Compositions and methods for genetically modifying CIITA in cells

Abstract

For example, compositions and methods for reducing MHC class II protein expression in cells, including genetically modifying CIITA for use in adoptive cell transfer therapy.

Description

[Technical Field]

[0001] This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 63 / 130,098, filed December 23, 2020, U.S. Provisional Application No. 63 / 251,002, filed September 30, 2021, U.S. Provisional Application No. 63 / 254,971, filed October 12, 2021, and U.S. Provisional Application No. 63 / 288,502, filed December 10, 2021, the disclosures of each of which are incorporated herein by reference in their entirety.

[0002] This application is filed with an electronic Sequence Listing. The Sequence Listing is provided as a file entitled "2021-12-20_01155-0038-00PCT_Seq_List_ST25.txt," created on December 20, 2021, and is 410,044 bytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

[0003] Introduction and Overview The ability to downregulate MHC class II is important for many in vivo and ex vivo applications, for example, when using allogeneic cells (derived from donors) for transplantation and / or for example, to generate cell populations that do not activate T cells in vitro.In particular, the transplantation of allogeneic cells into a subject is of great interest in the field of cell therapy.The use of allogeneic cells is limited by the problem of rejection by the recipient's immune cells, which recognize the transplanted cells as foreign and launch attacks.To avoid the problem of immune rejection, cell-based therapy focuses on an autologous approach, which uses the subject's own cells as the cell source for therapy, but this approach is time-consuming and expensive.

[0004] Typically, immune rejection of allogeneic cells results from mismatching of major histocompatibility complex (MHC) molecules between the donor and recipient. Within the human population, MHC molecules exist in various forms, including, for example, numerous genetic variants, or alleles, of any given MHC gene that encode different forms of MHC proteins. The primary classes of MHC molecules are referred to as MHC class I and MHC class II. MHC class I molecules (e.g., HLA-A, HLA-B, and HLA-C in humans) are expressed on all nucleated cells, present antigens, and activate cytotoxic T cells (CD8+ T cells or CTLs). MHC class II molecules (e.g., HLA-DP, HLA-DQ, and HLA-DR in humans) are expressed only on certain cell types (e.g., B cells, dendritic cells, and macrophages), present antigens, and activate helper T cells (CD4+ T cells or Th cells), which then provide signals to B cells to produce antibodies.

[0005] For example, slight differences in MHC alleles between individuals can activate T cells in the recipient. During T cell development, an individual's T cell repertoire is tolerant to its own MHC molecules, but T cells that recognize another individual's MHC molecules can persist in the circulation and are called alloreactive T cells. Alloreactive T cells can be activated, for example, by the presence of another individual's cells that express MHC molecules in the body, causing, for example, graft-versus-host disease and transplant rejection.

[0006] For example, methods and compositions for reducing the susceptibility of allogeneic cells to rejection, including reducing the expression of MHC proteins in cells to avoid recipient T cell responses, are of interest. In fact, the ability to genetically modify allogeneic cells for transplantation into a subject has been hindered by the requirement for multiple gene editing to reduce all MHC protein expression while simultaneously avoiding other adverse recipient immune responses. For example, strategies to deplete MHC class I proteins can reduce CTL activation, but cells lacking MHC class I on their surface are susceptible to lysis by natural killer (NK) cells of the immune system because NK cell activation is regulated by MHC class I-specific inhibitory receptors. Gene editing strategies for depleting MHC class II molecules have also proven difficult, especially in certain cell types, due to reasons including low editing efficiency and low cell viability, preventing their practical application as cell therapy.

[0007] Thus, there is a need for improved methods and compositions for modifying allogeneic cells to overcome the problems of recipient immune rejection and the technical difficulties associated with the multiple genetic modifications required to produce safer cells for transplantation.

[0008] The present disclosure provides engineered cells in which MHC class II surface expression is reduced or eliminated. The engineered cells contain a genetic modification in the CIITA gene (class II major histocompatibility complex transactivator), which may be useful in cell therapy. The present disclosure further provides compositions and methods for reducing or eliminating surface expression of MHC class II proteins in cells by genetically modifying the CIITA gene. The CIITA protein functions as a transcriptional activator (activating the MHC class II promoter) and is essential for MHC class II protein expression.

[0009] In some embodiments, the present disclosure further provides compositions and methods for reducing or eliminating surface expression of MHC class I proteins in cells, for example, by genetically modifying B2M (beta-2-microglobulin) or by genetically modifying the HLA-A gene. B2M proteins form heterodimers with MHC class I molecules and are required for MHC class I protein expression on the cell surface. In some embodiments involving B2M genetic modification, the present disclosure further provides for expression of an NK cell inhibitor molecule by the cells to reduce or eliminate lytic activity of NK cells. In some embodiments, the present disclosure further provides compositions and methods for reducing or eliminating surface expression of HLA-A in cells that are homozygous for HLA-B and homozygous for HLA-C.

[0010] In some embodiments, the methods and compositions further provide for the insertion of exogenous nucleic acids encoding, for example, targeting receptors, other polypeptides to be expressed on the cell surface, or polypeptides to be secreted from the cell. In some embodiments, the engineered cells are useful as "cell factories" for secreting exogenous proteins in a recipient. In some embodiments, the engineered cells are useful as adoptive cell therapy.

[0011] Provided herein are engineered cells comprising a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and wherein the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10902662-chr16:10923285.

[0012] 1. An engineered cell comprising a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, and wherein the genetic modification is selected from the group consisting of chr16:10902662-10902682, chr16:10902723-10902743, chr16:10902729-10902749, chr16:10903747-10903767, chr16:10903824-10903844, chr16:10903848-10903849 03868, chr16:10904761-10904781, chr16:10904764-10904784, chr16:10 904765-10904785, chr16:10904785-10904805, chr16:10906542-10906562 , chr16:10906556-10906576, chr16:10906609-10906629, chr16:1090661 0-10906630, chr16:10906616-10906636, chr16:10906682-10906702, chr1 6:10906756-10906776, chr16:10906757-10906777, chr16:10906757-109 06777, chr16:10906821-10906841, chr16:10906823-10906843, chr16:109 06847-10906867, chr16:10906848-10906868, chr16:10906853-10906873 , chr16:10906904-10906924, chr16:10906907-10906927, chr16:10906913 -10906933, chr16:10906968-10906988, chr16:10906970-10906990, chr1 6:10906985-10907005, chr16:10907030-10907050, chr16:10907058-1090 7078, chr16:10907119-10907139, chr16:10907139-10907159, chr16:109 07172-10907192, chr16:10907272-10907292, chr16:10907288-10907308,chr16:10907314-10907334、chr16:10907315-10907335、chr16:1090732 5-10907345、chr16:10907363-10907383、chr16:10907384-10907404、chr 16:10907385-10907405、chr16:10907433-10907453、chr16:10907434-10907454、chr16:10907435-10907455、chr16:10907441-10907461、chr16: 10907454-10907474、chr16:10907461-10907481、chr16:10907476-10907496、chr16:10907539-10907559、chr16:10907586-10907606、chr16:109 07589-10907609、chr16:10907621-10907641、chr16:10907622-10907642、chr16:10907623-10907643、chr16:10907730-10907750、chr16:109077 31-10907751、chr16:10907757-10907777、chr16:10907781-10907801、chr16:10907787-10907807、chr16:10907790-10907810、chr16:10907810- 10907830、chr16:10907820-10907840、chr16:10907870-10907890、chr16:10907886-10907906、chr16:10907924-10907944、chr16:10907928-109 07948、chr16:10907932-10907952、chr16:10907935-10907955、chr16:10907978-10907998、chr16:10907979-10907999、chr16:10908069-109080 89、chr16:10908073-10908093、chr16:10908101-10908121、chr16:10909056-10909076、chr16:10909138-10909158、chr16:10910195-10910215、chr16:10910196-10910216, chr16:10915592-10915612, chr16:10915626-10915646, chr16:10916375-10916395, chr16:10916382-109164 02, chr16:10916426-10916446, chr16:10916432-10916452, chr16:10918486-10918506, chr16:10918492-10918512, chr16:10918493-1091 Provided herein are engineered cells that contain an indel, a C to T substitution, or an A to G substitution within genomic coordinates selected from: 8513, chr16:10922435-10922455, chr16:10922441-10922461, chr16:10922441-10922461, chr16:10922444-10922464, chr16:10922460-10922480, chr16:10923257-10923277, and chr16:10923265-10923285.

[0013] Provided herein are methods of making engineered cells, the engineered cells having reduced or eliminated surface expression of MHC class II proteins compared to unmodified cells, the method comprising contacting a cell with a composition comprising: (a) a CIITA guide RNA comprising: (i) a guide sequence selected from SEQ ID NOs: 1-117; (ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-117; (iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-117; (iv) a sequence comprising 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 2; (v) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence from (iv); or (vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v); and (b) optionally an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder.

[0014] Provided herein are methods of reducing or eliminating surface expression of an MHC class II protein in engineered cells compared to unmodified cells, the method comprising contacting the cells with a composition comprising: (a) a CIITA guide RNA comprising: (i) a guide sequence selected from SEQ ID NOs: 1-117; (ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-117; (iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-117; (iv) a sequence comprising 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 2; (v) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence from (iv); or (vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v); and (b) optionally an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder.

[0015] Further embodiments are provided and described throughout the claims and drawings. [Brief explanation of the drawings]

[0016] [Figure 1] Figure 1 shows the results of screening the CIITA guide for efficacy in Cas9-mediated T cell editing in two donors after electroporation with RNP. Figure 1A shows the percentage of edited T cells after CIITA editing. Figure 1B shows the percentage of MHC class II-negative cells after CIITA editing in T cells. [Figure 2] Figure 2 shows dose-response results for editing T cells using Cas9 formulated in an LNP composition and three individual CIITA guides (G013674, G013675, G013676). Figure 2A shows the percent of indel editing in total T cells (n=1). Figure 2B shows the percentage of MHC class II-negative T cells after CIITA editing compared to untreated T cells. [Figure 3]Figure 3 shows the results of a dose-response screen of four CIITA guides (CR002961, CR009217, CR007982, and CR007994) for editing T cells with Cas9. Figure 3A shows the percent editing in T cells. Figure 3B shows the percentage of MHC class II-negative T cells after CIITA editing. [Figure 4] Figure 4 shows the efficiency results of three CIITA guides (G016086, G016092, and G016067) for editing T cells with BC22. Figure 4A shows the percent of C to T conversion. Figure 4B shows the percentage of MHC class II-negative T cells. [Figure 5] Figure 5 shows the results of three CIITA guides (G013676, G013675, and G015535) with mCherry insertion into the CIITA locus. Figure 5A shows the percentage of mCherry-positive CD4+ and CD8+ T cells. Figure 5B shows the percentage of MHC class II-negative T cells with and without mCherry insertion compared to untreated T cells. [Figure 6] Figure 6 shows results for CIITA guide G016086 with Cas9 or BC22. Figure 6A shows the percentage of total reads with indels, C to A / G transversions, and C to G transversions with increasing concentrations of Cas9 mRNA or BC22 mRNA. Figure 6B shows the percentage of MHC class II-negative T cells with increasing concentrations of Cas9 mRNA or BC22 mRNA. [Figure 7A] Figure 7 shows the results of serial editing in CD8+ T cells. Figure 7A shows the percentage of HLA-A positive cells. [Figure 7B] Figure 7B shows the results of sequential editing in CD8+ T cells. Figure 7B shows the percentage of MHC class II positive cells. [Figure 7C] Figure 7C shows the results of sequential editing in CD8+ T cells. Figure 7C shows the percentage of WT1 TCR-positive CD3+, Vb8+ cells. [Figure 7D]Figure 7D shows the results of sequential editing in CD8+ T cells. Figure 7D shows the percentage of CD3+ cells displaying mismatched TCRs. [Figure 7E] Figure 7D shows the results of sequential editing in CD8+ T cells. Figure 7E shows the percentage of CD3+, Vb8- cells that express only endogenous TCR. [Figure 7F] Figure 7F shows the results of sequential editing in CD8+ T cells. Figure 7F shows the percentage of CD3+, Vb8+ cells positive for WT1 TCR and negative for HLA-A and MHC class II. [Figure 8A] Figure 8 shows the results of serial editing in CD4+ T cells. Figure 8A shows the percentage of HLA-A positive cells. [Figure 8B] Figure 8B shows the results of sequential editing in CD4+ T cells. Figure 8B shows the percentage of MHC class II positive cells. [Figure 8C] Figure 8C shows the results of sequential editing in CD4+ T cells. Figure 8C shows the percentage of WT1 TCR-positive CD3+, Vb8+ cells. [Figure 8D] Figure 8D shows the results of sequential editing in CD4+ T cells. Figure 8D shows the percentage of cells displaying mismatched TCRs. [Figure 8E] Figure 8D shows the results of sequential editing in CD4+ T cells. Figure 8E shows the percentage of CD3+, Vb8- cells that express only the endogenous TCR. [Figure 8F] Figure 8F shows the results of sequential editing in CD4+ T cells. Figure 8F shows the percentage of CD3+, Vb8+ cells positive for WT1 TCR and negative for HLA-A and MHC class II. [Figure 9A] Shown is the percentage of indels after sequential editing of T cells for CIITA in T cells (Figure 9A). [Figure 9B] Shown is the percentage of indels after sequential editing of T cells for HLA-A (Figure 9B) in T cells. [Figure 9C] The percentage of indels after sequential editing of T cells of TRBC1 (Figure 9C) in T cells is shown. [Figure 9D]The percentage of indels after sequential editing of TRBC2 (Figure 9D) in T cells is shown. [Figure 10] Optionally, the resistance to NK cell-mediated killing of HLA-A knockout (HLA-B / C matched) versus B2M knockout T cells containing an exogenous HLA-E construct is shown as percent T cell lysis, comparing HLA-A knockout, HLA-A, CIITA double knockout, B2M knockout, B2M+HLA-E, and wild-type cells. [Figure 11A] Figure 11A shows luciferase expression from B2M, CIITA, HLA-A, or double (HLA-A, CIITA) knockout human T cells administered to mice inoculated with human natural killer cells. Figure 11B shows the luminance (photons / s / cm2 / sr) from luciferase-expressing T cells present at various time points after injection. [Figure 11B] Figure 11B shows luciferase expression from B2M, CIITA, HLA-A, or double (HLA-A, CIITA) knockout human T cells administered to mice inoculated with human natural killer cells. Figure 11B shows the luminance (photons / s / cm2 / sr) from luciferase-expressing T cells present in the various mouse groups on day 27. [Figure 12] Figure 12 shows luciferase expression from B2M and AlloWT1 knockout human T cells administered to mice inoculated with human natural killer cells. Figure 12A shows the total flux (p / s) from luciferase-expressing T cells present at various time points after injection. Figure 12B shows the total flux (p / s) from luciferase-expressing T cells present in various mouse groups 31 days later. [Figure 13A] Shown are the percentages of normalized proliferation of host CD4 (FIG. 13A) or host CD8 (FIG. 13B) T cells induced by HLA class I+HLA class II double knockout or HLA-A and HLA class II double knockout engineered autologous or allogeneic T cells. [Figure 13B]Shown are the percentages of normalized proliferation of host CD4 (FIG. 13A) or host CD8 (FIG. 13B) T cells induced by HLA class I+HLA class II double knockout or HLA-A and HLA class II double knockout engineered autologous or allogeneic T cells. [Figure 14A] Panels showing percentages of CD8+ (Figure 14A), endogenous TCR+ (Figure 14B), WT1 TCR+ (Figure 14C), HLA-A2 knockout (Figure 14D), HLA-DRDPDQ knockout (Figure 14E), and Allo WT1% (Figure 14F) are shown. [Figure 14B] Panels showing percentages of CD8+ (Figure 14A), endogenous TCR+ (Figure 14B), WT1 TCR+ (Figure 14C), HLA-A2 knockout (Figure 14D), HLA-DRDPDQ knockout (Figure 14E), and Allo WT1% (Figure 14F) are shown. [Figure 14C] Panels showing percentages of CD8+ (Figure 14A), endogenous TCR+ (Figure 14B), WT1 TCR+ (Figure 14C), HLA-A2 knockout (Figure 14D), HLA-DRDPDQ knockout (Figure 14E), and Allo WT1% (Figure 14F) are shown. [Figure 14D] Panels showing percentages of CD8+ (Figure 14A), endogenous TCR+ (Figure 14B), WT1 TCR+ (Figure 14C), HLA-A2 knockout (Figure 14D), HLA-DRDPDQ knockout (Figure 14E), and Allo WT1% (Figure 14F) are shown. [Figure 14E] Panels showing percentages of CD8+ (Figure 14A), endogenous TCR+ (Figure 14B), WT1 TCR+ (Figure 14C), HLA-A2 knockout (Figure 14D), HLA-DRDPDQ knockout (Figure 14E), and Allo WT1% (Figure 14F) are shown. [Figure 14F] Panels showing percentages of CD8+ (Figure 14A), endogenous TCR+ (Figure 14B), WT1 TCR+ (Figure 14C), HLA-A2 knockout (Figure 14D), HLA-DRDPDQ knockout (Figure 14E), and Allo WT1% (Figure 14F) are shown. [Figure 15]The total flux (p / s) from luciferase-expressing T cells present at various time points post-injection up to 18 days is shown. [Figure 16] Shown are the releases of IFN-γ and IL-2, respectively, in the supernatants from killing assays involving co-culture of engineered T cells from Allo-WT1, Auto-WT1, TCR KO, and wild-type (WT) groups with target tumor cells. [Figure 17A] Figure 17 shows the CIITA, HLA-A, TRAC, and TRBC editing and WT1 TCR insertion rates in CD8+ T cells under three conditions. The percentage of cells expressing the relevant cell surface proteins after serial T cell manipulations is shown for CD8+ T cells in Figure 17A. [Figure 17B] Figure 17B shows the rates of CIITA, HLA-A, TRAC, and TRBC editing and WT1 TCR insertion in CD8+ T cells under three conditions. The percentage of T cells with all intended editing (WT1-TCR insertion combined with HLA-A and CIITA knockout) is shown. [Figure 18] Shown is the average percent editing at the CIITA locus in T cells treated with the 100mer or 91mer form of sgRNA. [Figure 19] The mean percentage of CD8+ T cells negative for HLA-DR, DP, and DQ surface receptors after treatment with sgRNA in the form of a 100mer or 91mer targeting CIITA is shown. DETAILED DESCRIPTION OF THE INVENTION

[0017] The present disclosure provides engineered cells, as well as methods and compositions for genetically modifying cells to generate engineered cells and populations of engineered cells that are useful, for example, for adoptive cell transfer (ACT) therapy. The disclosure provided herein overcomes certain hurdles of conventional methods by providing methods and compositions for genetically modifying CIITA to reduce expression of MHC class II proteins on the surface of cells. In some embodiments, the present disclosure provides engineered cells in which surface expression of MHC class II proteins is reduced or eliminated as a result of genetic modification in the CIITA gene. In some embodiments, the present disclosure provides compositions and methods for reducing or eliminating expression of MHC class II proteins, as well as compositions and methods for further reducing the susceptibility of cells to immune rejection. For example, in some embodiments, the methods and compositions include genetically modifying CIITA to reduce or eliminate surface expression of MHC class II proteins, and reducing or eliminating surface expression of MHC class I proteins, and / or inserting an exogenous nucleic acid encoding an NK cell inhibitor molecule, or a targeting receptor, or other polypeptide (expressed on the cell surface or secreted) into cells by genetic modification. The engineered cell compositions produced by the methods disclosed herein have desirable properties including, for example, reduced expression of MHC molecules, reduced immunogenicity in vitro and in vivo, increased survival time, and increased genetic compatibility with larger recipients for transplantation.

[0018] The term "about" or "approximately" refers to an acceptable error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, or on the degree of variation that does not materially affect the properties of the described subject matter or tolerance accepted in the art (e.g., within 10%, 5%, 2%, or 1%). Accordingly, unless otherwise indicated, the numerical parameters set forth in the following specification and appended claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0019] I. Definition Unless otherwise stated, the following terms and phrases used herein are intended to have the following meanings:

[0020] As used herein, the term "or combinations thereof" refers to all permutations and combinations of the terms listed before it. For example, "A, B, C, or combinations thereof" is intended to include at least one of A, B, C, AB, AC, BC, or ABC, and, where order is important in a particular context, also BA, CA, CB, ACB, CBA, BCA, BAC, or CAB. Following this example, combinations containing one or more repeats of an item or term, such as BB, AAA, AAB, BBC, CBBA, CABA, etc., are expressly included. Those skilled in the art will understand that there is typically no limit to the number of items or terms in any combination unless otherwise clear from the context.

[0021] As used herein, the term "kit" refers to a packaged set of one or more polynucleotides or compositions and one or more related materials, e.g., related components such as a delivery device (e.g., a syringe), solvent, solution, buffer, instructions, or desiccant.

[0022] "Allogeneic" cells, as used herein, refer to cells derived from a donor subject of the same species as the recipient subject, where the donor and recipient subjects have genetic differences, e.g., genes at one or more loci that are not identical. Thus, for example, the cells are allogeneic to the subject to whom the cells are administered. As used herein, cells removed or isolated from a donor that are not reintroduced into the original donor are considered allogeneic cells.

[0023] "Autologous" cells, as used herein, refer to cells derived from the same subject into which the material is later reintroduced. Thus, for example, if cells are removed from a subject and then reintroduced into the same subject, the cells are considered autologous.

[0024] "β2M" or "B2M," as used herein, refers to the nucleic acid or protein sequence of "β-2 microglobulin," the human gene having accession number NC_000015 (range 44711492..44718877), reference GRCh38.p13. The B2M protein associates with MHC class I molecules as a heterodimer on the surface of nucleated cells and is required for MHC class I protein expression.

[0025] "CIITA" or "CIITA" or "C2TA" as used herein refers to the nucleic acid or protein sequence of the "class II major histocompatibility complex transactivator," the human gene having accession number NC_000016.10 (range 10866208..10941562), reference GRCh38.p13. The nuclear CIITA protein acts as a positive regulator of MHC class II gene transcription and is required for MHC class II protein expression.

[0026] As used herein, "MHC" or "MHC molecule(s)" or "MHC protein" or "MHC complex(es)" refers to a major histocompatibility complex molecule(s), including, for example, MHC class I and MHC class II molecules. In humans, MHC molecules are referred to as "human leukocyte antigen" complexes or "HLA molecules" or "HLA proteins." The use of the terms "MHC" and "HLA" is not meant to be limiting, and as used herein, the term "MHC" can be used to refer to human MHC molecules, i.e., HLA molecules. Thus, the terms "MHC" and "HLA" are used interchangeably herein.

[0027] The term "HLA-A," as used herein in the context of an HLA-A protein, refers to an MHC class I protein molecule, which is a heterodimer consisting of a heavy chain (encoded by the HLA-A gene) and a light chain (i.e., beta-2 microglobulin). The term "HLA-A" or "HLA-A gene," as used herein in the context of a nucleic acid, refers to the gene encoding the heavy chain of the HLA-A protein molecule. The HLA-A gene is also referred to as "HLA class I histocompatibility, A alpha chain," and the human gene has the accession number NC_000006.12 (29942532..29945870). It is known that there are thousands of different genotypic versions of the HLA-A gene throughout the population (and individuals can receive two different alleles of the HLA-A gene). A public database of HLA-A alleles, including sequence information, can be accessed at IPD-IMGT / HLA: https: / / www.ebi.ac.uk / ipd / imgt / hla / . All alleles of HLA-A are encompassed by the terms "HLA-A" and "HLA-A gene."

[0028] "HLA-B," as used herein in the context of nucleic acids, refers to the gene encoding the heavy chain of the HLA-B protein molecule. HLA-B is also referred to as "HLA class I histocompatibility, B alpha chain," and the human gene has the accession number NC_000006.12 (31353875..31357179).

[0029] "HLA-C," as used herein in the context of nucleic acids, refers to the gene encoding the heavy chain of the HLA-C protein molecule. HLA-C is also referred to as "HLA class I histocompatibility, C alpha chain," and the human gene has the accession number NC_000006.12 (31268749..31272092).

[0030] As used herein, the term "within genomic coordinates" includes the boundaries of a given genomic coordinate range. For example, if chr6:29942854-chr6:29942913 is given, then coordinates chr6:29942854-chr6:29942913 are encompassed. Throughout this application, referenced genomic coordinates are based on the genome annotations in the GRCh38 (also referred to as hg38) assembly of the human genome from the Genome Reference Consortium, available on the National Center for Biotechnology Information website. Tools and methods for converting genomic coordinates between one assembly and another are known in the art and can be used to convert the genomic coordinates provided herein to corresponding coordinates in another assembly of the human genome, including conversions to previous assemblies produced by the same organization or using the same algorithm (e.g., from GRCh38 to GRCh37), and conversions of assemblies produced by different organizations or algorithms (e.g., from GRCh38 to NCBI33, produced by the International Human Genome Sequencing Consortium). Available methods and tools known in the art include, but are not limited to, the NCBI Genome Remapping Service available at the National Center for Biotechnology Information website, UCSC LiftOver available at the UCSC Genome Brower website, and Assembly Converter available at the Ensembl.org website.

[0031] "Exon," as used herein, refers to a nucleic acid within a gene that encodes a mature RNA transcript. In the case of the CIITA gene, the genomic coordinates of the start and end of each exon within the gene are known and are provided in Table 1.

[0032] As used herein, the term "subject" is intended to include living organisms in which an immune response can be elicited, including, for example, mammals, primates, and humans.

[0033] "Polynucleotide" and "nucleic acid" are used herein to refer to polymeric compounds comprising nucleosides or nucleoside analogs (including traditional RNA, DNA, mixed RNA-DNA, and polymers of their analogs) having nitrogenous heterocyclic bases or base analogs linked together along the backbone. The nucleic acid "backbone" can be composed of various linkages, including one or more of sugar phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA, PCT Publication No. WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2' methoxy or 2' halide substitutions. The nitrogenous bases can be the traditional bases (A, G, C, T, U), their analogs (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine), derivatives of inosine, purine, or pyrimidine (e.g., N 4 -methyldeoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with a substituent at the 5- or 6-position (e.g., 5-methylcytosine), purine bases with a substituent at the 2-, 6-, or 8-position, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4-alkyl-pyrimidines, U.S. Pat. No. 5,378,825 and PCT Publication No. WO 93 / 13121. For a general discussion, see The Biochemistry of the Nucleic Acids 5-36, Adams et al., eds., 11th ed., 1992). Nucleic acids can contain one or more "abasic" residues, in which the backbone does not contain a nitrogenous base at one or more positions in the polymer (U.S. Pat. No. 5,585,481). Nucleic acids can contain only conventional RNA or DNA sugars, bases, and linkages, or can contain both conventional building blocks and substitutions (e.g., conventional bases with 2' methoxy linkages, or polymers containing both conventional bases and one or more base analogs). Nucleic acids include "locked nucleic acids" (LNAs), which are analogs containing one or more LNA nucleotide monomers that have a bicyclic furanose unit locked to an RNA-mimetic sugar structure, enhancing hybridization affinity to complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). RNA and DNA have different sugar moieties and can differ by the presence of uracil or its analogs in RNA and thymine or its analogs in DNA.

[0034] The terms "guide RNA," "gRNA," and simply "guide" are used interchangeably herein to refer, for example, to a guide that directs an RNA-guided DNA-binding agent to a target DNA, and can be a single guide RNA or a combination of crRNA and trRNA (also known as tracrRNA). Exemplary gRNAs include modified or unmodified forms of Class II Cas nuclease guide RNAs. The crRNA and trRNA can associate as a single RNA molecule (single guide RNA, sgRNA) or in two separate RNA strands (dual guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to each type. The trRNA can be a naturally occurring sequence or a trRNA sequence that has modifications or variations compared to the naturally occurring sequence. As used herein, a "guide sequence" refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct the guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA-binding agent. A "guide sequence" can also be referred to as a "targeting sequence" or a "spacer sequence." A guide sequence can be, for example, 20 base pairs in length in the case of Streptococcus pyogenes (i.e., Spy Cas9 (SpCas9)) and related Cas9 homologs / orthologs. Shorter or longer sequences, e.g., 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length, can also be used as a guide. In some embodiments, a target sequence, e.g., within a gene or on a chromosome, is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence can be about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the guide sequence and target region can be 100% complementary or identical. In other embodiments, the guide sequence and target region can contain at least one mismatch.For example, the guide sequence and target sequence may contain 1, 2, 3, or 4 mismatches, and the total length of the target sequence is at least 17, 18, 19, 20, or more base pairs. In some embodiments, the guide sequence and target region may contain 1 to 4 mismatches, and the guide sequence comprises at least 17, 18, 19, 20, or more nucleotides. In some embodiments, the guide sequence and target region may contain 1, 2, 3, or 4 mismatches, and the guide sequence comprises 20 nucleotides.

[0035] Because the nucleic acid substrate of an RNA-guided DNA binder is a double-stranded nucleic acid, the target sequence of the RNA-guided DNA binder includes both the plus and minus strands of genomic DNA (i.e., the given sequence and the reverse complement of the sequence). Thus, when a guide sequence is said to be "complementary to a target sequence," it should be understood that it can direct the guide RNA to bind to the reverse complement of the target sequence. Thus, in some embodiments, when the guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to a specific nucleotide of the target sequence (e.g., the target sequence without the PAM), except that T is replaced with U in the guide sequence.

