Methods for diagnosing Alzheimer's disease and other neurological disorders

Abstract

Disclosed herein are methods for diagnosing a subject with a neurological disorder, such as Alzheimer's disease, using a proximity-based detection assay capable of detecting a complex comprising two or more synaptic proteins, such as neuronal pentraxins, from a blood, cerebrospinal fluid or other bodily fluid sample from said subject. Also disclosed are methods for using said assay to assess and monitor a subject with or at risk of developing a neurological disorder.

Description

[Technical field]

[0001] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy, created on November 29, 2021, is entitled "51556-002WO2_Sequence_Listing_11_29_21_ST25" and is 1,354 bytes in size.

[0002] Statement on Federally Sponsored Research This invention was made with Government support under R35NS097966 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0003] The present disclosure relates to methods for diagnosing Alzheimer's disease and other neurological disorders. [Background technology]

[0004] Neurodegeneration is a pathophysiological process observed in many diseases associated with progressive dementia, such as Alzheimer's disease (AD). A key feature of this process is neurodegeneration and neuronal cell death, which leads to the global destruction of brain tissue and, inter alia, the associated full range of cognitive and behavioral deficits, including cognitive decline, language impairment, and memory loss.

[0005] AD is a late-onset neurodegenerative disease that is responsible for the majority of dementia cases in elderly people. AD patients suffer from progressive cognitive decline characterized by symptoms including insidious loss of short-term and long-term memory, attention deficits, language-specific problems, disorientation, impulse control, social withdrawal, anhedonia, and other symptoms. The prominent neuropathological features of AD are extracellular aggregates of amyloid-β plaques and neurofibrillary tangles consisting of hyperphosphorylated microtubule-associated tau protein. The accumulation of these aggregates is associated with neuronal loss and atrophy in many brain regions, including the frontal, temporal, and parietal lobes of the cerebral cortex, as well as subcortical structures such as the basal forebrain cholinergic system and the locus coeruleus in the brainstem. Although these prominent diagnostic features are highly indicative of disease burden, they are often only discovered long after the onset of symptoms or postmortem. Thus, there is a need for improved methods of diagnosing subjects as having or at risk of developing AD and other neurological disorders. Summary of the Invention

[0006] In a first aspect, the disclosure provides a method of identifying a subject as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of neuronal pentraxin 2 (NPTX2), neuronal pentraxin 1 (NPTX1) and neuronal pentraxin receptor (NPTXR) and a second affinity ligand specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand binds to an oligonucleotide plus strand and the second affinity ligand binds to an oligonucleotide plus strand. (ii) contacting the blood sample with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a ligated plus-minus oligonucleotide strand (LPMOS), where the LPMOS can hybridize to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iii) performing an amplification on the LPMOS, where if the first synaptic protein is within a proximity distance threshold to the second synaptic protein, the amplification generates a proximity signal; and (iv) detecting the proximity signal in the blood sample, where the proximity signal is indicative of an amount of the first complex in the blood sample; wherein an increase in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample identifies the subject as having or at risk of developing a neuropathy.

[0007] In another aspect, the disclosure provides a method of identifying a subject as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand, and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand is bound to an oligonucleotide plus strand, and the second affinity ligand is bound to an oligonucleotide minus strand; and (ii) contacting the blood sample with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand, and the second synaptic protein, (iii) contacting the second complex with a stranded connector oligonucleotide and a ligase enzyme, thereby generating a ligated plus-minus oligonucleotide strand (LPMOS), where the LPMOS is capable of hybridizing to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iv) performing an amplification on the LPMOS, where if the first synaptic protein is within a proximity distance threshold to the second synaptic protein, the amplification generates a proximity signal; and (iv) detecting the proximity signal in the blood sample, where the proximity signal is indicative of an amount of the first complex in the blood sample, wherein a decrease in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample identifies the subject as having or at risk of developing a neuropathy.

[0008] In another aspect, the disclosure provides a method of identifying a subject as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and the contacting generates a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand, and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand binds to a first oligonucleotide plus strand, and the second affinity ligand binds to a second oligonucleotide minus strand; and (ii) contacting the second complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a first LPMOS, wherein the first LPMOS is comprised of a first forward primer oligonucleotide and (iii) performing amplification on the first LPMOS, where if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein, the amplification generates a first proximity signal; (iv) detecting the first proximity signal in the blood sample, where the first proximity signal is indicative of an amount of the first complex in the blood sample; and (v) contacting the blood sample obtained from the subject with NPTX2, NPT contacting a third affinity ligand specific for a third synaptic protein selected from the group consisting of X1 and NPTXR with a fourth affinity ligand specific for a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the third and fourth synaptic proteins are in a third complex, and the contacting produces a fourth complex comprising the third affinity ligand, the third synaptic protein, the fourth affinity ligand and the fourth synaptic protein, and wherein the third and fourth synaptic proteins are different proteins;(vi) contacting the blood sample with a third affinity ligand bound to the second oligonucleotide positive strand and a fourth affinity ligand bound to the second oligonucleotide negative strand; and (vii) contacting the fourth complex with a second single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a second LPMOS, the second LPMOS being capable of hybridizing to the second forward primer oligonucleotide and the second reverse primer oligonucleotide; (viii) performing an amplification on the second LPMOS, where the amplification generates a second proximity signal if the third synaptic protein is within a proximity distance threshold relative to the fourth synaptic protein; (ix) quantifying the ratio of the first complex to the third complex by dividing the amount of the first complex by the amount of the third complex, wherein a decrease in the ratio of the first complex to the third complex in the subject's blood sample compared to the ratio of the first complex to the third complex in a reference blood sample identifies the subject as having or at risk of developing a neuropathy. In some embodiments, the method further comprises contacting the blood sample with an immobilized affinity ligand specific for the third synaptic protein.

[0009] In another aspect, the disclosure provides a method of identifying a subject as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR and a second affinity ligand specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, where the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; and (ii) measuring the amount of the first complex in the subject's blood sample, wherein an increase in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample identifies the subject as having or at risk of developing a neuropathy. In some embodiments, the first affinity ligand binds to a first proximity detector and the second affinity ligand binds to a second proximity detector.

[0010] In another aspect, the disclosure provides a method of identifying a subject as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR and a second affinity ligand specific for a second synaptic protein, where the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; and (ii) measuring the amount of the first complex in the subject's blood sample, wherein a decrease in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample identifies the subject as having or at risk of developing a neuropathy. In some embodiments, the first affinity ligand binds to a first proximity detector and the second affinity ligand binds to a second proximity detector.

[0011] In another aspect, the disclosure provides a method of identifying a subject as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR and a second affinity ligand specific for a second synaptic protein, where the first and second synaptic proteins are present in a first complex, and where the first and second synaptic proteins are different proteins; (ii) determining the amount of the first complex in the subject's blood sample; and (iii) contacting the blood sample obtained from the subject with a third affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR. The method includes contacting the blood sample with the affinity ligand and a fourth affinity ligand specific for a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, where the third and fourth synaptic proteins are in a second complex, and the third and fourth synaptic proteins are different proteins; (iv) measuring the amount of the second complex in the subject's blood sample; and (v) quantifying the ratio of the first complex to the second complex by dividing the amount of the first complex by the amount of the second complex, wherein a decrease in the ratio of the first complex to the second complex in the subject's blood sample compared to the ratio of the first complex to the second complex in the reference blood sample identifies the subject as having or at risk of developing a neuropathy. In some embodiments, the method further includes contacting the blood sample with an immobilized affinity ligand specific for a third synaptic protein. In some embodiments, the first affinity ligand comprises (e.g., binds to) a first proximity detector, and the second affinity ligand comprises a second proximity detector. In some embodiments, the third affinity ligand comprises a third proximity detector and the fourth affinity ligand comprises a fourth proximity detector.

[0012] In another aspect, the disclosure provides a method of selecting a subject identified as having or at risk for developing a neuropathy for treatment with a therapeutic agent, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR and a second affinity ligand specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand, and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, and wherein the first affinity ligand binds to an oligonucleotide plus strand and the second affinity ligand binds to an oligonucleotide minus strand. (ii) contacting the second complex with a single stranded connector oligonucleotide and a ligase enzyme, thereby generating a ligated plus-minus oligonucleotide strand (LPMOS), where the LPMOS can hybridize to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iii) performing an amplification on the LPMOS, where the amplification generates a proximity signal if the first synaptic protein is within a proximity distance threshold to the second synaptic protein; and (iv) detecting the proximity signal in the blood sample, where the proximity signal is indicative of an amount of the first complex in the blood sample; if the amount of the first complex in the subject's blood sample is increased compared to the amount of the first complex in the reference blood sample, the subject is selected for treatment with the therapeutic agent.

[0013] In another aspect, the disclosure provides a method of selecting a subject identified as having or at risk for developing a neuropathy for treatment with a therapeutic agent, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand, and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand binds to an oligonucleotide plus strand, and the second affinity ligand binds to an oligonucleotide minus strand. (ii) contacting the second complex with a single stranded connector oligonucleotide and a ligase enzyme, thereby generating a ligated plus-minus oligonucleotide strand (LPMOS), where the LPMOS can hybridize to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iii) performing an amplification on the LPMOS, where the amplification generates a proximity signal if the first synaptic protein is within a proximity distance threshold to the second synaptic protein; and (iv) detecting the proximity signal in the blood sample, where the proximity signal is indicative of an amount of the first complex in the blood sample; if the amount of the first complex in the subject's blood sample is decreased compared to the amount of the first complex in a reference blood sample, the subject is selected for treatment with a therapeutic agent.

[0014] In another aspect, the disclosure provides a method of selecting a subject identified as having or at risk of developing a neuropathy for treatment with a therapeutic agent, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and the contacting causes the first affinity ligand, the first synaptic protein, and the second synaptic protein to be in a first complex; (ii) contacting the blood sample with a first synaptic protein, a second affinity ligand, and a second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand binds to the positive strand of the first oligonucleotide, and the second affinity ligand binds to the negative strand of the second oligonucleotide; and (iii) contacting the second complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a first LPMOS, the first LPMOS comprising a first forward primer oligonucleotide, a second affinity ligand, and a second synaptic protein, the first and second synaptic proteins being different proteins, the first affinity ligand binds to the positive strand of the first oligonucleotide, and the second affinity ligand binds to the negative strand of the second oligonucleotide; (iii) performing amplification on the first LPMOS, where if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein, the amplification generates a first proximity signal; (iv) detecting the first proximity signal in the blood sample, where the first proximity signal indicates an amount of the first complex in the blood sample; and (v) contacting the blood sample obtained from the subject with NPTX2. with a third affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, and a fourth affinity ligand specific for a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the third and fourth synaptic proteins are in a third complex, and the contacting produces a fourth complex comprising the third affinity ligand, the third synaptic protein, the fourth affinity ligand and the fourth synaptic protein, and wherein the third and fourth synaptic proteins are different proteins;(vi) contacting the blood sample with a third affinity ligand bound to the second oligonucleotide positive strand and a fourth affinity ligand bound to the second oligonucleotide negative strand; (vii) contacting the fourth complex with a second single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a second LPMOS, the second LPMOS being capable of hybridizing to the second forward primer oligonucleotide and the second reverse primer oligonucleotide; and (vii) performing amplification on the second LPMOS, wherein the third synaptic protein is a first synaptic protein. (viii) detecting a second proximity signal in the blood sample, the second proximity signal being indicative of the amount of the third complex in the blood sample; and (ix) quantifying the ratio of the first complex to the third complex by dividing the amount of the first complex by the amount of the third complex, wherein the subject is selected for treatment with a therapeutic agent if the ratio of the first complex to the third complex in the subject's blood sample is decreased compared to the ratio of the first complex to the third complex in a reference blood sample. In some embodiments, the method further comprises contacting the blood sample with an immobilized affinity ligand specific for the third synaptic protein.

[0015] In another aspect, the disclosure provides a method of selecting a subject identified as having or at risk of developing a neuropathy for treatment with a therapeutic agent, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, and a second affinity ligand specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, where the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; and (ii) measuring the amount of the first complex in the subject's blood sample, where the amount of the first complex is increased in the subject's blood sample compared to the amount of the first complex in a reference blood sample, the subject is selected for treatment with the therapeutic agent. In some embodiments, the first affinity ligand binds to a first proximity detector and the second affinity ligand binds to a second proximity detector.

[0016] In another aspect, the disclosure provides a method of selecting a subject identified as having or at risk of developing a neuropathy for treatment with a therapeutic agent, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR and a second affinity ligand specific for a second synaptic protein, where the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; and (ii) measuring the amount of the first complex in the subject's blood sample, where the amount of the first complex is increased in the subject's blood sample compared to the amount of the first complex in a reference blood sample, the subject is selected for treatment with the therapeutic agent. In some embodiments, the first affinity ligand binds to a first proximity detector and the second affinity ligand binds to a second proximity detector.

[0017] In another aspect, the disclosure provides a method of selecting a subject identified as having or at risk for developing a neuropathy for treatment with a therapeutic agent, the method comprising the steps of: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR and a second affinity ligand specific for a second synaptic protein, where the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; (ii) determining the amount of the first complex in the subject's blood sample; and (iii) contacting the blood sample obtained from the subject with a third synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR. The method includes contacting a blood sample with a third affinity ligand specific for the napus protein and a fourth affinity ligand specific for a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, where the third and fourth synaptic proteins are in a second complex, and the third and fourth synaptic proteins are different proteins; (iv) measuring the amount of the second complex in the subject's blood sample; and (v) quantifying the ratio of the first complex to the second complex by dividing the amount of the first complex by the amount of the second complex, where the subject is selected for treatment with the therapeutic agent if the ratio of the first complex to the second complex in the subject's blood sample is decreased compared to the ratio of the first complex to the second complex in the reference blood sample. In some embodiments, the first affinity ligand comprises a first proximity detector and the second affinity ligand comprises a second proximity detector. In some embodiments, the third affinity ligand comprises a third proximity detector and the fourth affinity ligand comprises a fourth proximity detector. In some embodiments, the method further comprises contacting the blood sample with an immobilized affinity ligand specific for a third synaptic protein.

[0018] In another aspect, the disclosure provides a method of assessing resilience in a subject identified as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR and a second affinity ligand specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand is bound to an oligonucleotide plus strand and the second affinity ligand is bound to an oligonucleotide minus strand; (ii) contacting the second complex with a single-stranded connector oligonucleotide and (iii) performing an amplification on the LPMOS, where the amplification generates a proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; and (iv) detecting the proximity signal in the blood sample, where the proximity signal indicates an amount of the first complex in the blood sample; wherein if the amount of the first complex in the subject's blood sample is increased compared to the amount of the first complex in a reference blood sample, the subject is determined to be not resilient to the neurological disorder, and if the amount of the first complex in the subject's blood sample is unchanged or decreased compared to the amount of the first complex in the reference blood sample, the subject is determined to be resilient to the neurological disorder.

[0019] In another aspect, the disclosure provides a method of assessing resilience of a subject identified as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand is bound to an oligonucleotide plus strand and the second affinity ligand is bound to an oligonucleotide minus strand; and (ii) contacting the second complex with a single-stranded connector oligonucleotide and a ligase enzyme; Thus, the method includes contacting a second complex with a linked plus-minus oligonucleotide strand (LPMOS), the LPMOS being capable of hybridizing to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iii) performing an amplification on the LPMOS, the amplification generating a proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; and (iv) detecting the proximity signal in the blood sample, the proximity signal indicating the amount of the first complex in the blood sample; if the amount of the first complex in the subject's blood sample is decreased compared to the amount of the first complex in a reference blood sample, the subject is determined to be not resilient to neurological damage; and if the amount of the first complex in the subject's blood sample is unchanged or increased compared to the amount of the first complex in the reference blood sample, the subject is determined to be resilient to neurological damage.

[0020] In another aspect, the disclosure provides a method of assessing resilience in a subject identified as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and wherein the contacting results in a binding between the first affinity ligand, the first synaptic protein, the second synaptic protein and the first affinity ligand; and a second complex is generated, the first and second synaptic proteins being different proteins, the first affinity ligand binding to the first oligonucleotide plus strand and the second affinity ligand binding to the second oligonucleotide minus strand; (ii) contacting the second complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a first LPMOS, the first LPMOS being capable of hybridizing to the first forward primer oligonucleotide and the first reverse primer oligonucleotide; (iii) performing an amplification on the first LPMOS, the amplification generating a first proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; (iv) detecting the first proximity signal in the blood sample, the first proximity signal being indicative of the amount of the first complex in the blood sample; and (v) detecting the amount of the first complex in the blood sample by ligating the blood sample with NPTX2, N contacting a third affinity ligand specific for a third synaptic protein selected from the group consisting of PTX1 and NPTXR with a fourth affinity ligand specific for a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the third and fourth synaptic proteins are in a third complex, the contacting producing a fourth complex comprising the third affinity ligand, the third synaptic protein, the fourth affinity ligand and the fourth synaptic protein, wherein the third and fourth synaptic proteins are different proteins;(vi) contacting the blood sample with a third affinity ligand bound to the second oligonucleotide positive strand and a fourth affinity ligand bound to the second oligonucleotide negative strand; (vii) contacting the fourth complex with a second single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a second LPMOS, the second LPMOS being capable of hybridizing to the second forward primer oligonucleotide and the second reverse primer oligonucleotide; and (vii) performing an amplification on the second LPMOS, the amplification generating a second proximity signal if the third synaptic protein is within a proximity distance threshold to the fourth synaptic protein. (viii) detecting a second proximity signal in the blood sample, the second proximity signal being indicative of the amount of the third complex in the blood sample; and (ix) quantifying the ratio of the first complex to the third complex by dividing the amount of the first complex by the amount of the third complex, wherein the subject is determined to be non-resilient to neurological damage if the ratio of the first complex to the third complex in the subject's blood sample is decreased compared to the ratio of the first complex to the third complex in the reference blood sample, and the subject is determined to be resilient to neurological damage if the ratio of the first complex to the third complex in the subject's blood sample is unchanged or increased compared to the ratio of the first complex to the third complex in the reference blood sample. In some embodiments, the method further comprises contacting the blood sample with an immobilized affinity ligand specific for the third synaptic protein.

[0021] In another aspect, the disclosure provides a method for assessing resilience of a subject identified as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR and a second affinity ligand specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, where the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; and (ii) measuring the amount of the first complex in the subject's blood sample, wherein if the amount of the first complex in the subject's blood sample is increased compared to the amount of the first complex in a reference blood sample, the subject is determined to be not resilient to the neuropathy, and if the amount of the first complex in the subject's blood sample is unchanged or decreased compared to the amount of the first complex in the reference blood sample, the subject is determined to be resilient to the neuropathy. In some embodiments, the first affinity ligand binds to a first proximity detector and the second affinity ligand binds to a second proximity detector.

[0022] In another aspect, the disclosure provides a method for assessing resilience of a subject identified as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific to a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, and a second affinity ligand specific to a second synaptic protein, wherein the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; and (ii) measuring the amount of the first complex in the subject's blood sample, wherein the subject is determined to be not resilient to neuropathy if the amount of the first complex in the subject's blood sample is decreased compared to the amount of the first complex in a reference blood sample, and the subject is determined to be resilient to neuropathy if the amount of the first complex in the subject's blood sample is unchanged or increased compared to the amount of the first complex in the reference blood sample. In some embodiments, the first affinity ligand binds to a first proximity detector and the second affinity ligand binds to a second proximity detector.

[0023] In another aspect, the disclosure provides a method of assessing resilience in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR and a second affinity ligand specific for a second synaptic protein, where the first and second synaptic proteins are present in a first complex, and where the first and second synaptic proteins are different proteins; (ii) determining the amount of the first complex in the subject's blood sample; and (iii) contacting the blood sample obtained from the subject with a third affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR and a fourth affinity ligand specific for a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR. (iv) measuring the amount of the second complex in the subject's blood sample; and (v) quantifying the ratio of the first complex to the second complex by dividing the amount of the first complex by the amount of the second complex, wherein the subject is determined to be non-resilient to neurological damage if the ratio of the first complex to the second complex in the subject's blood sample is decreased compared to the ratio of the first complex to the second complex in the reference blood sample, and the subject is determined to be resilient to neurological damage if the ratio of the first complex to the second complex in the subject's blood sample is unchanged or decreased compared to the ratio of the first complex to the second complex in the reference blood sample. In some embodiments, the first affinity ligand comprises a first proximity detector and the second affinity ligand comprises a second proximity detector. In some embodiments, the third affinity ligand comprises a third proximity detector and the fourth affinity ligand comprises a fourth proximity detector. In some embodiments, the method further comprises contacting the blood sample with an immobilized affinity ligand specific for a third synaptic protein.

[0024] In another aspect, the disclosure provides a method of determining the therapeutic efficacy of an agent in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR and a second affinity ligand specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand, and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand is bound to an oligonucleotide plus strand, and the second affinity ligand is bound to an oligonucleotide minus strand. (ii) contacting the second complex with a single stranded connector oligonucleotide and a ligase enzyme, thereby generating a ligated plus-minus oligonucleotide strand (LPMOS), where the LPMOS can hybridize to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iii) performing an amplification on the LPMOS, where the amplification generates a proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; and (iv) detecting the proximity signal in the blood sample, where the proximity signal indicates an amount of the first complex in the blood sample; and the agent is determined to be therapeutically effective for the subject if the amount of the first complex in the subject's blood sample is unchanged or decreased compared to the amount of the first complex in a reference blood sample.

[0025] In another aspect, the disclosure provides a method of determining the therapeutic efficacy of an agent in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand, and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand is bound to an oligonucleotide plus strand, and the second affinity ligand is bound to an oligonucleotide minus strand; (i) contacting the second complex with a single stranded connector oligonucleotide and a ligase enzyme, thereby generating a ligated plus-minus oligonucleotide strand (LPMOS), where the LPMOS can hybridize to a forward primer oligonucleotide and a reverse primer oligonucleotide; (iii) performing an amplification on the LPMOS, where the amplification generates a proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; and (iv) detecting the proximity signal in the blood sample, where the proximity signal indicates an amount of the first complex in the blood sample; where the agent is determined to be therapeutically effective for the subject if the amount of the first complex in the subject's blood sample is unchanged or increased compared to the amount of the first complex in a reference blood sample.

[0026] In another aspect, the disclosure provides a method for determining the therapeutic efficacy of an agent in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and the contacting causes the first affinity ligand, the first synaptic protein, and the second synaptic protein to bind to each other. (ii) contacting the blood sample with a first synaptic protein, a second affinity ligand, and a second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand binds to the positive strand of the first oligonucleotide, and the second affinity ligand binds to the negative strand of the second oligonucleotide; and (iii) contacting the second complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a first LPMOS, the first LPMOS being a first forward primer oligonucleotide. (iii) performing amplification on the first LPMOS, where if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein, the amplification generates a first proximity signal; (iv) detecting the first proximity signal in the blood sample, where the first proximity signal indicates an amount of the first complex in the blood sample; and (v) contacting the blood sample obtained from the subject with NPTX2. with a third affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, and a fourth affinity ligand specific for a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the third and fourth synaptic proteins are in a third complex, and the contacting produces a fourth complex comprising the third affinity ligand, the third synaptic protein, the fourth affinity ligand and the fourth synaptic protein, and wherein the third and fourth synaptic proteins are different proteins;(v) contacting the blood sample with a third affinity ligand bound to the second oligonucleotide plus strand and a fourth affinity ligand bound to the second oligonucleotide minus strand; (v) contacting the fourth complex with a second single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a second LPMOS, the second LPMOS being capable of hybridizing to the second forward primer oligonucleotide and the second reverse primer oligonucleotide; and (vii) performing an amplification on the second LPMOS, wherein the third synaptic protein is linked to the fourth synaptic protein. (viii) detecting a second proximity signal in the blood sample, the second proximity signal being indicative of the amount of the third complex in the blood sample; and (ix) quantifying the ratio of the first complex to the third complex by dividing the amount of the first complex by the amount of the third complex, wherein the agent is determined to be therapeutically effective for the subject if the ratio of the first complex to the third complex in the blood sample of the subject is unchanged or increased compared to the ratio of the first complex to the third complex in the reference blood sample. In some embodiments, the method further comprises contacting the blood sample with an immobilized affinity ligand specific for the third synaptic protein.

[0027] In another aspect, the present disclosure provides a method for determining the therapeutic effect of a drug in a subject identified as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR and a second affinity ligand specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, where the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; and (ii) measuring the amount of the first complex in the subject's blood sample, and the drug is determined to be therapeutically effective for the subject if the amount of the first complex in the subject's blood sample is unchanged or decreased compared to the amount of the first complex in a reference blood sample. In some embodiments, the first affinity ligand binds to a first proximity detector and the second affinity ligand binds to a second proximity detector.

[0028] In another aspect, the disclosure provides a method for determining the therapeutic efficacy of a drug in a subject identified as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, and a second affinity ligand specific for a second synaptic protein, where the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; and (ii) measuring the amount of the first complex in the subject's blood sample, where the amount of the first complex in the subject's blood sample is unchanged or increased compared to the amount of the first complex in a reference blood sample, the drug is determined to be therapeutically effective for the subject. In some embodiments, the first affinity ligand binds to a first proximity detector and the second affinity ligand binds to a second proximity detector.

