Methods for treating cancer using modified PBMCs

Abstract

The present application provides modified PBMCs for treating HPV-associated cancer. The modified PBMCs are derived from input PBMCs in which at least one HPV antigen is delivered intracellularly. In some embodiments, the PBMCs are administered in combination with a checkpoint inhibitor, such as a CTLA4 antagonist and / or a PD-1 / PD-L1 agonist. In some aspects, the present invention provides a method of treating human papillomavirus (HPV)-associated cancer in an individual, the method comprising administering to the individual a composition comprising an effective amount of peripheral blood mononuclear cells (PBMCs), the PBMCs comprising at least one HPV antigen delivered intracellularly, and administering to the individual an effective amount of a CTLA-4 antagonist and / or a PD-1 / PD-L1 antagonist.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 131,504, filed December 29, 2020, U.S. Provisional Patent Application No. 63 / 190,194, filed May 18, 2021, U.S. Provisional Patent Application No. 63 / 249,739, filed September 29, 2021, and U.S. Provisional Patent Application No. 63 / 278,788, filed November 12, 2021, the entire contents of each of which are incorporated herein by reference. Submitting a sequence listing as an ASCII text file

[0002] The contents of the following submission in an ASCII text file are incorporated herein by reference in their entirety: Computer Readable Form (CRF) of Sequence Listing (Filename: 750322003140SEQLIST.TXT, Recorded: December 23, 2021, Size: 13,144 bytes).

[0003] The present disclosure generally relates to methods, and dosages and regimens, for treating individuals with human papillomavirus (HPV)-associated cancers using peripheral blood mononuclear cells (PBMCs) containing one or more human papillomavirus (HPV) antigens. Methods for producing such PBMCs containing HPV antigens, and compositions thereof, are also disclosed. [Background technology]

[0004] Papillomaviruses are small, non-enveloped DNA viruses with a virion size of approximately 55 nm in diameter. Over 100 HPV genotypes have been fully characterized, and many more are estimated to exist. HPV is a known cause of cervical cancer, as well as some vulvar, vaginal, penile, oropharyngeal, anal, and rectal cancers. Most HPV infections are asymptomatic and resolve spontaneously, but persistent infection with one of the oncogenic HPV types can progress to precancerous conditions or cancer. Other HPV-associated diseases include common warts, plantar warts, flat warts, anogenital warts, anal lesions, epidermodysplasia, focal epithelial hyperplasia, oral papillomas, warty cysts, laryngeal papillomas, squamous intraepithelial lesions (SIL), cervical intraepithelial neoplasia (CIN), vulvar intraepithelial neoplasia (VIN), and vaginal intraepithelial neoplasia (VAIN).

[0005] Many of the known HPV types cause benign lesions, and a subset are carcinogenic. Based on epidemiological and phylogenetic relationships, HPV types are classified into fifteen "high-risk types" (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, and 82) and three "presumed high-risk types" (HPV26, 53, and 66), both of which are known to manifest as low- and high-grade cervical changes and cancers, as well as other anogenital cancers, such as vulvar, vaginal, penile, anal, and perianal cancers, and head and neck cancers. Recently, an association of high-risk types HPV16 and 18 with breast cancer has also been described. Eleven HPV types classified as "low-risk types" (HPV types 6, 11, 40, 42, 43, 44, 54, 61, 70, 72, and 81) are known to manifest as benign and low-grade cervical changes, genital warts, and recurrent respiratory papillomas. Cutaneous HPV types 5, 8, and 92 are associated with skin cancer. In some HPV-associated cancers, the immune system is depressed and the antitumor response is correspondingly severely impaired. See Suresh and Burtness Am J Hematol Oncol 13(6):20-27(2017).

[0006] Immunotherapies are generally divided into two main types: passive and active interventions. Passive protocols include administration of preactivated and / or engineered cells (e.g., CAR T cells), disease-specific therapeutic antibodies, and / or cytokines. Active immunotherapy strategies aim to stimulate immune system effector functions in vivo. Some current protocols include vaccination strategies with disease-associated peptides, lysates, or allogeneic whole cells, injection of autologous dendritic cells (DCs) as a vehicle for tumor antigen delivery, and injection of immune checkpoint modulators. See Papaioannou, Nikos E., et al. Annals of translational medicine 4.14(2016). Adoptive immunotherapy can be utilized to modulate immune responses, enhance antitumor activity, and achieve the goal of treating or preventing HPV-associated cancers.

[0007] CD8 stimulated by disease-associated antigens + Cytotoxic T lymphocytes (CTL) and CD4 + Helper T (Th) cells have the potential to target and destroy diseased cells, but current methods for inducing endogenous T cell responses face challenges. The disclosure herein also includes methods, treatments, doses, and regimens for treating individuals with HPV-associated cancers using PBMCs containing HPV antigens. Also provided is a method that can be used to efficiently generate PBMCs containing HPV antigens and / or adjuvants in a high-throughput manner, which can be utilized to induce robust T cell responses to HPV antigens.

[0008] All references cited herein, including patent applications and publications, are incorporated by reference in their entirety. Patent publications WO2013 / 059343, WO2015 / 023982, WO2016 / 070136, WO2017041050, WO2017008063, WO2017 / 192785, WO2017 / 192786, WO2019 / 178005, WO2019 / 178006, WO2020 / 072833, WO2020 / 154696, and WO2020 / 176789, US20180142198, and US20180201889 are incorporated by reference in their entirety. [Prior art documents] [Patent documents]

[0009] [Patent Document 1] International Publication No. 2013 / 059343 [Patent Document 2] International Publication No. 2015 / 023982 [Patent Document 3] International Publication No. 2016 / 070136 [Patent Document 4] International Publication No. 2017 / 041050 [Patent Document 5] International Publication No. 2017 / 008063 [Non-patent literature]

