituents in the headgroup, degraded more rapidly than the dimethylamino ICL (Table 14).

[0542] The stability of ICLs with olefins separated by multiple methylenes was tested as part of mRNA-free liposome formulations using structurally related UO-1 and O-11769 ICLs. Other ionizable cationic lipids (KC2, KC2-01, KC3, and KC3-01) were excluded from this study because their chromatographic peaks overlap with those of DSPC, compromising data interpretation. Stability data for UO-1 and O-11769-based liposome formulations are shown in Figure 9A. UO-1 formulated in liposomes has a major UO-1 peak of 73 ± 0.05% after 72 hours of incubation in the presence of 1% hydrogen peroxide. In contrast, O-11769-based liposomes show only 3.9 ± 0.06% of the O-11769 peak after 72 hours of treatment.

[0543] The totality of this data suggests that in addition to the improved transfection efficiency of ICLs with multiple methylenes between olefins, as demonstrated in Examples 14 and 20, these lipids also exhibit significantly improved stability against oxidative degradation.

[0544] [Example 19] Effect of N / P ratio on transfection efficiency of mCherry mRNA-containing LNP The purpose of this study was to investigate the effect of various N / P ratios on transfection efficiency in dendritic cells. LNPs were prepared as described in Example 9, characterized for particle size and zeta potential as described in Example 10, and evaluated for transfection efficiency in murine dendritic cells as described in Example 11. All LNPs used KC2-01 as the ICL, but the cationic lipid to mRNA phosphate (N / P) ratio varied from 4 to 7, with a constant PS lipid content of 5 mol%, a constant DSPC phospholipid content of 5 mol%, and a constant cholesterol content of 38.5 mol%. The encapsulation efficiency of all formulations ranged from 84 to 90%, indicating high mRNA encapsulation efficiency in LNPs. Transfection efficiency in murine dendritic cells was evaluated as described in Example 11.

[0545] JPEG2023553343000279.jpg87170

[0546] Transfection activity was evaluated for both DSPS-targeted and non-targeted KC-01 LNP formulations at both 1 μg / mL (FIG. 10A) and 0.33 μg / mL (FIG. 10B). These data demonstrate high DSPS-mediated transfection efficiency of KC2-01-containing LNPs over a wide range of N / P ratios, with the highest transfection efficiency observed at N / P=7.

[0547] [Example 20] Effect of ionized lipid structure on transfection efficiency containing LNP The purpose of this study was to examine the effect of various...

Claims

1. A lipid nanoparticle (LNP) composition, nucleic acids and, Sterols and The LNP composition comprises one or more phospholipids containing a total amount of (L-serine)phosphatidylserine (PS) lipids in an amount of 1.25 to 10 mol% of the total lipid content, Complex lipids, An ionized lipid having a chemical structure consisting of a pair of linear polyunsaturated lipid tails covalently bonded to a head group, wherein the head group contains a dialkylamino group, The head group comprises a heterocyclyl or alkyl moiety covalently bonded to the dialkylamino group, and optionally further comprises a phosphate group. Each polyunsaturated lipid tail is unsaturated except for at least two olefins separated by at least two methylene groups along the length of the lipid tail, and optionally contains a single acyl group at the end of the lipid tail covalently bonded to the head group. a. The dialkylamino portion of the head group has the chemical structure of formula (IV-A) 【Chemistry 1】 [In the formula, In equation (IV-A), n is 2, 3, or 4. R in equation (IV-A) 10 and R 12 Each is independently selected from alkyl groups chosen from the group consisting of methyl, ethyl, and propyl, R 10 and R 12 The alkyl group in the compound is optionally substituted with one or more hydroxyls. The ionized lipid has a chemical structure in which the acyl group of each lipid tail is covalently bonded to a portion of the distal head group from the dialkylamino moiety of formula (IV-A). 【Chemistry 2】 It further includes, 【Transformation 3】 This indicates a connection to formula IV-A within the head base, and R 22 This represents a portion of each lipid tail covalently bonded to the acyl group, and formula A: 【Chemistry 4】 Formula A It has the following chemical structure, in formula A, 【Transformation 5】 Formulas A and R within each lipid tail are 22 This shows the connection with, a is 4, 1, 2, or 3. b is 4, 2, or 3. c is 4, 3, 5, 6, or 7. However, the sum of a, b, and c in equation A is 12, 10, 11, or 13. Optionally, R in formula (IV-A) 10 and R 12 are each independently methyl, ethyl, —(CH 2 )(CH 2 )OH, or —(CH 2 ) 2 (CH 2 )OH, and Optionally, b is 4, and R in equation (IV-A) 10 and R 12 Each of them is methyl; or b. The ionized lipid is of formula (I-A) 【Transformation 6】 Formula IA [In the formula, a is 4, 1, 2, 3, 5 or 6, b is 4, 3, or 2. c is 4, 3, 5, 6, or 7. The sum of a, b, and c is 12 or 10. q is 1, 2, 3, or 4. R 10 and R 12 Each of them is independently and optionally substituted with one or more hydroxyls (C 1 ~C 4 ) is alkyl, L is 【Transformation 7】 [where v is 0 or 1, and q2 is 2 or 1] It has the following chemical structure: Selectively, an ionized lipid where v is 0 and q is 1, 2, or 3. An LNP composition containing the following:

