Single domain antibodies binding to tetanus neurotoxin

Abstract

To provide single domain antibodies (SDAs) having the ability to bind to tetanus neurotoxin, to provide polypeptide constructs comprising SDAs having the ability to bind to a serum protein, preferably to serum albumin or immunoglobulin, to provide nucleic acids encoding such SDAs or polypeptide constructs, to provide pharmaceutical compositions comprising such SDAs or polypeptide constructs, to provide the medical use thereof, and to provide their use in the treatment of tetanus.SOLUTION: Provided is a SDA, the SDA having the ability to bind to serum proteins, and having at least 90% overall amino acid sequence identity with a sequence selected from the group consisting of particular sequences, or the SDA having the ability to bind to tetanus neurotoxin and having at least 90% overall amino acid sequence identity with a sequence selected from the group consisting of specific sequences, however, the amino acid sequence identity of CDR1, CDR2, and CDR3 being 100%.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention particularly relates to single domain antibodies (SDAs) capable of binding to tetanus neurotoxin, polypeptide constructs comprising such SDAs, compositions comprising such SDAs and / or polypeptide constructs, and DNA fragments encoding such SDAs and / or polypeptide constructs. Furthermore, the present invention relates to host cells comprising such DNA fragments, methods for producing such SDAs and / or polypeptide constructs, and the use of such SDAs and / or polypeptide constructs and / or compositions in treating or preventing disease following Clostridium tetani infection. [Background technology]

[0002] Tetanus is a disease caused by the bacterium Clostridium tetani and was first described in Egypt about 3000 years ago.

[0003] Tetanus toxemia is caused by a specific neurotoxin; tetanus neurotoxin (TeNT) produced by the bacterium Clostridium tetani. Almost all mammals, including humans, are susceptible. Humans, horses, and lambs are among the most susceptible of all species. Dogs and cats are relatively resistant. Tetanus is found worldwide, but the incidence of Clostridium tetani in soil and the incidence of tetanus in humans, horses, and lambs are higher in the warmer parts of various continents. In most cases, the bacteria Clostridium tetani are introduced into the tissues through a wound. Tetanus commonly results from a deep penetrating wound that promotes the growth of anaerobic bacteria. However, in lambs, and sometimes in other species, tetanus can also result from tail docking or castration.

[0004] Tetanus neurotoxin is a zinc-binding protease that cleaves the vesicle-associated membrane protein synaptobrevin. Cleavage of this protein results in the inhibition of neurotransmitter release. The toxin is absorbed by motor neurons in the infected area and travels retrogradely up the nerve cord toward the spinal cord, where it causes ascending tetanus.

[0005] TeNT is synthesized as a single polypeptide chain of 150 kDa. This polypeptide is cleaved into a 100 kDa heavy chain (H) and a 50 kDa light chain (L) that are held together by disulfide bonds to form the active toxin. Digestion of the holotoxin with papain isolates the TeNT light chain and the amino-terminal half of the TeNT heavy chain (H). N ), and fragment C (H C or TTC). In vitro experiments showed that H C is involved in the binding to neurons through gangliosides, whereas H N The fragment was suggested to play a role in internalization and membrane translocation.

[0006] The incubation period (time from infection to the first symptoms) can be as short as 24 hours or as long as many months after inoculation with tetanus bacteria. This interval reflects the distance the toxin must travel in the nervous system and may be related to the amount of toxin released. The onset period is the time between the first symptoms and the onset of spastic paralysis. The incubation period usually averages 10-14 days. Localized stiffness is often noted first, including in the muscles of masseter and neck, hind limbs, and in the area of ​​the infected wound; generalized stiffness becomes evident about a day later, and tonic spasms and hyperesthesia are evident. Because of their relatively high resistance to tetanus toxin, dogs and cats often have long incubation periods and frequently develop localized tetanus; however, generalized tetanus does develop in these species. A comprehensive description of tetanus neurotoxins (and related botulinum neurotoxins) can be found in BOTULINUM AND TETANUS NEUROTOXINS, ISBN 978-1-4757-9544-8, (C)1993 Springer Science & Business Media New York. Originally published in 1993 by Plenum Press, New York. A review relating to tetanus, its causes and effects, and methods of treatment can be found, for example, in Farrar, JJ et al., J. Neurol Neurosurg Psychiatry 69:292-301 (2000).

[0007] Passive immunization with polyclonal human or, for example, equine tetanus antitoxin can shorten the course of tetanus and reduce its severity. Equine antisera (Fab) are prepared from pooled sera collected from immunized horses and have a half-life of 12-20 hours in humans (Flanagan RJ, Jones AL. Drug Saf. 2004;27(14):1115-33). The equine (or bovine) form is used throughout the developing world and occasionally causes anaphylactic reactions, but is much cheaper and easier to produce than human donor serum.

[0008] Treatment of tetanus disease consists of administration of antibiotics or metronidazole, treatment of the infected site (e.g., flushing, draining, and dissection), administration of antitoxin, and supportive care (e.g., skeletal muscle relaxants, sedatives, hydration, etc.). Passive immunization with preparations containing immunoglobulins (e.g., purified and fragmented) obtained from actively immunized sheep or horses provides effective protection to non-immunized animals and humans. Tetanus antitoxin (e.g., in the form of SDA or immune serum) can be used in at least three different scenarios: as part of standard pre-operative procedures, in injured but not yet diseased animals, and thirdly, in therapeutic scenarios when the animal is diseased with tetanus. Depending on the prophylactic or therapeutic treatment, there are differences in the dose of antitoxin used, but therapeutically, it is 2-20 times higher dose depending on the species. In the case of tetanus, daily treatments may be required.

[0009] To date, the only proposed administration of antisera, for example in horses and human volunteers, is for the treatment of acute tetanus disease. In principle, a possible alternative could be offered by purified antibodies and their engineered variants, such as antigen-binding fragments (Fab) and single-chain variable fragments (scFv). Tetanus antitoxin SDA produced in vitro, avoiding animal and human donors, has not yet been commercially available for human or veterinary medicine. An example of a single-chain variable fragment of anti-tetanus toxin is described by Nathan Scott et al. in Molecular Immunology 47:1931-1941 (2010).

[0010] However, although useful, conventional antibodies and their engineered variants, Fab and scFv, have some limitations. Examples of such limitations include low solubility, low stability, and high cost and animal use (Doshi, R. et al., Scientific Reports 4:6760 DOI;10.1030 / srep06760). Such conventional antibodies and their fragments have a relatively high molecular weight: the average MW of conventional antibodies is about 160 kDa, Fab has a MW of 65 kDa, and even the relatively small scFv has a MW of 28 kDa.

[0011] On top of this there is the problem of poor manufacturing feasibility: producing larger proteins is sometimes difficult to solve and in any case expensive.

[0012] The monomeric hypervariable antigen-binding regions of homodimeric heavy-chain-only antibodies (HCAbs) naturally found in some species of camelids and sharks lack many of the shortcomings of conventional antibodies and their engineered variants, Fab and scFv. For clarity, this variable domain, derived from a heavy-chain molecule that is naturally devoid of light chains, is also called VHH when derived from camelids and VHH when derived from sharks to distinguish it from the conventional VH of four-chain immunoglobulins. NAR For convenience, the anti-TeNT VHHs are further referred to herein as single domain antibodies (SDA).

[0013] An early patent family related to the structure, composition, preparation, and use of heavy chain antibodies lacking light chains, and isolated antigen-binding fragments thereof, is the patent family including EP 0656946. Such single domain molecules have also been described, inter alia, by Hamers-Casterman, C. et al., Nature 363:446-448 (1993). Single domain molecules can be derived from Camelidae species, such as camel, llama, dromedary, alpaca, and guanaco. Compared to normal antibodies and their fragments, the molecular size of SDA is smallest (about 15 kDa). SDA is also very robust and highly resistant to denaturation / thermal degradation, has high aqueous solubility, and is generally highly and functionally expressed using standard microbial expression systems. In addition, SDA also has excellent biodistribution and tissue penetration, making it attractive for clinical use.

[0014] An example of SDA capable of binding to tetanus toxoid is described by Arbabi Ghahroudi (M. Arbabi Ghahroudi, A. Desmyter, L. Wyns, R. Hamers, S. Muyldermans. Selection and identification of single domain antibody fragments from camel heavy-chain antibodies. FEBS Letters 414 (1997) 521-526). WO 96 / 34103 discloses SDA capable of binding to tetanus toxoid. Mouse studies show that administration of SDA at low toxin doses allowed approximately 40-50% of treated mice to survive after 2-4 days. These results are also reported in Arbabi Ghahroudi et al., FEBS LETTERS (1997), 414, 521-526. Rossotti et al. (MABS, DOI:10.1080 / 19420862.2015.1068491) describe SDA binding to tetanus toxin.

[0015] A particular problem recognized with clostridial neurotoxins is their extremely high toxicity. TeNT is already toxic at concentrations as low as 0.1-2.5 ng / kg in humans and 0.1-5 ng / kg in other animals. In horses, the lethal dose is, for example, 0.1-0.3 ng / kg. This means that once infection with tetanus has occurred, only high-affinity antibodies capable of binding TeNT and subsequently blocking its uptake in neurons can reduce the levels of free TeNT to a level that prevents or even avoids the fatal symptoms of tetanus.

[0016] Direct measurement of biomolecular interactions plays an important role in the discovery and development of biotherapeutic drugs. Accurate information on the rate of formation of biomolecular complexes and the stability of the complexes is a key component of drug-target interactions. The affinity of the interaction directly affects the dose at which a biologic is effective. The affinity of an antibody to an antigen can be experimentally determined using any suitable method, see for example the methods described in Berzofsky et al., "Antibody-Antigen Interactions," In Fundamental Immunology, Paul, WE ed., Raven Press: New York, NY (1984); Kuby, Janis Immunology, WH Freeman and Company: New York, NY (1992); and Lad, L. et al., Journal of Biomolecular Screening 2015, Vol. 20(4) 498-507, Yang, D. et al., doi: 10.3791 / 55659). For a particular antibody-target protein interaction, its measured affinity may vary when measured under different conditions (e.g., salt concentration, pH). Thus, the affinity, or in the case of multimeric SDA, avidity (e.g., K D ,k a ,k dis Preferably, measurements of ) are made using standardized antibody and antigen solutions, and standardized buffers.

[0017] However, to date, the K D is above 1-10 nM or even above 35 nM, indicating a low affinity, as can be seen inter alia in Rossotti et al. (2015, mAbs, 7:5, 820-828, DOI:10.1080 / 19420862.2015.1068491) and Arbabi Ghahroudi, see above. Summary of the Invention

[0018] In one aspect, the present invention relates to a single domain antibody (SDA) capable of binding to tetanus neurotoxin (TeNT), the SDA having at least 70% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 17, 13, 14, 15, 16, 18, 19, 20, 21, 22, 23, 24, 25, and 26, with the proviso that the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%.

[0019] In a preferred embodiment, the SDA has at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100% overall amino acid sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 17, 13, 14, 15, 16, 18, 19, 20, 21, 22, 23, 24, 25, and 26, provided that CDR1, CDR2, and CDR3 have at least 75% amino acid sequence identity.

[0020] Alternatively, or in combination with the previous embodiments, in a further preferred embodiment, the amino acid sequence identity of CDR1, CDR2 and CDR3 is at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100%.

[0021] In a further aspect, the present invention relates to a polypeptide construct comprising at least one SDA capable of binding to TeNT according to the present invention and at least one SDA capable of binding to a serum protein. Preferably, the serum protein is serum albumin or an immunoglobulin. More preferably, the immunoglobulin is immunoglobulin G (IgG). In a preferred embodiment, the SDA capable of binding to serum albumin has at least 70% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 40, 37, 38, 39, 41, and 42, with the proviso that the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%. In a preferred embodiment, the SDA capable of binding to an immunoglobulin has at least 70% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 30, 27, 28, 29, 31, 32, 33, and 34, with the proviso that the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%.

[0022] In a preferred embodiment, the polypeptide construct comprises at least two SDAs capable of binding to TeNT, each of the at least two SDAs capable of binding to TeNT has an overall amino acid sequence identity of at least 70% with a sequence selected from option A; SEQ ID NO: 24, or option B; SEQ ID NO: 25, or option C; SEQ ID NO: 20, or option D; SEQ ID NO: 17 or 19, or option E; SEQ ID NO: 22, 15, 23, or 14, with the proviso that at least two SDAs do not comprise a sequence derived from the same option, and the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%.

[0023] In a further aspect, the present invention relates to a pharmaceutical composition comprising at least one SDA capable of binding to TeNT according to the present invention and / or at least one polypeptide construct according to the present invention and a pharma- ceutically acceptable carrier.Preferably, the composition comprises at least two SDAs capable of binding to TeNT according to the present invention and / or at least one polypeptide construct according to the present invention.

[0024] In a further aspect, the present invention relates to an SDA capable of binding to TeNT according to the invention, or a polypeptide construct according to the invention for use as a medicament.

[0025] In yet another aspect, the present invention relates to an SDA capable of binding to TeNT according to the present invention, a polypeptide construct according to the present invention, or a pharmaceutical composition according to the present invention, for use in the prevention or treatment of a tetanus disease / symptom.

[0026] In a further aspect, the present invention relates to a DNA fragment encoding an SDA capable of binding to TeNT according to the invention, or a polypeptide construct according to the invention.

[0027] In another aspect, the present invention relates to a nucleic acid comprising a DNA fragment according to the invention, said DNA fragment being operably linked to a promoter and, optionally, other regulatory elements.

[0028] In a further aspect, the present invention relates to a host cell comprising a nucleic acid according to the invention.

[0029] In a still further aspect, the present invention relates to a method for producing an SDA according to the invention, or a polypeptide construct according to the invention, comprising the steps of a) culturing a host cell according to the invention under conditions allowing expression of the SDA or the polypeptide construct, and optionally b) recovering the SDA or the polypeptide construct from at least one of the host cell and the culture medium.

[0030] In one embodiment, the present invention relates to a diagnostic kit comprising at least one SDA capable of binding to TeNT according to the present invention. [Brief description of the drawings]

[0031] [Figure 1] Sequences of TeNT-binding SDAs (SVT clones) isolated and subsequently produced in yeast. The SDAs are aligned and numbered according to the IMGT system. The horizontal lines indicate gaps introduced in the sequence alignment. The definition of the different complementarity determining regions (CDRs) and framework regions (FRs) is also based on the IMGT system. The three CDR regions are shown with a grey background. Additional positions 50a-50d were inserted in FR2 to accommodate the rare insertion of four amino acids in this region in SVT06, SVT08, and SVT31. Additional residues were also introduced in CDR2 to accommodate the long CDR2 of SVT05. An additional gap was introduced at IMGT position 60 in SVT16 and SVT25 to align residues 62 and 63 of these SDAs with the identical residues in SVT20 and SVT34. The classification of SDAs into subfamilies and CDR3 groups has been shown for each SDA

[52] . [Diagram 2] Sequences of the IgG-binding SDA isolated and subsequently produced in yeast (SVG clone) and two reference SDAs (sdAb-31 and sdAb-32). The SDAs are aligned and numbered according to the IMGT system. Horizontal lines indicate gaps introduced in the sequence alignment. The definition of the different complementarity determining regions (CDRs) and framework regions (FRs) is also based on the IMGT system. The three CDR regions are shown in grey background. The classification of the SDAs into subfamilies and into CDR3 groups is shown for each SDA

[52] . [Diagram 3]Sequences of Alb-binding SDAs (SVA clones) isolated and subsequently produced in yeast. The SDAs are aligned and numbered according to the IMGT system. Horizontal lines indicate gaps introduced in the sequence alignment. The definition of the different complementarity determining regions (CDRs) and framework regions (FRs) is also based on the IMGT system. The three CDR regions are shown in grey background. The classification of the SDAs into subfamilies and into CDR3 groups is shown for each SDA

[52] . [Figure 4] Western blot analysis of SVT SDA binding to TeNT. Blot strips of TeNT separated by reducing SDS-PAGE were incubated with biotinylated VHHs shown at the top. The positions of relevant molecular weight markers are indicated. The TeNT heavy chain is expected to migrate at approximately 100 kDa and the light chain at approximately 50 kDa. [Figure 5A] Figure 1 shows SDS PAGE analysis of monomeric and multimeric SDA. The loaded SDA is indicated at the top of each lane. In the case of multimeric SDA, the pRL plasmid encoding the SDA is also indicated. The positions of monomeric and multimeric SDA are indicated by arrows on the right side of each panel. The molecular weights of marker proteins are indicated on the right. Panel A, multimeric SDA containing SVG06 and three reference monomeric SDAs. [Figure 5B] Panel B: Multimeric SDAs containing SVA12 or SVG13 and their corresponding monomeric SDAs. The order of TeNT-bound SDAs in this gel is always SVT02, SVT16, SVT06, and SVT15-3FW4M in both monomeric and multimeric SDAs. [Figure 6A]Figure 1 shows the serum half-life of multimeric SDA injected (im) into piglets. SDA was injected at 0 hours and serum was collected on days 1, 2, 4, 8, 11, 14, 21, and 28. The amount of SDA present in serum samples was measured by ELISA. The mean and standard deviation of six piglets (Panels A-D) are shown. Panel A: SVT06-GS2-SVA12M2-H6 (0.2 mg / kg). [Figure 6B] Panel B: SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 (0.3 mg / kg). [Figure 6C] Panel C: SVT16-L123Q-GS2-SVA12M2-H6 (0.5 mg / kg). [Figure 6D] Panel D: SVT16-L123Q-GS2-SVG13M4-H6 (0.5 mg / kg). Curve fitting for serum half-life measurements was performed using data from 24-96 hours (48 hour prediction), or 96-504 hours (96 hour prediction). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0032] Description of the Invention Surprisingly, the K of known anti-TeNT SDAs D Significantly lower than K D It has now been found that it is possible to obtain anti-TeNT SDAs that have a tetanus toxin neutralizing activity in vivo. Such novel anti-TeNT SDAs have the advantage of being capable of binding to TeNT with extremely high affinity, which shifts the balance between free and bound TeNT molecules in favor of the bound TeNT molecules, thus sufficiently suppressing the fatal symptoms of tetanus even after infection with Clostridium tetani.

[0033] K<1nM DSeveral groups of anti-TeNT SDAs have now been identified that have the potential to significantly alter the cellular and biological properties of the antibody. FIG. 1 shows the sequences of seven groups or examples of members of the SDA groups (one member each from groups A, B, C, D, and groups E, F, and G). The three shaded regions indicate where the hypervariable regions or complementarity determining regions (CDRs) are located. As can be seen from FIG. 1, some natural variations do exist between individual SDAs. These variations can be due to amino acid difference(s) in the overall sequence or due to deletion, substitution, insertion, inversion, or addition of amino acid(s) in the sequence. Amino acid substitutions that do not substantially alter biological and immunological activity have been described, for example, by Neurath et al. in "The Proteins" Academic Press New York (1979). Amino acid substitutions between related amino acids or substitutions that have arisen frequently in evolution are, among others, Ser / Ala, Ser / Gly, Asp / Gly, Asp / Asn, Ile / Val (see Dayhof, MD, Atlas of protein sequence and structure, Nat. Biomed. Res. Found., Washington DC, 1978, vol. 5, suppl. 3). Other amino acid substitutions include Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Thr / Phe, Ala / Pro, Lys / Arg, Leu / Ile, Leu / Val, and Ala / Glu. Based on this information, Lipman and Pearson developed a method for rapid and sensitive protein comparison (Science 227, 1435-1441, 1985) and for determining the functional similarity between homologous proteins. Variations of representative embodiments of the invention having amino acid substitutions, as well as deletions and / or insertions, are within the scope of the invention so long as the resulting protein is not substantially affected in its antigenic or immunogenic properties.

[0034] This indicates that the SDA according to the present invention has an overall amino acid sequence identity level of about 70% while the protein has a K DThis explains why it may still represent the same protein in the sense that it still has a K value of <1 nM. D Such variations in the amino acid sequence of a particular SDA according to the invention, which still provides an SDA having a desired amino acid sequence, are considered to "not substantially affect the antigenic or immunogenic properties of the protein."

[0035] In a first aspect, the present invention relates to an antigen binding protein, preferably a single domain antibody (SDA), capable of binding to Tetanus Neurotoxin (TeNT), wherein the antigen binding domain has an overall amino acid sequence identity of at least 70% with a sequence selected from the group consisting of SEQ ID NOs: 17, 13, 14, 15, 16, 18, 19, 20, 21, 22, 23, 24, 25, and 26, with the proviso that the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75%.

[0036] In other words, in this aspect, the invention relates to an antigen-binding protein that specifically binds to tetanus neurotoxin (TeNT). Preferably, the antigen-binding protein comprises an amino acid sequence comprising four framework regions, FR1 to FR4, and three complementarity determining regions, CDR1 to CDR3, operably linked in the order FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Preferably, CDR1 has an amino acid sequence selected from the group consisting of CDR1 sequences of SEQ ID NOs: 13 to 26 of VHH, or an amino acid sequence which differs from CDR1 in one or two amino acid residues, as shown in Figure 1; b) CDR2 has an amino acid sequence selected from the group consisting of CDR2 sequences of SEQ ID NOs: 13 to 26 of VHH, or an amino acid sequence which differs from CDR2 in one, two, three, or four amino acid residues, as shown in Figure 1; and c) CDR3 has an amino acid sequence selected from the group consisting of CDR3 sequences of SEQ ID NOs: 13 to 26 of VHH, or an amino acid sequence which differs from CDR3 in one, two, three, four, or five amino acid residues, as shown in Figure 1; however, each of the framework regions has at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% amino acid identity to the framework amino acid sequence of any one of SEQ ID NOs: 13 to 26, as shown in Figure 1. Preferably, CDR1, CDR2 and CDR3 are derived from the same SEQ ID NO. More preferably, the framework regions are derived from the same SEQ ID NO as the complementarity determining regions.

[0037] A particular percentage of overall amino acid sequence identity level, such as about 70%, as used herein, means that the level of amino acid sequence identity of the entire antigen binding protein is, in other words, about 70% when the two sequences are aligned over their full length FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Thus, in this context, "overall" is used to include CDR1-3. "Sequence identity" or "identity" is defined herein as the relatedness between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence of one polypeptide and its conserved amino acid substitutions to the sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by known methods. The term "sequence identity" or "sequence similarity" means that two (poly)peptide or two nucleotide sequences share at least a certain percentage of sequence identity as defined elsewhere herein when optimally aligned, preferably over their entire length (at least of the shortest sequence in the comparison), maximizing the number of matches and minimizing the number of gaps, for example, by the programs ClustalW (1.83), GAP, or BESTFIT using default parameters. GAP uses the Needleman and Wunsch global alignment algorithm to align two sequences over their entire length, maximizing the number of matches and minimizing the number of gaps. Generally, GAP default parameters are used, except for gap creation penalty = 50, ClustalW (1.83) using the blosum matrix and default settings (gap opening penalty: 10; gap extension penalty: 0.05).Scores for sequence alignment and percent sequence identity can be determined using computer programs such as the GCG Wisconsin Package, version 10.3, available from Accelrys Inc, 9685 Scranton Road, San Diego, CA 92121-3752 USA, or open source software such as the programs "needle" (which uses the global Needleman Wunsch algorithm) or "water" (which uses the local Smith Waterman algorithm) at (nucleotides) / 8(protein) and gap extension penalty=3(nucleotides) / 2(protein). For nucleotides, the default scoring matrix used is nwsgapdna, and for proteins, the default scoring matrix is ​​Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). A preferred multiple alignment program for aligning the protein sequences of the present invention, EmbossWIN version 2.10.0, uses the same parameters as GAP above, or uses default settings (the default gap opening penalty is 10.0 and the default gap extension penalty is 0.5, for both "needle" and "water", and for both protein and DNA alignments; the default scoring matrices are Blossum62 for proteins and DNAFull for DNA). When sequences have substantially different overall lengths, local alignments, such as those using the Smith Waterman algorithm, are preferred. Alternatively, percent similarity or identity can be determined by searching against public databases using algorithms such as FASTA, BLAST, etc.

[0038] Alignment of rearranged antibody variable domains may require extensive gap introduction at the ends of the CDR regions. In particular, the CDR3 region sometimes requires such long gap extensions. Without wishing to be bound by any theory, this is likely due to the inherent molecular process of VDJ recombination that forms the CDR3. As a result, standard software programs for DNA or protein alignment may not be able to properly align rearranged SDA domains. The program IMGT / V-QUEST (Brochet, X. et al., Nucl. Acids Res.36, W503-508 (2008)) was specifically developed for sequence analysis, including alignment of SDA-containing antibody variable domains, and is therefore a preferred program for determining alignment. It is accessible from the internet at www.imgt.org / IMGT_vquest / vquest (IMGT / V-QUEST program version: 3.4.9, dated January 9, 2018 - AMGT / V-QUEST reference directory release: 201807-3, dated February 14, 2018). This results in the alignment of the SDA and the identification of three CDR and four FR regions based on the IMGT numbering system. The program also has an option for the identification of rare insertions and deletions. The sequence identity of the CDRs and FRs can then be determined.