[0029] In another aspect, the disclosure provides a method of determining the therapeutic efficacy of an agent in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; (ii) determining the amount of the first complex in the subject's blood sample; and (iii) contacting the blood sample obtained from the subject with a third synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR. The method includes contacting a blood sample with a third affinity ligand specific for the third synaptic protein and a fourth affinity ligand specific for a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, where the third and fourth synaptic proteins are in a second complex, and the third and fourth synaptic proteins are different proteins; (iv) measuring the amount of the second complex in the subject's blood sample; and (v) quantifying the ratio of the first complex to the second complex by dividing the amount of the first complex by the amount of the second complex, and the agent is determined to be therapeutically effective for the subject if the ratio of the first complex to the second complex in the subject's blood sample is unchanged or increased compared to the ratio of the first complex to the second complex in a reference blood sample. In some embodiments, the method further includes contacting the blood sample with an immobilized affinity ligand specific for the third synaptic protein. In some embodiments, the first affinity ligand comprises a first proximity detector, and the second affinity ligand comprises a second proximity detector. In some embodiments, the third affinity ligand comprises a third proximity detector and the fourth affinity ligand comprises a fourth proximity detector.

[0030] In another aspect, the disclosure provides a method of assessing learning and memory in a subject identified as having or at risk for developing a neurological disease or disorder, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR and a second affinity ligand specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand binds to an oligonucleotide plus strand and the second affinity ligand binds to an oligonucleotide plus strand. The method includes: (i) contacting a blood sample with a first synaptic protein having a first synaptic protein bound to a negative strand of the first synaptic protein; (ii) contacting the second complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a ligated plus-minus oligonucleotide strand (LPMOS), where the LPMOS can hybridize to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iii) performing an amplification on the LPMOS, where if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein, the amplification generates a proximity signal; and (iv) detecting the proximity signal in the blood sample, where the proximity signal is indicative of an amount of the first complex in the blood sample, where an increase in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample indicates a decline in learning and memory in the subject.

[0031] In another aspect, the disclosure provides a method of assessing learning and memory in a subject identified as having or at risk for developing a neurological disease or disorder, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand is bound to an oligonucleotide plus strand and the second affinity ligand is bound to an oligonucleotide minus strand; The method includes contacting a blood sample with a second complex; (ii) contacting the second complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a ligated plus-minus oligonucleotide strand (LPMOS), where the LPMOS can hybridize to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iii) performing an amplification on the LPMOS, where if the first synaptic protein is within a proximity distance threshold to the second synaptic protein, the amplification generates a proximity signal; and (iv) detecting the proximity signal in the blood sample, where the proximity signal is indicative of an amount of the first complex in the blood sample, wherein a decrease in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample indicates a decline in learning and memory in the subject.

[0032] In another aspect, the disclosure provides a method of assessing learning and memory in a subject identified as having or at risk for developing a neurological disease or disorder, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand, and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand binds to a first oligonucleotide plus strand, and the second affinity ligand binds to a second oligonucleotide minus strand; and (ii) contacting the second complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby producing a first LPMOS, wherein the first LPMOS is a ligase enzyme. (iii) contacting the LPMOS with a second complex capable of hybridizing to the first forward primer oligonucleotide and the first reverse primer oligonucleotide; (iv) performing an amplification on the first LPMOS, where if the first synaptic protein is within a proximity distance threshold to the second synaptic protein, the amplification generates a first proximity signal; and (iv) detecting the first proximity signal in the blood sample, where the first proximity signal is indicative of an amount of the first complex in the blood sample. (v) contacting the blood sample obtained from the subject with a third affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, and a fourth affinity ligand specific for a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the third and fourth synaptic proteins are in a third complex, and the contacting produces a fourth complex comprising the third affinity ligand, the third synaptic protein, the fourth affinity ligand and the fourth synaptic protein;contacting the blood sample, wherein the third and fourth synaptic proteins are different proteins, the third affinity ligand binds to the second oligonucleotide positive strand, and the fourth affinity ligand binds to the second oligonucleotide negative strand; (vi) contacting the fourth complex with a second single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a second LPMOS, the second LPMOS being capable of hybridizing to the second forward primer oligonucleotide and the second reverse primer oligonucleotide; and (vii) performing amplification on the second LPMOS. (viii) detecting a second proximity signal in the blood sample, the second proximity signal being indicative of an amount of the third complex in the blood sample; and (ix) quantifying a ratio of the first complex to the third complex by dividing the amount of the first complex by the amount of the third complex, wherein a decrease in the ratio of the first complex to the second complex in the subject's blood sample compared to the ratio of the first complex to the second complex in a reference blood sample indicates a decline in learning and memory in the subject. In some embodiments, the method further comprises contacting the blood sample with an immobilized affinity ligand specific for the third synaptic protein.

[0033] In another aspect, the disclosure provides a method of assessing learning and memory in a subject identified as having or at risk of developing a neurological disease or disorder, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR and a second affinity ligand specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, where the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; and (ii) measuring the amount of the first complex in the subject's blood sample, where an increase in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample indicates a decrease in the subject's learning and memory. In some embodiments, the first affinity ligand binds to a first proximity detector and the second affinity ligand binds to a second proximity detector.

[0034] In another aspect, the disclosure provides a method of assessing learning and memory in a subject identified as having or at risk of developing a neurological disease or disorder, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, and a second affinity ligand specific for a second synaptic protein, where the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; and (ii) measuring the amount of the first complex in the subject's blood sample, wherein a decrease in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample indicates a decrease in the subject's learning and memory. In some embodiments, the first affinity ligand binds to a first proximity detector and the second affinity ligand binds to a second proximity detector.

[0035] In another aspect, the disclosure provides a method of assessing learning and memory in a subject identified as having or at risk for developing a neurological disease or disorder, the method comprising the steps of: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR and a second affinity ligand specific for a second synaptic protein, where the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; (ii) determining the amount of the first complex in the subject's blood sample; and (iii) contacting the blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR and a second affinity ligand specific for a second synaptic protein, where the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins. (iv) measuring the amount of the second complex in the subject's blood sample; and (v) quantifying the ratio of the first complex to the second complex by dividing the amount of the first complex by the amount of the second complex, wherein a decrease in the ratio of the first complex to the second complex in the subject's blood sample compared to the ratio of the first complex to the second complex in a reference blood sample indicates a decrease in learning and memory in the subject. In some embodiments, the method further comprises contacting the blood sample with an immobilized affinity ligand specific for the third synaptic protein. In some embodiments, the first affinity ligand comprises a first proximity detector and the second affinity ligand comprises a second proximity detector. In some embodiments, the third affinity ligand comprises a third proximity detector and the fourth affinity ligand comprises a fourth proximity detector.

[0036] In another aspect, the disclosure provides a method for quantifying an amount of a synaptic protein complex comprising two or more synaptic proteins in a blood sample of a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, and a second affinity ligand specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand, and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, and the first affinity ligand is an oncoprotein. The method includes contacting a blood sample with a single-stranded connector oligonucleotide, wherein a first affinity ligand is bound to the oligonucleotide plus strand and a second affinity ligand is bound to the oligonucleotide minus strand; (ii) contacting the second complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a ligated plus-minus oligonucleotide strand (LPMOS), wherein the LPMOS can hybridize to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iii) performing amplification on the LPMOS, wherein the amplification generates a proximity signal if the first synaptic protein is within a proximity distance threshold to the second synaptic protein; and (iv) detecting the proximity signal in the blood sample, wherein the proximity signal is indicative of the amount of synaptic protein in the blood sample.

[0037] In another aspect, the disclosure provides a method for quantifying an amount of a synaptic protein complex comprising two or more synaptic proteins in a blood sample of a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, and the first affinity ligand is bound to an oligonucleotide plus strand. and a second affinity ligand is attached to the oligonucleotide minus strand; (ii) contacting the second complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a ligated plus-minus oligonucleotide strand (LPMOS), where the LPMOS is capable of hybridizing to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iii) performing amplification on the LPMOS, where if the first synaptic protein is within a proximity distance threshold to the second synaptic protein, the amplification generates a proximity signal; and (iv) detecting the proximity signal in the blood sample, where the proximity signal is indicative of the amount of synaptic protein in the blood sample.

[0038] In another aspect, the disclosure provides a method for quantifying the amount of a synaptic protein complex comprising two or more synaptic proteins in a blood sample of a subject identified as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR and a second affinity ligand specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, where the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; and (ii) measuring the amount of the first complex in the subject's blood sample, where the amount of the first complex indicates the amount of the synaptic protein complex in the subject's blood sample. In some embodiments, the first affinity ligand binds to a first proximity detector and the second affinity ligand binds to a second proximity detector.

[0039] In another aspect, the disclosure provides a method for quantifying the amount of a synaptic protein complex comprising two or more synaptic proteins in a blood sample of a subject identified as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR and a second affinity ligand specific for a second synaptic protein, where the first and second synaptic proteins are present in a first complex, and the first and second synaptic proteins are different proteins; and (ii) measuring the amount of the first complex in the subject's blood sample, where the amount of the first complex indicates the amount of the synaptic protein complex in the subject's blood sample. In some embodiments, the first affinity ligand binds to a first proximity detector and the second affinity ligand binds to a second proximity detector.

[0040] In some embodiments of any of the aforementioned aspects, the method further comprises contacting the blood sample with an immobilized affinity ligand specific for the first synaptic protein, thereby capturing the ligand on a surface (e.g., a solid support such as a plate, a resin, a particle (e.g., a bead), etc.). In some embodiments of any of the aforementioned aspects, the method further comprises contacting the blood sample with an immobilized affinity ligand specific for a third synaptic protein, thereby capturing the ligand on the surface.

[0041] In another aspect, the disclosure provides a method of identifying a subject as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, where the first synaptic protein is part of a first complex with a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, where the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein and the second synaptic protein, where the first and second synaptic proteins are different proteins. (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, whereby a third complex is generated comprising the second complex, the second affinity ligand, and the third affinity ligand, where the second affinity ligand is bound to the oligonucleotide plus strand (e.g., SEQ ID NO:1) and the third affinity ligand is bound to the oligonucleotide minus strand (e.g., SEQ ID NO:2); and (iii) contacting the third complex with a single-stranded connector oligonucleotide (e.g., a splint oligonucleotide, e.g., SEQ ID NO:3) and a ligase enzyme (e.g., T4(iv) performing an amplification on the LPMOS, where the amplification generates a proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; and (v) detecting the proximity signal in the blood sample, where the proximity signal is indicative of an amount of the first complex in the blood sample, wherein an increase in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample identifies the subject as having or at risk for developing a neuropathy.

[0042] In another aspect, the disclosure provides a method of identifying a subject as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, where the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), where the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, and the second synaptic protein, where the first and second synaptic proteins are different proteins; and (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, where the contacting produces a third complex comprising the second complex, the second affinity ligand, and the third affinity ligand. (iii) contacting the third complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating an LPMOS, the LPMOS being capable of hybridizing to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iv) performing an amplification on the LPMOS, the amplification generating a proximity signal if the first synaptic protein is within a proximity distance threshold to the second synaptic protein; and (v) detecting the proximity signal in the blood sample, the proximity signal indicative of an amount of the first complex in the blood sample; wherein a decrease in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample identifies the subject as having or at risk for developing a neuropathy.

[0043] In another aspect, the disclosure provides a method of identifying a subject as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), and wherein the contacting identifies the first affinity ligand as a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, (ii) contacting the blood sample with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, wherein the contacting produces a third complex comprising the second complex, the second affinity ligand and the third affinity ligand, wherein the second affinity ligand is a first oligonucleotide. (iii) contacting the second complex with a first single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a first LPMOS, the first LPMOS being capable of hybridizing to the first forward primer oligonucleotide and the first reverse primer oligonucleotide; and (iv) performing amplification on the first LPMOS. (v) detecting the first proximity signal in the blood sample, the first proximity signal being indicative of an amount of the first complex in the blood sample; and (vi) contacting the blood sample obtained from the subject with a fourth affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, the fourth affinity ligand being immobilized on a surface,(vii) contacting the blood sample with a blood sample containing a blood sample having ... (ix) performing an amplification on the second LPMOS, where if the third synaptic protein is within a proximity distance threshold relative to the fourth synaptic protein, the amplification generates a second proximity signal; (x) detecting the second proximity signal in the blood sample, where the second proximity signal is indicative of an amount of the fourth complex in the blood sample; and (xi) quantifying a ratio of the first complex to the fourth complex by dividing the amount of the first complex by the amount of the fourth complex, wherein a decrease in the ratio of the first complex to the fourth complex in the subject's blood sample compared to the ratio of the first complex to the fourth complex in a reference blood sample identifies the subject as having or at risk for developing a neuropathy.

[0044] In another aspect, the disclosure provides a method of identifying a subject as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the contacting binds the first affinity ligand, the first synaptic protein, and a second synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR. (ii) contacting the blood sample with a first affinity ligand specific for the first synaptic protein and a second affinity ligand specific for the second synaptic protein, wherein the first and second synaptic proteins are different proteins; (iii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; and (iii) measuring the amount of the first complex in the subject's blood sample, wherein an increase in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample identifies the subject as having or at risk for developing a neuropathy.

[0045] In another aspect, the disclosure provides a method of identifying a subject as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), and wherein the contacting binds the first affinity ligand, the first synaptic protein, and the first synaptic protein to a first affinity ligand. (ii) contacting the blood sample with a first affinity ligand specific for the first synaptic protein and a second affinity ligand specific for the second synaptic protein, wherein a second complex is generated, the first and second synaptic proteins being different proteins; (iii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; and (iii) measuring the amount of the first complex in the subject's blood sample, wherein a decrease in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample identifies the subject as having or at risk for developing a neuropathy.

[0046] In another aspect, the disclosure provides a method of identifying a subject as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), and wherein the contacting identifies a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR. (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; (iii) measuring the amount of the first complex in the subject's blood sample; and (iv) contacting the blood sample from the subject with a ligand selected from the group consisting of NPTX2, NPTX1 and NPTXR. (v) contacting the blood sample with a fourth affinity ligand specific for a third synaptic protein immobilized on a surface, the third synaptic protein being part of a third complex with a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, the contacting producing a fourth complex comprising the fourth affinity ligand, the third synaptic protein and the fourth synaptic protein, the third and fourth synaptic proteins being different proteins; and (v) contacting the blood sample with a fourth affinity ligand specific for a third synaptic protein immobilized on a surface, the third synaptic protein being part of a third complex with a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, the contacting producing a fourth complex comprising the fourth affinity ligand, the third synaptic protein and the fourth synaptic protein, the third and fourth synaptic proteins being different proteins. contacting the complex with a fifth affinity ligand specific for a third synaptic protein and a sixth affinity ligand specific for a fourth synaptic protein; (vi) measuring the amount of the third complex in a blood sample of the subject; and (vii) quantifying a ratio of the first complex to the third complex by dividing the amount of the first complex by the amount of the third complex, wherein a decrease in the ratio of the first complex to the third complex in the blood sample of the subject compared to the ratio of the first complex to the third complex in a reference blood sample indicates that the subject has a neuropathy oror be identified as being at risk for developing a neurological disorder.

[0047] In another aspect, the disclosure provides a method of selecting a subject identified as having or at risk for developing a neuropathy, for treatment with a therapeutic agent, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, where the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, where the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, and the second synaptic protein, where the first and second synaptic proteins are different proteins; and (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, where the contacting produces a second complex comprising the second affinity ligand, the first synaptic protein, and the second synaptic protein, where the first and second synaptic proteins are different proteins. (iii) contacting the second complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating an LPMOS, the LPMOS being capable of hybridizing to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iv) performing an amplification on the LPMOS, the amplification generating a proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; and (v) detecting the proximity signal in the blood sample, the proximity signal indicative of an amount of the first complex in the blood sample; if the amount of the first complex in the subject's blood sample is increased compared to the amount of the first complex in a reference blood sample, the subject is selected for treatment with the therapeutic agent.

[0048] In another aspect, the disclosure provides a method of selecting a subject identified as having or at risk for developing a neuropathy, for treatment with a therapeutic agent, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, where the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), where the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, and the second synaptic protein, where the first and second synaptic proteins are different proteins; and (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, where the contacting produces a second complex comprising the second affinity ligand, the first synaptic protein, and the second synaptic protein, where the first and second synaptic proteins are different proteins. (iii) contacting the second complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating an LPMOS, the LPMOS being capable of hybridizing to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iv) performing an amplification on the LPMOS, the amplification generating a proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; and (v) detecting the proximity signal in the blood sample, the proximity signal indicative of an amount of the first complex in the blood sample; if the amount of the first complex in the subject's blood sample is decreased compared to the amount of the first complex in a reference blood sample, the subject is selected for treatment with the therapeutic agent.

[0049] In another aspect, the disclosure provides a method of selecting a subject identified as having or at risk of developing a neuropathy for treatment with a therapeutic agent, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is in a first affinity binding state with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1). (ii) contacting the blood sample with a first affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, wherein the first affinity ligand is part of a complex with a first synaptic protein, and the contacting produces a second complex comprising a first affinity ligand, a first synaptic protein, and a second synaptic protein, the first and second synaptic proteins being different proteins; and (iii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, wherein the contacting produces a third complex comprising the second complex, the second affinity ligand, and the third affinity ligand, (iii) contacting the third complex with a first single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a first LPMOS, the first LPMOS being capable of hybridizing to the first forward primer oligonucleotide and the first reverse primer oligonucleotide; (iv) performing an amplification on the first LPMOS, the amplification generating a first proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; (v) detecting the first proximity signal in the blood sample, the first proximity signal being indicative of the amount of the first complex in the blood sample; and (vi) contacting the blood sample obtained from the subject with a fourth affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR,(vii) contacting the blood sample with a blood sample, wherein the fourth affinity ligand is immobilized on the surface and the third synaptic protein is part of a fourth complex with a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the contacting produces a fifth complex comprising the fourth affinity ligand, the third synaptic protein and the fourth synaptic protein, wherein the third and fourth synaptic proteins are different proteins; (vii) contacting the fifth complex with a fifth affinity ligand specific for the third synaptic protein and a sixth affinity ligand specific for the fourth synaptic protein, wherein the contacting produces a sixth complex comprising the fifth complex, the fifth affinity ligand and the sixth affinity ligand, wherein the fifth affinity ligand is bound to the second oligonucleotide plus strand and the sixth affinity ligand is bound to the second oligonucleotide minus strand; and (viii) contacting the fifth complex with a second single-stranded connector oligonucleotide and a linker. (ix) performing an amplification on the second LPMOS, where the amplification generates a second proximity signal if the third synaptic protein is within a proximity distance threshold relative to the fourth synaptic protein; (x) detecting the second proximity signal in the blood sample, where the second proximity signal indicates the amount of the fourth complex in the blood sample; and (xi) quantifying the ratio of the first complex to the fourth complex by dividing the amount of the first complex by the amount of the fourth complex, where the ratio of the first complex to the fourth complex in the subject's blood sample is decreased compared to the ratio of the first complex to the fourth complex in the reference blood sample, the subject is selected for treatment with a therapeutic agent.

[0050] In another aspect, the disclosure provides a method of selecting a subject identified as having or at risk for developing a neuropathy, for treatment with a therapeutic agent, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, and wherein the contacting causes the first affinity ligand to bind to a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR. (ii) contacting the blood sample with a reference blood sample, wherein a second complex is generated comprising a first affinity ligand, a first synaptic protein, and a second synaptic protein, the first and second synaptic proteins being different proteins; (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; and (iii) measuring the amount of the first complex in the subject's blood sample, wherein if the amount of the first complex is increased in the subject's blood sample compared to the amount of the first complex in a reference blood sample, the subject is selected for treatment with a therapeutic agent.

[0051] In another aspect, the disclosure provides a method of selecting a subject identified as having or at risk for developing a neuropathy, for treatment with a therapeutic agent, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), and wherein the contacting causes the first affinity ligand to bind to a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR. (ii) contacting the blood sample with a reference blood sample, wherein a second complex is generated comprising a first affinity ligand, a first synaptic protein, and a second synaptic protein, the first and second synaptic proteins being different proteins; (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; and (iii) measuring the amount of the first complex in the subject's blood sample, wherein if the amount of the first complex is decreased in the subject's blood sample compared to the amount of the first complex in a reference blood sample, the subject is selected for treatment with a therapeutic agent.

[0052] In another aspect, the disclosure provides a method of selecting a subject identified as having or at risk of developing a neuropathy for treatment with a therapeutic agent, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is in a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1). (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; (iii) measuring the amount of the first complex in the subject's blood sample; and (iv) contacting the blood sample from the subject with NPTX2, NPTX1 and NPTX2. and contacting the blood sample with a fourth affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the fourth affinity ligand is immobilized on the surface, and the third synaptic protein is part of a third complex with a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, and the contacting produces a fourth complex comprising the fourth affinity ligand, the third synaptic protein and the fourth synaptic protein, and wherein the third and fourth synaptic proteins are different proteins. (v) contacting the fourth complex with a fifth affinity ligand specific for the third synaptic protein and a sixth affinity ligand specific for the fourth synaptic protein; (vi) measuring the amount of the third complex in the subject's blood sample; and (vii) quantifying the ratio of the first complex to the third complex by dividing the amount of the first complex by the amount of the third complex, wherein the subject is diagnosed as having a decreased ratio of the first complex to the third complex in the subject's blood sample compared to the ratio of the first complex to the third complex in a reference blood sample.Selected for treatment with a therapeutic agent.

[0053] In another aspect, the disclosure provides a method of assessing resilience of a subject identified as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR; (ii) contacting the blood sample with a first affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, wherein contacting produces a third complex comprising the second complex, the second affinity ligand and the third affinity ligand, wherein the second affinity ligand is an oligonucleotide. (iii) contacting the third complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating an LPMOS, the LPMOS being capable of hybridizing to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iv) performing an amplification on the LPMOS, the amplification generating a proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; and (v) detecting the proximity signal in the blood sample, the proximity signal indicative of an amount of the first complex in the blood sample; if the amount of the first complex in the subject's blood sample is increased compared to the amount of the first complex in a reference blood sample, the subject is determined to be not resilient to the neuropathy; and if the amount of the first complex in the subject's blood sample is unchanged or decreased compared to the amount of the first complex in the reference blood sample, the subject is determined to be not resilient to the neuropathy.It is considered to be resilient against neurological disorders.

[0054] In another aspect, the disclosure provides a method of assessing resilience of a subject identified as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), and ... affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), and the first affinity ligand is immobilized on a surface, and the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic (ii) contacting the blood sample with a first affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, wherein contacting produces a third complex comprising the second complex, the second affinity ligand and the third affinity ligand, wherein the second affinity ligand is an oligonucleotide. (iii) contacting the third complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating an LPMOS, the LPMOS being capable of hybridizing to a forward primer oligonucleotide and a reverse primer oligonucleotide; (iv) performing an amplification on the LPMOS, the amplification generating a proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; and (v) detecting the proximity signal in the blood sample, the proximity signal indicative of an amount of the first complex in the blood sample; if the amount of the first complex in the subject's blood sample is decreased compared to the amount of the first complex in a reference blood sample, the subject is determined to be not resilient to neurological damage; and if the amount of the first complex in the subject's blood sample is unchanged or increased compared to the amount of the first complex in the reference blood sample, the subject is determined to be not resilient to neurological damage.It is considered to have resilience against neurological disorders.

[0055] In another aspect, the disclosure provides a method of assessing resilience of a subject identified as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), and ... affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), and the first affinity ligand is immobilized on a surface, and the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic (ii) contacting the blood sample with a first affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, wherein contacting produces a third complex comprising the second complex, the second affinity ligand and the third affinity ligand, wherein the second affinity ligand is a first oligonucleotide. (iii) contacting the second complex with a first single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a first LPMOS, the first LPMOS being capable of hybridizing to the first forward primer oligonucleotide and the first reverse primer oligonucleotide; and (iv) performing amplification on the first LPMOS. performing an amplification step, where the amplification generates a first proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; (v) detecting the first proximity signal in the blood sample, where the first proximity signal is indicative of an amount of the first complex in the blood sample; and (vi) contacting the blood sample obtained from the subject with a fourth affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, where the fourth affinity ligand is immobilized on a surface;(vii) contacting the blood sample with a fourth affinity ligand specific for the third synaptic protein and a sixth affinity ligand specific for the fourth synaptic protein, the fourth synaptic protein being part of a fourth complex with a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, the contacting producing a fifth complex comprising the fourth affinity ligand, the third synaptic protein and the fourth synaptic protein, the third and fourth synaptic proteins being different proteins; and (vii) contacting the fifth complex with a fifth affinity ligand specific for the third synaptic protein and a sixth affinity ligand specific for the fourth synaptic protein. (viii) contacting the fifth complex with a second single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a second LPMOS, the second LPMOS comprising a second forward primer oligonucleotide and a fifth affinity ligand, the fifth affinity ligand binding to the second oligonucleotide plus strand and the sixth affinity ligand binding to the second oligonucleotide minus strand; and (viii) contacting the fifth complex with a second single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a second LPMOS, the second LPMOS comprising a second forward primer oligonucleotide and a sixth affinity ligand, the fifth affinity ligand binding to the second oligonucleotide plus strand and the sixth affinity ligand binding to the second oligonucleotide minus strand. (ix) performing amplification on the second LPMOS, where if the third synaptic protein is within a proximity distance threshold to the fourth synaptic protein, the amplification generates a second proximity signal; (x) detecting the second proximity signal in the blood sample, where the second proximity signal indicates an amount of the fourth complex in the blood sample; and (xi) calculating the amount of the first complex relative to the amount of the fourth complex. and quantifying the ratio of the first complex to the fourth complex by dividing by the amount of the first complex to the fourth complex in the blood sample of the subject; if the ratio of the first complex to the fourth complex in the blood sample of the subject is decreased compared to the ratio of the first complex to the fourth complex in the reference blood sample, the subject is determined to be not resilient to the neuropathy; and if the ratio of the first complex to the fourth complex in the blood sample of the subject is unchanged or increased compared to the ratio of the first complex to the fourth complex in the reference blood sample, the subject is determined to be resilient to the neuropathy.