[0036] As used herein, "RNA-guided DNA binding agent" refers to a polypeptide or polypeptide complex having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, where the DNA-binding activity is sequence-specific and dependent on the sequence of the RNA. Exemplary RNA-guided DNA binding agents include Cas cleavase / nickases and their inactivated forms ("dCas DNA binding agents"). As used herein, "Cas nucleases," also referred to as "Cas proteins," encompass Cas cleavases, Cas nickases, and dCas DNA binding agents. Cas cleavases / nickases and dCas DNA binding agents include the Csm or Cmr complexes of type III CRISPR systems, Cas10, Csm1, or their Cmr2 subunits, the Cascade complex of type I CRISPR systems, its Cas3 subunit, and class 2 Cas nucleases. As used herein, a "class 2 Cas nuclease" is a single-chain polypeptide with RNA-guided DNA binding activity. Class 2 Cas nucleases include Class 2 Cas cleavase / nickases that further have RNA-guided DNA cleavase or nickase activity (e.g., H840A, D10A, or N863A variants), and Class 2 dCas DNA binders in which the cleavase / nickase activity is inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins, and modifications thereof. The Cpf1 protein, Zetsche et al., Cell, 163:1-13 (2015), is homologous to Cas9 and contains a RuvC-like nuclease domain. The Cpf1 sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Tables S1 and S3 of Zetsche.See, for example, Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0037] As used herein, the term "editor" refers to an agent comprising a polypeptide capable of making modifications within a DNA sequence. In some embodiments, the editor is a cleavase, such as a Cas9 cleavase. In some embodiments, the editor is capable of deaminating bases within a DNA molecule. In some embodiments, the editor is capable of deaminating cytosine (C) in DNA. In some embodiments, the editor is a fusion protein comprising an RNA-guided nickase fused to a cytidine deaminase. In some embodiments, the editor is a fusion protein comprising an RNA-guided nickase fused to an APOBEC3A deaminase (A3A). In some embodiments, the editor comprises a Cas9 nickase fused to an APOBEC3A deaminase (A3A). In some embodiments, the editor is a fusion protein comprising a cytidine deaminase and an RNA-guided nickase fused to a UGI. In some embodiments, the editor lacks a UGI.

[0038] As used herein, "cytidine deaminase" means a polypeptide or complex of polypeptides capable of cytidine deaminase activity, which catalyzes the hydrolytic deamination of cytidine or deoxycytidine, typically to yield uridine or deoxyuridine. Cytidine deaminases include enzymes within the cytidine deaminase superfamily, particularly the APOBEC family of enzymes (APOBEC1, APOBEC2, APOBEC4, and APOBEC3 subgroups of enzymes), activation-induced cytidine deaminases (AID or AICDA), and CMP deaminases (see, e.g., Conticello et al., Mol. Biol. Evol. 22:367-77, 2005; Conticello, Genome Biol. 9:229, 2008; Muramatsu et al., J. Biol. Chem. 274:18470-6, 1999; Carrington et al., Cells 9:1690 (2020)).

[0039] As used herein, the term "APOBEC3" refers to an APOBEC3 protein, such as an APOBEC3 protein expressed by any of the seven genes (A3A-A3H) in the human APOBEC3 locus. APOBEC3s can have catalytic DNA or RNA editing activity. The amino acid sequence of APOBEC3A has been described (UniPROT Accession ID: p31941) and is included herein as SEQ ID NO: 40. In some embodiments, the APOBEC3 protein is a human APOBEC3 protein and / or a wild-type protein. Variants include sequences that differ from the wild-type APOBEC3 protein by one or more mutations (i.e., substitutions, deletions, insertions), e.g., proteins with one or more single-point substitutions. For example, truncated APOBEC3 sequences can be used, e.g., by deleting several N- or C-terminal amino acids, preferably 1 to 4 amino acids at the C-terminus of the sequence. As used herein, the term "variant" refers to allelic variants, splicing variants, and natural or artificial mutants that are homologous to the APOBEC3 reference sequence. The variants are "functional" in that they exhibit catalytic activity for DNA or RNA editing. In some embodiments, the APOBEC3 (e.g., human APOBEC3A) has a wild-type amino acid position 57 (numbered in the wild-type sequence). In some embodiments, the APOBEC3 (e.g., human APOBEC3A) has an asparagine at amino acid position 57 (numbered in the wild-type sequence).

[0040] As used herein, a "nickase" is an enzyme that creates a single-strand break (also known as a "nick") in double-stranded DNA, i.e., it cleaves one strand of the DNA double helix but not the other. As used herein, an "RNA-guided DNA nickase" refers to a polypeptide or complex of polypeptides having DNA nickase activity, where the DNA nickase activity is sequence-specific and dependent on the sequence of the RNA. Exemplary RNA-guided DNA nickases include Cas nickases. Cas nickases include the nickase forms of the Csm or Cmr complexes of type III CRISPR systems, Cas10, Csm1, or their Cmr2 subunits, the Cascade complex of type I CRISPR systems, its Cas3 subunit, and class 2 Cas nucleases. Class 2 Cas nickases include variants with RNA-guided DNA nickase activity in which only one of the two catalytic domains is inactivated. Class 2 Cas nickases include, for example, Cas9 (e.g., H840A, D10A, or N863A variants of SpyCas9), Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins, and modifications thereof. The Cpf1 protein, Zetsche et al., Cell, 163:1-13 (2015), is homologous to Cas9 and contains a RuvC-like protein domain. Zetsche's Cpf1 sequences are incorporated by reference in their entirety. See, e.g., Tables S1 and S3 of Zetsche. "Cas9" encompasses S. pyogenes (Spy) Cas9, variants of Cas9 listed herein, and their equivalents.See, for example, Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0041] As used herein, the term "fusion protein" refers to a hybrid polypeptide containing protein domains from at least two different proteins. One protein may be located at the amino-terminal (N-terminal) portion or the carboxy-terminal (C-terminal) portion of the fusion protein, thus forming an "amino-terminal fusion protein" or a "carboxy-terminal fusion protein," respectively. Any of the proteins provided herein can be produced by any method known in the art. For example, the proteins provided herein can be produced via recombinant protein expression and purification, which is particularly suitable for fusion proteins containing peptide linkers. Methods of recombinant protein expression and purification are well known and include those described by Green and Sambrook, Molecular Cloning: A Laboratory Manual (4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2012)), the entire contents of which are incorporated herein by reference.

[0042] The term "linker," as used herein, refers to a chemical group or molecule that connects two adjacent molecules or moieties. Typically, a linker is positioned between or adjacent to two groups, molecules, or other moieties and is connected to each via a covalent bond. In some embodiments, the linker is an amino acid or a plurality of amino acids (e.g., a peptide or protein), such as a 16-amino acid residue "XTEN" linker, or a variant thereof (see, e.g., the Examples, and Schellenberger et al. A recombinant polypeptide extends the in vivo half-life of peptides and proteins in a tunable manner. Nat. Biotechnol. 27, 1186-1190 (2009)). In some embodiments, the XTEN linker comprises the sequence SGSETPGTSESATPES (SEQ ID NO: 900), SGSETPGTSESA (SEQ ID NO: 901), or SGSETPGTSESATPEGGSGGS (SEQ ID NO: 902).

[0043] As used herein, the term "uracil glycosylase inhibitor" or "UGI" refers to a protein that can inhibit the uracil-DNA glycosylase (UDG) base excision repair enzyme.

[0044] As used herein, the "open reading frame" or "ORF" of a gene refers to a sequence of codons that specifies the amino acid sequence of the protein encoded by the gene. An ORF begins with a start codon (e.g., ATG in DNA or AUG in RNA) and ends with a stop codon (e.g., TAA, TAG, or TGA in DNA, or UAA, UAG, or UGA in RNA).

[0045] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to a guide RNA that is coupled with an RNA-guided DNA-binding agent, such as a Cas nuclease, e.g., a Cas cleavase, a Cas nickase, or a dCas DNA-binding agent (e.g., Cas9). In some embodiments, the guide RNA guides the RNA-guided DNA-binding agent, such as Cas9, to a target sequence, the guide RNA hybridizes to the target sequence, the agent binds to the target sequence, and, if the agent is a cleavase or nickase, can cleave or nick the target sequence after binding.

[0046] As used herein, a first sequence is considered to "comprise a sequence having at least X% identity to" a second sequence if alignment of the first sequence to the second sequence shows that X% or more of the positions of the second sequence overall are matched by the first sequence. For example, the sequence AAGA contains a sequence having 100% identity to the sequence AAG because the alignment gives 100% identity in that there is a match at all three positions in the second sequence. Differences between RNA and DNA (generally, the exchange of thymidine with uridine, or vice versa), and the presence of nucleoside analogs such as modified uridines, do not contribute to differences in identity or complementarity between polynucleotides, as long as the related nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as their complement). Thus, for example, the sequence 5'-AXG (where X is any modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine) is considered 100% identical to AUG, in that both are perfectly complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. Those skilled in the art will understand the selection of an appropriate algorithm and parameter settings for a given pair of sequences to be aligned. Generally, for sequences of similar length and predicted identity of greater than 50% for amino acids or 75% for nucleotides, the Needleman-Wunsch algorithm, using the default settings of the Needleman-Wunsch algorithm interface provided by EBI at the www.ebi.ac.uk web server, is generally appropriate.

[0047] "mRNA" is used herein to refer to a polynucleotide that contains an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by a ribosome and an aminoacylated tRNA). An mRNA can include a phosphate sugar backbone that includes ribose residues or analogs thereof (e.g., 2'-methoxyribose residues). In some embodiments, the sugars of the mRNA phosphate sugar backbone consist essentially of ribose residues, 2'-methoxyribose residues, or a combination thereof.

[0048] As used herein, "indel" refers to an insertion / deletion mutation consisting of a number of nucleotides that are either inserted or deleted within a target nucleic acid, for example, at the site of a double-strand break (DSB).

[0049] As used herein, "reduced or eliminated" expression of a protein on a cell refers to a partial or complete loss of expression of the protein relative to unmodified cells. In some embodiments, the surface expression of a protein on a cell is measured by flow cytometry and has "reduced or eliminated" surface expression compared to unmodified cells, as evidenced by a reduced fluorescent signal when stained with the same antibody against the protein. Cells that have "reduced or eliminated" surface expression of a protein by flow cytometry compared to unmodified cells can be referred to as "negative" for the expression of that protein, as evidenced by a fluorescent signal similar to that of cells stained with an isotype control antibody. "Reduced or eliminated" protein expression can be measured by other known techniques in the art, using appropriate controls known to those skilled in the art.

[0050] As used herein, "knockdown" refers to a reduction in the expression of a particular gene product (e.g., protein, mRNA, or both), for example, compared to the expression of an unedited target sequence. Protein knockdown can be measured by detecting the total cellular amount of protein from a sample, such as a tissue, fluid, or cell population of interest. It can also be measured by measuring a surrogate, marker, or activity of the protein. Methods for measuring mRNA knockdown are known and include analyzing mRNA isolated from a sample of interest. In some embodiments, "knockdown" can refer to some loss of expression of a particular gene product, for example, a reduction in the amount of transcribed mRNA, or a reduction in the amount of protein expressed by a cell or cell population (including in vivo populations such as those found in tissues).

[0051] As used herein, "knockout" refers to the loss of expression from a specific gene or the loss of a specific protein in a cell. Knockout can result in a reduction in expression below the detection level of an assay. Knockout can be measured by detecting the total cellular amount of protein in either a cell, tissue, or cell population.

[0052] As used herein, "target sequence" or "genomic target sequence" refers to a sequence of nucleic acid within a target gene that has complementarity to the guide sequence of a gRNA. The interaction between the target sequence and the guide sequence directs the RNA-guided DNA-binding agent to bind and potentially (depending on the activity of the agent) nick or cleave within the target sequence.

[0053] As used herein, "treatment" refers to any administration or application of a therapy for a disease or disorder in a subject, including inhibiting the disease, halting its progression, alleviating one or more symptoms of the disease, curing the disease, or preventing one or more symptoms of the disease, including the recurrence of symptoms.

[0054] Reference will now be made in detail to specific embodiments of the invention. Example embodiments of the invention are illustrated in the accompanying drawings. While the invention will be described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents that may be included within the invention as defined by the appended claims and the included embodiments.

[0055] Before describing the present teachings in detail, it should be understood that the present disclosure is not limited to particular compositions or process steps, as such may vary. It should be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to "a conjugate" includes a plurality of conjugates, and a reference to, for example, "a cell" includes a plurality of cells.

[0056] Numerical ranges are inclusive of the numbers defining the range. Measured and measurable values ​​are understood to be approximate, taking into account significant orders of magnitude and the error associated with the measurements. Additionally, the use of "comprise," "comprises," "comprising," "contain," "contains," "containing," "include," "includes," and "including" is not intended to be limiting. It should be understood that both the foregoing general description and the detailed description are exemplary and illustrative only and are not limiting of the teachings herein.

[0057] Unless otherwise stated herein, embodiments herein that recite various components as "comprising" are also assumed to "consist of" or "consist essentially of" the recited components. Embodiments herein that recite various components as "consisting of" are also assumed to "comprising" or "consisting essentially of" the recited components. Embodiments herein that recite various components as "consisting essentially of" are also assumed to "consist of" or "comprising" the recited components (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in its inclusive sense, i.e., equivalent to "and / or," unless the context clearly dictates otherwise.

[0058] The section headings used herein are for organizational purposes only and should not be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference conflicts with any term defined herein or any other explicit content of this specification, the present specification shall control. While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. To the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those skilled in the art.

[0059] II. Genetically modified cells A. Engineered Cell Compositions The present disclosure provides engineered cell compositions in which MHC class II surface expression is reduced or eliminated compared to unmodified cells. In some embodiments, the engineered cell compositions comprise a genetic modification in the CIITA gene. In some embodiments, the engineered cells are allogeneic cells. In some embodiments, the engineered cells with reduced MHC class II expression are useful for adoptive cell transplantation therapy. In some embodiments, the engineered cells comprise additional genetic modifications in the genome of the cells to produce cells desirable for allogeneic transplantation purposes.

[0060] As used herein, the term "within genomic coordinates" includes the boundaries of a given genomic coordinate range. For example, given chr16:10895702-10895722, coordinates chr16:10895702 and chr16:10895722 are encompassed.

[0061] In some embodiments, for each given range of genomic coordinates, the range may encompass + / - 10 nucleotides on either end of the specified coordinate. For each given range of genomic coordinates, the range may encompass + / - 5 nucleotides on either end of the range. For example, given chr16:10895702-10895722, in some embodiments, the genomic target sequence or genetic modification may fall within chr16:10895692-10895732.

[0062] The genetic modification in CIITA gene is further described herein.In some embodiments, the genetic modification in CIITA gene comprises any one or more of the insertion, deletion, substitution or deamination of at least one nucleotide in target sequence.

[0063] In some embodiments, a given range of genomic coordinates may include target sequences on both strands of DNA (i.e., the plus (+) strand and the minus (-) strand).

[0064] In some embodiments, an engineered cell is provided that comprises a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, and wherein the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10902662-chr16:10923285.

[0065] The boundaries of the exons within the CIITA gene are known based on the ENST00000618327 transcript and are provided in Table 1 below. See https: / / useast.ensembl.org / Homo_sapiens / Transcript / Exons?db=core;g=ENSG00000179583;r=16:10866222-10943021;t=ENST00000618327.

[0066] [Table 1]

[0067] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and wherein the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 consecutive nucleotides within genomic coordinates chr16:10902662-chr16:10923285.

[0068] In some embodiments, an engineered cell is provided that comprises a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, and wherein the genetic modification comprises at least 5 consecutive nucleotides within genomic coordinates chr16:10902662-chr16:10923285.

[0069] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least 6, 7, 8, 9, or 10 contiguous nucleotides within genomic coordinates chr16:10902662-chr16:10923285. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least 6 contiguous nucleotides within genomic coordinates chr16:10902662-chr16:10923285. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least 7 contiguous nucleotides within genomic coordinates chr16:10902662-chr16:10923285. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least 8 contiguous nucleotides within genomic coordinates chr16:10902662-chr16:10923285. In some embodiments, an engineered cell is provided that comprises a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, and wherein the genetic modification comprises at least 9 consecutive nucleotides within genomic coordinates chr16:10902662-chr16:10923285.In some embodiments, an engineered cell is provided that comprises a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, and wherein the genetic modification comprises at least 10 consecutive nucleotides within genomic coordinates chr16:10902662-chr16:10923285.

[0070] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10902662-chr16:10923285. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least one C to T substitution within genomic coordinates chr16:10902662-chr16:10923285. In some embodiments, an engineered cell is provided that comprises a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, and wherein the genetic modification comprises at least one A to G substitution within genomic coordinates chr16:10902662-chr16:10923285.

[0071] In some embodiments, an engineered cell is provided that comprises a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, and wherein the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10906542-chr16:10923285.

[0072] In some embodiments, an engineered cell is provided that comprises a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, and wherein the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10906542-chr16:10908121.

[0073]

[0023] In some embodiments, the engineered cells comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modifications are selected from the group consisting of chr16:10916432-10916452, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10906985-10907005, chr16:10908073-10908093, chr16:10907433-10907453, chr 16:10907979-10907999, chr16:10907139-10907159, chr16:10922435-1 0922455, chr16:10907384-10907404, chr16:10907434-10907454, chr16: 10907119-10907139, chr16:10907539-10907559, chr16:10907810-10907 830, chr16:10907315-10907335, chr16:10916426-10916446, chr16:1090 9138-10909158, chr16:10908101-10908121, chr16:10907790-10907810 , chr16:10907787-10907807, chr16:10907454-10907474, chr16:1089570 2-10895722, chr16:10902729-10902749, chr16:10918492-10918512, chr 16:10907932-10907952, chr16:10907623-10907643, chr16:10907461-10 907481, chr16:10902723-10902743, chr16:10907622-10907642, chr16: 10922441-10922461, chr16:10902662-10902682, chr16:10915626-10915 646, chr16:10915592-10915612, chr16:10907385-10907405, chr16:1090 7030-10907050, chr16:10907935-10907955, chr16:10906853-10906873,Engineered cells are provided that include at least one nucleotide of an exon within genomic coordinates selected from chr16:10906757-10906777, chr16:10907730-10907750, and chr16:10895302-10895322.

[0074]

[0021] In some embodiments, the engineered cells comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification is selected from the group consisting of chr16:10907539-10907559, chr16:10916426-10916446, chr16:10906907-10906927, chr16:10895702-10895722, chr16:109077

[0013] Engineered cells are provided that comprise at least one nucleotide of an exon within genomic coordinates selected from chr16:10907476-10907496, chr16:10907385-10907405, and chr16:10923265-10923285.

[0075]

[0021] In some embodiments, the engineered cells comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification is selected from the group consisting of chr16:10906853-10906873, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10907315-10907335, chr16:10916432-10916452, chr16:10907932-10907952, Engineered cells are provided that comprise at least one nucleotide of an exon within genomic coordinates selected from chr16:10915626-10915646, chr16:10907586-10907606, chr16:10916426-10916446, chr16:10907476-10907496, chr16:10907787-10907807, chr16:10907979-10907999, chr16:10906904-10906924, and chr16:10909138-10909158.

[0076]

[0021] In some embodiments, the engineered cells comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification is selected from the group consisting of chr16:10895702-10895722, chr16:10916432-10916452, chr16:10907623-10907643, chr16:10907932-10907952, chr16:10906985-10907005, Engineered cells are provided that comprise at least one nucleotide of an exon within genomic coordinates selected from chr16:10915626-10915646, chr16:10907539-10907559, chr16:10916426-10916446, chr16:10907476-10907496, chr16:10907119-10907139, chr16:10907979-10907999, and chr16:10909138-10909158.

[0077] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and wherein the genetic modification comprises at least one nucleotide of an exon within genomic coordinates selected from chr16:10906853-10906873, chr16:10906757-10906777, chr16:10895302-10895322, chr16:10907539-10907559, chr16:10907730-10907750, and chr16:10895702-10895722.

[0078] In some embodiments, an engineered cell is provided that comprises a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, and wherein the genetic modification comprises at least one nucleotide of an exon within genomic coordinates selected from chr16:10906853-10906873, chr16:10922444-10922464, and chr16:10916432-10916452.

[0079] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10906853-10906873. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10922444-10922464. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10916432-10916452. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10906757-10906777. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10895302-10895322. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10907539-10907559.In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10907730-10907750. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10895702-10895722. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10907932-10907952. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10907476-10907496. In some embodiments, an engineered cell is provided that comprises a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, and wherein the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10909138-10909158.

[0080]

[0022] In some embodiments, the engineered cells comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification is selected from the group consisting of chr16:10902662-10902682, chr16:10902723-10902743, chr16:10902729-10902749, chr16:10903747-10903767, chr16:10903824-10903844, chr 16:10903848-10903868, chr16:10904761-10904781, chr16:10904764-1 0904784, chr16:10904765-10904785, chr16:10904785-10904805, chr16: 10906542-10906562, chr16:10906556-10906576, chr16:10906609-10906 629, chr16:10906610-10906630, chr16:10906616-10906636, chr16:1090 6682-10906702, chr16:10906756-10906776, chr16:10906757-10906777 , chr16:10906757-10906777, chr16:10906821-10906841, chr16:1090682 3-10906843, chr16:10906847-10906867, chr16:10906848-10906868, chr 16:10906853-10906873, chr16:10906853-10906873, chr16:10906904-10 906924, chr16:10906907-10906927, chr16:10906913-10906933, chr16: 10906968-10906988, chr16:10906970-10906990, chr16:10906985-10907 005, chr16:10907030-10907050, chr16:10907058-10907078, chr16:1090 7119-10907139, chr16:10907139-10907159, chr16:10907172-10907192,chr16:10907272-10907292、chr16:10907288-10907308、chr16:1090731 4-10907334、chr16:10907315-10907335、chr16:10907325-10907345、chr 16:10907363-10907383、chr16:10907384-10907404、chr16:10907385-10907405、chr16:10907433-10907453、chr16:10907434-10907454、chr16: 10907435-10907455、chr16:10907441-10907461、chr16:10907454-10907474、chr16:10907461-10907481、chr16:10907476-10907496、chr16:109 07539-10907559、chr16:10907586-10907606、chr16:10907589-10907609、chr16:10907621-10907641、chr16:10907622-10907642、chr16:109076 23-10907643、chr16:10907730-10907750、chr16:10907731-10907751、chr16:10907757-10907777、chr16:10907781-10907801、chr16:10907787- 10907807、chr16:10907790-10907810、chr16:10907810-10907830、chr16:10907820-10907840、chr16:10907870-10907890、chr16:10907886-109 07906、chr16:10907924-10907944、chr16:10907928-10907948、chr16:10907932-10907952、chr16:10907935-10907955、chr16:10907978-109079 98、chr16:10907979-10907999、chr16:10908069-10908089、chr16:10908073-10908093、chr16:10908101-10908121、chr16:10909056-10909076、chr16:10909138-10909158, chr16:10910195-10910215, chr16:10910196-1 0910216, chr16:10915592-10915612, chr16:10915626-10915646, chr16:10 916375-10916395, chr16:10916382-10916402, chr16:10916426-10916446, chr16:10916432-10916452, chr16:10918486-10918506, chr16:10918492-10

[0013] Engineered cells are provided that include an indel, a C to T substitution, or an A to G substitution within genomic coordinates selected from 918512, chr16:10918493-10918513, chr16:10922435-10922455, chr16:10922441-10922461, chr16:10922441-10922461, chr16:10922444-10922464, chr16:10922460-10922480, chr16:10923257-10923277, and chr16:10923265-10923285. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 5 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinate.

[0081]

[0023] In some embodiments, the engineered cells comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modifications are selected from the group consisting of chr16:10916432-10916452, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10906985-10907005, chr16:10908073-10908093, chr16:10907433-10907453, chr 16:10907979-10907999, chr16:10907139-10907159, chr16:10922435-1 0922455, chr16:10907384-10907404, chr16:10907434-10907454, chr16: 10907119-10907139, chr16:10907539-10907559, chr16:10907810-10907 830, chr16:10907315-10907335, chr16:10916426-10916446, chr16:1090 9138-10909158, chr16:10908101-10908121, chr16:10907790-10907810 , chr16:10907787-10907807, chr16:10907454-10907474, chr16:1089570 2-10895722, chr16:10902729-10902749, chr16:10918492-10918512, chr 16:10907932-10907952, chr16:10907623-10907643, chr16:10907461-10 907481, chr16:10902723-10902743, chr16:10907622-10907642, chr16: 10922441-10922461, chr16:10902662-10902682, chr16:10915626-10915 646, chr16:10915592-10915612, chr16:10907385-10907405, chr16:1090 7030-10907050, chr16:10907935-10907955, chr16:10906853-10906873,Engineered cells are provided that comprise an indel, a C to T substitution, or an A to G substitution within a genomic coordinate selected from chr16:10906757-10906777, chr16:10907730-10907750, and chr16:10895302-10895322. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 5 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinate.

[0082]

[0023] In some embodiments, the engineered cells comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification is selected from the group consisting of chr16:10907539-10907559, chr16:10916426-10916446, chr16:10906907-10906927, chr16:10895702-10895722, chr16:10907757-

[0013] Engineered cells are provided that comprise an indel, a C to T substitution, or an A to G substitution within a genomic coordinate selected from: 10907777, chr16:10907623-10907643, chr16:10915626-10915646, chr16:10906756-10906776, chr16:10907476-10907496, chr16:10907385-10907405, and chr16:10923265-10923285. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 5 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinate.

[0083]

[0023] In some embodiments, the engineered cells comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modifications are selected from the group consisting of chr16:10906853-10906873, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10907315-10907335, chr16:10916432-10916452, chr16:10907932-10907952, ... 6:10915626-10915646, chr16:10907586-10907606, chr16:10916426-10916446, chr16:10907476-10907496, chr16:10907787-10907807, chr16:10907979-10907999, and chr16:10906904-10906924, and chr16:10909138-10909158. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 consecutive nucleotides within a genomic coordinate. In some embodiments, the genetic modification comprises at least 5 consecutive nucleotides within a genomic coordinate. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 consecutive nucleotides within a genomic coordinate. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within a genomic coordinate.

[0084]

[0023] In some embodiments, the engineered cells comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification is selected from the group consisting of chr16:10895702-10895722, chr16:10916432-10916452, chr16:10907623-10907643, chr16:10907932-10907952, chr16:10906985-10907005, chr 16:10915626-10915646, chr16:10907539-10907559, chr16:10916426-10916446, chr16:10907476-10907496, chr16:10907119-10907139, chr16:10907979-10907999, and chr16:10909138-10909158. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 5 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinate.

[0085] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within a genomic coordinate selected from chr16:10906853-10906873, chr16:10906757-10906777, chr16:10895302-10895322, chr16:10907539-10907559, chr16:10907730-10907750, and chr16:10895702-10895722. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 consecutive nucleotides within a genomic coordinate. In some embodiments, the genetic modification comprises at least 5 consecutive nucleotides within a genomic coordinate. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 consecutive nucleotides within a genomic coordinate. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within a genomic coordinate.

[0086] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within a genomic coordinate selected from chr16:10906853-10906873, chr16:10922444-10922464, and chr16:10916432-10916452. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 5 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within a genomic coordinate.

[0087] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within genomic coordinates chr16:10906853-10906873. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within genomic coordinates chr16:10922444-10922464. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within genomic coordinates chr16:10916432-10916452. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within genomic coordinates chr16:10906757-10906777. In some embodiments, an engineered cell is provided that comprises a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, and wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within genomic coordinates chr16:10895302-10895322.In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within genomic coordinates chr16:10907539-10907559. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within genomic coordinates chr16:10907730-10907750. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within genomic coordinates chr16:10895702-10895722. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within genomic coordinates chr16:10907932-10907952. In some embodiments, an engineered cell is provided that comprises a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, and wherein the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within genomic coordinates chr16:10907476-10907496.In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification comprises an indel, a C to T substitution, or an A to G substitution within genomic coordinate chr16:10909138-10909158. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 5 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least 6, 7, 8, 9, or 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinate.