[0010] [Non-Patent Document 1] Suresh and Burtness Am J Hematol Oncol 13(6):20-27(2017) [Non-Patent Document 2] Papaioannou, Nikos E., et al. Annals of translational medicine 4.14(2016) Summary of the Invention [Means for solving the problem]

[0011] In some aspects, the present invention provides a method of treating a human papillomavirus (HPV) associated cancer in an individual, the method comprising administering to the individual a composition comprising an effective amount of peripheral blood mononuclear cells (PBMCs), the PBMCs comprising at least one HPV antigen delivered intracellularly, and administering to the individual an effective amount of an antagonist of CTLA-4 and / or an antagonist of PD-1 / PD-L1. In some embodiments, the antagonist of CTLA4 is an antibody that binds CTLA4. In some embodiments, the antagonist of PD-1 / PD-L1 is an antibody that binds PD-1 or an antibody that binds PD-L1. In some embodiments, an antibody that binds CTLA-4 and an antibody that binds PD-1 are administered to the individual. In some embodiments, an antibody that binds CTLA-4 is administered to the individual and an antibody that binds PD-L1 is administered to the individual. In some embodiments, the antibody that binds CTLA-4 is ipilimumab. In some embodiments, the antibody that binds PD-1 is nivolumab. In some embodiments, the antibody that binds to PD-1 is pembrolizumab. In some embodiments, the antibody that binds to PD-L1 is atezolizumab.

[0012] In some aspects, the present invention provides a method of treating an HPV+ recurrent, locally advanced, or metastatic tumor in an individual, the method comprising administering to the individual an effective amount of a composition comprising peripheral blood mononuclear cells (PBMCs), the PBMCs comprising at least one HPV antigen delivered intracellularly. In some embodiments, the composition comprising PBMCs is administered in conjunction with one or more immune checkpoint inhibitors. In some embodiments, the checkpoint inhibitor is an antagonist of CTLA-4 and / or an antagonist of PD-1 / PD-L1 to the individual. In some embodiments, the one or more immune checkpoint inhibitors are antibodies that bind to PD-L1, CTLA-4, or PD-1. In some embodiments, the composition comprising PBMCs is administered in conjunction with an antibody that binds to CTLA-4 and an antibody that binds to PD-1. In some embodiments, the antibody that binds to PD-L1 is atezolizumab. In some embodiments, the antibody that binds to CTLA-4 is ipilimumab. In some embodiments, the antibody that binds to PD-1 is nivolumab. In some embodiments, the antibody that binds to PD-1 is pembrolizumab.

[0013] In some embodiments of the invention, the PBMCs of the invention comprise at least one HPV antigen, the one HPV antigen being an HPV-16 antigen or an HPV-18 antigen. In some embodiments, the at least one HPV antigen comprises a peptide derived from HPV E6 and / or E7. In some embodiments, the at least one HPV antigen comprises an HLA-A2 restricted peptide derived from HPV E6 and / or E7. In some embodiments, the HLA-A2 restricted peptide comprises the amino acid sequence of any one of SEQ ID NOs: 1-4. In some embodiments, the at least one HPV antigen comprises the amino acid sequence of any one of SEQ ID NOs: 18-25. In some embodiments, the PBMCs comprise an antigen comprising the amino acid sequence of SEQ ID NO: 19 and an antigen comprising the amino acid sequence of SEQ ID NO: 23.

[0014] In some embodiments of the therapeutic methods of the invention, the individual is a human. *In some embodiments, the PBMCs are positive for HLA-A 02. * In some embodiments, the PBMCs are autologous to the individual. In some embodiments, the individual is positive for Human Immunodeficiency Virus (HIV). In some embodiments, the HPV-associated cancer is head and neck cancer, cervical cancer, anal cancer, or esophageal cancer.

[0015] In some embodiments, the composition comprising PBMCs is administered intravenously. In some embodiments, the antagonist of CTLA-4 and / or the antagonist of PD-1 / PD-La is administered intravenously, orally, or subcutaneously. In some embodiments, the antibody that binds CTLA-4, and / or the antibody that binds PD-1, and / or the antibody that binds PD-L1 is administered intravenously.

[0016] In some embodiments of the treatment methods of the invention, an effective amount of PBMCs containing at least one HPV antigen is about 0.5×10 6 cells / kg ~ approx. 5.0×10 6 In some embodiments, the effective amount of ipilimumab is about 1 mg / kg to about 3 mg / kg. In some embodiments, the effective amount of nivolumab is about 360 mg. In some embodiments, the effective amount of atezolizumab is about 1200 mg. In some embodiments, the composition comprising PBMCs is delivered on day 1 of a three-week cycle. In some embodiments, the composition comprising PBMCs is further administered on day 2 of the first three-week cycle. In some embodiments, the composition comprising PBMCs is about 0.5×10 6 cells / kg, approximately 2.5×10 6 cells / kg, approximately 5.0×10 6 Cells / kg are administered on day 1 of each three-week cycle. In some embodiments, about 0.5×10 6 cells / kg, approximately 2.5×10 6 cells / kg, or approximately 5.0 x 10 6Cells / kg are administered on day 2 of the first three-week cycle. In some embodiments, the antibody that binds CTLA4 and / or the antibody that binds PD-1 and / or the antibody that binds PD-L1 are administered once every three-week cycle. In some embodiments, the antibody that binds CTLA-4 is administered on day 1 of each three-week cycle. In some embodiments, the antibody that binds CTLA-4 is administered once every two three-week cycles. In some embodiments, the antibody that binds CTLA-4 is ipilimumab, and the ipilimumab is administered at a dose of about 3 mg / kg. In some embodiments, the antibody that binds PD-1 is administered on day 8 of the first three-week cycle and on day 1 of each cycle thereafter. In some embodiments, the antibody that binds PD-1 is nivolumab, and the nivolumab is administered at a dose of about 360 mg. In some embodiments, the antibody that binds CTLA-4 is ipilimumab, and ipilimumab is administered at a dose of about 1 mg / kg on day 1 of the first three-week cycle of two three-week cycles, and the antibody that binds PD-1 is administered at a dose of about 360 mg on day 8 of the first three-week cycle and day 1 of each cycle thereafter. In some embodiments, the antibody that binds PD-L1 is administered on day 8 of the first three-week cycle and day 1 of each cycle thereafter. In some embodiments, the antibody that binds PD-L1 is atezolizumab, and atezolizumab is administered at a dose of about 1200 mg. In some embodiments, the composition comprising PBMCs is administered to the individual for at least about three months, six months, nine months, or one year.