[0056] In another aspect, the disclosure provides a method of assessing resilience in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein and the second synaptic protein, The method includes (i) contacting a blood sample with a first affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, the first and second synaptic proteins being different proteins; (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; and (iii) measuring the amount of the first complex in the subject's blood sample, wherein if the amount of the first complex in the subject's blood sample is increased compared to the amount of the first complex in a reference blood sample, the subject is determined to be not resilient to neurological damage, and if the amount of the first complex in the subject's blood sample is unchanged or decreased compared to the amount of the first complex in the reference blood sample, the subject is determined to be resilient to neurological damage.

[0057] In another aspect, the disclosure provides a method of assessing resilience in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), wherein the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, and the second synaptic protein, The method includes (i) contacting a blood sample with a first affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, wherein the first and second synaptic proteins are different proteins; (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; and (iii) measuring the amount of the first complex in the subject's blood sample, wherein if the amount of the first complex in the subject's blood sample is decreased compared to the amount of the first complex in a reference blood sample, the subject is determined to be not resilient to neurological damage, and if the amount of the first complex in the subject's blood sample is unchanged or increased compared to the amount of the first complex in the reference blood sample, the subject is determined to be resilient to neurological damage.

[0058] In another aspect, the disclosure provides a method of assessing resilience in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1). (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; (iii) measuring the amount of the first complex in the subject's blood sample; and (iv) contacting the blood sample from the subject with NPTX2, NPTX1 and NPTXR. contacting the blood sample with a fourth affinity ligand specific for a third synaptic protein selected from the group consisting of: NPTX2, NPTX1 and NPTXR, wherein the fourth affinity ligand is immobilized on a surface, and the third synaptic protein is part of a third complex with a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the contacting produces a fourth complex comprising the fourth affinity ligand, the third synaptic protein and the fourth synaptic protein, wherein the third and fourth synaptic proteins are different proteins; (v) contacting the fourth complex with a fifth affinity ligand specific for the third synaptic protein and a sixth affinity ligand specific for the fourth synaptic protein; (vi) measuring the amount of the third complex in the subject's blood sample; and (vii) quantifying the ratio of the first complex to the third complex by dividing the amount of the first complex by the amount of the third complex, wherein if the ratio of the first complex to the third complex in the subject's blood sample is decreased compared to the ratio of the first complex to the fourth complex in a reference blood sample, the subject isThe subject is determined to be resilient to neuropathy if the ratio of the first complex to the third complex in the subject's blood sample is unchanged or decreased compared to the ratio of the first complex to the fourth complex in the reference blood sample.

[0059] In another aspect, the disclosure provides a method of determining the therapeutic efficacy of an agent in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, where the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, where the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, and the second synaptic protein, where the first and second synaptic proteins are different proteins; and (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, where the contacting produces a second complex comprising the second complex, the second affinity ligand, and the third affinity ligand. (iii) contacting the third complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating an LPMOS, the LPMOS being capable of hybridizing to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iv) performing an amplification on the LPMOS, the amplification generating a proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; and (v) detecting the proximity signal in the blood sample, the proximity signal indicative of an amount of the first complex in the blood sample; and the agent is determined to be therapeutically effective for the subject if the amount of the first complex in the subject's blood sample is unchanged or decreased compared to the amount of the first complex in the reference blood sample.

[0060] In another aspect, the disclosure provides a method of determining the therapeutic efficacy of an agent in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, where the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), where the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, and the second synaptic protein, where the first and second synaptic proteins are different proteins; and (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, where the contacting produces a second complex comprising the second affinity ligand, the second affinity ligand, and the third affinity ligand. (iii) contacting the third complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating an LPMOS, the LPMOS being capable of hybridizing to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iv) performing an amplification on the LPMOS, the amplification generating a proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; and (v) detecting the proximity signal in the blood sample, the proximity signal indicative of an amount of the first complex in the blood sample; and if the amount of the first complex in the subject's blood sample is unchanged or increased compared to the amount of the first complex in the reference blood sample, the agent is determined to be therapeutically effective for the subject.

[0061] In another aspect, the disclosure provides a method of determining the therapeutic efficacy of an agent in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is in a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1). (ii) contacting the blood sample with a first affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, the third affinity ligand being part of a combination of the first and second synaptic proteins, the contacting producing a second complex comprising a first affinity ligand, a first synaptic protein, and a second synaptic protein, the first and second synaptic proteins being different proteins; and (iii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, the contacting producing a third complex comprising the second complex, the second affinity ligand, and the third affinity ligand, the second parent synaptic protein being part of a combination of the first and second synaptic proteins. (iii) contacting the third complex with a first single-stranded connector oligonucleotide and a ligase enzyme, thereby generating a first LPMOS, the first LPMOS being capable of hybridizing to the first forward primer oligonucleotide and the first reverse primer oligonucleotide; (iv) performing an amplification on the first LPMOS, the amplification generating a first proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; (v) detecting the first proximity signal in the blood sample, the first proximity signal being indicative of the amount of the first complex in the blood sample; and (vi) contacting the blood sample obtained from the subject with a fourth affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR,(vii) contacting the blood sample with a blood sample, wherein the fourth affinity ligand is immobilized on a surface and the third synaptic protein is part of a fourth complex with a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, whereby a fifth complex is generated comprising the fourth affinity ligand, the third synaptic protein and the fourth synaptic protein, whereby the third and fourth synaptic proteins are different proteins; (vii) contacting the fifth complex with a fifth affinity ligand specific for the third synaptic protein and a sixth affinity ligand specific for the fourth synaptic protein, whereby a sixth complex is generated comprising the fifth complex, the fifth affinity ligand and the sixth affinity ligand, whereby the fifth affinity ligand is bound to the second oligonucleotide plus strand and the sixth affinity ligand is bound to the second oligonucleotide minus strand; and (viii) contacting the fifth complex with a second single-stranded connector oligonucleotide and a ligase enzyme. (ix) performing an amplification on the second LPMOS, where the amplification generates a second proximity signal if the third synaptic protein is within a proximity distance threshold relative to the fourth synaptic protein; (x) detecting the second proximity signal in the blood sample, where the second proximity signal indicates an amount of the fourth complex in the blood sample; and (xi) quantifying the ratio of the first complex to the fourth complex by dividing the amount of the first complex by the amount of the fourth complex, where the drug is determined to be therapeutically effective for the subject if the ratio of the first complex to the fourth complex in the subject's blood sample is unchanged or increased compared to the ratio of the first complex to the fourth complex in the reference blood sample.

[0062] In another aspect, the disclosure provides a method of determining the therapeutic efficacy of an agent in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, and wherein the contacting binds the first affinity ligand, the first synaptic protein, and the first affinity ligand to a surface. The method includes the steps of: (i) contacting a blood sample with a second synaptic protein, wherein a second complex is generated, the second complex comprising a synaptic protein and a second synaptic protein, the first and second synaptic proteins being different proteins; (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; and (iii) measuring the amount of the first complex in the subject's blood sample, wherein the agent is determined to be therapeutically effective for the subject if the amount of the first complex in the subject's blood sample is unchanged or decreased compared to the amount of the first complex in a reference blood sample.

[0063] In another aspect, the disclosure provides a method of determining the therapeutic efficacy of an agent in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), and wherein the contacting binds the first affinity ligand, the first synaptic protein, and the first affinity ligand to a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR. The method includes contacting a blood sample with a second synaptic protein, wherein a second complex is generated comprising a synaptic protein and a second synaptic protein, the first and second synaptic proteins being different proteins; (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; and (iii) measuring the amount of the first complex in the subject's blood sample, wherein the agent is determined to be therapeutically effective for the subject if the amount of the first complex in the subject's blood sample is unchanged or increased compared to the amount of the first complex in a reference blood sample.

[0064] In another aspect, the disclosure provides a method of determining the therapeutic efficacy of an agent in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein forms a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1). (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; (iii) measuring the amount of the first complex in the subject's blood sample; and (iv) contacting the blood sample from the subject with NPTX2, NPTX1 and NSP-1, wherein the contacting produces a second complex comprising a first affinity ligand, a first synaptic protein and a second synaptic protein, the first and second synaptic proteins being different proteins. contacting the blood sample with a fourth affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the fourth affinity ligand is immobilized on a surface, and the third synaptic protein is part of a third complex with a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, the contacting producing a fourth complex comprising the fourth affinity ligand, the third synaptic protein and the fourth synaptic protein, wherein the third and fourth synaptic proteins are different proteins. (v) contacting the fourth complex with a fifth affinity ligand specific for the third synaptic protein and a sixth affinity ligand specific for the fourth synaptic protein; (vi) measuring the amount of the third complex in the subject's blood sample; and (vii) quantifying the ratio of the first complex to the third complex by dividing the amount of the first complex by the amount of the third complex, wherein the ratio of the first complex to the third complex in the subject's blood sample is unchanged compared to the ratio of the first complex to the third complex in a reference blood sample.If so, the agent is determined to be therapeutically effective in the subject.

[0065] In another aspect, the disclosure provides a method of assessing learning and memory in a subject identified as having or at risk for developing a neurological disease or disorder, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, where the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, where the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein and the second synaptic protein, where the first and second synaptic proteins are different proteins; and (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, where the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein and the second synaptic protein. (iii) contacting the third complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating an LPMOS, the LPMOS being capable of hybridizing to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iv) performing an amplification on the LPMOS, the amplification generating a proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; and (v) detecting the proximity signal in the blood sample, the proximity signal indicative of an amount of the first complex in the blood sample, wherein an increase in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample indicates a decline in learning and memory in the subject.

[0066] In another aspect, the disclosure provides a method of assessing learning and memory in a subject identified as having or at risk for developing a neurological disease or disorder, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, where the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), where the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, and the second synaptic protein, where the first and second synaptic proteins are different proteins; and (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, where the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, and the second synaptic protein, where the first and second synaptic proteins are different proteins. (iii) contacting the third complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating an LPMOS, the LPMOS being capable of hybridizing to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iv) performing an amplification on the LPMOS, the amplification generating a proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; and (v) detecting the proximity signal in the blood sample, the proximity signal indicative of an amount of the first complex in the blood sample, wherein a decrease in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in the reference blood sample indicates a decrease in learning and memory in the subject.

[0067] In another aspect, the disclosure provides a method of assessing learning and memory in a subject identified as having or at risk for developing a neurological disease or disorder, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is linked to a second synaptic protein (e.g., any of the synaptic proteins listed in Table 1). (i) contacting a blood sample with a first synaptic protein that is part of a first complex with a first synaptic protein, the first synaptic protein being part of a second ... (iii) contacting the third complex with a first single-stranded connector oligonucleotide and a ligase enzyme, thereby generating LPMOSs, the first LPMOSs being capable of hybridizing to the first forward primer oligonucleotide and the first reverse primer oligonucleotide; (iv) performing an amplification on the first LPMOSs, the amplification generating a first proximity signal if the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein; (v) detecting the first proximity signal in the blood sample, the first proximity signal being indicative of the amount of the first complex in the blood sample; and (vi) contacting the blood sample obtained from the subject with a fourth affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR,(vii) contacting the blood sample with a blood sample, wherein the fourth affinity ligand is immobilized on the surface and the third synaptic protein is part of a fourth complex with a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the contacting produces a fifth complex comprising the fourth affinity ligand, the third synaptic protein and the fourth synaptic protein, wherein the third and fourth synaptic proteins are different proteins; (vii) contacting the fifth complex with a fifth affinity ligand specific for the third synaptic protein and a sixth affinity ligand specific for the fourth synaptic protein, wherein the contacting produces a sixth complex comprising the fifth complex, the fifth affinity ligand and the sixth affinity ligand, wherein the fifth affinity ligand is bound to the second oligonucleotide plus strand and the sixth affinity ligand is bound to the second oligonucleotide minus strand; and (viii) contacting the fifth complex with a second single-stranded connector oligonucleotide. (ix) performing an amplification on the second LPMOS, where the amplification generates a second proximity signal if the third synaptic protein is within a proximity distance threshold relative to the fourth synaptic protein; (x) detecting the second proximity signal in the blood sample, where the second proximity signal indicates an amount of the fourth complex in the blood sample; and (xi) quantifying the ratio of the first complex to the fourth complex by dividing the amount of the first complex by the amount of the fourth complex, wherein a decrease in the ratio of the first complex to the fourth complex in the blood sample of the subject compared to the ratio of the first complex to the fourth complex in the reference blood sample indicates a decrease in learning and memory of the subject.

[0068] In another aspect, the disclosure provides a method of assessing learning and memory in a subject identified as having or at risk for developing a neurological disease or disorder, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, (ii) contacting the blood sample with a first affinity ligand, a first synaptic protein, and a second synaptic protein, whereby a second complex is generated, the second complex comprising a first affinity ligand, a first synaptic protein, and a second synaptic protein, wherein the first and second synaptic proteins are different proteins; (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; and (iii) measuring the amount of the first complex in the subject's blood sample, wherein an increase in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample indicates a decline in learning and memory in the subject.

[0069] In another aspect, the disclosure provides a method of assessing learning and memory in a subject identified as having or at risk for developing a neurological disease or disorder, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), and (ii) contacting the blood sample with a first affinity ligand, a first synaptic protein, and a second synaptic protein, whereby a second complex is generated, the second complex comprising a first affinity ligand, a first synaptic protein, and a second synaptic protein, the first and second synaptic proteins being different proteins; (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; and (iii) measuring the amount of the first complex in the subject's blood sample, wherein a decrease in the amount of the first complex in the subject's blood sample compared to the amount of the first complex in a reference blood sample indicates a decline in learning and memory in the subject.

[0070] In another aspect, the disclosure provides a method of assessing learning and memory in a subject identified as having or at risk for developing a neurological disease or disorder, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is linked to a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1). (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; (iii) measuring the amount of the first complex in the subject's blood sample; and (iv) contacting the blood sample from the subject with NPTX2, contacting the blood with a fourth affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX1 and NPTXR, the fourth affinity ligand being immobilized on a surface, the third synaptic protein being part of a third complex with a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, the contacting producing a fourth complex comprising the fourth affinity ligand, the third synaptic protein and the fourth synaptic protein, the third and fourth synaptic proteins being different proteins; (v) contacting the fourth complex with a fifth affinity ligand specific for the third synaptic protein and a sixth affinity ligand specific for the fourth synaptic protein; (vi) measuring the amount of the third complex in the subject's blood sample; and (vii) quantifying the ratio of the first complex to the third complex by dividing the amount of the first complex by the amount of the third complex, wherein a decrease in the ratio of the first complex to the third complex in the subject's blood sample compared to the ratio of the first complex to the fourth complex in a reference blood sample indicatesThe subject shows a decline in learning and memory.

[0071] In another aspect, the disclosure provides a method for quantifying an amount of a synaptic protein complex comprising two or more synaptic proteins in a blood sample of a subject identified as having or at risk for developing a neurological disease or disorder, the method comprising: (i) contacting the blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, where the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, where the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein and the second synaptic protein, where the first and second synaptic proteins are different proteins; and (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a second affinity ligand specific for the second synaptic protein. (iii) contacting the third complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating an LPMOS, the LPMOS being capable of hybridizing to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iv) performing amplification on the LPMOS, the amplification generating a proximity signal if the first synaptic protein is within a proximity distance threshold to the second synaptic protein; and (v) detecting the proximity signal in the blood sample, the proximity signal indicative of the amount of synaptic protein in the blood sample.

[0072] In another aspect, the disclosure provides a method for quantifying an amount of a synaptic protein complex comprising two or more synaptic proteins in a blood sample of a subject identified as having or at risk for developing a neurological disease or disorder, the method comprising: (i) contacting the blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, where the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein (e.g., any one of the synaptic proteins listed in Table 1), whereby a second complex comprising the first affinity ligand, the first synaptic protein, and the second synaptic protein is generated, wherein the first and second synaptic proteins are different proteins; and (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a second affinity ligand specific for the second synaptic protein. (iii) contacting the third complex with a single-stranded connector oligonucleotide and a ligase enzyme, thereby generating an LPMOS, the LPMOS being capable of hybridizing to the forward primer oligonucleotide and the reverse primer oligonucleotide; (iv) performing amplification on the LPMOS, the amplification generating a proximity signal if the first synaptic protein is within a proximity distance threshold to the second synaptic protein; and (v) detecting the proximity signal in the blood sample, the proximity signal indicative of the amount of synaptic protein in the blood sample.

[0073] In another aspect, the disclosure provides a method for quantifying an amount of a synaptic protein complex comprising two or more synaptic proteins in a blood sample of a subject identified as having or at risk for developing a neurological disease or disorder, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR; The method includes (i) contacting a blood sample with a first affinity ligand specific for the first synaptic protein, the first affinity ligand being part of a first complex with a synaptic protein, wherein the contact generates a second complex comprising a first affinity ligand, the first synaptic protein, and a second synaptic protein, the first and second synaptic proteins being different proteins; (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; and (iii) measuring the amount of the first complex in the subject's blood sample, wherein the amount of the first complex is indicative of the amount of synaptic protein complex in the subject's blood sample.

[0074] In another aspect, the disclosure provides a method for quantifying an amount of a synaptic protein complex comprising two or more synaptic proteins in a blood sample of a subject identified as having or at risk for developing a neurological disease or disorder, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the first affinity ligand is immobilized on a surface, and the first synaptic protein is part of a first complex with a second synaptic protein, and wherein the contacting results in the first affinity ligand being immobilized on a surface, the first synaptic protein being part of a first complex with a second synaptic protein, (ii) contacting the blood sample with an affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein; and (iii) measuring the amount of the first complex in the subject's blood sample, wherein the amount of the first complex indicates the amount of synaptic protein complex in the subject's blood sample.

[0075] In some embodiments of any of the above aspects, the first synaptic protein is NPTX2 and the second synaptic protein is NPTXR, or the first synaptic protein is NPTXR and the second synaptic protein is NPTX2. In some embodiments of any of the above aspects, the first synaptic protein is NPTX1 and the second synaptic protein is NPTXR, or the first synaptic protein is NPTXR and the second synaptic protein is NPTX1. In some embodiments of any of the above aspects, the first synaptic protein is NPTX2 and the second synaptic protein is NPTX1, or the first synaptic protein is NPTX1 and the second synaptic protein is NPTX2. In some embodiments of any of the above aspects, the third synaptic protein is NPTX2 and the fourth synaptic protein is NPTXR, or the third synaptic protein is NPTXR and the fourth synaptic protein is NPTX2. In some embodiments of any of the aforementioned aspects, the third synaptic protein is NPTX1 and the fourth synaptic protein is NPTXR, or the third synaptic protein is NPTXR and the fourth synaptic protein is NPTX. In some embodiments of any of the aforementioned aspects, the first synaptic protein is NPTX2 and the second synaptic protein is NPTX1, or the third synaptic protein is NPTX1 and the fourth synaptic protein is NPTX2.

[0076] In some embodiments of any of the preceding aspects, the first synaptic protein is NPTX2 and the second synaptic protein is glutamate ionotropic receptor AMPA type subunit 4 (GluA4). In some embodiments of any of the preceding aspects, the first synaptic protein is NPTX1 and the second synaptic protein is GluA4. In some embodiments of any of the preceding aspects, the first synaptic protein is NPTXR and the second synaptic protein is GluA4. In some embodiments of any one of the preceding aspects, the first synaptic protein is NPTX2 and the second synaptic protein is glutamate ionotropic receptor AMPA type subunit 1 (GluA1). In some embodiments of any of the preceding aspects, the first synaptic protein is NPTX1 and the second synaptic protein is GluA1. In some embodiments of any of the preceding aspects, the first synaptic protein is NPTXR and the second synaptic protein is GluA1.

[0077] In some embodiments of the aforementioned aspects and embodiments, the second affinity ligand comprises a first proximity detector and the third affinity ligand comprises a second proximity detector. In some embodiments, the first and second proximity detectors generate a first proximity signal when the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein, the first proximity signal indicating the amount of the first complex in the blood sample of the subject. In some embodiments, the fifth affinity ligand comprises a third proximity detector and the third affinity ligand comprises a fourth proximity detector. In some embodiments, the third and fourth proximity detectors generate a second proximity signal when the third synaptic protein is within a proximity distance threshold relative to the fourth synaptic protein, the second proximity signal indicating the amount of the third complex in the blood sample of the subject.

[0078] In some embodiments of any of the aforementioned aspects and embodiments, the first, second, third and / or fourth proximity detector is selected from the group consisting of an oligonucleotide, a fluorescence resonance energy transfer (FRET) chromophore or a bioluminescence resonance energy transfer (BRET) chromophore, a biomolecular fluorescence complementation (BiFC) protein or fragment thereof, and an enzyme capable of generating a reactive biotin species.

[0079] In some embodiments of any of the foregoing aspects and embodiments, the first, second, third and / or fourth proximity detectors are oligonucleotides. In some embodiments, the first and third proximity detectors comprise an oligonucleotide plus strand (e.g., SEQ ID NO:1) and the second and fourth proximity detectors comprise an oligonucleotide minus strand (e.g., SEQ ID NO:2). In some embodiments, the oligonucleotide plus and minus strands are configured to hybridize to a connector oligonucleotide (e.g., SEQ ID NO:3). In some embodiments, the oligonucleotide plus strand is configured to hybridize to a forward primer (e.g., SEQ ID NO:4) and the oligonucleotide minus strand is configured to hybridize to a reverse primer (e.g., SEQ ID NO:5).

[0080] In some embodiments of any of the foregoing aspects and embodiments, the first, second, third and / or fourth proximity detector is a FRET or BRET chromophore. In some embodiments, the FRET or BRET chromophore comprises a pair of fluorescent proteins selected from the group consisting of a cyan fluorescent protein (CFP)-yellow fluorescent protein (YFP) pair and luciferase-YFP. In some embodiments, each of the proteins in the pair of fluorescent proteins is independently fused or conjugated to a separate proximity detector.

[0081] In some embodiments of any of the foregoing aspects and embodiments, the first, second, third and fourth proximity detectors comprise an enzyme capable of generating a reactive biotin species. In some embodiments, the enzyme capable of generating a reactive biotin species is selected from the group consisting of E. coli biotin ligase, A. aeolicus biotin ligase, B. subtilis biotin ligase, and ascorbate peroxidase. In some embodiments, the enzyme capable of generating a reactive biotin species comprises two complementary halves of an enzyme, each of the two complementary halves being independently fused or conjugated to a separate proximity detector.

[0082] In some embodiments of any of the foregoing aspects and embodiments, the first and second and / or third and fourth proximity detectors are each independently complementary halves of a bimolecular BiFC protein. In some embodiments, the BiFC protein is enhanced green fluorescent protein (EGFP), YFP, enhanced CFP (ECFP), red fluorescent protein (RFP), enhanced blue fluorescent protein (EBFP), mCherry, mHoneydew, mBanana, mOrange, tdTomato, mTangerine, mStrawberry, mCherry, mGrapel, mRaspberry, mGrape2, mPlum, dsRed, or a luciferase (e.g., Renilla luciferase, firefly luciferase, click beetle luciferase, cabbage luciferase, bacterial luciferase, or dinoflagellate luciferase).

[0083] In some embodiments of the foregoing aspects and embodiments, each of the first, second, third, fourth, fifth and / or sixth affinity ligands comprises an antibody or antigen-binding fragment thereof, a single chain polypeptide or oligopeptide, or an aptamer (e.g., a nucleic acid aptamer). In some embodiments, the first, second, third, fourth, fifth and / or sixth affinity ligand is an antibody or antigen-binding fragment thereof. In some embodiments, the first, second, third, fourth, fifth and / or sixth affinity ligand is a single chain polypeptide or oligopeptide. In some embodiments, the single chain polypeptide or oligopeptide is a snake venom toxin. In some embodiments, the snake venom toxin is taipoxin. In some embodiments, the first, second, third, fourth, fifth and / or sixth affinity ligand is an aptamer.