[0088] In some embodiments, MHC class II expression is selected from the group consisting of chr16:10902662-10902682, chr16:10902723-10902743, chr16:10902729-10902749, chr16:10903747-10903767, chr16:10903824-10903844, chr16:10903848-10903868, chr16:10904761-10904781, chr16:10904764-10904784, chr16: 10904765-10904785, chr16:10904785-10904805, chr16:10906542-1090 6562, chr16:10906556-10906576, chr16:10906609-10906629, chr16:109 06610-10906630, chr16:10906616-10906636, chr16:10906682-1090670 2, chr16:10906756-10906776, chr16:10906757-10906777, chr16:109067 57-10906777, chr16:10906821-10906841, chr16:10906823-10906843, c hr16:10906847-10906867, chr16:10906848-10906868, chr16:10906853- 10906873, chr16:10906853-10906873, chr16:10906904-10906924, chr1 6:10906907-10906927, chr16:10906913-10906933, chr16:10906968-109 06988, chr16:10906970-10906990, chr16:10906985-10907005, chr16:1 0907030-10907050, chr16:10907058-10907078, chr16:10907119-109071 39, chr16:10907139-10907159, chr16:10907172-10907192, chr16:1090 7272-10907292, chr16:10907288-10907308, chr16:10907314-10907334,chr16:10907315-10907335、chr16:10907325-10907345、chr16:1090736 3-10907383、chr16:10907384-10907404、chr16:10907385-10907405、chr 16:10907433-10907453、chr16:10907434-10907454、chr16:10907435-10907455、chr16:10907441-10907461、chr16:10907454-10907474、chr16: 10907461-10907481、chr16:10907476-10907496、chr16:10907539-10907559、chr16:10907586-10907606、chr16:10907589-10907609、chr16:109 07621-10907641、chr16:10907622-10907642、chr16:10907623-10907643、chr16:10907730-10907750、chr16:10907731-10907751、chr16:109077 57-10907777、chr16:10907781-10907801、chr16:10907787-10907807、chr16:10907790-10907810、chr16:10907810-10907830、chr16:10907820- 10907840、chr16:10907870-10907890、chr16:10907886-10907906、chr16:10907924-10907944、chr16:10907928-10907948、chr16:10907932-109 07952、chr16:10907935-10907955、chr16:10907978-10907998、chr16:10907979-10907999、chr16:10908069-10908089、chr16:10908073-109080 93、chr16:10908101-10908121、chr16:10909056-10909076、chr16:10909138-10909158、chr16:10910195-10910215、chr16:10910196-10910216、chr16:10915592-10915612, chr16:10915626-10915646, chr16:10916375-10916395, chr16:10916382-10916402, chr16:10916426-109164 46, chr16:10916432-10916452, chr16:10918486-10918506, chr16:10918492-10918512, chr16:10918493-10918513, chr16:10922435-1092

[0010] Provided are engineered cells in which a gene editing system binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within a genomic coordinate selected from the group consisting of 2455, chr16:10922441-10922461, chr16:10922441-10922461, chr16:10922444-10922464, chr16:10922460-10922480, chr16:10923257-10923277, and chr16:10923265-10923285. In some embodiments, the CIITA genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the CIITA genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinate. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9. In some embodiments, the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase.

[0089] In some embodiments, MHC class II expression is selected from the group consisting of chr16:10906542-10906562, chr16:10906556-10906576, chr16:10906609-10906629, chr16:10906610-10906630, chr16:10906616-10906636, chr16:10906682-10906702, chr16:10906756-10906776, chr16:10906757-10906777, chr16: 10906821-10906841, chr16:10906823-10906843, chr16:10906847-1090 6867, chr16:10906848-10906868, chr16:10906853-10906873, chr16:109 06853-10906873, chr16:10906904-10906924, chr16:10906907-1090692 7, chr16:10906913-10906933, chr16:10906968-10906988, chr16:109069 70-10906990, chr16:10906985-10907005, chr16:10907030-10907050, c hr16:10907058-10907078, chr16:10907119-10907139, chr16:10907139- 10907159, chr16:10907172-10907192, chr16:10907272-10907292, chr1 6:10907288-10907308, chr16:10907314-10907334, chr16:10907315-109 07335, chr16:10907325-10907345, chr16:10907363-10907383, chr16:1 0907384-10907404, chr16:10907385-10907405, chr16:10907433-109074 53, chr16:10907434-10907454, chr16:10907435-10907455, chr16:1090 7441-10907461, chr16:10907454-10907474, chr16:10907461-10907481,chr16:10907476-10907496、chr16:10907539-10907559、chr16:1090758 6-10907606、chr16:10907589-10907609、chr16:10907621-10907641、chr 16:10907622-10907642、chr16:10907623-10907643、chr16:10907730-10907750、chr16:10907731-10907751、chr16:10907757-10907777、chr16: 10907781-10907801、chr16:10907787-10907807、chr16:10907790-10907810、chr16:10907810-10907830、chr16:10907820-10907840、chr16:109 07870-10907890、chr16:10907886-10907906、chr16:10907924-10907944、chr16:10907928-10907948、chr16:10907932-10907952、chr16:109079 35-10907955、chr16:10907978-10907998、chr16:10907979-10907999、chr16:10908069-10908089、chr16:10908073-10908093、chr16:10908101- 10908121、chr16:10909056-10909076、chr16:10909138-10909158、chr16:10910195-10910215、chr16:10910196-10910216、chr16:10915592-109 15612、chr16:10915626-10915646、chr16:10916375-10916395、chr16:10916382-10916402、chr16:10916426-10916446、chr16:10916432-109164 52、chr16:10918486-10918506、chr16:10918492-10918512、chr16:10918493-10918513、chr16:10922435-10922455、chr16:10922441-10922461、Provided are engineered cells in which a gene editing system binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within a genomic coordinate selected from chr16:10922441-10922461, chr16:10922444-10922464, chr16:10922460-10922480, chr16:10923257-10923277, and chr16:10923265-10923285, reducing or eliminating CIITA expression. In some embodiments, the CIITA genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the CIITA genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinate. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9. In some embodiments, the RNA-guided DNA binding agent comprises APOBEC3A deaminase (A3A) and an RNA-guided nickase.

[0090] In some embodiments, MHC class II expression is selected from the group consisting of chr16:10906542-10906562, chr16:10906556-10906576, chr16:10906609-10906629, chr16:10906610-10906630, chr16:10906616-10906636, chr16:10906682-10906702, chr16:10906756-10906776, chr16:10906757-10906777, chr16: 10906821-10906841, chr16:10906823-10906843, chr16:10906847-1090 6867, chr16:10906848-10906868, chr16:10906853-10906873, chr16:109 06853-10906873, chr16:10906904-10906924, chr16:10906907-1090692 7, chr16:10906913-10906933, chr16:10906968-10906988, chr16:109069 70-10906990, chr16:10906985-10907005, chr16:10907030-10907050, c hr16:10907058-10907078, chr16:10907119-10907139, chr16:10907139- 10907159, chr16:10907172-10907192, chr16:10907272-10907292, chr1 6:10907288-10907308, chr16:10907314-10907334, chr16:10907315-109 07335, chr16:10907325-10907345, chr16:10907363-10907383, chr16:1 0907384-10907404, chr16:10907385-10907405, chr16:10907433-109074 53, chr16:10907434-10907454, chr16:10907435-10907455, chr16:1090 7441-10907461, chr16:10907454-10907474, chr16:10907461-10907481,chr16:10907476-10907496, chr16:10907539-10907559, chr16:10907586-10907606, chr16:10907589-1 0907609, chr16:10907621-10907641, chr16:10907622-10907642, chr16:10907623-10907643, chr16:109 07730-10907750, chr16:10907731-10907751, chr16:10907757-10907777, chr16:10907781-10907801, chr r16:10907787-10907807, CHR16:10907790-10907810, CHR16:10907810-10907830, chr16:10907820-1090 7840, chr16:10907870-10907890, chr16:10907886-10907906, chr16:10907924-10907944, chr16:10907 928-10907948, chr16:10907932-10907952, chr16:10907935-10907955, chr16:10907978-10907998, chr1 6:10907979-10907999, chr16:10908069-10908089, chr16:10908073-10908093, chr16:10908101-10908121. In some embodiments, the CIITA genomic target sequence comprises at least 10 contiguous nucleotides in the genomic coordinate. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides in the genomic coordinate. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9. In some embodiments, the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase.

[0091] In some embodiments, MHC class II expression is selected from the group consisting of chr16:10916432-10916452, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10906985-10907005, chr16:10908073-10908093, chr16:10907433-10907453, chr16:10907979-10907999, chr16:10907139-10907159, chr16:10922435-10922455, chr16:10907384-10907404, chr16:10907434-10907454, chr16:10907119-10907139, chr16:10907539-10907559, chr16:10907810-10907830, chr16:10907315-10907335, chr16:10916426-10916446, chr16:10909138-10909158, chr16:10908101-10908121, chr16:10907790-10907810, chr16:10907787-10907807, chr16:10907454-10907474, chr16:10895702-10895722, chr16:10902729-10902749, chr16:10918492-10918512, chr16:10907932-10907952, chr16:10907623-10907643, chr16:10907461-10907481, chr16:10902723-10902743, chr16:10907622-10907642, chr16:10922441-10922461, chr16:10902662-10902682, chr16:10915626-10915646, chr16:10915592-10915612, chr16:10907385-10907405, chr16:10907030-10907050, chr16:10907935-10907955, chr16:10906853-10906873, chr16:10906757-10906777, chr16:10907730-10907750,and chr16:10895302-10895322. In some embodiments, the CIITA genomic target sequence comprises at least 10 contiguous nucleotides within the genomic coordinates. In some embodiments, the CIITA genomic target sequence comprises at least 15 contiguous nucleotides within the genomic coordinates. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9. In some embodiments, the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase.

[0092] In some embodiments, MHC class II expression is selected from the group consisting of chr16:10907539-10907559, chr16:10916426-10916446, chr16:10906907-10906927, chr16:10895702-10895722, chr16:10907757-10907777, chr16:10907623-10907643, chr16:10915626-10915

[0010] Provided are engineered cells in which a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within a genomic coordinate selected from chr16:646, chr16:10906756-10906776, chr16:10907476-10907496, chr16:10907385-10907405, and chr16:10923265-10923285 is reduced or eliminated. In some embodiments, the CIITA genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the CIITA genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinate. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9.

[0093] In some embodiments, MHC class II expression is selected from the group consisting of chr16:10907539-10907559, chr16:10916426-10916446, chr16:10906907-10906927, chr16:10895702-10895722, chr16:10907757-10907777, chr16:10907623-10907643, chr16:10915626-10915

[0010] Provided are engineered cells in which a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within a genomic coordinate selected from chr16:646, chr16:10906756-10906776, chr16:10907476-10907496, chr16:10907385-10907405, and chr16:10923265-10923285 is reduced or eliminated. In some embodiments, the CIITA genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the CIITA genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinate. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises APOBEC3A deaminase (A3A) and an RNA-guided nickase.

[0094] In some embodiments, MHC class II expression is selected from the group consisting of chr16:10906853-10906873, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10907315-10907335, chr16:10916432-10916452, chr16:10907932-10907952, chr16:10915626-10915646, chr16:10907586-10907606, chr16:10

[0010] Provided are engineered cells in which a gene editing system binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within a genomic coordinate selected from chr16:916426-10916446, chr16:10907476-10907496, chr16:10907787-10907807, chr16:10907979-10907999, chr16:10906904-10906924, and chr16:10909138-10909158. In some embodiments, the CIITA genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the CIITA genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinate. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9.

[0095] In some embodiments, MHC class II expression is selected from the group consisting of chr16:10895702-10895722, chr16:10916432-10916452, chr16:10907623-10907643, chr16:10907932-10907952, chr16:10906985-10907005, chr16:10915626-10915646, chr16:10907539-10907559, chr16:10

[0010] Provided are engineered cells in which a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within a genomic coordinate selected from chr16:916426-10916446, chr16:10907476-10907496, chr16:10907119-10907139, chr16:10907979-10907999, and chr16:10909138-10909158 is reduced or eliminated. In some embodiments, the CIITA genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the CIITA genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinate. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises APOBEC3A deaminase (A3A) and an RNA-guided nickase.

[0096]

[0010] In some embodiments, engineered cells are provided in which MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within a genomic coordinate selected from chr16:10906853-10906873, chr16:10906757-10906777, chr16:10895302-10895322, chr16:10907539-10907559, chr16:10907730-10907750, and chr16:10895702-10895722. In some embodiments, the CIITA genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the CIITA genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinate. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9. In some embodiments, the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase.

[0097]

[0013] In some embodiments, engineered cells are provided in which MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within a genomic coordinate selected from chr16:10906853-10906873, chr16:10922444-10922464, and chr16:10916432-10916452. In some embodiments, the CIITA genomic target sequence comprises at least 10 consecutive nucleotides within the genomic coordinate. In some embodiments, the CIITA genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinate. In some embodiments, the gene editing system comprises an RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9.

[0098] In some embodiments, engineered cells are provided in which MHC class II expression has been reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr16:10906853-10906873. In some embodiments, engineered cells are provided in which MHC class II expression has been reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr16:10922444-10922464. In some embodiments, engineered cells are provided in which MHC class II expression has been reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr16:10906757-10906777. In some embodiments, engineered cells are provided in which MHC class II expression has been reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr16:10895302-10895322. In some embodiments, engineered cells are provided in which MHC class II expression has been reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr16:10907539-10907559. In some embodiments, engineered cells are provided in which MHC class II expression has been reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr16:10907730-10907750. In some embodiments, engineered cells are provided in which MHC class II expression is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr16:10895702-10895722.In some embodiments, engineered cells are provided in which MHC class II expression has been reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr16:10907932-10907952. In some embodiments, engineered cells are provided in which MHC class II expression has been reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr16:10907476-10907496. In some embodiments, engineered cells are provided in which MHC class II expression has been reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates chr16:10909138-10909158. In some embodiments, the CIITA genomic target sequence comprises at least 15 consecutive nucleotides within the genomic coordinates. In some embodiments, the gene editing system comprises an RNA-guided DNA binder. In some embodiments, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9. In some embodiments, the RNA-guided DNA binding agent comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase.

[0099] In some embodiments, engineered cells are provided that contain a genetic modification in the CIITA gene described herein, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the cells further have reduced or eliminated surface expression of HLA-A. In some embodiments, the engineered cells contain a genetic modification in the HLA-A gene. In some embodiments, the engineered cells contain a genetic modification in the HLA-A gene, such that the cells are homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the engineered cells contain a genetic modification that eliminates expression of MHC class I proteins on the surface of the engineered cells.

[0100] The engineered human cells described herein can comprise any HLA-A allele of the HLA-A gene.HLA genes are located on chromosome 6 in a genomic region known as the HLA superlocus, and several hundred HLA-A alleles have been reported in the art (see, for example, Shiina et al., Nature 54:15-39 (2009)).The sequences of HLA-A alleles are available in the art (see, for example, IPD-IMGT / HLA database https: / / www.ebi.ac.uk / ipd / imgt / hla / allele.html for searching the sequence of a specific HLA-A allele).

[0101] In any of the above embodiments, an engineered cell is provided that comprises a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, the modification comprising at least one nucleotide of an exon within genomic coordinates chr16:10902662-chr16:10923285, and further comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within genomic coordinates selected from chr6:29942864-chr6:29942903. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate selected from chr6:29943528-chr6:29943609. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate selected from chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, and comprising at least one nucleotide within genomic coordinates selected from chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046.In some embodiments, the cells comprise a genetic modification in the HLA-A gene, wherein the genetic modifications in the HLA-A gene are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6: The present invention relates to a method for identifying a genomic region containing an indel, a C to T substitution, or an A to G substitution within a genomic coordinate selected from chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the HLA-A expression of the cells is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529 -29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C.

[0102] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, the genetic modification comprising at least one nucleotide of an exon within genomic coordinates chr16:10906542-chr16:10923285, and the cell further comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within genomic coordinates selected from chr6:29942864-chr6:29942903. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate selected from chr6:29943528-chr6:29943609. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate selected from chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, and comprising at least one nucleotide within genomic coordinates selected from chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046.In some embodiments, the cells comprise a genetic modification in the HLA-A gene, wherein the genetic modifications in the HLA-A gene are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6: The present invention relates to a method for identifying a genomic region containing an indel, a C to T substitution, or an A to G substitution within a genomic coordinate selected from chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the HLA-A expression of the cells is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529 -29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C.

[0103] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, the genetic modification comprising at least one nucleotide of an exon within genomic coordinates chr16:10906542-chr16:10908121, and the cell further comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within genomic coordinates selected from chr6:29942864-chr6:29942903. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate selected from chr6:29943528-chr6:29943609. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate selected from chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, and comprising at least one nucleotide within genomic coordinates selected from chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046.In some embodiments, the cells comprise a genetic modification in the HLA-A gene, wherein the genetic modifications in the HLA-A gene are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6: The present invention relates to a method for identifying a genomic region containing an indel, a C to T substitution, or an A to G substitution within a genomic coordinate selected from chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the HLA-A expression of the cells is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529 -29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C.

[0104]

[0023] In some embodiments, the engineered cells comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modifications are selected from the group consisting of chr16:10916432-10916452, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10906985-10907005, chr16:10908073-10908093, chr16:10907433-10907453, chr 16:10907979-10907999, chr16:10907139-10907159, chr16:10922435-1 0922455, chr16:10907384-10907404, chr16:10907434-10907454, chr16: 10907119-10907139, chr16:10907539-10907559, chr16:10907810-10907 830, chr16:10907315-10907335, chr16:10916426-10916446, chr16:1090 9138-10909158, chr16:10908101-10908121, chr16:10907790-10907810 , chr16:10907787-10907807, chr16:10907454-10907474, chr16:1089570 2-10895722, chr16:10902729-10902749, chr16:10918492-10918512, chr 16:10907932-10907952, chr16:10907623-10907643, chr16:10907461-10 907481, chr16:10902723-10902743, chr16:10907622-10907642, chr16: 10922441-10922461, chr16:10902662-10902682, chr16:10915626-10915 646, chr16:10915592-10915612, chr16:10907385-10907405, chr16:1090 7030-10907050, chr16:10907935-10907955, chr16:10906853-10906873,Engineered cells are provided that comprise at least one nucleotide of an exon within a genomic coordinate selected from chr16:10906757-10906777, chr16:10907730-10907750, and chr16:10895302-10895322, and wherein the cell further comprises a genetic modification in an HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. In some embodiments, the cell comprises a genetic modification in an HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate selected from chr6:29942864-chr6:29942903. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate selected from chr6:29943528-chr6:29943609. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate selected from chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, In some embodiments, the cell comprises at least one nucleotide within a genomic coordinate selected from chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene is selected from chr6:29942864-29942884, chr6:29942868-29942888,chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6: 29943126-29943146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943 and chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the HLA-A expression of the cells is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529 In some embodiments, the HLA-A gene expression level is reduced or eliminated by a gene editing system that binds to an HLA-A genomic target sequence comprising at least 5 consecutive nucleotides within genomic coordinates selected from chr6:29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C.

[0105]

[0023] In some embodiments, the engineered cells comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification is selected from the group consisting of chr16:10907539-10907559, chr16:10916426-10916446, chr16:10906907-10906927, chr16:10895702-10895722, chr16:10907757-10907777, chr16:10907623-10907643, chr16:10915626-10915646, chr16:10 and wherein the cell further comprises a genetic modification in the HLA-A gene, the genetic modification in the HLA-A gene comprising at least one nucleotide within genomic coordinates selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. In some embodiments, the cell comprises a genetic modification in an HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate selected from chr6:29942864-chr6:29942903. In some embodiments, the cell comprises a genetic modification in an HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate selected from chr6:29943528-chr6:29943609.In some embodiments, the cells comprise a genetic modification in the HLA-A gene, wherein the genetic modifications in the HLA-A gene are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, and comprising at least one nucleotide within genomic coordinates selected from chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the cells comprise a genetic modification in the HLA-A gene, wherein the genetic modifications in the HLA-A gene are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6: The present invention relates to a method for identifying a genomic region containing an indel, a C to T substitution, or an A to G substitution within a genomic coordinate selected from chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046.In some embodiments, the HLA-A expression of the cells is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529 -29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C.

[0106]

[0020] In some embodiments, the engineered cells comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the genetic modification is selected from the group consisting of chr16:10906853-10906873, chr16:10906757-10906777, chr16:10895302-10895322, chr16:10907539-10907559, chr16:10907730-1090 7750, chr16:10895702-10895722, and wherein the cell further comprises a genetic modification in an HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate selected from chr6:29942854-chr6:29942913 and chr6:29943518-chr6:29943619. In some embodiments, the cell comprises a genetic modification in an HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within a genomic coordinate selected from chr6:29942864-chr6:29942903. In some embodiments, the cell comprises a genetic modification in the HLA-A gene, wherein the genetic modification in the HLA-A gene comprises at least one nucleotide within genomic coordinates selected from chr6:29943528-chr6:29943609.In some embodiments, the cells comprise a genetic modification in the HLA-A gene, wherein the genetic modifications in the HLA-A gene are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, and comprising at least one nucleotide within genomic coordinates selected from chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the cells comprise a genetic modification in the HLA-A gene, wherein the genetic modifications in the HLA-A gene are chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6: The present invention relates to a method for identifying a genomic region containing an indel, a C to T substitution, or an A to G substitution within a genomic coordinate selected from chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046.In some embodiments, the HLA-A expression of the cells is chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943146, chr6:29943528-29943548, chr6:29943529 -29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C.

[0107] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene described herein, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, and the cells further have reduced or eliminated surface expression of MHC class I. In some embodiments, the engineered cells comprise a genetic modification in the beta-2-microglobulin (B2M) gene. In some embodiments, the engineered cells comprise a genetic modification in the beta-2-microglobulin (B2M) gene and insertion of an exogenous nucleic acid encoding an NK cell inhibitor molecule. In some embodiments, the engineered cells comprise a genetic modification that eliminates expression of an MHC class I protein on the surface of the engineered cells.

[0108] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, the modification comprising at least one nucleotide of an exon within genomic coordinates chr16:10902662-chr16:10923285, and the cell further comprises an exogenous nucleic acid. In some embodiments, the exogenous nucleic acid encodes a targeting receptor expressed on the surface of the engineered cell. In some embodiments, the targeting receptor is a chimeric antigen receptor (CAR). In some embodiments, the targeting receptor is a universal CAR (UniCar). In some embodiments, the targeting receptor is a T cell receptor (TCR). In some embodiments, the targeting receptor is a WT1 TCR. In some embodiments, the targeting receptor is a hybrid CAR / TCR. In some embodiments, the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain and a subunit of a TCR). In some embodiments, the targeting receptor is a cytokine receptor. In some embodiments, the targeted receptor is a chemokine receptor. In some embodiments, the targeted receptor is a B cell receptor (BCR). In some embodiments, the exogenous nucleic acid encodes a polypeptide secreted by the engineered cell (i.e., a soluble polypeptide). In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the exogenous nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an enzyme. In some embodiments, the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the exogenous nucleic acid encodes a fusion protein.

[0109] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, the modification comprising at least one nucleotide of an exon within genomic coordinates chr16:10902662-chr16:10923285, the cells further have reduced or eliminated surface expression of MHC class I, and the cells further comprise an exogenous nucleic acid. In some embodiments, the engineered cells comprise a genetic modification in the beta-2-microglobulin (B2M) gene. In some embodiments, the engineered cells comprise a genetic modification that reduces expression of an MHC class I protein on the surface of the engineered cells. In some embodiments, the exogenous nucleic acid encodes a targeting receptor expressed on the surface of the engineered cells. In some embodiments, the targeting receptor is a chimeric antigen receptor (CAR). In some embodiments, the targeting receptor is a universal CAR (UniCar). In some embodiments, the targeting receptor is a T cell receptor (TCR). In some embodiments, the targeted receptor is a WT1 TCR. In some embodiments, the targeted receptor is a hybrid CAR / TCR. In some embodiments, the targeted receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain and a subunit of a TCR). In some embodiments, the targeted receptor is a cytokine receptor. In some embodiments, the targeted receptor is a chemokine receptor. In some embodiments, the targeted receptor is a B cell receptor (BCR). In some embodiments, the exogenous nucleic acid encodes a polypeptide secreted by the engineered cell (i.e., a soluble polypeptide). In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the exogenous nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an enzyme. In some embodiments, the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the exogenous nucleic acid encodes a fusion protein.

[0110] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, the modification comprising at least one nucleotide of an exon within genomic coordinates chr16:10902662-chr16:10923285, the cells further have reduced or eliminated surface expression of HLA-A, and the cells further comprise an exogenous nucleic acid. In some embodiments, the engineered cells comprise a genetic modification in the HLA-A gene. In some embodiments, the engineered cells comprise a genetic modification that reduces expression of HLA-A protein on the surface of the engineered cells. In some embodiments, the exogenous nucleic acid encodes a targeting receptor expressed on the surface of the engineered cells. In some embodiments, the targeting receptor is a chimeric antigen receptor (CAR). In some embodiments, the targeting receptor is a universal CAR (UniCar). In some embodiments, the targeting receptor is a T cell receptor (TCR). In some embodiments, the targeting receptor is a WT1 TCR. In some embodiments, the targeting receptor is a hybrid CAR / TCR. In some embodiments, the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain and a subunit of a TCR). In some embodiments, the targeting receptor is a cytokine receptor. In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is a B cell receptor (BCR). In some embodiments, the exogenous nucleic acid encodes a polypeptide secreted by the engineered cell (i.e., a soluble polypeptide). In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the exogenous nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an enzyme. In some embodiments, the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the exogenous nucleic acid encodes a fusion protein.

[0111] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, the modification comprising at least one nucleotide of an exon within genomic coordinates chr16:10902662-chr16:10923285, and the cells further have reduced or eliminated expression of endogenous TCR proteins compared to unmodified cells. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, the modification comprising at least one nucleotide of an exon within genomic coordinates chr16:10902662-chr16:10923285, the cells further comprise an exogenous nucleic acid, and the engineered cells further have reduced or eliminated expression of endogenous TCR proteins compared to unmodified cells. In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, the modification comprising at least one nucleotide of an exon within genomic coordinates chr16:10902662-chr16:10923285, the cells further have reduced or eliminated surface expression of MHC class I, and the cells further have reduced or eliminated expression of endogenous TCR proteins compared to unmodified cells.

[0112] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, the modification comprising at least one nucleotide of an exon within genomic coordinates chr16:10902662-chr16:10923285, the cell further comprising an exogenous nucleic acid, the cell further has reduced or eliminated surface expression of MHC class I, and the cell further has reduced or eliminated expression of endogenous TCR proteins compared to unmodified cells. In some embodiments, the engineered cells have reduced or eliminated expression of TRAC protein compared to unmodified cells. In some embodiments, the engineered cells have reduced or eliminated expression of TRBC protein compared to unmodified cells. In some embodiments, the engineered cells comprise a genetic modification in the beta-2-microglobulin (B2M) gene. In some embodiments, the engineered cells comprise a genetic modification that reduces expression of MHC class I protein on the surface of the engineered cells. In some embodiments, the exogenous nucleic acid encodes a targeted receptor expressed on the surface of the engineered cell. In some embodiments, the targeted receptor is a chimeric antigen receptor (CAR). In some embodiments, the targeted receptor is a universal CAR (UniCar). In some embodiments, the targeted receptor is a T cell receptor (TCR). In some embodiments, the targeted receptor is a WT1 TCR. In some embodiments, the targeted receptor is a hybrid CAR / TCR. In some embodiments, the targeted receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain and a subunit of a TCR). In some embodiments, the targeted receptor is a cytokine receptor. In some embodiments, the targeted receptor is a chemokine receptor. In some embodiments, the targeted receptor is a B cell receptor (BCR). In some embodiments, the exogenous nucleic acid encodes a polypeptide secreted by the engineered cell (i.e., a soluble polypeptide). In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide.In some embodiments, the exogenous nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an enzyme. In some embodiments, the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the exogenous nucleic acid encodes a fusion protein.

[0113] In some embodiments, engineered cells are provided that comprise a genetic modification in the CIITA gene, wherein the engineered cells have reduced or eliminated surface expression of MHC class II compared to unmodified cells, the modification comprising at least one nucleotide of an exon within genomic coordinates chr16:10902662-chr16:10923285, and the cells further comprise an exogenous nucleic acid, wherein the cells further have reduced or eliminated surface expression of HLA-A, and wherein the cells further have reduced or eliminated expression of endogenous TCR proteins compared to unmodified cells. In some embodiments, the engineered cells have reduced or eliminated expression of TRAC protein compared to unmodified cells. In some embodiments, the engineered cells have reduced or eliminated expression of TRBC protein compared to unmodified cells. In some embodiments, the engineered cells comprise a genetic modification in the HLA-A gene. In some embodiments, the engineered cells comprise a genetic modification that reduces expression of HLA-A protein on the surface of the engineered cells. In some embodiments, the exogenous nucleic acid encodes a targeting receptor expressed on the surface of the engineered cells. In some embodiments, the targeting receptor is a chimeric antigen receptor (CAR). In some embodiments, the targeting receptor is a universal CAR (UniCar). In some embodiments, the targeting receptor is a T cell receptor (TCR). In some embodiments, the targeting receptor is a WT1 TCR. In some embodiments, the targeting receptor is a hybrid CAR / TCR. In some embodiments, the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain and a TCR subunit). In some embodiments, the targeting receptor is a cytokine receptor. In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is a B cell receptor (BCR). In some embodiments, the exogenous nucleic acid encodes a polypeptide secreted by the engineered cell (i.e., a soluble polypeptide). In some embodiments, the exogenous nucleic acid encodes a therapeutic polypeptide. In some embodiments, the exogenous nucleic acid encodes an antibody.In some embodiments, the exogenous nucleic acid encodes an enzyme. In some embodiments, the exogenous nucleic acid encodes a cytokine. In some embodiments, the exogenous nucleic acid encodes a chemokine. In some embodiments, the exogenous nucleic acid encodes a fusion protein.

[0114] The engineered cells can be any of the exemplary cell types disclosed herein. In some embodiments, the engineered cells are immune cells. In some embodiments, the engineered cells are hematopoietic stem cells (HSCs). In some embodiments, the engineered cells are induced pluripotent stem cells (iPSCs). In some embodiments, the engineered cells are monocytes, macrophages, mast cells, dendritic cells, or granulocytes. In some embodiments, the engineered cells are monocytes. In some embodiments, the engineered cells are macrophages. In some embodiments, the engineered cells are mast cells. In some embodiments, the engineered cells are dendritic cells.