2. Each lipid tail is identical, and each lipid tail has a total of two olefins separated only by unsubstituted ethylene, n-propyl, or n-butyl. The composition according to claim 1, wherein each lipid tail optionally further comprises an acyl group that bonds to the oxygen of the head group to form an ester, and the composition has a total of 16 or 18 carbon atoms including the acyl group.

3. a. The dialkylamino portion of the head group has the chemical structure of formula (IV-A) 【Transformation 8】 [In the formula, In equation (IV-A), n is 2, 3, or 4. R in equation (IV-A) 10 and R 12 Each is independently selected from alkyl groups chosen from the group consisting of methyl, ethyl, and propyl, R 10 and R 12 The alkyl group in the compound is optionally substituted with one or more hydroxyls. b. A chemical structure in which the ionized lipid includes the acyl group of each lipid tail covalently bonded to a portion of the distal head group from the dialkylamino moiety of formula (IV-A). 【Chemistry 9】 It further includes, 【Chemistry 10】 This indicates a connection to formula IV-A within the head base, and R 22 This represents a portion of each lipid tail covalently bonded to the acyl group, and formula A: 【Chemistry 11】 Formula A It has the following chemical structure, in formula A, 【Chemistry 12】 Formulas A and R within each lipid tail are 22 This shows the connection with, a is 4, 1, 2, or 3. b is 4, 2, or 3. c is 4, 3, 5, 6, or 7. However, the sum of a, b, and c in equation A is 12, 10, 11, or 13. Optionally, R in equation (IV-A) 10 and R 12 However, each is independent of methyl, ethyl, and -(CH 2 ) (CH 2 )OH, or -(CH 2 ) 2 (CH 2 ) OH, Optionally, b is 4, and R in equation (IV-A) 10 and R 12 The composition according to claim 2, wherein each of them is methyl.

4. The aforementioned ionized lipid is given by formula (I-A) 【Chemistry 13】 [In the formula, a is 4, 1, 2, 3, 5 or 6, b is 4, 3, or 2. c is 4, 3, 5, 6, or 7. The sum of a, b, and c is 12 or 10. q is 1, 2, 3, or 4. R 10 and R 12 Each of them is independently and optionally substituted with one or more hydroxyls (C 1 ~C 4 ) is alkyl, L is 【Chemistry 14】 [where v is 0 or 1, and q2 is 2 or 1] It has the following chemical structure: The composition according to claim 1, wherein v is optionally 0 and q is 1, 2, or 3.

5. The ionized lipids are AKG-UO-1, AKG-UO-1A, AKG-UO-1B, AKG-UO-2, AKG-UO-4, AKG-UO-4A, AKG-UO-5, AKG-UO-6, AKG-UO-7, AKG-UO-8, AKG-UO-9, and AKG-UO-10: 【Chemical Engineering 15A】 【Chemical 15B】 A composition according to claim 4, selected from the group consisting of the following.

6. a. The nucleic acid, b. The ionized lipids, c. The sterols which are cholesterol, d. One or more phospholipids comprising the phosphatidylserine (PS) lipid, wherein (i) one or more phospholipids selected from the group consisting of DSPC, HSPC, DPPC, eggSM, and DOPC, and (ii) one or more phospholipids consisting of PS lipids selected from the group consisting of DPPS, DSPS, and DOPS. e. Complex lipids A composition according to any one of claims 1 to 5, comprising:

7. The one or more phospholipids mentioned above a. DSPC, and b. One or more PS lipids selected from the group consisting of (L-serine)DPPS and (L-serine)DSPS. It consists of, The composition contains a total amount of PS lipids of 2.5 to 10 mol% of the total lipids in the composition, The composition according to claim 6, wherein the composite lipid optionally contains PEG.