[0084] In some embodiments of any of the foregoing aspects and embodiments, the neurological disorder is selected from the group consisting of a neurodegenerative disorder, a neurodevelopmental disorder, and a neuropsychiatric disorder. In some embodiments, the neurodegenerative disorder is age-related cognitive decline, Alzheimer's disease (AD, e.g., late-onset (sporadic) or familial AD), Down's syndrome, normal pressure hydrocephalus, Alzheimer's disease-related dementia (ADRD), Parkinson's disease, Huntington's disease, motor neuron disease, spinocerebellar ataxia, spinal muscular atrophy, Friedreich's ataxia, prion disease, or lysosomal storage disorder. In some embodiments, the AD is sporadic AD or familial AD. In some embodiments, the ADRD is frontotemporal dementia, dementia with Lewy bodies, vascular cognitive impairment and dementia, or mixed etiology dementia. In some embodiments, the neurodevelopmental disorder is intellectual disability, X-linked intellectual disability, learning disability, autism spectrum disorder, developmental movement disorder, tic disorder, cerebral palsy, communication and language disorder, fragile X syndrome, Down syndrome, attention deficit hyperactivity disorder, or neurotoxicity-induced neurodevelopmental disorder. In some embodiments, the neuropsychiatric disorder is major depression, bipolar disorder, obsessive-compulsive disorder, eating disorder, or schizophrenia.

[0085] In some embodiments of any of the aforementioned aspects and embodiments, the blood sample is a serum sample or a plasma sample. In some embodiments of any of the aforementioned aspects and embodiments, the proximity distance threshold is equal to or less than 40 nm, 35 nm, 25 nm, 20 nm, 15 nm, 10 nm, 5 nm, or 1 nm.

[0086] In some embodiments of any of the foregoing aspects and embodiments, one or more of the first, second, third and / or fourth synaptic proteins are isolated from exosomes of a sample of the subject.

[0087] In some embodiments of any of the aforementioned aspects and embodiments, the amplification is carried out using quantitative real-time polymerase chain reaction. In some embodiments of any of the foregoing aspects and embodiments, the subject is a human. [Brief description of the drawings]

[0088] [Figure 1]1 shows a schematic diagram of an exemplary proximity ligation assay (PLA) of the present disclosure. A blood sample (e.g., blood, serum or plasma) from a subject (e.g., a subject identified as having or at risk of developing a neuropathy) is contacted with a first NPTX2 antibody immobilized on a surface (e.g., a solid support, e.g., a plate, resin, particle, vessel) in a reaction vessel (e.g., a plate) to capture synaptic protein complexes including anti-neuronal pentraxin 2 (NPTX2) and neuronal pentraxin receptor (NPTXR). The immobilized anti-NPTX2 antibody captures the NPTX2-NPTXR complex on the surface of the reaction vessel. A second anti-NPTX2 antibody bound to the 5' end of an oligonucleotide plus strand (e.g., SEQ ID NO: 1) and an anti-PTXR antibody bound to the 3' end of an oligonucleotide minus strand (e.g., SEQ ID NO: 2) are added to the reaction mixture. A ligation mixture containing a connector (e.g., splint) oligonucleotide (SEQ ID NO: 3) capable of binding at or near the 3' end of the oligonucleotide plus strand and at or near the 5' end of the oligonucleotide minus strand, as well as a ligase (e.g., T4 DNA ligase) are then added to the reaction vessel. With sufficient physical proximity between the plus and minus strands, the connector oligonucleotide hybridizes to both the plus and minus strands, bringing them close enough together to facilitate ligation at the ligation sites indicated by the black arrows at the 3' end of the plus strand and the 5' end of the minus strand. The ligated plus-minus oligonucleotide strands (LPMOS) are then amplified using quantitative real-time polymerase chain reaction (qRT-PCR) by annealing a forward primer (e.g., SEQ ID NO: 4) upstream of the ligation site and a reverse primer (SEQ ID NO: 5) downstream of the ligation site. The amplified LPMOS are quantified to assess the level of the target synaptic protein, in this case the complex of NPTX2 and NPTXR, in the subject's blood sample. [Diagram 2]Scatter plot of NPTX2 levels from cerebrospinal fluid (CSF) measured by ELISA and the levels of NPTX2-NPTXR complex measured independently by the PLA method of the present disclosure. Pearson correlation analysis shows that PLA measurements are strongly correlated with ELISA measurements (n=12). [Figure 3A] Shown is a scatter plot of quantified NPTX2-NPTXR protein complexes measured by PLA in plasma serially diluted in phosphate-buffered saline (PBS) + 1% bovine serum albumin (BSA). The solid line represents a four-parameter logistic regression performed on the dilution curve. [Figure 3B] Scatter plots of quantified NPTX2-NPTXR protein complexes measured by PLA in plasma serially diluted with NPTX2-depleted plasma. The solid lines represent four-parameter logistic regressions performed on the dilution curves. [Figure 4] Scatter plots of quantified NPTX2-NPTXR protein complexes measured by PLA in plasma samples from clinically diagnosed Alzheimer's disease (AD) patients and matched healthy controls (Ctrl). NPTX2-NPTXR tended to be elevated in the AD group (Control: n=34, AD: n=33, p=0.109, two-tailed t-test). Mean values ​​± standard error of the mean (SEM) are shown as solid lines overlaid on the data points. [Figure 5A] 1 shows a dilution plot obtained from a PLA experiment assaying the presence of a complex of NPTX2 and glutamate ionotropic receptor AMPA subunit 4 (GluA4) proteins in human plasma samples. In this case, anti-NPTX2 antibodies were immobilized on a solid support, and oligonucleotide-conjugated anti-NPTX2 and GluA4 antibodies were used. Plasma samples were serially diluted 2-fold with PBS or NPTX2-depleted plasma. The solid lines represent a four-parameter logistic regression applied to the dilution curves. [Figure 5B]1 shows a dilution plot obtained from a PLA experiment assaying the presence of a complex of NPTX2 and glutamate ionotropic receptor AMPA subunit 4 (GluA4) proteins in human plasma samples. In this case, anti-NPTX2 antibodies were immobilized on a solid support, and oligonucleotide-conjugated anti-NPTX2 and GluA4 antibodies were used. Plasma samples were serially diluted 2-fold with PBS or NPTX2-depleted plasma. The solid lines represent a four-parameter logistic regression applied to the dilution curves. [Figure 6A] Scatter plots of synaptic protein complexes measured by PLA in plasma samples from clinically diagnosed AD patients and healthy controls (Ctrl). PLA assays were performed to detect levels of NPTX2-GLuA4 complexes and showed no significant differences between control and AD patients. Mean values ​​± SEM are shown as solid lines overlaid on the data points. [Figure 6B] Scatter plots of synaptic protein complexes measured by PLA in plasma samples from clinically diagnosed AD patients and healthy controls (Ctrl). When normalized by the levels of NPTX2-NPTXR complexes in the samples, NPTX2-GluA4 levels are significantly decreased in AD patients compared to control patients (control: n=34, AD: n=33, p=0.039, two-tailed t-test). Mean values ​​± SEM are shown as solid lines overlaid on the data points. [Figure 7A] 1 shows a dilution plot obtained from a PLA experiment assaying for the presence of neuronal pentraxin 1 (NPTX1)-NPTXR protein complexes in human plasma samples. Plasma samples were serially diluted 2-fold in PBS. The solid line represents a four-parameter logistic regression applied to the dilution curve. [Figure 7B] Figure 1 shows a dilution plot obtained from a PLA experiment assaying for the presence of neuronal pentraxin 1 (NPTX1)-NPTXR protein complexes in human plasma samples. Plasma samples were serially diluted 2-fold in NPTX1-depleted plasma. The solid line represents a four-parameter logistic regression applied to the dilution curve. [Figure 8A]Scatter plots of quantified NPTX1-NPTXR and NPTX2-GluA4 protein complexes measured by PLA in plasma samples from clinically diagnosed AD patients and matched healthy control patients. NPTX1-NPTXR levels tended to be elevated in the AD group (control: n=34, AD: n=33). Mean values ​​± SEM are shown as solid lines overlaid on the data points. [Figure 8B] Scatter plots of quantified NPTX1-NPTXR and NPTX2-GluA4 protein complexes measured by PLA in plasma samples from clinically diagnosed AD patients and matched healthy control patients. When taking the ratio of levels of NPTX2-GluA4 complex to NPTX1-NPTXR complex, the AD group tended to show a decreased ratio compared to the control group (control: n=34, AD: n=33, p=0.154, two-tailed t-test). Mean values ​​± SEM are shown as solid lines overlaid on the data points. [Figure 9] Scatter plots of quantified NPTX2-GluA4 protein complexes measured by PLA in plasma samples from clinically diagnosed AD patients and controls (control: n=50, AD: n=40, p=0.69, two-tailed t-test). Mean values ​​± SEM are displayed as solid lines overlaid on the data points. [Figure 10] Scatter plots of quantified NPTX2-NPTXR protein complexes measured by PLA in plasma samples from clinically diagnosed AD patients and controls. NPTX2-NPTXR levels were significantly elevated in the AD group (control: n=50, AD: n=40, p=0.015, two-tailed t-test). Mean values ​​± SEM are shown as solid lines overlaid on the data points. [Figure 11]Scatter plots of quantified NPTX2-GluA4 and NPTX2-NPTXR protein complexes measured by PLA in plasma samples from clinically diagnosed AD patients and controls. Taking the ratio of levels of NPTX2-GluA4 complex (FIG. 9) to NPTX2-NPTXR complex (FIG. 10), the AD group showed a significant decrease in the ratio compared to the control group (control: n=50, AD: n=40, p=0.010, two-tailed t-test). Mean values ​​± SEM are displayed as solid lines overlaid on the data points. [Figure 12] 1 shows a schematic summary of the above figures. NPTX2-NPTXR and NPTX1-NPTXR complexes tend to show elevated levels in clinically diagnosed AD patients, whereas NPTX2-GluA4 complexes, or the ratio of NPTX2-GluA4 to NPTX2-NPTXR or NPTX2-GluA4 to NPTX1-NPTXR complexes, tend to be decreased in clinically diagnosed AD patients. These findings demonstrate that the PLA method of the present disclosure can be used to detect sample pentraxin protein in human blood, and that the ratio of NPTX2-GluA4 to NPTX2-NPTXR can statistically distinguish between control and AD patients. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0089] definition For convenience, the meanings of some terms and phrases used in the specification, examples and the appended claims are provided below. Unless otherwise specified or implied from the context, the following terms and phrases have the meanings set forth below. The definitions are provided to help explain certain embodiments and are not intended to limit the claimed technology. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this technology belongs. In the event of an apparent discrepancy between the use of a term in the art and its definition provided herein, the definition provided herein shall prevail.

[0090] As used herein, "a" or "an" means "at least one" or "one or more" unless specifically stated otherwise. Additionally, the singular forms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise.

[0091] As used herein, the terms "ascorbate peroxidase" and "APX" refer to a protein belonging to the family of heme-containing peroxidases that catalyze the peroxide-dependent oxidation of various biological substrates. APX can be used in proximity labeling assays (such as the proximity labeling assays disclosed herein) to label substrate molecules (e.g., proteins or nucleic acids) with biotin. APX performs biotinylation by generating a reactive biotin derivative that diffuses from the active site to label nearby proteins. Thus, as used herein, APX can refer to a proximity detection molecule that facilitates the detection of proteins by labeling physically nearby proteins with biotin, which can then be detected using biochemical methods (i.e., streptavidin-based detection, e.g., streptavidin affinity matrices).

[0092] As used herein, "Alzheimer's disease" and "AD" refer to a delayed-onset neurodegenerative disorder that manifests as cognitive decline, insidious loss of short-term and long-term memory, attention deficits, language-specific problems, disorientation, impulse control, social withdrawal, anhedonia, and other symptoms. Brain tissue from AD patients exhibits neuropathological features such as extracellular aggregates of amyloid beta protein and neurofibrillary tangles of hyperphosphorylated microtubule-associated tau protein. The accumulation of these aggregates is associated with neuronal cell loss and atrophy in many brain regions, including the frontal, temporal, and parietal lobes of the cerebral cortex, as well as subcortical structures such as the basal forebrain cholinergic system and the locus coeruleus in the brainstem.

[0093] As used herein, the terms "Alzheimer's disease-related dementia" and "ADRD" generally refer to related neurological diseases (e.g., neurodegenerative disorders) characterized by dementia as a prominent symptom. Non-limiting examples of ADRD include frontotemporal degeneration, dementia with Lewy bodies, vascular cognitive impairment and dementia, and mixed etiology dementia.

[0094] As used herein, the term "antibody" refers to a molecule that specifically binds or is immunologically reactive with a particular antigen and contains at least a variable domain of a heavy chain, and typically contains at least the variable domains of the heavy and light immunoglobulin chains. Antibodies and antigen-binding fragments, variants or derivatives thereof include polyclonal, monoclonal, multispecific, human, humanized, primatized or chimeric antibodies, heteroconjugate antibodies (e.g., bispecific, trispecific and tetraspecific antibodies, diabodies, triabodies and tetrabodies), single domain antibodies (sdAbs), epitope-binding fragments such as Fab, Fab' and F(ab')2, Fd, Fvs, single chain Fvs (scFvs), rIgG, single chain antibodies, disulfide-linked Fvs (sdFvs), VFvs, ... L or V H Examples of antibodies include, but are not limited to, fragments comprising any of the domains, fragments produced by a Fab expression library, and anti-idiotypic (anti-Id) antibodies. The antibody molecules of the present invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass of immunoglobulin molecule. Furthermore, unless otherwise indicated, the term "monoclonal antibody" (mAb) is meant to include both intact molecules and antibody fragments (e.g., Fab and F(ab')2 fragments, etc.) capable of specifically binding to a target protein. Fab and F(ab')2 fragments lack the Fc fragment of intact antibodies.

[0095] As used herein, the term "antigen-binding fragment" refers to one or more fragments of an immunoglobulin that retain the ability to specifically bind to a target antigen. The antigen-binding function of an immunoglobulin may be performed by a fragment of a full-length antibody. An antibody fragment may be a Fab, F(ab')2, scFv, SMIP, diabody, triabody, affibody, nanobody, aptamer, or domain antibody. Examples of binding fragments encompassed by the term "antigen-binding fragment" of an antibody include (i) Fab fragments, V(ab')2, scFv, SMIP, diabody, triabody, affibody, nanobody, aptamer, or domain antibody. L , V H , C L and C H (ii) a F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a V H and C H (iv) a V of a single arm of an antibody; L and V H (v) an Fv fragment consisting of a V H and V L (vi) dAb containing the V domain (Ward et al., Nature 341:544-546, 1989); H (vii) a dAb fragment consisting of the V H or V L These include, but are not limited to, dAbs consisting of a domain, (viii) an isolated complementarity determining region (CDR), and (ix) a combination of two or more isolated CDRs that may optionally be joined by a synthetic linker. Additionally, the two domains V of an Fv fragment may be linked by a dAb. L and V H Although the V are encoded by separate genes, they can be joined by a linker that allows them to be made as a single protein chain using recombinant methods, and the V L and V HThe regions pair to form a monovalent molecule known as a single chain Fv (scFv). These antibody fragments can be obtained using conventional techniques known to those of skill in the art, and the fragments can be screened for utility in the same manner as intact antibodies. Antigen-binding fragments can be produced by recombinant DNA techniques, by enzymatic or chemical cleavage of intact immunoglobulins, or, in certain cases, by chemical peptide synthesis procedures known in the art.

[0096] As used herein, the term "aptamer" refers to a synthetic non-coding polynucleotide that can adopt a specific three-dimensional conformation and bind to a specific molecule, such as a protein, to regulate its biological activity. Aptamers usually consist of a short chain of oligonucleotides. As described herein, aptamers can be used as ligands to bind to proteins or protein complexes to facilitate detection and quantification of the proteins or protein complexes. The aptamers can be further coupled to one or more proximity detectors (e.g., oligonucleotides, FRET / BRET fluorophores, or APX / BioID) disclosed herein.

[0097] As used herein, the terms "bioluminescence resonance energy transfer" and "BRET" refer to methods similar to fluorescence resonance energy transfer (FRET, see below), except for the use of bioluminescent chromophores that do not require external illumination to produce a detectable signal.

[0098] As used herein, the term "BirA biotin-protein ligase" refers to a protein that is commonly used as part of the BioID method to facilitate screening of protein-protein interactions by indiscriminately biotinylating proteins based on physical proximity. BirA ligase or its functional fragments can be fused or conjugated to a biomolecule of interest (e.g., a protein or a nucleic acid) and then contacted with a sample of interest (e.g., a blood sample). Proteins that are physically close to the intact ligase are labeled with a biotin moiety and can then be detected using standard detection protocols (e.g., streptavidin-based detection).

[0099] As used herein, the term "blood sample" refers to a specimen (eg, blood or blood components (eg, serum or plasma)) isolated from a subject. As used herein and unless otherwise specified, the term "complementary" when used to describe a first nucleotide or nucleoside sequence relative to a second nucleotide or nucleoside sequence refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide or nucleoside sequence to hybridize and form a duplex structure with an oligonucleotide or polynucleotide comprising the second nucleotide sequence under certain conditions, as understood by those skilled in the art. Physiologically relevant conditions that may be encountered in an organism may be applied. Those skilled in the art will be able to determine the most suitable set of conditions for testing the complementarity of two sequences depending on the final use of the hybridized nucleotide or nucleoside.

[0100] As used herein, the term "complex" refers to a group of two or more polypeptides that constitute the quaternary structure of a protein. The proteins in a complex are generally bound by non-covalent protein-protein interactions and may participate in biological functions that require the concerted activity of the complexed proteins. Types of protein complexes may include obligate complexes that can increase the stability of a protein's structure by complexing it with one or more additional proteins. Non-obligate protein complexes include proteins whose folding is stable enough that they do not require additional proteins to improve thermodynamic stability. Protein complexes may be transient in time or have a long half-life. For example, obligate protein complexes may have a longer half-life compared to non-obligate complexes.

[0101] As used herein, the terms "connector oligonucleotide" and "sprint oligonucleotide" refer to a short nucleic acid sequence that can hybridize to one or more nucleic acid molecules (e.g., oligonucleotides or polynucleotides) through complementary base pairing. A connector oligonucleotide can, for example, bring two oligonucleotide strands (e.g., a positive and negative strand) into sufficient physical proximity to facilitate ligation (e.g., by a ligase) of the two oligonucleotide strands and subsequent amplification of the ligated oligonucleotide product.

[0102] As used herein, the term "contacting" refers to bringing two or more biological samples and / or molecules (e.g., a blood sample of a subject and an affinity ligand, such as an antibody) into sufficient physical proximity to facilitate physical interaction. Contacting can be by any possible means. For example, contacting a blood sample with an antibody includes contacting the blood sample with the antibody in vitro. Contacting can be performed directly or indirectly. Thus, for example, the antibody can be physically contacted with the blood sample by the individual performing the method, or the antibody can be placed in a situation that allows or causes it to subsequently contact the blood sample. Contacting the blood sample in vitro can be performed, for example, by incubating the blood sample with the antibody.

[0103] As used herein, the term "exosome" refers to membrane-tethered extracellular vesicles produced by endosomes of eukaryotic cells and typically measuring approximately 30-150 nm in diameter. Exosomes are generated from intraluminal vesicles of multivesicular bodies that fuse with the cell surface and are released as exosomes. Exosomes generally retain markers of the cell of origin and are involved in managing cellular waste products and transporting cargo (such as proteins and / or RNA) to nearby cells.

[0104] As used herein, the terms "fluorescence resonance energy transfer" (also known as Förster resonance energy transfer) and "FRET" refer to a method of generating a detectable optical signal by facilitating energy transfer between two light-sensitive molecules (chromophores). The basic principle of FRET is the transfer of energy from a donor chromophore in an excited electronic state to an acceptor chromophore via non-radioactive dipole coupling. The intensity of the FRET signal can be used to ascertain the physical proximity of two fluorophores or ligands bound to the fluorophores.

[0105] As used herein, the term "fluorophore" refers to a fluorescent agent (e.g., a compound or protein) that emits light of a particular wavelength upon excitation with the same or different wavelength of light. According to the disclosed methods, fluorophores (e.g., FRET or biomolecular fluorescence complementation (BiFC) fluorophores) can function as proximity detectors that signal the physical proximity between two or more proteins in a complex.

[0106] As used herein, the terms "glutamate ionotropic receptor AMPA type subunit 1" and "GluA1" (also known as GluR1) refer to a subunit of the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptor, encoded by the GRIA1 gene and localized to the postsynaptic neuronal membrane. The GluA1 subunit is normally present as a dimer within the AMPA receptor and can interact with components of the postsynaptic density. GluA1 is important in controlling AMPA receptor localization, conductance, and open probability through phosphorylation at one or more of four phosphorylation sites. GluA1 also mediates synaptic plasticity and may therefore be important for learning and memory. GluA1 may be expressed in excitatory or inhibitory neurons, but is believed to be particularly important in mediating excitation of parvalbumin positive (PV+) interneurons and thus in controlling neuronal inhibition and the subsequent transmission of activity through neuronal assemblies.

[0107] As used herein, the terms "glutamate ionotropic receptor AMPA subunit 4" and "GluA4" (also referred to as GluRA-D2) refer to a subunit of the AMPA receptor that is encoded by the GRIA4 gene and localized to the postsynaptic neuronal membrane. Similar to GluA1, the GluA4 AMPA receptor subunit exists as a dimer and can interact with components of the postsynaptic density. Increased channel kinetics typically occurs upon incorporation of the GluA4 subunit into the AMPA receptor, thereby establishing a critical role for this receptor in the timing and duration of synaptic excitation. Mice lacking the NPTX2 / NPTXR protein have been shown to have reduced GluA4 expression, particularly in PV+ interneurons, with subsequent alterations in neuronal network activity.

[0108] As used herein, the terms "increase" and "decrease" refer to a regulation that results in a greater or lesser amount of a function, expression or activity metric, respectively, compared to a reference. For example, in the methods described herein, after contacting a blood sample with an affinity ligand (e.g., an antibody or its antigen-binding fragment, a single-chain polypeptide or oligopeptide, or an aptamer), the amount of a marker (e.g., a proximity signal) of a metric described herein can increase or decrease by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or more relative to a control reference sample. Generally, the metric is measured after contacting with the ligand.

[0109] As used herein, the term "affinity ligand" refers to a biomolecule, such as a protein (e.g., a single-chain polypeptide, oligopeptide, antibody or antigen-binding fragment thereof) or a nucleic acid (e.g., an aptamer), that can non-covalently bind to a synaptic protein (e.g., NPTX2, NPTX1, NPTXR, or any one of the synaptic proteins listed in Table 1).

[0110] As used herein, the terms "ligated plus-minus oligonucleotide strands" and "LPMOS" refer to a polynucleotide or oligonucleotide product resulting from the ligation (e.g., by a ligase such as T4 DNA ligase) of an oligonucleotide plus strand (e.g., SEQ ID NO:1) and an oligonucleotide minus strand (e.g., SEQ ID NO:2), respectively, that are hybridized to a common connector oligonucleotide.

[0111] As used herein, the phrase "learning and memory" refers to cognitive abilities including the acquisition of skills or knowledge and the expression of acquired skills or knowledge (e.g., learning to say new words and vocalizing new words, respectively). "Learning and memory" refers to two independent processes: 1) acquiring new skills or knowledge (i.e., learning); and 2) processing, storing, and recalling learned skills or knowledge (i.e., memory), which may differ in time scale (learning is generally slower and more effortful than recalling memories or performing learned skills) and neurobiological basis. Patients diagnosed with a neurological disorder (e.g., a neurodegenerative, neurodevelopmental, or neuropsychiatric disorder described herein) may have impaired learning and memory compared to healthy reference patients or patient populations.

[0112] As used herein, the terms "neuronal pentraxin 1" and "NPTX1" refer to a protein encoded by the NPTX1 gene, which is expressed exclusively in the nervous system. The NPTX1 gene belongs to a family of conserved proteins characterized by a cyclic multimeric structure. NPTX1 is a secreted glycoprotein involved in the reuptake of synaptic debris into presynaptic cells or adjacent glia.

[0113] As used herein, the terms "neuronal pentraxin 2" and "NPTX2" refer to a protein encoded by the NPTX2 immediate early gene, which is expressed in the nervous system, liver, kidney and testis. The NPTX2 gene belongs to a family of conserved proteins characterized by a cyclic multimeric structure. NPTX2 is a calcium-dependent lectin that can bind ligands in a calcium-dependent manner. Individual NPTX2 units can form a cyclic pentameric structure. Postsynaptic neuronal AMPA receptors have been shown to bind NPTX2 at excitatory synapses. NPTX2 has also been shown to be involved in the clustering of various AMPA receptor subunits, including GluA1, GluA2 and GluA3, and is considered to be involved in the development, maturation and stabilization of excitatory synapses. As an immediate early gene, the expression of NPTX2 is upregulated by synaptic activity and may be particularly important in balancing synaptic excitation and inhibition within the CNS.

[0114] As used herein, the terms "neuronal pentraxin receptor" and "NPTXR" refer to a transmembrane protein encoded by the NPTXR gene that functions as a receptor for the neuronal pentraxin proteins, NPTX1 and NPTX2. NPTXR is known to interact with GluA1 and GluA4 proteins through the pentraxin domain, and its ablation is associated with a decrease in excitatory postsynaptic specialization.