[0017] In some embodiments of the invention, the composition comprising PBMCs administered to an individual comprises: a) about 5×10 6 PBMC ~ approx. 5×10 7 PBMCs, b) a cryopreservation medium in a proportion of about 40% to about 60% (w / w), c) a cryopreservation medium in a proportion of about 25% to about 35% (w / w), and d) about 3% to about 8% (w / w) human serum albumin, and the pH of the composition is about pH 6.0 to about pH 8.5. In some embodiments, the composition comprising PBMCs comprises: a) about 1 x 10 6 PBMC / mL ~ approx. 1×10 7In some embodiments, the composition comprises: a) about 2.75×10 PBMCs / mL; b) a cryopreservation medium in a proportion of about 40% to about 60% (w / w); c) a cryopreservation medium in a proportion of about 25% to about 35% (w / w); and d) human serum albumin in a proportion of about 3% to about 8% (w / w); and the pH of the composition is about pH 6.0 to about pH 8.5. In some embodiments, the composition comprising PBMCs comprises: a) about 2.75×10 7 PBMCs, b) a cryopreservation medium in a proportion of about 50% (w / w), c) a cryopreservation medium in a proportion of about 30% (w / w), and d) a human serum albumin in a proportion of about 5% (w / w), and the pH of the composition is about pH 7.4. In some embodiments, the composition comprising PBMCs comprises: a) about 5×10 6 In some embodiments, the composition comprising PBMCs comprises: a) about 5×10 PBMCs / mL; b) about 50% (w / w) cryopreservation medium; c) about 30% (w / w) cryopreservation medium; and d) about 5% (w / w) human serum albumin, and the pH of the composition is about pH 7.4. 6 PBMC ~ approx. 5×10 7 In some embodiments, the composition comprises: a) about 1×10 PBMCs; b) a cryopreservation medium in a proportion of about 65% to about 95% (w / w); and c) human serum albumin in a proportion of about 3% to about 8% (w / w), and the pH of the composition is about pH 6.0 to about pH 8.5. 6 PBMC / mL ~ approx. 1×10 7 In some embodiments, the composition comprises: a) about 2.5×10 PBMCs / mL; b) a cryopreservation medium in a proportion of about 65% to about 95% (w / w); and c) human serum albumin in a proportion of about 3% to about 8% (w / w), and the pH of the composition is about pH 6.0 to about pH 8.5. 7 PBMCs, b) a cryopreservation medium in a proportion of about 80% (w / w), and c) human serum albumin in a proportion of about 5% (w / w), and the pH of the composition is about pH 7.4. In some embodiments, the composition comprising PBMCs comprises: a) about 5×10 6PBMC / mL, b) a cryopreservation medium in a percentage of about 80% (w / w), c) a percentage of about 5% (w / w) human serum albumin, and the pH of the composition is about pH 7.4. In some embodiments, the cryopreservation medium is CryoStor® CS10. In some embodiments, the cryopreservation medium is HypoThermasol® FRS.

[0018] In some embodiments, the PBMCs of the present invention comprise two or more of T cells, B cells, NK cells, or monocytes. In some embodiments, the PBMCs comprise T cells, B cells, NK cells, and monocytes. In some embodiments, (a) about 25% to about 80% of the PBMCs are T cells, (b) about 1.5% to about 30% of the PBMCs are B cells, (c) about 3.0% to about 20% of the PBMCs are NK cells, or (d) about 4.0% to about 45% of the PBMCs are monocytes.

[0019] In some embodiments of the invention, PBMCs comprising at least one HPV antigen are prepared by a process comprising: a) passing a cell suspension comprising a population of input PBMCs through a cell-deforming constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing a perturbation of the input PBMCs sufficient to allow at least one HPV antigen to pass to form perturbed input PBMCs, and b) culturing the population of perturbed input PBMCs with at least one HPV antigen for a sufficient time to allow the antigen to enter the perturbed input PBMCs, thereby generating PBMCs comprising at least one HPV antigen. In some embodiments, the diameter of the constriction is about 4.2 μm to about 6 μm, or about 4.2 μm to about 4.8 μm. In some embodiments, the PBMCs comprising at least one HPV antigen are conditioned. In some embodiments, the PBMCs containing at least one HPV antigen are conditioned by a process of culturing the PBMCs with an adjuvant at about 37° C. for about 2 hours to about 10 hours, about 3 hours to about 6 hours, or about 4 hours to condition the PBMCs. In some embodiments, the adjuvant is a CpG oligodeoxynucleotide (ODN), LPS, IFN-α, a STING agonist, a RIG-I agonist, poly I:C, R837, R848, a TLR3 agonist, a TLR4 agonist, or a TLR9 agonist. In some embodiments, the adjuvant is a CpG7909 oligodeoxynucleotide (ODN). [Brief description of the drawings]

[0020] [Figure 1] Figure 1 shows the treatment regimens for cohorts 1 to 3.

[0021] [Diagram 2] FIG. 2 shows the treatment regimen for Cohort 4.

[0022] [Diagram 3] FIG. 3 shows the treatment regimen for Cohort 5.

[0023] [Figure 4] FIG. 4 shows the treatment regimen for Cohort 6.

[0024] [Diagram 5] FIG. 5 shows the treatment regimen for Cohort 7.