[0115] In some embodiments, the engineered cells are granulocytes. In some embodiments, the engineered cells are lymphocytes. In some embodiments, the engineered cells are T cells. In some embodiments, the engineered cells are CD4+ T cells. In some embodiments, the engineered cells are CD8+ T cells. In some embodiments, the engineered cells are memory T cells. In some embodiments, the engineered cells are B cells. In some embodiments, the engineered cells are plasma B cells. In some embodiments, the engineered cells are memory B cells.

[0116] In some embodiments, the engineered cells are homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the HLA-B alleles are selected from the following HLA-B alleles: HLA-B*07:02, HLA-B*08:01, HLA-B*44:02, HLA-B*35:01, HLA-B*40:01, HLA-B*57:01, HLA-B*14:02, HLA-B*15:01, HLA-B*13:02, HLA-B*44:03, HLA-B*38:01, HLA-B*18:01, HLA-B*44:03, HLA-B*51:01, HLA-B*52:01, HLA-B*53:01, HLA-B*54:01, HLA-B*55:01, HLA-B*56:01, HLA-B*57:01, HLA-B*58:01, HLA-B*59:01, HLA-B*60:01, HLA-B*61:01, HLA-B*62:01, HLA-B*63:01, HLA-B*64:01, HLA-B*65:01, HLA-B*66:01, HLA-B*67:01, HLA-B*68:01, HLA-B*69:01, HLA-B*69:01, HLA-B*66:01, HLA-B*69 ... HLA-B*49:01, HLA-B*15:01, HLA-B*18:01, HLA-B*27:05, HLA-B*35:03, HLA-B*18:01, HLA-B*52:01, HLA-B*51:01, HLA-B*37:01, HLA-B*53:01, HLA-B*55:01, HLA-B*44:02, HLA-B*44:03, HLA-B*35:02, HLA-B*15:01, and HLA-B*40:02.

[0117] In some embodiments, the HLA-C alleles are the following HLA-C alleles: HLA-C*07:02, HLA-C*07:01, HLA-C*05:01, HLA-C*04:01, HLA-C*03:04, HLA-C*06:02, HLA-C*08:02, HLA-C*03:03, HLA-C*06:02, HLA-C*16:01, HLA-C*12:03, HLA-C*07:01, HLA-C*04:01, HLA-C*15 ... A-C*07:01, HLA-C*03:04, HLA-C*12:03, HLA-C*02:02, HLA-C*04:01, HLA-C*05:01, HLA-C*12:02, HLA-C*14:02, HLA-C*06:02, HLA-C*04:01, HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*04:01, HLA-C*04:01, and HLA-C*02:02.

[0118] In some embodiments, the HLA-B alleles are the following HLA-B alleles: HLA-B*07:02, HLA-B*08:01, HLA-B*44:02, HLA-B*35:01, HLA-B*40:01, HLA-B*57:01, HLA-B*14:02, HLA-B*15:01, HLA-B*13:02, HLA-B*44:03, HLA-B*38:01, HLA-B*18:01, HLA-B*44:03, HLA-B*51:01 , HLA-B*49:01, HLA-B*15:01, HLA-B*18:01, HLA-B*27:05, HLA-B*35:03, HLA-B*18:01, HLA-B*52:01, HLA-B*51:01, HLA-B Any one of *37:01, HLA-B*53:01, HLA-B*55:01, HLA-B*44:02, HLA-B*44:03, HLA-B*35:02, HLA-B*15:01, and HLA-B*40:02 The HLA-C alleles are selected from the following: HLA-C*07:02, HLA-C*07:01, HLA-C*05:01, HLA-C*04:01, HLA-C*03:04, HLA-C*06:02, HLA-C*08:02, HLA-C*03:03, HLA-C*06:02, HLA-C*16:01, HLA-C*12:03, HLA-C*07:01, HLA-C*04:01, HLA-C*15 ... *07:01, HLA-C*03:04, HLA-C*12:03, HLA-C*02:02, HLA-C*04:01, HLA-C*05:01, HLA-C*12:02, HLA-C*14:02, HLA-C*06:02, HLA-C*04:01, HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*04:01, HLA-C*04:01, and HLA-C*02:02.

[0119] In some embodiments, the engineered cells are homozygous for HLA-B and homozygous for HLA-C, and the HLA-B and HLA-C alleles are the following HLA-B and HLA-C alleles: HLA-B*07:02 and HLA-C*07:02, HLA-B*08:01 and HLA-C*07:01, HLA-B*44:02 and HLA-C*05:01, HLA-B*35:01 and HLA-C*04:01, HLA-B*40:01 and HLA-C*0 3:04, HLA-B*57:01 and HLA-C*06:02, HLA-B*14:02 and HLA-C*08:02, HLA-B*15:01 and HLA-C*03:03, HLA-B*13:02 and HLA-C*06:02, HLA -B*44:03 and HLA-C*16:01, HLA-B*38:01 and HLA-C*12:03, HLA-B*18:01 and HLA-C*07:01, HLA-B*44:03 and HLA-C*04:01, HLA-B*51:01 and and HLA-C*15:02, HLA-B*49:01 and HLA-C*07:01, HLA-B*15:01 and HLA-C*03:04, HLA-B*18:01 and HLA-C*12:03, HLA-B*27:05 and HLA-C*0 2:02, HLA-B*35:03 and HLA-C*04:01, HLA-B*18:01 and HLA-C*05:01, HLA-B*52:01 and HLA-C*12:02, HLA-B*51:01 and HLA-C*14:02, HLA- In some embodiments, the HLA-B alleles are selected from any one of HLA-B*37:01 and HLA-C*06:02, HLA-B*53:01 and HLA-C*04:01, HLA-B*55:01 and HLA-C*03:03, HLA-B*44:02 and HLA-C*07:04, HLA-B*44:03 and HLA-C*07:01, HLA-B*35:02 and HLA-C*04:01, HLA-B*15:01 and HLA-C*04:01, and HLA-B*40:02 and HLA-C*02:02. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C, and the HLA-B and HLA-C alleles are HLA-B*07:02 and HLA-C*07:02.In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C, where the HLA-B and HLA-C alleles are HLA-B*08:01 and HLA-C*07:01. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C, where the HLA-B and HLA-C alleles are HLA-B*44:02 and HLA-C*05:01. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C, where the HLA-B and HLA-C alleles are HLA-B*35:01 and HLA-C*04:01.

[0120] In some embodiments, the present disclosure provides a pharmaceutical composition comprising any one of the engineered cells disclosed herein. In some embodiments, the pharmaceutical composition comprises a population of any one of the engineered cells disclosed herein. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 65% negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 70% negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 80% negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 90% negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 91% negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 92% negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 93% negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 94% negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 95% endogenous TCR protein negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 97% endogenous TCR protein negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 98% endogenous TCR protein negative as measured by flow cytometry. In some embodiments, the pharmaceutical composition comprises an engineered cell population that is at least 99% endogenous TCR protein negative as measured by flow cytometry.

[0121] In some embodiments, methods are provided for administering the engineered cells or pharmaceutical compositions disclosed herein to a subject in need thereof. In some embodiments, methods are provided for administering the engineered cells or pharmaceutical compositions disclosed herein to a subject as an ACT therapy. In some embodiments, methods are provided for administering the engineered cells or pharmaceutical compositions disclosed herein to a subject as a treatment for cancer. In some embodiments, methods are provided for administering the engineered cells or pharmaceutical compositions disclosed herein to a subject as a treatment for autoimmune disease. In some embodiments, methods are provided for administering the engineered cells or pharmaceutical compositions disclosed herein to a subject as a treatment for infectious disease.

[0122] B. Methods and Compositions for Reducing or Eliminating Surface Expression of MHC Class II The present disclosure provides methods and compositions for reducing or eliminating surface expression of MHC class II proteins on cells compared to unmodified cells by genetically modifying the CIITA gene. The resulting genetically modified cells may also be referred to herein as engineered cells. In some embodiments, already genetically modified (or engineered) cells may be starting cells for further genetic modification using the methods or compositions provided herein. In some embodiments, the cells are allogeneic cells. In some embodiments, cells with reduced MHC class II expression are useful for adoptive cell transfer therapy. In some embodiments, editing of the CIITA gene is combined with additional genetic modifications to produce desirable cells for allogeneic transplantation purposes.

[0123] In some embodiments, a method comprises reducing or eliminating surface expression of an MHC class II protein on the surface of a cell, comprising contacting the cell with a composition comprising a CIITA guide RNA comprising: i) a guide sequence selected from SEQ ID NOs: 1-117; ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-117; ii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-117; iv) a sequence comprising 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 2; v) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence from (iv); or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v). In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding the RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent is Cas9. In some embodiments, the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the CIITA guide RNA is an S. pyogenes Cas9 guide RNA. In some embodiments, the RNA-guided DNA binder further comprises a deaminase domain. In some embodiments, the RNA-guided DNA binder comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase. In some embodiments, the expression of MHC class II proteins on the surface of the cell (i.e., the engineered cell) is thereby reduced.

[0124] In some embodiments, a method comprises generating engineered cells having reduced or eliminated surface expression of MHC class II proteins compared to unmodified cells, comprising contacting the cells with a composition comprising a CIITA guide RNA comprising: i) a guide sequence selected from SEQ ID NOs: 1-117; ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-117; ii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-117; iv) a sequence comprising 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 2; v) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence from (iv); or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v). In some embodiments, the method further comprises contacting the cells with an RNA-guided DNA binding agent, or a nucleic acid encoding the RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent is Cas9. In some embodiments, the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the CIITA guide RNA is S. pyogenes Cas9 guide RNA. In some embodiments, the RNA-guided DNA binding agent further comprises a deaminase domain. In some embodiments, the RNA-guided DNA binding agent comprises APOBEC3A deaminase (A3A) and an RNA-guided nickase. In some embodiments, expression of MHC class II proteins on the surface of the cell (i.e., the engineered cell) is thereby reduced.

[0125] In some embodiments, a method comprises genetically modifying a cell to reduce or eliminate surface expression of an MHC class II protein, comprising contacting the cell with a composition comprising a CIITA guide RNA comprising: i) a guide sequence selected from SEQ ID NOs: 1-117; ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-117; ii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-117; iv) a sequence comprising 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 2; v) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence from (iv); or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v). In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA binding agent or a nucleic acid encoding the RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent is Cas9. In some embodiments, the RNA-guided DNA binding agent is S. pyogenes Cas9. In some embodiments, the CIITA guide RNA is an S. pyogenes Cas9 guide RNA. In some embodiments, the RNA-guided DNA binder further comprises a deaminase domain. In some embodiments, the RNA-guided DNA binder comprises an APOBEC3A deaminase (A3A) and an RNA-guided nickase. In some embodiments, the expression of MHC class II proteins on the surface of the cell (i.e., the engineered cell) is thereby reduced.

[0126] In some embodiments, the method for reducing expression of an MHC class II protein on the surface of a cell comprises contacting the cell with any one or more of the CIITA guide RNAs disclosed herein. In some embodiments, the CIITA guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-117.

[0127] In some embodiments, a composition is provided comprising a CIITA guide RNA comprising: i) a guide sequence selected from SEQ ID NOs: 1-117; ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-117; ii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-117; iv) a sequence comprising 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 2; v) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence from (iv); or vi) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v). In some embodiments, the composition further comprises an RNA-guided DNA binder, or a nucleic acid encoding the RNA-guided DNA binder. In some embodiments, the composition comprises an RNA-guided DNA binder that is Cas9. In some embodiments, the RNA-guided DNA binder is S. pyogenes Cas9. In some embodiments, the CIITA guide RNA is an S. pyogenes Cas9 guide RNA. In some embodiments, the RNA-guided DNA binding agent further comprises a deaminase domain, hi some embodiments, the RNA-guided DNA binding agent comprises APOBEC3A deaminase (A3A) and an RNA-guided nickase.

[0128] In any of the foregoing embodiments, the guide sequence is selected from SEQ ID NOs: 32, 64, 67, 68, 74, 76, 84, 86, 90, 91, and 115; ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 32, 64, 67, 68, 74, 76, 84, 86, 90, 91, and 115; ii) a guide sequence at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 32, 64, 67, 68, 74, 76, 84, 86, 90, 91, and 115.

[0129] In some embodiments, the composition further comprises a uracil glycosylase inhibitor (UGI). In some embodiments, the composition comprises an RNA-guided DNA binder, wherein the RNA-guided DNA binder generates a cytosine (C) to thymine (T) conversion with the CIITA genomic target sequence. In some embodiments, the composition comprises an RNA-guided DNA binder, wherein the RNA-guided DNA binder generates an adenosine (A) to guanine (G) conversion with the CIITA genomic target sequence.

[0130] In some embodiments, engineered cells are provided that are produced by the methods described herein. In some embodiments, the engineered cells that are produced by the methods and compositions described herein are allogeneic cells. In some embodiments, the methods produce compositions comprising engineered cells that have reduced MHC class II expression. In some embodiments, the methods produce compositions comprising engineered cells that have reduced CIITA protein expression. In some embodiments, the methods produce compositions comprising engineered cells that have reduced CIITA levels in the cell nucleus. In some embodiments, the methods produce compositions comprising engineered cells that express a truncated form of CIITA protein. In some embodiments, the methods produce compositions comprising engineered cells that do not produce detectable CIITA protein. In some embodiments, the engineered cells have reduced MHC class II expression, reduced CIITA protein, and / or reduced CIITA levels in the cell nucleus compared to unmodified cells. In some embodiments, the engineered cells produced by the methods disclosed herein elicit a reduced response from CD4+ T cells compared to unmodified cells, as measured in an in vitro cell culture assay containing CD4+ T cells.

[0131] In some embodiments, the compositions disclosed herein further comprise a pharmaceutically acceptable carrier. In some embodiments, cells produced by the compositions disclosed herein are provided, the cells comprising the pharmaceutically acceptable carrier. In some embodiments, compositions are provided, the cells comprising the cells disclosed herein.

[0132] 1.CIITA guide RNA The methods and compositions provided herein disclose CIITA guide RNAs useful for reducing the expression of MHC class II proteins on the surface of cells. In some embodiments, such guide RNAs direct an RNA-guided DNA binder to a CIITA genomic target sequence and may be referred to herein as "CIITA guide RNAs." In some embodiments, the CIITA guide RNA directs an RNA-guided DNA binder to a human CIITA genomic target sequence. In some embodiments, the CIITA guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-117.

[0133] In some embodiments, compositions are provided comprising a CIITA guide RNA as described herein and an RNA-guided DNA binder, or a nucleic acid encoding the RNA-guided DNA binder.

[0134] In some embodiments, a CIITA single guide RNA (sgRNA) is provided that comprises a guide sequence selected from SEQ ID NOs: 1 to 117. In some embodiments, a composition is provided that comprises a CIITA single guide RNA (sgRNA) that comprises a guide sequence selected from SEQ ID NOs: 1 to 117. In some embodiments, a composition is provided that comprises a CIITA sgRNA described herein and an RNA-guided DNA binder, or a nucleic acid encoding an RNA-guided DNA binder.

[0135] In some embodiments, a CIITA dual guide RNA (dgRNA) is provided that comprises a guide sequence selected from SEQ ID NOs: 1 to 117. In some embodiments, a composition is provided that comprises a CIITA dual guide RNA (dgRNA) that comprises a guide sequence selected from SEQ ID NOs: 1 to 117. In some embodiments, a composition is provided that comprises a CIITA dgRNA described herein and an RNA-guided DNA binding agent, or a nucleic acid encoding an RNA-guided DNA binding agent.

[0136] Exemplary CIITA guide sequences are shown in Table 2 below (SEQ ID NOs: 1-117 with corresponding guide RNA sequences of SEQ ID NOs: 218-334 and 335-426).

[0137] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9]

Table 2-10

Table 2-11

Table 2-12

Table 2-13

Table 2-14

Table 2-15

Table 2-16

Table 2-17

Table 2-18

Table 2-19

Table 2-20

Table 2-21

Table 2-22

Table 2-23

[0138] The terms "mA," "mC," "mU," or "mG" may be used to refer to 2'-O-Me modified nucleotides.

[0139] In some embodiments, the CIITA guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-117. In some embodiments, the CIITA guide RNA comprises a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-117. In some embodiments, the CIITA guide RNA comprises a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-117. In some embodiments, the CIITA guide RNA comprises a guide sequence that is at least 95% identical to a sequence selected from SEQ ID NOs: 1-117. In some embodiments disclosed herein, the guide sequence is (i) a guide sequence of SEQ ID NO: 32, 64, 67, 68, 74, 76, 84, 86, 90, 91, or 115; ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NO: 32, 64, 67, 68, 74, 76, 84, 86, 90, 91, and 115; ii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NO: 32, 64, 67, 68, 74, 76, 84, 86, 90, 91, and 115.

[0140] In some embodiments, the CIITA guide RNA comprises a guide sequence that includes at least 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 2. As used herein, at least 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate means, for example, at least 10 contiguous nucleotides within a genomic coordinate that includes 10 nucleotides in the 5' direction and 10 nucleotides in the 3' direction from the range listed in Table 2. For example, the CIITA guide RNA may include 10 contiguous nucleotides within genomic coordinate chr16:10877360-10877380 or chr16:10877350-10877390 (inclusive of the boundary nucleotides of these ranges). In some embodiments, the CIITA guide RNA comprises a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of a sequence that includes 10 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 2. In some embodiments, the CIITA guide RNA comprises a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from a sequence that is 17, 18, 19, or 20 contiguous nucleotides of a sequence comprising 10 contiguous nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 2.

[0141] In some embodiments, the CIITA guide RNA comprises a guide sequence comprising at least 15 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 2. In some embodiments, the CIITA guide RNA comprises a guide sequence comprising at least 20 contiguous nucleotides ± 10 nucleotides of a genomic coordinate listed in Table 2.

[0142] In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 1. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 2. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 3. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 4. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 5. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 6. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 7. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 8. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 9. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 10. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 11. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 12. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 13. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 14. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 15. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 16. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 17. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 18. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 19. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 20. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 21. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 22. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 23. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 24. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 25. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 26. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 27. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 28.In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 29. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 30. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 31. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 32. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 33. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 34. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 35. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 36. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 37. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 38. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 39. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 40. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 41. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 42. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 43. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 44. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 45. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 46. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 47. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 48. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 49. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 50. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 51. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 52. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 53. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 54. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 55. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 56.In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 57. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 58. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 59. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 60. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 61. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 62. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 63. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 64. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 65. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 66. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 67. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 68. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 69. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 70. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 71. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 72. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 73. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 74. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 75. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 76. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 77. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 78. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 79. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 80. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 81. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 82. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 83. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 84.In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 85. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 86. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 87. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 88. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 89. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 90. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 91. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 92. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 93. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 94. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 95. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 96. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 97. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 98. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 99. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 100. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 101. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 102. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 103. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 104. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 105. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 106. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 107. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 108. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 109. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 110. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 111. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 112.In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 113. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 114. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 115. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 116. In some embodiments, the CIITA guide RNA comprises SEQ ID NO: 117.

[0143] For example, additional embodiments of CIITA guide RNAs are provided herein, including exemplary modifications to the guide RNA.

[0144] 2. Genetic modification for CIITA In some embodiments, the methods and compositions disclosed herein genetically modify at least one nucleotide of an exon in the CIITA gene in a cell. Because the CIITA protein regulates MHC class II expression, in some embodiments, genetic modifications to CIITA alter production of the CIITA protein, thereby reducing the expression of MHC class II protein on the surface of the genetically modified cell (or engineered cell). Genetic modifications include a set of modifications resulting from contact with a gene editing system (e.g., a set of edits resulting from Cas9 and a CIITA guide RNA, or a set of edits resulting from BC22 and a CIITA guide RNA).

[0145] In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10902662-chr16:10923285. In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10906542-chr16:10923285. In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10906542-chr16:10908121. In some embodiments, the genetic modifications are chr16:10916432-10916452, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10906985-10907005, chr16:10908073-10908093, chr16:10907433-10907453, chr16:10907979-10907999, chr 16:10907139-10907159, chr16:10922435-10922455, chr16:10907384-10907404, chr16:10907434-10907454, chr r16:10907119-10907139, chr16:10907539-10907559, chr16:10907810-10907830, chr16:10907315-10907335, chr r16:10916426-10916446, chr16:10909138-10909158, chr16:10908101-10908121, chr16:10907790-10907810, c hr16:10907787-10907807, chr16:10907454-10907474, chr16:10895702-10895722, chr16:10902729-10902749, c hr16:10918492-10918512, chr16:10907932-10907952, chr16:10907623-10907643, chr16:10907461-10907481, chr16:10902723-10902743, chr16:10907622-10907642, chr16:10922441-10922461, chr16:10902662-10902682,and at least one nucleotide of the exon within genomic coordinates selected from chr16:10915626-10915646, chr16:10915592-10915612, chr16:10907385-10907405, chr16:10907030-10907050, chr16:10907935-10907955, chr16:10906853-10906873, chr16:10906757-10906777, chr16:10907730-10907750, and chr16:10895302-10895322. In some embodiments, the genetic modifications are chr16:10907539-10907559, chr16:10916426-10916446, chr16:10906907-10906927, chr16:10895702-10895722, chr16:10907757-10907777, chr16:10907623-109076 43, comprising at least one nucleotide of an exon within genomic coordinates selected from chr16:10915626-10915646, chr16:10906756-10906776, chr16:10907476-10907496, chr16:10907385-10907405, and chr16:10923265-10923285. In some embodiments, the genetic modifications are chr16:10906853-10906873, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10907315-10907335, chr16:10916432-10916452, chr16:10907932-10907952, chr16:10915626-10915646, chr16:109 In some embodiments, the genetic modification comprises at least one nucleotide of an exon within a genomic coordinate selected from: 07586-10907606, chr16:10916426-10916446, chr16:10907476-10907496, chr16:10907787-10907807, chr16:10907979-10907999, chr16:10906904-10906924, and chr16:10909138-10909158.chr16:10895702-10895722, chr16:10916432-10916452, chr16:10907623-10907643, chr16:109 07932-10907952, chr16:10906985-10907005, chr16:10915626-10915646, chr16:10907539-1090 and at least one nucleotide of the exon within genomic coordinates selected from chr16:10907979-10907999, chr16:10909138-10909158, chr16:10916426-10916446, chr16:10907476-10907496, chr16:10907119-10907139, chr16:10907979-10907999, and chr16:10909138-10909158. In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates selected from chr16:10906853-10906873, chr16:10906757-10906777, chr16:10895302-10895322, chr16:10907539-10907559, chr16:10907730-10907750, and chr16:10895702-10895722. In some embodiments, the genetic modification comprises at least one nucleotide of an exon within a genomic coordinate selected from chr16:10906853-10906873, chr16:10922444-10922464, chr16:10916432-10916452. In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10906853-10906873. In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10922444-10922464. In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10906757-10906777. In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10916432-10916452. In some embodiments, the genetic modification comprises:In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10895302-10895322. In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10907539-10907559. In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10907730-10907750. In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10895702-10895722. In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10907932-10907952. In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10907476-10907496. In some embodiments, the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10909138-10909158.

[0146] In some embodiments, the genetic modifications are chr16:10902662-10902682, chr16:10902723-10902743, chr16:10902729-10902749, chr16:10903747-10903767, chr16:10903824-10903844, chr16:10903848-10903868, chr16:10904761-10904781, chr16:10904764-10904784, chr16:10904765-10904785, chr16:109 04785-10904805, chr16:10906542-10906562, chr16:10906556-1090657 6, chr16:10906609-10906629, chr16:10906610-10906630, chr16:10906 616-10906636, chr16:10906682-10906702, chr16:10906756-10906776, chr16:10906757-10906777, chr16:10906821-10906841, chr16:10906823 -10906843, chr16:10906847-10906867, chr16:10906848-10906868, chr 16:10906853-10906873, chr16:10906853-10906873, chr16:10906904-1 0906924, chr16:10906907-10906927, chr16:10906913-10906933, chr16 :10906968-10906988, chr16:10906970-10906990, chr16:10906985-1090 7005, chr16:10907030-10907050, chr16:10907058-10907078, chr16:10 907119-10907139, chr16:10907139-10907159, chr16:10907172-109071 92, chr16:10907272-10907292, chr16:10907288-10907308, chr16:1090 7314-10907334, chr16:10907315-10907335, chr16:10907325-10907345,chr16:10907363-10907383、chr16:10907384-10907404、chr16:1090738 5-10907405、chr16:10907433-10907453、chr16:10907434-10907454、chr 16:10907435-10907455、chr16:10907441-10907461、chr16:10907454-10907474、chr16:10907461-10907481、chr16:10907476-10907496、chr16: 10907539-10907559、chr16:10907586-10907606、chr16:10907589-10907609、chr16:10907621-10907641、chr16:10907622-10907642、chr16:109 07623-10907643、chr16:10907730-10907750、chr16:10907731-10907751、chr16:10907757-10907777、chr16:10907781-10907801、chr16:109077 87-10907807、chr16:10907790-10907810、chr16:10907810-10907830、chr16:10907820-10907840、chr16:10907870-10907890、chr16:10907886- 10907906、chr16:10907924-10907944、chr16:10907928-10907948、chr16:10907932-10907952、chr16:10907935-10907955、chr16:10907978-109 07998、chr16:10907979-10907999、chr16:10908069-10908089、chr16:10908073-10908093、chr16:10908101-10908121、chr16:10909056-109090 76、chr16:10909138-10909158、chr16:10910195-10910215、chr16:10910196-10910216、chr16:10915592-10915612、chr16:10915626-10915646、chr16:10916375-10916395, chr16:10916382-10916402, chr16:10916426-10916446, chr16:10916432-10916452, chr16:1091848 6-10918506, chr16:10918492-10918512, chr16:10918493-10918513, chr16:10922435-10922455, chr16:10922441-10922461, chr and at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 consecutive nucleotides within genomic coordinates selected from chr16:10922441-10922461, chr16:10922444-10922464, chr16:10922460-10922480, chr16:10923257-10923277, and chr16:10923265-10923285. In some embodiments, the genetic modifications are chr16:10916432-10916452, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10906985-10907005, chr16:10908073-109080 93, chr16:10907433-10907453, chr16:10907979-10907999, chr16:10907139-10 907159, chr16:10922435-10922455, chr16:10907384-10907404, chr16:10907434 -10907454, chr16:10907119-10907139, chr16:10907539-10907559, chr16:1090 7810-10907830, chr16:10907315-10907335, chr16:10916426-10916446, chr16:1 0909138-10909158, chr16:10908101-10908121, chr16:10907790-10907810, chr 16:10907787-10907807, chr16:10907454-10907474, chr16:10895702-10895722,chr16:10902729-10902749, chr16:10918492-10918512, chr16:10907932-109 07952, chr16:10907623-10907643, chr16:10907461-10907481, chr16:1090272 3-10902743, chr16:10907622-10907642, chr16:10922441-10922461, chr16:10 902662-10902682, chr16:10915626-10915646, chr16:10915592-10915612, chr 16:10907385-10907405, chr16:10907030-10907050, chr16:10907935-10907955, chr16:10906853-10906873, chr16:10906757-10906777, chr16:10907730-10907750, and chr16:10895302-10895322. In some embodiments, the genetic modifications are chr16:10907539-10907559, chr16:10916426-10916446, chr16:10906907-10906927, chr16:10895702-10895722, chr16:10907757-10907777, chr16:10907623-10907643, chr16:10915626-10915646, chr16:1 In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon within genomic coordinates selected from chr16:10906756-10906776, chr16:10907476-10907496, chr16:10907385-10907405, and chr16:10923265-10923285. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon within genomic coordinates selected from chr16:10906853-10906873, chr16:10922444-10922464,chr16:10907924-10907944, chr16:10907315-10907335, chr16:10916432-10916452, chr16:10907932-10907952, chr r16:10915626-10915646, chr16:10907586-10907606, chr16:10916426-10916446, chr16:10907476-10907496, chr16 :10907787-10907807, chr16:10907979-10907999, chr16:10906904-10906924, and chr16:10909138-10909158, comprising at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon within genomic coordinates selected from chr16:10907787-10907807, chr16:10907979-10907999, chr16:10906904-10906924, and chr16:10909138-10909158. In some embodiments, the genetic modifications are chr16:10895702-10895722, chr16:10916432-10916452, chr16:10907623-10907643, chr16:10907932-10907952, chr16:10906985-10907005, chr16:10915626-10915646, chr16:10907539-10907559, chr16:10916426-1091 and at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten nucleotides of an exon within genomic coordinates selected from chr16:10907476-10907496, chr16:10907119-10907139, chr16:10907979-10907999, and chr16:10909138-10909158. In some embodiments, the genetic modification comprises at least two exons within genomic coordinates selected from chr16:10906853-10906873, chr16:10906757-10906777, chr16:10895302-10895322, chr16:10907539-10907559, chr16:10907730-10907750, and chr16:10895702-10895722;In some embodiments, the genetic modification comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides within a genomic coordinate selected from chr16:10906853-10906873, chr16:10922444-10922464, chr16:10916432-10916452, The genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon within genomic coordinates chr16:10906853-10906873. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon within genomic coordinates chr16:10922444-10922464. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon within genomic coordinates chr16:10906757-10906777. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon within genomic coordinates chr16:10916432-10916452. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon within genomic coordinates chr16:10895302-10895322. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon within genomic coordinates chr16:10907539-10907559.In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon within genomic coordinates chr16:10907730-10907750. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon within genomic coordinates chr16:10895702-10895722. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon within genomic coordinates chr16:10907932-10907952. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon within genomic coordinates chr16:10907476-10907496. In some embodiments, the genetic modification comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 nucleotides of an exon within genomic coordinates chr16:10909138-10909158.