[0115] As used herein, the term "normalize" with respect to a mathematical quantity refers to the method of dividing a numerical amount (e.g., the amount of a first protein or a first protein complex) by another numerical amount (e.g., the amount of a second protein or a second protein complex) to generate a ratio between the two numerical amounts.

[0116] As used herein, the term "oligonucleotide" is defined as a molecule that contains two or more covalently linked nucleosides, as commonly understood by those skilled in the art. Such covalently linked nucleosides can also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are usually produced in a laboratory by solid-phase chemical synthesis followed by purification. When referring to the sequence of an oligonucleotide, it refers to the sequence or order of the nucleobase moieties of the covalently linked nucleotides or nucleosides. The oligonucleotides of the present invention can be man-made, chemically synthesized, and typically purified or isolated. The term "oligonucleotide" can refer to short polynucleotides (e.g., those with 100 or fewer nucleosides linked together).

[0117] The oligonucleotides can be of any length that allows for the detection of one or more synaptic proteins disclosed herein, and can be about 10-50 base pairs in length, e.g., about 15-50 base pairs in length or about 18-50 base pairs in length, e.g., about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 base pairs in length, e.g., about 15-30, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-2 2, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23 , 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs. Ranges and lengths intermediate to the ranges and lengths listed above are also contemplated as being part of the invention.

[0118] As used herein, the term "oligonucleotide minus strand" refers to a short (e.g., about 60 nucleotides in length) oligonucleotide whose 3' end is attached to a ligand (e.g., a single-chain polypeptide, oligopeptide, antibody, antigen-binding fragment thereof, or aptamer). When attached to a protein, such as an antibody or antigen-binding fragment thereof, the oligonucleotide minus strand may feature an amino group at its 3' end to facilitate peptide bond formation with the carboxy terminus of the protein. The 5' end of the minus strand includes a 5' monophosphate moiety and a connector oligonucleotide binding region, generally between 6 and 15 nucleotides, capable of hybridizing to a connector oligonucleotide by complementary base pairing.

[0119] As used herein, the term "oligonucleotide plus strand" refers to a short (e.g., about 60 nucleotides in length) oligonucleotide whose 5' end is attached to a ligand (e.g., a single-chain polypeptide, oligopeptide, antibody, antigen-binding fragment thereof, or aptamer). When attached to a protein such as an antibody or antigen-binding fragment thereof, the oligonucleotide plus strand may feature an amino group at its 5' end to facilitate peptide bond formation with the carboxy terminus of the protein. The 3' end of the plus strand includes an -OH group and a connector oligonucleotide binding region, generally between 6 and 15 nucleotides, that can hybridize to a connector oligonucleotide by complementary base pairing.

[0120] "Percentage of sequence identity" to a reference polynucleotide sequence or a reference single-chain polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to those in a reference polynucleotide sequence or a reference single-chain polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percentage of sequence identity. Alignment for the purpose of measuring percentage of nucleic acid or amino acid sequence identity can be achieved in a variety of ways within the capabilities of those skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine the appropriate parameters for aligning sequences, including any algorithms required to obtain maximum alignment over the full length of the sequences being compared. For example, percentage sequence identity values ​​can be generated using the sequence comparison computer program BLAST. As an illustration, the percent sequence identity of a given nucleic acid or amino acid sequence A to a given nucleic acid or amino acid sequence B (which may alternatively be referred to as a given nucleic acid or amino acid sequence A having a particular percent sequence identity with or to a given nucleic acid or amino acid sequence B) is calculated as follows: 100×(fraction X / Y) [where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in a programmatic alignment of A and B, and Y is the total number of nucleic acids in B.] If the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, then the percent sequence identity of A to B will not be equal to the percent sequence identity of B to A.

[0121] As used herein, the term "polypeptide" is intended to encompass all peptides described in the present invention and refers to any polymer, regardless of its size, that consists essentially of amino acids and maintains a level of cross-reactivity comparable to that of the unmodified polypeptide from which it is derived. Although "protein" is often used in reference to relatively large polypeptides and "peptide" is often used in reference to small polypeptides, the use of these terms in the art overlaps and varies. Thus, as used herein, the term "polypeptide" refers interchangeably to peptides and polypeptides, unless otherwise indicated. Furthermore, the term "polypeptide" is meant to encompass any derivative thereof. Derivatives refer to modified or altered forms of a natural or original polypeptide. As used herein, a derivative will have a level of cross-reactivity comparable to that of the unmodified polypeptide from which it is derived. Such modifications include, but are not limited to, substitution, modification, addition or deletion of amino acids; alterations in the lipidation, glycosylation or phosphorylation patterns; reactions of free amino, carboxyl or hydroxyl side groups present in the amino acid residues of the polypeptide with other organic and inorganic molecules; and other modifications, any of which may result in changes in the primary, secondary or tertiary structure.

[0122] As used herein, the term "proximity detector" refers to a molecule (e.g., a nucleic acid or a protein) that can be used to detect the physical proximity of two or more synaptic proteins in a blood sample of a subject. The proximity detector can be bound or fused to an affinity ligand molecule (e.g., a single-chain polypeptide, oligopeptide, aptamer, or an antibody or antigen-binding fragment thereof), and a proximity signal can be generated when two proximity detectors, each bound to a different affinity ligand, are close enough to allow direct or indirect (e.g., via intermediate molecule(s)) physical contact between the two proximity detectors. For example, two proximity detectors that are oligonucleotides (e.g., a plus strand (e.g., SEQ ID NO:1) and a minus strand (e.g., SEQ ID NO:2)) can each be independently bound to two separate antibodies, with some of the antibodies independently binding to different synaptic proteins. If a connector oligonucleotide is present that can hybridize to both the plus strand and the minus strand, and there is sufficient physical proximity between the two synaptic proteins, the proximity detector oligonucleotide can hybridize to the connector oligonucleotide and form a duplex between each of the plus strand and the minus strand and the connector strand. Upon hybridization with the connector, a ligase enzyme (e.g., T4 DNA ligase) can be used to join the plus and minus strands, generating a concatenated plus-minus oligonucleotide strand (LPMOS). Following the formation of the LPMOS, primer oligonucleotides are annealed to regions downstream and upstream of the connector-binding region on the plus and minus strands, respectively, and qRT-PCR is performed to amplify the LPMOS products. The intensity of the amplification product is a direct proxy for the physical proximity (e.g., proximity signal) between the two synaptic proteins bound by the oligonucleotide-binding ligand.

[0123] As used herein, the term "proximity distance threshold" refers to the minimum distance between two synaptic proteins required to allow detection of a physical protein-protein interaction between the two synaptic proteins. According to the present disclosure, the proximity distance threshold may be 40 nm or less (e.g., 35 nm, 30 nm, 25 nm, 20 nm, 15 nm, 10 nm, 5 nm, 4 nm, 3 nm, 2 nm, 1 nm or less).

[0124] As used herein, the term "proximity signal" refers to a signal that can be detected in the assays disclosed herein. In general, a proximity signal is a proxy for the physical proximity between two or more synaptic proteins present in a complex in a subject (e.g., a blood sample such as blood, serum or plasma) obtained from a subject (e.g., a human). Such a proximity signal is generated when two proximity detectors (e.g., oligonucleotide-based proximity detectors, FRET / BRET-based proximity detectors, BiFC-based proximity detectors, or APX / BirA-based proximity detectors) are within sufficient physical proximity distance (e.g., within a proximity distance threshold) to each other to allow direct or indirect physical interaction between the two proximity detectors.

[0125] As used herein, the term "quantity" or "amount" refers to the level of a protein (e.g., a synaptic protein) or a protein complex. A "decreased amount" or "increased amount" of a protein or protein complex refers to a decrease or increase in protein or complex levels compared to a reference (e.g., about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 100%, about 150%, about 200%, about 300%, about 400%, about 500% or more decrease or increase; a decrease or increase in a protein or complex compared to a reference). (a decrease or increase of more than about 10%, about 15%, about 20%, about 50%, about 75%, about 100%, or about 200% compared to a control; a decrease or increase of less than about 0.01 fold, about 0.02 fold, about 0.1 fold, about 0.3 fold, about 0.5 fold, about 0.8 fold, or less; an increase of more than about 1.2 fold, about 1.4 fold, about 1.5 fold, about 1.8 fold, about 2.0 fold, about 3.0 fold, about 3.5 fold, about 4.5 fold, about 5.0 fold, about 10 fold, about 15 fold, about 20 fold, about 30 fold, about 40 fold, about 50 fold, about 100 fold, about 1000 fold, or more). The level of protein can be expressed as mass / volume (e.g., g / dL, mg / mL, μg / mL, ng / mL, etc.) or as a percentage of the total protein in the sample.

[0126] As used herein, the term "reference blood sample" refers to a blood sample (e.g., blood, serum or plasma) obtained from a reference subject or subject population that does not have or is not suspected of having or developing a neurological disorder (e.g., a neurodegenerative, neurodevelopmental or neuropsychiatric disorder).

[0127] As used herein, the term "resilience" refers to the phenomenon in subjects who live to old age without showing symptoms of a neurological disorder (e.g., a neurodegenerative disorder such as AD) but who are found after death to have a high burden of CNS pathology (e.g., amyloid-β plaques and hyperphosphorylated tau protein tangles). Resilient subjects do not show the cognitive decline characteristic of Alzheimer's disease patients with a similar burden.

[0128] As used herein, the terms "subject" and "patient" refer to an animal (e.g., a mammal, such as a human). A subject diagnosed according to the methods described herein can be a subject identified as having a neurological disorder or a subject at risk for developing the condition. Non-limiting examples of neurological disorders include neurodegenerative diseases (e.g., AD (e.g., sporadic or familial AD), Down's syndrome, age-related cognitive decline, Parkinson's disease, Huntington's disease, frontotemporal lobar degeneration, motor neuron diseases, spinocerebellar ataxia, spinal muscular atrophy, Friedreich's ataxia, anamnesis, and lysosomal storage disorders), neurodevelopmental disorders (e.g., intellectual disability (e.g., X-linked intellectual disability), learning disabilities, autism spectrum disorders, developmental movement disorders, tic disorders, cerebral palsy, communication and language disorders, fragile X syndrome, Down's syndrome, attention deficit hyperactivity (ADHD) disorder, or neurodevelopmental disorders due to neurotoxic substances), and neuropsychiatric disorders (e.g., major depression, bipolar disorder, obsessive-compulsive disorder, eating disorders, and schizophrenia). Diagnosis may be performed using the methods of the present disclosure and / or by any method or technique known in the art. One of skill in the art will understand that subjects screened according to the methods of the present disclosure may have undergone standard testing, or may not have undergone testing but have been identified as being at risk due to the presence of one or more risk factors associated with the disorder.

[0129] As used herein, the term "synaptic protein" refers to a protein that is localized in neuronal synapses and may be involved in synaptic functions, such as scaffolding, neurotransmission and plasticity, among others. Synaptic proteins may include presynaptic proteins and postsynaptic proteins. Non-limiting examples of postsynaptic proteins include neuronal pentraxins (e.g., NPTX2, NPTX1 and NPTXR), or any one of the synaptic proteins listed in Table 1.

[0130] As used herein, the terms "vascular cognitive impairment and dementia" and "VCID" refer to a common form of dementia in the elderly caused by damage to the blood vessels that supply the brain.VCID can occur after one or more strokes.The symptoms of VCID are similar to those of AD and can occur at the same time.

[0131] Other features and advantages of the invention will become apparent from the following detailed description, the drawings, and the claims. Featured are methods for diagnosing a subject (e.g., a mammal such as a human) having or at risk for developing a neurological disorder (e.g., a neurodegenerative, neurodevelopmental or neuropsychiatric disorder) by performing a proximity-based protein detection assay (e.g., a proximity ligation assay (PLA)) on a blood sample (e.g., blood, plasma or serum) obtained from the subject. Such methods are suitable for detecting the presence of two or more synaptic proteins in a protein complex, where the expression level of one or more synaptic proteins in the complex may be increased or decreased in a subject having or at risk for developing a neurological disorder compared to a healthy control subject or subject population.

[0132] The disclosed methods can be used to diagnose a subject as having or at risk of developing a neurological disease state, to select a subject identified as having or at risk of developing a neurological disease for treatment with a therapeutic agent, to assess the resilience of a subject identified as having or at risk of developing a neurological disorder, to determine the therapeutic efficacy of a therapeutic agent in a subject identified as having or at risk of developing a neurological disorder, or to assess learning and memory in a subject identified as having or at risk of developing a neurological disorder. Additionally, the disclosed methods can be used to detect the presence of a complex comprising two or more synaptic proteins in a blood sample of a subject identified as having or at risk of developing a neurological disorder.

[0133] The present disclosure is based, in part, on the inventors' discovery that detection and quantification of certain synaptic proteins, namely neuronal pentraxins (e.g., neuronal pentraxin 1 (NPTX1), neuronal pentraxin 2 (NPTX2) and neuronal pentraxin receptor (NPTXR)) using the disclosed assays allows reliable identification of differences in the expression levels of said synaptic proteins among patients with neurological diseases (i.e., Alzheimer's disease (AD)), thereby facilitating the diagnosis and prognosis of AD patients. The disclosed methods are generally suitable for diagnosing a wide range of neurological disorders, including neurodegenerative, neurodevelopmental, and neuropsychiatric disorders.

[0134] Synaptic Proteins The methods disclosed herein provide a powerful approach for detecting levels of synaptic proteins (e.g., NPTX2, NPTX1, NPTXR, or any one of the synaptic proteins listed in Table 1) in a blood sample (e.g., blood, serum, or plasma) obtained from a subject (e.g., a human) for the purpose of diagnosing the subject as having or at risk of developing a neurological disorder (e.g., a neurodegenerative, neurodevelopmental, or neuropsychiatric disorder). In some embodiments, the detected synaptic proteins include neuronal pentraxins (e.g., NPTX2, NPTX1, and / or NPTX1), or any one of the synaptic proteins listed in Table 1. Because the circulating levels of synaptic proteins in blood are low, detection of individual synaptic proteins is usually hindered by low signal-to-noise ratios. The present disclosure exploits the phenomenon that some synaptic proteins exist in transient or chronic complexes with other synaptic proteins, thus allowing amplification of weak signals using tandem detection of two or more synaptic proteins by a proximity-based detection assay.

[0135] Neuronal Pentraxin Proteins Neuronal pentraxin proteins are members of an evolutionarily conserved protein family that exhibits prominent, if not unique, expression in the central nervous system (CNS). As a family, pentraxins are characterized by a cyclic multimeric structure and a "pentraxin" signature sequence (His-X-Cys-X-Ser / Thy-Trp-X-Ser / Thy, where x is any amino acid). Neuronally expressed pentraxins include NPTX1 (UniProt ID: Q15818), NPTX2 (UniProt ID: P47972) and NPTXR (UniProt ID: O95502), each of which shows varying degrees of homology to each other. NPTX1 and NPTX2 are secreted glycoproteins, while NPTXR is a transmembrane protein that functions as a receptor for secreted neuronal pentraxins. Functionally, NPTX1 has been shown to be involved in the clearance of synaptic debris via a presynaptic reuptake mechanism. NPTX2, also known as activity-dependent neuronal pentraxin, is an immediate early gene whose expression increases after sustained neuronal activity. Unlike NPTX1 and NPTXR, NPTX2 expression is not restricted to the CNS, but can also be found in the pancreas, liver, kidney, and testis. The role of NPTX2 in synapse function and development has been established through its known interaction with α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) receptors, which are one of the major excitatory postsynaptic ionotropic receptors in neurons and play a key role in regulating synaptic activity, development, maintenance, and plasticity. In particular, NPTX2 has been linked to AMPA receptor-mediated synapse formation and clustering of AMPA receptor subunit proteins, including GluA1, GluA2, and GluA3, thereby demonstrating its role in synapse maturation. NPTX1 and NPTXR have also been found to colocalize with the GluA4 subunit in neuronal cultures, suggesting that these pentraxins may play a role in recruiting GluA4 to synapses.

[0136] Mutations in NPTX2 expression and subsequent changes in AMPA receptor function have been associated with animal models of neurodegenerative diseases. For example, NPTX2 knockout rats with amyloidosis show reduced GluR4 expression, especially on parvalbumin-positive (PV+) interneurons (Xiao et al., Elife6:e23798,2017), leading to reduced GluA4 expression, disrupted neuronal network activity, and increased excitatory neurons. Reduced NPTX2 and GluA4 levels have also been shown in postmortem cortical tissue from human AD patients, and NPTX2 levels in cerebrospinal fluid (CSF) are reduced in AD subjects and correlate with both cognitive function and hippocampal volume. Thus, these studies suggest that reduced neuronal inhibition resulting from NPTX2-mediated reduction of AMPA receptor subunits on PV+ interneurons in the CNS may be responsible for altered cognitive function in AD patients. Interestingly, human subjects who were postmortem determined to have AD plaque burden comparable to diagnosed AD patients, but who do not exhibit the rapid cognitive decline observed in AD (also known as "resilient" subjects), did not exhibit the reduction in NPTX2 seen in symptomatic AD patients.

[0137] Thus, NPTX2 expression levels can be utilized as a predictive biomarker for the diagnosis and prognosis of neurological disorders such as AD, among others. Furthermore, NPTX2 levels can serve as a useful surrogate for identifying resilient patients and selecting treatment strategies for symptomatic patients. Unfortunately, conventional methods for measuring protein expression in the CNS are highly invasive and generally require brain tissue biopsy or cerebrospinal fluid (CSF) samples from the subject. Such methods include well-known protocols for measuring proteins or nucleic acids in tissue samples, but may also be difficult to detect proteins with low expression levels. Thus, there is a need for a robust assay for detecting synaptic proteins (e.g., neuronal pentraxin and related proteins) whose expression is altered in neurological disorders that can be performed on samples obtained in a less invasive manner than brain tissue or CSF biopsy, such as blood samples from the subject.

[0138] In other embodiments, the synaptic protein detected is any one of the synaptic proteins listed in Table 1.

[0139] [Table 1-1]

[0140] [Table 1-2]

[0141] [Table 1-3]

[0142] [Table 1-4]

[0143] [Table 1-5]

[0144] [Table 1-6]

[0145] [Table 1-7]

[0146] [Table 1-8]

[0147] [Table 1-9]

[0148] In some embodiments, the subject's blood sample contains one or more neuronal pentraxin proteins (e.g., NPTX2, NPTX1, or NPTXR) complexed with one or more different types of neuronal pentraxin proteins (e.g., NPTX2-NPTX1, NPTX2-NPTXR, or NPTX1-NPTXR). In some embodiments, the subject's blood sample contains one or more neuronal pentraxin proteins complexed with one or more synaptic proteins listed in Table 1. In some embodiments, the neuronal pentraxin proteins are complexed with GluA1 (e.g., NPTX2-GluA1, NPTX1-GluA1, or NPTXR-GluA1). In some embodiments, the neuronal pentraxin proteins are complexed with GluA4 (e.g., NPTX2-GluA4, NPTX1-GluA4, or NPTXR-GluA4). In some embodiments, the complex of synaptic proteins comprises at least two (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more) synaptic proteins. In some embodiments, at least one of the synaptic proteins in the protein complex is a neuronal pentraxin. In some embodiments, at least one of the synaptic proteins in the protein complex is NPTX2. In some embodiments, at least one of the synaptic proteins in the protein complex is NPTX1. In some embodiments, at least one of the synaptic proteins in the protein complex is NPTXR. In some embodiments, at least one of the synaptic proteins in the protein complex is an AMPA receptor subunit. In some embodiments, at least one of the synaptic proteins in the protein complex is GluA1. In some embodiments, at least one of the synaptic proteins in the protein complex is GluA4. In some embodiments, the AMPA receptor subunit protein (e.g., GluA1 or GluA2) is intrinsic to excitatory synapses of inhibitory CNS neurons (e.g., parvalbumin-positive interneurons).

[0149] In some embodiments, the synaptic proteins in the subject's blood sample are derived from exosomes in the blood sample. Assay Provided herein are methods for measuring and quantifying the levels of one or more synaptic proteins, such as neuronal pentraxins (e.g., NPTX1, NPTX2 and / or NPTXR) or any one of the synaptic proteins listed in Table 1, from a blood sample (e.g., blood, serum or plasma) of a subject (e.g., a mammal such as a human) diagnosed as having or at risk of developing a neurological disorder (e.g., a neurodegenerative, neurodevelopmental or neuropsychiatric disorder). The disclosed methods are advantageous over conventional methods of assaying protein levels in the CNS because they require a relatively non-invasive process to obtain a sample from the subject (i.e., by venisection) and can be used to quantify synaptic proteins that are typically detected at low levels in blood. In general, the disclosed assays are based on the proximity detection of two or more synaptic proteins in a protein complex in a blood sample from a subject. Detection of at least two synaptic proteins in a complex is advantageous compared to detection of individual synaptic proteins, since detection of individual synaptic proteins is hindered by the low levels of said synaptic proteins in blood. Moreover, the disclosed assays are particularly advantageous for reliably stratifying controls as subjects with or at risk of developing neuropathy versus healthy individuals. The methods can detect synaptic proteins that exist transiently or chronically in complexes with one or more additional synaptic proteins.

[0150] Proximity ligation assay The first proximity-based method disclosed herein for detecting the presence of two or more synaptic proteins in a blood sample obtained from a subject is based on the proximity ligation assay (PLA), a screening assay that can detect protein-protein interactions between two or more proteins in a sample that are in close physical proximity. The basic principle behind PLA is that two affinity ligands (e.g., antibodies or antigen-binding fragments thereof, single-chain polypeptides or aptamers) are each independently bound to a unique synthetic oligonucleotide (proximity detector). Conventional PLA methods generally incorporate the use of sequence-matched oligonucleotides (e.g., backbone and splint oligonucleotides) that hybridize to the ligand-bound proximity detector oligonucleotides and are converted into circular oligonucleotides by ligation (e.g., by a ligase enzyme). Rolling circle amplification is then used to amplify the ligand-bound oligonucleotides. The present disclosure provides a modified PLA method in which a first affinity ligand (e.g., a single-chain polypeptide, an oligopeptide, an antibody or an antigen-binding fragment thereof, or an aptamer) specific to a target synaptic protein (e.g., NPTX1, NPTX2, or NPTXR, or any one of the synaptic proteins listed in Table 1) is either immobilized on a surface (e.g., a solid support, e.g., a plate, a resin, a particle, a container, a membrane, or a bead) or suspended in a solution (e.g., a PLA reaction mixture). The former type of PLA in which the first affinity ligand is immobilized on a surface is generally referred to as solid-phase PLA, and the latter is referred to as homogeneous PLA. The advantage of homogeneous PLA is that no solid support is required to immobilize the target protein. In some embodiments, the PLA is solid-phase PLA. In some embodiments, the PLA is homogeneous PLA. A blood sample (e.g., blood, serum, or plasma) obtained from a subject and containing one or more synaptic proteins is contacted with a first affinity ligand (e.g., an immobilized or suspended affinity ligand).Subsequently, two different affinity ligands, specific for the target synaptic protein and another synaptic protein complexed with the target synaptic protein, bound to the proximity detector oligonucleotides, are added to the reaction mixture. A connector oligonucleotide, with a sequence complementary to the respective regions of the binding oligonucleotides, is then added along with a ligase enzyme (e.g., T4 DNA ligase), ligating the ligand-bound oligonucleotides. Subsequently, primers specific for each of the ligand-bound oligonucleotides are annealed and quantitative real-time polymerase chain reaction (qRT-PCR) is performed to amplify the ligated ligand-bound oligonucleotides. The central requirement of this assay is that the two oligonucleotide-bound affinity ligands are in sufficient proximity within the sample to allow for physical interaction between the ligand-bound oligonucleotide and the connector oligonucleotide. Thus, the intensity of the amplified signal correlates (e.g., linearly, supralinearly, multiplicatively or exponentially) with the physical proximity of the two affinity ligands and, therefore, the physical proximity of the proteins to which they bind. An advantage of using the disclosed PLA assays over conventional assays that measure the levels of a particular target protein in isolation is that the PLA method allows for the detection of native protein complexes present in body fluids (e.g., blood CSF) and brain tissue. Thus, the PLA assay provides an assessment of the function of a target protein in conjunction with other proteins, not just its expression.

[0151] Another proximity-based method contemplated by the present disclosure to detect the presence of two or more synaptic proteins in a blood sample obtained from a subject uses fluorescent molecules (e.g., chromophores such as fluorescent proteins) as proximity detectors. Non-limiting examples of fluorescent proximity detectors include FRET, BRET and BiFC proteins. The basic principle behind such methods is that two fluorescent or luminescent proteins of a protein pair, or two complementary halves of a fluorescent protein, generate a proximity signal (e.g., a signal indicating the presence of two physically close proteins in a protein complex) when they are sufficiently close. Such fluorescent or luminescent proteins, or their complementary fragments, can be fused or conjugated to affinity ligands specific for synaptic proteins using routine methods to facilitate detection of said synaptic proteins.