[0025] [Figure 6] FIG. 6 is a schematic diagram showing the mechanism of SQZ-PBMC-HPV-101 investigational drug generated by Cell Squeeze® technology, demonstrating that the SQZ-PBMC-HPV vaccine directly stimulates CD8 T cell responses.

[0026] [Figure 7] Figure 7 is a schematic diagram of the clinical trial design. SQZ-PBMC-HPV is administered at the indicated dose (cells per body weight) every three weeks (q3w) as monotherapy in the monotherapy phase or in conjunction with the indicated dose of checkpoint inhibitors (atezolizumab, ipilimumab (Ipi), nivolumab (Nivo)) at the indicated intervals (q3w, q3w x 4, q6w).

[0027] [Figure 8] Figure 8A-C show the production results of SQZ-PBMC-HPV, showing the mean viability, mean end-to-end process time, and IFN-γ secretion assay of SQZ-PBMC-HPV, respectively.

[0028] [Figure 9] FIG. 9 shows an overview of best overall response (BOR), survival on study (days), and Royal Marsden Hospital (RMH)1 score across all cohorts.

[0029] [Figure 10A] 10A-C show total tumor size, IHC image analysis showing changes in CD8 TILs in the central tumor, and representative IHC images showing CD8 TILs, respectively, in case study patient 2 after treatment. [Figure 10B] Same as above. [Figure 10C] Same as above.

[0030] [Figure 11A] 11A-C show total tumor size, IHC image analysis showing changes in CD8 TILs in the central tumor, and representative IHC images showing CD8 TILs, respectively, in case study patient 7 after treatment. [Figure 11B] Same as above. [Figure 11C] Same as above.

[0031] [Figure 12] FIG. 12 shows the density of CD8+ cells in the tumors at screening (pre-dose) and day 8 of cycle 2 (C2D8, post-dose) for patients in cohorts 1, 2, 3 and 3a.

[0032] [Figure 13] FIG. 13 shows the density of CD8+ / Granzyme B+ (GZMB+) cells in tumors at screening (pre-dose) and C2D8 (post-dose) for patients in cohorts 1, 2, 3 and 3a.

[0033] [Figure 14] FIG. 14 shows the density of CD8+ / Ki67+ cells in tumors at screening (pre-dose) and C2D8 (post-dose) for patients in cohorts 1, 2, 3 and 3a.

[0034] [Figure 15] FIG. 15 shows the density of CD8+ / Ki67- cells in tumors at screening (pre-dose) and C2D8 (post-dose) for patients in cohorts 1, 2, 3 and 3a.

[0035] [Figure 16]Figure 16 shows MHC-1 expression in tumors at screening (pre-treatment) and C2D8 (post-treatment) for patients in cohorts 1, 2, 3 and 3a as measured by H-score (top panel). The relative proportions of MHC-, MHC-1 low, MHC-1 intermediate and MHC-1 high cells at screening (pre-treatment) and C2D8 (post-treatment) are shown in the bottom panel.

[0036] [Figure 17] Figure 17 shows the % of tumor cells with PD-L1 membrane staining at screening (pre-dose) and C2D8 (post-dose) for patients in cohorts 1, 2, 3 and 3a. TPS indicates tumor proportion score.

[0037] [Figure 18] Figure 18 shows the expression of HPV16 E6 in tumors at screening (pre-treatment) and C2D8 (post-treatment) for patients in cohorts 1, 2, 3 and 3a as measured by RNA ISH modified H-score (top panel). The relative proportions of HPV16 negative, HPV16+1, HPV16+2, HPV16+3 and HPV16+4 cells at screening (pre-treatment) and C2D8 (post-treatment) are shown in the bottom panel. * indicates that the cell morphology was not suitable for scoring.

[0038] [Figure 19] Figure 19 shows the expression of HPV16 E7 in tumors at screening (pre-treatment) and C2D8 (post-treatment) of patients from cohorts 1, 2, 3 and 3a as measured by RNA ISH modified H-score (top panel). The relative proportions of HPV16 negative, HPV16+1, HPV16+2, HPV16+3 and HPV16+4 cells at screening (pre-treatment) and C2D8 (post-treatment) are shown in the bottom panel. * indicates that the cell morphology was not suitable for scoring.

[0039] [Figure 20]Figure 20 shows % of tumor cells with PD-1 cells by area within the tumor center for patients in cohorts 1, 2, 3, and 3a at screening (pre-dose) and C2D8 (post-dose). * indicates that the cell morphology was not suitable for scoring.

[0040] [Figure 21] Figure 21 shows CD8 infiltration of tumors for patient 112-068 at screening (pre-dose) and C2D8 (post-dose). The left panel shows tumor infiltration in the central tumor (CN) and infiltration in the stroma and parenchyma. The center panel shows CTL, Treg and NK function in tumors measured by CD8, GZMB and FoxP3. The right panel shows the percentage of CD8+ cells that are GZMB+ cells.

[0041] [Figure 22] FIG. 22 shows examples of immunohistochemical images from which the data in FIG. 21 was derived.

[0042] [Figure 23] Figure 23 shows proliferation / activation cell density in tumors from patient 112-068 at screening (pre-dose) and C2D8 (post-dose) as indicated by the density of cells that are CD8+, CD8+ / Ki67-, CD8- / Ki67+, and CD8+ / Ki67+. Immunohistochemistry is shown in the right panel. The top image is low resolution, the bottom image is high resolution.

[0043] [Figure 24] Figure 24 shows the % of tumor cells from patient 112-068 with PD-L1 staining at screening (pre-dose) and C2D8 (post-dose).