8. The ionized lipids are 【Chemistry 16】 A composition according to claim 1, selected from the group consisting of the following.

9. a. nucleic acid, b. An ionized cationic lipid according to any one of claims 1 to 5 or 8, in an amount of 40 to 65 mol% of the total lipid content of the LNP composition. c. Sterols in a total amount of 25 to 45 mol% of the total lipid content of the LNP composition. d. The LNP composition contains an anionic phospholipid targeting moiety in a total amount of 2.5 to 10 mol% of the total lipid content, and one or more phospholipids in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition. e. A nucleic acid lipid nanoparticle (LNP) composition according to any one of claims 1 to 8, further comprising, optionally, a total amount of complex lipids in an amount of 0.5 to 2.5 mol% of the total lipid content of the LNP composition.

10. The nucleic acid is mRNA, Selectively, the sterol is cholesterol. The composition according to claim 9, wherein, optionally, one or more of the phospholipids consist of DSPC and L-serine PS.

11. The LNP composition contains a total amount of PS of 5.0 to 7.5 mol% of the total lipids in the composition. Optionally, the composite lipid may contain PEG. Optionally, the composite lipid is PEG-DMG, The composition according to claim 10, wherein the LNP composition optionally contains a total amount of complex lipids of 0.5 to 1.5 mol% of the total lipid content of the LNP composition, or the LNP composition contains a total amount of complex lipids of less than 1 mol% of the total lipid content of the LNP composition.

12. a. The nucleic acid is mRNA, b. The total amount of the ionized cationic lipids is 45 to 55 mol% of the total lipid content of the LNP composition. c. Sterols are cholesterol in a total amount of 35 to 45 mol% of the total lipid content of the LNP composition. d. The total amount of phospholipids is 7 to 15 mol% of the total lipid content of the LNP composition. e. The one or more phospholipids include DSPC, and the PS lipid is one or more lipids selected from the group consisting of DPPS and the L-serine form of DSPS. f. The composition according to claim 9, wherein the total amount of the PS lipids is 3 to 9 mol% of the total lipid content of the LNP composition.

13. The composition according to claim 12, wherein the PS lipid is contained in a total amount selected from 1.25 mol%, 2.5 mol%, 5 mol%, 7.5 mol%, and 10 mol% of the total lipid content of the LNP composition.

14. (A) The LNP composition is a. nucleic acid, b. Ionized cationic lipids in a total amount of 50 mol% of the total lipid content of the LNP composition, c. Cholesterol in a total amount of 38.5 mol% of the total lipid content of the LNP composition. d. One or more phospholipids comprising 3 to 9 mol% of the total lipid content of the LNP composition, and comprising 3 to 9 mol% of the total lipid content of the LNP composition, wherein the phospholipid comprises one or more phospholipids selected from the group consisting of DSPC, HSPC, eggSM, DPPC, and DOPC, and the PS lipid comprises one or more L-serolelipids selected from the group consisting of DPPS and DSPS, and e. PEG-containing lipids in a total amount of 0.5 to 1.5 mol% of the total lipid content of the LNP composition. A composition containing, or (B) The LNP composition comprises one or more phospholipids including at least two (L-serine)PS lipids with differing acyl chain lengths, wherein the PS lipids are optionally DPPC and DSPS, and optionally the DPPC and DSPS are present in the LNP in a total amount of 5 mol% of the total lipid content of the LNP composition. The nucleic acid lipid nanoparticle (LNP) composition according to claim 9.

15. The composition according to any one of claims 9 to 14, wherein the nucleic acid is mRNA encoding the SARS-CoV-2 spike protein.

16. The composition is a. mRNA nucleic acids with an N / P ratio of 3 to 8. b. Ionized cationic lipids in a total amount of 40 to 65 mol% of the total lipid content of the LNP composition. c. A total amount of cholesterol of 25 to 40 mol% of the total lipid content of the LNP composition. d. (L-serine)PS lipids in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition. e. DSPC phospholipids in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition, and f. PEG-DMG in an amount of 0 to 2.5 mol% of the total lipid content of the LNP composition. An LNP vaccine composition containing The composition according to claim 9, wherein the nucleic acid is optionally the mRNA of SEQ ID NO:

2.

17. The one or more phospholipids mentioned above a. HSPC, and b. One or more PS lipids selected from the group consisting of (L-serine)DPPS and (L-serine)DSPS. It consists of, Optionally, the composition contains a total amount of PS lipids of 2.5 to 10 mol% of the total lipids in the composition. The composition according to claim 1, wherein the composite lipid optionally contains PEG.