[0152] Thus, the present disclosure provides a proximity-based fluorescence detection method in which a first affinity ligand (e.g., an antibody or antigen-binding fragment thereof, a single-chain polypeptide or oligopeptide, or an aptamer) specific for a target synaptic protein (e.g., NPTX1, NPTX2, NPTXR, or any one of the synaptic proteins listed in Table 1) is immobilized on a surface or suspended in a solution (e.g., a PLA reaction mixture). A blood sample (e.g., blood, serum, or plasma) obtained from a subject and containing two or more synaptic proteins is contacted with the first affinity ligand (e.g., the immobilized or suspended affinity ligand). Subsequently, two different affinity ligands (e.g., an antibody or antigen-binding fragment thereof, a single-chain polypeptide, an oligopeptide, or an aptamer), each bound to a proximity detector oligonucleotide and specific for the target synaptic protein, are added to the reaction mixture. In the case of FRET or BRET-based detection, each of the affinity ligands is fused or conjugated to a single member of a fluorescent protein pair described herein. In BiFC-based detection, each of the two affinity ligands is fused or conjugated to the complementary halves of a BiFC protein. Conventional fluorescence imaging methods are implemented to detect the proximity signal generated by the close placement between the two fluorescent proteins (FRET or BRET) or complementary halves of a fluorescent protein (BiFC). The intensity of the fluorescent or luminescent signal correlates (e.g., linearly, supralinearly, multiplicatively or exponentially) with the physical proximity of the two affinity ligands and thus with the physical proximity of the synaptic proteins to which they bind.

[0153] Yet another proximity-based detection assay suitable for use in the disclosed method is based on the proximity ligation of reactive biotin species using enzymes capable of biotinylation, such as ascorbate peroxidase (APX) and BirA biotin protein ligase (BirA). This approach is based on the principle that a biotinylation enzyme within sufficient physical proximity to a synaptic protein will label the protein with a biotin moiety that can be detected using conventional methods (e.g., streptavidin-based detection methods, such as streptavidin affinity matrices). Thus, the biotinylation enzyme or a functional fragment thereof can be conjugated or fused to an affinity ligand (e.g., a single-chain polypeptide, an oligopeptide, an antibody or antigen-binding fragment thereof, or an aptamer) specific for a synaptic protein. When two affinity ligands and their corresponding synaptic proteins are sufficiently close (e.g., within a proximity distance threshold), the biotinylation enzyme functions as a proximity detector by biotinylating the synaptic protein. The biotin moiety is then detected, for example, using a streptavidin affinity matrix, generating a detectable proximity signal that indicates that two or more synaptic proteins are interacting in a complex.

[0154] Affinity Ligands Affinity ligands suitable for use in the disclosed methods include ligands that bind to one or more binding sites of a synaptic protein (e.g., NPTX1, NPTX2, NPTXR, or any one of the synaptic proteins listed in Table 1). Any ligand that binds to a synaptic protein can be used in the methods described herein, including an antibody or antigen-binding fragment thereof, a single-chain polypeptide or oligopeptide, or an aptamer. In some embodiments, the affinity ligand is an antibody or antigen-binding fragment thereof. In some embodiments, the antibody or antigen-binding fragment thereof is specific for (i.e., binds preferentially to) a synaptic protein. In some embodiments, the affinity ligand is a single-chain polypeptide or oligopeptide. In some embodiments, the single-chain polypeptide or oligopeptide is specific for a synaptic protein. In some embodiments, the affinity ligand is an aptamer (e.g., a nucleic acid aptamer). In some embodiments, the aptamer is specific for a synaptic protein. In some embodiments, the affinity ligand (e.g., a first affinity ligand) is immobilized on a surface (e.g., a solid support, e.g., a plate, a resin, a particle, a container, a membrane, or a bead). In some embodiments, the affinity ligand (eg, the first affinity ligand) is not immobilized on a surface (eg, the affinity ligand is suspended in solution, such as, for example, a PLA reaction mixture).

[0155] i.Antibodies The present disclosure contemplates the use of an antibody or antigen-binding fragment thereof as an affinity ligand that preferentially binds to a synaptic protein (e.g., NPTX1, NPTX2, NPTXR, or any one of the synaptic proteins listed in Table 1) obtained from a blood sample of a subject (e.g., a subject diagnosed as having or at risk of developing a neuropathy). An antibody or antigen-binding fragment thereof that specifically binds to a synaptic protein is an antibody or antigen-binding fragment thereof that does not specifically bind to any protein other than the specific synaptic protein (e.g., the interaction of a target synaptic protein-specific antibody or antigen-binding fragment thereof with a non-target synaptic protein results in a signal that is indistinguishable from background). In some embodiments, the antibody or antigen-binding fragment thereof is conjugated or fused to a proximity detector disclosed herein (e.g., an oligonucleotide, a FRET or BRET protein, a BiFC protein or functional fragment thereof, or a protein or functional fragment thereof that can be biotinylated).

[0156] Antibodies can be produced against human synaptic proteins or against synaptic proteins from another animal (e.g., non-human primates, cows, pigs, sheep, goats, cats, dogs, rats, mice, rabbits, guinea pigs, or any other non-human mammal that expresses the target synaptic protein). Antibodies that specifically bind to a target synaptic protein may bind only to human synaptic proteins, or may bind to synaptic proteins from humans and other mammals. Antibodies can be produced by immunization of animals (e.g., rabbits, guinea pigs, rats, mice, sheep, donkeys, goats, hamsters, or chickens) with the synaptic protein.

[0157] Furthermore, antibodies or antigen-binding fragments thereof suitable for use in the disclosed methods may be used in a variety of forms, such as monoclonal antibodies or antigen-binding fragments thereof, polyclonal antibodies or antigen-binding fragments thereof, humanized antibodies or antigen-binding fragments thereof, primatized antibodies or antigen-binding fragments thereof, bispecific antibodies or antigen-binding fragments thereof, multispecific antibodies or antigen-binding fragments thereof, dual variable immunoglobulin domains, monovalent antibodies or antigen-binding fragments thereof, chimeric antibodies or antigen-binding fragments thereof, single chain Fv molecules (scFv), diabodies, triabodies, nanobodies, antibody-like protein scaffolds, domain antibodies, Fv fragments, Fab fragments, F(ab')2 molecules, and tandem scFv (taFv), among others.

[0158] The antibodies or antigen-binding fragments thereof described herein have a K of less than 100 nM (e.g., 95 nM, 90 nM, 85 nM, 80 nM, 75 nM, 70 nM, 65 nM, 60 nM, 55 nM, 50 nM, 45 nM, 40 nM, 35 nM, 30 nM, 25 nM, 20 nM, 15 nM, 10 nM, 5 nM, 4 nM, 3 nM, 2 nM or 1 nM). DIn some embodiments, the antibodies or antigen-binding fragments thereof described herein specifically bind to a synaptic protein with a concentration of less than 1 nM (e.g., 990 pM, 980 pM, 970 pM, 960 pM, 950 pM, 940 pM, 930 pM, 920 pM, 910 pM, 900 pM, 890 pM, 880 pM, 870 pM, 860 pM, 850 pM, 840 pM, 830 pM, 820 pM, 810 pM, 8 00pM, 790pM, 780pM, 770pM, 760pM, 750pM, 740pM, 730pM, 720pM, 710pM, 700pM, 690pM, 680pM, 670 pM, 660pM, 650pM, 640pM, 630pM, 620pM, 610pM, 600pM, 590pM, 580pM, 570pM, 560pM, 550pM, 540pM, 530pM, 520pM, 510pM, 500pM, 490pM, 480pM, 470pM, 460pM, 450pM, 440pM, 430pM, 420pM, 410pM, 40 0pM, 390pM, 380pM, 370pM, 360pM, 350pM, 340pM, 330pM, 320pM, 310pM, 300pM, 290pM, 280pM, 270p K of 100pM, 260pM, 250pM, 240pM, 230pM, 220pM, 210pM, 200pM, 190pM, 180pM, 170pM, 160pM, 150pM, 140pM, 130pM, 120pM, 110pM, 100pM, 90pM, 80pM, 70pM, 60pM, 50pM, 40pM, 30pM, 20pM, 10pM, 5pM or 1pM) D It specifically binds to synaptic proteins at low levels.

[0159] K of synaptic protein-specific antibodies or their antigen-binding fragments D or EC 50Examples of experiments that can be used to determine include, for example, surface plasmon resonance, isothermal titration calorimetry, fluorescence polarization, ELISA-based assays, gene expression assays, protein expression assays, among others. ELISA is a particularly useful method for analyzing antibody activity, since it is an assay that typically requires a minimal concentration of antibody. The common signal analyzed in a typical ELISA assay is luminescence, which is usually the result of the activity of a peroxidase attached to a secondary antibody that specifically binds to the primary antibody. The antibodies and antigen-binding fragments thereof described herein can bind to synaptic proteins and epitopes therein. The antibodies and antigen-binding fragments thereof described herein can further bind to isolated peptides derived from synaptic proteins that structurally pre-organize various residues in a manner that simulates the conformation of said epitopes in the native protein. In a direct ELISA experiment, this binding can be quantified, for example, by analyzing the luminescence that occurs upon incubation of an HRP substrate (e.g., 2,2'-azino-di-3-ethylbenzthiazoline sulfonate) with an antigen-antibody complex bound to an HRP-conjugated secondary antibody.

[0160] Prior to carrying out the methods described herein in a mammalian subject (e.g., a human), it may be desirable to conjugate the antibody or fragment thereof to a second molecule (e.g., a proximity detector), for example, to facilitate detection of a synaptic protein of a synaptic protein complex. Antibodies and fragments thereof can be conjugated to other molecules at either the N-terminus or C-terminus of the antibody's light or heavy chain using any of a variety of established conjugation strategies well known in the art. Examples of pairs of reactive functional groups that can be used to covalently conjugate an antibody or fragment thereof to another molecule include, but are not limited to, thiol pairs, carboxylic acids and amino groups, ketones and amino groups, aldehydes and amino groups, thiols and α,β-unsaturated moieties (such as maleimide or dehydroalanine), thiols and α-haloamides, carboxylic acids and hydrazides, aldehydes and hydrazides, and ketones and hydrazides.

[0161] The antibodies or antigen-binding fragments thereof disclosed herein can be directly covalently attached to another molecule by chemical bonds as described. Alternatively, a fusion protein comprising the antibody or antigen-binding fragment thereof can be recombinantly expressed from a cell (e.g., a eukaryotic or prokaryotic cell). This can be accomplished, for example, by integrating a polynucleotide encoding the fusion protein into the nuclear genome of the cell (e.g., using techniques described herein or known in the art). Optionally, the antibodies and fragments thereof described herein can be attached to a second molecule by forming a covalent bond between the antibody and a linker. This linker can then be attached to another molecule, or the linker can be attached to another molecule prior to ligation to the antibody or fragment thereof. Examples of linkers that can be used to form conjugates include polypeptide linkers, such as those that include naturally occurring or non-naturally occurring amino acids. In some embodiments, it may be desirable to include D-amino acids in the linker, as these residues do not occur in natural proteins and are therefore more resistant to degradation by endogenous proteases. Fusion proteins containing polypeptide linkers can be produced using conventional chemical synthesis techniques or by recombinant expression of a polynucleotide encoding the fusion protein in a cell (e.g., a prokaryotic or eukaryotic cell). Linkers can be prepared using a variety of strategies known in the art and can be cleaved by enzymatic hydrolysis, photolysis, hydrolysis under acidic conditions, hydrolysis under basic conditions, oxidation, disulfide reduction, nucleophilic cleavage, or organometallic cleavage (Leriche et al., Bioorg Med Chem 20:571-582, 2012), depending on the reactive components of the linker.

[0162] In some embodiments, the antibody or antigen-binding fragment is immobilized on a surface (e.g., a solid support, such as a plate, resin, particle, container, membrane, or bead). In some embodiments, the antibody or antigen-binding fragment is not immobilized on a surface (e.g., the antibody or antigen-binding fragment is suspended in solution).

[0163] ii. Polypeptides According to the methods disclosed herein, a structured (e.g., having a secondary or tertiary structure) or unstructured (i.e., linear) single-chain polypeptide or oligopeptide can be used as an affinity ligand that specifically binds to a synaptic protein to detect two or more synaptic proteins in a protein complex. Within the context of the present disclosure, the polypeptide or oligopeptide affinity ligand can be directed to one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30 or more) amino acid residues of a synaptic protein. In some embodiments, the polypeptide or oligopeptide comprises one or more (e.g., 1, 2, 3, 4, 5, 6 or more) CDRs covalently linked to each other, for example, by amide bonds, thioether bonds, carbon-carbon bonds or disulfide bridges. In some embodiments, the polypeptide or oligopeptide is a recombinant protein. In some embodiments, the polypeptide or oligopeptide comprises a portion or fragment of a protein that binds to a synaptic protein in situ. In some embodiments, portions or fragments of proteins that bind to synaptic proteins can be modified (e.g., mutated) to achieve desired properties, such as affinity, solubility, half-life, and stability, among others. In some embodiments, the polypeptide or oligopeptide is an engineered synthetic amino acid polymer with a desired affinity for a synaptic protein. In some embodiments, the single chain polypeptide or oligopeptide is a snake venom toxin. In some embodiments, the snake venom toxin is taipoxin. In some embodiments, the polypeptide or oligopeptide affinity ligand is conjugated or fused to a proximity detector disclosed herein (e.g., an oligonucleotide, a FRET protein, or a biotinylatable protein). In some embodiments, the polypeptide or oligopeptide is immobilized on a surface (e.g., a solid support, such as a plate, a resin, a particle, a container, a membrane, or a bead). In some embodiments, the polypeptide or oligopeptide is not immobilized on a surface (e.g., the polypeptide or oligopeptide is suspended in solution).

[0164] iii. Aptamers The present disclosure also contemplates aptamers (e.g., nucleic acid aptamers, such as single-stranded or double-stranded DNA, RNA or XNA aptamers) for use as affinity ligands that specifically bind to synaptic proteins for the detection of two or more synaptic proteins in a protein complex. Aptamers are oligonucleotide (e.g., DNA, RNA or XNA) or peptide molecules that preferentially bind to target proteins by non-covalent interactions (e.g., electrostatic interactions or hydrophobic interactions). In some embodiments, the aptamer affinity ligand is specific for a synaptic protein (e.g., NPTX1, NPTX2, NPTXR, or any one of the synaptic proteins listed in Table 1).

[0165] Nucleic acid aptamers can be synthesized using well-known methods, which may include, for example, the introduction of nucleotides at each stage of the synthesis reaction to control the final sequence. Certain modified aptamers can be used in any of the methods, devices, and kits described. Aptamers that contain nucleotides with modified bases have several properties that differ from standard aptamers that contain only naturally occurring nucleotides (i.e., unmodified nucleotides), such as improved half-life, nuclease resistance, and thermal stability. Modified nucleotides can be introduced during the synthesis process at desired positions in the base sequence. Other functional groups can be introduced as desired using known chemical modifications of nucleotides.

[0166] Peptide aptamers can also be used in combination with the disclosed method.Peptide aptamers are generally small, ordered, soluble, engineered proteins designed to specifically bind to target molecules.The general structure of peptide aptamers includes one or more peptide loops of variable amino acid sequence attached to a protein scaffold.

[0167] In some embodiments, the aptamer affinity ligand is included in (conjugated or fused to) a proximity detector (e.g., an oligonucleotide, a FRET protein, or a biotinylatable protein) disclosed herein. In the case of a nucleic acid aptamer combined with an oligonucleotide proximity detector, the aptamer can be synthesized without the need for conjugation of the oligonucleotide to the aptamer sequence, such that the oligonucleotide proximity detector (e.g., the oligonucleotide plus or minus strand) becomes part of the aptamer sequence. In some embodiments, the aptamer is immobilized on a surface (e.g., a solid support, such as a plate, a resin, a particle, a container, a membrane, or a bead). In some embodiments, the aptamer is not immobilized on a surface (e.g., the aptamer is suspended in solution).

[0168] Proximity Detector The disclosed methods are based in part on the detection of complex synaptic proteins in a subject's blood sample using a proximity-based detection assay (e.g., the proximity ligation assay described herein), whose sensitivity depends on the physical proximity of synaptic proteins in a protein complex. Such proximity detection can be aided by binding a proximity detector to an affinity ligand as disclosed herein, such that when two or more proximity detector-bound affinity ligands are sufficiently adjacent, the proximity detectors can physically interact and generate a proximity signal that is proportional in magnitude (e.g., linearly, superlinearly, multiplicatively, or exponentially proportional) to the amount of target synaptic protein in the protein complex. Thus, the present disclosure provides a plurality of proximity detectors that can be used in conjunction with the methods disclosed herein.

[0169] i. Oligonucleotides In some embodiments, the proximity detection of synaptic proteins in protein complexes uses single-stranded oligonucleotides as proximity detectors. The oligonucleotides can be used according to the modified PLA protocol described herein. Specifically, the oligonucleotide-based proximity detector can include an oligonucleotide plus strand (e.g., SEQ ID NO: 1) bound to an affinity ligand (e.g., a non-immobilized affinity ligand) specific for a first synaptic protein (e.g., NPTX2, NPTX1, or NPTXR), and an oligonucleotide minus strand (e.g., SEQ ID NO: 2) bound to a different affinity ligand specific for a second synaptic protein (e.g., NPTX2, NPTX1, or NPTXR, or any one of the synaptic proteins listed in Table 1, provided that the second synaptic protein is of a different species from the first synaptic protein) present in a complex with the first protein. The oligonucleotide plus strand can be bound to its corresponding affinity ligand at its 5' end, while the oligonucleotide minus strand can be bound to its corresponding affinity ligand at its 3' end. The plus and minus strands may contain binding sites for forward primers (e.g., SEQ ID NO: 4) and reverse primers (e.g., SEQ ID NO: 5) that may be used in the qRT-PCR reactions described herein. To detect physical proximity between the plus and minus strands, a connector oligonucleotide (e.g., a splint oligonucleotide such as SEQ ID NO: 3) may be used to hybridize at or near the 3' end of the plus strand and the 5' end of the minus strand, generating a duplex structure that closely juxtaposes the plus and minus strands. In some embodiments, the oligonucleotide plus strand has between 6 and 15 nucleotides at or near its 3' end (e.g., 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 nucleotides from the 3' end) that can hybridize by complementary base pairing (e.g., complete or partial complementarity) to the connector oligonucleotide.In some embodiments, the oligonucleotide minus strand has between 6 and 15 nucleotides (e.g., 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 nucleotides from the 5' end) at or near its 5' end that can hybridize complementary base pairing (e.g., complete or partial complementarity) to the connector oligonucleotide. The plus and minus strands juxtaposed by hybridization to the connect oligonucleotide can be linked using a ligase enzyme (e.g., T4 DNA ligase, E. coli DNA ligase, or mammalian DNA ligase) that catalyzes the formation of a phosphodiester bond between two adjacent nucleotides. Such ligation of the plus and minus oligonucleotide strands produces a linked plus-minus oligonucleotide strand (LPMOS), which can then be amplified using known nucleic acid amplification methods (e.g., qRT-PCR). Thus, the magnitude of the amplified signal from the LPMOS amplicon indicates the amount of a protein complex containing the first and second synaptic proteins. In some embodiments, the LPMOS amplicon has a length of 60-100 (e.g., 65-95, 70-90, or 75-85) nucleotides.

[0170] In some embodiments, the oligonucleotide plus strand has the nucleic acid sequence of SEQ ID NO:1 or a variant thereof having at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more) sequence identity to the nucleic acid sequence of SEQ ID NO:1.

[0171] 5'CGCATCGCCCTTGGACTACGACTGACGAACCGCTTTGCCTGACTGATCGCTAAATCGTG3' (SEQ ID NO:1) In some embodiments, the 5' end of the oligonucleotide plus strand comprises an amino group. In some embodiments, the oligonucleotide plus strand comprises DNA or RNA. In some embodiments, the oligonucleotide plus strand comprises 30-100 (e.g., 35-95, 40-90, 45-85, 50-80, 55-75, or 60-70) nucleotides or nucleosides. In some embodiments, the oligonucleotide plus strand can hybridize to a forward primer. In some embodiments, the forward primer has a nucleic acid sequence of SEQ ID NO: 4 (5'CATCGCCCTTGGACTACGA3') or a variant thereof having at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more) sequence identity to the nucleic acid sequence of SEQ ID NO: 4.

[0172] In some embodiments, the oligonucleotide minus strand has the nucleic acid sequence of SEQ ID NO:2 or a variant thereof having at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more) sequence identity to the nucleic acid sequence of SEQ ID NO:2.

[0173] 5'TCGTGTCTAAAGTCCGTTACCTTGATTCCCCTAACCCTCTTGAAAAATTCGGCATCGGTGA3' (Sequence number 2).

[0174] In some embodiments, the 3' end of the oligonucleotide minus strand comprises an amino group. In some embodiments, the 5' end of the oligonucleotide minus strand comprises a 5' monophosphate moiety. In some embodiments, the oligonucleotide minus strand comprises DNA or RNA. In some embodiments, the oligonucleotide minus strand comprises 30-100 (e.g., 35-95, 40-90, 45-85, 50-80, 55-75, or 60-70) nucleotides or nucleosides. In some embodiments, the oligonucleotide minus strand can hybridize to a reverse primer. In some embodiments, the reverse primer has a nucleic acid sequence of SEQ ID NO:5 (5'GGGAATCAAGGTAACGGACTTTAG3') or a variant thereof having at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more) sequence identity to the nucleic acid sequence of SEQ ID NO:5.

[0175] In some embodiments, the connector oligonucleotide has the nucleic acid sequence of SEQ ID NO:3 or a variant thereof having at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more) sequence identity to the nucleic acid sequence of SEQ ID NO:3.

[0176] 5'TACTTAGACACGACACGATTTAGTTT3' (SEQ ID NO:3) In some embodiments, the connector oligonucleotide comprises DNA or RNA, hi some embodiments, the connector oligonucleotide comprises 10-30 (e.g., 12-28, 14-26, 16-24, or 18-22) nucleotides or nucleosides.

[0177] ii. Fluorescence resonance energy transfer The present disclosure also contemplates the use of fluorescence resonance energy transfer (FRET, also known as Förster resonance energy transfer) molecules (e.g., proteins) for use as proximity detectors to detect the presence of two or more synaptic proteins in a protein complex. The basic principle underlying FRET technology is the transfer of energy between two light-sensitive molecules (chromophores), a donor chromophore and an acceptor chromophore, by non-radioactive dipole coupling. The efficiency of this energy transfer is inversely proportional to the sixth power of the physical distance between the donor and acceptor chromophores, making the FRET method particularly suitable for sensitively measuring the distance between chromophores. The transfer of energy begins when an excited (acceptor) chromophore emits a virtual (i.e., undetectable) photon, which is instantly absorbed by the donor chromophore. Given its advantageous properties, FRET technology is useful for evaluating protein-protein interactions, such as the physical interactions between synaptic proteins (e.g., NPTX1, NPTX2, NPTXR, or any one of the synaptic proteins listed in Table 1) in a protein complex. FRET fluorescent signals are suitable for conventional fluorescent imaging methods. Many well-known chromophores have been developed for use in FRET. Non-limiting examples of chromophores suitable for use as FRET proximity detectors include the cyan fluorescent protein (CFP)-yellow fluorescent protein (YFP) pair, or any other green fluorescent protein (GFP) derivative. These proteins can be fused to protein affinity ligands or conjugated to the nucleic acid affinity ligands of the present disclosure, for example, using well-known methods such as those described herein.

[0178] A variant of FRET called bioluminescence resonance energy transfer (BRET) can also be used as a proximity detector for use in the disclosed methods. The advantage of BRET compared to FRET is that it does not require external illumination to initiate fluorescence transfer, improving the signal-to-noise ratio and reducing photobleaching. BRET relies on the use of bioluminescent proteins such as R. reniformis luciferase or O. gracilirostris luciferase, or variants thereof.

[0179] iii. Bimolecular Fluorescence Complementation According to the present disclosure, biomolecular fluorescence complementation (BiFC) can also be used in the proximity detection method described herein. BiFC is premised on the generation of a fluorescent signal by fusing complementary fragments of a fluorescent reporter protein (e.g., enhanced GFP, enhanced CFP, YFP, RFP, enhanced BFP, mCherry, mHoneydew, mBanana, mOrange, tdTomato, mTangerine, mStrawberry, mCherry, mGrapel, mRaspberry, mGrape2, mPlum or dsRed) to two target proteins that are believed to interact (e.g., in a protein complex). Physical interaction or proximity between the two target proteins allows the interaction of the complementary fluorescent protein fragments, which causes the proteins to return to their native conformation and generate a fluorescent signal. Thus, one complementary fragment of the fluorescent reporter can be fused to a first affinity ligand specific for a first synaptic protein, and the other fragment can be fused to a second affinity ligand specific for a second synaptic protein, where the two synaptic proteins are believed to interact with each other in a protein complex. Thus, each half of the fluorescent reporter protein acts as a proximity detector that, when sufficiently close to its complementary half, generates a proximity signal indicative of the interaction between the two synaptic proteins in the complex. As with FRET, standard fluorescent imaging methods can be used to detect the fluorescent signal generated by the BiFC substrate protein.