[0044] [Diagram 25]Figure 25 shows expression of MHC-1 and HPV16 E6 and E7 epitopes in tumors from patient 112-068 at screening (pre-dose) and C2D8 (post-dose). The top left panel shows MHC-1 expression at screening and C2D8. The top center panel shows relative expression of MHC-1 in cells in tumors at screening and C2D8. The bottom left panel shows expression of HPV16 E6. The bottom center panel shows expression of HPV16 E7. The right panel shows an example of immunohistochemistry from which the data in the left and center panels were obtained.

[0045] [Figure 26] FIG. 26 shows the tumor growth kinetics of patient 112-068.

[0046] [Figure 27] Figure 27 shows CD8 infiltration of tumors for patient 103-027 at screening (pre-dose) and C2D8 (post-dose). The left panel shows tumor infiltration in the central tumor (CN) and infiltration in the stroma and parenchyma. The center panel shows CTL, Treg and NK function in tumors measured by CD8, GZMB and FoxP3. The right panel shows the percentage of CD8+ cells that are GZMB+ cells.

[0047] [Figure 28] FIG. 28 shows examples of immunohistochemical images from which the dates in FIG. 27 were derived.

[0048] [Figure 29] Figure 29 shows the proliferation / activation cell density in tumors from patient 103-027 at screening (pre-treatment) and C2D8 (post-treatment), as indicated by the density of cells that are CD8+, CD8+ / Ki67-, CD8- / Ki67+, and CD8+ / Ki67+. Immunohistochemistry is shown in the right panel. The top image is low resolution, the bottom image is high resolution.

[0049] [Diagram 30]Figure 30 shows the % of tumor cells from patient 103-027 with PD-L1 staining at screening (pre-dose) and C2D8 (post-dose).

[0050] [Diagram 31] Figure 31 shows the expression of MHC-1 and HPV16 E6 and E7 epitopes in tumors from patient 103-027 at screening (pre-treatment) and C2D8 (post-treatment). The top left panel shows MHC-1 expression at screening and C2D8. The top center panel shows the relative expression of MHC-1 in cells in tumors at screening and C2D8. The bottom left panel shows HPV16 E6 expression. The bottom center panel shows HPV16 E7 expression. * indicates that the morphology of the cells was not suitable for scoring. The right panel shows an example of immunohistochemistry from which the data in the left and center panels were obtained.

[0051] [Diagram 32] Figure 32 shows CD8 infiltration of tumors for patient 103-008 at screening (pre-treatment) and C2D8 (post-treatment). The left panel shows tumor infiltration in the central tumor (CN) and infiltration in the stroma and parenchyma. The center panel shows CTL, Treg and NK function in tumors measured by CD8, GZMB and FoxP3. The right panel shows the percentage of CD8+ cells that are GZMB+ cells.

[0052] [Diagram 33] FIG. 33 shows an example of immunohistochemistry from which the dates in FIG. 32 were derived.

[0053] [Diagram 34] Figure 34 shows the proliferation / activation cell density in tumors from patient 103-008 at screening (pre-treatment) and C2D8 (post-treatment), as indicated by the density of cells that are CD8+, CD8+ / Ki67-, CD8- / Ki67+, and CD8+ / Ki67+. Immunohistochemistry is shown in the right panel. The top image is low resolution, the bottom image is high resolution.

[0054] [Diagram 35] Figure 35 shows the % of tumor cells from patient 103-008 with PD-L1 staining at screening (pre-dose) and C2D8 (post-dose).

[0055] [Diagram 36] Figure 36 shows expression of MHC-1 and HPV16 E6 and E7 epitopes in tumors from patient 103-008 at screening (pre-treatment) and C2D8 (post-treatment). The top left panel shows MHC-1 expression at screening and C2D8. The top center panel shows relative expression of MHC-1 in cells in tumors at screening and C2D8. The bottom left panel shows expression of HPV16 E6. The bottom center panel shows expression of HPV16 E7. The right panel shows an example of immunohistochemistry from which the data in the left and center panels were obtained.

[0056] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0057] In some aspects, the present invention provides a method of treating human papillomavirus (HPV) associated cancer in an individual, the method comprising administering to the individual an effective amount of a composition comprising peripheral blood mononuclear cells (PBMCs), the PBMCs comprising at least one HPV antigen delivered intracellularly.

[0058] In some aspects, the invention provides methods of treating HPV-associated cancer in an individual, the methods comprising administering to the individual an effective amount of a composition comprising PBMCs, the PBMCs comprising at least one HPV antigen to be delivered intracellularly, and administering an effective amount of one or more immune checkpoint inhibitors. In some embodiments, the one or more immune checkpoint inhibitors comprise antagonists of CTLA-4 (such as, but not limited to, ipilimumab), antagonists of PD-1 (such as, but not limited to, nivolumab), and / or antagonists of PD-L1 (such as, but not limited to, atezolizumab).

[0059] In some aspects, the invention provides methods of treating HPV-associated cancer in an individual, the method comprising administering to the individual an effective amount of a composition comprising activated PBMCs, wherein the PBMCs comprise at least one HPV antigen delivered intracellularly, and administering an effective amount of one or more of ipilimumab, nivolumab, or atezolizumab, wherein the PBMCs comprise the HPV antigen and / or the one or more immune checkpoint inhibitors are administered in a three week cycle, wherein the effective amount of PBMCs is about 0.5×10 6 cells / kg ~ approx. 5×10 6 cells / kg, an effective amount of ipilimumab is about 1 mg / kg to about 3 mg / kg, an effective amount of nivolumab is about 360 mg, and an effective amount of atezolizumab is about 1200 mg.