[0147] In some embodiments, the genetic modifications are chr16:10902662-10902682, chr16:10902723-10902743, chr16:10902729-10902749, chr16:10903747-10903767, chr16:10903824-10903844, chr16:10903848-10903868, chr16:10904761-10904781, chr16:10904764-10904784, chr16:10904765-10904785, chr16:109 04785-10904805, chr16:10906542-10906562, chr16:10906556-1090657 6, chr16:10906609-10906629, chr16:10906610-10906630, chr16:10906 616-10906636, chr16:10906682-10906702, chr16:10906756-10906776, chr16:10906757-10906777, chr16:10906821-10906841, chr16:10906823 -10906843, chr16:10906847-10906867, chr16:10906848-10906868, chr 16:10906853-10906873, chr16:10906853-10906873, chr16:10906904-1 0906924, chr16:10906907-10906927, chr16:10906913-10906933, chr16 :10906968-10906988, chr16:10906970-10906990, chr16:10906985-1090 7005, chr16:10907030-10907050, chr16:10907058-10907078, chr16:10 907119-10907139, chr16:10907139-10907159, chr16:10907172-109071 92, chr16:10907272-10907292, chr16:10907288-10907308, chr16:1090 7314-10907334, chr16:10907315-10907335, chr16:10907325-10907345,chr16:10907363-10907383、chr16:10907384-10907404、chr16:1090738 5-10907405、chr16:10907433-10907453、chr16:10907434-10907454、chr 16:10907435-10907455、chr16:10907441-10907461、chr16:10907454-10907474、chr16:10907461-10907481、chr16:10907476-10907496、chr16: 10907539-10907559、chr16:10907586-10907606、chr16:10907589-10907609、chr16:10907621-10907641、chr16:10907622-10907642、chr16:109 07623-10907643、chr16:10907730-10907750、chr16:10907731-10907751、chr16:10907757-10907777、chr16:10907781-10907801、chr16:109077 87-10907807、chr16:10907790-10907810、chr16:10907810-10907830、chr16:10907820-10907840、chr16:10907870-10907890、chr16:10907886- 10907906、chr16:10907924-10907944、chr16:10907928-10907948、chr16:10907932-10907952、chr16:10907935-10907955、chr16:10907978-109 07998、chr16:10907979-10907999、chr16:10908069-10908089、chr16:10908073-10908093、chr16:10908101-10908121、chr16:10909056-109090 76、chr16:10909138-10909158、chr16:10910195-10910215、chr16:10910196-10910216、chr16:10915592-10915612、chr16:10915626-10915646、chr16:10916375-10916395, chr16:10916382-10916402, chr16:10916426-10916446, chr16:10916432-10916 452, chr16:10918486-10918506, chr16:10918492-10918512, chr16:10918493-10918513, chr16:10922435-10 and comprising at least five consecutive nucleotides within genomic coordinates selected from chr16:10922441-10922461, chr16:10922441-10922461, chr16:10922444-10922464, chr16:10922460-10922480, chr16:10923257-10923277, and chr16:10923265-10923285. In some embodiments, the genetic modifications are chr16:10916432-10916452, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10906985-10907005, chr16:10908073-10908093, chr16:10907433- 10907453, chr16:10907979-10907999, chr16:10907139-10907159, chr16:10922435-10922 455, chr16:10907384-10907404, chr16:10907434-10907454, chr16:10907119-10907139, ch r16:10907539-10907559, chr16:10907810-10907830, chr16:10907315-10907335, chr16:1 0916426-10916446, chr16:10909138-10909158, chr16:10908101-10908121, chr16:1090779 0-10907810, chr16:10907787-10907807, chr16:10907454-10907474, chr16:10895702-108 95722, chr16:10902729-10902749, chr16:10918492-10918512, chr16:10907932-10907952,chr16:10907623-10907643, chr16:10907461-10907481, chr16:10902723-10902743, chr16:10907622-10907642, chr r16:10922441-10922461, chr16:10902662-10902682, chr16:10915626-10915646, chr16:10915592-10915612, chr16 :10907385-10907405, chr16:10907030-10907050, chr16:10907935-10907955, chr16:10906853-10906873, chr16:10906757-10906777, chr16:10907730-10907750, and chr16:10895302-10895322. In some embodiments, the genetic modifications are chr16:10907539-10907559, chr16:10916426-10916446, chr16:10906907-10906927, chr16:10895702-10895722, chr16:10907757-10907777, chr16:10907623-109076 43, comprising at least 5 nucleotides of an exon within genomic coordinates selected from chr16:10915626-10915646, chr16:10906756-10906776, chr16:10907476-10907496, chr16:10907385-10907405, and chr16:10923265-10923285. In some embodiments, the genetic modifications are chr16:10906853-10906873, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10907315-10907335, chr16:10916432-10916452, ch r16:10907932-10907952, chr16:10915626-10915646, chr16:10907586-10907606, c hr16:10916426-10916446, chr16:10907476-10907496, chr16:10907787-10907807,In some embodiments, the genetic modification comprises at least 5 nucleotides of an exon within genomic coordinates selected from chr16:10907979-10907999, chr16:10906904-10906924, and chr16:10909138-10909158. In some embodiments, the genetic modification comprises at least 5 nucleotides of an exon within genomic coordinates selected from chr16:10895702-10895722, chr16:10916432-10916452, chr16:10907623-10907643, chr16:10907932-10907952, chr16:10906985-10907005, chr16:10915626-10915646, chr16:109 and comprising at least 5 nucleotides of the exon within genomic coordinates selected from chr16:10907476-10907496, chr16:10907119-10907139, chr16:10907979-10907999, and chr16:10909138-10909158. In some embodiments, the genetic modification comprises at least 5 nucleotides of an exon within genomic coordinates selected from chr16:10906853-10906873, chr16:10906757-10906777, chr16:10895302-10895322, chr16:10907539-10907559, chr16:10907730-10907750, and chr16:10895702-10895722. In some embodiments, the genetic modification comprises at least 5 nucleotides of an exon within a genomic coordinate selected from chr16:10906853-10906873, chr16:10922444-10922464, chr16:10916432-10916452. In some embodiments, the genetic modification comprises at least 5 nucleotides of an exon within genomic coordinates chr16:10906853-10906873. In some embodiments, the genetic modification comprises at least 5 nucleotides of an exon within genomic coordinates chr16:10922444-10922464. In some embodiments, the genetic modification comprises at least 5 nucleotides of an exon within genomic coordinates chr16:10922444-10922464. In some embodiments, the genetic modification comprisesIn some embodiments, the genetic modification comprises at least 5 nucleotides of an exon within genomic coordinates chr16:10906757-10906777. In some embodiments, the genetic modification comprises at least 5 nucleotides of an exon within genomic coordinates chr16:10916432-10916452. In some embodiments, the genetic modification comprises at least 5 nucleotides of an exon within genomic coordinates chr16:10895302-10895322. In some embodiments, the genetic modification comprises at least 5 nucleotides of an exon within genomic coordinates c, In some embodiments, the genetic modification comprises at least five nucleotides of an exon within genomic coordinates chr16:10907539-10907559. In some embodiments, the genetic modification comprises at least five nucleotides of an exon within genomic coordinates chr16:10907730-10907750. In some embodiments, the genetic modification comprises at least five nucleotides of an exon within genomic coordinates chr16:10895702-10895722. In some embodiments, the genetic modification comprises at least five nucleotides of an exon within genomic coordinates chr16:10907932-10907952. In some embodiments, the genetic modification comprises at least five nucleotides of an exon within genomic coordinates chr16:10907476-10907496. In some embodiments, the genetic modification comprises at least five nucleotides of an exon within genomic coordinates chr16:10909138-10909158.

[0148] In some embodiments, the genetic modifications are chr16:10902662-10902682, chr16:10902723-10902743, chr16:10902729-10902749, chr16:10903747-10903767, chr16:10903824-10903844, chr16:10903848-10903868, chr16:10904761-10904781, chr16:10904764-10904784, chr16:10904765-10904785, chr16:109 04785-10904805, chr16:10906542-10906562, chr16:10906556-1090657 6, chr16:10906609-10906629, chr16:10906610-10906630, chr16:10906 616-10906636, chr16:10906682-10906702, chr16:10906756-10906776, chr16:10906757-10906777, chr16:10906821-10906841, chr16:10906823 -10906843, chr16:10906847-10906867, chr16:10906848-10906868, chr 16:10906853-10906873, chr16:10906853-10906873, chr16:10906904-1 0906924, chr16:10906907-10906927, chr16:10906913-10906933, chr16 :10906968-10906988, chr16:10906970-10906990, chr16:10906985-1090 7005, chr16:10907030-10907050, chr16:10907058-10907078, chr16:10 907119-10907139, chr16:10907139-10907159, chr16:10907172-109071 92, chr16:10907272-10907292, chr16:10907288-10907308, chr16:1090 7314-10907334, chr16:10907315-10907335, chr16:10907325-10907345,chr16:10907363-10907383、chr16:10907384-10907404、chr16:1090738 5-10907405、chr16:10907433-10907453、chr16:10907434-10907454、chr 16:10907435-10907455、chr16:10907441-10907461、chr16:10907454-10907474、chr16:10907461-10907481、chr16:10907476-10907496、chr16: 10907539-10907559、chr16:10907586-10907606、chr16:10907589-10907609、chr16:10907621-10907641、chr16:10907622-10907642、chr16:109 07623-10907643、chr16:10907730-10907750、chr16:10907731-10907751、chr16:10907757-10907777、chr16:10907781-10907801、chr16:109077 87-10907807、chr16:10907790-10907810、chr16:10907810-10907830、chr16:10907820-10907840、chr16:10907870-10907890、chr16:10907886- 10907906、chr16:10907924-10907944、chr16:10907928-10907948、chr16:10907932-10907952、chr16:10907935-10907955、chr16:10907978-109 07998、chr16:10907979-10907999、chr16:10908069-10908089、chr16:10908073-10908093、chr16:10908101-10908121、chr16:10909056-109090 76、chr16:10909138-10909158、chr16:10910195-10910215、chr16:10910196-10910216、chr16:10915592-10915612、chr16:10915626-10915646、chr16:10916375-10916395, chr16:10916382-10916402, chr16:10916426-10916446, chr16:10916432-109164 52, chr16:10918486-10918506, chr16:10918492-10918512, chr16:10918493-10918513, chr16:10922435-109 and comprising at least 10 consecutive nucleotides within genomic coordinates selected from chr16:10922441-10922461, chr16:10922441-10922461, chr16:10922444-10922464, chr16:10922460-10922480, chr16:10923257-10923277, and chr16:10923265-10923285. In some embodiments, the genetic modifications are chr16:10916432-10916452, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10906985-10907005, chr16:10908073-10908093, chr16:10907433- 10907453, chr16:10907979-10907999, chr16:10907139-10907159, chr16:10922435-10922 455, chr16:10907384-10907404, chr16:10907434-10907454, chr16:10907119-10907139, ch r16:10907539-10907559, chr16:10907810-10907830, chr16:10907315-10907335, chr16:1 0916426-10916446, chr16:10909138-10909158, chr16:10908101-10908121, chr16:1090779 0-10907810, chr16:10907787-10907807, chr16:10907454-10907474, chr16:10895702-108 95722, chr16:10902729-10902749, chr16:10918492-10918512, chr16:10907932-10907952,chr16:10907623-10907643, chr16:10907461-10907481, chr16:10902723-10902743, chr16:10907622-10907642, chr 16:10922441-10922461, chr16:10902662-10902682, chr16:10915626-10915646, chr16:10915592-10915612, chr16: and comprising at least 10 consecutive nucleotides within genomic coordinates selected from chr16:10907385-10907405, chr16:10907030-10907050, chr16:10907935-10907955, chr16:10906853-10906873, chr16:10906757-10906777, chr16:10907730-10907750, and chr16:10895302-10895322. In some embodiments, the genetic modifications are chr16:10907539-10907559, chr16:10916426-10916446, chr16:10906907-10906927, chr16:10895702-10895722, chr16:10907757-10907777, chr16:10907623-1090764 3, comprising at least 10 nucleotides of an exon within genomic coordinates selected from chr16:10915626-10915646, chr16:10906756-10906776, chr16:10907476-10907496, chr16:10907385-10907405, and chr16:10923265-10923285. In some embodiments, the genetic modifications are chr16:10906853-10906873, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10907315-10907335, chr16:10916432-10916452, ch r16:10907932-10907952, chr16:10915626-10915646, chr16:10907586-10907606, c hr16:10916426-10916446, chr16:10907476-10907496, chr16:10907787-10907807,In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates selected from chr16:10907979-10907999, chr16:10906904-10906924, and chr16:10909138-10909158. In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates selected from chr16:10895702-10895722, chr16:10916432-10916452, chr16:10907623-10907643, chr16:10907932-10907952, chr16:10906985-10907005, chr16:10915626-10915646, chr16:1090 and comprising at least 10 nucleotides of the exon within genomic coordinates selected from chr16:10907559, chr16:10916426-10916446, chr16:10907476-10907496, chr16:10907119-10907139, chr16:10907979-10907999, and chr16:10909138-10909158. In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates selected from chr16:10906853-10906873, chr16:10906757-10906777, chr16:10895302-10895322, chr16:10907539-10907559, chr16:10907730-10907750, and chr16:10895702-10895722. In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates selected from chr16:10906853-10906873, chr16:10922444-10922464, and chr16:10916432-10916452. In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates chr16:10906853-10906873. In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates chr16:10922444-10922464. In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates chr16:10922444-10922464. In some embodiments, the genetic modification comprisesIn some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates chr16:10906757-10906777. In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates chr16:10916432-10916452. In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates chr16:10895302-10895322. In some embodiments, In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates chr16:10907539-10907559. In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates chr16:10907730-10907750. In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates chr16:10895702-10895722. In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates chr16:10907932-10907952. In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates chr16:10907476-10907496. In some embodiments, the genetic modification comprises at least 10 nucleotides of an exon within genomic coordinates chr16:10909138-10909158.

[0149] In some embodiments, the genetic modifications are chr16:10902662-10902682, chr16:10902723-10902743, chr16:10902729-10902749, chr16:10903747-10903767, chr16:10903824-10903844, chr16:10903848-10903868, chr16:10904761-10904781, chr16:10904764-10904784, chr16:10904765-10904785, chr16:109 04785-10904805, chr16:10906542-10906562, chr16:10906556-1090657 6, chr16:10906609-10906629, chr16:10906610-10906630, chr16:10906 616-10906636, chr16:10906682-10906702, chr16:10906756-10906776, chr16:10906757-10906777, chr16:10906821-10906841, chr16:10906823 -10906843, chr16:10906847-10906867, chr16:10906848-10906868, chr 16:10906853-10906873, chr16:10906853-10906873, chr16:10906904-1 0906924, chr16:10906907-10906927, chr16:10906913-10906933, chr16 :10906968-10906988, chr16:10906970-10906990, chr16:10906985-1090 7005, chr16:10907030-10907050, chr16:10907058-10907078, chr16:10 907119-10907139, chr16:10907139-10907159, chr16:10907172-109071 92, chr16:10907272-10907292, chr16:10907288-10907308, chr16:1090 7314-10907334, chr16:10907315-10907335, chr16:10907325-10907345,chr16:10907363-10907383、chr16:10907384-10907404、chr16:1090738 5-10907405、chr16:10907433-10907453、chr16:10907434-10907454、chr 16:10907435-10907455、chr16:10907441-10907461、chr16:10907454-10907474、chr16:10907461-10907481、chr16:10907476-10907496、chr16: 10907539-10907559、chr16:10907586-10907606、chr16:10907589-10907609、chr16:10907621-10907641、chr16:10907622-10907642、chr16:109 07623-10907643、chr16:10907730-10907750、chr16:10907731-10907751、chr16:10907757-10907777、chr16:10907781-10907801、chr16:109077 87-10907807、chr16:10907790-10907810、chr16:10907810-10907830、chr16:10907820-10907840、chr16:10907870-10907890、chr16:10907886- 10907906、chr16:10907924-10907944、chr16:10907928-10907948、chr16:10907932-10907952、chr16:10907935-10907955、chr16:10907978-109 07998、chr16:10907979-10907999、chr16:10908069-10908089、chr16:10908073-10908093、chr16:10908101-10908121、chr16:10909056-109090 76、chr16:10909138-10909158、chr16:10910195-10910215、chr16:10910196-10910216、chr16:10915592-10915612、chr16:10915626-10915646、chr16:10916375-10916395, chr16:10916382-10916402, chr16:10916426-10916446, chr16:10916432-10916452, c hr16:10918486-10918506, chr16:10918492-10918512, chr16:10918493-10918513, chr16:10922435-10922455, chr and comprising at least one C to T substitution or at least one A to G substitution within genomic coordinates selected from r16:10922441-10922461, chr16:10922441-10922461, chr16:10922444-10922464, chr16:10922460-10922480, chr16:10923257-10923277, and chr16:10923265-10923285. In some embodiments, the genetic modifications are chr16:10916432-10916452, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10906985-10907005, chr16:10908073-10908093, chr16:109 07433-10907453, chr16:10907979-10907999, chr16:10907139-10907159, chr16:10922 435-10922455, chr16:10907384-10907404, chr16:10907434-10907454, chr16:10907119 -10907139, chr16:10907539-10907559, chr16:10907810-10907830, chr16:10907315-1 0907335, chr16:10916426-10916446, chr16:10909138-10909158, chr16:10908101-1090 8121, chr16:10907790-10907810, chr16:10907787-10907807, chr16:10907454-109074 74, chr16:10895702-10895722, chr16:10902729-10902749, chr16:10918492-10918512,chr16:10907932-10907952, chr16:10907623-10907643, chr16:10907461-10907481, chr16:10902723-10902743, chr16:1090762 2-10907642, chr16:10922441-10922461, chr16:10902662-10902682, chr16:10915626-10915646, chr16:10915592-10915612, chr and at least one C to T substitution or at least one A to G substitution within genomic coordinates selected from chr16:10907385-10907405, chr16:10907030-10907050, chr16:10907935-10907955, chr16:10906853-10906873, chr16:10906757-10906777, chr16:10907730-10907750, and chr16:10895302-10895322. In some embodiments, the genetic modifications are chr16:10907539-10907559, chr16:10916426-10916446, chr16:10906907-10906927, chr16:10895702-10895722, chr16:10907757-10907777, chr16:10907623-10907643, chr16 :10915626-10915646, chr16:10906756-10906776, chr16:10907476-10907496, chr16:10907385-10907405, and chr16:10923265-10923285. In some embodiments, the genetic modifications are chr16:10906853-10906873, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10907315-10907335, chr16:10916432-10916452, chr16:10907932-10907952, chr16:10915626-10915646, chr16:10907586-10907606,and comprising at least one C to T substitution or at least one A to G substitution within genomic coordinates selected from chr16:10916426-10916446, chr16:10907476-10907496, chr16:10907787-10907807, chr16:10907979-10907999, chr16:10906904-10906924, and chr16:10909138-10909158. In some embodiments, the genetic modifications are chr16:10895702-10895722, chr16:10916432-10916452, chr16:10907623-10907643, chr16:10907932-10907952, chr16:10906985-10907005, chr16:10915626-10915646, chr16:10907539-10 and at least one C to T substitution or at least one A to G substitution within genomic coordinates selected from chr16:907559, chr16:10916426-10916446, chr16:10907476-10907496, chr16:10907119-10907139, chr16:10907979-10907999, and chr16:10909138-10909158. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within a genomic coordinate selected from chr16:10906853-10906873, chr16:10906757-10906777, chr16:10895302-10895322, chr16:10907539-10907559, chr16:10907730-10907750, and chr16:10895702-10895722. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within a genomic coordinate selected from chr16:10906853-10906873, chr16:10922444-10922464, chr16:10916432-10916452. In some embodiments, the genetic modification comprises:In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10906853-10906873. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10922444-10922464. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10906757-10906777. ... The genetic modification comprises at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10916432-10916452. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10895302-10895322. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10907539-10907559. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10907730-10907750. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10895702-10895722. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10907932-10907952. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10907476-10907496. In some embodiments, the genetic modification comprises at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10909138-10909158.

[0150] In some embodiments, the modification to CIITA comprises any one or more of insertion, deletion, substitution, or deamination of at least one nucleotide in the target sequence. In some embodiments, the modification to CIITA comprises insertion of 1, 2, 3, 4, or 5 or more nucleotides in the target sequence. In some embodiments, the modification to CIITA comprises deletion of 1, 2, 3, 4, or 5 or more nucleotides in the target sequence. In other embodiments, the modification to CIITA comprises insertion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 or more nucleotides in the target sequence. In other embodiments, the modification to CIITA comprises deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 or more nucleotides in the target sequence. In some embodiments, the modification to CIITA comprises an indel, which is generally defined in the art as an insertion or deletion of less than 1000 base pairs (bp). In some embodiments, the modification to CIITA comprises an indel that results in a frameshift mutation in the target sequence. In some embodiments, the modification to CIITA comprises a substitution of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or 25 or more nucleotides in the target sequence. In some embodiments, the modification to CIITA comprises one or more of an insertion, deletion, or substitution of nucleotides resulting from the incorporation of a template nucleic acid. In some embodiments, the modification to CIITA comprises an insertion of a donor nucleic acid in the target sequence. In some embodiments, the modification to CIITA is not transient.

[0151] In some embodiments, the genetic modification of CIITA results in the use of an out-of-frame stop codon.In some embodiments, the genetic modification of CIITA results in the reduction of CIITA protein expression by cells.In some embodiments, the genetic modification of CIITA results in the reduction of CIITA in the cell nucleus.In some embodiments, the modification of CIITA results in the reduction of MHC class II protein expression on the surface of cells.

[0152] In some embodiments, the genetic modification to CIITA results in a truncated form of the CIITA protein. In some embodiments, the truncated CIITA protein does not bind to GTP. In some embodiments, the truncated CIITA protein does not localize to the nucleus. In some embodiments, the CIITA protein (e.g., a truncated form of the CIITA protein) has reduced activity relative to the activity of wild-type CIITA protein related to regulating MHC class II expression. In some embodiments, the expression of MHC class II on the surface of cells is reduced as a result of the reduction in CIITA protein activity. In some embodiments, the expression of MHC class II on the surface of cells is absent as a result of the reduction in CIITA protein activity.

[0153] 3. Efficacy of CIITA guide RNA The efficacy of a CIITA guide RNA can be determined by techniques available in the art that assess the editing efficiency of the guide RNA, the levels of CIITA protein and / or mRNA, and / or the levels of MHC class II in the target cells.

[0154] In some embodiments, the efficacy of a CIITA guide RNA is determined by measuring the level of CIITA protein in cells. The level of CIITA protein can be detected, for example, by cell lysate and Western blot using an anti-CIITA antibody. In some embodiments, the efficacy of a CIITA guide RNA is determined by measuring the level of CIITA protein in cell nuclei. In some embodiments, the efficacy of a CIITA guide RNA is determined by measuring the level of CIITA mRNA in cells. The level of CIITA mRNA can be detected, for example, by RT-PCR. In some embodiments, a decrease in the level of CIITA protein and / or CIITA mRNA in target cells compared to unmodified cells indicates an effective CIITA guide RNA.

[0155] An "unmodified cell" (or "unmodified cells") refers to a control cell (or cells) of the same type of cell in an experiment or test, where the "unmodified" control cell has not been contacted with a CIITA guide. Thus, an unmodified cell (or cells) can be a cell that has not been contacted with a guide RNA or a cell that has been contacted with a guide RNA that does not target CIITA.

[0156] In some embodiments, the efficacy of the CIITA guide RNA is determined by measuring the reduction or elimination of MHC class II protein expression by target cells. The CIITA protein functions as a transactivator, activating the MHC class II promoter and is essential for the expression of MHC class II proteins. In some embodiments, MHC class II protein expression can be detected on the surface of target cells. In some embodiments, MHC class II protein expression is measured by flow cytometry. In some embodiments, antibodies against MHC class II proteins (e.g., anti-HLA-DR, -DQ, -DP) can be used to detect MHC class II protein expression, for example, by flow cytometry. In some embodiments, one or more antibodies against MHC class II proteins (e.g., anti-HLA-DR, -DQ, -DP) can be used to detect MHC class II protein expression, for example, by flow cytometry. In some embodiments, the one or more antibodies against MHC class II proteins include one or more of an antibody against HLA-DR, an antibody against HLA-DQ, and an antibody against HLA-DP. In some embodiments, the one or more antibodies against MHC class II proteins comprise antibodies against HLA-DR, antibodies against HLA-DQ, and antibodies against HLA-DP. In some embodiments, the one or more antibodies against MHC class II proteins comprise antibodies against HLA-DR, HLA-DQ, and HLA-DP.

[0157] In some embodiments, reduction or elimination of MHC class II proteins on the surface of a cell (or cell population) compared to an unmodified cell (or unmodified cell population) is indicative of an effective CIITA guide RNA. In some embodiments, a cell (or cell population) contacted with a particular CIITA guide RNA and an RNA-guided DNA binder that is negative for MHC class II proteins by flow cytometry is indicative of an effective CIITA guide RNA.

[0158] In some embodiments, MHC class II protein expression is reduced or eliminated in a cell population using the methods and compositions disclosed herein. In some embodiments, the cell population is enriched (e.g., by FACS or MACS) and is at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, or 94% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is not enriched (e.g., by FACS or MACS) and is at least 65%, 70%, 80%, 90%, 91%, 92%, 93%, or 94% MHC class II negative when measured by flow cytometry compared to an unmodified cell population.

[0159] In some embodiments, the cell population is at least 65% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 70% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 80% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 90% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 91% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 92% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 93% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 94% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 95% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 96% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 97% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 98% MHC class II negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 99% MHC class II negative when measured by flow cytometry compared to an unmodified cell population.

[0160] In some embodiments, the cell population is at least 65% MHC class II negative when measured by flow cytometry using one or more of antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 65% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 65% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 70% MHC class II negative when measured by flow cytometry using one or more of antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 70% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, anti-HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 70% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 80% MHC class II negative when measured by flow cytometry using one or more of antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 80% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, anti-HLA-DQ, and HLA-DP compared to an unmodified cell population.In some embodiments, the cell population is at least 80% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 90% MHC class II negative when measured by flow cytometry using one or more of antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 90% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, anti-HLA-DQ, and anti-HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 90% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, anti-HLA-DQ, and anti-HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 92% MHC class II negative when measured by flow cytometry using one or more of antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 92% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 92% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 93% MHC class II negative when measured by flow cytometry using one or more of antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population.In some embodiments, the cell population is at least 93% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, anti-HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 93% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 94% MHC class II negative when measured by flow cytometry using one or more of antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 94% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, anti-HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 94% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 95% MHC class II negative when measured by flow cytometry using one or more of antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 95% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, anti-HLA-DQ, and anti-HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 95% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, anti-HLA-DQ, and anti-HLA-DP compared to an unmodified cell population.In some embodiments, the cell population is at least 96% MHC class II negative when measured by flow cytometry using one or more of antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 96% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 96% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 97% MHC class II negative when measured by flow cytometry using one or more of antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 97% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, anti-HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 97% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 98% MHC class II negative when measured by flow cytometry using one or more of antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 98% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, anti-HLA-DQ, and HLA-DP compared to an unmodified cell population.In some embodiments, the cell population is at least 98% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 99% MHC class II negative when measured by flow cytometry using one or more of antibodies to HLA-DR, HLA-DQ, and HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 99% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, anti-HLA-DQ, and anti-HLA-DP compared to an unmodified cell population. In some embodiments, the cell population is at least 99% MHC class II negative when measured by flow cytometry using antibodies to HLA-DR, anti-HLA-DQ, and anti-HLA-DP compared to an unmodified cell population.

[0161] In some embodiments, an effective CIITA guide RNA can be determined by measuring immune cell (e.g., CD4+ T cell) responses to genetically modified target cells in vitro or in vivo. CD4+ T cell responses can be assessed by assays measuring CD4+ T cell activation responses, such as CD4+ T cell proliferation, activation marker expression, and / or cytokine production (IL-2, IL-12, IFN-γ) (e.g., flow cytometry, ELISA). CD4+ T cell responses can be assessed in in vitro cell culture assays in which genetically modified cells are co-cultured with cells containing CD4+ T cells. For example, genetically modified cells can be co-cultured with, e.g., PBMCs, purified CD3+ T cells containing CD4+ T cells, purified CD4+ T cells, or a CD4+ T cell line. The CD4+ T cell response elicited from genetically modified cells can be compared to the response elicited from unmodified cells. A reduced response from CD4+ T cells indicates an effective CIITA guide RNA.