[0039] Optionally, when determining the degree of amino acid similarity, those skilled in the art can also take into account so-called "conservative" amino acid substitutions, as will be apparent to those skilled in the art. Conservative amino acid substitutions refer to the interchangeability of residues with similar side chains. For example, the group of amino acids with aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; the group of amino acids with aliphatic hydroxyl side chains is serine and threonine; the group of amino acids with amide-containing side chains is asparagine and glutamine; the group of amino acids with aromatic side chains is phenylalanine, tyrosine, and tryptophan; the group of amino acids with basic side chains is lysine, arginine, and histidine; and the group of amino acids with sulfur-containing side chains is cysteine ​​and methionine. Preferred conservative amino acid substitution groups are valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitutional variants of the amino acid sequences disclosed herein are those in which at least one residue in the disclosed sequence has been removed and a different residue has been inserted in its place. Preferably, the amino acid changes are conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser or Ala; Gln to Asn; Glu to Asp; Gly to Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg; Gln or Glu; Met to Leu or Ile; Phe to Met, Leu, or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Val to Ile or Leu.

[0040] A preferred SDA according to the invention comprises the amino acid sequence VEDG at positions 50a-50d. It is located in the middle of the FR2 region adjacent to residue Arg50 (Kabat position 45), which is often described in the SDA literature as the most representative amino acid substitution in SDA. Conventional SDAs usually contain Leu at IMGT position 50, which causes hydrophobic contact with the VL domain. SDAs most frequently have Arg at IMGT position 50. This substitution makes the conventional VL interface more hydrophilic. The insertion of VEDG makes the FR2 region more hydrophilic, lowering its isoelectric point, increasing its solubility, and reducing the chance of aggregation.

[0041] In a preferred embodiment, the antigen-binding protein according to the invention comprises one or more single binding domains, whereby the single binding domain does not comprise a light chain and whereby the single binding domain comprises full antigen-binding capacity. Preferably, the antigen-binding protein of the invention is selected from the group consisting of antibodies, fragments thereof, affibodies (Nord et al. (1997) Nature Biotechnology 15:772-777), single domain antibodies and fragments thereof, comprising heavy chains and lacking light chains. Examples of antigen-binding proteins according to the invention are camelid or shark heavy chain-only antibodies, naturally lacking light chains, and SDA derived affibodies. Preferably, the antigen-binding protein is an antibody, or antibody fragment thereof, comprising only heavy chains and naturally lacking light chains, such as a VHH (derived from camelids), or a VHH (derived from camelids). NAR(derived from sharks), etc. Alternatively (and also preferred), the antigen-binding proteins of the invention may be derived from antibodies, or fragments thereof, that are naturally devoid of light chains, e.g., by modification, e.g., mutation. Antibodies that are naturally devoid of light chains may be obtained, for example, by immunization of camelids (e.g., llamas, camels, dromedaries, Bactrian camels, alpacas, vicunas, and guanacos), or sharks (see further below). These antibodies comprise only heavy chains and are devoid of light chains. Advantages of such single domain heavy chain antibodies include that they are exceptionally stable, small, and easily produced in a host microorganism, e.g., Saccharomyces cerevisiae.

[0042] Thus, the antigen binding protein of the present invention preferably comprises, within a single polypeptide chain, an immunoglobulin-derived variable domain that comprises a complete antigen binding site for an epitope on a target molecule. Such antigen binding proteins include: 1) Antibodies obtainable from camelids and sharks that are composed only of heavy chains and naturally lack light chains; 2) VHH domain or V NAR 1) the variable domain of an antibody as defined in claim 1), which is usually referred to as a fragment thereof and is collectively referred to herein as a single domain antibody (SDA); 3) An antibody as defined in 1) in which framework sequences of a camelid (or shark) VHH domain have been grafted with CDRs obtained from another source, or an engineered form of the domain in 2), such as a "camelidised" or "camelised" antibody; 4) engineered forms of immunoglobulin-like variable domains in which framework sequences from various immunoglobulin-like molecules are combined with CDRs specific for a given target molecule, as described, for example, in WO 04 / 108749. In particular, but not limited to,

[0043] In a preferred antigen binding protein of the invention, a single polypeptide chain of a variable domain with complete antigen binding capacity preferably has an amino acid sequence and structure that can be considered to be composed of four framework regions or "FRs", which are referred to in the art and herein as "framework region 1" or "FR1", "framework region 2" or "FR2", "framework region 3" or "FR3", and "framework region 4" or "FR4", respectively, interrupted by three complementarity determining regions or "CDRs", which are referred to in the art as "complementarity determining region 1" or "CDR1", "complementarity determining region 2" or "CDR2", and "complementarity determining region 3" or "CDR3", respectively. These framework and complementarity determining regions are preferably operably linked in the order FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4 (from amino terminus to carboxy terminus).

[0044] The total number of amino acid residues in a variable domain with full antigen-binding capacity may be in the region of 110 to 135, but is preferably in the region of 115 to 129. However, a variable domain with full antigen-binding capacity according to the invention is not particularly restricted in terms of its length and / or size, provided that the domain fulfils the further functional requirements outlined herein and / or is suitable for the purposes described herein. As applied to VHH domains derived from camelids by Riechmann and Muyldermans (1999, J. Immunol. Methods 231(1-2):25-38, see e.g. FIG. 2 in the reference above) and by Harmsen et al. (2000, Molecular Immunology 37:579-590, see e.g. FIG. 1 in the reference above), the amino acid residues of variable domains having complete antigen-binding capacity are numbered according to the general numbering scheme for VH domains devised by Kabat et al. (Sequences of Proteins of Immunological Interest (5th Edition), NIH Publication No. 91-3242, USDepartment of Health and Human Services, Public Health Service, National Institutes of Health (1991)).

[0045] In this respect, it should be noted that, as is well known in the art for VH and VHH domains, the total number of amino acid residues contained in each of the CDRs may vary and may not correspond to the total number of amino acid residues indicated by Kabat numbering. However, based on the conserved amino acids in the framework regions, a person skilled in the art can align each framework and complementarity determining region based on the Kabat definition for the variable domain having complete antigen binding. Examples are given in the definition of the complementarity determining region in the amino acid sequence of VHH binding to TeNT, immunoglobulin, and serum albumin, respectively, as shown in Figures 1 to 3. Alternative methods for numbering the amino acid residues of a VH domain, which are applicable in an analogous manner to VHH domains from camelids and to variable domains with full antigen-binding capacity, are those described by Chothia et al. (Nature 342, 877-883 (1989)), the so-called "AbM definition", and the so-called "contact definition", or IMGT numbering system (Lefranc et al., 1999, Nucl. Acids Res. 27:209-212).

[0046] The three hypervariable or complementarity determining regions (CDR1, 2, and 3) are known to be the regions that play the major role in actually determining the specificity and binding properties of SDA.

[0047] It should be noted that the variation of amino acid sequences contained in the CDR1 and CDR2 regions within the various groups shown in Figure 1 is relatively low, i.e., lower than the variation within the non-CDR-related parts of the various SDAs. The CDR1 region contains an average of 8 or 9 amino acids, and the variation within the group concerns only 1 or 2 amino acids, i.e., about 25%. The CDR2 region shows almost the same level of variation. The level of identity of this region can be estimated not to be lower than 75%. In most cases, the level of identity is even higher, i.e., 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or even 100%. It should also be noted that the variation of amino acid sequences within the CDR3 region, which is generally considered to be the most important region involved in binding, is lower than the variation within the non-CDR-related parts of the various SDAs. Merely by way of example: the level of identity in the CDR3 region between the four members of SDAs group A identified so far and shown in FIG. 1 is about 95%. The level of identity in this region between the three members of group B is about 92% and in group C it is 94%. The two SDAs of group D have a CDR3 identity level of about 75%. For the CDR1 and CDR2 regions, it can be assumed that the level of identity in this region is not below 75%. In most cases, the level of identity is even higher, i.e. at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100%.

[0048] However, the proviso that the amino acid sequence identity of the CDR1, 2 and 3 regions is at least 75% suggests that an antigen binding protein included within the scope of the present invention has CDR1, 2 and 3 regions that have at least 75% amino acid sequence identity with any of the CDR1, 2 and 3 regions within an amino acid sequence selected from the group of SEQ ID NOs: 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 and 26.

[0049] Preferably, an antigen binding protein having the ability to bind TeNT has greater than 70%, e.g., at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, or even 100% overall sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26, in such order of preference.

[0050] Alternatively, or in combination with the previous embodiments, in a preferred embodiment the sequence identities of the CDR1, CDR2 and CDR3 regions are at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, or even 100%, in the following order of preference. These sequence identities can be determined independently of each other.

[0051] Accordingly, a preferred form of this embodiment relates to an antigen binding protein according to the invention, wherein the antigen binding protein has at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, or preferably 100% overall amino acid sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 and 26, provided that the amino acid sequence identity of CDR1, CDR2 and CDR3 is at least 75%. Thus, in a more preferred form of this embodiment, the antigen binding protein comprises a sequence selected from the group consisting of SEQ ID NOs: 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26, and at least one of SEQ ID NOs: 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97 , 98, 99% or even 100% overall amino acid sequence identity, provided that the amino acid sequence identity of the CDR1, CDR2 and CDR3 regions is at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% or even 100%.

[0052] An antigen-binding protein of the present invention that can bind to, has affinity for, has the ability to bind to, and / or has specificity for a specific antigen, such as TeNT, may also be said to be "allelic" or "targeting" said antigen (e.g., TeNT). The term "specificity" refers to the number of different types of antigens or antigenic determinants that a particular antigen-binding protein molecule can bind. The specificity of an antigen-binding protein can be determined based on affinity and / or avidity. Affinity is determined by the dissociation equilibrium constant (K D) and is a measure of the binding strength between an antigenic determinant and an antigen-binding site on an antigen-binding protein. Alternatively, affinity is expressed as 1 / K D The affinity constant (K A ) Avidity can be determined in a manner known per se depending on the unique combination of antigen-binding protein and antigen of interest. Avidity is understood herein to refer to the binding strength of a target molecule having multiple binding sites by a larger complex of binding substances, i.e., the binding strength of multivalent binding. Avidity is related to both the affinity between an antigenic determinant on an antigen-binding molecule and its antigen-binding site, and the number of binding sites present on the antigen-binding molecule. Avidity, on the other hand, refers to a simple monovalent receptor-ligand system.

[0053] Generally, an antigen-binding protein of the invention having the ability to bind TeNT has a molecular weight of about 10 -5 ~10 -12 M or less, and preferably 10 -7 ~10 -12 M or less, and more preferably 10 -8 ~10 -12 The dissociation constant (K D ) and / or at least 10 -7 M, preferably at least 10 -8 M, more preferably at least 10 -9 M, for example at least 10 -10 , 10 -11 , 10 -12 M or greater. -4 Any K greater than M DValues ​​(i.e., less than 100 μM) are generally considered to indicate non-specific binding. Preferably, the polypeptide of the present invention binds to TeNT with an affinity of less than 500 nM, preferably less than 200 nM, more preferably less than 10 nM, such as less than 500 pM. Specific binding of an antigen-binding protein to an antigen or antigenic determinant can be determined in any suitable manner known per se, including, for example, Scatchard analysis and / or competitive binding assays, such as radioimmunoassays (RIA), enzyme immunoassays (EIA), and sandwich competitive assays, as well as different variants thereof known per se in the art.

[0054] Tetanus toxoid is an attenuated form of TeNT, e.g., formaldehyde-treated TeNT. Preferred antigen-binding proteins of the invention that have the ability to bind bacterial toxins, such as TeNT, also have the ability to bind tetanus toxoid. Toxoid-binding ability is advantageous as it allows for the evaluation of antigen-binding proteins according to the invention without the need to use TeNT.

[0055] Moreover, the advantages of SDA over classical antibodies, such as binding specificity, resistance to denaturation / thermal degradation, aqueous solubility, biodistribution, and tissue penetration, are addressed.

[0056] However, a drawback of SDA fragments is their relatively short serum half-life once administered to the body; they are cleared from the blood at a high rate. A typical half-life for monovalent VHHs can be around 2 hours, but clearance occurs within a day (Harmsen, MM et al., Vaccine 23:4926-4934 (2005)). This drawback is due to their relatively low molecular weight. As a rule of thumb, molecules with a minimum MW of 50-60 kDa, more preferably 60-70 kDa, have significantly longer half-lives.

[0057] This drawback could be overcome, for example, through continuous intravenous administration of SDA fragments. This approach is not the preferred method, however, due to animal welfare, practicality, and economical considerations. For these reasons, other methods have been tried and found to overcome this problem.

[0058] A widely used approach to reduce the clearance rate is direct conjugation to a second molecule with an inherently long serum half-life. One such method is to increase the hydrodynamic size of the protein by chemical linkage of polyethylene glycol (PEG), which can generate drugs with a terminal half-life of up to 14 days in humans. Another approach is to express the therapeutic protein as a genetic fusion with a natural protein with a long serum half-life; the 67 kDa serum albumin (SA) or the Fc portion of an antibody (which adds an additional 60-70 kDa in its native dimeric form depending on glycosylation). This provides compounds with a terminal half-life of several days in humans.

[0059] In the present invention, a different approach is chosen. The solution provided in the present invention and discussed in more detail below concerns the combination of at least one SDA capable of binding to TeNT according to the present invention, coupled via a linker, with at least another SDA targeting another (non-TeNT) protein. As used herein, said other protein, which is not a TeNT protein, is a protein present in the human or animal body, preferably in the blood, preferably a serum protein. Examples of such proteins are given below, and the concept is explained in more detail.

[0060] An example of such a combination is a combination comprising an SDA according to the invention having the ability to bind TeNT, a linker, and an SDA that targets another (non-TeNT) protein.

[0061] It goes without saying that a combination comprising two or more SDAs capable of binding to TeNT, for example connected via a linker and further connected via a linker to at least one SDA that targets another (non-TeNT) protein, preferably a serum protein, may even be more efficient in neutralizing TeNT. Preferably, the two or more SDAs capable of binding to TeNT target different epitopes of TeNT.

[0062] As used herein, any such combination of at least one SDA capable of binding to TeNT, at least one linker, and at least one other SDA that targets another (non-TeNT) protein is further referred to as a polypeptide construct. The Examples section below provides ample examples of such polypeptide constructs.

[0063] The concept of the linker is considered in more detail below. Essentially, the function of the linker is to link the SDAs. The linker is a relatively short peptide that adopts an unstructured, flexible conformation. In principle, the linker peptide should not, or should do as little as possible, interfere with the assembly and binding activity of the domains it links.

[0064] A polypeptide construct according to the invention has a size of about 2 x 15 kDa, for example for a polypeptide construct comprising one SDA capable of binding to a TeNT epitope, a linker, and a second SDA capable of binding to another protein, and a size of about 3 x 15 kDa, for example for a polypeptide construct comprising one SDA capable of binding to a first TeNT epitope, a second SDA capable of binding to a second TeNT epitope, and a third SDA capable of binding to another protein.

[0065] An advantage of such a polypeptide construct is that its relatively short length makes it possible to readily synthesize it chemically in an economically feasible manner, or to express a DNA fragment encoding the polypeptide construct in a suitable expression system.

[0066] Although there is room for discussion, such a polypeptide construct in principle still has a relatively short half-life (its MW is still less than 50-60 kDa, or less than 60-70 Da), but is significantly different from the monomeric construct in that once administered to the body, the polypeptide construct binds to another protein through its "SDA capable of binding to another protein", thereby resulting in a molecule with a significantly larger size than such a polypeptide construct. The resulting polypeptide construct after binding has a MW significantly greater than 60 kDa.

[0067] This approach has the advantage that the polypeptide constructs can be easily generated (see above) and at the same time it overcomes the problem of the short half-life of small molecules: once administered, larger molecules can be formed that overcome this problem.

[0068] The other (non-TeNT) protein is preferably a serum protein so that the SDA capable of binding to the other (non-TeNT) protein can easily come into intimate contact with the protein after parenteral administration.

[0069] Thus, in one embodiment, the present invention relates to a particular form of antigen binding protein of the present invention: a multivalent antigen binding protein. The multivalent antigen binding protein comprises the amino acid sequence of at least one antigen binding protein capable of binding to TeNT as defined herein above, and at least one antigen binding protein capable of binding to a serum protein. The amino acid sequences of the at least two antigen binding proteins are usually fused head-to-tail, i.e., the C-terminus of the most N-terminal sequence is fused to the N-terminus of the second sequence, etc. The amino acid sequences of the at least two antigen binding proteins may be fused directly linked or via a linker or spacer. The multivalent antigen binding protein of the present invention may be produced by expression of a nucleotide sequence encoding a multivalent protein, provided that the coding sequences of the two or more antigen binding proteins are operably linked together in the same reading frame. The skilled artisan will understand how to operably fuse protein coding sequences.

[0070] Thus, in another aspect, the present invention relates to a polypeptide construct (or fusion protein) comprising at least one antigen-binding protein capable of binding to TeNT according to the present invention and at least one antigen-binding protein capable of binding to a serum protein. The two or more amino acid sequences are preferably linked together by genetic fusion, provided that the nucleotide sequences encoding each amino acid sequence are operably linked together in frame by means known per se in the art. The amino acid sequences may be linked directly or, optionally, via a spacer or linker amino acid sequence.

[0071] Moreover, the serum protein is preferably a relatively large protein: the size of the product formed after the polypeptide construct binds to the serum protein should preferably be greater than 60 kDa in order to achieve a longer half-life. Examples of large serum proteins are, inter alia, serum albumin and serum immunoglobulins (Ig), such as immunoglobulin G (IgG).

[0072] Thus, a preferred form of this embodiment of the invention relates to a polypeptide construct comprising at least one antigen-binding protein capable of binding to TeNT according to the invention and at least one antigen-binding protein capable of binding to a serum protein, wherein said serum protein is serum albumin, preferably horse, porcine, feline or canine serum albumin.

[0073] In a preferred embodiment, the polypeptide construct comprising at least one SDA capable of binding to a serum protein according to the present invention and at least one SDA capable of binding to TeNT has at least one SDA that binds to a linear epitope and at least a second SDA that binds to a conformational epitope. More preferably, the construct has one SDA that binds to a linear epitope and two SDAs that bind to conformational epitopes.

[0074] Thus, a highly preferred embodiment relates to a polypeptide construct comprising at least one antigen binding protein, preferably SDA, capable of binding to a serum protein, and at least a first and a second antigen binding protein, preferably each SDA, capable of binding to a bacterial toxin, preferably a Clostridium toxin, more preferably a Tetanus, Cl.botuli or Clostridium difficile toxin, most preferably TeNT, wherein the first toxin binding protein binds a linear epitope, more preferably the first toxin binding protein binds a linear epitope and the second toxin binding protein binds a conformational epitope.

[0075] Another highly preferred embodiment relates to a polypeptide construct comprising at least a first and a second antigen binding protein, preferably each SDA, capable of binding to a bacterial toxin, preferably a Clostridium toxin, more preferably a Tetanus, Clostridium botulinum or Clostridium difficile toxin, most preferably TeNT, wherein the first toxin binding protein binds a linear epitope, more preferably the first toxin binding protein binds a linear epitope and the second toxin binding protein binds a conformational epitope.

[0076] Serum albumin exists in the body at a relatively high concentration. This means that the polypeptide construct according to the present invention, which comprises at least one antigen-binding protein capable of binding to serum albumin, will easily form a large product through binding with serum albumin once administered into the body. Nevertheless, even in the case of an antigen-binding protein capable of binding to serum albumin, the K D The value is preferably low, e.g., less than 1 microM. The present invention provides antigen binding proteins with the ability to bind serum albumin. Six examples of such antigen binding proteins and their sequences are presented in Figure 3. The three shaded regions indicate where the hypervariable regions or complementarity determining regions (CDRs) are located. The present invention indeed provides antigen binding proteins with low K D Provided is SDA that binds to serum albumin at (0.5 to 300 nM).

[0077] Table 18 and FIG. 6 in the Examples section show, inter alia, half-life results in pigs of various polypeptide constructs in which an SDA capable of binding to TeNT according to the invention is coupled to an SDA capable of binding to serum albumin according to the invention. As is immediately evident from the table, such polypeptide constructs have a surprisingly long average half-life of 100-150 hours. A similar half-life (117 hours) was reported for other albumin half-life extended single domain antibodies (Hoefman et al., 2015). Table 33 in the Examples section (Example 23) shows the surprising finding that the polypeptide constructs in which an SDA capable of binding to TeNT according to the invention is coupled to an SDA capable of binding to serum albumin according to the invention had an average half-life of 396-609 hours when administered to horses. A preferred polypeptide construct according to the present invention comprising at least one SDA according to the present invention capable of binding to TeNT and at least one SDA according to the present invention capable of binding to a serum protein (such as, for example, SVA12) has an average half-life of at least 200 hours, preferably at least 250 hours, more preferably at least 300 hours, even more preferably at least 350 hours, even more preferably at least 375 hours, even more preferably at least 380 hours, even more preferably at least 390 hours, even more preferably at least 395 hours, even more preferably at least 450 hours, even more preferably at least 475 hours, more preferably still at least 500 hours, even more preferably at least 550 hours and most preferably at least 600 hours, whereby said half-life is preferably the half-life in horses, more preferably as determined in Example 23.

[0078] Even more surprisingly, the present invention specifically provides SDAs that exhibit a wide range of cross-species binding. Cross-species binding is understood as binding to serum albumin of more than one species. Six examples of SDAs and their sequences that have the ability to bind to serum albumin according to the present invention are provided in Table 6 and discussed below.

[0079] The obvious advantage of SDAs having cross-species binding, i.e. the ability to bind to serum albumin of more than one animal species, is that such SDAs can be used in polypeptide constructs according to the invention that can be used for more than one animal species.

[0080] Thus, in another aspect, the present invention relates to an antigen-binding protein which specifically binds to serum albumin, preferably comprising an amino acid sequence comprising four framework regions, FR1 to FR4, and three complementarity determining regions, CDR1 to CDR3, which are operably linked in the order FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Preferably, CDR1 has an amino acid sequence selected from the group consisting of VHH CDR1 sequences of SEQ ID NOs: 37 to 42, or amino acid sequences which differ from CDR1 in one or two amino acid residues, as shown in Figure 2; a) CDR2 has an amino acid sequence selected from the group consisting of VHH CDR2 sequences of SEQ ID NOs: 37 to 42, or amino acid sequences which differ from CDR2 in one, two, three, or four amino acid residues, as shown in Figure 2; and c) CDR3 has an amino acid sequence selected from the group consisting of VHH CDR3 sequences of SEQ ID NOs: 37 to 42, or amino acid sequences which differ from CDR3 in one, two, three, four, or five amino acid residues, as shown in Figure 2; with the proviso that each of the framework regions has at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% amino acid identity to the framework amino acid sequence of any one of SEQ ID NOs: 37 to 42, as shown in Figure 2. Preferably, CDR1, CDR2 and CDR3 are derived from the same SEQ ID NO. More preferably, the framework regions are derived from the same SEQ ID NO as the complementarity determining regions. In other words, in this aspect, the invention relates to an antigen binding protein having the ability to bind to serum albumin, preferably SDA, which has an overall amino acid sequence identity of at least 70% with a sequence selected from the group consisting of SEQ ID NOs: 40, 37, 38, 39, 41 or 42, with the proviso that the amino acid sequence identity of CDR1, CDR2 and CDR3 is at least 75%. Preferably, the antigen binding protein has the ability to bind to equine, porcine, feline or canine serum albumin.

[0081] Preferably, an antigen binding protein having the ability of binding to serum albumin according to the present invention has an overall sequence identity of more than 70%, such as at least more than 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or even 100%, with a sequence selected from the group consisting of SEQ ID NOs: 37, 38, 39, 40, 41 and 42, in such order of preference. Preferably, the level of identity of the CDR1, CDR2 and CDR3 regions is at least 75%.

[0082] Alternatively, or in combination with the previous embodiments, in a preferred embodiment the sequence identities of the CDR1, CDR2 and CDR3 regions are at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100%, in this order of preference. These sequence identities can be determined independently of each other.

[0083] Accordingly, a preferred form of this embodiment relates to an antigen binding protein capable of binding to serum albumin according to the present invention having at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100% overall amino acid sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 37, 38, 39, 40, 41 and 42, provided that the amino acid sequence identity of CDR1, CDR2 and CDR3 is at least 75%. Thus, a more preferred form of this embodiment is an antigen binding protein capable of binding to serum albumin according to the present invention, comprising a sequence selected from the group consisting of SEQ ID NOs: 37, 38, 39, 40, 41 and 42 and at least one of SEQ ID NOs: 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95 , 96, 97, 98, 99, or even 100% overall amino acid sequence identity, provided that the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or even 100%.

[0084] As mentioned above, an antigen binding protein having the ability to bind to serum albumin of two or more animal species has the advantage that it can be used in a polypeptide construct according to the present invention, which can be used in two or more animal species. The present invention provides several antigen binding proteins having the ability to bind to serum albumin that exhibit such cross-species binding. As can be seen in Table 6, in particular SVA12L (SEQ ID NO: 40) and SVA06L (SEQ ID NO: 39) provide strong cross-species binding in the sense that they bind to serum albumin of dogs, horses, cats, and pigs. Also, as can be seen in Tables 6 and 28, in particular SVA16L (SEQ ID NO: 37) provides strong cross-species binding in the sense that it binds to serum albumin of dogs, horses, and cats.

[0085] Thus, a more preferred form of this embodiment has at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% overall amino acid sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 37, 39, and 40, but The present invention relates to an antigen-binding protein capable of binding to serum albumin, wherein the amino acid sequence identity of CDR1, CDR2 and CDR3 is at least 75%, preferably at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%.

[0086] Therefore, a more preferred form of embodiment of the present invention relates to a polypeptide construct (or fusion protein) comprising at least one antigen-binding protein capable of binding to TeNT according to the present invention and at least one antigen-binding protein capable of binding to serum albumin, with the proviso that said at least one antigen-binding protein capable of binding to serum albumin is preferably an antigen-binding protein according to the present invention, see above.