[0060] Also provided are compositions of PBMCs comprising HPV antigens and adjuvants, and methods of preparing PBMCs comprising HPV antigens and adjuvants. In some embodiments, the PBMCs are prepared by a process comprising: a) passing a cell suspension comprising a population of input PBMCs through a cell-deforming constriction, the diameter of the constriction being a function of the diameter of the PBMCs in the suspension, thereby causing a perturbation of the input PBMCs large enough for the HPV antigens and adjuvants to pass through to form perturbed input PBMCs; and b) culturing the population of perturbed input PBMCs with HPV antigens and adjuvants for a sufficient time to allow the antigens to enter the perturbed input PBMCs, thereby generating modified PBMCs comprising HPV antigens and adjuvants. Also provided are compositions for use in inducing an immune response to HPV antigens or for treating HPV-associated cancers. Also provided are uses of compositions comprising an effective amount of PBMCs in the manufacture of medicaments for stimulating an immune response to HPV antigens or for treating HPV-associated cancers.

[0061] Common methods The techniques and procedures described or referenced herein are generally well understood and may be found, for example, in Molecular Cloning: A Laboratory Manual (Sambrook et al., 2004). thed.,Cold Spring Harbor Laboratory Press,Cold Spring Harbor,N.Y.,2012);Current Protocols in Molecular Biology(F.M.Ausubel,et al.eds.,2003);the series Methods in Enzymology(Academic Press,Inc.);PCR 2:A Practical Approach(M.J.MacPherson,B.D.Hames and G.R.Taylor eds.,1995);Antibodies,A Laboratory Manual(Harlow and Lane,eds.,1988);Culture of Animal Cells:A Manual of Basic Technique and Specialized Applications(R.I.Freshney,6 thed.,J.Wiley and Sons,2010);Oligonucleotide Synthesis(M.J.Gait,ed.,1984);Methods in Molecular Biology,Humana Press;Cell Biology:A Laboratory Notebook(J.E.Cellis,ed.,Academic Press,1998);Introduction to Cell and Tissue Culture(J.P.Mather and P.E.Roberts,Plenum Press,1998);Cell and Tissue Culture:Laboratory Procedures(A.Doyle,J.B.Griffiths,and D.G.Newell,eds.,J.Wiley and Sons,1993-8);Handbook of Experimental Immunology(D.M.Weir and C.C.Blackwell,eds.,1996);Gene Transfer Vectors for Mammalian Cells(J.M.Miller and M.P.Calos,eds.,1987);PCR:The Polymerase Chain Reaction,(Mullis et al.,eds.,1994);Current Protocols in Immunology(J.E.Coligan et al.,eds.,1991);Short Protocols in Molecular Biology(Ausubel et al.,eds.,J.Wiley and Sons,2002);Immunobiology(C.A.Janeway et al.,2004);Antibodies(P.Finch,1997);Antibodies:A Practical Approach(D.Catty.,ed.,IRL Press,1988-1989);Monoclonal Antibodies:A Practical Approach(P.Shepherd and C.Dean,eds., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D. Lane, Cold Spring Harbor Laboratory Press, 1999), The Antibodies (M. Zanetti and JD Capra, eds., Harwood Academic Publishers, 1995), and Cancer: Principles and Practice of Oncology (VT DeVita et al., eds., JBLippincott Company, 2011), are commonly employed by those skilled in the art using conventional methodologies.

[0062] definition For purposes of interpreting this specification, the following definitions will apply, except that where appropriate, terms used in the singular will include the plural and vice versa. In the event that any definition set forth below conflicts with any document incorporated herein by reference, the definition set forth above shall control.

[0063] As used herein, the singular forms "a," "an," and "the" include plural references unless otherwise indicated.

[0064] As used herein, the terms "comprising," "having," "containing," and "including," as well as other similar forms and their grammatical equivalents, are intended to be equivalent in meaning and open-ended in that the item or items following any one of these terms are not meant to be an exhaustive list of such items or items, or to be limited to only the listed item or items. For example, an article comprising components A, B, and C may consist of (i.e., include only) components A, B, and C, or may include not only components A, B, and C, but also one or more other components. Thus, "comprising" and similar forms and their grammatical equivalents are intended and understood to include disclosure of embodiments that "consist essentially of" or "consist of."

[0065] Where a range of values ​​is provided, unless the context clearly dictates otherwise, it is understood that each intervening value, to the tenth of the unit of the lower limit, is encompassed within the disclosure, subject to the specific exclusion limits within the stated range, as are values ​​between the upper and lower limits of that range, as well as any other stated or intervening values ​​within that range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

[0066] The term "about" as used herein refers to the normal error range of each value, which is easily recognized by those skilled in the art. Reference to "about" a value or parameter herein includes (and describes) an embodiment that is directed to the value or parameter itself. For example, a description that refers to "about X" includes the description of "X".

[0067] As used herein, "peripheral blood mononuclear cells" or "PBMCs" refers to a heterogeneous population of blood cells with round nuclei. Examples of cells that may be found in a population of PBMCs may include lymphocytes, such as T cells, B cells, NK cells (including natural killer T cells (NKT cells) and cytokine-induced killer cells (CIK cells)), and monocytes, such as macrophages and dendritic cells. As used herein, a "plurality of PBMCs" refers to a preparation of PBMCs that includes cells of at least two types of blood cells. In some embodiments, the plurality of PBMCs includes two or more of T cells, B cells, NK cells, macrophages, or dendritic cells. In some embodiments, the plurality of PBMCs includes three or more of T cells, B cells, NK cells, macrophages, or dendritic cells. In some embodiments, the plurality of PBMCs includes four or more of T cells, B cells, NK cells, macrophages, or dendritic cells. In some embodiments, the plurality of PBMCs includes T cells, B cells, NK cells, macrophages, and dendritic cells.

[0068] PBMCs can be isolated by means known in the art. For example, PBMCs can be obtained from the peripheral blood of an individual based on the density of PBMCs compared to other blood cells. In some embodiments, PBMCs can be obtained from the peripheral blood of an individual using Ficoll (e.g., Ficoll gradient). In some embodiments, PBMCs can be obtained from the peripheral blood of an individual using the ELUTRA® cell separation system. PBMCs can be obtained from an individual undergoing apheresis.