[0162] The efficacy of the CIITA guide RNA may also be assessed by the survival of cells after editing. In some embodiments, the cells survive for at least 1 to 6 weeks after editing. In some embodiments, the cells survive for at least 1 to 12 weeks after editing. In some embodiments, the cells survive for at least 2 weeks after editing. In some embodiments, the cells survive for at least 3 weeks after editing. In some embodiments, the cells survive for at least 4 weeks after editing. In some embodiments, the cells survive for at least 5 weeks after editing. In some embodiments, the cells survive for at least 6 weeks after editing. The viability of genetically modified cells may be measured using standard techniques, including, for example, measures of cell death, live / dead staining by flow cytometry, or cell proliferation.

[0163] C. Methods and Compositions for Reducing or Eliminating MHC Class II and Additional Modifications 1. MHC class I knockout In some embodiments, a method is provided for reducing or eliminating the expression of MHC class II proteins on the surface of cells by genetically modifying CIITA as disclosed herein, and the method further provides for reducing or eliminating the expression of MHC class I proteins on the surface of cells compared to unmodified cells. In one approach, MHC class I protein expression is reduced or eliminated by genetically modifying the B2M gene. In some embodiments, MHC class I protein expression is reduced or eliminated by contacting cells with a B2M guide RNA. In another approach, the expression of MHC class I protein HLA-A is reduced or eliminated by genetically modifying HLA-A, thereby reducing or eliminating the surface expression of HLA-A in human cells, wherein the human cells are homozygous for HLA-B and homozygous for HLA-C. Thus, in some embodiments, HLA-A protein expression is reduced or eliminated by contacting human cells with an HLA-A guide RNA, wherein the human cells are homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the cells obtained are allogeneic cells.

[0164] In some embodiments, the method comprises reducing or eliminating MHC class II protein surface expression in engineered cells compared to unmodified cells, and comprises contacting the cells with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cells with a B2M guide RNA. In some embodiments, the method further comprises contacting the cells with an RNA-guided DNA binder. In some embodiments, the method further comprises inducing a DSB or SSB in the B2M target sequence. In some embodiments, B2M expression is thereby reduced by the cells. In some embodiments, MHC class I protein expression is thereby reduced or eliminated by the cells.

[0165] In some embodiments, the B2M guide RNA targets the human B2M gene.

[0166] In some embodiments, the B2M guide RNA comprises SEQ ID NO: 701. In some embodiments, the B2M guide RNA comprises a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of SEQ ID NO: 701. In some embodiments, the B2M guide RNA comprises a guide sequence that is at least 95%, 90%, or 85% identical to SEQ ID NO: 701.

[0167] For example, additional embodiments of B2M guide RNAs are provided herein, including exemplary modifications to the guide RNA.

[0168] In some embodiments, the effectiveness of a B2M guide RNA is determined by measuring the level of B2M protein in the cell compared to unmodified cells. In some embodiments, the effectiveness of a B2M guide RNA is determined by measuring the level of B2M protein expressed by the cell. In some embodiments, an antibody against B2M protein (e.g., anti-B2M) can be used to detect the level of B2M protein, for example, by flow cytometry. In some embodiments, the effectiveness of a B2M guide RNA is determined by measuring the level of B2M mRNA in the cell, for example, by RT-PCR. In some embodiments, a reduction or elimination of the level of B2M protein or B2M mRNA compared to the level of B2M protein in unmodified cells indicates an effective B2M guide RNA. In some embodiments, a cell (or cell population) that is negative for B2M protein by flow cytometry compared to unmodified cells (or unmodified cell population) indicates an effective B2M guide RNA. In some embodiments, a cell (or population of cells) contacted with a particular B2M guide RNA and an RNA-guided DNA binder that is negative for MHC class I proteins by flow cytometry is indicative of an effective B2M guide RNA.

[0169] In some embodiments, the efficacy of the B2M guide RNA is determined by measuring the level of MHC class I protein on the surface of the cells. In some embodiments, the MHC class I protein level is measured by flow cytometry (e.g., using an antibody against HLA-A, HLA-B, or HLA-C). In some embodiments, the cell population is at least 65% MHC class I negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 70% MHC I negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 80% MHC I negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 90% MHC I negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 95% MHC I negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 100% MHC class I negative as measured by flow cytometry compared to an unmodified cell population.

[0170] In some embodiments, the methods comprise reducing or eliminating surface expression of MHC class II proteins in engineered cells compared to unmodified cells, the methods comprising contacting the cells with a composition comprising a CIITA guide RNA disclosed herein, the composition comprising a CIITA guide RNA selected from the group consisting of chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-29943 146, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046.In some embodiments, the methods comprise reducing or eliminating surface expression of MHC class II proteins in engineered cells compared to unmodified cells, the methods comprising contacting the cells with a composition comprising a CIITA guide RNA disclosed herein, the composition comprising a CIITA guide RNA selected from the group consisting of chr6:29942864-29942884, chr6:29942868-29942888, chr6:29942876-29942896, chr6:29942877-29942897, chr6:29942883-29942903, chr6:29943126-299431 46, chr6:29943528-29943548, chr6:29943529-29943549, chr6:29943530-29943550, chr6:29943537-29943557, chr6:29943549-29943569, chr6:29943589-29943609, and chr6:29944026-29944046. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29942864-29942884. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29942868-29942888. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29942876-29942896. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29942877-29942897. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29942883-29942903. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29943126-29943146. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29943528-29943548. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29943529-29943549. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29943530-29943550.In some embodiments, the HLA-A genomic coordinates are selected from chr6:29943537-29943557. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29943549-29943569. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29943589-29943609. In some embodiments, the HLA-A genomic coordinates are selected from chr6:29944026-29944046. In some embodiments, the gene editing system comprises an RNA-guided DNA binder. In some embodiments, the RNA-guided DNA binder comprises a Cas9 protein, such as S. pyogenes Cas9. In some embodiments, the cell is homozygous for HLA-B and homozygous for HLA-C.

[0171] In some embodiments, the method comprises reducing or eliminating surface expression of MHC class II proteins in engineered cells compared to unmodified cells, and comprises contacting the cells with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cells with an HLA-A guide RNA. In some embodiments, the HLA-A guide RNA comprises a guide sequence selected from SEQ ID NOs: 2001-2095 (see Table 3 below). In some embodiments, the method further comprises contacting the cells with an RNA-guided DNA binder. In some embodiments, the RNA-guided DNA binder comprises a Cas9 protein, such as S. pyogenes Cas9. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C.

[0172] In some embodiments, a method for generating engineered cells having reduced or eliminated surface expression of MHC class II proteins compared to unmodified cells is provided, comprising: a. contacting the cells with a CIITA guide RNA, wherein the guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-117; b. contacting the cells with an HLA-A guide RNA, wherein the HLA-A guide RNA comprises a guide sequence selected from any one of SEQ ID NOs: 2001-2095 (see Table 3 below); and c. optionally, contacting the cells with an RNA-guided DNA binder or a nucleic acid encoding the RNA-guided DNA binder, wherein surface expression of HLA-A in the cells is reduced or eliminated compared to unmodified cells. In some embodiments, the method comprises contacting the cells with an RNA-guided DNA binder or a nucleic acid encoding the RNA-guided DNA binder. In some embodiments, the RNA-guided DNA binder comprises S. pyogenes Cas9. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C.

[0173] Exemplary HLA-A guide RNAs are provided in Table 3 (SEQ ID NOs: 2001-2095 with corresponding guide RNA sequences of SEQ ID NOs: 427-521 and 603-697).

[0174] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5]

Table 3-6

Table 3-7

Table 3-8

Table 3-9

Table 3-10

Table 3-11

Table 3-12

Table 3-13

Table 3-14

Table 3-15

Table 3-16

Table 3-17

Table 3-18

Table 3-19

Table 3-20

Table 3-21

Table 3-22

Table 3-23

Table 3-24

Table 3-25

Table 3-26

Table 3-27

Table 3-28

Table 3-29

[0175] In some embodiments, the efficacy of the HLA-A guide RNA is determined by measuring the level of HLA-A protein on the surface of cells. In some embodiments, the HLA-A protein level is measured by flow cytometry (e.g., using antibodies to HLA-A2 and / or HLA-A3). In some embodiments, the cell population is at least 65% HLA-A negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 70% HLA-A negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 80% HLA-A negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 90% HLA-A negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 95% HLA-A negative when measured by flow cytometry compared to an unmodified cell population. In some embodiments, the cell population is at least 100% HLA-A negative as measured by flow cytometry compared to an unmodified cell population.

[0176] In some embodiments, the efficacy of a B2M guide RNA or HLA-A guide may be determined by measuring immune cell responses in vitro or in vivo (e.g., CD8+ T cells) to genetically modified target cells compared to unmodified cells. For example, a reduced response from CD8+ T cells indicates an effective B2M or HLA-A guide RNA. CD8+ T cell responses may be assessed by assays measuring CD8+ T cell activation responses, such as CD8+ T cell proliferation, expression of activation markers, and / or cytokine production (IL-2, IFN-γ, TNF-α) (e.g., flow cytometry, ELISA). CD8+ T cell responses may be assessed in vitro or in vivo. In some embodiments, CD8+ T cell responses may be assessed by co-culturing genetically modified cells with CD8+ T cells in vitro. In some embodiments, CD8+ T cell activity may be assessed in an in vivo model, such as a rodent model. In an in vivo model, for example, the genetically modified cells may be administered with CD8+ T cells, with survival of the genetically modified cells indicating their ability to evade CD8+ T cell lysis. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of CD8+ T cells for 1, 2, 3, 4, 5, or 6 weeks or longer. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of CD8+ T cells for at least 1-6 weeks. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of CD8+ T cells for at least 2-4 weeks. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of CD8+ T cells for at least 4-6 weeks. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of CD8+ T cells for more than 6 weeks.

[0177] In some embodiments, the method produces a composition comprising cells in which MHC class II expression is reduced or eliminated and MHC class I expression is reduced or eliminated compared to unmodified cells. In some embodiments, the method produces a composition comprising cells in which MHC class II protein expression is reduced or eliminated, CIITA protein expression is reduced or eliminated, and / or CIITA levels in the cell nucleus are reduced or eliminated, and / or MHC class I protein expression is eliminated. In some embodiments, the method produces a composition comprising cells in which MHC class II protein expression is reduced or eliminated, CIITA protein expression is reduced or eliminated, and / or CIITA levels in the cell nucleus are reduced or eliminated, and / or B2M protein expression is eliminated. In some embodiments, the method produces a composition comprising cells in which MHC class II protein expression is reduced or eliminated, CIITA protein expression is reduced or eliminated, and / or CIITA levels in the cell nucleus are reduced or eliminated, and B2M mRNA levels are reduced or eliminated. In some embodiments, the cells induce a reduction or elimination of a response from CD8+ T cells.

[0178] In some embodiments, the method produces a composition comprising cells with reduced or eliminated MHC class II expression and reduced or eliminated HLA-A expression compared to unmodified cells, and the cells are homozygous for HLA-B and homozygous for HLA-C. In some embodiments, the method produces a composition comprising cells with reduced or eliminated MHC class II protein expression, reduced or eliminated CIITA protein expression, and / or reduced or eliminated CIITA levels in the cell nucleus, and / or eliminated HLA-A protein expression. In some embodiments, the method produces a composition comprising cells with reduced or eliminated MHC class II protein expression, reduced or eliminated CIITA protein expression, and / or reduced or eliminated CIITA levels in the cell nucleus, and / or eliminated HLA-A protein expression. In some embodiments, the cells elicit a reduced or eliminated response from CD8+ T cells.

[0179] In some embodiments, engineered cells are provided, wherein the cells have reduced or eliminated expression of MHC class II and MHC class I proteins on the cell surface, the cells comprise a genetic modification in CIITA, and the cells comprise a modification in B2M. In some embodiments, the cells elicit a reduced response from CD4+ T cells and a reduced response from CD8+ T cells.

[0180] In some embodiments, engineered cells are provided, wherein the cells have reduced or eliminated expression of MHC class II and HLA-A proteins on the cell surface, wherein the cells comprise a genetic modification in CIITA, wherein the cells comprise a genetic modification in the HLA-A gene, and wherein the cells are homozygous for HLA-B and homozygous for HLA-C. In some embodiments, engineered cells are provided, wherein the cells have reduced or eliminated expression of MHC class II and HLA-A proteins on the cell surface, wherein the cells comprise a genetic modification in CIITA, and wherein the cells comprise a genetic modification in the HLA-A gene. In some embodiments, the cells are homozygous for HLA-B and HLA-C. In some embodiments, the cells elicit a reduced response from CD4+ T cells and a reduced response from CD8+ T cells.

[0181] 2.Exogenous nucleic acid In some embodiments, the present disclosure provides methods and compositions for reducing or eliminating expression of MHC class II proteins on the cell surface by genetically modifying the CIITA disclosed herein, which methods and compositions further provide for expression of exogenous nucleic acids by the engineered cells.

[0182] a) NK cell inhibitor knock-in In some embodiments, the present disclosure provides a method for reducing or eliminating the expression of MHC class II proteins on the cell surface by genetically modifying a CIITA disclosed herein, the method further providing for the expression of an exogenous nucleic acid by the cell, the exogenous nucleic acid encoding an NK cell inhibitor molecule. In some embodiments, the NK cell inhibitor molecule is expressed on the surface of the cell, thereby avoiding NK cell activity (e.g., lysis of the cell by NK cells). In some embodiments, the ability of the genetically modified cells to avoid NK cell lysis makes the cells suitable for adoptive cell transfer therapy. In some embodiments, the cells are allogeneic cells.

[0183] In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein on the surface of a cell, comprising genetically modifying CIITA, and comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, wherein the method further comprises contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule. In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein on the surface of a cell, comprising modifying CIITA, and comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, wherein the method further comprises contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule and a B2M guide RNA, thereby reducing or eliminating expression of an MHC class I protein on the surface of the cell. In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA binder.

[0184] In some embodiments, the methods comprise reducing or eliminating expression of an MHC class II protein on the surface of the cell, and comprise genetically modifying the cell with one or more compositions comprising a CIITA guide RNA, a B2M guide RNA, a nucleic acid encoding an NK cell inhibitor molecule, and an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder as disclosed herein.

[0185] In some embodiments, a method comprises inducing DSBs or SSBs in CIITA, comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, wherein the method further comprises contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule. In some embodiments, a method comprises inducing DSBs or SSBs in CIITA, comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, wherein the method further comprises contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule and a B2M guide RNA, thereby reducing expression of an MHC class I protein on the cell surface. In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA-binding agent.

[0186] In some embodiments, a method comprises reducing or eliminating expression of CIITA protein in a cell, comprising delivering a composition comprising a CIITA guide RNA disclosed herein, wherein the method further comprises contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule. In some embodiments, a method comprises reducing expression of CIITA protein in a cell, comprising delivering a composition comprising a CIITA guide RNA disclosed herein, wherein the method further comprises contacting the cell with a nucleic acid encoding an NK cell inhibitor molecule and a B2M guide RNA, thereby reducing expression of MHC class I protein on the cell surface. In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA binder.

[0187] In some embodiments, the NK cell inhibitor molecule binds to an inhibitory receptor on an NK cell. In some embodiments, the NK cell inhibitor molecule binds to an inhibitory receptor specific for MHC class I. In some embodiments, the NK cell inhibitor molecule binds to an inhibitory receptor that is not specific for MHC class I. NK cell inhibitory receptors include, for example, KIR (human), CD94-NKG2A heterodimer (human / mouse), Ly49 (mouse), 2B4, SLAMF6, NKFP-B, TIGIT, and KIR2DL4.

[0188] In some embodiments, the NK cell inhibitor molecule binds to NKG2A.

[0189] In some embodiments, the NK cell inhibitor molecule is an MHC class I molecule. In some embodiments, the NK cell inhibitor molecule is a classical MHC class I molecule. In some embodiments, the NK cell inhibitor molecule is a non-classical MHC class I molecule. In some embodiments, the NK cell inhibitor molecule is an HLA molecule. Examples of NK cell inhibitor molecules include HLA-C, HLA-E, HLA-G, Cd1, CD48, SLAMF6, Clr-b, and CD155.

[0190] In some embodiments, the NK cell inhibitor molecule is HLA-E.

[0191] In some embodiments, the NK cell inhibitor molecule is a fusion protein. In some embodiments, the NK cell inhibitor molecule is a fusion protein comprising HLA-E. In some embodiments, the NK cell inhibitor molecule comprises B2M. In some embodiments, the NK cell inhibitor molecule comprises HLA-E and B2M. In some embodiments, the fusion protein comprises a linker. In some embodiments, the HLA-E construct is provided in a vector. In some embodiments, the vector comprising the HLA-E construct is a lentiviral vector. In some embodiments, the HLA-E construct is delivered to cells via lentiviral transduction.

[0192] In some embodiments, the NK cell inhibitor molecule is inserted into the genome of the target cell. In some embodiments, the NK cell inhibitor molecule is integrated into the genome of the target cell. In some embodiments, the NK cell inhibitor molecule is integrated into the genome of the target cell by homologous recombination (HR). In some embodiments, the NK cell inhibitor molecule is integrated into the genome of the target cell by blunt-end insertion. In some embodiments, the NK cell inhibitor molecule is integrated into the genome of the target cell by non-homologous end joining. In some embodiments, the NK cell inhibitor molecule is integrated into a safe harbor locus in the genome of the cell. In some embodiments, the NK cell inhibitor molecule is integrated into one of the TRAC locus, the B2M locus, the AAVS1 locus, and / or the CIITA locus. In some embodiments, the NK cell inhibitor molecule is provided to the cell in a lipid-nucleic acid assembly composition. In some embodiments, the lipid-nucleic acid assembly composition is a lipid nanoparticle (LNP).

[0193] In some embodiments, the methods produce engineered cells that elicit a reduced response from NK cells. NK cell responses can be assessed in vitro or in vivo. In some embodiments, NK cell activity can be assessed in vitro by co-culturing the genetically modified cells with NK cells. In some embodiments, NK cell activity can be assessed in an in vivo model, e.g., a rodent model. In an in vivo model, for example, the genetically modified cells can be administered with NK cells, and survival of the genetically modified cells indicates their ability to evade NK cell lysis. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of NK cells for 1, 2, 3, 4, 5, or 6 weeks or longer. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of NK cells for at least 1-6 weeks. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of NK cells for at least 2-4 weeks. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of NK cells for at least 4-6 weeks. In some embodiments, the methods produce compositions comprising cells that survive in vivo in the presence of NK cells for more than 6 weeks.

[0194] In some embodiments, the method produces a composition comprising engineered cells with reduced or eliminated MHC class II expression and comprising a nucleic acid encoding an NK cell inhibitor molecule. In some embodiments, the method produces a composition comprising engineered cells with reduced or eliminated MHC class II expression and reduced or eliminated expression of an NK cell inhibitor molecule on the cell surface. In some embodiments, the method produces a composition comprising cells with reduced or eliminated MHC class II expression and eliciting a reduced response from NK cells. In some embodiments, the method produces a composition comprising cells with reduced or eliminated MHC class II protein expression, reduced or eliminated CIITA protein expression, and / or reduced or eliminated CIITA levels in the cell nucleus, eliciting a reduced response from NK cells, and reduced or eliminated MHC class I protein expression. In some embodiments, the cells elicit a reduced response from CD4+ T cells, CD8+ T cells, and / or NK cells.

[0195] In some embodiments, allogeneic cells are provided, the cells having reduced or eliminated expression of MHC class II and MHC class I proteins on the cell surface, the cells comprising a modification in CIITA disclosed herein, the cells comprising a genetic modification in B2M, and the cells comprising a nucleic acid encoding an NK cell inhibitor molecule. In some embodiments, the allogeneic cells elicit a reduced response from CD4+ T cells, CD8+ T cells, and / or NK cells.

[0196] b) Targeting receptors and other cell surface-expressed and secreted polypeptides In some embodiments, the present disclosure provides a method for reducing or eliminating the expression of MHC class II proteins on the surface of a cell by genetically modifying a CIITA disclosed herein, wherein the method further provides for the expression of one or more exogenous nucleic acids (e.g., an antibody, a chimeric antigen receptor (CAR), a T cell receptor (TCR), a cytokine or cytokine receptor, a chemokine or chemokine receptor, an enzyme, a fusion protein, or other types of cell surface-associated or soluble polypeptides). In some embodiments, the exogenous nucleic acid encodes a protein to be expressed on the cell surface. For example, in some embodiments, the exogenous nucleic acid encodes a targeting receptor to be expressed on the cell surface (as further described herein). In some embodiments, the genetically modified cell can function as a "cell factory" for the expression of secreted polypeptides encoded by the exogenous nucleic acid, including, for example, as a source for continuous production of the polypeptide in vivo (as further described herein). In some embodiments, the cell is an allogeneic cell.

[0197] In some embodiments, the method comprises reducing or eliminating expression of MHC class II proteins on the surface of a cell, comprising genetically modifying CIITA, and contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cell with an exogenous nucleic acid. In some embodiments, the method comprises reducing or eliminating expression of MHC class II proteins on the surface of a cell, comprising genetically modifying CIITA, and contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cell with an exogenous nucleic acid and a B2M guide RNA, thereby reducing or eliminating expression of MHC class I proteins on the surface of the cell. In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein on the surface of a cell, comprises genetically modifying the CIITA gene, comprises contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and further comprises contacting the cell with an exogenous nucleic acid, a cell surface-expressed (e.g., targeting receptor) or soluble (e.g., secreted) polypeptide, and a B2M guide RNA, thereby reducing or eliminating expression of an MHC class I protein on the cell surface. In some embodiments, the method comprises contacting the cell with two or more exogenous nucleic acids. In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA-binding agent.

[0198] In some embodiments, the method comprises reducing or eliminating expression of MHC class II protein on the surface of the cell, comprises genetically modifying CIITA, and comprises contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cell with an exogenous nucleic acid. In some embodiments, the method comprises reducing or eliminating expression of MHC class II protein on the surface of the cell, comprises genetically modifying CIITA, and comprises contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cell with an exogenous nucleic acid and an HLA-A guide RNA, thereby reducing or eliminating expression of HLA-A protein on the surface of the cell. In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein on the surface of a cell, comprises genetically modifying the CIITA gene, comprises contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and further comprises contacting the cell with an exogenous nucleic acid, a cell surface-expressed (e.g., targeting receptor) or soluble (e.g., secreted) polypeptide, and an HLA-A guide RNA, thereby reducing or eliminating expression of an HLA-A protein on the surface of the cell. In some embodiments, the method comprises contacting the cell with two or more exogenous nucleic acids. In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA-binding agent.

[0199] In some embodiments, the methods comprise reducing or eliminating expression of an MHC class II protein on the surface of the cell, and comprise genetically modifying the cell with one or more compositions comprising a CIITA guide RNA disclosed herein, a B2M guide RNA, an exogenous nucleic acid encoding an NK cell inhibitor molecule, an exogenous nucleic acid encoding a polypeptide (e.g., a targeted receptor), and an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder.

[0200] In some embodiments, the methods comprise reducing or eliminating expression of MHC class II and MHC class I proteins on the surface of the cells, and comprise genetically modifying the cells with one or more compositions comprising a CIITA guide RNA disclosed herein, a B2M guide RNA, an exogenous nucleic acid encoding an NK cell inhibitor molecule, an exogenous nucleic acid encoding a polypeptide (e.g., a targeted receptor), and an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder.

[0201] In some embodiments, the methods comprise reducing or eliminating expression of MHC class II proteins and HLA-A proteins on the surface of the cells, and comprise genetically modifying the cells with one or more compositions comprising a CIITA guide RNA, a B2M guide RNA, an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor), and an RNA-guided DNA binder or a nucleic acid encoding an RNA-guided DNA binder as disclosed herein.

[0202] In some embodiments, the exogenous nucleic acid encodes a polypeptide expressed on the surface of a cell. In some embodiments, the exogenous nucleic acid encodes a soluble polypeptide. As used herein, a "soluble" polypeptide refers to a polypeptide that is secreted by a cell. In some embodiments, the soluble polypeptide is a therapeutic polypeptide. In some embodiments, the soluble polypeptide is an antibody. In some embodiments, the soluble polypeptide is an enzyme. In some embodiments, the soluble polypeptide is a cytokine. In some embodiments, the soluble polypeptide is a chemokine. In some embodiments, the soluble polypeptide is a fusion protein.

[0203] In some embodiments, the exogenous nucleic acid encodes an antibody. In some embodiments, the exogenous nucleic acid encodes an antibody fragment (e.g., Fab, Fab2). In some embodiments, the exogenous nucleic acid encodes a full-length antibody. In some embodiments, the exogenous nucleic acid encodes a single-chain antibody (e.g., scFv). In some embodiments, the antibody is an IgG, IgM, IgD, IgA, or IgE. In some embodiments, the antibody is an IgG antibody. In some embodiments, the antibody is an IgG1 antibody. In some embodiments, the antibody is an IgG4 antibody. In some embodiments, the heavy chain constant region contains mutations known to reduce effector function. In some embodiments, the heavy chain constant region contains mutations known to enhance effector function. In some embodiments, the antibody is a bispecific antibody. In some embodiments, the antibody is a single domain antibody (e.g., an antibody with only a VH domain).

[0204] In some embodiments, the exogenous nucleic acid encodes a neutralizing antibody. A neutralizing antibody neutralizes the activity of its target antigen. In some embodiments, the antibody is a neutralizing antibody against a viral antigen. In some embodiments, the antibody neutralizes the target viral antigen and blocks the virus's ability to infect cells. In some embodiments, a cell-based neutralization assay can be used to measure the neutralizing activity of an antibody. The specific cell and readout depend on the target antigen of the neutralizing antibody. The half-maximal effective concentration (EC 50 ) can be measured in a cell-based neutralization assay and has a lower EC 50 indicates more potent neutralizing antibodies.

[0205] In some embodiments, the exogenous nucleic acid encodes an antibody that binds to an antigen associated with a disease or disorder (see, eg, the diseases and disorders described in Section IV).

[0206] In some embodiments, the exogenous nucleic acid encodes a polypeptide expressed on the surface of a cell (i.e., a cell surface binding protein). In some embodiments, the exogenous nucleic acid encodes a targeting receptor. A "targeting receptor" is a receptor present on the surface of a cell, e.g., a T cell, that allows the cell to bind to a target site, e.g., a specific cell or tissue within an organism. In some embodiments, the targeting receptor is a CAR. In some embodiments, the targeting receptor is a universal CAR (UniCAR). In some embodiments, the targeting receptor is a TCR. In some embodiments, the targeting receptor is TRuC. In some embodiments, the targeting receptor is a B cell receptor (BCR) (e.g., expressed on B cells). In some embodiments, the targeting receptor is a chemokine receptor. In some embodiments, the targeting receptor is a cytokine receptor.

[0207] In some embodiments, the targeting receptor comprises a chimeric antigen receptor (CAR), a T cell receptor (TCR), and a receptor for a cell surface molecule operably linked through at least a transmembrane domain within an internal signaling domain that can activate T cells upon binding of the extracellular receptor portion. In some embodiments, CAR refers to an scFv, VHH, or nanobody operably linked to an extracellular antigen recognition domain, e.g., an intracellular signaling domain that activates T cells upon antigen binding. CARs are composed of four regions: an antigen recognition domain, an extracellular hinge region, a transmembrane domain, and an intracellular T cell signaling domain. Such receptors are well known in the art (see, e.g., WO2020092057, WO2019191114, WO2019147805, and WO2018208837). Reverse universal CARs that facilitate immune cell binding to target cells via an adapter molecule (see, e.g., WO2019238722) are also contemplated. CARs can target any antigen for which an antibody can be developed, and are typically directed to a molecule displayed on the surface of the targeted cell or tissue. In some embodiments, the targeting receptor comprises an antigen recognition domain (e.g., a cancer antigen recognition domain) and a subunit of a TCR (e.g., TRuC). (See Baeuerle et al. Nature Communications 2087 (2019)).

[0208] In some embodiments, the exogenous nucleic acid encodes a TCR. In some embodiments, the exogenous nucleic acid encodes a genetically modified TCR. In some embodiments, the exogenous nucleic acid encodes a genetically modified TCR with specificity for a polypeptide expressed by a cancer cell. In some embodiments, the exogenous nucleic acid encodes a targeting receptor specific for the Wilms tumor gene (WT1) antigen. In some embodiments, the exogenous nucleic acid encodes a WT1-specific TCR (see, e.g., WO2020 / 081613A1).

[0209] In some embodiments, the exogenous nucleic acid is inserted into the genome of the target cell. In some embodiments, the exogenous nucleic acid is integrated into the genome of the target cell. In some embodiments, the exogenous nucleic acid is integrated into the genome of the target cell by homologous recombination (HR). In some embodiments, the exogenous nucleic acid is integrated into the genome of the target cell by blunt-end insertion. In some embodiments, the exogenous nucleic acid is integrated into the genome of the target cell by non-homologous end joining. In some embodiments, the exogenous nucleic acid is integrated into a safe harbor locus in the genome of the cell. In some embodiments, the exogenous nucleic acid is integrated into one of the TRAC locus, the B2M locus, the AAVS1 locus, and / or the CIITA locus. In some embodiments, the exogenous nucleic acid is provided to the cell in a lipid-nucleic acid assembly composition. In some embodiments, the lipid-nucleic acid assembly composition is a lipid nanoparticle (LNP).