[0087] Another preferred form of embodiment of the present invention relates to a polypeptide construct (or fusion protein) comprising at least one antigen-binding protein capable of binding to TeNT according to the present invention and at least one antigen-binding protein capable of binding to a serum protein, with the proviso that said serum protein is an immunoglobulin.

[0088] A more preferred form of this embodiment relates to a polypeptide construct according to the invention comprising at least one antigen-binding protein capable of binding to TeNT and at least one antigen-binding protein capable of binding to a serum protein, wherein said serum protein is an IgG immunoglobulin, preferably an equine, porcine, murine, guinea pig, human, bovine, feline or canine IgG immunoglobulin.

[0089] Immunoglobulins, like serum albumin, are present in the body at relatively high concentrations. This means that the polypeptide construct according to the present invention, which comprises at least one antigen-binding protein capable of binding to immunoglobulins, will easily form large products through binding to serum immunoglobulins once administered to the body. Nevertheless, even in the case of antigen-binding proteins capable of binding to immunoglobulins, low K D Values, for example, less than 1 μM, are preferred.

[0090] The present invention provides a suitable D The present invention provides an antigen-binding protein that binds to Ig and has a low K D Eight examples of antigen binding proteins according to the invention that bind to immunoglobulins having the following sequence are provided in Figure 2. The three shaded regions indicate where the hypervariable regions or complementarity determining regions (CDRs) are located.

[0091] Thus, in another aspect, the present invention relates to an antigen-binding protein which specifically binds to an immunoglobulin (Ig), preferably comprising an amino acid sequence comprising four framework regions, FR1 to FR4, and three complementarity determining regions, CDR1 to CDR3, operably linked in the order FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. Preferably, CDR1 has an amino acid sequence selected from the group consisting of VHH CDR1 sequences of SEQ ID NOs: 27 to 34 or amino acid sequences which differ from CDR1 in one or two amino acid residues, as shown in Figure 3; a) CDR2 has an amino acid sequence selected from the group consisting of VHH CDR2 sequences of SEQ ID NOs: 27 to 34 or amino acid sequences which differ from CDR2 in one, two, three or four amino acid residues, as shown in Figure 3; and c) CDR3 has an amino acid sequence selected from the group consisting of VHH CDR3 sequences of SEQ ID NOs: 27 to 34 or amino acid sequences which differ from CDR3 in one, two, three, four or five amino acid residues, as shown in Figure 3, with the proviso that each of the framework regions has at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% amino acid identity to the framework amino acid sequence of any one of SEQ ID NOs: 27 to 34, as shown in Figure 3. Preferably, CDR1, CDR2 and CDR3 are derived from the same SEQ ID NO. More preferably, the framework regions are derived from the same SEQ ID NO as the complementarity determining regions. In other words, in this aspect, the invention relates to an antigen binding protein, preferably a single domain antibody (SDA), capable of binding to an immunoglobulin (Ig), which has an overall amino acid sequence identity of at least 70% with a sequence selected from the group consisting of SEQ ID NOs: 30, 27, 28, 29, 31, 32, 33 or 34, with the proviso that the amino acid sequence identity of CDR1, CDR2 and CDR3 is at least 75%.

[0092] Preferably, an antigen binding protein having the ability of binding to Ig has an overall sequence identity of more than 70%, such as at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or even 100%, with a sequence selected from the group consisting of SEQ ID NOs: 27, 28, 29, 30, 31, 32, 33, and 34, in such order of preference. Preferably, the sequence identity of the CDR1, CDR2 and CDR3 regions is at least 75%.

[0093] Accordingly, a preferred form of this embodiment relates to an antigen binding protein capable of binding to an Ig according to the present invention having at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% overall amino acid sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 27, 28, 29, 30, 31, 32, 33 and 34, provided that the amino acid sequence identity of the CDR1, CDR2 and CDR3 regions is at least 75%.

[0094] More preferably, the SDA capable of binding to Ig has a sequence selected from the group of SEQ ID NOs: 27, 28, 29, 30, 31, 32, 33, or 34 and more than 70% of the sequence selected from the group of SEQ ID NOs: 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97 , 98, 99 or even 100%, although preferably the level of identity of the CDR1, CDR2 and CDR3 regions is in the following order of preference: 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or even 100%.

[0095] Thus, a more preferred form of this embodiment is a nucleic acid sequence comprising a sequence selected from the group consisting of SEQ ID NOs: 27, 28, 29, 30, 31, 32, 33, and 34 and at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% overall The present invention relates to an antigen binding protein having the ability of binding to an Ig according to the present invention, which has an amino acid sequence identity of at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100% amino acid sequence identity of the CDR1, CDR2 and CDR3 regions.

[0096] According to Table 7, SVG23 is specific for dogs, while SVG03 is specific for horses.

[0097] Even more surprisingly, the present invention provides SDAs with the ability to bind Igs that exhibit a broad range of cross-species binding. As can also be seen in Table 7, SVG06 and SVG13 in particular provide very strong cross-species binding in the sense that they bind, for example, to feline, canine, equine, human and porcine Igs (Fab fragments). Also according to Table 7, SVG24 in particular provides very strong cross-species binding in the sense that it binds to both canine and equine Igs (Fc fragments).

[0098] Thus, an even more preferred form of this embodiment relates to an antigen binding protein capable of binding to an Ig according to the present invention having at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% overall amino acid sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 27, 30, 31, 32 and 33, provided that the amino acid sequence identity of the CDR1, CDR2 and CDR3 regions is at least 75%.

[0099] An even more preferred form of this embodiment is a method for detecting a mutated nucleotide sequence comprising a sequence selected from the group consisting of SEQ ID NOs: 27, 30, 31, 32, and 33 and at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100% overall mutated nucleotide sequence. The present invention relates to an antigen binding protein having the ability of binding to Ig according to the present invention, which has amino acid sequence identity to the CDR1, CDR2 and CDR3 regions of at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100% amino acid sequence identity.

[0100] Therefore, another more preferred form of embodiment of the present invention relates to a polypeptide construct (or fusion protein) comprising at least one antigen-binding protein capable of binding to TeNT according to the present invention, and at least one antigen-binding protein capable of binding to a serum protein, with the proviso that said serum protein is Ig, and wherein said at least one antigen-binding protein capable of binding to Ig is preferably an antigen-binding protein according to the present invention, see above.

[0101] It should be noted that it is generally true that the order of the various antigen-binding proteins within the polypeptide construct according to the invention (their location relative to the N-terminus and C-terminus of the polypeptide construct) can vary. This is due to the fact that the hinge(s) adopt an unstructured, flexible conformation; its main function is to bind the various antigen-binding proteins.

[0102] As alluded to above, in one aspect, the present invention relates to a polypeptide construct (or fusion protein) comprising at least one antigen-binding protein capable of binding to TeNT according to the present invention and at least one antigen-binding protein capable of binding to a serum protein. Even more surprisingly, an unexpected synergistic effect was found for a polypeptide construct according to the present invention comprising two or more SDAs capable of binding to TeNT. The bivalent construct achieves a stronger level of binding to TeNT in a mouse toxin neutralization test than, for example, a mixture of two monovalent constructs. This effect is even more significant when the polypeptide construct comprises two or more SDAs capable of binding to TeNT that bind to different epitopes of TeNT. This can be seen from Table 15, which provides an overview of the epitope binding properties of various SDAs capable of binding to TeNT according to the present invention.

[0103] As is immediately apparent from Table 12, five different options for SDAs with the ability to bind TeNT were identified: Option A; SVT02, Option B; SVT03, Option C; SVT15, Option D; SVT06 / 08, and Option E; SVT13 / 16 / 22 / 34.

[0104] For example, a polypeptide construct comprising two SDAs: (i) an SDA capable of binding to TeNT and having an amino acid sequence based on SEQ ID NO: 17, and (ii) an SDA capable of binding to TeNT and having an amino acid sequence based on SEQ ID NO: 15, was found to produce a strong synergistic effect. The TeNT neutralizing ability of such a construct is significantly stronger than that of the single SVT-06 and SVT-16 SDAs (see Tables 19 and 20, Example 17).

[0105] For this reason, in an even more preferred embodiment, the polypeptide construct according to the present invention comprises at least two antigen-binding proteins capable of binding to TeNT according to the present invention. Preferably, each of the at least two antigen-binding proteins capable of binding to TeNT has an overall amino acid sequence identity of at least 70% with a sequence selected from option A; SEQ ID NO: 24, or option B; SEQ ID NO: 25, or option C; SEQ ID NO: 20, or option D; SEQ ID NO: 17 or 19, or option E; SEQ ID NO: 22, 15, 23, or 14, with the proviso that at least two SDAs do not contain sequences from the same option, and the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75%. Thus, in other words, each of the at least two antigen-binding proteins capable of binding to TeNT has an overall amino acid sequence identity of at least 70% with a sequence selected from option A; SEQ ID NO: 24, or option B; SEQ ID NO: 25, or option C; SEQ ID NO: 20, or option D; SEQ ID NO: 17 or 19, or option E; SEQ ID NO: 22, 15, 23, or 14, with the proviso that at least two SDAs do not contain sequences from the same option, and the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75%. (i) SEQ ID NO:24; (ii) SEQ ID NO:25; (iii) SEQ ID NO: 20; (iv) SEQ ID NO:17, or SEQ ID NO:19; and (v) SEQ ID NO:22, SEQ ID NO:15, SEQ ID NO:23, or SEQ ID NO:14; having at least 70% overall amino acid sequence identity with a sequence selected from the group consisting of: However, the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75%.

[0106] A polypeptide construct according to the present invention preferably comprises two, three or four antigen-binding proteins capable of binding to TeNT according to the present invention, more preferably two or three, and most preferably two antigen-binding proteins capable of binding to TeNT. In a preferred embodiment, a polypeptide construct according to the present invention comprises two antigen-binding proteins capable of binding to TeNT, and a polypeptide having the sequence: (i) SEQ ID NO:15, and SEQ ID NO:17; (ii) SEQ ID NO:24, and SEQ ID NO:17; (iii) SEQ ID NO:20, and SEQ ID NO:17; (iv) SEQ ID NO: 15, and SEQ ID NO: 24; or (v) SEQ ID NO:24, and SEQ ID NO:20; and having at least 70% overall amino acid sequence identity with, provided that the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75%.

[0107] The polypeptide construct according to the invention preferably comprises one antigen-binding protein having the ability to bind to a serum protein.

[0108] Merely by way of example: such a polypeptide construct according to the present invention may, for example, comprise an SDA capable of binding to TeNT, option C; having at least 70% overall amino acid sequence identity with SEQ ID NO: 20, with the proviso that the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75% amino acid sequence identity, and an SDA capable of binding to TeNT, option D; having at least 70% overall amino acid sequence identity with SEQ ID NO: 17, with the proviso that the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75% amino acid sequence identity.

[0109] Preferably, the antigen binding protein of such a construct having the ability to bind TeNT has at least 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100% overall amino acid sequence identity with a sequence selected from option A; SEQ ID NO: 24, or option B; SEQ ID NO: 25, or option C; SEQ ID NO: 20, or option D; SEQ ID NO: 17 or 19, or option E; SEQ ID NO: 22, 15, 23, or 14.

[0110] More preferably, the antigen binding protein of such a construct comprises a sequence selected from option A; SEQ ID NO: 24, or option B; SEQ ID NO: 25, or option C; SEQ ID NO: 20, or option D; SEQ ID NO: 17 or 19, or option E; SEQ ID NO: 22, 15, 23 or 14, and at least one of 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88 , 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100% overall amino acid sequence identity, and the amino acid sequence identity of the CDR1, CDR2, and CDR3 regions is at least 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100%.

[0111] In a more preferred embodiment, the polypeptide construct according to the present invention comprises an antigen binding protein having the sequence as set forth in SEQ ID NO: 15, an antigen binding protein having the sequence as set forth in SEQ ID NO: 17 and an antigen binding protein having the sequence as set forth in SEQ ID NO: 40. More preferably, the polypeptide construct comprises, in the specific order N-terminus-SEQ ID NO: 17-SEQ ID NO: 15-SEQ ID NO: 40-C-terminus, an SDA (SVT-06) having the sequence as set forth in SEQ ID NO: 17, an SDA (SVT16) having the sequence as set forth in SEQ ID NO: 15 and an SDA (SVA12) having the sequence as set forth in SEQ ID NO: 40. Even more preferably, the polypeptide construct comprises an amino acid sequence as set forth in SEQ ID NO: 51, 77, or 78, preferably 51, or a combination of SEQ ID NO: 51, 77, or 78, preferably 51 and at least one of SEQ ID NO: 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, , 95, 96, 97, 98, 99, or preferably 100% sequence identity, with the proviso that the sequence identity of the CDR1, CDR2, and CDR3 regions is at least 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100%. The polypeptide construct can be altered, for example, by removing the His6 tag and / or by altering or replacing the linker sequence as shown in SEQ ID NO: 51, 77, or 78, preferably 51.

[0112] In a highly preferred embodiment, the polypeptide construct comprises an amino acid sequence as set forth in SEQ ID NO:51, or a sequence identical to SEQ ID NO:51 and at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%, preferably 80%, more preferably 90%, even more preferably 95%, even more preferably 98%, Most preferably, it has an amino acid sequence with 100% sequence identity, where the sequence identity of the CDR1, CDR2 and CDR3 regions is at least 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%, preferably 80%, more preferably 90%, even more preferably 95%, even more preferably 98%, most preferably 100%. The polypeptide construct can be altered, for example, by removing the His6 tag and / or by altering or replacing the linker sequence as shown in SEQ ID NO:51.

[0113] In a highly preferred embodiment, the polypeptide construct comprises an amino acid sequence as set forth in SEQ ID NO: 77, or a sequence identical to SEQ ID NO: 77 and at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%, preferably 80%, more preferably 90%, even more preferably 95%, even more preferably 98%, Most preferably, it has an amino acid sequence with 100% sequence identity, where the sequence identity of the CDR1, CDR2 and CDR3 regions is at least 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%, preferably 80%, more preferably 90%, even more preferably 95%, even more preferably 98%, most preferably 100%. The polypeptide construct can be altered, for example, by removing the His6 tag and / or by altering or replacing the linker sequence as shown in SEQ ID NO:77.

[0114] In a highly preferred embodiment, the polypeptide construct comprises an amino acid sequence as set forth in SEQ ID NO: 78, or a sequence identical to SEQ ID NO: 78 and at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%, preferably 80%, more preferably 90%, even more preferably 95%, even more preferably 98%, Most preferably, it has an amino acid sequence with 100% sequence identity, where the sequence identity of the CDR1, CDR2 and CDR3 regions is at least 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100%, preferably 80%, more preferably 90%, even more preferably 95%, even more preferably 98%, most preferably 100%. The polypeptide construct can be altered, for example, by removing the His6 tag and / or by altering or replacing the linker sequence as shown in SEQ ID NO:78.

[0115] In a most preferred form, the polypeptide construct according to the present invention has a sequence as set forth in SEQ ID NO: 51, 47, 48, 52, 53, 61, 62, 49, 50, 77 or 78, preferably as set forth in SEQ ID NO: 51, 47, 48, 52, 53, 61, 62, 49, 77 or 78, more preferably as set forth in SEQ ID NO: 51, 47, 48, 52, 53, 61, 62 or 49, most preferably as set forth in SEQ ID NO: 51, provided that the sequence identity of the CDR1, CDR2 and CDR3 regions is at least 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or preferably 100%.

[0116] It was also surprisingly found that different SDA combinations according to the invention, when mixed together, show a stronger toxin neutralizing effect in the mouse Tetanus Toxin Neutralization Test (TNT). This is shown in Tables 21 to 23 in the Examples section. Tables 21 and 24 show the different combinations tested. Table 24 shows that a single SDA, SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, provides 50% protection at a given dilution in mice, while the combination of SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 and SVT15-3FW4M-GS2-SVG13M4-H6 provides 100% protection at the same dilution in mice.

[0117] As mentioned above, the various SDAs in the polypeptide construct according to the invention are preferably linked to each other through linker peptides, which are sequences of amino acids commonly used to physically link polypeptide domains.

[0118] Such a linker can be any linker known to those skilled in the art. For example, the linker can be a biocompatible polymer having a length of 1 to 100 atoms. It can be, for example, a polymer present as poly-lysine, poly-glycine, poly-glutamic acid, poly-isoleucine, poly-serine, or poly-arginine residues, or in combinations thereof. Most linker peptides are composed of one or more repeating modules of the amino acids glycine and serine. By way of example only: such a linker can have, for example, the following sequence: Gly4-Ser-Gly3-Ser, or (Gly4-Ser) n where n is 2, 3, 4, 5, or 6, preferably 4, 5, or 6.

[0119] Preferably, a 15 amino acid (G4S)3 linker is used, which is composed of three consecutive repeats of the amino acid sequence (Gly)4-Ser. This linker was first used in the production of single chain Fvs

[27] , but is also often used in the fusion of VHHs

[28] . It is a flexible linker that facilitates independent binding to different antigenic sites. This linker peptide has been well characterized in the art (e.g., in the context of antibody single chain Fv (scFv) domains) and has been shown to adopt an unstructured, flexible conformation. Moreover, this linker peptide does not interfere with the assembly and binding activity of the domains it joins (Freund, C. et al., FEBS 320:97 (1993)). Other examples of suitable hinges are presented, inter alia, in EP 2 655 624.

[0120] Other, more rigid linkers for protein domain fusion are also known. Huston JS,et al., Proc Natl Acad Sci.1988;85:5879-83,

[28] Mukherjee J,et al., PLoS ONE.2012;7:e29941,

[29] Sepulveda J,et al., Infect Immun.2010;78:756-63,

[30] Vance DJ,et al., J Biol Chem.2013;288:36538-47,

[31] Klein JS,et al., Protein Eng Des Sel.2014;27:325-30, Trinh R,et al., Mol Immunol.2004;40:717-22.

[0121] The Examples section (see below) provides examples of linkers that find use in the present invention.

[0122] In a further aspect, the present invention relates to a DNA fragment encoding an antigen binding protein according to the invention or encoding a polypeptide construct according to the invention, such a DNA fragment comprises the genetic information encoding an SDA or a polypeptide construct.

[0123] In another aspect, the present invention relates to a nucleic acid comprising a DNA fragment encoding an antigen binding protein according to the present invention or a polypeptide construct according to the present invention as defined herein above. A preferred nucleic acid according to the present invention is a nucleic acid construct, such as a plasmid, in which the DNA fragment is operably linked to a promoter and, optionally, other regulatory elements, such as terminators, enhancers, polyadenylation signals, signal sequences for secretion, etc. Such a nucleic acid construct is particularly useful for producing the antigen binding protein or polypeptide construct of the present invention using recombinant techniques to express in a suitable host cell a nucleotide sequence (DNA fragment) encoding the antigen binding protein of interest, as described, for example, in Ausubel et al., "Current Protocols in Molecular Biology", Greene Publishing and Wiley Interscience, New York (1987) and in Sambrook and Russell (2001) "Molecular Cloning: A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York). As used herein, the term "operably linked" refers to the association of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence. "Operably linked" means that the DNA sequences being linked are generally contiguous, and, where necessary to join two protein coding regions, contiguous and in reading frame.

[0124] A suitable promoter is one that is recognized in the host cell and drives the expression of the genetic information that it controls in that host cell. Suitable promoter / host cell combinations have been known in the art for decades already.

[0125] Such nucleic acid can be inserted into a suitable host cell, allowing expression of the antigen binding protein or polypeptide construct under the control of a suitable promoter.

[0126] Expression of a DNA fragment comprising a nucleic acid encoding any of the SDAs according to the invention, or any of the polypeptide constructs according to the invention, can be carried out in prokaryotic and eukaryotic host cells, all of which expression systems in host cells have been known in the art for decades.

[0127] A classic textbook describing a large number of expression systems is "Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems" by Gerd Gellissen (ed.), ISBN: 978-3-527-31036-4, December 2004, Publisher Wiley-Blackwell.

[0128] An overview of methods for expressing heterologous proteins in insect cells is given in "Opportunities and challenges for the baculovirus expression system", (Monique M. van Oers, Journal of Invertebrate Pathology, Volume 107, Supplement, July 2011, Pages S3-S15). Specific methods for expressing camelid SDA in lower eukaryotic hosts such as filamentous fungi and yeasts are presented inter alia in EP 0 698 097. Furthermore, the Examples section, more particularly Examples 6 and 14 (see below), provides detailed examples of the expression of SDA in yeast.

[0129] Therefore, in a further aspect, the present invention relates to a host cell comprising a nucleic acid as defined above. Preferably, the host cell is a host cell for the production of an antigen binding protein according to the invention or a polypeptide construct according to the invention.

[0130] The host cell may be any host cell capable of producing the antigen binding protein of the invention, including for example prokaryotic host cells, such as E. coli, or (cultured) mammalian, plant, insect, fungal or yeast host cells, including for example CHO-cells, BHK-cells, human cell lines (including HeLa, COS, and PER.C6), Sf9 cells, and Sf+ cells. However, preferred host cells for producing the antigen binding proteins of the invention are cells of eukaryotic microorganisms, such as yeast and filamentous fungi. Preferred yeast host cells include for example Saccharomyces cerevisiae, Pichia pastoris, Hansenula polymorpha, Pichia angusta, and Kluyveromyces lactis. Preferred strains, constructs, and fermentation conditions for producing the antigen-binding proteins of the invention are described by van de Laar et al. (2007, Biotechnology and Bioengineering, Vol. 96, No. 3: 483-494). For example, production of the antigen-binding proteins can be carried out in standard bioreactors with working volumes of 10-10,000 liters.

[0131] In another aspect, the present invention relates to a method for producing an antigen binding protein according to the invention or a polypeptide construct according to the invention, comprising the steps of a) culturing a host cell comprising an antigen binding protein according to the invention or a polypeptide construct according to the invention under conditions allowing expression of the antigen binding protein or polypeptide construct, and optionally b) recovering, harvesting or purifying the antigen binding protein or polypeptide construct from at least one of the host cell and the culture medium. Suitable conditions may include the use of a suitable medium, the presence of a suitable food source and / or suitable nutrients, a suitable temperature, and optionally the presence of a suitable inducer or compound (e.g. when the nucleotide sequence of the invention is placed under the control of an inducible promoter); all of which may be selected by the skilled artisan. In such conditions, the amino acid sequence of the invention may be expressed in a constitutive manner, in a transient manner or only when suitably induced. The antigen binding protein of the invention may then be isolated from the host cell / host microorganism and / or from the culture medium in which said host cell or host microorganism has been cultured using protein isolation and / or purification techniques known per se, such as (preparative) chromatographic and / or electrophoretic techniques, differential precipitation techniques, affinity techniques (e.g. using specific cleavable amino acid sequences fused to an amino acid sequence of the invention) and / or preparative immunological techniques (i.e. using antibodies against the antigen binding protein to be isolated), etc. In one embodiment, the produced and optionally recovered antigen binding protein or polypeptide construct is further mixed with a pharma- ceutically acceptable carrier.

[0132] In another aspect, the present invention relates to a pharmaceutical composition comprising at least one antigen-binding protein having the ability to bind to TeNT according to the present invention, and / or at least one polypeptide construct according to the present invention comprising at least one antigen-binding protein having the ability to bind to TeNT according to the present invention, and a pharma- ceutically acceptable carrier. In a further preferred embodiment, the pharmaceutical composition comprises at least two antigen-binding proteins having the ability to bind to TeNT according to the present invention, and / or at least one polypeptide construct according to the present invention comprising at least two antigen-binding proteins having the ability to bind to TeNT according to the present invention.

[0133] A pharma- ceutically acceptable carrier, as used herein, can be as simple as, for example, sterile water, physiological saline, or a buffer, for example, a buffered aqueous solution at physiological ionic strength and / or osmolarity (such as, for example, PBS).

[0134] Pharmaceutical formulations, methods of administration, and the use of pharma- ceutical acceptable excipients are known and conventional in the art, and are described, for example, in Remington; The Science and Practice of Pharmacy, 21st Edition 2005, University of Sciences in Philadelphia. Pharmaceutical compositions and medicaments according to the invention are preferably formulated for intravenous, subcutaneous, or intramuscular administration, although other routes of administration are envisaged, such as by injection, e.g. mucosal administration, or intradermal and / or intracutaneous administration.

[0135] Such compositions, as well as antigen binding proteins according to the invention, and / or polypeptide constructs according to the invention, can be successfully used in treating or preventing clinical disease following Clostridium tetani infection.

[0136] Therefore, in a further aspect, the present invention relates to an antigen-binding protein according to the invention, or a polypeptide construct according to the invention, for use as a medicament.

[0137] In a further aspect the invention relates to an antigen binding protein according to the invention and / or a polypeptide construct according to the invention and / or a pharmaceutical composition according to the invention for use in the prevention or treatment of a disease following a Clostridium tetanus infection. In other words, in this aspect the invention relates to the use of an antigen binding protein according to the invention and / or a polypeptide construct according to the invention for the manufacture of a medicament for the prevention or treatment of a disease following a Clostridium tetanus infection. Alternatively, in this aspect the invention relates to a method for preventing or treating a disease following a Clostridium tetanus infection, wherein a subject in need thereof is administered a therapeutically sufficient amount of an antigen binding protein according to the invention and / or a polypeptide construct of the invention. Thus, in this aspect the antigen binding protein, polypeptide construct and / or pharmaceutical composition according to the invention is used to prevent or treat tetanus.