[0180] iv. Biotin ligase or ascorbate peroxidase Additionally, the disclosed methods may employ biotin-based proximity detection methods, for example, methods using biotinylated proteins such as ascorbate peroxidase (APX) or birA biotin protein ligase (BirA). APX is a heme-containing peroxidase that catalyzes the oxidation of a variety of molecules. APX can oxidize biotin and generate reactive biotin species that diffuse from the active site and indiscriminately biotinylate nearby proteins at tyrosine, tryptophan, cysteine, and histidine residues. Established methods for assessing protein-protein interactions using biotinylation by APX enzymes are the APEX (pea APX) and APEX2 (soybean APX) technologies. APEX (and APEX2) are characterized by fast biotinylation that occurs on a time scale of minutes, facilitating efficient detection of labeled molecules. Proximity biotinylation methods similar to the APEX technology include BioID, TurboID and MiniTurbo methods, which use the E. coli BirA enzyme, BioID2, which uses A. aeolicus biotin ligase, and BASU, which uses B. subtilis biotin ligase.

[0181] In the context of the present disclosure, the APX enzyme or any one of the other aforementioned biotinylation enzymes can be fused or conjugated to an affinity ligand specific for a first synaptic protein or a second synaptic protein, or both. When there is sufficient physical proximity between the two synaptic proteins, the APX enzyme transfers a reactive biotin moiety to the first and / or second synaptic protein, thereby generating a proximity signal that can be detected using conventional methods (e.g., streptavidin-based detection methods, e.g., streptavidin affinity matrices). Alternatively, the APX enzyme or any one of the other aforementioned biotinylation enzymes can be separated into two complementary fragments, each of which can be fused or conjugated to a first affinity ligand specific for the first synaptic protein and a second affinity ligand protein specific for the second synaptic protein, respectively. When the two synaptic proteins are close enough to allow the binding of the two complementary halves of the biotinylation enzyme, the enzyme becomes functional, thereby allowing the generation of a reactive biotin species that biotinylates one or both of the synaptic proteins. The transferred biotin moiety thus serves as a proximity signal that can be detected using conventional methods: the amount of biotinylation can be proportional (e.g., linear, supralinear, multiplicative or exponential) to the physical distance between the first and second synaptic proteins.

[0182] sample The disclosed methods can be performed using a sample from a subject (e.g., a human, such as a human at risk for developing a neuropathy). In particular, the sample is a blood sample (e.g., blood, serum, or plasma) obtained from a subject (e.g., a human subject diagnosed as having or at risk for developing a neuropathy). The amount of sample used in the assay varies depending on the type of assay being performed and the support (e.g., a solid support, such as a plate, resin, particle, vessel, membrane, or bead) used. The amount of sample used can be from about 1 μL to about 500 μL (e.g., for assays using multi-well plates, from about 50 μL to about 200 μL). In some embodiments, the amount of sample is 50 μL. The sample can be diluted with a buffer (e.g., water, PBS, or a buffer used in the assay method) that does not interfere with binding to the binding agent or detection agent prior to use in the assay, and can be diluted 1:2, 1:3, 1:4, 1:5, 1:10, 1:15, 1:20, 1:100, or more.

[0183] Quantification of synaptic proteins The amount of a synaptic protein (e.g., NPTX2, NPTX1, NPTXR, or any one of the synaptic proteins listed in Table 1) in a blood sample obtained from a subject (e.g., a human, such as a human subject identified as having or at risk of developing a neuropathy) can be quantified according to conventional detection methods, such as, for example, the detection methods disclosed herein. As described herein, the amount of a synaptic protein can be ascertained by measuring the amount of a first synaptic protein in a complex with a second synaptic protein (e.g., NPTX2, NPTX1, NPTXR, or any one of the synaptic proteins listed in Table 1, provided that the first and second synaptic proteins are different types) using the disclosed proximity-based assays. In the case of the nucleic acid-based proximity detectors disclosed herein, quantification of one or more synaptic proteins can be performed using conventional nucleic acid amplification and detection methods (e.g., PCR such as qRT-PCR, microarrays, and sequencing, among others).

[0184] In some embodiments, the amount of one or more synaptic proteins is quantified using qRT-PCR. qRT-PCR generally uses at least one primer, and often two primers (e.g., a forward primer and a reverse primer). Primers useful for use in conjunction with the present disclosure include oligonucleotide primers that can act as initiation points for nucleic acid synthesis within or adjacent to an oligonucleotide sequence. Primers can be generated using conventional methods (e.g., synthetic). Such primers are usually made single-stranded to improve amplification efficiency. Primers can be DNA or RNA primers. Generally, the results of a qRT-PCR run are expressed in the form of a cycle threshold (C(T)) value, which is the point at which the fluorescence intensity of a sample crosses the background intensity. A lower C(T) value reflects a higher number of amplification products formed. qRT-PCR can be used to measure amounts using relative or absolute quantification. Absolute quantification allows the exact amount of a target nucleic acid molecule to be measured by comparison to a standard curve. Relative quantification relies on an internal reference gene to quantify the fold difference in expression of the target nucleic acid. In relative quantification, the measured amount is relative to an internal reference gene. Measuring the amount of a synaptic protein in a subject's blood sample can also be performed by averaging multiple qRT-PCR runs.

[0185] When quantification of synaptic proteins in a blood sample of a subject by detection of a fluorescent or luminescent signal emitted by a protein (e.g., a FRET, BRET or BiFC protein) is required, conventional fluorescence imaging techniques (e.g., total internal reflection fluorescence microscopy, light sheet fluorescence microscopy, fluorescence lifetime imaging microscopy, or fluorescence confocal laser scanning microscopy) can be used to quantify the amount of synaptic protein(s) in the sample. Various parameters of the fluorescent signal (e.g., amplitude, duration, decay time constant or waveform) can be used to analyze the amount of one or more synaptic proteins in the sample.

[0186] Quantification of one or more synaptic proteins in a subject's blood sample can also be performed when the proximity detector (e.g., the proximity detectors described herein) is an enzyme capable of generating reactive biotin species. In such cases, the biotin moiety attached to the synaptic protein(s) serves as a substrate for detection. Conventional techniques can be used to detect biotinylated synaptic proteins in a sample. For example, due to its strong binding with streptavidin, the presence of the biotin moiety on the protein can be detected using a streptavidin-based detection assay (e.g., streptavidin affinity matrix). If the identity of the biotinylated synaptic protein is known a priori, simultaneous labeling with an antibody or antigen-binding fragment thereof specific for the synaptic protein can be used to confirm the identity of the biotinylated protein.

[0187] Neuropathy The present disclosure contemplates methods for the diagnosis and prognosis of various neurological disorders, including neurodegenerative, neurodevelopmental or neuropsychiatric disorders, in a subject.

[0188] Neurodegenerative disorders Neurodegeneration is a pathophysiological process observed in many diseases associated with progressive dementia, such as late-onset (sporadic) or familial AD and Alzheimer's disease-related dementia (ADRD, e.g., frontotemporal degeneration (FTD), Lewy body dementia (LBD), vascular cognitive impairment and dementia (VCID), and mixed etiology dementia (MED)), Parkinson's disease (PD), Huntington's disease (HD), lysosomal storage disorders (e.g., neuronal ceroid lipofuscinosis), and prion diseases. A key feature of this process is neurodegeneration and neuronal cell death, which leads to a global destruction of brain tissue and a variety of associated behavioral deficits, including cognitive decline, speech impairment, and movement disorders, among others. The present disclosure features diagnostic and prognostic methods for subjects suffering from one or more neurodegenerative disorders described herein.

[0189] i. Alzheimer's disease AD is a neurodegenerative disease characterized by progressive neuronal loss in the frontal, temporal and parietal lobes of the cerebral cortex, as well as in subcortical structures such as the basal forebrain cholinergic system and the locus coeruleus in the brainstem. Clinical symptoms of AD are the progressive decline of many cognitive functions, including short-term and long-term memory, spatial navigation, verbal fluency, impulse control, anhedonia and social withdrawal. Neuronal atrophy in the brains of AD patients is associated with the accumulation of extracellular and intracellular protein inclusions. Aggregates of insoluble amyloid-β (Aβ) protein are prevalent in the extracellular space, whereas neurofibrillary tangles (NFTs) of hyperphosphorylated tau protein are usually found in the intracellular compartment of affected neurons. These neuropathologies are thought to be important in the pathogenesis of AD.

[0190] Previous studies have linked neuronal pentraxin proteins to the pathogenesis of AD (Xiao et al., Elife6:e23798,2017). In particular, Xiao et al. found that NPTX2-deficient rats with amyloidosis exhibited reduced GluR4 AMPA receptor subunit expression, especially on parvalbumin-positive (PV+) interneurons in the CNS. The study also demonstrated reduced NPTX2 levels in postmortem samples from AD patients, as well as a significant correlation between NPTX2 levels in cerebrospinal fluid (CSF) and cognitive performance and hippocampal volume in AD patients. PV+ interneurons are particularly susceptible to degeneration, and have been demonstrated to be reduced by up to 60% in the brains of AD patients (Chapman et al., Front Cell Neurosci13:575,2019).

[0191] ii. Parkinson's disease with or without dementia PD is a progressive disease that affects movement and is recognized as the second most common neurodegenerative disease after AD. Common symptoms of PD include resting tremor, rigidity and bradykinesia, and non-motor symptoms such as depression, constipation, pain, sleep disorders, urinary problems, cognitive decline and olfactory disorders are also increasingly associated with the disorder. A key feature of PD is the death of dopaminergic neurons in the substantia nigra pars compacta, and therefore most current treatments for PD focus on increasing dopamine. Another well-known neuropathological feature of PD is the presence of α-synuclein-containing Lewy bodies in affected brain regions, which are thought to contribute to the disease.

[0192] PD is thought to result from a combination of genetic and environmental risk factors. No single gene is responsible for all PD cases, and the majority of cases appear to be sporadic and not directly inherited. Mutations in the genes encoding parkin, PTEN-induced putative kinase 1 (PINK1), leucine-rich repeat kinase 2 (LRRK2), and Parkinson's disease-associated deglycase (DJ-1) have been found to be associated with PD, but they account for only a small proportion of the total number of cases. Occupational exposure to some pesticides and herbicides has also been proposed as a risk factor for PD.

[0193] Previous studies have demonstrated upregulation of human NPTX2 mRNA in sporadic PD, particularly in cortical neurons and glial cells with Lewy bodies in the substantia nigra, suggesting a potential involvement of NPTX2 in the neurodegeneration observed in PD (Chapman et al., Front Cell Neurosci 13:575, 2019). Furthermore, NPTX2 levels are decreased in the cerebrospinal fluid (CSF) of patients with dementia and Lewy body disease (DLB) (van Steenovet et al., Mol. Neurodegen. 15:36, 2020).

[0194] iii. Frontotemporal degeneration FTD is a clinical syndrome characterized by progressive neurodegeneration in the frontal and temporal lobes of the cerebral cortex. The symptoms of FTD are complex and heterogeneous and can manifest as one of three clinically distinct variants, including: 1) behavioral variant frontotemporal dementia (BVFTD), characterized by behavioral and personality changes, blunted affect, social withdrawal, perseverative behavior, attention deficit, disinhibition, and overt degeneration of the frontal lobe; and 2) semantic dementia (SD), characterized by fluent aphasia, progressive loss of semantic knowledge of words, objects, and concepts, and overt degeneration of the anterior temporal lobe. Furthermore, the SD variant of FTD shows flat affect, social deficit, perseverative behavior, and disinhibition, or 3) progressive non-fluent aphasia, characterized by motor impairment in speech, reduced language expression, and overt degeneration of the perisylvian cortex. Neuronal loss in the brains of FTD patients is associated with one of three distinct neuropathologies: 1) the presence of tau-positive neuronal and glial inclusions, 2) ubiquitin (ub)-positive and TAR DNA-binding protein 43 (TDP43)-positive but tau-negative inclusions, or 3) ub- and fused sarcoma (FUS)-positive but tau- and TDP-43-negative inclusions. These neuropathologies are thought to be important in the pathogenesis of FTD.

[0195] Nearly half of patients with FTD have a first-degree family member with dementia, ALS, or PD, suggesting a strong genetic link to the cause of the disease. A number of mutations on chromosome 17q21 have been associated with the development of FTD.

[0196] Previous studies have demonstrated that syndromic HD mutation carriers have lower CSF levels of NPTX1, NPTX2, and NPTXR (van der Ende et al., J Neurol Neurosurg Psychiatry91:612-21,2020). Notably, CSF NPTX2 levels correlated with clinical measures of disease severity and gray matter volume in multiple brain regions and predicted reduced phonological verbal fluency and clinical measures of dementia.

[0197] iv. Huntington's disease HD is an autosomal dominant neuronal amyloidogenic disease. 5-10 per 100,000 people are affected by this autosomal disorder. However, the prevalence in the United States is much higher, with studies showing that 50% of fewer than 200,000 Americans are at risk of developing HD, with only 100,000 registered worldwide, compared to 30,000 registered patients in the United States.

[0198] HD is caused by a trinucleotide CAG repeat expansion in the huntingtin (HTT) gene, specifically in exon 1 of the HTT gene located on chromosome 4 (MacDonald et al., Cell 72, (1993), 971-983), which is converted into a polyglutamine (polyQ) stretch in the HTT protein. HD occurs when the length of the polyQ tract exceeds 35-40 glutamine residues, and there is a strong inverse correlation between repeat length and age of onset. This polyQ stretch causes misfolding and aggregation of HTT in neurons and glial cells of the CNS. With age, the accumulation of HTT aggregates causes degeneration of striatal GABAergic neurons and cortical pyramidal neurons. Symptoms of HD include involuntary movements, lack of motor coordination, depression, and cognitive decline, e.g., memory loss and / or dementia.

[0199] Neurodevelopmental disorders Neurodevelopmental disorders are a group of conditions characterized by disturbances in the typical development of the nervous system, resulting in impairments in neural branching and brain function, including, but not limited to, learning, memory, emotional control, impulse control, communication deficits, and motor deficits. Neurodevelopmental disorders can result from abnormal development of the nervous system caused by genetic disorders, social deprivation, metabolic diseases, immune disorders, infections, nutritional factors, physical trauma, or toxic or environmental factors. Non-limiting examples of neurodevelopmental disorders that may be suitable for screening using the disclosed methods include intellectual disability, learning disabilities (e.g., dyslexia or dyscalculia), autism spectrum disorders (e.g., autism or Asperger's syndrome), movement disorders (e.g., developmental coordination disorder or stereotypy), tic disorders (e.g., Tourette's syndrome), traumatic brain injury (e.g., congenital injury), communication and language disorders, genetic disorders (e.g., fragile X syndrome, Down's syndrome, attention deficit hyperactivity disorder (ADHD), hypogonadotropic hypogonadism syndrome), and disorders due to neurotoxic substances (e.g., fetal alcohol spectrum disorder, Minamata disease due to mercury, behavioral disorders due to heavy metals such as lead, chromium and platinum, hydrocarbons, PBDEs, PCBs, drugs, or illegal drugs). Thus, the present disclosure features, inter alia, diagnostic and prognostic methods for subjects suffering from one or more of the aforementioned neurodevelopmental disorders.

[0200] Neuropsychiatric disorders Neuropsychiatric disorders are a group of diverse conditions characterized by abnormal emotions, cognition and / or behavior. In many cases, these disorders result from organic damage to the cerebral cortex, but extracerebral regions of the CNS may also be affected. Neuropsychiatric disorders usually exhibit a variety of psychiatric symptoms, including, but not limited to, anxiety, nervousness, apathy, mood disorders, hallucinations, delusions, behavioral and personality changes, delirium, and dementia. Non-limiting examples of neuropsychiatric disorders suitable for screening using the disclosed method include major depression, bipolar disorder, obsessive-compulsive disorder, eating disorder, and schizophrenia.

[0201] Diagnostic and prognostic methods Diagnosis and Prognosis The proximity-based detection assays described herein can be used to provide a subject (e.g., a human) with a diagnosis or prognosis indicative of the presence of a neurological disorder (e.g., a neurodegenerative, neurodevelopmental, or neuropsychiatric disorder), clinical outcome with or without medical treatment, responsiveness to a therapeutic agent, the patient's resilience to a neurological disorder, or the severity of symptoms within a particular cognitive domain (e.g., learning and memory) of the subject. In particular, the disclosed methods can be used to provide a diagnosis or prognosis to a subject having or suspected of having a neurological disorder based on detection of one or more synaptic proteins (e.g., NPTX2, NPTX1, NPTXR, or any one of the synaptic proteins listed in Table 1) in a blood sample (e.g., blood, serum, or plasma) from the subject. The diagnostic or prognostic methods can be performed on prodromal subjects, or on symptomatic subjects who have or are at risk of developing a neurological disorder. Risk factors can include, among others, genetic mutations, environmental factors (e.g., exposure to neurotoxins), infections, trauma, age, sex, ethnicity, weight, socioeconomic status, diet, personal lifestyle, or pre-existing conditions.

[0202] The assays described herein can be used to measure the level of one or more synaptic proteins in a blood sample of a subject who has or is at risk of developing a neuropathy. The level of complex synaptic protein(s) measured from a blood sample can be used to determine whether the subject has or is at risk of developing a neuropathy by comparing said levels in a blood sample from the subject with a reference blood sample. The reference blood sample can be from one or more healthy subjects of similar age, sex, geographic location, lifestyle, etc. For example, the level of a neuronal pentraxin (e.g., NPTX2, NPTX1, or NPTXR) complexed with another synaptic protein (e.g., NPTX2, NPTX1, NPTXR, or any one of the synaptic proteins listed in Table 1, provided that the two synaptic proteins are different types) in a blood sample can indicate the disease state of the subject from whom the blood sample was taken. In particular, an increase in the level of a protein complex containing both NPTX2 and NPTXR in a blood sample of a subject having or suspected of having a neuropathy compared to a reference blood sample may indicate a positive diagnosis that the subject has or is at risk of developing a neuropathy. In another example, an increase in the level of a protein complex containing both NPTX1 and NPTXR in a blood sample of a subject having or suspected of having a neuropathy compared to a reference blood sample may indicate a positive diagnosis that the subject has or is at risk of developing a neuropathy. In another example, a decrease in the level of a protein complex containing both NPTX2 and GluA4 in a blood sample of a subject having or suspected of having a neuropathy compared to a reference blood sample may indicate a positive diagnosis that the subject has or is at risk of developing a neuropathy. Furthermore, the ratio of synaptic protein levels measured in a subject's blood sample may indicate a disease state.For example, a decrease in the ratio of NPTX2-GluA4 synaptic protein complex to NPTX2-NPTXR synaptic protein complex in a blood sample of a subject may indicate that the subject has a neuropathy or is at risk of developing a neuropathy.Similarly, a decrease in the ratio of NPTX2-GluA4 synaptic protein complex to NPTX1-NPTXR synaptic protein complex in a blood sample of a subject may indicate that the subject has a neuropathy or is at risk of developing a neuropathy.The decrease in the level of synaptic protein (or synaptic protein complex) or the ratio of synaptic protein complex can be 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more compared to the level of synaptic protein or the ratio of synaptic protein complex in a reference blood sample. An increase in the level of a synaptic protein (or synaptic protein complex) or proportion of a synaptic protein complex can be a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, 1000% or more decrease compared to the level of a synaptic protein or proportion of a synaptic protein complex in a reference blood sample.

[0203] The assays disclosed herein can be used in conjunction with any of the methods described, for example, in the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition and the International Classification of Diseases, 11 th It can be used as a diagnostic method in combination with other conventional methods for diagnosing neurological disorders, such as the method described in the Revision.

[0204] For example, the diagnosis of neurological disorder in a subject may be guided by neuropsychological testing to assess the degree of cognitive impairment in the subject.The cognitive function of a subject can be evaluated by carrying out a cognitive test that evaluates the performance across one or more cognitive domains, including but not limited to complex attention, executive function, learning and memory, language, sensory-motor function, and social cognition.The cognitive function of a subject can be compared with a standard value (e.g., a reference population such as the general population) that is appropriate for the subject's age, medical history, education, socioeconomic status, and lifestyle to determine the diagnosis of the subject's neurological disorder. Non-limiting examples of cognitive tests include Eight-item Informant Interview to Differentiate Aging and Dementia (AD8), Annual Wellness Visit (AWV), General Practitioner Assessment of Cognition (GPCOG), Health Risk Assessment (HRA), Memory Impairment Screen (MIS), Mini Mental Status Exam (MMSE), Montreal Cognitive Assessment (MoCA), St. Louis University Mental Status Exam (SLUMS) and Short Informant Questionnaire on Cognitive Decline in the Elderly (Short IQCODE).Alternatively or in addition, the use of F18-fluorodeoxyglucose PET scan or MRI scan can be used to determine the presence of neurodegeneration in subjects with neurological disorders (e.g., neurodegenerative disorders).

[0205] Additionally, the subject may be tested for the presence of biomarkers specific to the particular neurological disorder of interest, for example, the presence of Aβ plaques or hyperphosphorylated tau protein NFTs in the subject's forebrain, mutations in the APP, PSEN1, PSEN2 and / or TREM2 genes, and the presence of a variant of the ε4 allele of APOE in the subject, that indicate the subject has AD.

[0206] The cognitive function of the subject can be evaluated by carrying out a cognitive test that evaluates the performance across one or more cognitive domains, including, but not limited to, learning and memory, complex attention, executive function, language, sensory-motor function, and social cognition.The cognitive function of the subject can be compared with a standard value (e.g., a reference population such as the general population) that is appropriate for the subject's age, medical history, education, socioeconomic status, and lifestyle to determine or confirm the diagnosis of the subject's neurological disorder.

[0207] Disease Severity The methods described herein can also be used to assess the severity of disease in subjects identified as having neuropathy or at risk of developing neuropathy.For example, in the blood sample of a subject with neuropathy or suspected of having neuropathy, the level of the protein complex containing both NPTX2 and NPTXR, or NPTX1 and NPTXR, is increased compared to the reference blood sample, which can indicate that the severity of disease in the subject is higher than normal (e.g., for a reference patient or patient population).In another example, the level of the protein complex containing both NPTX2 and GluA4, or the ratio of NPTX2-GluA4 synaptic protein complex to NPTX2-NPTXR complex in the blood sample of the subject can indicate that the severity of disease in the subject is higher than normal. The decrease in the level of a synaptic protein (or synaptic protein complex) or the proportion of a synaptic protein complex can be a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more decrease compared to the level of a synaptic protein or the proportion of a synaptic protein complex in a reference blood sample. The increase in the level of a synaptic protein (or synaptic protein complex), or the proportion of a synaptic protein complex, may be a decrease of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, 1000% or more compared to the level of a synaptic protein or the proportion of a synaptic protein complex in a reference blood sample. Once the severity of the neurological disorder has been assessed, a corresponding course of treatment may be recommended. For example, subjects identified as having high disease severity may be administered a more frequent and / or more aggressive treatment regimen than subjects identified as having normal or low disease severity.Thus, the assays disclosed herein can be used to detect potentially debilitating or life-threatening conditions and to assess the need for an appropriate therapeutic response.

[0208] Monitoring Subjects who have or are at risk of developing a neuropathy described herein can be monitored using the methods disclosed herein. Monitoring can be an appropriate approach for subjects whose current disease state shows a possible worsening of disease symptoms, whether determined using the disclosed methods or methods known in the art. Alternatively, monitoring can be performed in subjects who have been diagnosed with a neuropathy using the disclosed methods or methods known in the art, but who are asymptomatic at the time of evaluation. Monitoring can be performed using the disclosed methods at regular intervals (e.g., once a year, twice a year, once every three months, once a month, once every two months, or once a week) to determine whether the levels of synaptic proteins or their ratios are stable or fluctuating. A decrease in the levels of NPTX2-NPTXR complex and / or NPTX1-NPTXR complex in the subject's blood sample can indicate an improvement in the disease state. Furthermore, an increase in the level of NPTX2-GluA4, or the ratio of NPTX2-GluA4 to NPTX2-NPTXR, or the ratio of NPTX2-GluA4 to NPTX1-NPTXR in a blood sample of a subject may indicate an improvement in a disease state. Conversely, an increase in the level of NPTX2-NPTXR complex and / or NPTX1-NPTXR complex in a blood sample of a subject may indicate an aggravation of a disease state. Similarly, a decrease in the level of NPTX2-GluA4, or the ratio of NPTX2-GluA4 to NPTX2-NPTXR, or the ratio of NPTX2-GluA4 to NPTX1-NPTXR in a blood sample of a subject may indicate an aggravation of a disease state. The decrease in the level of a synaptic protein (or synaptic protein complex) or the proportion of a synaptic protein complex can be a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more decrease compared to the level of a synaptic protein or the proportion of a synaptic protein complex in a reference blood sample.An increase in the level of a synaptic protein (or synaptic protein complex) or proportion of a synaptic protein complex can be a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, 1000% or more decrease compared to the level of a synaptic protein or proportion of a synaptic protein complex in a reference blood sample.