[0069] In some embodiments, the population of PBMCs is isolated from an individual. In some embodiments, the plurality of PBMCs is an autologous population of PBMCs, which is derived from a particular individual, manipulated by any of the methods described herein, and returned to the particular individual. In some embodiments, the plurality of PBMCs is an allogeneic population of PBMCs, which is derived from an individual, manipulated by any of the methods described herein, and administered to a second individual.

[0070] In some embodiments, the plurality of PBMCs is a reconstituted preparation of PBMCs. In some embodiments, the plurality of PBMCs may be generated by mixing cells typically found in a population of PBMCs, for example, by mixing two or more populations of T cells, B cells, NK cells, or monocytes.

[0071] As used herein, "payload" refers to a material to be delivered to a PBMC, such as loaded into the PBMC. "Payload," "cargo," "delivery agent," and "compound" are used interchangeably herein. In some embodiments, payload may refer to proteins, small molecules, nucleic acids (e.g., RNA and / or DNA), lipids, carbohydrates, macromolecules, vitamins, polymers, fluorescent dyes and fluorophores, carbon nanotubes, quantum dots, nanoparticles, and steroids. In some embodiments, payload may refer to proteins or small molecule drugs. In some embodiments, payload may include one or more compounds.

[0072] The term "heterologous" as it relates to nucleic acid sequences, such as coding sequences and control sequences, refers to sequences that are not normally linked together and / or are not normally associated with a particular cell. Thus, a "heterologous" region of a nucleic acid construct or vector is a segment of nucleic acid within or attached to another nucleic acid molecule that is not found in association with the other molecule in nature. For example, a heterologous region of a nucleic acid construct may include a coding sequence that is flanked by sequences that are not found in association with the coding sequence in nature. Another example of a heterologous coding sequence is a construct in which the coding sequence itself is not found in nature (e.g., a synthetic sequence with codons different from the native gene). Similarly, a cell transformed with a construct that is not normally present in the cell would be considered heterologous for the purposes of the present invention. Allelic variations or naturally occurring mutational events do not give rise to heterologous DNA as used herein.

[0073] The term "heterologous" as it relates to amino acid sequences, such as peptide and polypeptide sequences, refers to sequences that are not normally linked together and / or are not normally associated with a particular cell. Thus, a "heterologous" region of a peptide sequence is a segment of amino acids within or attached to another amino acid molecule that is not found in association with the other molecule in nature. For example, a heterologous region of a peptide construct may include an amino acid sequence of a peptide flanked by sequences that are not found in association with the amino acid sequence of the peptide in nature. Another example of a heterologous peptide sequence is a construct in which the peptide sequence itself is not found in nature (e.g., a synthetic sequence with encoded amino acids different from the native gene). Similarly, a cell transformed with a vector that expresses an amino acid construct that is not normally present in the cell would be considered heterologous for the purposes of the present invention. Allelic variations or naturally occurring mutational events do not give rise to a heterologous peptide as used herein.

[0074] The term "exogenous" when used with respect to an agent associated with a cell, such as, for example, an antigen or adjuvant, refers to an agent outside the cell or an agent delivered into the cell from outside the cell. The cell may or may not have the agent already present, and may or may not produce the agent after the exogenous agent is delivered.

[0075] The term "homologous" as used herein refers to molecules that are derived from the same organism. In some instances, the term refers to a nucleic acid or protein that is normally found or expressed in a given organism.

[0076] As used herein, "treatment" or "treating" is an approach to obtain beneficial or desired results, including clinical results. For purposes of the present invention, beneficial or desired clinical results include, but are not limited to, one or more of the following: alleviating one or more symptoms caused by the disease, reducing the extent of the disease, stabilizing the disease (e.g., preventing or delaying the worsening of the disease), preventing or delaying the spread of the disease (e.g., metastasis), preventing or delaying the recurrence of the disease, delaying or slowing the progression of the disease, ameliorating the disease state, remission (partially or completely) of the disease, reducing the dose of one or more other drugs required to treat the disease, delaying the progression of the disease, increasing or improving quality of life, increasing weight gain, and / or prolonging survival. "Treatment" also encompasses the reduction of pathological results of cancer (e.g., tumor volume, etc.). The methods of the present invention contemplate any one or more of these aspects of treatment.

[0077] As used herein, the term "prophylactic treatment" refers to treatment in which an individual is known or suspected to have a disorder or is at risk of having a disorder, but does not show symptoms of the disorder or shows minimal symptoms.The individual who receives prophylactic treatment can be treated before the onset of symptoms.In some embodiments, an individual can be treated when they have precancerous lesions, particularly precancerous lesions associated with HPV infection.

[0078] As used herein, "combination therapy" means that a first agent is administered in conjunction with another agent. "In conjunction with" refers to the administration of one therapeutic modality in addition to another therapeutic modality, such as administering a composition of PMBC described herein in addition to administering an immunoconjugate described herein to the same individual. Thus, "in conjunction with" refers to the administration of one therapeutic modality before, during, or after the delivery of the other therapeutic modality to the individual.

[0079] As used herein, the term "co-administration" means that the first and second therapies in a combination therapy are administered within about 15 minutes, such as within about 10 minutes, 5 minutes, or 1 minute of each other. When the first and second therapies are administered simultaneously, the first and second therapies can be included in the same composition (e.g., a composition that includes both the first and second therapies) or can be included in separate compositions (e.g., the first therapy in one composition and the second therapy in another composition).

[0080] As used herein, the term "sequential administration" means that the first and second therapies in the combination therapy are administered at a time interval of more than about 15 minutes, such as about 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, or more. Either the first or second therapy can be administered first. The first and second therapies are contained in separate compositions that can be contained in the same or different packages or kits.

[0081] As used herein, the term "co-administration" means that the administration of a first therapy and a second therapy in a combination therapy overlap with each other.

[0082] In the context of cancer, the term "treating" includes any or all of killing cancer cells, inhibiting the growth of cancer cells, inhibiting the replication of cancer cells, reducing the overall tumor burden, and ameliorating one or more symptoms associated with the disease.