[0138] As used herein, the terms "treat", "treatment", or "treating" refer to the application or administration of an antigen binding protein, polypeptide construct, and / or pharmaceutical composition of the invention to a subject with tetanus in order to cure, partially or completely reverse, alleviate, improve, inhibit, delay, suppress, slow, or stop the progression or severity of tetanus, or symptoms associated with tetanus. The term "treating" includes reducing or alleviating at least one side effect or symptom of tetanus. A treatment is generally "effective" if one or more symptoms or clinical markers are reduced. Alternatively, a treatment is "effective" if the progression of tetanus is reduced or stopped. That is, "treatment" is not limited to improvement of symptoms or markers, but also includes the halting or at least slowing of the progression or worsening of symptoms that would be expected in the absence of treatment. Beneficial or desired clinical outcomes include, but are not limited to, alleviation of one or more symptom(s), whether detectable or undetectable, reduction in the extent of disease, a stabilized (i.e., not worsening) state of disease, a delay or slowing of disease progression, improvement or mitigation of the disease state, and remission (whether partial or total). The term "treatment" of tetanus also includes achieving relief from the symptoms or side effects of tetanus (including palliative treatment). As used herein, the terms "prevent", "prevention", or "prophylactic" (also referred to as prophylactic) refer to the application or administration of an antigen binding protein, polypeptide construct, and / or pharmaceutical composition according to the invention to a subject at risk of developing tetanus with the purpose of preventing the onset of, alleviating, ameliorating, relieving, inhibiting the progression of, reducing the severity of, and / or reducing the morbidity of, one or more future symptoms or characteristics of tetanus disease. Thus, an antigen binding protein, polypeptide construct or pharmaceutical composition according to the invention may preferably be administered to a subject that does not show signs of tetanus and / or that shows only early signs of tetanus, with the aim of reducing the risk of developing pathologies associated with tetanus.

[0139] In one embodiment, the subject is a human, preferably a mammal, more preferably a non-human mammal, even more preferably a horse, dog, cat, pig, or animal including members of the ruminant family Bovidae (e.g., cow, goat). Preferred subjects according to the invention are, for example, wild horses (Equus ferus), African wild asses (Equus africanus), domestic dogs (Canis familiaris), domestic cats (Felis catus), pigs (Sus scrofa domesticus), cattle (Bos taurus), sheep (Ovis aries), and goats (Capra aegagrus hircus), most preferably wild horses.

[0140] Passive immunization with antigen-binding proteins or polypeptide constructs against TeNT according to the invention can be used in at least three different scenarios. For example, in a prophylactic scenario as part of a standard procedure before surgery or in a subject who has been injured and possibly infected with tetanus bacteria but is not yet diseased. Thirdly, in a therapeutic scenario when the subject is diseased with tetanus. Depending on the prophylactic or therapeutic treatment, there are differences in the dosage, for example in the latter case the dose is 2-20 times higher depending on the species. Small antitoxin doses (for example 1000 IU) may be administered locally near the wound site. Several routes of administration are applicable, such as intramuscular, subcutaneous, intravenous, epidural, subarachnoid or intrathecal. Antigen-binding proteins according to the invention and / or polypeptide constructs according to the invention capable of efficiently neutralizing tetanus toxin can be used in the following manner. The administered preparation should preferably cause a blood concentration of at least 0.01-0.1 IU / ml. Thus, dosage is preferably based on body weight / blood volume.

[0141] By way of example only: in established human cases, patients should receive 500-1000 IU / kg intravenously or intramuscularly. For SDA SVT06-SVT16-SVA12 (SEQ ID NO: 51), this results in a maximum dosage of 0.5-1 mg / kg. For small animals (cats and dogs), when administering classical equine antivenom products for established cases, the dose is 100-1000 IU / kg intravenously. For SDA SVT06-SVT16-SVA12, this results in a maximum dosage of 0.1-1 mg / kg. Larger animals receive proportionally smaller doses than smaller animals. For example, horses may receive 7500-11000 IU intramuscularly or subcutaneously as a preoperative treatment, and foals up to 100 kg may receive 3000-4000 IU via either route. Injured horses (not suffering from tetanus) may receive 15,000-20,000 IU intramuscularly or subcutaneously as a prophylactic treatment, foals up to 100 kg may receive 6,500-8,000 IU via either route. Horses suffering from tetanus should receive at least 50,000-60,000 IU via one route (if the preparation allows) or a combination of several routes.

[0142] In clinical cases, tetanus treatment may be repeated daily depending on the effect observed.

[0143] All recommended dosages provide passive protection, usually for at least 3 weeks. Again, merely by way of example: the half-life of the construct SVT06-SVT16-SVA12 (SEQ ID NO: 51) was shown to be such that after administration of 0.3 mg / kg to pigs, serum levels of 0.1 micrograms / ml (equivalent to more than 0.1 IU (Example 17, Table 25)) were still detectable after 21 days, as can be seen in FIG. 6 of Example 16. The same construct SVT06-SVT16-SVA12 (SEQ ID NO: 51) when administered to horses (0.17 mg / kg, intramuscularly) resulted in serum levels of 0.4-0.6 micrograms / ml after 21 days (Example 23), which is a fully protective level.

[0144] The amount of antitoxin (also called "potency" or "neutralizing capacity") is expressed in International Units (IU). The first milestone in the international standardization of tetanus toxoids was the establishment in 1928 of an international standard for tetanus antitoxins of equine origin, which was replaced in 1969 (WHO Expert Committee on Biological Standardization. Twenty-second report. Geneva, World Health Organization, 1970 (WHO Technical Report Series, No. 444). The availability and use of this preparation allowed the evaluation of the toxoids for their capacity to generate tetanus antitoxin in humans and allowed a protective unit for the antitoxin to be defined in International Units (IU). The neutralizing capacity can be determined, for example, as shown in Example 17 ("Analysis of SDA for tetanus toxin neutralizing capacity in a mouse model").

[0145] Commercially recommended antitoxin dosages for species vary and are mainly based on experimental data. Several routes of administration are applicable, such as intramuscular, subcutaneous, intravenous, epidural, subarachnoid or intrathecal. Antigen-binding proteins capable of binding TeNT according to the invention and capable of efficiently neutralizing tetanus toxin are available as well. The dose of antitoxin should preferably cause a blood concentration of at least 0.01-0.1 IU / ml. In established human cases, patients are preferably administered 500-1000 IU / kg of equine antitoxin intravenously or intramuscularly. Depending on the preparation used, up to 5000-8000 IU of human anti-tetanus immune globulin may be administered intramuscularly. The preferred dose of classical equine antitoxin products for established cases in small animals (such as cats and dogs) is 100-1000 units / kg intravenously. Larger animals receive proportionally smaller doses than smaller animals. For example, horses may receive 7500-8500 IU intramuscularly or subcutaneously as a preoperative treatment, and foals up to 100 kg may receive 3000-4000 IU via either route. Injured horses (not affected by tetanus) may receive 15000-17000 IU intramuscularly or subcutaneously as a prophylactic treatment, and foals up to 100 kg may receive 6500-8000 IU via either route. Horses affected by tetanus are preferably administered at least 50000 IU by any route (if the preparation allows) or by a combination of several routes. In clinical cases of tetanus, the treatment may be repeated daily depending on the effect observed. All recommended dosages provide passive protection, usually for as long as 1-3 weeks, depending on the species and the treatment performed. In addition to passive immunity, active vaccination, so-called passive-active immunity, should preferably be administered to the subject. This provides both short-term immunity (passive) and long-term humoral immunity (active). A secondary immunity emerges when the first immunity fades, thus avoiding a window of non-protection. Active immunity can be achieved using formulated tetanus toxoid. Such tetanus-based toxoid vaccines are commercially available.The toxoid-based vaccine can be administered simultaneously with the SDA-based antitoxin, preferably repeated within 21 days.

[0146] In a further aspect, the present invention relates to diagnostic tests for detecting TeNT or anti-TeNT antibodies, for example, in body fluids. Such diagnostic tests, for example aimed at the in vitro detection of toxins or anti-TeNT antibodies in human or animal blood, are currently very complicated and time-consuming. This must be carried out in light of, among other things, the fact that even very low levels of TeNT in blood are highly toxic, and as a result such tests must be very sensitive. The present invention relates to a method for detecting TeNT with a very high affinity (i.e., a low K D Provided herein are antigen binding proteins that exhibit a specific agonistic activity (a agonist activity value). Diagnostic tests based on such antigen binding proteins are naturally highly sensitive and therefore such antigen binding proteins are highly suitable for use in diagnostic tests.

[0147] As merely an example of such a test: in the classical sandwich ELISA test, well known in the art for decades, a 96-well plate, or a microwell plate, a lateral flow device carrier material, or even a chip, can be coated with one or more antigen-binding proteins according to the invention. Again, merely as an example, SDA SVT06 can be used in the coating step. Due to its excellent affinity properties, SDA SVT06 strongly binds even trace amounts of TeNT, if present. In a second step, the body fluid to be screened for the presence of TeNT can be added to the well. If TeNT is present, it binds to SDA SVT06. After a washing step, for example, conjugated SDA SVT15 can be added to the well. If TeNT is present in the body fluid and thus bound to SDA SVT06, the conjugated SDA SVT15 can bind to another epitope of the bound TeNT, and in a subsequent color development step, a color reaction takes place, thus revealing the presence of even trace amounts of TeNT.

[0148] Similarly, in tests for detecting antibodies against TeNT in body fluids, antigen-binding proteins capable of binding to TeNT according to the present invention are suitable. In such tests, the body fluid to be tested can be mixed with a small amount of toxin. If anti-TeNT antibodies are present, they will bind to the toxin. Afterwards (preferably after removal of the antibody-TeNT complex), the body fluid can be subjected to the above-mentioned sandwich ELISA to see if the toxin is still present. If so, this indicates that the body fluid does not contain anti-TeNT antibodies.

[0149] Similarly, in tests where the proteolytic cleavage activity of the TeNT L-chain is used to detect TeNT, which is captured using a receptor that binds to the TeNT H-chain, the SDAs capable of binding TeNT according to the present invention are suitable. At present, such binding-cleavage (BINACLE) assays are under development (Behrensdorf-Nicol et al., 2015, ALTEX 32, 137-142). The monovalent VHHs described above could serve as binding domains in such assays. The multivalent TeNT-binding SDAs SVT06-SVT16-SVA12 are even more preferred for such applications, since they show higher affinity and bind to two different TeNT antigenic sites, which increases the chance of binding only to the active form of TeNT.

[0150] Thus, yet another embodiment of the present invention relates to a diagnostic kit comprising an antigen-binding protein capable of binding to TeNT according to the present invention. Such a diagnostic kit may further comprise, for example, a 96-well plate, a microwell plate, or a chip pre-coated with one or more of the antigen-binding proteins capable of binding to TeNT according to the present invention. It may, for example, additionally or alternatively comprise, in conjugated form, one or more of the antigen-binding proteins capable of binding to TeNT according to the present invention. Such a diagnostic kit may further comprise instructions for carrying out a diagnostic test.

[0151] The present invention also relates to a diagnostic kit for detecting specific types of albumin in processed meat, e.g. minced beef. Such diagnostic kits aimed at detecting equine albumin in, e.g., minced meat in sausages, are currently very complicated and time-consuming. The present invention now provides an antigen-binding protein that exhibits high binding capacity for equine albumin. Thus, the present invention provides a method for detecting albumin, comprising: i) providing an SDA capable of binding to serum albumin, preferably having at least 70% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 40, 37, 38, 39, 41, and 42, with the proviso that the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%; ii) contacting the SDA of step i) with a test sample; iii) detecting possible binding between the SDA of step i) and albumin present in the sample of step ii); The present invention provides a method comprising:

[0152] The characteristics and definition of SDA in step i) are as described elsewhere herein. The sample in step ii) is preferably a sample containing processed meat, more preferably a sample suspected of containing meat from more than one species. The albumin detected is preferably equine albumin. The detection in step iii) can be performed using any method known in the art, such as ELISA, surface plasmon resonance, or isothermal titration calorimetry. The method is preferably an in vitro method. Thus, the present invention also relates to the use of SDA in step i) for detecting albumin.

[0153] As merely an example of such a test: in the classical sandwich ELISA test, well known in the art for decades, a 96-well plate, or a microwell plate, a sensor, or for example a microchip, can be coated with one or more antigen-binding proteins according to the invention. Also as merely an example, SDA SVA12, or SVA16 can be used in the coating step. Due to their very high binding properties, these SDAs capture albumin, if present, even in trace amounts. In a second step, minced meat dissolved in a liquid to be screened for the presence of albumin can be added to the wells. If albumin is present, it binds, for example, to SDA SVA12, or SVA16. After a washing step, conjugated SDA SVA06 or SVA07 can be added to the wells. If albumin is present in the body fluid and thus bound to SDA SVA12 or SVA16, the conjugated SDA SVA06 or SVA07 will bind to another epitope on albumin and in a subsequent color development step a color reaction will occur, thus revealing the presence of even minute amounts of albumin.

[0154] The present invention also relates to a biosensor platform for characterizing the affinity of, for example, equine monoclonal antibodies. Such a platform may use, for example, SDA SVG24L to capture equine Ig on a sensor or microchip, which can then be analyzed for interaction with a target protein.

[0155] It is highly preferred to use SDA at low concentrations, which should have rapid association with the toxin, yet be sufficiently delayed in dissociation from the toxin to prevent the toxin from exerting its activity, and be recirculatable in the (intoxicated) animal for an extended period of time (see Examples 16 and 22).

[0156] [Table 1] TIFF2024023268000002.tif105149

[0157] In this document and its claims, the verb "comprise" and its conjugations are used in their open-ended sense, meaning that items following the word are inclusive but not excluding items not specifically recited. Furthermore, referring to an element with the indefinite article "a" or "an" does not exclude the possibility that more than one element is present, unless the context clearly requires that one and only one element is present. The indefinite article "a" or "an" therefore normally means "at least one."

[0158] The word "about" or "approximately," when used in connection with a numerical value (e.g., about 10), preferably means that the numerical value may be 0.1% greater or less than the given numerical value (of 10).

[0159] All patents and literature references cited herein are hereby incorporated by reference in their entirety.

[0160] Unless otherwise stated, the practice of the present invention employs standard conventional techniques in molecular biology, virology, microbiology, or biochemistry. Such techniques are described in Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual (2nd Edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press; Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY; Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA, Vols. 1 and 2; Brown (1998) Molecular Biology LabFax, Second Edition, Academic Press (UK), Vols. I and II; Oligonucleotide Synthesis (N. Gait editor); Nucleic Acid Hybridization (Hames and Higgins eds.).

[0161] The following examples are offered for illustrative purposes only and are not intended to limit the scope of the present invention in any way. EXAMPLES

[0162] 1. Immunization of llamas and generation of a phage display library Llamas (no. 9236 and 9237) were immunized in the same manner. Commercially available tetanus vaccine (off-the-shelf type, based on tetanus toxoid) was injected intramuscularly without further adjuvant in the right thigh at 0, 21, and 42 days after primary immunization (DPI) at 1 ml per llama. A target antigen mixture was prepared consisting of 0.5 mg chrompure equine IgG (Jackson Immunoresearch Laboratories, West Grove, PA), 0.5 mg chrompure canine IgG (Jackson Immunoresearch Laboratories), 0.5 mg equine Alb (Rockland Immunochemicals, Limerick, PA), 0.5 mg canine Alb (Molecular Innovations, Novi, MI), and 8 μg recombinant tetanus toxin fragment C (rTTC; Reagent Proteins, San Diego, CA). In vitro experiments [5] suggested that fragment C (also named Hc or TTC) is involved in the binding of tetanus toxin to neurons. The antigen mixture was emulsified with Stimune adjuvant (Thermofisher Scientific, Lelystad, the Netherlands) and injected intramuscularly into the left thigh of each llama at 0 and 21 DPI. The same antigen mixture adjuvanted with IMS1312 adjuvant (Seppic, France) was injected intramuscularly into the left thigh of each llama at 42 DPI. Heparinized blood samples (150 ml) were obtained at 28 and 49 DPI, and peripheral blood lymphocytes (PBLs) were rapidly isolated. Blood samples for serum preparation were obtained at 0, 28, and 49 DPI.

[0163] Total RNA was extracted from PBLs using the RNeasy Maxi kit (Qiagen) and used for preparation of cDNA using dT18 priming and Superscript III reverse transcriptase (Invitrogen, Carlsbad, Calif.). Three PCRs specific for SDA were carried out using a mixture of primers BOLI192 (AACAGTTAAG CTTCCGCTTG CGGCCGCTAC TTCATTCGTT CCTGAGGAGA CGGT, SEQ ID NO:1), lam07 (AACAGTTAAG CTTCCGCTTG CGGCCGCGGA GCTGGGGTCT TCGCTGTGGT GCG, SEQ ID NO:2), and primers lam08 (AACAGTTAAG CTTCCGCTTG CGGCCGCTGG TTGTGGTTTT GGTGTCTTGG GTT, SEQ ID NO:3) and BOLI401 (AACAGTTAAG CTTCCGCTTG CGGCCGCTGG TTGTGGTTGT GGTATCTTGG GTT, SEQ ID NO:4), all three times in combination with primer VH2B (SEQ ID NO:64)

[45] . The resulting PCR fragment was digested with PstI and NotI and inserted into the phage display plasmid pRL144

[19] . The ligation was used to transform E. coli TG1 cells (Lucigen, Middleton, WI, USA) by electroporation, resulting in 12 libraries (designated pAL808 to pAL819).

[0164] 2. Production of cAb-TT2 single domain antibody in yeast A single domain antibody (SDA) cAb-TT2

[46] that binds tetanus holotoxin but not rTTC was produced in Saccharomyces cerevisiae for use in subsequent phage display selection of TeNT-binding SDAs. A synthetic gene encoding this SDA as a fusion to the yeast invertase signal sequence and 5'-leader was generated as a SacI-BstEII fragment. Insertion of the synthetic gene into plasmid pRL188 led to the production of SDA linked to a llama long hinge region containing a single cysteine ​​and a his6-tag [2]. Such an expression format is particularly suitable for immobilization of SDA to solid surfaces [3]. cAb-TT2 SDA was produced in Saccharomyces cerevisiae strain SU51 at a 150 ml scale, purified by immobilized metal affinity chromatography (IMAC), and a portion of the isolated SDA was biotinylated as previously described [3].

[0165] 3. Phage display selection of TeNT-binding SDAs The following reagents were used in the phage display selections: Yeast-produced cAb-TT2 is described in previous examples. Tetanus toxin-neutralizing mAb TT10 [47, 48] was purchased from the National Institute for Biological Standards and Regulation (NIBSC; Potters Bar, UK). Authentic tetanus holotoxin (TeNT) was purchased from List Biological Laboratories (Campbell, CA) and rTTC is described in Example 1.

[0166] The 12 libraries were used in phage rescue using the helper phage VCSM13, and phage display selection was performed as previously described

[49] , however, a modified procedure was used as follows: 96-well ELISA plates were used in selection rather than immunotubes.

[50] about 10 10 A smaller number of transducing units (TU) of phage were used in each panning. Trypsin was used for phage elution

[74] . Phage libraries of the three isotypes (hinge primers) were pooled.

[0167] Furthermore, selections were performed using a simultaneous phage ELISA to monitor the different panning procedures and to determine which panning tests should be used further.

[0168] The phage display library was screened in two rounds of phage display selection for SDA that bound directly coated TeNT or rTTC.

[0169] Further selections were performed with cAb-TT2 SDA or on TeNT captured with mAb TT10. Sometimes, different antigens were used in the second phage display round compared to the first round.

[0170] To detect soluble SDA present in 10-fold diluted E. coli culture supernatants binding to the directly coated antigen, ELISA utilizing mouse mAb anti-myc tag PO-conjugate for SDA detection was performed as previously described

[19] . However, TeNT and rTTC were coated at 1 μg / ml using PBS buffer, whereas cAb-TT2 was coated at 1 μg / ml in 50 mM carbonate / bicarbonate buffer (pH 9.6). Only absorbance values ​​of SDA clones that were ultimately expressed in yeast are reported.

[0171] To identify individual TeNT binders, eight 96-well plates were inoculated with individual clones from the second panning round and induced for production of soluble SDA in 96-well plates as previously described

[49] . Ten-fold dilutions of E. coli supernatants containing the different antigens and soluble SDA were used in ELISA. All clones were screened in ELISA on directly coated TeNT and rTTC, on cAb-TT2 captured TeNT.

[0172] Furthermore, to detect SDAs that inhibit the toxin-receptor interaction, all clones were screened in the GT1b-TeNT binding inhibition ELISA, which is best suited to compare the toxin-binding and neuronal binding blocking abilities of different SDAs, since it does not depend on, for example, biotinylation efficiency, accessibility of the epitope tag, and denaturation caused by the coating procedure.

[0173] GT1b-TeNT inhibition ELISA was performed according to [8]. 96-well polystyrene plates were coated with 10 μg / ml bovine brain-derived GT1b ganglioside (Sigma Aldrich, St Louis, MO) in methanol at 100 μl / well by overnight incubation at room temperature (RT). During the overnight incubation period, the methanol was completely evaporated. All subsequent incubations were performed for 1 h at RT in PBS containing 0.5% BSA and 0.05% Tween 20 after manual washing of the plates with PBS. 1 μg / ml TeNT (List Biological Laboratories) was preincubated with SDA, E. coli culture supernatant or mAb in separate 96-well polystyrene ELISA plates at 100 μl / well and incubated for 1 h at RT. 90 μl of these samples were then transferred to the GT1b-coated plates and incubated for 1 h at RT. Plates were then incubated with 100 μl / well of 1000-fold diluted llama 9237 serum (49 DPI). Bound llama IgG was detected with a goat anti-llama IgG-PO conjugate (Bethyl Laboratories, Montgomery, TX). Bound PO was detected by staining with TMB. The reaction was stopped with sulfuric acid and absorbance at 450 nm was measured using a spectrophotometer.

[0174] To determine the SDA (purified by streaking, single colony picked) sequence, DNA fragments for sequence analysis were obtained by PCR on E. coli TG1 cells using primers MPE25 (TTTCTGTATGGGGTTTTGCTA, SEQ ID NO: 6) and MPE26 (GGATAACAATTTCACACAGGA, SEQ ID NO: 7). Sequence analysis was performed using the BigDye Terminator v1.1 cycle sequencing kit and an automated ABI3130 DNA sequencer (Applied Biosystems, Nieuwerkerk a / d IJssel, The Netherlands). The purified PCR fragment was used as template in combination with primers MPE25 and RevSeq (TCACACAGGAAACAGCTATGAC, SEQ ID NO: 8). All sequences were determined from two reactions. All sequence interpretations were performed based on the translated SDA sequence. The PstI site used in SDA cloning overlaps amino acids 4 and 5 of mature SDA. Therefore, the sequence QVQ (amino acids 1-3), encoded by the phage display vector used, was added to the N-terminus of SDA. SDAs were aligned based on the IMGT numbering system

[51] of the mature SDA coding region ending with the sequence VTVSS. SDAs were classified into subfamilies as previously performed

[52] . Subfamily C represents conventional SDAs lacking the FR2 residues typical of SDAs. Such SDAs are often produced at low levels. SDAs designated subfamily 1, 2, and 3 represent three bona fide SDA subfamilies. Subfamily X represents unclassifiable SDAs. SDAs were also classified into CDR3 groups based on having identical CDR3 length and at least 65% sequence identity in CDR3. SDA sequences were also examined for the presence of potential N-glycosylation sites (Asn-X-Ser / Thr, where X is any amino acid except Pro). The clone selected for yeast expression lacked such N-glycosylation sites.

[0175] Table 2 shows 14 TeNT-binding SDA clones, starting with "SVT" followed by a number. Two SDAs, SVT02 and SVT03, selected on cAb-TT2 or mAb TT10-captured TeNT, respectively, did indeed bind to cAb-TT2-captured TeNT, but not to directly coated TeNT or rTTC, and did not inhibit the GT1b-TeNT interaction, since the measured absorption was comparable to that observed for E. coli culture supernatants that did not contain SDA (Table 2). These SDAs probably bind to TeNT epitopes whose conformation is affected by passive adsorption to polystyrene, causing a loss of antigenicity, as previously observed for other antigens [3, 53]. An additional 12 SDAs, 11 of which were selected on directly coated TeNT or rTTC, indeed bound both directly coated TeNT and entrapped TeNT and directly coated rTTC and also inhibited the TeNT-GT1b interaction (Table 2). Only three SDAs, SVT05, SVT06, and SVT08, showed partial inhibition of the GT1b-TeNT interaction, as their absorbance values ​​decreased from approximately 1.3 in the SDA-free sample to 0.72-0.99.

[0176] The sequences of the 14 SVT SDAs form seven CDR3 groups, represented by letters A to G (Figure 1). Clones from the same CDR3 group generally behave similarly in ELISA (Table 2). Twelve clones from CDR3 groups A, B, C, D, and G all inhibit the GT1b-TeNT interaction and bind directly coated TeNT and rTTC, as well as cAb-TT2 captured TeNT. Clones SVT02 and SVT03, which form CDR3 groups E and F, do not inhibit the GT1b-TeNT interaction and do not bind directly coated TeNT or rTTC, although they do bind cAb-TT2 captured TeNT. Several distinct sequence attributes have been observed for the various SDAs considered per CDR3 group. Four SDA clones derived from CDR3 group A and two SDA clones forming CDR3 group C contain Leu at IMGT position 123, which is associated with low production levels in yeast

[11] . Two SDA clones derived from CDR3 group C also have Lys120 and Ile122, which are typical of the J7 segment encoding FR4, which is associated with reduced SDA production levels in yeast

[11] . This suggests that these SDAs are more highly produced with the mutations K120Q, I122T, and L123Q.