[0209] Treatment effect The disclosed method can also be used to evaluate or predict the therapeutic effect of a therapeutic agent in a subject identified as having or at risk of developing a neuropathy. For example, the level of a synaptic protein disclosed herein in a subject's blood sample can be measured before or after the start of treatment, and then continuously during treatment (e.g., once a day, once a week, once every two weeks, once a month, once every two months, once every three months, or twice a year). A decrease in the level of NPTX2-NPTXR complex and / or NPTX1-NPTXR complex in the subject's blood sample during the course of treatment can indicate improvement and demonstrate the effectiveness of the treatment. Furthermore, an increase in the level of NPTX2-GluA4, or the ratio of NPTX2-GluA4 to NPTX2-NPTXR, or the ratio of NPTX2-GluA4 to NPTX1-NPTXR in the subject's blood sample can also indicate a therapeutic effect. Conversely, an increase in the level of NPTX2-NPTXR complex and / or NPTX1-NPTXR complex in the subject's blood sample can indicate a lack of therapeutic effect. Similarly, the level of NPTX2-GluA4 or the ratio of NPTX2-GluA4 to NPTX2-NPTXR or the ratio of NPTX2-GluA4 to NPTX1-NPTXR in the blood sample of the subject may indicate lack of therapeutic effect.The level of synaptic protein (or synaptic protein complex) or the ratio of synaptic protein complex may be reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more compared to the level of synaptic protein or the ratio of synaptic protein complex in the reference blood sample.An increase in the level of a synaptic protein (or synaptic protein complex) or proportion of a synaptic protein complex can be a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, 1000% or more decrease compared to the level of a synaptic protein or proportion of a synaptic protein complex in a reference blood sample.

[0210] Resilience In the context of neurodegenerative disease, resilience refers to the phenomenon that some subjects who were asymptomatic throughout their lives may be found after death to exhibit neuropathological features indicative of the burden of neurodegenerative disease. For example, a patient who is resilient to AD may not exhibit symptoms of cognitive decline throughout their life, but after death, may be found to have a high burden of amyloid-β plaques and / or hyperphosphorylated tau protein changes. In such cases, it may be advantageous to perform the disclosed assays on a blood sample from a subject, such as, for example, a subject with a history of familial neurodegenerative disease or a subject exposed to environmental toxins that may induce neurodegenerative disease, to determine whether the subject will develop symptoms of neurodegenerative disease (i.e., the subject is not resilient) or not (e.g., the subject is resilient). Thus, the assays described herein can be used to assess the resilience of a subject with a neurological disorder (e.g., a neurodegenerative disorder) by measuring the level of one or more synaptic proteins (e.g., NPTX2, NPTX1, NPTXR, or any one of the synaptic proteins listed in Table 1) in a blood sample (e.g., blood, serum, or plasma) obtained from the subject.

[0211] For example, a decrease in the level of NPTX2-NPTXR complex and / or NPTX1-NPTXR complex in the blood sample of a subject during the course of treatment may indicate that the subject is resilient to neuropathy. Furthermore, an increase in the level of NPTX2-GluA4, or the ratio of NPTX2-GluA4 to NPTX2-NPTXR, or the ratio of NPTX2-GluA4 to NPTX1-NPTXR in the blood sample of a subject may also indicate resilience. Conversely, an increase in the level of NPTX2-NPTXR complex and / or NPTX1-NPTXR complex in the blood sample of a subject may indicate that the subject is not resilient to neuropathy. Similarly, a decrease in the level of NPTX2-GluA4, or the ratio of NPTX2-GluA4 to NPTX2-NPTXR, or the ratio of NPTX2-GluA4 to NPTX1-NPTXR in the blood sample of a subject may also indicate lack of resilience to neuropathy. The decrease in the level of a synaptic protein (or synaptic protein complex) or the proportion of a synaptic protein complex can be a decrease of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more compared to the level of a synaptic protein or the proportion of a synaptic protein complex in a reference blood sample. An increase in the level of a synaptic protein (or synaptic protein complex) or proportion of a synaptic protein complex can be a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, 1000% or more decrease compared to the level of a synaptic protein or proportion of a synaptic protein complex in a reference blood sample.

[0212] kit The disclosure also features kits for use in measuring levels of synaptic proteins in a blood sample from a subject (e.g., a human subject, such as a human subject diagnosed with or at risk for developing a neuropathy). The kits may include one or more of the following: a support (e.g., a plate (e.g., a multiwell plate)); a ligand (e.g., an antibody specific for a synaptic protein disclosed herein) immobilized on the support; two or more non-immobilized ligands (e.g., an antibody specific for two or more synaptic proteins disclosed herein), each having a proximity detector bound thereto (e.g., an oligonucleotide plus strand (e.g., SEQ ID NO:1) and an oligonucleotide minus strand (e.g., SEQ ID NO:2), a connector oligonucleotide (e.g., SEQ ID NO:3), and a DNA ligase enzyme (e.g., T4 DNA ligase); reagents (e.g., primers and buffers) for a quantitative real-time polymerase chain reaction assay; and instructions for performing the detection assay. EXAMPLES

[0213] The following examples are presented to provide one of ordinary skill in the art with an illustration of how the compositions and methods described herein can be used, made, and evaluated, and are intended to be purely illustrative of the disclosure and are not intended to limit the scope of what the inventors regard as their disclosure.

[0214] Example 1: Use of a proximity ligation assay to detect synaptic protein complexes containing neuronal pentraxin 2 and neuronal pentraxin receptors in human cerebrospinal fluid A proximity ligation assay (PLA) was performed on human cerebrospinal fluid (CSF) samples to determine whether the assay could be used to detect synaptic protein complexes in CSF. Figure 1 shows a schematic diagram summarizing the PLA assay of the present disclosure. As a first step, an ELISA plate was coated with rabbit anti-NPTX2 antibody (5 μg / mL). The reaction mixture was then blocked with 0.1 mg / mL salmon sperm DNA and incubated at room temperature for 1 h. 50 μL of CSF sample was added to the plate and incubated at 4 °C overnight. The reaction mixture was washed with Tris-buffered saline containing 0.1% Tween detergent (TBST) and 50 μL of PLA probes (1 μg / mL of oligonucleotide plus strand (SEQ ID NO: 1) conjugated with rabbit anti-NPTX2 antibody and 1 μg / mL of oligonucleotide minus strand (SEQ ID NO: 2) conjugated with sheep anti-NPTXR antibody in TBS containing 0.1 mg / mL salmon sperm DNA and 1% bovine serum albumin (BSA)) were added to the reaction mixture and incubated for 1 hour. After washing with TBST, 50 μL of ligation reaction mixture containing 1 μL of T4 DNA ligase, 0.5 μL of connector (sprint) oligonucleotide (SEQ ID NO: 3) at a concentration of 20 μM, 5 μL of 10× T4 ligase buffer and 43.5 μL of water was added to the reaction plate and incubated for 1 hour. After washing with phosphate-buffered saline (PBS), 50 μL of dithiothreitol (DTT, 20 mM) was added to the reaction mixture and incubated for 1 hour. The released ligation products were then collected in Eppendorf tubes and quantitative real-time polymerase chain reaction (PCR) was performed on the ligation products in a 384-well plate using forward primer (SEQ ID NO: 4) and reverse primer (SEQ ID NO: 5).

[0215] NPTX2 levels in human CSF were measured using the NPTX2-NPTXR PLA procedure described above and compared to quantification of NPTX2 performed on human CSF samples using ELISA. Pearson correlation analysis demonstrated a strong correlation between PLA measurements of NPTX2-NPTXR and ELISA measurements of NPTX2 (Figure 2, n=12, Pearson correlation coefficient r=0.968).

[0216] Example 2: Use of a proximity ligation assay to detect synaptic protein complexes containing neuronal pentraxin 2 and neuronal pentraxin receptors in human blood PLA was performed on human blood samples to determine whether the assay can be used to detect synaptic protein complexes in blood. The NPTX2-NPTXR PLA assay described in Example 1 above was performed on 50 μL of human plasma samples. Plasma samples were serially diluted 2-fold with PBS and 1% BSA or NPTX2-depleted plasma. Dilution curves were then generated for plasma samples diluted with PBS (FIG. 3A) and NPTX2-depleted plasma (FIG. 3B).

[0217] We then performed the NPTX2-NPTX4 PLA assay described above on 50 μL plasma samples collected from clinically diagnosed Alzheimer's disease (AD) patients (n = 33) and matched healthy controls (Ctrl, n = 34). NPTX2-NPTXR tended to be elevated in the AD group (Figure 4), but did not achieve statistical significance (p = 0.109, two-tailed t-test).

[0218] Example 3: Use of a proximity ligation assay to detect synaptic protein complexes containing neuronal pentraxin 2 and glutamate ionotropic receptor AMPA subunit 4 in human blood The PLA assay described above was performed on human plasma samples to measure the presence of a synaptic protein complex containing NPTX2 and the glutamate ionotropic receptor AMPA subunit 4 (GluA4) in blood (NPTX2-GluA4). The PLA assay was performed as above, except that instead of using 1 μg / mL of the oligonucleotide minus strand (SEQ ID NO:2) conjugated to a sheep anti-NPTXR antibody, 1 μg / mL of the oligonucleotide minus strand conjugated to a rabbit anti-GluA4 antibody was used. Dilution curves were generated for human plasma samples serially diluted in PBS (Figure 5A) or NPTX2-depleted plasma (Figure 5B).

[0219] We then performed the NPTX2-GluA4 PLA assay described above on 50 μL plasma samples collected from clinically diagnosed AD patients (n=33) and matched healthy controls (Ctrl, n=34). Plasma levels of NPTX2-GluA4 did not show significant differences between control and AD patients (Figure 6A). However, the ratio of plasma NPTX2-GluA4 levels to NPTX2-NPTXR levels showed a significant decrease in AD patients compared to control patients (Figure 6B, p=0.039, two-tailed t-test). These findings indicate that the ratio of NPTX2-GluA4 levels to NPTX2-NPTXR levels in human blood samples can be used to stratify AD patients from healthy control patients.

[0220] Example 4: Use of a proximity ligation assay to detect synaptic protein complexes containing neuronal pentraxin 1 and neuronal pentraxin receptors in human blood The PLA assay described above was performed on human plasma samples to measure the presence of neuronal pentraxin 1 (NPTX1) and the synaptic protein complex containing NPTXR (NPTX1-NPTXR) in blood. The PLA assay was performed similarly to above, except that the immobilized antibody was a rabbit anti-NPTX1 antibody and 1 μg / mL of oligonucleotide minus strand (SEQ ID NO: 2) conjugated to a sheep anti-NPTXR antibody was used. Dilution curves were generated for human plasma samples serially diluted in PBS (Figure 7A) or NPTX2-depleted plasma (Figure 7B).

[0221] Subsequently, the above NPTX1-NPTXR PLA assay was performed on 50 μL plasma samples collected from clinically diagnosed AD patients (n = 33) and matched healthy controls (Ctrl, n = 34). The plasma levels of NPTX1-NPTXR showed no significant difference between control and AD patients (Figure 8A). However, the ratio of plasma NPTX2-GluA4 levels to NPTX2-NPTXR levels showed a tendency to decrease in AD patients compared to control patients (Figure 8B, p = 0.154, two-tailed t-test).

[0222] conclusion In conclusion, the above examples demonstrate that neuronal pentraxins can be detected in human blood using the disclosed PLA method. Of particular value is the discovery that the ratio of blood NPTX2-GluA4 complex to NPTX2-NPTXR complex can be used to distinguish AD patients from healthy control patients (Figure 12), thereby providing an avenue for using the disclosed method as a diagnostic or prognostic tool for neurological disorders such as AD, among others.

[0223] Example 5: Use of a proximity ligation assay to detect synaptic protein complexes containing neuronal pentraxin 2, glutamate ionotropic receptor AMPA subunit 4 and neuronal pentraxin receptors in human blood In a larger sample of clinically diagnosed AD patients, the above PLA assay was performed on human plasma samples to measure the presence of the synaptic protein complex containing NPTX2 and GluA4 (NPTX2-GluA4) in the blood. The NPTX2-GluA4 PLA assay was performed using 1 μg / mL of an oligonucleotide minus strand conjugated to a rabbit anti-GluA4 antibody. Furthermore, the above NPTX2-GluA4 PLA assay was further performed on 50 μL of plasma samples obtained from the same population of clinically diagnosed AD patients and matched healthy controls.

[0224] In this larger subject population, the plasma levels of NPTX2-GluA4 did not show significant differences between control and AD patients (Figure 9). However, the plasma levels of NPTX2-NPTXR showed significant differences between control and AD patients (Figure 10). Moreover, the ratio of plasma NPTX2-GluA4 levels to NPTX2-NPTXR levels showed a significant decrease in AD patients compared to control patients (Figure 11, p = 0.010, two-tailed t-test). These findings further illustrate that the ratio of NPTX2-GluA4 levels to NPTX2-NPTXR levels in human blood samples can be used to stratify AD patients from healthy control patients.

[0225] Other embodiments Various modifications and alterations of the described disclosure will become apparent to those skilled in the art without departing from the scope and spirit of the present disclosure. Although the present disclosure has been described in connection with specific embodiments, it should be understood that the present disclosure as claimed should not be unnecessarily limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the present disclosure that are apparent to those skilled in the art are intended to be within the scope of the present disclosure.

[0226] Other embodiments are found in the claims.

Claims

1. 1. A method for assessing the resilience of a subject identified as having or at risk of developing a neuropathy, the method comprising: (i) coupling a blood sample from said subject to a first affinity ligand specific for a first synaptic protein selected from the group consisting of neuronal pentraxin 2 (NPTX2), neuronal pentraxin (NPTX1) and neuronal pentraxin receptor (NPTXR) and a second affinity ligand specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1, NPTXR, glutamate ionotropic receptor AMPA-type subunit 1 (GluA1) and glutamate ionotropic receptor AMPA-type subunit 4 (GluA4); contacting the blood sample with an affinity ligand, wherein the first and second synaptic proteins are in a first complex, and wherein the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand, and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand binds to an oligonucleotide plus strand, and the second affinity ligand binds to an oligonucleotide minus strand; (ii) contacting the second complex with a single stranded connector oligonucleotide and a ligase enzyme, thereby generating a ligated plus-minus oligonucleotide strand (LPMOS), wherein the LPMOS is capable of hybridizing to a forward primer oligonucleotide and a reverse primer oligonucleotide; (iii) performing an amplification on the LPMOS, the amplification generating a proximity signal when the first synaptic protein is within a proximity distance threshold to the second synaptic protein; and (iv) detecting the proximity signal in the blood sample, the proximity signal being indicative of the amount of the first complex in the blood sample; The subject is determined to be not resilient to the neurological disorder if the amount of the first complex in the subject's blood sample is increased or decreased compared to the amount of the first complex in a reference blood sample, and the subject is determined to be resilient to the neurological disorder if the amount of the first complex in the subject's blood sample is unchanged, decreased, or increased compared to the amount of the first complex in the reference blood sample.

2. 1. A method for assessing the resilience of a subject identified as having or at risk of developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, NPTXR, GluA1, and GluA4, and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and the first and second synaptic proteins are different proteins; (ii) determining the amount of the first complex in the blood sample of the subject; and (iii) contacting a blood sample obtained from the subject with a third affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, and a fourth affinity ligand specific for a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the third and fourth synaptic proteins are in a second complex, and the third and fourth synaptic proteins are different proteins; (iv) determining the amount of the second complex in the blood sample of the subject; and (v) quantifying the ratio of the first complex to the second complex by dividing the amount of the first complex by the amount of the second complex; The subject is determined to be not resilient to the neurological disorder if the ratio of the first complex to the second complex in the subject's blood sample is decreased compared to the ratio of the first complex to the second complex in a reference blood sample, and the subject is determined to be resilient to the neurological disorder if the ratio of the first complex to the second complex in the subject's blood sample is unchanged or decreased compared to the ratio of the first complex to the second complex in a reference blood sample.

3. 1. A method for determining the therapeutic efficacy of an agent in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, NPTXR, GluA1, and GluA4, and a second affinity ligand specific for a second synaptic protein selected from the group consisting of NPTX2, NPTX1, and NPTXR, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand, and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand binds to an oligonucleotide plus strand, and the second affinity ligand binds to an oligonucleotide minus strand; (ii) contacting the second complex with a single stranded connector oligonucleotide and a ligase enzyme, thereby generating a ligated plus-minus oligonucleotide strand (LPMOS), wherein the LPMOS is capable of hybridizing to a forward primer oligonucleotide and a reverse primer oligonucleotide; (iii) performing an amplification on the LPMOS, the amplification generating a proximity signal when the first synaptic protein is within a proximity distance threshold to the second synaptic protein; and (iv) detecting the proximity signal in the blood sample, the proximity signal being indicative of the amount of the first complex in the blood sample; The method, wherein the agent is determined to have a therapeutic effect in the subject if the amount of the first complex in the blood sample of the subject is unchanged, decreased, or increased compared to the amount of the first complex in a reference blood sample.

4. 1. A method for determining the therapeutic efficacy of an agent in a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, NPTXR, GluA1, and GluA4, and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and the first and second synaptic proteins are different proteins; (ii) determining the amount of the first complex in the blood sample of the subject; and (iii) contacting a blood sample obtained from the subject with a third affinity ligand specific for a third synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, and a fourth affinity ligand specific for a fourth synaptic protein selected from the group consisting of NPTX2, NPTX1 and NPTXR, wherein the third and fourth synaptic proteins are in a second complex, and the third and fourth synaptic proteins are different proteins; (iv) determining the amount of the second complex in the blood sample of the subject; and (v) quantifying the ratio of the first complex to the second complex by dividing the amount of the first complex by the amount of the second complex; The method of claim 1, wherein the agent is determined to be therapeutically effective in the subject if the ratio of the first complex to the second complex in the blood sample of the subject is unchanged or increased compared to the ratio of the first complex to the second complex in a reference blood sample.

5. 1. A method for quantifying the amount of a synaptic protein complex comprising two or more synaptic proteins in a blood sample of a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, NPTXR, GluA1, and GluA4, and a second affinity ligand specific for a second synaptic protein, wherein the first and second synaptic proteins are in a first complex, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, the second affinity ligand, and the second synaptic protein, wherein the first and second synaptic proteins are different proteins, the first affinity ligand binds to an oligonucleotide plus strand, and the second affinity ligand binds to an oligonucleotide minus strand; (ii) contacting the second complex with a single stranded connector oligonucleotide and a ligase enzyme, thereby generating a LPMOS, wherein the LPMOS is capable of hybridizing to a forward primer oligonucleotide and a reverse primer oligonucleotide; (iii) performing an amplification on the LPMOS, the amplification generating a proximity signal when the first synaptic protein is within a proximity distance threshold to the second synaptic protein; and (iv) detecting the proximity signal in the blood sample, the proximity signal being indicative of an amount of synaptic protein in the blood sample.

6. 1. A method for quantifying the amount of a synaptic protein complex comprising two or more synaptic proteins in a blood sample of a subject identified as having or at risk for developing a neuropathy, the method comprising: (i) contacting a blood sample obtained from the subject with a first affinity ligand specific for a first synaptic protein selected from the group consisting of NPTX2, NPTX1, NPTXR, GluA1, and GluA4, wherein the first affinity ligand is immobilized on a surface, the first synaptic protein is part of a first complex with a second synaptic protein, and the contacting produces a second complex comprising the first affinity ligand, the first synaptic protein, and the second synaptic protein, wherein the first and second synaptic proteins are different proteins; (ii) contacting the second complex with a second affinity ligand specific for the first synaptic protein and a third affinity ligand specific for the second synaptic protein, wherein the contacting produces a third complex comprising the second complex, the second affinity ligand, and the third affinity ligand, wherein the second affinity ligand binds to an oligonucleotide plus strand and the third affinity ligand binds to an oligonucleotide minus strand; (iii) contacting the third complex with a single stranded connector oligonucleotide and a ligase enzyme, thereby generating a LPMOS, wherein the LPMOS is capable of hybridizing to a forward primer oligonucleotide and a reverse primer oligonucleotide; (iv) performing amplification on the LPMOS, the amplification generating a proximity signal when the first synaptic protein is within a proximity distance threshold to the second synaptic protein; and (v) detecting the proximity signal in the blood sample, the proximity signal being indicative of the amount of the synaptic protein complex in the blood sample. (a) the first synaptic protein is NPTX2 and the second synaptic protein is NPTXR, or the first synaptic protein is NPTXR and the second synaptic protein is NPTX2; (b) the first synaptic protein is NPTX1 and the second synaptic protein is NPTXR, or the first synaptic protein is NPTXR and the second synaptic protein is NPTX1; (c) the first synaptic protein is NPTX2 and the second synaptic protein is NPTX1, or the first synaptic protein is NPTX1 and the second synaptic protein is NPTX2; (d) the first synaptic protein is NPTX2 and the second synaptic protein is GluA4, or the first synaptic protein is GluA4 and the second synaptic protein is NPTX2; (e) the first synaptic protein is NPTX1 and the second synaptic protein is GluA4, or the first synaptic protein is GluA4 and the second synaptic protein is NPTX1; (f) the first synaptic protein is NPTXR and the second synaptic protein is GluA4, or the first synaptic protein is GluA4 and the second synaptic protein is NPTXR; (g) the first synaptic protein is NPTX2 and the second synaptic protein is GluA1, or the first synaptic protein is GluA1 and the second synaptic protein is NPTX2; (h) the first synaptic protein is NPTX1 and the second synaptic protein is GluA1, or the first synaptic protein is GluA1 and the second synaptic protein is NPTX1; 7. The method of any one of claims 1 to 6, wherein (i) the first synaptic protein is NPTXR and the second synaptic protein is GluA1, or the first synaptic protein is GluA1 and the second synaptic protein is NPTXR. (a) the third synaptic protein is NPTX2 and the fourth synaptic protein is NPTXR, or the third synaptic protein is NPTXR and the fourth synaptic protein is NPTX2, or (b) the third synaptic protein is NPTX1 and the fourth synaptic protein is NPTXR, or the third synaptic protein is NPTXR and the fourth synaptic protein is NPTX1.

9. The method of any one of claims 1 to 5 and 7, wherein the method further comprises contacting the blood sample with an immobilized affinity ligand specific for the first synaptic protein.

10. 10. The method of any one of claims 2, 4, and 7-9, wherein the method further comprises contacting the blood sample with an immobilized affinity ligand specific for the third synaptic protein.

11. 10. The method of any one of claims 2, 4 and 7 to 9, wherein the first affinity ligand comprises a first proximity detector and the second affinity ligand comprises a second proximity detector.

12. 12. The method of claim 11 , wherein the first and second proximity detectors generate a first proximity signal when the first synaptic protein is within a proximity distance threshold relative to the second synaptic protein, the first proximity signal indicating an amount of the first complex in the blood sample of the subject.

13. 13. The method of any one of claims 2, 4, 7-9 and 12, wherein the third affinity ligand comprises a third proximity detector and the fourth affinity ligand comprises a fourth proximity detector.

14. 14. The method of claim 13, wherein the third and fourth proximity detectors generate a second proximity signal when the third synaptic protein is within a proximity distance threshold relative to the fourth synaptic protein, the second proximity signal indicating an amount of the third complex in the blood sample of the subject.

15. 15. The method of any one of claims 11 to 14, wherein the first, second, third and / or fourth proximity detectors are selected from the group consisting of oligonucleotides, fluorescence resonance energy transfer (FRET) or bioluminescence resonance energy transfer (BRET) chromophores, biomolecular fluorescence complementation (BiFC) proteins or fragments thereof, and enzymes capable of generating reactive biotin species.

16. 16. The method of claim 15, wherein the first, second, third and / or fourth proximity detectors are oligonucleotides, the first and third proximity detectors comprising a positive oligonucleotide strand and the second and fourth proximity detectors comprising a negative oligonucleotide strand.

17. 17. The method of claim 16, wherein the oligonucleotide plus strand and the oligonucleotide minus strand are configured to hybridize to a connector oligonucleotide, and / or the oligonucleotide plus strand is configured to hybridize to a forward primer and the oligonucleotide minus strand is configured to hybridize to a reverse primer.

18. The method of any one of claims 1 to 17, wherein the neurological disorder is selected from the group consisting of a neurodegenerative disorder, a neurodevelopmental disorder, and a neuropsychiatric disorder.

19. (a) the neurodegenerative disorder is age-related cognitive decline, Alzheimer's disease (AD), Down's syndrome, normal pressure hydrocephalus, Alzheimer's disease related dementia (ADRD), Parkinson's disease, Huntington's disease, motor neuron disease, spinocerebellar ataxia, spinal muscular atrophy, Friedreich's ataxia, prion disease, or a lysosomal storage disorder; (b) the neurodevelopmental disorder is intellectual disability, X-linked intellectual disability, learning disability, autism spectrum disorder, developmental movement disorder, tic disorder, cerebral palsy, communication and language disorder, fragile X syndrome, Down syndrome, attention deficit hyperactivity disorder, or neurotoxic neurodevelopmental disorder; 20. The method of claim 18, wherein (c) the neuropsychiatric disorder is major depression, bipolar disorder, obsessive-compulsive disorder, an eating disorder, or schizophrenia. (a) the neurodegenerative disorder is AD, and the AD is sporadic AD or familial AD, or 20. The method of claim 19, wherein (b) said neurodegenerative disorder is ADRD, said ADRD being frontotemporal dementia, dementia with Lewy bodies, vascular cognitive impairment and dementia, or mixed etiology dementia.

21. The method of any one of claims 1 to 20, wherein the proximity distance threshold is less than or equal to 40nm, 35nm, 25nm, 20nm, 15nm, 10nm, 5nm or 1nm.

22. 22. The method of any one of claims 1 to 21, wherein one or more of the synaptic proteins are isolated from exosomes of the sample of the subject.

Images