[0210] In some embodiments, the methods produce compositions comprising engineered cells that have reduced or eliminated MHC class II expression and contain an exogenous nucleic acid. In some embodiments, the methods produce compositions comprising engineered cells that have reduced or eliminated MHC class II expression and secrete and / or express a polypeptide encoded by an exogenous nucleic acid integrated into the genome of the cell. In some embodiments, the methods produce compositions comprising engineered cells that have reduced or eliminated MHC class II protein expression, reduced or eliminated CIITA protein expression, and / or reduced or eliminated CIITA levels in the cell nucleus, and that elicit a reduced response from NK cells, or that have reduced MHC class I protein expression and secrete and / or express a polypeptide encoded by an exogenous nucleic acid integrated into the genome of the cell. In some embodiments, the engineered cells elicit a reduced response from CD4+ T cells, CD8+ T cells, and / or NK cells.

[0211] In some embodiments, allogeneic cells are provided, the cells having reduced or eliminated expression of MHC class II and MHC class I proteins on the cell surface, the cells comprising a modification in CIITA disclosed herein, the cells comprising a modification in B2M, the cells comprising an exogenous nucleic acid encoding an NK cell inhibitor molecule, and the cells further comprising an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor). In some embodiments, the allogeneic cells elicit a reduced response from CD4+ T cells, CD8+ T cells, and / or NK cells, and further secrete and / or express a therapeutic agent.

[0212] In embodiments, allogeneic cells are provided, the cells having reduced or eliminated expression of MHC class II and HLA-A proteins on the cell surface, the cells comprising a modification in a CIITA gene disclosed herein, the cells comprising a modification in an HLA-A gene, and the cells further comprising an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor). In some embodiments, the allogeneic cells elicit a reduced response from CD4+ T cells and / or CD8+ T cells.

[0213] In some embodiments, the present disclosure provides a method for reducing or eliminating the expression of MHC class II protein on the surface of cells by genetically modifying the CIITA disclosed herein, and the method further provides for reducing the expression of one or more additional target genes (e.g., TRAC, TRBC). In some embodiments, the additional genetic modification provides additional benefits for the use of genetically modified cells for adoptive cell transplantation applications. In some embodiments, the cells are allogeneic cells.

[0214] In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein on the surface of a cell, comprising genetically modifying CIITA, and comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, wherein the method further comprises contacting the cell with a guide RNA that directs an RNA-guided DNA binder to a target sequence located in another gene (e.g., a gene other than CIITA or B2M or HLA-A), thereby reducing or eliminating expression of the other gene. In some embodiments, the method comprises reducing expression of an MHC class II protein on the surface of a cell, comprising genetically modifying CIITA, and comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, wherein the method further comprises contacting the cell with a guide RNA that directs an RNA-guided DNA binder to a target sequence located in another gene, and with a B2M guide RNA, thereby reducing or eliminating expression of an MHC class I protein on the surface of the cell. In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein on the surface of the cell, comprises genetically modifying CIITA, comprises contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cell with a guide RNA that directs the RNA-guided DNA binder to a target sequence located in another gene (thereby reducing or eliminating expression of the other gene), and an exogenous nucleic acid encoding a polypeptide (e.g., a targeted receptor).

[0215] In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein on the surface of a cell, comprising genetically modifying CIITA, and comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cell with an RNA-guided DNA binder with a guide RNA directed to a target sequence located in another gene (e.g., a gene other than CIITA or B2M or HLA-A), thereby reducing or eliminating expression of the other gene. In some embodiments, the method comprises reducing expression of an MHC class II protein on the surface of a cell, comprising genetically modifying CIITA, and comprising contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cell with an RNA-guided DNA binder with a guide RNA directed to a target sequence located in another gene, and with an HLA-A guide RNA, thereby reducing or eliminating expression of an HLA-A protein on the surface of the cell. In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein on the surface of the cell, comprises genetically modifying CIITA, comprises contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cell with a guide RNA that directs the RNA-guided DNA binder to a target sequence located in another gene (thereby reducing or eliminating expression of the other gene), and an exogenous nucleic acid encoding a polypeptide (e.g., a targeted receptor).

[0216] In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein on the surface of the cell, comprises genetically modifying CIITA, comprises contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cell with a guide RNA that directs the RNA-guided DNA binder to a target sequence located in another gene (thereby reducing expression of the other gene), a B2M guide RNA (thereby reducing expression of an MHC class I protein on the surface of the cell), and an exogenous nucleic acid encoding an NK cell inhibitor.

[0217] In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein on the surface of the cell, comprises genetically modifying CIITA, and comprises contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cell with a guide RNA that directs the RNA-guided DNA binder to a target sequence located in another gene (thereby reducing expression of the other gene), and an HLA-A guide RNA (thereby reducing expression of an HLA-A protein on the surface of the cell).

[0218] In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein on the surface of the cell, comprises genetically modifying CIITA, and comprises contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cell with a guide RNA that directs the RNA-guided DNA binder to a target sequence located in another gene (thereby reducing or eliminating expression of the other gene), a B2M guide RNA (thereby reducing or eliminating expression of an MHC class I protein on the surface of the cell), and an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor).

[0219] In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein on the surface of the cell, comprises genetically modifying CIITA, comprises contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cell with a guide RNA that directs the RNA-guided DNA binder to a target sequence located in another gene, an exogenous nucleic acid encoding an NK cell inhibitor molecule, and an exogenous nucleic acid encoding a polypeptide (e.g., a targeted receptor).

[0220] In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein on the surface of the cell, comprises genetically modifying CIITA, comprises contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cell with a guide RNA that directs the RNA-guided DNA binder to a target sequence located in another gene (thereby reducing expression of the other gene), and an HLA-A guide RNA (thereby reducing expression of an HLA-A protein on the surface of the cell), and an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor).

[0221] In some embodiments, the method comprises reducing or eliminating expression of an MHC class II protein on the surface of a cell, comprises genetically modifying CIITA, comprises contacting the cell with a composition comprising a CIITA guide RNA disclosed herein, and the method further comprises contacting the cell with a guide RNA that directs the RNA-guided DNA binder to a target sequence located in another gene (thereby reducing or eliminating expression of the additional gene), a B2M guide RNA (thereby reducing or eliminating expression of an MHC class I protein on the surface of the cell), an exogenous nucleic acid encoding an NK cell inhibitor molecule, and an exogenous nucleic acid encoding a polypeptide (e.g., a targeted receptor). In some embodiments, the method further comprises contacting the cell with an RNA-guided DNA binder.

[0222] In some embodiments, the methods comprise reducing or eliminating expression of an MHC class II protein on the surface of a cell, and comprise genetically modifying the cell with one or more compositions comprising a CIITA guide RNA disclosed herein, a B2M guide RNA, an exogenous nucleic acid encoding an NK cell inhibitor molecule, an exogenous nucleic acid encoding a polypeptide (e.g., a targeted receptor), a guide RNA that directs an RNA-guided DNA binder to a target sequence located in another gene (thereby reducing or eliminating expression of the other gene), and an RNA-guided DNA binder, or a nucleic acid encoding an RNA-guided DNA binder.

[0223] In some embodiments, the methods involve reducing or eliminating expression of an MHC class II protein on the surface of a cell, and involve genetically modifying the cell with one or more compositions comprising a CIITA guide RNA disclosed herein, an HLA-A guide RNA, an exogenous nucleic acid encoding a polypeptide (e.g., a targeting receptor), a guide RNA that directs an RNA-guided DNA binder to a target sequence located in another gene (thereby reducing or eliminating expression of the other gene), and an RNA-guided DNA binder, or a nucleic acid encoding an RNA-guided DNA binder.

[0224] In some embodiments, the additional target gene is TRAC. In some embodiments, the additional target gene is TRBC.

[0225] D. Exemplary Cell Types In some embodiments, the methods and compositions disclosed herein genetically modify cells. In some embodiments, the cells are allogeneic cells. In some embodiments, the cells are human cells. In some embodiments, the genetically modified cells are referred to as engineered cells. Engineered cells refer to cells (or progeny of cells) that contain an engineered genetic modification, e.g., have been contacted with a gene editing system and have been genetically modified by the gene editing system. The terms "engineered cells" and "genetically modified cells" are used interchangeably throughout. Engineered cells can be any of the exemplary cell types disclosed herein.

[0226] In some embodiments, the cell is an immune cell. As used herein, "immune cell" refers to a cell of the immune system, including, for example, lymphocytes (e.g., T cells, B cells, natural killer cells ("NK cells," and NKT cells, or iNKT cells)), monocytes, macrophages, mast cells, dendritic cells, or granulocytes (e.g., neutrophils, eosinophils, and basophils). In some embodiments, the cell is a primary immune cell. In some embodiments, the immune system cell is a CD3 + , CD4 +, and CD8 + The immune cells may be selected from T cells, regulatory T cells (Tregs), B cells, NK cells, and dendritic cells (DCs). In some embodiments, the immune cells are allogeneic.

[0227] In some embodiments, the cell is a lymphocyte. In some embodiments, the cell is an adaptive immune cell. In some embodiments, the cell is a T cell. In some embodiments, the cell is a B cell. In some embodiments, the cell is a NK cell. In some embodiments, the lymphocyte is allogeneic.

[0228] As used herein, a T cell may be defined as a cell that expresses a T cell receptor ("TCR" or "αβ TCR" or "γδ TCR"), although in some embodiments, the TCR of a T cell may be genetically modified (e.g., by genetic modification to the TRAC or TRBC gene) to reduce its expression, and thus expression of the protein CD3 may be used as a marker to identify T cells by standard flow cytometry methods. CD3 is a multi-subunit signaling complex that associates with the TCR. Thus, T cells may be referred to as CD3+. In some embodiments, a T cell is a cell that expresses the CD3+ marker and either the CD4+ or CD8+ marker. In some embodiments, the T cell is allogeneic.

[0229] In some embodiments, T cells express the glycoprotein CD8 and are therefore CD8+ by standard flow cytometry and may be referred to as "cytotoxic" T cells. In some embodiments, T cells express the glycoprotein CD4 and are therefore CD4+ by standard flow cytometry and may be referred to as "helper" T cells. CD4+ T cells can differentiate into subsets and may be referred to as Th1 cells, Th2 cells, Th9 cells, Th17 cells, Th22 cells, T regulatory ("Treg") cells, or T follicular helper cells ("Tfh"). Each CD4+ subset releases specific cytokines that may have either pro- or anti-inflammatory, survival, or protective functions. T cells may be isolated from a subject by CD4+ or CD8+ selection methods.

[0230] In some embodiments, the T cells are memory T cells. In the body, memory T cells have encountered antigen. Memory T cells can be located in secondary lymphoid organs (central memory T cells) or recently infected tissues (effector memory T cells). Memory T cells can be CD8+ T cells. Memory T cells can be CD4+ T cells.

[0231] As used herein, "central memory T cells" can be defined as antigen-experienced T cells, which may express, for example, CD62L and CD45RO. Central memory T cells may be detected as CD62L+ and CD45RO+, and also express CCR7, and therefore may be detected as CCR7+ by standard flow cytometry methods.

[0232] As used herein, "early stem cell memory T cells" (or "Tscm") can be defined as T cells that express CD27 and CD45RA and are therefore CD27+ and CD45RA+ by standard flow cytometry. Tscm do not express the CD45 isoform CD45RO, and therefore, when stained for this isoform by standard flow cytometry, Tscm are also CD45RO-. Thus, CD45RO-CD27+ cells are also early stem cell memory T cells. Tscm cells also express CD62L and CCR7 and can therefore be detected as CD62L+ and CCR7+ by standard flow cytometry. Early stem cell memory T cells have been shown to correlate with increased persistence and therapeutic efficacy of cell therapy products.

[0233] In some embodiments, the cells are B cells. As used herein, a "B cell" can be defined as a cell that expresses CD19 and / or CD20, and / or B-cell maturation antigen ("BCMA"), and thus the B cells are CD19+, and / or CD20+, and / or BCMA+ by standard flow cytometry. The B cells are further negative for CD3 and CD56 by standard flow cytometry. The B cells can be plasma cells. The B cells can be memory B cells. The B cells can be naive B cells. The B cells can be IgM+ or have a class-switched B cell receptor (e.g., IgG+ or IgA+). In some embodiments, the B cells are allogeneic.

[0234] In some embodiments, the cells are mononuclear cells, e.g., derived from bone marrow or peripheral blood. In some embodiments, the cells are peripheral blood mononuclear cells ("PBMCs"). In some embodiments, the cells are PBMCs, e.g., lymphocytes or monocytes. In some embodiments, the cells are peripheral blood lymphocytes ("PBLs"). In some embodiments, the mononuclear cells are allogeneic.

[0235] Cells used in ACT and / or tissue regeneration therapy include, for example, stem cells, progenitor cells, and primary cells. Stem cells include, for example, pluripotent stem cells (PSCs), induced pluripotent stem cells (iPSCs), embryonic stem cells (ESCs), mesenchymal stem cells (MSCs, e.g., isolated from bone marrow (BM), peripheral blood (PB), placenta, umbilical cord (UC), or adipose tissue), hematopoietic stem cells (HSCs, e.g., isolated from BM or UC), neural stem cells (NSCs), tissue-specific progenitor stem cells (TSPSCs), and limbal stem cells (LSCs). Progenitor and primary cells include mononuclear cells (MNCs, e.g., isolated from BM or PB), endothelial progenitor cells (EPCs, e.g., isolated from BM, PB, and UC), neural progenitor cells (NPCs), and tissue-specific primary cells or cells derived therefrom (TSCs), including chondrocytes, myocytes, and keratinocytes. Also included are cells for organ or tissue transplantation, such as pancreatic islet cells, cardiomyocytes, thyroid cells, thymocytes, nerve cells, skin cells, and retinal cells.

[0236] In some embodiments, the cells are human cells, such as cells isolated from a human subject. In some embodiments, the cells are isolated from human donor PBMCs or leukopaks. In some embodiments, the cells are from a subject with a condition, disorder, or disease. In some embodiments, the cells are from a human donor with Epstein-Barr virus ("EBV").

[0237] In some embodiments, the method is carried out ex vivo. As used herein, "ex vivo" refers to an in vitro method, such as an ACT therapy, in which cells can be transferred to a subject. In some embodiments, the ex vivo method is an in vitro method that includes an ACT therapy cell or cell population.

[0238] In some embodiments, the cells are derived from a cell line. In some embodiments, the cell line is derived from a human subject. In some embodiments, the cell line is a lymphoblastoid cell line ("LCL"). The cells may be cryopreserved and thawed. The cells may not have been previously cryopreserved.

[0239] In some embodiments, the cells are from a cell bank. In some embodiments, the cells are genetically modified and then transferred to a cell bank. In some embodiments, cells are removed from a subject, genetically modified ex vivo, and transferred to a cell bank. In some embodiments, a genetically modified population of cells is transferred to a cell bank. In some embodiments, a genetically modified population of immune cells is transferred to a cell bank. In some embodiments, a genetically modified population of immune cells comprising first and second subpopulations, the first and second subpopulations having at least one common genetic modification and at least one different genetic modification, is transferred to a cell bank.

[0240] In some embodiments, when the cells are homozygous for HLA-B, the HLA-B alleles are selected from the following HLA-B alleles: HLA-B*07:02, HLA-B*08:01, HLA-B*44:02, HLA-B*35:01, HLA-B*40:01, HLA-B*57:01, HLA-B*14:02, HLA-B*15:01, HLA-B*13:02, HLA-B*44:03, HLA-B*38:01, HLA-B*18:01, HLA-B*44:03, HLA - selected from any one of HLA-B*51:01, HLA-B*49:01, HLA-B*15:01, HLA-B*18:01, HLA-B*27:05, HLA-B*35:03, HLA-B*18:01, HLA-B*52:01, HLA-B*51:01, HLA-B*37:01, HLA-B*53:01, HLA-B*55:01, HLA-B*44:02, HLA-B*44:03, HLA-B*35:02, HLA-B*15:01, and HLA-B*40:02.

[0241] In some embodiments, when the cells are homozygous for HLA-C, the HLA-C alleles are selected from the following HLA-C alleles: HLA-C*07:02, HLA-C*07:01, HLA-C*05:01, HLA-C*04:01, HLA-C*03:04, HLA-C*06:02, HLA-C*08:02, HLA-C*03:03, HLA-C*06:02, HLA-C*16:01, HLA-C*12:03, HLA-C*07:01, HLA-C*04:01, HLA -C*15:02, HLA-C*07:01, HLA-C*03:04, HLA-C*12:03, HLA-C*02:02, HLA-C*04:01, HLA-C*05:01, HLA-C*12:02, HLA-C*14:02, HLA-C*06:02, HLA-C*04:01, HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*04:01, HLA-C*04:01, and HLA-C*02:02.

[0242] In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C, and the HLA-B alleles are the following HLA-B alleles: HLA-B*07:02, HLA-B*08:01, HLA-B*44:02, HLA-B*35:01, HLA-B*40:01, HLA-B*57:01, HLA-B*14:02, HLA-B*15:01, HLA-B*13:02, HLA-B*44:03, HLA-B*38 ...57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA-B*57:01, HLA *18:01, HLA-B*44:03, HLA-B*51:01, HLA-B*49:01, HLA-B*15:01, HLA-B*18:01, HLA-B*27:05, HLA-B*35:03, HLA-B*18:01, HLA- B*52:01, HLA-B*51:01, HLA-B*37:01, HLA-B*53:01, HLA-B*55:01, HLA-B*44:02, HLA-B*44:03, HLA-B*35:02, HLA-B*15:01, and HL A-B*40:02, and the HLA-C allele is selected from any one of the following HLA-C alleles: HLA-C*07:02, HLA-C*07:01, HLA-C*05:01, HLA-C*04:01, HLA-C*03:04, HLA-C*06:02, HLA-C*08:02, HLA-C*03:03, HLA-C*06:02, HLA-C*16:01, HLA-C*12:03, HLA-C*07:01, HLA-C*04:01, HLA-C*16:02 ... HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*03:04, HLA-C*12:03, HLA-C*02:02, HLA-C*04:01, HLA-C*05:01, HLA-C*12:02, HLA-C*14:02, HLA-C*06:02, HLA-C*04:01, HLA-C*03:03, HLA-C*07:04, HLA-C*07:01, HLA-C*04:01, HLA-C*04:01, and HLA-C*02:02.

[0243] In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C, and the HLA-B and HLA-C alleles are the following HLA-B and HLA-C alleles: HLA-B*07:02 and HLA-C*07:02, HLA-B*08:01 and HLA-C*07:01, HLA-B*44:02 and HLA-C*05:01, HLA-B*35:01 and HLA-C*04:01, HLA-B*40:01 and HLA-C*03:01. 4, HLA-B*57:01 and HLA-C*06:02, HLA-B*14:02 and HLA-C*08:02, HLA-B*15:01 and HLA-C*03:03, HLA-B*13:02 and HLA-C*06:02, HLA-B* 44:03 and HLA-C*16:01, HLA-B*38:01 and HLA-C*12:03, HLA-B*18:01 and HLA-C*07:01, HLA-B*44:03 and HLA-C*04:01, HLA-B*51:01 and H LA-C*15:02, HLA-B*49:01 and HLA-C*07:01, HLA-B*15:01 and HLA-C*03:04, HLA-B*18:01 and HLA-C*12:03, HLA-B*27:05 and HLA-C*02: 02, HLA-B*35:03 and HLA-C*04:01, HLA-B*18:01 and HLA-C*05:01, HLA-B*52:01 and HLA-C*12:02, HLA-B*51:01 and HLA-C*14:02, HLA-B In some embodiments, the HLA-B alleles are selected from any one of HLA-B*37:01 and HLA-C*06:02, HLA-B*53:01 and HLA-C*04:01, HLA-B*55:01 and HLA-C*03:03, HLA-B*44:02 and HLA-C*07:04, HLA-B*44:03 and HLA-C*07:01, HLA-B*35:02 and HLA-C*04:01, HLA-B*15:01 and HLA-C*04:01, and HLA-B*40:02 and HLA-C*02:02. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C, and the HLA-B and HLA-C alleles are HLA-B*07:02 and HLA-C*07:02.In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C, where the HLA-B and HLA-C alleles are HLA-B*08:01 and HLA-C*07:01. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C, where the HLA-B and HLA-C alleles are HLA-B*44:02 and HLA-C*05:01. In some embodiments, the cells are homozygous for HLA-B and homozygous for HLA-C, where the HLA-B and HLA-C alleles are HLA-B*35:01 and HLA-C*04:01.

[0244] III. Details of the gene editing system Various suitable gene editing systems may be used to create the engineered cells disclosed herein, including, but not limited to, CRISPR / Cas systems, zinc finger nuclease (ZFN) systems, and transcription activator-like effector nuclease (TALEN) systems. Generally, gene editing systems involve the use of engineered cleavage systems to induce double-strand breaks (DSBs) or nicks (e.g., single-strand breaks, or SSBs) in target DNA sequences. Cleavage or nicking can occur by using specific nucleases, such as engineered ZFNs or TALENs, or by using CRISPR / Cas systems with engineered guide RNAs to induce specific cleavage or nicking of target DNA sequences. Additionally, targeted nucleases have been developed based on the Argonaute system (e.g., from T. thermophilus known as "TtAgo", see Swarts et al (2014) Nature 507(7491):258-261), which may also have potential for use in gene editing and gene therapy.

[0245] In some embodiments, the gene editing system is a TALEN system. Transcription activator-like effector nucleases (TALENs) are restriction enzymes that can be engineered to cleave specific sequences in DNA. They are created by fusing a TAL effector DNA binding domain to a DNA cleavage domain (a nuclease that cleaves DNA strands). Transcription activator-like effectors (TALEs) can be engineered to bind to desired DNA sequences and promote DNA cleavage at specific locations (see, for example, Boch, 2011, Nature Biotech). Restriction enzymes can be introduced into cells for use in gene editing or for in situ gene editing, a technique known as gene editing using engineered nucleases. Such methods and compositions for use therein are known in the art. See, for example, WO2019147805, WO2014040370, and WO2018073393, the contents of which are incorporated herein in their entireties.

[0246] In some embodiments, the gene editing system is a zinc finger system. Zinc finger nuclease (ZFN) is an artificial restriction enzyme that is generated by fusing a zinc finger DNA binding domain with a DNA cleavage domain. The zinc finger domain can be engineered to target specific desired DNA sequences, so that zinc finger nucleases can target unique sequences within complex genomes. The non-specific cleavage domain from type II restriction endonuclease FokI is typically used as the cleavage domain in ZFN. The cleavage is repaired by endogenous DNA repair mechanisms, allowing ZFN to precisely modify the genome of higher organisms. Such methods and compositions for use therein are known in the art. For example, see WO2011091324, the entire contents of which are incorporated herein by reference.

[0247] In some embodiments, the gene editing system is a CRISPR / Cas system, e.g., comprising a CRISPR guide RNA comprising a guide sequence and an RNA-guided DNA binding agent, as further described herein.

[0248] A. CRISPR guide RNA Provided herein are guide sequences useful for modifying target sequences, for example, using guide RNAs, including the disclosed guide sequences, with RNA-guided DNA-binding agents (e.g., CRISPR / Cas systems).

[0249] Each of the guide sequences disclosed herein may further comprise additional nucleotides to form a crRNA, for example, at its 3' end, the guide sequence has the following exemplary nucleotide sequence following it: in the 5' to 3' direction, GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 170). In the case of an sgRNA, the above-mentioned guide sequences may further comprise additional nucleotides (scaffold sequences) to form an sgRNA, for example, at the 3' end of the guide sequence, the following exemplary nucleotide sequence following it: in the 5' to 3' direction, GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 171) or GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 172, which is SEQ ID NO: 171 without the four terminal Us). In some embodiments, none of the four terminal Us of SEQ ID NO: 171 are present. In some embodiments, only 1, 2, or 3 of the four terminal Us of SEQ ID NO: 171 are present.

[0250] In some embodiments, the sgRNA comprises any one of the guide sequences of SEQ ID NOs: 1-117 and additional nucleotides to form a crRNA, for example, having the following exemplary nucleotide sequence at its 3' end following the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGCACCGAGUCGGUGC (SEQ ID NO: 173) in the 5' to 3' direction. SEQ ID NO: 173 lacks 8 nucleotides, referencing the following wild-type guide RNA conserved sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 172). Other exemplary scaffold nucleotide sequences are provided in Table 4. In some embodiments, the sgRNA comprises any one of the guide sequences of SEQ ID NOs: 1-117 and an additional guide scaffold sequence in the 5' to 3' direction of Table 4, comprising a modified version of the scaffold sequence, as shown.

[0251] In some embodiments, the guide RNA is an sgRNA comprising any one of the sequences set forth in Table 2 (SEQ ID NOS: 218-334 and 335-426). In some embodiments, the guide RNA is a chemically modified guide RNA. In some embodiments, the guide RNA is a chemically modified single guide RNA. The chemically modified guide RNA may comprise one or more of the modifications set forth in Table 2. The chemically modified guide RNA may comprise one or more modified nucleotides of any one of SEQ ID NOS: 1006, 1010-1012, and 1014-1017.

[0252] In some embodiments, the guide RNA is an sgRNA comprising any one of SEQ ID NOs: 218-334 with at least one chemical modification disclosed herein. In some embodiments, the guide RNA is an sgRNA comprising a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any one of SEQ ID NOs: 218-334 and with at least one chemical modification disclosed herein.

[0253] In some embodiments, the guide RNA is an sgRNA comprising the modification pattern set forth in SEQ ID NO: 1016 or 1017. In some embodiments, the guide RNA is an sgRNA comprising a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids in SEQ ID NOs: 335-426.

[0254] In some embodiments, the guide RNA comprises an sgRNA comprising the modification pattern set forth in SEQ ID NO: 1006. In some embodiments, the guide RNA comprises an sgRNA comprising the modified nucleotides of SEQ ID NO: 1006, which comprises a guide sequence comprising a sequence selected from SEQ ID NOs: 1-117. In some embodiments, the guide RNA is an sgRNA comprising the sequence of SEQ ID NO: 1008, or a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to SEQ ID NO: 1008.

[0255] In some embodiments, the guide RNA is a single guide RNA comprising any one of the sequences set forth in SEQ ID NOs: 335-426 and 1008, or a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any one of the sequences set forth in SEQ ID NOs: 335-426 and 1008. In some embodiments, the guide RNA is a single guide sequence comprising any one of SEQ ID NOs: 32, 64, 67, 68, 74, 76, 84, 86, 90, 91, and 115. In some embodiments, the guide RNA is a single guide RNA comprising any one of the sequences of SEQ ID NOs: 341, 373, 376, 377, 383, 385, 393, 395, 399, 400, and 424, or a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any one of the sequences of SEQ ID NOs: 341, 373, 376, 377, 383, 385, 393, 395, 399, 400, and 424.

[0256] The guide RNA may further comprise a trRNA. In each composition and method embodiment described herein, the crRNA and trRNA may be associated as a single RNA (sgRNA) or may be on separate RNAs (dgRNA). In the context of an sgRNA, the crRNA and trRNA components may be covalently linked, for example, via a phosphodiester bond or other covalent bond. In some embodiments, the crRNA and / or trRNA sequence may be referred to as the "scaffold" or "conserved portion" of the guide RNA.

[0257] In each of the composition, use, and method embodiments described herein, the guide RNA may comprise two RNA molecules as a "dual guide RNA" or "dgRNA." The dgRNA comprises a first RNA molecule comprising a crRNA, e.g., comprising a guide sequence as shown in Table 2, and a second RNA molecule comprising a trRNA. The first and second RNA molecules may not be covalently linked, but may form an RNA duplex by base pairing between portions of the crRNA and trRNA.

[0258] In each of the embodiments of the compositions, uses, and methods described herein, the guide RNA may comprise a single RNA molecule referred to as a "single guide RNA" or "sgRNA." The sgRNA may comprise a crRNA (or a portion thereof) comprising a guide sequence shown in Table 2 covalently linked to a trRNA. The sgRNA may comprise 17, 18, 19, or 20 consecutive nucleotides of a guide sequence shown in Table 2. In some embodiments, the crRNA and trRNA are covalently linked via a linker. In some embodiments, the sgRNA forms a stem-loop structure by base pairing between portions of the crRNA and trRNA. In some embodiments, the crRNA and trRNA are covalently linked via one or more bonds that are not phosphodiester bonds.

[0259] In some embodiments, the trRNA may comprise all or part of a trRNA sequence from a naturally occurring CRISPR / Cas system. In some embodiments, the trRNA comprises a truncated or modified wild-type trRNA. The length of the trRNA depends on the CRISPR / Cas system used. In some embodiments, the trRNA comprises or consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 nucleotides. In some embodiments, the trRNA may comprise a specific secondary structure, such as, for example, one or more hairpin or stem-loop structures, or one or more bulges.

[0260] In some embodiments, compositions are provided that include one or more guide RNAs comprising any one of the guide sequences in Table 2. In some embodiments, compositions are provided that include one or more guide RNAs comprising any one of the guide sequences in Table 2, wherein the guide sequence is followed at its 3' end by nucleotides of SEQ ID NO: 170, 171, 172, or 173. In some embodiments, one or more guide RNAs comprising any one of the guide sequences in Table 2, wherein the guide sequence is followed at its 3' end by nucleotides of SEQ ID NO: 170, 171, 172, or 173, are modified according to the modification pattern of any one of SEQ ID NOs: 1006, 1010-1012, and 1014-1017.