[0177] All three SDA clones from CDR3 group B contain a rare insertion of the amino acid sequence VEDG at positions 50a-50d. This is located in the middle of the FR2 region adjacent to residue Arg50 (Kabat position 45), which is often described in the SDA literature as the most typical amino acid substitution in SDA. Conventional SDAs usually contain Leu at IMGT position 50, which makes hydrophobic contacts with the VL domain. SDAs almost always have Arg at IMGT position 50. This substitution makes the conventional VL interface more hydrophilic [1]. The insertion of hydrophilic residues D (Asp) and E (Glu) among the VEDG insertions also most likely makes the FR2 region more hydrophilic. The predicted isoelectric points (IEPs) of these clones are low, in part because of these acidic residues. Low IEPs are more frequently observed in SDA and are associated with increased solubility of SDA

[54] . The very long CDR2 and CDR3 regions are also noteworthy. Long CDR3s are extremely common in SDA [1, 52]. Long CDR2s are less common, presumably arising from somatic hypermutation

[55] .

[0178] Clones SVT13 and SVT22, which form CDR3 group D, have a Cys at IMGT position 55 and an additional Cys within CDR3 that is typical of SDAs of subfamily 3 and most likely forms an additional disulfide bond

[52] . Although the CDR3 sequences are clearly homologous, SVT13 and SVT22 are highly diverse and display 32 amino acid differences.

[0179] A single clone, SVT05, derived from CDR3 group G has a very long CDR2 of 17 residues (see above discussion for CDR3 group B) and a low IEP.

[0180] 4. Phage display selection of IgG-binding SDAs Phage display selection of IgG-binding SDAs was carried out essentially as described in the previous examples using directly coated IgG from dog or horse. To select SDAs that bind to both dog and horse IgG, a second round of panning was performed not only on IgG of the same species origin, but also on IgG from other species.

[0181] To identify individual IgG binders, six 96-well plates were inoculated with individual clones from the second panning round and soluble SDA production was induced in the 96-well plates

[49] . All clones were screened for binding to directly coated IgG, Fab, and Fc fragments of different species in an ELISA as previously described

[19] . Horse and dog IgG antigens are described in Example 1. Horse IgG Fc was obtained from Fitzgerald Industries (Tompkinsville, KY) and dog Fab from Rockland Immunochemicals.

[0182] Only the absorbance values ​​of the SDA clones that were also finally expressed in yeast are reported. For this purpose, IgG binding clones were preferentially selected that bind to both dog and horse, and preferably even more species of antigens, respectively. Furthermore, clones that bind to Fab fragments were preferentially selected. These SDAs are most suitable for therapeutic use, since interference with the binding to neonatal Fc (Brambell) receptors responsible for the half-life of IgG is not expected for Fab binding SDAs, and since they recognize multiple species, it is highly unlikely that allotypic IgG variation could result in failure to recognize IgG in a particular individual animal.

[0183] Table 3 shows eight IgG-binding SDA clones, starting with "SVG" followed by a number. The background absorbance value for horse IgG using E. coli culture supernatant without SDA was 0.26, significantly higher than the other IgG samples. This may suggest the binding of horse IgG to the peroxidase-conjugate used. The maximum absorbance in ELISA was also highly variable between the different SDAs, probably because the antigen used for coating was not a pure protein, but rather a mixture of different IgGs with different isotypes and different variable domains. SDAs SVG03 and SVG24 bind Fc fragments from horse, but not Fab fragments from dog or horse. SDA SVG23 binds only dog ​​IgG. SVG23 probably binds dog Fc, since it does not bind dog Fab. SVG03 binds IgG from horse, but not IgG from dog, human, pig, cow, or guinea pig. SVG24 binds dog, horse, and pig IgG, but not human, cow, or guinea pig IgG. Thus, the three Fc-specific SDAs also have species specificity. SDAs SVG06, SVG07, SVG13, SVG18, and SVG19 bind Fab fragments from dog and horse, but not horse Fc fragments. They bind IgG from all six species. Thus, the five Fab-specific SDAs also have fairly broad species specificity.

[0184] Sequence analysis was performed as described in the previous examples. The eight clones selected for in-yeast production (Figure 2) all belong to different CDR3 groups. All three SDAs bind Fab fragments of dog and horse IgG, and IgG from all six species tested. All three SDAs, as well as SVG06, are conventional SDAs (subfamily C). They all lack the substitution of Trp118 (residue 103 according to the Kabat numbering scheme) to a hydrophilic residue, often Lys, that is often observed for such SDAs

[56] . SVG13 additionally has a Lys at position 120 and a Leu at position 123, while SVG06 has a Glu at position 120 and a Leu at position 123 mutation, both of which are typical of the use of the J7 segment in FR4, which is associated with reduced levels of SDA production in yeast

[11] .

[0185] Most SDAs are similar to human VH3 family VHs. However, SVG07 is more similar to human VH4 family VHs. Such SDAs have been observed previously

[57] . For reference, two VH4 family SDAs isolated from camels (sdAb-31 and sdAb-32) are included in the SDA alignment (Figure 2). The amino acid sequences of FR1, FR2, and FR3 of SVG07 are identical to those of sdAb31 and / or sdAb32, and differ from the other SDAs at IMGT positions 9, 14, 16, 17, 18, 20, 22, 24, 25, 39, 42, 45, 53, 54, 68, 69, 71, 74, 77, 82, 83, 86, 87, 92, 94, and 95.

[0186] 5. Phage display selection of Alb-binding SDAs Phage display selection of Alb-binding SDAs was carried out essentially as described in the previous examples using directly coated Albs of dog or horse origin as described in Example 1. To select for SDAs that bind to both dog and horse Albs, a second round of panning was carried out on Albs of the same species origin as well as on Albs of other species.

[0187] To identify individual Alb binders, two 96-well plates were inoculated with individual clones from the second panning round and induced for production of soluble SDA in 96-well plates

[49] . All clones were screened for binding to directly coated dog, horse, and human Alb in an ELISA as previously described

[19] . Human Alb was obtained from a commercial supplier (Jackson Immunoresearch Laboratories).

[0188] Only the absorbance values ​​of the SDA clones that were also finally expressed in yeast are shown. For this purpose, Alb-binding clones that bind to both canine and equine antigens, respectively, were preferentially selected. Table 4 shows six Alb-binding clones, starting with "SVA" followed by a number. None of the SDAs bind to human Alb. All SDAs bind to equine Alb. SDA SVA07 does not bind to canine Alb, while SDAs SVA02, SVA04, SVA06, SVA12, and SVA16 do indeed bind to canine Alb. Thus, five SDAs were obtained that bind to both canine and equine Alb.

[0189] Sequence analysis was performed as described in the previous examples. The six clones selected for production in yeast (Figure 3) all belong to different CDR3 groups. They are all bona fide SDAs of subfamily 1

[52] . They all lack specific protein sequence features, such as long insertions, or FR4 residues associated with reduced SDA production in yeast

[11] .

[0190] 6. Production of novel SDA isolated by phage display in yeast Fourteen SVT SDAs (Table 2), eight SVG SDAs (Table 3), and six SVA SDAs (Table 4) were generated by secretory yeast expression. For this purpose, the SDA coding regions were amplified by PCR from phage display plasmids (Examples 3-5), then cut with PstI and BstEII and ligated with a similarly cut pUR4585 plasmid. pUR4585 is a yeast-E. coli shuttle vector suitable for the expression of SDAs fused C-terminally to c-myc and his6 tags. SDAs generated in this manner are designated by the suffix "L". Plasmids derived from pUR4585 that code for such SDAs are designated by the name of the SDA added to the suffix "L" and the prefix "p". In addition, three mutant SVT SDAs were generated with mutations in the FR4 region that increase the level of production in yeast (see Example 3 and

[11] ): SDA SVT15L-3FW4M is a derivative of SVT15L containing the mutations K120Q, I122T, and L123Q SDA SVT20L-L123Q is a derivative of SVT20L containing the mutation L123Q SDA SVT34L-L123Q is a derivative of SVT34L containing the mutation L123Q

[0191] These mutations were introduced by generating synthetic PstI-BstEII fragments containing these mutations and subsequent insertion into plasmid pUR4585. The BstEII site used for subcloning is a highly conserved site in FR4, but is missing in some SDAs. This is the case for SVT16, SVT20, SVT25, and SVT34. This site was therefore non-expressively introduced into these four authentic SDAs, as well as SVT20L-L123Q and SVT34L-L123Q, by generating synthetic PstI-BstEII fragments and subsequent insertion into pUR4585. For all yeast expression plasmids, sequence verification was performed as described in Example 3, but using purified plasmid DNA as template in combination with primers BOLI166 (ATGATGCTTTTGCAAGCCTTC, SEQ ID NO: 9) and BOLI188 (TTCAGATCCTCTTCTGAGATGAG, SEQ ID NO: 10). The pUR4585-derived plasmid encoding SVT29 encoded a non-representative A to G mutation at position 60 after the PstI site (CCTGTCGAGCCTACG (SEQ ID NO:11) to CCTGTCGGGCCTACG (SEQ ID NO:12)), but was ignored because it was non-representative.

[0192] Plasmids derived from pUR4585 were introduced into Saccharomyces cerevisiae strain W303-1a (ATCC no. 208352; MATa, ade2-1, ura3-1, his3-11, trp1-1, leu2-3, leu2-112, can1-100) by selecting for the auxotrophic leu2 marker. Plasmids pSVT13L, pSVT15L, pSVT20L, and pSVT34L were also introduced into strain SU51, which is more commonly used for the production of SDA [19, 58]. Yeast cultures for the production of SDA and purification of SDA from culture supernatants by IMAC were performed as previously described [19, 58]. Purified SDA was concentrated and buffer exchanged into phosphate-buffered saline (PBS) by using Amicon Ultra 3 kDa molecular weight cutoff centrifugal concentration devices (Millipore, Bedford, MA). SDA concentration was determined using a Biorad (Hercules, CA) protein assay and bovine IgG standards. From these stocks, samples were biotinylated with sulfo-NHS-LC-biotin (Pierce, Rockford, IL) at a protein to biotin weight ratio of 5. Mouse mAb, horse and dog Alb and IgG, and TeNT were similarly biotinylated.

[0193] Based on the yield of SDA after purification, the production levels of SDA secreted by yeast per liter of culture volume were also determined (Table 5). SDA was primarily produced in S. cerevisiae strain W303-1a, but to compare the in-yeast production levels, the four SVT SDAs were also produced in strain SU51

[58] . The increase in production levels using strain SU51 varied from 2.5-fold to 13.6-fold depending on the nature of the SDA. Mutant SDA containing various FR4 mutations were produced at levels 2.6-fold to 5.2-fold higher than wild-type SDA (Table 5), consistent with previous findings

[11] .

[0194] The low production level of SVG07L, 0.15 mg / L, may be related to the similarity of this SDA to the SDAs of the human VH4 gene family. Conventional SDAs (subfamily C in Table 5) were previously suggested to produce at low levels

[61] . However, three conventional SDAs, SVG06L, SVG13L, and SVG19L, produce at reasonably high levels of at least 1.59 mg / L (Table 5).

[0195] 7. Antigen binding of SVA SDA produced in yeast The binding of SVA SDA to Alb from different species was analyzed by ELISA by coating the antigen onto plates and detecting it mainly with unlabeled SDA while utilizing the myc tag for SDA detection. ELISA was performed essentially as described in Example 3. Purified serum albumin was coated at a concentration of 5 μg / ml. The source of horse and dog Alb was described in Example 1. Bovine Alb and chicken ovalbumin were obtained from Sigma Aldrich, human albumin from Jackson Immunoresearch Laboratories, and mouse, sheep, and porcine albumin from Antibodies Online (Beijing, CN). Feline albumin was captured on plates coated with immunoaffinity-adsorbed goat anti-feline Alb IgG (Antibodies Online) diluted 1:1000 from normal feline serum diluted 1:500 (Agrisera Antibodies, Vannas, Sweden). Plates were then incubated with a two-fold dilution series of SDA across 12 wells starting at an SDA concentration of 1 μg / ml. SDA was detected using 0.5 μg / ml of anti-myc clone 9E10 mAb peroxidase conjugate (Roche Applied Science). Absorbance data was evaluated using an Excel® spreadsheet template (Microsoft Corporation, Redmond, USA) to calculate maximum A450 values. A four-parameter logistic curve was fitted to the absorbance and SDA concentration to interpolate the effective concentration (EC), resulting in an absorbance value of 0.2 for each SDA in each ELISA.

[0196] Negative controls with no antigen coated, no SDA, or non-specific SDA (SVT06L) all yielded values ​​below 0.15 (Table 6). Absorbance values ​​above 0.15 were considered to indicate Alb binding. Clones SVA12L and SVA16L bind horse and dog Alb with high (>1) absorbance values. SVA12L also binds porcine Alb with high absorbance values ​​and feline Alb with lower absorbance values. Feline Alb was captured from normal serum using coated polyclonal antibodies. The observed lower absorbance values ​​do not necessarily indicate that the antibody binds feline Alb less efficiently compared to Alb from other species. Indeed, in Example 18 (Table 28), it is clear that SVA12L and SVA06L bind feline Alb (commercially available) with very similar affinities. Furthermore, SVA12L and SVA06L were found to bind to horse and dog Alb with similar affinities (Example 18). Competitive assays (ELISA) revealed that SVA06L and SVA12L recognized different epitopes (data not shown).

[0197] Both SVA12L and SVA16L have low SDA titers of about 10 ng / ml in ELISA. SVA02L, SVA04L, SVA06L, and SVA07L also bind to some Alb species, but often with lower absorbance values ​​and higher SDA titers than SVA12L and SVA16L. SVA02L and SVA06L also bind to mouse Alb.

[0198] None of the SDAs bind to human, ovine, bovine, or chicken Alb. The ELISA binding of the SVA SDA produced in yeast is consistent with that of the corresponding SDA produced in E. coli (Example 5; Table 4), with one important exception: clone SVA04L does not bind to canine Alb, while its E. coli produced counterpart bound to canine Alb with a high absorbance value of 1.533. This may be because the E. coli produced clones are not monoclonal, but rather represent a mixture of two clones producing different SDAs. The results based on the SDA produced in yeast are more reliable because it is clonal and has been more thoroughly tested as an SDA dilution series rather than in single wells.

[0199] Clone SVA12L was selected for the development of multimeric SDA because it binds to both equine, canine, porcine, and feline Alb and is efficiently produced in yeast (3.85 mg / L using strain W303-1a) (see Examples 14, 15, 16, 17, and 18). SVA12L does not bind to mouse Alb in ELISA and is therefore unlikely to achieve half-life extension in mice (Example 17). SVA06L is a suitable candidate for SDA half-life extension in mice.

[0200] 8. Antigen binding of SVG SDA produced in yeast The binding of eight yeast-produced SVG SDAs to IgG of different species origin and several species of antibody fragments Fab, F(ab')2, and Fc was analyzed as described in the previous examples. The sources of several IgGs and their fragments are described in Example 4. Mouse, feline, ovine, bovine, and guinea pig gamma globulin (GG) and horse F(ab')2 fragments were obtained from Jackson Immunoresearch Laboratories. Canine Fc fragments were obtained from Rockland Immunochemicals. The results are shown in Table 7. Three ELISAs contained relatively high backgrounds (Table 7, footnote b), possibly due to cross-reaction of mouse anti-myc mAb PO-conjugate with coated antigen. Therefore, background was subtracted for the absorbance values ​​in these ELISAs (Table 7, footnote b). If the background-subtracted absorbance value was greater than 0.2, it was considered to indicate antigen binding.

[0201] The ELISA binding of SVG SDA produced in yeast is consistent with that of the corresponding SDA produced in E. coli (Example 4), with two exceptions. First, the SDA produced in yeast SVG07L only binds dog IgG, whereas the corresponding SDA produced in E. coli bound IgG of all species analyzed. This can probably be partially explained by the arbitrary cutoff value of A450=0.2 chosen for binding being too high. Second, the clone produced in yeast SVG24L does not bind porcine IgG, whereas its counterpart produced in E. coli did. This could also be due to the arbitrary cutoff value of A450=0.2 chosen for binding being too high. Alternatively, the binding of such clones produced in E. coli could also be due to the fact that these clones are not monoclonal. Such artifacts are not possible for SDA produced in yeast. Thus, the ELISA binding data of SDA produced in yeast is more reliable.

[0202] SDA SVG06L and SVG13L bind to Fab fragments and IgG of all species analyzed except chicken, with background subtracted absorbance values ​​above 0.2, which is interpreted as indicating antigen binding. Most other SDAs have absorbance values ​​below 0.08 in this ELISA, so the absorbance value of 0.164 for SVG13 on chicken IgG likely represents binding to chicken IgG. SDA SVG19L shows considerable sequence similarity to SDA SVG13L (Example 4) and a similar binding pattern to SVG13L, but does not bind to mouse, sheep, and pig IgG, with absorbance values ​​above background of 0.2. SVG03L is specific for horse Fc, and SVG23L is specific for dog Fc fragments. SVG24L primarily recognizes horse and dog Fc.

[0203] SDA SVG13L is most suitable for the development of multimeric SDA since it binds Fab and IgG from all species analyzed and is produced well (even without optimization) in yeast (1.6 mg / L).

[0204] SDA SVG06L also binds Fab and IgG from all species analyzed except chicken and is also produced well (even without optimization) in yeast (1.8 mg / L), making it also suitable for the development of multimeric SDAs.

[0205] 9. Species specificity of IgG-binding SDA The binding in ELISA of four previously isolated porcine IgG-binding SDAs (VI-clones)

[19] to IgG from various species was compared with SDA SVG13L, which reacts with IgG from most species. ELISA was performed as described in Example 8. The results (Table 8) show that SDA VI-4L, VI-8L, VI-11L, and VI-14L do not bind bovine, feline, canine, murine, or human IgG. They probably bind to ovine IgG, since the maximum absorption is slightly increased above the background without SDA. SDA VI-11L also binds to equine IgG. However, in all cases, SVG13L gives significantly higher absorption values ​​for IgG from all species except for porcine IgG, where, conversely, all VI clones give higher absorption values ​​than SVG13L.

[0206] 10. Antigen binding of SVT SDA produced in yeast In a manner similar to that described for SVA and SVG SDA, several yeast-produced SDAs and six anti-TeNT mAbs were analyzed for antigen binding in ELISA. The anti-TeNT mAbs were obtained from different suppliers. Information provided by the suppliers regarding their origin and neutralization of TeNT in mouse bioassays or antigen binding in Western blots is listed in Table 9. Some of these mAbs were biotinylated as described in Example 6.

[0207] The binding of unlabeled SDA or mAb to directly coated TeNT, rTTC, or polystyrene plates not coated with antigen, and to TeNT captured by passively adsorbed cAb-TT2 SDA was analyzed. See Examples 1 and 3 for such antigen coating procedures. These plates were then incubated with a dilution series of unlabeled SDA or mAb and further processed as described in Example 7, but using a 2000-fold diluted rabbit anti-mouse immunoglobulin PO conjugate (Dako, Glostrup, Denmark) to detect mouse mAb, and without the incremental addition of SDA on rTTC-coated plates. Furthermore, the binding of biotinylated SDA or mAb to directly coated TeNT and cAb-TT2-captured TeNT was analyzed in a similar manner, using 0.5 μg / ml streptavidin-PO conjugate (Jackson Immunoresearch Laboratories) to detect SDA. Finally, inhibition of the GT1b-TeNT interaction by unlabeled SDA or mAbs was analyzed as described in Example 3 using a two-fold dilution series of SDA or mAbs across 11 wells, starting at a concentration of 1 μg / ml for SDA or 10 μg / ml for mAb.

[0208] The results are shown in Table 10. Plates without specific TeNT antigen coating had absorbance values ​​below 0.07. In the ELISA with the control SDA SVA12L, absorbance values ​​were also up to 0.155 (directly coated TeNT and biotinylated SDA or mAb) or 0.072 (other ELISAs), except for the GT1b-TeNT inhibition ELISA. Thus, absorbance values ​​above 0.2 indicate antigen binding. ELISAs with biotinylated SDA or mAb on directly coated TeNT or captured TeNT were generally consistent with similar ELISAs using unlabeled SDA or mAb. None of the biotinylated SDA or mAb were negative in the ELISA, whereas their unlabeled counterparts were positive. This indicates that biotinylation does not abolish antigen binding. In many cases, biotinylated SDAs resulted in slightly higher absorbance values ​​in the captured TeNT (e.g., three SDAs in CDR3 group B, SVT06L, SVT08L, and SVT31L). Notable exceptions were mAbs B417M and 11n185, which generally resulted in lower absorbance values ​​and >50-fold higher EC when biotinylated, suggesting that biotinylation was less effective or affected antigen binding by these mAbs. In the case of mAb B417M, the presence of 0.5% HSA as a stabilizer may have reduced its biotinylation efficiency.

[0209] In general, the ELISA binding of SVT SDAs produced in yeast is consistent with that of their counterparts produced in E. coli (Example 3; Table 2). As previously noted in Example 3, all SDAs bind to rTTC, with the exception of SVT02L and SVT03L. As previously noted, the failure to detect binding of SVT02 and SVT03 to rTTC may be due to the direct coating of rTTC, since these SDAs also failed to bind directly coated TeNT, whereas they did indeed bind captured TeNT. Furthermore, as previously observed, the three SDAs in CDR3 group B, SVT06L, SVT08L, and SVT31L, as well as SVT05L, only partially inhibit the TeNT-GT1b interaction, with a minimum absorbance value of about 0.5 and a relatively high EC value. Furthermore, as previously observed, the SDA SVT03L does not inhibit the TeNT-GT1b interaction. However, the yeast-produced clone SVT02L also showed partial TeNT-GT1b inhibition with an EC value of >1000 ng / ml, whereas its E. coli-produced counterpart showed no inhibition at all. This difference could simply be due to the use of an excessively low SDA concentration, which in the case of E. coli-produced SDA was used by diluting E. coli supernatants with unknown SDA concentrations 10-fold. Binding of biotinylated yeast-produced SVT03L to directly coated TeNT was observed only at the highest concentration of SDA analyzed, which was also not observed previously and could equally be explained by the higher SDA concentrations used (see Example 11).

[0210] The three mutant SDAs, SVT15L, SVT20L, and SVT34L, have similar maximum absorbance and EC values ​​to their wild-type counterparts in ELISAs using biotinylated SDA and in GT1b-TeNT inhibition ELISAs, suggesting that the framework 4 mutations introduced to increase antigen binding do not affect TeNT binding. Here, EC values ​​are the 50% inhibition of TeNT-GT1b inhibition (IC 50 ) is determined at the absorption value corresponding to IC 50The values ​​ranged from 34 to 986 ng / ml. Clones derived from CDR3 group B had higher IC than clones derived from CDR3 groups A, C, and D (34 to 133 ng / ml). 50 The IC values ​​of clones derived from the same CDR3 group are shown (317-986ng / ml). 50 The values ​​differ by a factor of up to four. Six mAbs were included in the analysis. mAb 11n185 was selected because it binds to the TeNT light chain. An additional five mAbs were selected because they neutralize TeNT in a mouse bioassay. The mAbs bind in different ELISAs as follows: 1. mAbs 14F5 and 6F55, similar to SVT02L and SVT03L, bind less efficiently to directly coated TeNT compared to captured TeNT.

[0211] 2. Only mAbs 6E7 and 6F57 inhibited the TeNT-GT1b interaction in ELISA. Both had almost the same IC 50 It has a significantly higher IC50 than

[0212] 3. While most SDA binds to rTTC, only two of the six mAbs bind to rTTC, suggesting that the neutralization of TeNT by the three mAbs is not based on inhibition of the TeNT-GT1b interaction.

[0213] 11. SDA characterized for binding to TeNT fragment C (rTTC binding) Two SDAs (SVT02L and SVT03L) did not bind to directly coated TeNT, and therefore their binding to directly coated fragment C (rTTC) of TeNT (also named Hc or TTC) was inconclusive regarding the specificity of the particles (Example 10). It is possible that passive adsorption abolished antigen binding. The binding of these SDAs to rTTC captured with mAb6E7 was therefore analyzed as described in Example 10. Six wells of a 96-well plate were coated with TeNT (0.75 μg / ml) and 18 wells with mAb6E7 (1 μg / ml). Six mAb6E7-coated wells were subsequently incubated with 2 μg / ml rTTC and six further wells with 0.75 μg / ml TeNT, while the remaining six wells coated with mAb6E7 were incubated with ELISA buffer (negative control). Six SDAs were then incubated in four wells coated with different antigens at a SDA concentration of 2 μg / ml. Bound SDA was detected by incubation with anti-mycMAb PO-conjugate. The results (Table 11) show: The negative control SVA12L and the mAb6E7 coating without captured antigen are negative (absorbance <0.07).

[0214] Capture of TeNT or rTTC with mAb6E7 or direct coating of TeNT is successful as detected by SVT16L (high absorption) and SVT15-3FW4M (lower absorption).

[0215] SVT02L and SVT03L are functional as they bind to captured TeNT.

[0216] SVT03L does bind to directly coated TeNT, albeit with a lower A450 than entrapped TeNT, whereas SVT02L does not bind to directly coated TeNT at all.

[0217] SVT02L and SVT03L do not bind to rTTC captured with mAb6E7, because they recognize antigenic sites different from those of mAb6E7 (Example 13), and this is not due to the use of mAb6E7 for capture.

[0218] Thus, SVT02L and SVT03L bind to a portion of TeNT that is distinct from that present in rTTC, an observation consistent with the inability of these SDAs to inhibit the TeNT-GT1b interaction (Example 10).

[0219] 12. Western blot analysis of TeNT binding in SVT SDA Binding of SVT clones to TeNT light or heavy chains was analyzed by Western blotting as previously performed

[19] , using 2.5 μg of authentic TeNT per gel, and 0.5 μg / ml of biotinylated SDA (Example 6) and 0.1 μg / ml of streptavidin PO conjugate (Jackson Immunoresearch Laboratories) for immunoblotting (Figure 4). SDA SVA12L was used as a negative control. Most SDAs did not show binding to either light or heavy chains in Western blots. This could be due to such SDAs recognizing conformational epitopes. However, SDA SVT06 and SVT08 bind to a polypeptide of about 100 kDa that must correspond to the TeNT heavy chain. These clones belong to the same CDR3 group (group B) and recognize the same antigenic site (Table 12). Both SDAs also bind to rTTC derived heavy chains (Tables 2 and 10). Thus, the binding of SDAs SVT06 and SVT08 to the TeNT heavy chain in Western blots is consistent with previous observations.

[0220] 13. Mapping of tetanus toxin antigen by SDA (SVT) The antigenic sites of SVT SDA and six anti-TeNT mAbs were mapped by blocking / competition ELISA using biotinylated SDA and mAbs. When possible, two representatives of each CDR3 group were used for this purpose. SDA was shown to be highly potent in the TeNT-GT1b interaction due to its IC 50 The selection was mainly based on the absorption value. However, SVT29L produced in yeast was only 0.07 mg / L and was therefore replaced by SVT15L-3FW4M. A competition / blocking ELISA was performed using an ELISA procedure similar to that described in the previous examples, but using 0.5 μg / ml TeNT for direct coating. The biotinylated SDA or mAb concentration that gave the near-maximal absorbance value was used, and this SDA or mAb was competed and blocked by using 5 μg / ml of various unlabeled SDA or mAbs. TeNT-coated plates were first incubated with unlabeled SDA or mAb in 90 μl / well for 30 min (blocking step). Then 10 μl of 50 μg / ml biotinylated SDA or mAb was added and incubated for another 30 min (competition step). In the case of biotinylated SVT02 and SVT04, cAb-TT2 was used to capture TeNT, since these SDAs only bind captured TeNT, but not directly coated TeNT. In all other cases, directly coated antigen was used. Controls with no antigen coating and no biotinylated SDA were included. The % inhibition of antigen binding due to SDA competition / blocking was then calculated as 100-100 x ([A450 with competing SDA or mAb]-[A450 without Ag coating]) / ([A450 without competing SDA or mAb]-[A450 without Ag coating]). All SDAs and mAbs blocked the binding of their biotinylated counterparts by at least 75%, suggesting that the assay was valid.

[0221] At least five independent antigenic sites, represented by letters A to E, were identified (Tables 12 and 13). As expected, SDAs derived from the same CDR3 group are always part of the same antigenic site. SVT02L, mAb14F5, and mAb6F55 form antigenic site A. These three SDAs or mAbs also show other similar characteristics in other ELISAs. Most notably, they bind more efficiently to captured TeNT compared to directly coated TeNT, suggesting that the binding is highly dependent on the correct TeNT tertiary structure. SVT03L is a single SDA that forms antigenic site B. SVT15L and its mutant derivative SVT15L-3FW4M form antigenic site C. SVT06L, SVT08L, mAb6E7, and mAb6F57 form antigenic site D. These SDAs are expected to be less dependent on the correct conformation of the antigenic site, since they also bind TeNT in Western blots (Example 12).

[0222] Consistent with this notion, no partial competition by clones derived from other antigenic sites occurs for these four SDAs or mAbs. SDAs SVT13, SVT16, SVT22, and SVT34, representing two CDR3 groups, form antigenic site E. The results for the SVT clones are summarized in Table 12. In general, the results are consistent with the general notion of the Ag specificity of SDA and the antigenic structure of TeNT: SDAs with the same CDR3 group are classified into the same antigenic site. SDA or mAbs to the same antigenic site show similar antigen binding specificity: SDA or mAbs in antigenic site A bind conformationally sensitive epitopes, as they show reduced binding upon direct coating of TeNT. SDA in antigenic site D binds to TeNT Hc in Western blots.

[0223] Both SDAs and mAbs directed to antigenic sites C, D, and E inhibit the TeNT-GT1b interaction, whereas SDAs or mAbs directed to antigenic sites A and B do not.

[0224] Either SDA or mAbs that inhibit the TeNT-GT1b interaction bind to rTTC.

[0225] It is noteworthy that clone SVT02 is now shown to bind to the same antigenic site as two mAbs reported to neutralize TeNT in mouse bioassays. This strongly suggests that SVT02, although it did not inhibit the TeNT-GT1b interaction, may still neutralize TeNT. TeNT-neutralizing mAbs that do not inhibit GT1b interaction have been described previously

[68] . Similarly, clones SVT06 and SVT08 likely neutralize TeNT because they compete with the two neutralizing mAbs (Example 17). Clone SVT06 was produced at a higher level and is therefore the most suitable for further study. The SDAs derived from antigenic sites C and E do not compete with either of the neutralizing mAbs. However, these SDAs do inhibit the TeNT-GT1b interaction. Thus, it is likely that these SDAs neutralize TeNT, although this has not yet been demonstrated in an in vivo assay (Example 17). SDAs SVT02L, SVT06L, SVT15L-3FW4M, and SVT16L are therefore recommended building blocks for generating multimeric SDAs (Table 13).

[0226] 14. Production of multimeric SDA in yeast To increase the level of SDA production, multimeric SDAs were generated by creating stable MIRY integrants in the yeast strain SU50

[70] using plasmid pRL44

[69] . Such MIRY integrants have an average of 5-fold increased production levels of SDA compared to the 2 micron-based plasmid. Twelve plasmids were generated encoding multimeric SDAs consisting of fusions of TeNT-linked SVT-SDA with Alb-linked SVA12SDA (5 plasmids), IgG-linked SVG06SDA (2 plasmids), or IgG-linked SVG13SDA (5 plasmids) (Table 14). The elements from which these multimeric SDAs were created are as follows: GS3: (G4S)3 linker, previously described

[27] GS2: (G4S)2 linker derived from the pRL144 plasmid

[19] H6: Similar to pRL188, it contains a his6 tag, a double stop codon, and a HindIII site [2]. SVG06M4: SVG06 with four mutations: Q1E, Q5V, E120Q, L123Q SVG13M4: SVG13 with four mutations: Q1E, Q5V, K120Q, and L123Q SVA12M2: SVA12 with two mutations: Q1E, Q5V SVT15-3FW4M: SVT15 without the internal SacI site and with three mutations: K120Q, I122T, L123Q SVT16-L123Q: SVT16 with a non-expressing restored BstEII site and the L123Q mutation A synthetic SacI-HindIII fragment was generated and then subcloned into plasmid pRL44 using the SacI and HindIII sites

[69] , resulting in plasmids pRL482 to pRL501 (Table 14).

[0227] Baker's yeast strain SU50 (MATa; cir°; leu2-3,-112; his4-519; can1;

[70] ) was transformed by electroporation with HpaI-linearized plasmids pRL482 to pRL501

[71] , and leu+ auxotrophs were selected. Single colony-purified transformants were induced at a 0.5 L scale in shaker flasks for SDA expression, and SDA was purified from culture supernatants by IMAC

[58] . SDA was then further purified by cation exchange chromatography on an SP Sepharose column as previously described

[44] , with minor modifications. SP Sepharose Fast Flow (GE Healthcare, Piscataway, NJ) and 25 mM sodium acetate, pH 4.7 buffer were used to bind SDA to the column. Bound SDA was eluted using a step gradient of 0.1, 0.2, 0.4, 0.6, 0.8, and 1M NaCl in binding buffer. Bound SDA typically eluted between 0.4 and 0.8M NaCl (Table 14). It was concentrated using a 3 kDa molecular weight cutoff centrifugal concentration device and buffer exchanged into PBS. SDA concentration was determined using the bicinchoninic acid assay (BCA, Pierce catalog number 23212) and bovine serum albumin standard (Thermo Scientific, Rockford, IL). Based on the SDA yield after purification, the production level of multimeric SDA in yeast was calculated (Table 14).

[0228] Monomeric and multimeric SDA were analyzed by reducing SDS PAGE using NuPage Novex 4%-12% Bis-Tris gels with MOPS running buffer (Invitrogen) and stained with Gelcode Blue reagent (Thermo Scientific). In contrast to multimeric SDA, monomeric SDA contains a myc tag in addition to the his6 tag. Monomeric SDA containing the myc tag yielded an additional molecule with a molecular mass approximately 2 kDa higher that was not observed for most multimeric SDA lacking the myc tag (Figure 5A and 5B). This additional molecule likely corresponds to partial O-glycosylation dependent on the presence of the myc tag. Such molecules have been observed previously

[44] . In addition to this putative O-glycosylated variant, SVT15-3FW4M SDA produces a molecule with a molecular mass approximately 2 kDa lower that likely corresponds to degraded SDA (Figure 5B).

[0229] SDS PAGE analysis of two examples of multimeric SDA containing SVG06M4 reveals a double band at the position of SDA2 (Figure 5A), which is not observed in multimeric SDA containing SVA12M2 or SVG13M4 SDA (Figure 5B). Since this SDA is always located at the C-terminus of multimeric SDA, degradation at the C-terminus of SVG06M4 is highly likely. This may be due to the introduction of mutations E120Q and L123Q at the C-terminus of SVG06M4 in multimeric SDA, which means the loss of the his6 tag in such SDA. Since SDA was first purified by IMAC, this means that such degradation occurred after IMAC purification.

[0230] All of the multimeric SDAs containing SVG13M4 and SVA12M2 migrated to the expected positions based on their predicted molecular masses (Figure 5B). Monomeric SVG13L SDA migrated slightly faster than SVA12L SDA, consistent with SVA12L having a molecular weight approximately 1 kDa lower. Such a pattern is also seen when comparing multimeric SDAs containing SVG13L and SVA12L, which are composed of two (SDA2) or three (SDA3) SDA domains.

[0231] 15. Bispecific or bivalent antigen binding of multimeric SDA The target antigen binding capacity of some of the various multimeric yeast-produced SDAs was specifically evaluated in ELISA. A control of monovalent SDA, which forms the building block of these multimeric SDAs, was included. ELISAs were essentially performed as described in previous examples. Seven different ELISAs were performed (Tables 15 and 16). The GT1b-TeNT inhibition ELISA was already described in Examples 3 and 10. Three additional ELISAs, in which both anti-his tag mAb and polyclonal anti-SDA serum were used for SDA detection, served to measure the binding of monovalent SDA to passively adsorbed TeNT (0.75 μg / ml), Alb (5 μg / ml), or IgG (5 μg / ml). To measure bispecific or bivalent TeNT binding to TeNT and IgG or Alb, TeNT and horse Alb were also biotinylated using sulfo-NHS-LC-biotin (Pierce, Rockford, IL) with a protein to biotin weight ratio of 5 as previously described

[72] . They were used in three ELISAs to measure: Bispecific binding to coated dog IgG or Alb (5 μg / ml) and biotinylated TeNT (0.25 μg / ml) Bispecific binding to TeNT (0.75 μg / ml) captured with passively adsorbed cAb-TT2 (1 μg / ml) and biotinylated horse Alb (1 μg / ml) Bivalent binding to coated TeNT (0.75 μg / ml) and biotinylated TeNT (0.25 μg / ml)

[0232] Polystyrene 96-well plates were coated overnight at 4° C. with 100 μl / well of the required antigens dissolved in either PBS (TeNT) or 50 mM NaHCO3, pH 9.2 (all additional antigens). All subsequent incubations were performed after washing the plates with 100 μl / well in ELISA buffer (1% skim milk; 0.05% Tween 20; 0.5 M NaCl; 2.7 mM KCl; 2.8 mM KH2PO4; 8.1 mM Na2HPO4; pH 7.4) for 1 h at RT. The cAb-TT2 coated plates were then incubated with TeNT in ELISA buffer. The plates were then incubated with a 2-fold SDA dilution series across 12 wells, starting with an SDA concentration of 1 μg / ml. In some ELISAs, bound SDA was detected directly using anti-his6 clone BMG-his-1 MAb PO conjugate (hisPO; Roche Applied Science) diluted 1:1000 or goat anti-llama Ig PO conjugate (GALPO; Bethyl Laboratories) diluted 1:10,000. In other ELISAs, plates containing bound SDA were incubated with biotinylated TeNT or biotinylated horse Alb. Biotinylated antigen was then detected with 0.5 μg / ml streptavidin PO conjugate (StrepPO; Jackson Immunoresearch Laboratories). Bound PO was then detected by staining with 3,3',5,5' tetramethylbenzidine. After stopping the reaction by the addition of 0.5 M sulfuric acid (50 μl per well), absorbance at 450 nm was measured using a spectrophotometer. Absorption data was evaluated using an Excel spreadsheet template (Microsoft Corporation, Redmond, USA), which was used to calculate maximum A450 values. A four-parameter logistic curve was fitted to the absorption and SDA concentration using appropriate computer software.This curve was used to interpolate the effective concentration (EC), resulting in a specific absorbance value for each SDA in each ELISA. The exact absorbance values ​​used in the interpolation of SDA concentrations (see Table 14) varied between different ELISAs, depending on the background absorbance value in the absence of SDA, and the maximum absorbance values ​​observed for the different SDAs. The results of the various ELISAs are presented both in terms of the maximum absorbance reached (minimum absorbance in the case of the TeNT-GT1b inhibition ELISA; Table 15) and the effective concentration of SDA (Table 16). From these ELISAs the following can be concluded: GT1b-TeNT inhibition ELISA shows that SVT02-containing SDA, as well as monomeric SVA and SVG SDA, do not inhibit, whereas all further monomeric and multimeric SDAs do, consistent with previous observations with monomeric SDAs SVT06L, SVT15L, and SVT16L (Example 10).

[0233] ELISA with TeNT and biotin-TeNT has high maximum absorbance values ​​of 1.63 and 1.72 for the multimeric SDA as expected, but lower absorbance values ​​of up to 1.12 for some bispecific multimeric SDAs, and slightly increased absorbance values ​​of up to 0.35 for some monomeric SDAs (which is unexpected). The background absorbance is about 0.14. There may be bridging due to IgG or Alb present in the milk and used as blocking agents. Nevertheless, these results suggest bivalent TeNT binding by the two bivalent SDAs and bispecific SDA.

[0234] As previously observed, multimeric SDA containing the SVT02 SDA domain never binds directly coated TeNT.

[0235] In an ELISA using TeNT captured with cAb-TT2 and biotinylated horse Alb, all multimeric SDAs containing SVA12 SDA did indeed bind, including SVT02-GS2-SVA12M2-H6, which did not bind monomeric SVA12L SDA or directly coated TeNT.

[0236] SVT15-3FW4M SDA and SVT15-3FW4M-GS2-SVG06M4-H6 SDA appear to be inefficiently recognized by the anti-his6MAb PO-conjugate, but are well detected using GALPO or in the GT1b-TeNT inhibition ELISA, consistent with the C-terminal proteolysis of the his6 tag also observed by SDS-PAGE (Example 14).

[0237] SVT02-GS2-SVG06M4-H6 (Example 14) showed degradation in SDS-PAGE (which may suggest that the his6 tag was lost from most SDA molecules), which could explain the low absorbance value in ELISA on dog IgG using anti-his6 mAb for SDA detection. In the case of this particular bispecific SDA, SVT02 does not bind directly coated TeNT or inhibit in GT1b-TeNT ELISA, so this cannot be confirmed by demonstrating binding to TeNT using GALPO or in GT1b-TeNT inhibition ELISA.

[0238] As demonstrated by ELISA using dog IgG or dog Alb coated TeNT and biotinylated TeNT, all multimeric SDA including SVT02-GS2-SVG06M4-H6 and SVT15-3FW4M-GS2-SVG06M4-H6 bind to TeNT and either Alb or IgG. Monomeric SDA shows no binding in these ELISAs.

[0239] STV02-GS2-SVG13M4-H6 gives a maximum absorbance value of 0.18 in dog IgG, which is considerably lower than other multimeric SDA containing SVG13M4, but is comparable to the value of 0.16 for monomeric SVG13L and clearly exceeds the background value of 0.05-0.06 observed for nonspecific monomeric SVT-SDA. This suggests that STV02-GS2-SVG13M4-H6 binds to dog IgG. This is confirmed by the higher absorbance value when biotinylated TeNT is used to detect STV02-GS2-SVG13M4-H6 bound to a plate coated with dog IgG.

[0240] Taken together, all multimeric SDAs show dual specific binding to TeNT and either IgG or Alb, but some SDAs do not show strong binding in specific ELISA because they do not directly bind to coated TeNT (SVT02-containing SDA), or because they do not inhibit the GT1b-TeNT interaction (SVT02-containing SDA), or because they have lost the C-terminal his-tag (SVT02-GS2-SVG06M4-H6, and SVT15-3FW4M-GS2-SVG06M4-H6).

[0241] To confirm the bispecific / bivalent nature of the multimeric SDA, a second completely different assay system was used. Biolayer Interferometry (BLI) was used as the analytical technique to measure the interaction between TeNT (holotoxin), albumin (horse), and several SDAs. BLI is an optical technique that analyzes the interference pattern of light waves reflected from two surfaces. Changes in the number of molecules bound to the biosensor cause a spectral shift in the interference wavelength pattern, which is measured (in real time) and reported as a nanometer (nm) shift. The Octet® platform thereby provides a means to obtain precise information about the rate of biomolecular complex formation between SDA and the target antigen. An Octet Red96 instrument (ForteBio) was equipped with a streptavidin (SAX) biosensor. For the measurements, 10 μg / ml of biotinylated TeNT (bio-T, Table 17a) or biotinylated equine albumin (bio-Ah, Table 17b), referred to as ligands, were coupled to the SAX sensor for 10 min. The sensor (loaded with the respective target antigen) was transferred into a solution containing the specific SDA (monomeric or multimeric) at 100 nM and the interaction was measured for 4 min. In the next step, the sensor (now bound to monomeric or multimeric SDA) was transferred into the solution and reacted with the second analyte, either unlabeled toxin (TeNT, 100 nM) or equine albumin (Ah, 100 nM), for 5 min. The interaction (nm shift) between the sensor and the analyte was monitored again. The results were analyzed and Tables 17a and 17b below show the results for the different SDAs (monomeric and multimeric).

[0242] From the results it can be concluded that: The SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 exhibits bivalent binding to two TeNT-TeNT molecules.

[0243] The SDAs SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 and SVT06-GS2-SVA12M2-H6 show bispecific binding towards TeNT and equine albumin in two different test configurations.

[0244] SVT16-L123Q-GS2-SVG13M4-H6 and SVT16L were able to bind to TeNT.

[0245] SVT16-L123Q-GS2-SVG13M4-H6 and SVG13L were unable to interact with equine albumin, as expected.

[0246] 16. Analysis of Multimeric SDA Serum Half-Life in Pigs Several in vitro assays (Examples 4, 5, 7, 8, 9, 15, and 18) with monomeric and polymeric SDAs demonstrated that these SDAs are capable of binding to blood components of several species (e.g., horse, dog, cat, and pig). Animal studies were performed on some of the SDAs to evaluate their in vivo characteristics in terms of serum half-life extension. Since the SDAs were generated using only horse and dog proteins, the animal studies were performed on pigs to be truly xenogeneic. For this purpose, 24 piglets of about 6 weeks of age, 12 males and 12 females, were used. They were weighed 10 days before inoculation with the polymeric SDA and allocated into 4 groups of 6 piglets each with equal distribution of sex, preferably equal average body weight, and preferably equal distribution of piglets based on sow origin. The groups (Table 18) are designated by the name of the plasmid (pRL489, pRL490, pRL495, and pRL499) encoding the bispecific SDA that was injected intramuscularly. Three piglets (two males and one female) in group pRL489 also received a second bispecific SDA encoded by plasmid pRL276, called M8ggsVI4q6e

[44] . This bispecific SDA contains the same IgG-binding SDA domain as SDA2 K609ggsVI-4q6e, a different fused SDA domain that was previously used to measure half-life

[19] but is specific for a foot and mouth disease virus (FMDV) antigen.

[0247] Piglets were weighed one day prior to SDA inoculation (day -1). Based on these weights, the dosage of multimeric SDA was calculated (Table 18). Dosages increased from 0.2, 0.3 to 0.5 mg / kg per group. Filter-sterilized SDA diluted in PBS was injected intramuscularly at a single site in the hind thigh in a volume of approximately 5 ml. Blood samples for serum preparation were collected from the jugular vein immediately prior to SDA inoculation and on days 1, 2, 4, 8, 11, 14, 21, and 28 after SDA inoculation. Piglet weights were also determined at the end of the experiment on day 28 to correct for serum half-life for animal growth.

[0248] SDA levels in serum were measured by ELISA using TeNT holotoxin or FMDV and anti-tag MAb PO-conjugate. For this purpose, 96-well polystyrene plates were coated overnight at 4°C with 100 μl / well of TeNT holotoxin at 2 μg / ml in PBS or with SDA M23F[2] specific for FMDV O1 manisa dissolved in coating buffer (50 mM NaHCO3, pH 9.2 buffer). After washing the plates with buffer, all subsequent incubations were performed for 1 h at RT. M23F-coated plates were subsequently incubated with 5 μg / ml of FMDV O1 manisa 146S in ELISA buffer. Next, plates were incubated with 2-fold dilution series of SDA across 8 wells, 2 series, and 5-fold dilutions of piglet serum starting from the concentration of both SDA standards at 1 μg / ml and 0.1 μg / ml. Sera from piglets inoculated with SVT06 or SVT16-containing multimeric SDA were incubated on TeNT-coated plates, while serum from piglets inoculated with M8ggsVI4q6e was incubated on FMDV-coated plates. TeNT-coated plates were subsequently incubated with anti-his6 mAb-PO conjugates, and FMDV-coated plates with anti-myc MAb-PO conjugates. Bound PO was then detected by staining with 3,3',5,5' tetramethylbenzidine. After stopping the reaction by adding 0.5 M sulfuric acid, the absorbance at 450 nm was measured using a spectrophotometer. A four-parameter logistic curve was fitted to the absorbance of the standards and the SDA concentration. This curve was used to interpolate the SDA concentration, resulting in specific absorbance values ​​for each serum sample in each ELISA. The calculated serum SDA concentrations were exported to an Excel spreadsheet template (Microsoft Corporation, Redmond, USA).

[0249] The piglet weights increased by approximately 10 kg to approximately 25 kg during the 4 weeks of serum collection. Weight gain during serum half-life measurements was corrected as follows: For each piglet, the weight gain per hour was assumed to depend on the initial weight, using the formula BW(t) = BW(0). * T t (T=10 (log10(BW(t) / BW(0)) / t) where t is time (hours), BW(t) is the weight at time t, BW(0) is the weight at time 0, and T is the weight gain per hour.

[0250] This allows the calculation of the factor T from the piglet weights on days -1 and 28. At intermediate time points between days -1 and 28, the factor T t The VHH concentrations were corrected for weight gain by multiplying the measured VHH concentrations with

[0251] The terminal serum half-life was calculated based on the following formula: SDA(t) = SDA(0) * (0.5 (t / T1 / 2β) ), where t is time (hours), SDA(0) is the SDA concentration at the first time point used (corrected for weight gain in the half-life calculation), SDA(t) is the SDA concentration at time t, and T 1 / 2 β is the terminal half-life.

[0252] Day 28 samples contained lower levels of SDA as evidenced by absorbance values ​​that were often less than three times the background absorbance, and these data were therefore excluded from the analysis. Serum half-lives were calculated from samples from days 4 to 21. For each individual piglet, the Solver function in Microsoft Excel was used to fit SDA concentrations against time based on the above formula. 1 / 2 The mean and standard deviation of β were then calculated.

[0253] The biodistribution volume in humans of intravenously injected IgG is 60 ml / kg body weight according to reference

[73] . Therefore, the initial (days 1-2) concentration of SDA in the blood is expected to be slightly lower than 1 / 0.06 = 16.67 times the injected dose, since most of the SDA is initially in the blood. This fits well for the three Alb-binding SDAs and the control SDA M8ggsVI-4q6e, which have initial SDA concentrations above 2 mg / L (Figure 6), but are quite low for SVT16-L123Q-GS2-SVG13M4-H6, consistent with its short half-life.

[0254] T of SDA starting from day 4 (96 hours) 1 / 2 β (including weight correction) was calculated and summarized in Table 18. 1 / 2 β is the previously measured T of K609ggsVI-4q6e 1 / 2 β is lower than that of β

[19] . This may be due to the different fused SDAs or differences between the two animal studies.

[0255] All three Alb-binding multimeric SDAs had T ranging from 111 to 135 hours. 1 / 2 The 82-hour T of the positive control SDA M8ggsVI-4q6e was significantly higher than that of the control SDA M8ggsVI-4q6e, and the standard deviation was small. 1 / 2 β. All three of these multimeric SDAs contained the Alb-binding SDA domain SVA12M2 fused to either SVT06, SVT16-L123Q, or to both of these SVT SDA domains to form the multimeric SDA. Apparently, the half-life provided by SVA12M2 is not affected by the specific SVT SDA fused to it, nor by the number of SDAs fused to it.