[0261] In some embodiments, compositions are provided comprising one or more guide RNAs comprising any one of the guide sequences in Table 2. In one aspect, the invention provides compositions comprising one or more gRNAs comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs: 1-117.

[0262] In other embodiments, compositions are provided that include at least one, e.g., at least two, gRNAs that include a guide sequence selected from any two or more of the guide sequences shown in Table 2. In some embodiments, the compositions include at least two gRNAs that each include a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the guide sequences shown in Table 2.

[0263] In some embodiments, the guide RNA composition of the present invention is designed to recognize (e.g., hybridize to) a target sequence in CIITA. For example, the CIITA target sequence can be recognized and cleaved by a provided Cas cleavage comprising a guide RNA. In some embodiments, an RNA-guided DNA binding agent, such as a Cas cleavage, can be directed to the target sequence in CIITA by the guide RNA, where the guide sequence of the guide RNA hybridizes to the target sequence, and the RNA-guided DNA binding agent, such as a Cas cleavage, cleaves the target sequence.

[0264] In some embodiments, the selection of one or more guide RNAs is determined based on the target sequence in CIITA. In some embodiments, the composition comprising one or more guide sequences comprises guide sequences complementary to the corresponding genomic regions shown in Table 2 according to coordinates from the human reference genome hg38. In further embodiments, the guide sequences may be complementary to sequences near any of the genomic coordinates listed in Table 2 in CIITA. For example, in further embodiments, the guide sequences may be complementary to sequences comprising 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 2.

[0265] Without being bou...

Claims

1. An engineered cell comprising a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, and wherein the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10902662-10923285.

2. The genetic modification comprises at least 5, 6, 7, 8, 9, or 10 consecutive nucleotides within genomic coordinates chr16:10902662-10923285; and / or the genetic modification comprises at least one C to T substitution or at least one A to G substitution within genomic coordinates chr16:10902662-chr16:10923285; and / or the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10906542-chr16:10923285; and / or the genetic modification comprises at least one nucleotide of an exon within genomic coordinates chr16:10906542-chr16:10908121; The engineered cell of claim 1 .

3. (i) The genetic modification is selected from the group consisting of chr16:10907539-10907559, chr16:10916426-10916446, chr16:10906907-10906927, chr16:10895702-10895722, chr16:10907757-10907777, chr16:10907623-10907643, chr and / or comprising at least one nucleotide of an exon within genomic coordinates selected from chr16:10915626-10915646, chr16:10906756-10906776, chr16:10907476-10907496, chr16:10907385-10907405, and chr16:10923265-10923285; and / or (ii) the genetic modification is chr16: 10916432-10916452, chr16: 10922444-10922464, chr16: 10907924-10907944, chr16: 10906985-10907005, chr16: 10908073-10908093, chr16: 10907433-10907453, chr16: 10907979-10907999, chr16: 10907139-10907159, chr16: 10922435-10922455, chr16: 10 907384-10907404, chr16:10907434-10907454, chr16:10907119-1090 7139, chr16:10907539-10907559, chr16:10907810-10907830, chr16: 10907315-10907335, chr16:10916426-10916446, chr16:10909138-10 909158, chr16:10908101-10908121, chr16:10907790-10907810, chr16 :10907787-10907807, chr16:10907454-10907474, chr16:10895702-1 0895722, chr16:10902729-10902749, chr16:10918492-10918512, chr 16:10907932-10907952, chr16:10907623-10907643, chr16:10907461 -10907481, chr16:10902723-10902743, chr16:10907622-10907642, ch r16:10922441-10922461, chr16:10902662-10902682, chr16:1091562 6-10915646, chr16:10915592-10915612, chr16:10907385-10907405, c hr16:10907030-10907050, chr16:10907935-10907955, chr16:109068 53-10906873, chr16:10906757-10906777, chr16:10907730-10907750,and chr16: 10895302-10895322, comprising at least one nucleotide of an exon within genomic coordinates selected from The engineered cell of claim 1 or 2.

4. An engineered cell comprising a genetic modification in the CIITA gene, wherein the engineered cell has reduced or eliminated surface expression of MHC class II compared to an unmodified cell, and wherein the genetic modification is selected from the group consisting of chr16:10902662-10902682, chr16:10902723-10902743, chr16:10902729-10902749, chr16:10903747-10903767, chr16:10903824-10903844, chr16:1090 3848-10903868, chr16:10904761-10904781, chr16:10904764-10904784 , chr16:10904765-10904785, chr16:10904785-10904805, chr16:109065 42-10906562, chr16:10906556-10906576, chr16:10906609-10906629, c hr16:10906610-10906630, chr16:10906616-10906636, chr16:10906682- 10906702, chr16:10906756-10906776, chr16:10906757-10906777, chr1 6:10906757-10906777, chr16:10906821-10906841, chr16:10906823-10 906843, chr16:10906847-10906867, chr16:10906848-10906868, chr16: 10906853-10906873, chr16:10906904-10906924, chr16:10906907-1090 6927, chr16:10906913-10906933, chr16:10906968-10906988, chr16:10 906970-10906990, chr16:10906985-10907005, chr16:10907030-109070 50, chr16:10907058-10907078, chr16:10907119-10907139, chr16:1090 7139-10907159, chr16:10907172-10907192, chr16:10907272-10907292,chr16:10907288-1090730000 and chr16:109073344-1090734 5-10907335、chr16:10907325-10907 345、chr16:10907363-10907383、chr 1999-04-2019 and 1999-04-2019 09059444, 090594 ... 10:00 AM - 11:00 AM 48, 49, 54, 55, 56, 57, 58 0904 904 904 904 1, 2019-04-26 2019-04-26 2019-04-26 30-10907750、chr16:10907731-109 07751、chr16:10907757-10907777、c hr16:10907781-10907801、chr16:10 907787-10907807、chr16:10907790- 10907810、chr16:10907810-109078 30、chr16:10907820-10907840、chr1 9:0 ... 09044, 090444, 090444 0904 935 935 935 9.9, 9.9 (11:00 AM) 9.9 (11:00 AM) 9.9 (11:00 AM) 9.9 (11:00 AM) 911-03-2019, 911-03-2019, 911-03-2019, 911-03-2019,chr16:10910195-10910215, chr16:10910196-10910216, chr16:109155 92-10915612, chr16:10915626-10915646, chr16:10916375-10916395, c hr16:10916382-10916402, chr16:10916426-10916446, chr16:1091643 2-10916452, chr16:10918486-10918506, chr16:10918492-10918512, ch the engineered cell comprises an indel, a C to T substitution, or an A to G substitution within a genomic coordinate selected from r16:10918493-10918513, chr16:10922435-10922455, chr16:10922441-10922461, chr16:10922441-10922461, chr16:10922444-10922464, chr16:10922460-10922480, chr16:10923257-10923277, and chr16:10923265-10923285.

5. (i) The genetic modification is selected from the group consisting of chr16:10916432-10916452, chr16:10922444-10922464, chr16:10907924-10907944, chr16:10906985-10907005, chr16:10908073-10908093, chr16:10907433-10907453, chr16:10907979-10907999, chr16:10907139-10907159, chr16:10922435-10922455, chr16:10907384- 10907404, chr16:10907434-10907454, chr16:10907119-10907139, chr 16:10907539-10907559, chr16:10907810-10907830, chr16:10907315-1 0907335, chr16:10916426-10916446, chr16:10909138-10909158, chr16 :10908101-10908121, chr16:10907790-10907810, chr16:10907787-109 07807, chr16:10907454-10907474, chr16:10895702-10895722, chr16: 10902729-10902749, chr16:10918492-10918512, chr16:10907932-1090 7952, chr16:10907623-10907643, chr16:10907461-10907481, chr16:10 902723-10902743, chr16:10907622-10907642, chr16:10922441-109224 61, chr16:10902662-10902682, chr16:10915626-10915646, chr16:109 15592-10915612, chr16:10907385-10907405, chr16:10907030-1090705 0, chr16:10907935-10907955, chr16:10906853-10906873, chr16:10906 757-10906777, chr16:10907730-10907750, chr16:10907586-10907606,and / or comprising at least one nucleotide of an exon within genomic coordinates selected from chr16:10907476-10907496, chr16:10906904-10906924, and chr16:10895302-10895322; (ii) the genetic modification is chr16: 10907539-10907559, chr16: 10916426-10916446, chr16: 10906907-10906927, chr16: 10895702-10895722, chr16: 10907757-10907777, chr16: 10907623-10907643, comprising at least one nucleotide of an exon within genomic coordinates selected from chr16:10915626-10915646, chr16:10906756-10906776, chr16:10907476-10907496, chr16:10907385-10907405, and chr16:10923265-10923285; The engineered cell of claim 4.

6. The genetic modification comprises at least 5, 6, 7, 8, 9, or 10 consecutive nucleotides within the genomic coordinates; and / or the genetic modification comprises at least one C to T substitution or at least one A to G substitution within the genomic coordinates; The engineered cell of claim 4 or 5. (i) the MHC class II expression is selected from the group consisting of chr16:10902662-10902682, chr16:10902723-10902743, chr16:10902729-10902749, chr16:10903747-10903767, chr16:10903824-10903844, chr16:10903824-10903844, chr16:10903848-10903868, chr16:10904761-10904781, chr16:10904764-10904784, chr16:10904 765-10904785, chr16:10904785-10904805, chr16:10906542-10906562, chr16:10906556-10906576, chr16:10906609-10906629, chr16:1090661 0-10906630, chr16:10906616-10906636, chr16:10906682-10906702, ch r16:10906756-10906776, chr16:10906757-10906777, chr16:10906757- 10906777, chr16:10906821-10906841, chr16:10906823-10906843, chr1 6:10906847-10906867, chr16:10906848-10906868, chr16:10906853-10 906873, chr16:10906853-10906873, chr16:10906904-10906924, chr16: 10906907-10906927, chr16:10906913-10906933, chr16:10906968-1090 6988, chr16:10906970-10906990, chr16:10906985-10907005, chr16:10 907030-10907050, chr16:10907058-10907078, chr16:10907119-109071 39, chr16:10907139-10907159, chr16:10907172-10907192, chr16:1090 7272-10907292, chr16:10907288-10907308, chr16:10907314-10907334,chr16:10907315-109073355, chr16:109073355 3-10907383、chr16:10907384-10907 404、chr16:10907385-10907405、chr 1999-04-2019 and 1999-04-2019 09059444, 090594 ... 10:00 AM - 11:00 AM 9559, 9559 to 1000 people, 955 to 1000 people 09:00 PM, 09:00 PM, 09:00 PM, 09:00 PM 3, 41 101 101 101 101 101 101 101 57-10907777、chr16:10907781-109 07801、chr16:10907787-10907807、c hr16:10907790-10907810、chr16:10 907810-10907830、chr16:10907820- 10907840、chr16:10907870-109078 90、chr16:10907886-10907906、chr1 9:0 ... 0904920, 0904920, 0904920, 0904920 9:00 PM - 11:00 AM, 9:00 AM - 11:00 AM, 9:00 AM 93, 93A, 93C, 93C, 93C, 93C, 93C 934,393,493,493. 113,393,493,493.chr16:10915592-10915612, chr16:10915626-10915646, chr16:10916375-10916395, chr16:10916382-10916402, chr16:10916426-109 16446, chr16:10916432-10916452, chr16:10918486-10918506, chr16:10918492-10918512, chr16:10918493-10918513, chr16:1092243 and wherein the gene editing system binds to a CIITA genomic target sequence that includes at least five consecutive nucleotides within a genomic coordinate selected from: chr16:10922441-10922461, chr16:10922441-10922461, chr16:10922444-10922464, chr16:10922460-10922480, chr16:10923257-10923277, and chr16:10923265-10923285. (ii) the MHC class II expression is chr16: 10906542-10906562, chr16: 10906556-10906576, chr16: 10906609-10906629, chr16: 10906610-10906630, chr16: 10906616-10906636, chr16: 10906682-10906702, chr16: 10906756-10906776, chr16: 10906757-10906777, chr16: 1090 6821-10906841, chr16:10906823-10906843, chr16:10906847-10906867 , chr16:10906848-10906868, chr16:10906853-10906873, chr16:109068 53-10906873, chr16:10906904-10906924, chr16:10906907-10906927, c hr16:10906913-10906933, chr16:10906968-10906988, chr16:10906970- 10906990, chr16:10906985-10907005, chr16:10907030-10907050, chr1 6:10907058-10907078, chr16:10907119-10907139, chr16:10907139-10 907159, chr16:10907172-10907192, chr16:10907272-10907292, chr16: 10907288-10907308, chr16:10907314-10907334, chr16:10907315-1090 7335, chr16:10907325-10907345, chr16:10907363-10907383, chr16:10 907384-10907404, chr16:10907385-10907405, chr16:10907433-109074 53, chr16:10907434-10907454, chr16:10907435-10907455, chr16:1090 7441-10907461, chr16:10907454-10907474, chr16:10907461-10907481,chr16:10907476-109074996 and chr16:1090758 6-10907606、chr16:10907589-10907 609、chr16:10907621-10907641、chr 1945-1948, 1945-1948 090345454, 09034545454, 0903454545454, 090345454545454 10:00 AM to 10:00 AM 900, 9001 and 9002 1985-1996 and 1985-1996 4, 2019-04-26 11:00:00 AM, 2019-04-26 11:00:00 AM 35-10907955、chr16:10907978-109 07998、chr16:10907979-10907999、c hr16:10908069-10908089、chr16:10 908073-10908093、chr16:10908101- 10908121、chr16:10909056-109090 76、chr16:10909138-10909158、chr1 09:001 ... 15012, 151212, 1512121, 1512121, 1512121, 1512121, 15121, 15121, 15121, 15121 0904 ... 52, 2019-05-26T09:0 ... 44561 ...reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence that includes at least five consecutive nucleotides within genomic coordinates selected from chr16: 10922441-10922461, chr16: 10922444-10922464, chr16: 10922460-10922480, chr16: 10923257-10923277, and chr16: 10923265-10923285; (iii) the MHC class II expression is chr16: 10906542-10906562, chr16: 10906556-10906576, chr16: 10906609-10906629, chr16: 10906610-10906630, chr16: 10906616-10906636, chr16: 10906682-10906702, chr16: 10906756-10906776, chr16: 10906757-10906777, chr16: 109 06821-10906841, chr16:10906823-10906843, chr16:10906847-1090686 7, chr16:10906848-10906868, chr16:10906853-10906873, chr16:10906 853-10906873, chr16:10906904-10906924, chr16:10906907-10906927, chr16:10906913-10906933, chr16:10906968-10906988, chr16:10906970 -10906990, chr16:10906985-10907005, chr16:10907030-10907050, chr 16:10907058-10907078, chr16:10907119-10907139, chr16:10907139-1 0907159, chr16:10907172-10907192, chr16:10907272-10907292, chr16 :10907288-10907308, chr16:10907314-10907334, chr16:10907315-1090 7335, chr16:10907325-10907345, chr16:10907363-10907383, chr16:10 907384-10907404, chr16:10907385-10907405, chr16:10907433-109074 53, chr16:10907434-10907454, chr16:10907435-10907455, chr16:1090 7441-10907461, chr16:10907454-10907474, chr16:10907461-10907481,chr16:10907476-10907496, chr16:10907539-10907559, chr16:10907586-10907606, chr16:10907589- 10907609, chr16:10907621-10907641, chr16:10907622-10907642, chr16:10907623-10907643, chr16: 10907730-10907750, chr16:10907731-10907751, chr16:10907757-10907777, chr16:10907781-109078 01, chr16:10907787-10907807, chr16:10907790-10907810, chr16:10907810-10907830, chr16:1090782 0-10907840, chr16:10907870-10907890, chr16:10907886-10907906, chr16:10907924-10907944, chr1 6:10907928-10907948, chr16:10907932-10907952, chr16:10907935-10907955, chr16:10907978-10907 998, chr16:10907979-10907999, chr16:10908069-10908089, chr16:10908073-10908093, and chr16:10908101-10908121, wherein the CIITA genomic target sequence is reduced or eliminated by a gene editing system that binds to the CIITA genomic target sequence comprising at least five consecutive nucleotides within a genomic coordinate selected from the group consisting of: (iv) the MHC class II expression is chr16: 10916432-10916452, chr16: 10922444-10922464, chr16: 10907924-10907944, chr16: 10906985-10907005, chr16: 10908073-10908093, chr16: 10907433-10907453, chr16: 10907979-10907999, chr16: 10907139-10907159, chr16: 10922435-10922455, chr1 6:10907384-10907404, chr16:10907434-10907454, chr16:10907119- 10907139, chr16:10907539-10907559, chr16:10907810-10907830, chr 16:10907315-10907335, chr16:10916426-10916446, chr16:10909138- 10909158, chr16:10908101-10908121, chr16:10907790-10907810, chr 16:10907787-10907807, chr16:10907454-10907474, chr16:10895702 -10895722, chr16:10902729-10902749, chr16:10918492-10918512, ch r16:10907932-10907952, chr16:10907623-10907643, chr16:1090746 1-10907481, chr16:10902723-10902743, chr16:10907622-10907642, c hr16:10922441-10922461, chr16:10902662-10902682, chr16:109156 26-10915646, chr16:10915592-10915612, chr16:10907385-10907405, chr16:10907030-10907050, chr16:10907935-10907955, chr16:109068 53-10906873, chr16:10906757-10906777, chr16:10907730-10907750,and / or is reduced or eliminated by a gene editing system that binds to a CIITA genomic target sequence comprising at least 5 consecutive nucleotides within a genomic coordinate selected from: (v) The MHC class II expression is chr16: 10907539-10907559, chr16: 10916426-10916446, chr16: 10906907-10906927, chr16: 10895702-10895722, chr16: 10907757-10907777, chr16: 10907623-10907643, chr16: 10915626-10 915646, chr16:10906756-10906776, chr16:10907476-10907496, chr16:10907385-10907405, and chr16:10923265-10923285, The engineered cell of any one of claims 1 to 6.

8. The CIITA genomic target sequence comprises at least 10 or at least 15 consecutive nucleotides within the genomic coordinates; and / or The gene editing system comprises an RNA-guided DNA binding agent, and optionally, the RNA-guided DNA binding agent comprises a Cas9 protein, such as S. pyogenes Cas9; The engineered cell of claim 7.

9. The engineered cell of any one of claims 1 to 8, wherein the engineered cell further has reduced or eliminated surface expression of MHC class I, and optionally, the engineered cell comprises a genetic modification in the beta-2-microglobulin (B2M) gene, and optionally, the engineered cell comprises a genetic modification in the HLA-A gene.

10. The engineered cell of any one of claims 1 to 9, wherein the engineered cell comprises an exogenous nucleic acid encoding a targeted receptor expressed on the surface of the engineered cell, and optionally, the targeted receptor is a CAR, a T cell receptor (TCR), or a WT1 TCR.

11. The engineered cell further comprises an exogenous nucleic acid encoding a polypeptide secreted by the engineered cell; and / or the engineered cells are T cells and further have reduced or eliminated expression of endogenous T cell receptor (TCR) proteins compared to unmodified cells, and optionally the cells have reduced or eliminated expression of TRAC or TRBC proteins compared to unmodified cells; The engineered cell of any one of claims 1 to 10.

12. A pharmaceutical composition comprising an engineered cell according to any one of claims 1 to 11.

13. A cell population comprising an engineered cell according to any one of claims 1 to 11.

14. A pharmaceutical composition comprising a cell population, wherein the cell population comprises an engineered cell according to any one of claims 1 to 11.

15. The cell population is at least 65%, at least 70%, at least 80%, at least 90%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% MHC class II negative as measured by flow cytometry; and / or the cell population is at least 95%, at least 97%, at least 98%, or at least 99% endogenous TCR protein negative as measured by flow cytometry; A cell population according to claim 13 or a pharmaceutical composition according to claim 12 or 14.

16. A method for producing engineered cells, wherein the engineered cells have reduced or eliminated surface expression of MHC class II proteins compared to unmodified cells, the method comprising: a. A CIITA guide RNA, i) a guide sequence selected from SEQ ID NOs: 1-117; ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-117; iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-117; iv) a sequence comprising 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 2; v) at least 17, 18, 19, or 20 consecutive nucleotides of the sequence from (iv); or vi) the CIITA guide RNA comprising a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v); b. optionally an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent; The composition comprising The method comprises contacting the 17. A method for reducing or eliminating surface expression of an MHC class II protein in an engineered cell compared to an unmodified cell, said method comprising:

1. A composition comprising: a. A CIITA guide RNA, i) a guide sequence selected from SEQ ID NOs: 1-117; ii) at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 1-117; iii) a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 1-117; iv) a sequence comprising 10 consecutive nucleotides ± 10 nucleotides of the genomic coordinates listed in Table 2; v) at least 17, 18, 19, or 20 consecutive nucleotides of the sequence from (iv); or vi) the CIITA guide RNA comprising a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from (v); b. optionally an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent; The composition comprising The method comprises contacting the 18. A method for producing engineered cells having reduced or eliminated surface expression of MHC class II proteins and HLA-A proteins compared to unmodified cells, said method comprising: a. contacting the cell with a CIITA guide RNA, wherein the guide RNA comprises a guide sequence selected from SEQ ID NOs: 1-117; b. contacting the cell with an HLA-A guide RNA, wherein the HLA-A guide RNA comprises a guide sequence selected from SEQ ID NOs: 2001-2095; and c. Optionally, contacting the cell with an RNA-guided DNA-binding agent or a nucleic acid encoding an RNA-guided DNA-binding agent. reducing or eliminating the surface expression of MHC class II proteins and HLA-A proteins on said cells. The method comprising:

19. The CIITA guide RNA is i) a guide sequence selected from SEQ ID NOs: 32, 64, 67, 68, 74, 76, 84, 86, 90, 91, and 115; ii) at least 17, 18, 19, or 20 consecutive nucleotides of a sequence selected from SEQ ID NOs: 32, 64, 67, 68, 74, 76, 84, 86, 90, 91, and 115; or iii) the method of any one of claims 16 to 18, comprising a guide sequence that is at least 95%, 90%, or 85% identical to a sequence selected from SEQ ID NOs: 32, 64, 67, 68, 74, 76, 84, 86, 90, 91, and 115.

20. A method described in any one of claims 16 to 19, wherein the CIITA guide RNA is an array selected from SEQ ID NOs: 32, 64, 67, 68, 74, 76, 84, 86, 90, 91 and 115.

21. The method of claim 20, further comprising reducing or eliminating surface expression of MHC class I proteins in said cells compared to unmodified cells; and / or further comprising reducing or eliminating surface expression of B2M protein in said cells compared to unmodified cells; and / or further comprising reducing or eliminating surface expression of HLA-A protein in said cells compared to unmodified cells; and / or further comprising reducing or eliminating surface expression of a TCR protein in said cells compared to unmodified cells; and / or further comprising contacting the cell with an exogenous nucleic acid, optionally further comprising contacting the cell with an exogenous nucleic acid encoding a targeted receptor or polypeptide secreted by the cell; and / or further comprising contacting the cell with a DNA-dependent protein kinase inhibitor (DNAPKi), optionally wherein the DNAPKi is Compound 1. The method according to any one of claims 16 to 20.

22. The method of claim 21, wherein the cell comprises or contacts the cell with an exogenous nucleic acid, the exogenous nucleic acid encoding an NK cell inhibitor molecule; Optionally, the NK cell inhibitor molecule binds to an inhibitory receptor on an NK cell; or Optionally, the NK cell inhibitor molecule binds to NKG2A on NK cells; or Optionally, the NK cell inhibitor molecule is a non-classical MHC class I molecule, or Optionally, the NK cell inhibitor molecule is HLA-E, or Optionally, the NK cell inhibitor molecule is a fusion protein, or Optionally, the NK cell inhibitor molecule is a fusion protein comprising HLA-E and B2M.

22. The engineered cell, cell population, pharmaceutical composition, or method of any one of claims 1 to 21.

23. A method of producing a cell comprising the steps of: (a) contacting said cell with an exogenous nucleic acid encoding a polypeptide secreted by said cell; the secreted polypeptide is an antibody or antibody fragment; or the secreted polypeptide is an anti-full length IgG antibody, a single chain antibody, or a neutralizing antibody; or the secreted polypeptide is an antienzyme, a cytokine, or a fusion protein; or the secreted polypeptide comprises an anti-soluble receptor; 23. The engineered cell, cell population, pharmaceutical composition, or method of any one of claims 1 to 22.

24. The engineered cell, cell population, pharmaceutical composition, or method of any one of claims 1 to 23, comprising or contacting the cells with exogenous nucleic acid encoding a targeted receptor, wherein the targeted receptor is a T cell receptor (TCR), a genetically modified TCR, a WT1 TCR, or a CAR.

25. The engineered cell, cell population, pharmaceutical composition, or method of any one of claims 16 to 24, wherein the CIITA guide RNA, the RNA-guided DNA binder, and / or the exogenous nucleic acid are provided to the cell in a vector, optionally wherein the CIITA guide RNA and the RNA-guided DNA binder are provided in the same vector, and optionally wherein the vector is a viral vector or a non-viral vector, or optionally wherein the vector is a lentiviral vector or an AAV.

26. The engineered cell, cell population, pharmaceutical composition, or method of any one of claims 1 to 25, wherein a lipid-nucleic acid assembly composition comprising gene-editing system components is provided to the cell, and optionally, the lipid-nucleic acid assembly composition is a lipid nanoparticle (LNP).

27. The engineered cell, cell population, pharmaceutical composition, or method of any one of claims 16 to 26, wherein the lipid nucleic acid assembly composition comprises the CIITA guide RNA and / or the exogenous nucleic acid, and optionally, the RNA-guided DNA binder is provided to the cell, and optionally, the lipid nucleic acid assembly composition is a lipid nanoparticle (LNP). (i) the CIITA guide RNA is a single guide RNA comprising any one of the sequences of SEQ ID NOs: 335-426 and 1008, or a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any one of the sequences of SEQ ID NOs: 335-426 and 1008; (ii) the CIITA guide RNA comprises any one of the sequences set forth in SEQ ID NOs: 32, 64, 67, 68, 74, 76, 84, 86, 90, 91, and 115; or 28. The engineered cell, cell population, pharmaceutical composition, or method of any one of claims 16-27, wherein (iii) the CIITA guide RNA is a single guide RNA comprising any one of the sequences in SEQ ID NOs: 341, 373, 376, 377, 383, 385, 393, 395, 399, 400, and 424, or a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any one of the sequences in SEQ ID NOs: 341, 373, 376, 377, 383, 385, 393, 395, 399, 400, and 424.

29. The CIITA guide RNA comprises at least one modification, the at least one modification being (i) 2'-O-methyl (2'-O-Me) modified nucleotides, (ii) phosphorothioate (PS) linkages between nucleotides, (iii) 2'-fluoro (2'-F) modified nucleotides, (iv) a modification in one or more of the first five nucleotides at the 5' end of the guide RNA, (v) a modification in one or more of the last five nucleotides at the 3' end of the guide RNA, or (vi) a modification in one or more of the last five nucleotides at the 3' end of the guide RNA.

29. The engineered cell, cell population, pharmaceutical composition, or method of any one of claims 16-28, wherein the engineered cell comprises (i) a PS bond between the first four nucleotides of A, (vii) a PS bond between the last four nucleotides of the guide RNA, (viii) 2'-O-Me modified nucleotides at the first three nucleotides at the 5' end of the guide RNA, (ix) 2'-O-Me modified nucleotides at the last three nucleotides at the 3' end of the guide RNA, or a combination of one or more of (i)-(ix).

30. An engineered cell or cell population comprising a genetic modification comprising an indel, a C to T substitution, or an A to G substitution within a genomic region targeted by a CIITA guide RNA described in any one of claims 16 to 29.

31. The engineered cell, cell population, pharmaceutical composition, or method of any one of claims 1 to 30 for use in expressing a TCR having specificity for a polypeptide expressed by a cancer cell.

32. The engineered cell, cell population, pharmaceutical composition, or method of any one of claims 1 to 31 for use as adoptive cell transfer (ACT) therapy for administration to a subject.

33. Use of an engineered cell, cell population, pharmaceutical composition, or method according to any one of claims 1 to 32 in the manufacture of a medicament for treating cancer, an infectious disease, or an autoimmune disease.

34. The engineered cell, cell population, pharmaceutical composition, method, or use of any one of claims 1 to 33, wherein the genetic modification comprises (i) an indel, (ii) a C to T substitution, and / or (iii) an A to G substitution.

35. (i) The cells are homozygous for HLA-B and homozygous for HLA-C. (ii) the cell further comprises a genetic modification in an HLA-A gene, wherein the cell is homozygous for HLA-B and homozygous for HLA-C, and the genetic modification in the HLA-A gene is a. chr6:29942854-chr6:29942913 and b. chr6:29943518-chr6:29943619 comprising at least one nucleotide within a genomic coordinate selected from and / or (iii) the cell further comprises a genetic modification in an HLA-A gene, wherein the genetic modification in the HLA-A gene is a. chr6:29942864-chr6:29942903 and b. chr6:29943528-chr6:29943609 comprising at least one nucleotide within a genomic coordinate selected from 35. The engineered cell, cell population, pharmaceutical composition, method or use of any one of claims 1 to 34.