[0256] T of SVT16-L123Q-GS2-SVG13M4-H6 containing SVG13 SDA targeting IgG 1 / 2 The beta is only 20 hours long. 1 / 2 β does not bind to serum proteins and has a T 1 / 2The T of Alb-binding multimeric SDA was significantly increased compared to the control monomeric SDA K609ggsK812

[19] , suggesting that a half-life extension occurred. Nevertheless, this is not a significant difference from the control monomeric SDA K609ggsK812

[19] , which is a significant difference from the control monomeric SDA K609ggsK812

[20] . 1 / 2 β. In ELISA, SVG13L bound to porcine IgG, resulting in lower maximum absorbance values ​​and lower EC values ​​for porcine IgG when compared to feline, equine, canine, and human IgG (Table 8). This suggests that SVG13L binds to IgGs other than porcine IgG with higher affinity, thus resulting in a longer serum half-life in these species.

[0257] The affinity of SVA12L for horse, dog, and cat albumin ranged from 10 to 270 nM, and was approximately 159 nM for porcine albumin (Example 18). Thus, a similar, or even better, serum half-life of SVA12 can be expected in vivo in horses, dogs, and cats when included in multimeric SDA.

[0258] The positive control M8ggsVI-4q6e contains the SDA domain VI-4, as does VI-4L (Example 9). SDA VI-4L, VI8L, VI11L, and VI14L have affinities (K D ) [19,44]. SDA SVG13 showed comparable EC values ​​for equine, canine, and feline IgG, as did SDA VI4L, VI8L, VI11L, and VI14L for porcine IgG (Table 8). Thus, similar serum half-lives for SVG13 can be expected in vivo in equine, canine, and feline species.

[0259] 17. Analysis of SDA for tetanus toxin neutralization capacity in a mouse model In vitro assays (Examples 3, 10, 11, 12, 13, 15, and 18) were performed with monomeric and multimeric SVT-based SDAs, demonstrating that these SDAs can effectively bind tetanus holotoxin in several experimental test configurations. To evaluate the in vivo characteristics of some of these SDAs, animal studies were performed to evaluate their tetanus toxin neutralization ability. Six candidate SDA samples (see Table 19) were tested for anti-tetanus toxin potency using a mouse toxin neutralization test. One monomeric SDA (SVT03L), four bispecific SDAs (SVT02-GS2-SVG13M4-H6, SVT06-GS2-SVG13M4-H6, SVT153FW4M-GS2-SVG13M4-H6, SVT16L123Q-GS2-SVG13M4-H6), and one bispecific (against albumin and tetanus) and bivalent (against tetanus toxin) SDA (SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6) were evaluated in the mouse toxin neutralization test (TNT) according to a method similar to that described in the European Pharmacopoeia monograph 0091 for tetanus antitoxin. To accurately determine the neutralization endpoint of SDA, the assay was performed using a higher sensitivity level than the method described in Ph Eur monograph 0091, allowing the detection of lower amounts of toxin-neutralizing antibodies. The tetanus toxin (NIBSC:AWX4664, diluted 1 / 100) dose level of the assay performed was Lp / 200. In each test, a reference tetanus antitoxin TE3 (prediluted 1 / 400 to 0.025 IU / ml in the first dilution) was included (4 mice per group) to allow the determination of potency for each test sample. Each time, a fixed volume of 0.35 ml of toxin was mixed with 2.15 ml of prediluted SDA test sample and left for 30 minutes before injection into the mouse (0.5 ml sc, left thigh). Each prediluted sample was serially diluted with buffer to generate a 2-fold or 4-fold dilution series. Each SDA dilution had n=4 mice. The animals were observed for 96 hours for signs of tetanus paralysis. In each assay, the reference TE3 was diluted (2-fold or 4-fold) in buffer.Female NIH mice, 16-20 g, 5-6 weeks old, were used in each test (1, 2, and 3). A total of three tests were performed consecutively.

[0260] In Test 1, SDA samples were diluted so that the starting concentration of each SDA in the assay mixture was 1000 nM for all candidates except SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 (the amount in the mixture was 100 nM). Each candidate was then serially diluted to generate a two-fold dilution series consisting of 5 or 6 dilutions in total (see Table 19). Each dilution was mixed with a fixed amount of tetanus toxoid and left for 30 minutes before being injected into mice (0.5 ml sc, left thigh). Each dilution group had n=4 mice. Animals were observed for 96 hours for signs of tetanus paralysis. The percentage of mice protected at each dilution is shown in Table 19.

[0261] For SDA SVT02-GS2-SVG13M4-H6, SVT03L, and SVT16-L123Q-GS2-SVG13M4-H6, no in vivo tetanus toxin neutralizing effect was observed at the 1000 nM level.

[0262] The SDAs SVT06-GS2-SVG13M4-H6 and SVT15-3FW4M-GS2-SVG13M4-H6 both provided protection at concentrations of 1000 nM and 500 nM, and both SDAs were able to efficiently neutralize tetanus toxin when tested in this in vivo model.

[0263] SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 SDA provided complete protection at all 6 dilutions. Despite being administered at a 10-fold lower concentration, this bivalent (i.e., against TeNT) SDA was more potent than all other bispecific SDAs. Furthermore, SVA12L SDA fused to the bifusion SVT SDA (SVT06-GS3-SVT16-L123Q) does not bind mouse albumin (in vitro). Thus, this multimeric SDA neutralizes tetanus toxin very efficiently within the incubation time of 30 minutes set. Based on the concentration of the reference antitoxin TE3 (prediluted 1 / 400 to 0.025 IU / ml at the first dilution) at the endpoint (halfway between dilution steps 2 and 3), the potency of each test sample can be expressed in IU / ml. Note that if the endpoint was not obtained, efficacy is expressed as < (0% protection at all dilutions) or > (100% protection at all dilutions). The data are shown in Table 20.

[0264] The endpoint for the reference antitoxin was midway between dilutions 2 and 3 = 1.3 ml of assay mixture (0.0325 IU in assay mixture). For the unknown sample, at the endpoint there was 0.0325 IU in the assay mixture = 0.0325 IU in 2.15 ml = 0.0151 IU / ml. This number can then be multiplied by the respective total dilution factor of the SDA involved.

[0265] The trivalent SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 has the highest potency of all samples tested (protection at concentrations below 3.1 nM). It is the trivalent SDA with one SDA (SVA12) among three linked SDAs that binds to albumin in several species. The other two SDAs (SVT06 and SVT16) bind with high affinity (low K D The tetanus toxin binds at a 3′-terminal (3′-terminal) domain, and each binds to a different domain (Examples 13, 15, 18).

[0266] Afterwards, another TNT had to be performed to determine the protection endpoint for SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 (Test 2). Furthermore, it has been described in the literature [7,42] that mixing mouse monoclonal antibodies targeting different epitopes can exert a synergistic effect on the neutralization level of tetanus toxin. A similar effect was observed for scFvs able to neutralize tetanus toxin

[67] . Other sources

[24] published that bivalent anti-tetanus toxin nanobodies do not achieve a strong improvement in efficacy when compared to the monomeric form. Therefore, furthermore, in this second test, it was evaluated whether combinations of these different multimeric SDAs, when mixed together in solution, show a stronger toxin neutralization effect (synergistic effect) than when tested alone. See Table 21 for the tested scheme. The assay was carried out as described above.

[0267] The results of the second mouse toxin neutralization test are shown in Tables 22a, 22b, and 23. The endpoint for the reference antitoxin was the same as in Test 1, with the midpoint of dilutions 2 and 3 in the assay mixture = 1.3 ml (0.0325 IU in assay mixture). Therefore, the same potency calculations (based on the relevant concentrations at the initial dilution) as those shown in Test 1 are applied to Group 7 (single SDA). Since the relative contribution of each SDA is unknown when using SDA combinations, it is not possible to provide an estimate for the potency of each SDA in the mixture. However, the potency of the mixture can be described as the lowest concentration (nM) at which the SDA mixture provided 100% protection (Table 22b).

[0268] The multimeric SDAs SVT15-3FW4M-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6, when mixed with SVT06-GS2-SVG13M4-H6 at 62.5 nM (groups 1 and 3), provided at least >125-fold higher levels of protection than when SVT06-GS2-SVG13M4-H6 was tested as a single molecule (500 nM) (final concentration of both SDAs was 3.91 nM overall), thus demonstrating clear evidence of a strong synergistic effect between these SDAs (see Table 21a+Table 21b).

[0269] Mice in group 5 were not protected, indicating that no synergistic effect was found for SVT15-3FW4M-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6 in this mixture at these concentrations of relevant SDA.

[0270] SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 again achieved full protection at all dilutions. The final dilution where full protection was found had an SDA amount equal to 0.2 nM (Table 23). The potency of this SDA is therefore >1478 IU / mg.

[0271] From the data of study 2, it cannot be excluded that the SDAs SVT02-GS2-SVG13M4-H6 and SVT03L may have a synergistic effect, since the synergistic effect of the other SDAs in the mixture is present alone in the final dilution. However, the final concentrations of the individual SDAs SVT15-3FW4M-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6 in groups 2 and 4 were 1 / 2 lower than the final concentrations of the same SDAs in groups 1 and 3 when mixed with SVT06-GS2-SVG13M4-H6. Complete protection was found at the lowest concentration (0.97 nM in the final dilution step). A third study was then performed to determine the efficacy endpoint of the candidate SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 (see Table 24 below). In this study, it was decided to perform a 4-fold dilution step by step. Furthermore, this group was also included to investigate whether the single multimeric SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 alone was more potent than the two SDA SVT06-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6 molecules mixed and similarly diluted.

[0272] To investigate whether SVT15-3FW4M-GS2-SVG13M4-H6 further increases the efficacy of the single SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, a mixture of both was also tested in another group.

[0273] In study 3, the endpoint for the reference antitoxin (TE-3) was slightly different from the endpoints obtained in studies 1 and 2, with only 75% of the animals protected at dilution 2 (Table 24). Using the Spearman-Karber method to calculate the 50% protective dose, the concentration of antitoxin at the endpoint is calculated as 0.034 IU in the assay mixture (in stages 1 and 2, the endpoint for the reference was the midpoint of dilutions 2 and 3 = 0.0325 IU in the assay mixture).

[0274] For SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, which was tested separately, the endpoint was dilution 1 (50% of the animals were protected) and dilution 1 contains 0.034 IU in the assay mixture (=0.034 IU in 2.15 ml of test sample, i.e. 0.0158 IU / ml). The neutralization titer can be calculated by multiplying the total dilution factor corresponding to the sample by the concentration of antitoxin at the endpoint, as shown in Table 25.

[0275] A very high tetanus toxin neutralizing capacity was again confirmed for SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6. The potency of the master stock for this particular multimeric SDA was calculated from the results of this particular assay as 11,474 IU / ml (equivalent to more than 1500 IU per mg of protein). In a separate assay using smaller dilution steps from 0.2 nM onwards, the neutralizing capacity of this SDA can be determined even more accurately.

[0276] Notably, SVA12L does not bind to mouse Alb and is therefore unlikely to confer an extended half-life in mice or contribute to efficacy measurements following its administration to mice (Example 7).

[0277] Evidence of a synergistic effect when combining SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 with SVT15-3FW4M-GS2-SVG13M4-H6 was demonstrated at 0.4 nM total SDA achieving full protection.

[0278] No protection was observed in this assay for the candidate combinations SVT06-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6. Therefore, based on the above results, it can be concluded that the total concentration of this pair of SDAs required to provide full protection ranges from 0.4 to 4 nM, with 0.2 to 2 nM or less for each individual SDA in the mixture.

[0279] Thus, from the three studies performed, it can be seen that the single bivalent and bispecific multimeric SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 achieves a very high level of protection against the highly potent tetanus toxin. Moreover, it is superior to the strong synergistic effect observed after mixing two single bispecific SDAs SVT06-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6. SVG13L SDA was found to bind to mouse IgG (Example 8) which may contribute to the efficacy of these bispecific SDAs after the mixture was administered to mice. The bivalent bispecific SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 has a higher potency as a single molecule than the super-synergistic tetanus toxin neutralizing properties of the mixture, which is a remarkable property.

[0280] 18. Determine the affinity of different SDAs for TeNT, albumin, and immunoglobulins Several SDAs were tested for their target (TeNT, albumin, and immunoglobulins of different species) binding properties. Tetanus toxin binding properties are particularly important in the ability of each SVT SDA to neutralize tetanus toxin in vivo (Example 17). Once fused to the SVT SDA, SVA and SVG SDAs help to extend the final serum half-life of the SVT SDA. Thus, binding properties for different blood components [19, 22, 23, 25] are important for SVA and SVG SDA. For veterinary purposes, it is also important to address species differences between such blood components. In the case of certain cross-species disease targets (e.g., tetanus), it is preferable to use a single SDA for therapeutic applications targeting several species, instead of developing individual therapeutic SDAs for each species.

[0281] Here, Biolayer Interferometry (BLI) technology was used to measure the interactions between TeNT, different species of albumin, and different species of immunoglobulins, as well as several monomeric and polymeric SDA. BLI is an optical analysis technique that analyzes the interference pattern between waves of light. Changes in the number of molecules (analytes) bound to the biosensor (coated with ligands) cause a spectral shift (nm shift) in the interference wavelength pattern (=signal) that is measured in real time. D is the affinity constant or equilibrium dissociation constant, which is a measure of how tightly a ligand binds to its analyte. It represents the ratio of the association rate to the dissociation rate, k a and k dis It can be calculated using K D is expressed in molar units (M). D K corresponds to the concentration of analyte at which, at equilibrium, 50% of the ligand binding sites are occupied, or the concentration at which the number of analyte-bound ligand molecules is equal to the number of analyte-free ligand molecules. D There is an inverse correlation between affinity and affinity, with a smaller affinity constant indicating a tighter interaction or a stronger affinity of the analyte for the ligand.

[0282] To measure the interaction between the target and SDA, an Octet Red 96 instrument (Pall Life Sciences) was equipped with a streptavidin (SA / SAX), Anti-Penta-HI (HIS1K), or e.g. Ni-NTA (NTA) Dip and Read™ biosensor (ForteBio).

[0283] To determine the binding affinity of SDA to tetanus toxin, 2 μg / ml of biotinylated (see Example 3) TeNT was coupled to the SA sensor. SDA was incubated in PBS buffer (PBS10×Fischer Scientific, cat. no. 233362500) containing 0.02% Tween 20 (ACROS ORGANICS, cat. no. 233362500). The antibodies were diluted in BP399-1 and WFI (Hyclone, Cat. No. SH3022110) (PBS Tween) as a two-fold dilution series ranging from 100 nM to 1.56 nM (SVT02-GS2-SVG13M4-H6, SVT03L, SVT15-3FW4M-GS2-SVG13M4-H6, and SVT16L123Q-GS2-SVG13M4-H6) or as a two-fold dilution series ranging from 10 nM to 0.156 nM (SVT06-GS2-SVG13M4-H6, SVT06-GS2-SVA12M2-H6, and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6). The SDA dilution series was incubated with the TeNT-coupled sensor for 5 min (100 nM starting concentration) or 10 min (10 nM starting concentration) followed by an additional dissociation step in PBS-Tween for 10 min (SVT02-GS2-SVG13M4-H6, SVT03L, SVT15-3FW4M-GS2-SVG13M4-H6, and SVT16L123Q-GS2-SVG13M4-H6) or 60 min (SVT06-GS2-SVG13M4-H6, SVT06-GS2-SVA12M2-H6, and SVT06-GS3-SVT16-L123Q-SVA1212M2-H6).

[0284] To determine the binding affinity of the SDAs SVT06L, SVT15L, and SVT16L for tetanus toxin, 5 μg / ml of each biotinylated SDA was coupled to the SA sensor, and tetanus toxin (two-fold dilution series from 75 nM to 4.69 nM) was incubated with the SDA-coupled sensor for 5 min, followed by a dissociation step in PBS-Tween for an additional 30 min.

[0285] The results were then analyzed using ForteBio data analysis software to calculate affinity constants (K D , k diss / k a ) was determined. Table 27 shows the affinity data for several purified SDA.

[0286] Bispecific and monomeric SDAs (SVT02-GS2-SVG13M4-H6, SVT06-GS2-SVG13M4-H6, SVT06-GS2-SVA12M2-H6, SVT15-3FW4M-GS2-SVG13M4-H6, SVT06L, SVT15L, SVT16L, SVT16L123Q-GS2-SVA12M2-H6, SVT16L123Q-GS2-SVG13M4-H6) bound TeNT with subnanomolar to picomolar affinity, a feature important for the neutralizing ability of TeNT. The rapid association and extremely slow dissociation of SVT-based SDAs prevents the toxin from exerting its activity in a rapid and prolonged manner at the low toxin concentrations typically found in toxin-injected animals.

[0287] In particular, the stability of the complex of tetanus toxin and SDA is important, as it prevents, for example, uptake of the toxin in neurons. Very low dissociation (Kdis) values ​​were found for SDA SVT03L, SVT15-3FW4M-GS2-SVG13M4-H6, SVT06-GS3-SVT15-3FW4M-GS2-SVG06M4-H6, and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6.

[0288] Three of these four fragment C-linked SDAs (SVT06-GS2-SVG13M4-H6, SVT15-3FW4M-GS2-SVG13M4-H6, and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6) demonstrated superior toxin-neutralizing properties when tested in vivo in TNT as single SDAs (at <4 μg / ml and <30 ng / ml levels) and mixed together (at <30 ng / ml levels, see Example 17).

[0289] The avidity (K) of three SDAs containing two SVT domains (SVT06-GS3-SVT02-GS2-SVG06M4-H6, SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6) for TeNT D ) is in the picomolar range. For SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, the measured avidity was 13 picomolar, and this SDA showed excellent tetanus toxin neutralizing properties in an in vivo toxin neutralization model (Example 17).

[0290] This SDA has an affinity that is approximately 10-fold higher (low K ) than that of a comparable monomeric SDA or of a multimeric VHH containing only one corresponding TeNT-binding SDA domain (SVT06 or SVT16). D values), suggesting that both SDA domains present in SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 have the ability to bind antigen simultaneously.

[0291] To determine the binding affinity of SDA to serum albumin, several assays were performed. First, 1.0 (SVA06L) or 1.5 (SVA12L, SVA16L) micrograms / ml of SDA was coupled to a Ni-NTA sensor (loading time 15 min). For SVA06L, horse, dog, or feline albumin was added as analyte in a two-fold dilution series from 76.9 nM to 4.81 nM (horse, dog, or feline albumin). For SVA12L, a two-fold dilution series from 307.7 nM to 19.2 nM (horse or canine albumin) or from 615.4 nM to 38.5 nM (feline albumin) was used. For SVA16L, a two-fold dilution series from 100 nM to 3.1 nM (horse, dog, and feline albumin) was used. Albumin was reacted on the SDA (SVA06L, and SVA12L) coated sensors for 1 min followed by a dissociation step in PBSTween for an additional 2 min, except for SVA16L, where the interval was 3 and 5 min, respectively.

[0292] To determine the affinity of SVA12L for porcine albumin, a two-fold dilution series from 250 to 15.6 nM was used, with a 1 min association and dissociation step.

[0293] The results were then analyzed using ForteBio data analysis software. Table 28 shows the data for the SDAs tested.

[0294] Several SDAs that bind to the Fc portion of horse or dog immunoglobulin were also tested for their binding properties. First, a 0.5 μg / ml SDA coupled to NTA sensor configuration was used to determine the affinity of SDA SVG03L, SVG23L, and SVG24L when bound to horse IgG (Fc) (Fitzgerald, Cat. No. 31C-CH0804). Scouting assays showed that SVG23L did not bind to the horse Fc protein used. For SDA SVG03L, horse IgG (Fc) was diluted in a two-fold dilution series from 50 nM to 3.13 nM in PBS Tween. For SDA SVG24L, horse IgG (Fc) was diluted in a two-fold dilution series from 100 nM to 6.25 nM in PBS Tween. The Fc dilution series was incubated with the SDA coupled sensor for 3 min (association step) followed by a 10 min dissociation step in PBSTween.

[0295] To determine the affinity of SDA SVG03L, SVG23L, and SVG24L for binding to dog IgG (Fc) (Rockland, Cat. No. 004-0103), a 1 μg / ml SDA coupled to NTA sensor configuration was used. Scouting assays showed that SVG03L did not bind to the dog Fc protein used. For SDA SVG23L, dog IgG (Fc) was diluted in a two-fold dilution series from 40 nM to 2.5 nM in PBS Tween. For SDA SVG24L, dog IgG (Fc) was diluted in a two-fold dilution series from 400 nM to 18.80 nM in PBS Tween. The Fc dilution series was incubated with the SDA coupled sensor for 70-100 seconds (association step), followed by a dissociation step in PBS Tween for 5 minutes.

[0296] The results were then analyzed using ForteBio data analysis software. Table 35 shows the data for SDAs tested against the Fc portion of horse or dog immunoglobulin.

[0297] Because albumin and immunoglobulins are abundant serum proteins, the affinity of SDA for albumin or immunoglobulins does not need to be very high for most SDA molecules to bind to this target. Consistent with this concept, it has been observed that the extension of serum half-life of protein therapeutics using engineered bacterial albumin binding domains is largely independent of affinity for albumin. D When values ​​were lower than 100 nM (increased binding affinity), serum half-life was not affected by affinity. D Serum half-life decreased slightly only when values ​​approached 1 μM [36,37].

[0298] For SDAs SVA06L, SVA12L, and SVA16L, the affinity for albumin of porcine, equine, canine, or feline origin varied from 1 to 275 nM, all less than 1000 nM. For the multimeric SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, a serum half-life of approximately 110 to 145 hours was estimated in young pigs. At 21 days after administration, SDAs SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 (0.3 mg / kg), SVT06-GS2-SVA12M2-H6 (0.2 mg / kg), and SVT16-L123Q-GS2-SVA12M2-H6 (0.5 mg / kg) were still detectable in pig serum. Thus, for SDA SVA12L, the dosage, the amount of SDA fused to it, and the type of SDA did not significantly affect half-life in pigs. Because all SVA SDAs were generated using horse and canine albumin, similar half-life profiles for these SDAs can be expected in horses, dogs, and cats.

[0299] For SDA SVG03L, SVG23L, and SVG24L, the affinity constant K for the Fc portion of immunoglobulins of equine or canine origin DThe binding densities varied from 0.1 to 4 nM, all below 10 nM. The use of these binders could be beneficial in interfering with different immunological processes, in particular the activation of the complement pathway, type I hypersensitivity reactions, allergies, and atopy.

[0300] 19. Construction and Production of Further Multimeric SDAs for TeNT Two further multimeric SDAs (SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6) were generated by creating stable MIRY integrants

[75] using plasmid pRL44

[69] in the yeast strain SU50

[70] . The elements from which these multimeric SDAs were generated are as follows: GS3: (G4S)3 linker as previously described

[27] GS2: (G4S)2 linker derived from the pRL144 plasmid

[19] H6: Similar to pRL188, it contains a his6 tag, a double stop codon, and a HindIII site. [2] SVG13M5: SVG13 with five mutations: Q1E, Q5V, W118R, K120Q, and L123Q. SVA12M2: SVA12 with two mutations: Q1E, Q5V SVT15-3FW4M: SVT15 without the internal SacI site and with three mutations: K120Q, I122T, L123Q SVT16-L123Q: SVT16 with a non-expressing restored BstEII site and the L123Q mutation. A synthetic SacI-HindIII fragment was generated and then subcloned into plasmid pRL44

[69] using the SacI and HindIII sites to give plasmids pRL505 and pRL506 (Table 34).

[0301] The Saccharomyces cerevisiae strain SU50 (MATa; cir°; leu2-3,-112; his4-519; can1;

[70] ) was transformed by electroporation with HpaI-linearized plasmids pRL505 and pRL506

[71] , and leu+ auxotrophs were selected. Single-colony purified transformants were induced for SDA expression at a 0.5 L scale, and SDA was purified from the culture supernatant by IMAC

[58] . SDA was then further purified by cation exchange chromatography on an SP Sepharose column as previously described

[44] , with minor modifications. SP Sepharose Fast Flow (GE Healthcare, Piscataway, NJ) and 25 mM sodium acetate, pH 4.7 buffer were used to bind SDA to the column. Bound SDA was eluted using a step gradient of 0.1, 0.2, 0.4, 0.6, 0.8, and 1 M NaCl in binding buffer. Bound SDA typically eluted at 0.4-0.6 M NaCl (Table 34). It was concentrated using a 3 kDa molecular weight cutoff centrifugal concentration device and buffer exchanged into PBS. SDA concentration was determined using the bicinchoninic acid assay (BCA, Pierce catalog number 23212) and a bovine serum albumin standard (Thermo Scientific, Rockford, IL). Based on the SDA yield after purification, the production level of multimeric SDA in yeast was calculated (Table 34).

[0302] Multimeric SDA was analyzed by reducing SDS PAGE using NuPage Novex 4%-12% Bis-Tris gels with MOPS running buffer (Invitrogen) and staining with Gelcode Blue reagent (Thermo Scientific). All of the multimeric SDA migrated to the expected location based on their predicted molecular masses. Samples were biotinylated from stock using the appropriate weight ratio of protein to biotin (Sulfo-NHS-LC-Biotin, Pierce, Cat. No. 21335, Lot No. OE185235A).

[0303] 20. Further binding properties of some SDAs for TeNT Further assays were performed to test the binding of selected SDAs when compared with cAb-TT1 and cAb-TT2

[46] using an Octet Red96 instrument (Pall Life Sciences) equipped with a streptavidin (SA) biosensor. To this end, the binding affinity of SDAs SVT06L, SVT15L, and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, cAb-TT1, and cAb-TT2 for tetanus toxin was evaluated.

[0304] To determine the binding affinity for tetanus toxin, biotinylated SDA was coupled to the SA sensor (see Example 18). A two-fold dilution series of tetanus toxin was prepared, see Table 29 for assay details. After further assay optimization, SDA was incubated with different dilutions of tetanus toxin, followed by an association step (2-8 min) followed by a dissociation step (2-10 min) in PBS-Tween. The results were then analyzed using ForteBio data analysis software to determine the affinity constant (K D ) was determined. Table 29 shows the affinity data for each SDA.

[0305] Previous test results of SVT06L, SVT15L and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 (see Table 27) were repeated in this assay configuration, confirming their high affinity for tetanus toxin. In the case of cAb-TT1 and cAb-TT2, the published lower affinity was confirmed. In particular, the rapid dissociation of both cAb-TT1 and cAb-TT2 is evident. However, this is consistent with the results obtained from the mouse toxin neutralization test, in which 75% of the mice died 4 days after application of 4 μg of cAb-TT2, as described in WO 96 / 34103. In contrast, SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, when used at low nanogram levels (20-30 ng / ml), protected mice against more than five times the lethal dose of tetanus toxin in several consecutive TNT runs.

[0306] To determine the affinity of two additional multimeric SDA (SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6) for binding to tetanus toxin, a 4 μg / ml biotinylated TeNT was coupled to the SA sensor. SDA (including SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6) was diluted in a 2-fold dilution series from 10 nM to 0.62 nM in PBS buffer containing 0.02% Tween 20 (PBSTween). The SDA dilution series was incubated with the TeNT-coupled sensor for 3 min (association step), followed by a dissociation step in PBS-Tween for an additional 15 min. The results were then analyzed using ForteBio data analysis software to determine affinity constants (K D ) was decided.

[0307] From this study, bispecific (binding to tetanus toxin and albumin or IgG) and bivalent (to tetanus toxin) SDAs bound TeNT with subnanomolar to picomolar affinities. See Table 30. These SDAs (SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6) are expected to achieve effective neutralization of tetanus toxin in vivo at low nanogram levels based on the results provided in Example 17.

[0308] 21. Further binding characteristics of some polymeric SDAs to horse, human, or canine albumin Additional assays were performed on selected bivalent and bispecific (multimeric) SDAs to determine their binding affinity to horse, dog, and human serum albumin.

[0309] To determine the affinity of three multimeric SDAs (SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6, and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6) when bound to equine albumin, a configuration was used in which, after optimization, 2.5 micrograms / ml of biotinylated (sulfo-NHS-LC-biotin, Pierce, Cat. No. 21335, Lot No. OE185235A, at the appropriate weight ratio of protein to biotin) equine albumin or 5.0 micrograms of human albumin was coupled to the SA sensor. After further optimization, these two SDAs (SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6) were diluted in PBS buffer containing 0.02% Tween 20 (PBSTween) as a two-fold dilution series from 10 nM to 0.62 nM. The SDA dilution series was incubated with the equine albumin-coupled sensor for 6–10 min (association step), followed by a dissociation step in PBS-Tween for another 10 min. For SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6, a concentration of 100 nM was chosen.

[0310] The monomeric SDA SVA12L and all three multimeric SDAs were evaluated for their affinity binding properties to human albumin at a concentration of 100 nM.

[0311] To determine the affinity of three multimeric SDA (SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6, and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6) when bound to canine albumin, a configuration was used in which 1.25 micrograms / ml of biotinylated multimeric SDA (see Example 19) was coupled to the SA sensor. Canine albumin was diluted in a 2-fold dilution series from 500 nM to 16 nM in PBS buffer containing 0.02% Tween 20 (PBSTween). The albumin dilution series was incubated with each SDA-coupled sensor for 4–5 min (association step), followed by a dissociation step in PBS-Tween for an additional 5–10 min.

[0312] The results were then analyzed using ForteBio data analysis software. Tables 31a and 31b show the data of the SDA tested. As expected, neither monomeric nor multimeric SDA was found to bind to human albumin. As expected, multimeric SDA SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6 was found to not bind to horse, human, or canine albumin.

[0313] For the multimeric SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 and SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6, the affinity constants K DThe affinity data ranged from 0.5 to 1.5 nM and from 250 to 400 nM, respectively. For the multimeric SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, a serum half-life of approximately 110 to 145 hours (4.5 to 6 days) was found in pigs (see Example 16) and a serum half-life of approximately 510 hours (21.25 days) was found in horses (see Example 23). Based on the affinity data, a similar half-life in pigs and horses can be expected for SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6.

[0314] 22. Affinity of some SDAs for TeNT as determined by another method (Creoptix WAVE system) For some SDAs, the affinity constants for the target TeNT were in the pM range as determined by an Octet Red96 instrument. To confirm this finding, an additional technique was used, the grating-coupled interferometry (GCI) method

[76] , which is specific to the Creoptix™ sensor. GCI is a waveguide interferometry-based method for monitoring and characterizing molecular interactions and determining the kinetic rates, affinity constants, and concentrations of interacting analytes. Similar to other optical label-free methods, such as surface plasmon resonance (SPR), waveguide interferometry detects refractive index changes that occur in the evanescent field near the sensor surface due to mass changes caused by complex formation of interacting molecules. The combination of two highly sensitive methods, interferometry and planar optical waveguide sensing, allows for very low detection limits.

[0315] Affinity (KD) experiments of several monomeric and multimeric SDA with TeNT as target were carried out at 30°C using a Creoptix WAVE instrument (Creoptix AG, Waedenswil, Switzerland). Protocols within the WAVE control software were followed for conditioning the chip (4PCP-S), immobilizing the proteins, and performing the kinetic experiments. Standard chemicals were used.

[0316] Biotinylated tetanus toxin (10 micrograms / ml) was immobilized on the PCH-streptavidin chip by injection of 10 microliters / min for 120 seconds on the relevant channel. All experiments were performed with PBS buffer containing 0.02% Tween 20 (PBSTween) as running buffer. Binding properties were evaluated for several SDAs (monomers and multimers) at five concentrations (100-1.2 nM, 3-fold dilution steps). The association phase for the SDAs evaluated was 4 minutes. For SVT 03L, SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6, the dissociation period was 6000 seconds. The dissociation period was set to 1000 and 12000 seconds for SVT06-SVT16-L123Q-GS2-SVG13M4-H6 and SVT15-3FW4M-GS2-SVG13M4-H6, respectively. The results were then analyzed using Creoptix data analysis software to determine the affinity constants (K D The results are shown in Table 32.

[0317] The results confirm previous findings regarding the slow dissociation and fast association of each of the SDAs tested. D ranged from 1.0 to 25 pM.

[0318] 23. Analysis of serum half-life of polymeric SDA in horses Serum half-life determinations were also performed in horses for SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6. SDA was generated using only equine and canine albumin proteins, thus being a relevant target species. For this purpose, three ponies (females) aged 4.5-6.5 years were used. They were weighed before intramuscular inoculation. Based on body weight, the required amount of multimeric SDA per animal was calculated (dosed at 0.17 mg / kg). Filter-sterilized SDA was dissolved in PBS and injected intramuscularly in a single site in the hind thigh with a volume of approximately 2.5 ml. Blood samples for serum preparation were collected from the jugular vein immediately prior to SDA inoculation and on days 1, 2, 4, 7, 10, 13, 17, and 21 thereafter.

[0319] SDA levels in serum were measured by ELISA using TeNT holotoxin and anti-tag mAb PO-conjugate. For this purpose, 96-well polystyrene plates were coated with 2 μg / ml TeNT holotoxin in PBS in coating buffer (50 mM NaHCO3, pH 9.2 buffer), 100 μl / well, overnight at 4° C. After washing the plates with ELISA buffer (1% skim milk; 0.05% Tween 20; 0.5 M NaCl; 2.7 mM KCl; 2.8 mM KH2PO4; 8.1 mM Na2HPO4; pH 7.4, 100 μl / well), all subsequent incubations were performed for 1 h at RT. TeNT-coated plates were incubated with a two-fold dilution series across eight wells, starting per column with both 1 microgram / ml and 0.1 microgram / ml SDA standard, null serum spiked with 1 microgram / ml SDA in column 3, and sera from nine collected animals in columns 4-12. Serum was first diluted five-fold and then further diluted two-fold across eight wells. After washing, TeNT-coated plates were then incubated with anti-his6mAb-PO conjugate (1 / 1000, Roche, Cat. No. 11965085001). Bound PO was then detected by staining with 3,3',5,5' tetramethylbenzidine (Surmodics; Cat. No. TMBW-1000-01). After stopping the reaction by addition of 0.5 M sulfuric acid, the absorbance at 450 nm was measured using a spectrophotometer. Absorbance data was evaluated using a suitable commercial software program. A four-parameter logistic curve was fitted to the absorbance of the standards and the SDA concentrations. This curve was used to interpolate the SDA concentrations to obtain specific absorbance values ​​for each serum sample in each ELISA. The calculated serum SDA concentrations were exported to an Excel spreadsheet template (Microsoft Corporation, Redmond, USA).

[0320] The terminal serum half-life was calculated based on the following formula: SDA(t) = SDA(0) * (0.5 (t / T1 / 2β) ), where t is time (hours), SDA(0) is the SDA concentration at the first time point used (corrected for weight gain in the half-life calculation), SDA(t) is the SDA concentration at time t, and T 1 / 2 β is the terminal half-life.

[0321] Serum half-lives were calculated from data taken from samples on days 2 through 21. The Solver function in Microsoft Excel was used to fit SDA concentrations versus time for each individual animal based on the formula above. 1 / 2 The mean and standard deviation of β were then calculated (see Table 33).

[0322] Animals inoculated with the (equine) albumin-binding bivalent and bispecific multimeric SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 had an average T of 510 hours. 1 / 2 β. This multimeric SDA contains the albumin-binding SDA domain SVA12M2, linked to the SVT06 and SVT16-L123Q SDA domains to form the multimeric SDA. On day 21 after SDA administration, serum levels of 0.4-0.6 micrograms / ml were measured in three animals, thus, based on the data shown in Example 17, all animals would have been protected against tetanus, since this is much higher than the minimum required level (0.1 IU / ml). As expected, the calculated serum half-life for SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 in horses exceeds the serum half-life measured and calculated for pigs. This supports the calculations predicting that a similar long serum half-life can be expected for dogs.

[0323] [Table 2] TIFF2024023268000004.tif224149

[0324]

Table 3

[0325]

Table 4

[0326]

Table 5

[0327]

Table 6

[0328]

Table 7

[0329]

Table 8

[0330]

Table 9

[0331]

Table 10

[0332]

Table 11

[0333]

Table 12

[0334]

Table 13

[0335]

Table 14

[0336]

Table 15

[0337]

Table 16

[0338]

Table 17

[0339]

Table 18

[0340]

Table 19

[0341]

Table 20

[0342]

Table 21

[0343]

Table 22

[0344]

Table 23

[0345]

Table 24

[0346]

Table 25

[0347]

Table 26

[0348]

Table 27

[0349]

Table 28

[0350]

Table 29

[0351]

Table 30

[0352]

Table 31

[0353]

Table 32

[0354]

Table 33

[0355]

Table 34

[0356]

Table 35

[0357]

Table 36

[0358]

Table 37

[0359]

Table 38

[0360] References [1] Hamers-Casterman C et a. Nature.1993;363:446-8. [2] Harmsen MM et al. Vet Microbiol. 2007;120:193-206. [3] Harmsen MM et al. J ImmunoassayImmunochem. 2012;33:234-51. [4] Rossetto O et al. Tetanusneurotoxin. Toxicon. 2013;66:59-63. [5] Herreros J et al. Biochem J. 2000;347Pt 1:199-204. [6] Fitzsimmons SP et al. Vaccine.2000;19:114-21. [7] Yousefi M et al. Human vaccines & immunotherapeutics. 2014;10:344-51. [8] Scott N et al. Mol Immunol.2010;47:1931-41. [9] Sagt CM et al. Appl Environ Microbiol.2000;66:4940-4.

[10] Liu L. J Pharm Sci. 2015;104:1866-84.

[11] Gorlani A et al. Protein Eng Des Sel.2012;25:39-46.

[12] Liu JL et al. Microbial cell factors. 2015;14:158.

[13] Goldman ER et al. Protein Expr Purif.2014;95:226-32.

[14] Van de Laar T et al. BiotechnolBioeng. 2007;96:483-94.

[15] Batra SK et al. Curr Opin Biotechnol.2002;13:603-8.

[16] Iznaga-Escobar N et al. Methods FindExp Clin Pharmacol. 2004;26:123-7.

[17] Kontermann RE. Curr Opin Biotechnol.2011;22:868-76.

[18] Klooster R et al. J Immunol Methods.2007;324:1-12.

[19] Harmsen MM et al. Vaccine.2005;23:4926-34.

[20] Coppieters K et al. Arthritis Rheum.2006;54:1856-66.

[21] Holliger P et al. Nat Biotechnol.1997;15:632-6.

[22] Holt LJ et al. Protein Eng Des Sel.2008;21:283-8.

[23] Hutt M et al. J Biol Chem.2012;287:4462-9.

[24] Rossotti MA et al. mAbs. 2015;7:820-8.

[25] Walker A et al. Protein Eng Des Sel.2010;23:271-8.

[26] Terryn S et al. PLoS ONE.2014;9:e109367.

[27] Huston JS et al. Proc Natl Acad Sci.1988;85:5879-83.

[28] Mukherjee J et al. PLoS ONE.2012;7:e29941.

[29] Sepulveda J et al. Infect Immune. 2010;78:756-63.

[30] Vance DJ et al. J Biol Chem.2013;288:36538-47.

[31] Klein JS et al. ProteinEng Des Salt. 2014;27:325-30.

[32] Trinh R et al. MolImmunol. 2004;40:717-22.

[33] Beirnaert E. Improved nanobodies(TM)against tumor necrosis factor-alpha. 2006.

[34] WO2011064382

[35] Conrath KE et al. J Biol Chem.2001;276:7346-50.

[36] Hopp J et al. ProteinEng Des Sel. 2010;23:827-34.

[37] Jacobs SA et al. Protein Eng Des Sel. 2015;28:385-93.

[38] Fridy PC et al. NatMethods. 2014;11:1253-60.

[39] Chaudhury C et al. J Exp Med.2003;197:315-22.

[40] Nagel J et al. J Immunol. 1973;110:1388-95.

[41] Mizuguchi J et al. Naturwissenschaften. 1982;69:597-8.

[42] Volk WA et al. Infect Immun.1984;45:604-9.

[43] Harmsen MM et al. Appl MicrobiolBiotechnol. 2009;84:1087-94.

[44] Harmsen MM et al. Vet Microbiol.2008;132:56-64.

[45] Frenken LGJ et al. J Biotechnol.2000;78:11-21.

[46] Arbabi-Ghahroudi M et al. FEBS Lett.1997;414:521-6.

[47] Xing DK et al. Biologicals.1996;24:57-65.

[48] ​​Coombes L et al. Biologicals. 2012;40:466-72.

[49] McCafferty J, Johnson KS. In: Phagedisplay of peptides and proteins. 1996. p. 79-111.

[50] Lou J et al. J Immunol Methods.2001;253:233-42.

[51] Lefranc MP, Methods Mol Biol.2004;248:27-49.

[52] Harmsen MM et al. Mol Immunol.2000;37:579-90.

[53] Butler JE. Methods. 2000;22:4-23.

[54] Arbabi-Ghahroudi M et al. Protein engineering, design & selection: PEDS. 2009;22:59-66.

[55] de Wildt RM et al. J Mol Biol.1999;294:701-10.

[56] Desmyter A et al. J Biol Chem.2001;276:26285-90.

[57] Deschacht N et al. J Immunol.2010;184:5696-704.

[58] Van der Vaart JM in Methods Mol Biol. Totowa, NJ: Humana Press; 2002. p. 359-66.

[59] Harmsen MM et al. Appl MicrobiolBiotechnol. 1996;46:365-70.

[60] Harmsen MM et al. Appl MicrobiolBiotechnol. 2002;60:449-54.

[61] Harmsen MM et al. Appl MicrobiolBiotechnol. 2007;77:13-22.

[62] Sheppard AJ et al. Infect Immun.1984;43:710-4.

[63] Emsley P et al. J Biol Chem.2000;275:8889-94.

[64] Fotinou C et al. JBiol Chem. 2001;276:32274-81.

[65] Chen C, Baldwin MR, Barbieri JT.Biochemistry. 2008;47:7179-86.

[66] Chen C, Fu Z, Kim JJ, Barbieri JT,Baldwin MR. J Biol Chem. 2009;284:26569-77.

[67] Wang H, Yu R, Fang T, Yu T, Chi X, ZhangX, et al. Toxins. 2016;8.

[68] Kenimer JG et al. Infect Immun.1983;42:942-8.

[69] Harmsen MM et al. Vet Microbiol.2005;111:89-98.

[70] Joseph ML et al. Appl EnvironMicrobiol. 1993;59:52-9.

[71] Becker DM, Guarente L. MethodsEnzymol. 1991;194:182-7.

[72] Harmsen MM et al. Vaccines.2011;29:2682-90.

[73] Van Oers JW, Tilders FJ. Endocrinology.1991;128:496-503.

[74] Verheesen & Laeremans. Methods MolBiol 2012; 911: 81–104.

[75] Gorlani A et al. Methods Mol Biol.2012;911:277-86

[76] Kozma, F. et al. Biosensors andBioelectronics 2014 , 58:287-307.

[0361] The present invention relates to the following: [1] A single domain antibody (SDA) capable of binding to tetanus neurotoxin (TeNT), having at least 70% overall amino acid sequence identity to a sequence selected from the group consisting of SEQ ID NOs: 17, 13, 14, 15, 16, 18, 19, 20, 21, 22, 23, 24, 25, and 26, provided that CDR1, CDR2, and CDR3 have at least 75% amino acid sequence identity. [2] The SDA of [1], having an overall amino acid sequence identity of at least 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or preferably 100% to a sequence selected from the group consisting of SEQ ID NOs: 17, 13, 14, 15, 16, 18, 19, 20, 21, 22, 23, 24, 25, and 26, with the proviso that the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%. [3] The SDA described in [1] or [2], wherein the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 76% or preferably 100%. [4] A polypeptide construct comprising at least one SDA capable of binding to TeNT, and at least one SDA capable of binding to a serum protein, according to any one of [1] to [3]. [5] The polypeptide construct according to [4], wherein the serum protein is serum albumin or immunoglobulin. [6] The polypeptide construct described in [5], wherein the SDA capable of binding to serum albumin has an overall amino acid sequence identity of at least 70% to a sequence selected from the group consisting of SEQ ID NOs: 40, 37, 38, 39, 41, and 42, with the proviso that the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%. [7] The polypeptide construct according to [5], wherein the immunoglobulin is immunoglobulin G (IgG). [8] The polypeptide construct described in [5] or [7], wherein the SDA capable of binding to the immunoglobulin has an overall amino acid sequence identity of at least 70% to a sequence selected from the group consisting of SEQ ID NOs: 30, 27, 28, 29, 31, 32, 33, and 34, with the proviso that the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%. [9] A polypeptide construct described in any one of [4] to [8], comprising at least two SDAs capable of binding to TeNT, each of the at least two SDAs capable of binding to TeNT having an overall amino acid sequence identity of at least 70% with a sequence selected from option A; SEQ ID NO: 24, or option B; SEQ ID NO: 25, or option C; SEQ ID NO: 20, or option D; SEQ ID NO: 17 or 19, or option E; SEQ ID NO: 22, 15, 23, or 14, provided that the at least two SDAs do not comprise a sequence derived from the same option, and the amino acid sequence identity of CDR1, CDR2, and CDR3 is at least 75%.

[10] A pharmaceutical composition comprising at least one SDA according to any one of [1] to [3], and / or at least one polypeptide construct according to any one of [4] to [9], and a pharma- ceutical acceptable carrier.

[11] The pharmaceutical composition described in

[10] , comprising at least two SDAs capable of binding to TeNT described in any one of [1] to [3], and / or at least one polypeptide construct described in [9].

[12] An SDA according to any one of [1] to [3] or a polypeptide construct according to any one of [4] to [9] for use as a pharmaceutical.

[13] An SDA described in any one of [1] to [3], a polypeptide construct described in any one of [4] to [9], or a pharmaceutical composition described in

[10] or

[11] for use in the prevention or treatment of a disease / symptom caused by Clostridium tetani.

[14] A DNA fragment encoding the SDA according to any one of [1] to [3], or the polypeptide construct according to any one of [4] to [9].

[15] A nucleic acid comprising the DNA fragment described in

[14] , wherein the DNA fragment described in

[14] is operably linked to a promoter and, optionally, other regulatory elements.

[16] A host cell comprising the nucleic acid described in

[15] .

[17] A method for producing an SDA according to any one of [1] to [3], or a polypeptide construct according to any one of [4] to [9], comprising the steps of a) culturing a host cell according to

[16] under conditions allowing expression of the SDA or the polypeptide construct, and optionally b) recovering the SDA or the polypeptide construct from at least one of the host cell and the culture medium.

[18] A diagnostic kit comprising at least one SDA capable of binding to TeNT described in any one of [1] to [3].

Claims

1. A single-domain antibody (SDA), An SDA having the ability to bind to serum proteins and having at least 90% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 40, 37, 38, 39, 41, 42, 30, 27, 28, 29, 31, 32, 33, and 34, wherein the amino acid sequence identity of CDR1, CDR2, and CDR3 is 100%.

2. The SDA according to claim 1, having at least 95% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 40, 37, 38, 39, 41, 42, 30, 27, 28, 29, 31, 32, 33, and 34.

3. The SDA according to claim 1 or 2, having 100% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 40, 37, 38, 39, 41, 42, 30, 27, 28, 29, 31, 32, 33, and 34.

4. The SDA according to any one of claims 1 to 3, wherein the SDA has the ability to bind to serum albumin.

5. The SDA according to any one of claims 1 to 3, wherein the SDA has the ability to bind to immunoglobulin.

6. A polypeptide construct comprising at least one SDA having the ability to bind to a serum protein as described in any one of claims 1 to 5, and at least one SDA having the ability to bind to TeNT.

7. The polypeptide construct according to claim 6, wherein the serum protein is serum albumin or immunoglobulin.

8. The polypeptide construct according to claim 7, wherein the SDA having the ability to bind to serum albumin has 90% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 40, 37, 38, 39, 41, and 42, provided that the amino acid sequence identity of CDR1, CDR2, and CDR3 is 100%.

9. The polypeptide construct according to claim 7, wherein the immunoglobulin is immunoglobulin G (IgG).

10. The polypeptide construct according to claim 7 or 9, wherein the SDA having the ability to bind to the immunoglobulin has 90% overall amino acid sequence identity with a sequence selected from the group consisting of SEQ ID NOs: 30, 27, 28, 29, 31, 32, 33, and 34, provided that the amino acid sequence identity of CDR1, CDR2, and CDR3 is 100%.

11. A polypeptide construct according to any one of claims 6 to 10, comprising at least two SDAs having the ability to bind to TeNT, wherein each of the at least two SDAs having the ability to bind to TeNT has at least 95% overall amino acid sequence identity with a sequence selected from option A: SEQ ID NO: 24, or option B: SEQ ID NO: 25, or option C: SEQ ID NO: 20, or option D: SEQ ID NO: 17 or 19, or option E: SEQ ID NO: 22, 15, 23, or 14, provided that the at least two SDAs do not include sequences derived from the same option, and the amino acid sequence identity of CDR1, CDR2, and CDR3 is 100%.

12. A pharmaceutical composition comprising at least one SDA according to any one of claims 1 to 5, and / or at least one polypeptide construct according to any one of claims 6 to 11, and a pharmaceutically acceptable carrier.

13. The pharmaceutical composition according to claim 12, comprising at least two SDAs having the ability to bind to serum proteins according to any one of claims 1 to 5, and / or at least one polypeptide construct according to claim 11.

14. A composition for use as a pharmaceutical, comprising an SDA according to any one of claims 1 to 5, and / or a polypeptide construct according to any one of claims 6 to 11.

15. A composition comprising the SDA according to any one of claims 1 to 5 and / or the polypeptide construct according to any one of claims 6 to 11, or the pharmaceutical composition according to claim 12 or 13, for use in the prevention or treatment of diseases / symptoms of Clostridium tetanus.

16. A DNA fragment encoding an SDA according to any one of claims 1 to 5, or a polypeptide construct according to any one of claims 6 to 11.

17. A nucleic acid comprising the DNA fragment according to claim 16, wherein the DNA fragment according to claim 16 is operably linked to a promoter and, optionally, other regulatory elements.

18. A host cell containing the nucleic acid described in claim 17.

19. A method for producing an SDA according to any one of claims 1 to 5, or a polypeptide construct according to any one of claims 6 to 11, comprising: a) culturing the host cells according to claim 18 under conditions that enable the expression of the SDA or polypeptide construct; and optionally b) recovering the SDA or polypeptide construct from at least one of the host cells and the culture medium.

20. A diagnostic kit comprising at least one SDA having the ability to bind to a serum protein as described in any one of claims 1 to 5.

Images