[0083] As used herein, the term "modulate" may refer to the act of changing, altering, modifying, or otherwise modifying the presence or activity of a particular target. For example, modulating an immune response may refer to any act that results in altering, altering, modifying, or otherwise modifying an immune response. In some examples, "modulation" refers to enhancing the presence or activity of a particular target. In some examples, "modulation" refers to suppressing the presence or activity of a particular target. In other examples, modulating the expression of a nucleic acid may include, but is not limited to, changes in the transcription of the nucleic acid, changes in mRNA abundance (e.g., increased mRNA transcription), corresponding changes in the degradation of mRNA, changes in mRNA translation, and the like.

[0084] As used herein, the term "inhibit" may refer to the action of blocking, reducing, eliminating, or otherwise antagonizing the presence or activity of a particular target. Inhibition may refer to partial or complete inhibition. For example, inhibiting an immune response may refer to any action that results in blocking, reducing, eliminating, or any other antagonism of an immune response. In other examples, inhibiting expression of a nucleic acid may include, but is not limited to, reducing transcription of the nucleic acid, reducing mRNA abundance (e.g., silencing mRNA transcription), degrading mRNA, inhibiting mRNA translation, gene editing, and the like. In other examples, inhibiting expression of a protein may include, but is not limited to, reducing transcription of a nucleic acid encoding a protein, reducing stability of an mRNA encoding a protein, inhibiting translation of a protein, reducing stability of a protein, and the like. In another example, inhibition may refer to the action of slowing or stopping growth, for example, delaying or preventing the growth of tumor cells.

[0085] As used herein, the term "suppress" may refer to the action of decreasing, reducing, hindering, restricting, alleviating, or otherwise diminishing the presence or activity of a particular target. Suppression may refer to partial or complete suppression. For example, suppressing an immune response may refer to any action that results in decreasing, reducing, hindering, restricting, alleviating, or otherwise diminishing an immune response. In other examples, suppressing expression of a nucleic acid may include, but is not limited to, reducing transcription of the nucleic acid, reducing mRNA abundance (e.g., silencing mRNA transcription), degrading mRNA, inhibiting mRNA translation, and the like. In other examples, suppressing expression of a protein may include, but is not limited to, reducing transcription of a nucleic acid encoding a protein, reducing stability of an mRNA encoding a protein, inhibiting translation of a protein, reducing stability of a protein, and the like.

[0086] As used herein, the term "enhancing" may refer to the action of improving, boosting, enhancing, or otherwise increasing the presence or activity of a particular target. For example, enhancing an immune response may refer to any action that results in improving, boosting, enhancing, or otherwise increasing an immune response. In an illustrative example, enhancing an immune response may refer to utilizing an antigen and / or an adjuvant to improve, boost, enhance, or otherwise increase an immune response. In other examples, enhancing expression of a nucleic acid may include, but is not limited to, increasing transcription of the nucleic acid, increasing mRNA abundance (e.g., increasing mRNA transcription), reducing mRNA degradation, increasing mRNA translation, and the like. In other examples, enhancing expression of a protein may include, but is not limited to, increasing transcription of a nucleic acid encoding a protein, increasing stability of an mRNA encoding a protein, increasing translation of a protein, increasing stability of a protein, and the like.

[0087] As used herein, the term "induce" may refer to the action of initiating, promoting, stimulating, establishing, or otherwise producing a result. For example, inducing an immune response may refer to any action that results in initiating, promoting, stimulating, establishing, or otherwise producing a desired immune response. In other examples, inducing expression of a nucleic acid may include, but is not limited to, initiating transcription of a nucleic acid, initiating translation of an mRNA, and the like. In other examples, inducing expression of a protein may include, but is not limited to, increasing transcription of a nucleic acid encoding a protein, increasing stability of an mRNA encoding a protein, increasing translation of a protein, increasing stability of a protein, and the like.

[0088] The term "polynucleotide" or "nucleic acid" as used herein refers to a polymeric form of nucleotides of any length, including ribonucleotides and deoxyribonucleotides. Thus, the term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers that contain purine and pyrimidine bases, or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. The backbone of a polynucleotide can include sugar and phosphate groups (typically found in RNA or DNA), or modified or substituted sugar or phosphate groups. The backbone of a polynucleotide can include repeating units such as N-(2-aminoethyl)-glycine linked by peptide bonds (i.e., peptide nucleic acid). Alternatively, the backbone of the polynucleotide can comprise a polymer of synthetic subunits such as phosphoramidates and phosphorothioates, and thus can be an oligodeoxynucleoside phosphoramidate (P-NH2) or a mixed phosphorothioate-phosphorodiester oligomer or a mixed phosphoramidate-phosphodiester oligomer.In addition, double-stranded polynucleotides can be obtained from the single-stranded polynucleotide products of chemical synthesis by either synthesizing a complementary strand and annealing the strands under suitable conditions, or by synthesizing a complementary strand de novo using a DNA polymerase with a suitable primer.

[0089] The terms "polypeptide" and "protein" are used interchangeably to refer to polymers of amino acid residues and are not limited to a minimum length. Such polymers of amino acid residues may contain natural or non-natural amino acid residues, including but not limited to peptides, oligopeptides, dimers, trimers, and multimers of amino acid residues. Both full-length proteins and fragments thereof are encompassed by the definition. The term also includes post-expression modifications of the polypeptide, such as glycosylation, sialylation, acetylation, phosphorylation, and the like. Furthermore, for purposes of the present invention, "polypeptide" refers to proteins that contain modifications, such as deletions, additions, and substitutions (generally conserved in nature), relative to the native sequence, so long as the desired activity is maintained. These modifications may be deliberate, such as through site-directed mutagenesis, or may be accidental, such as through mutations of the host that produces the protein or errors due to PCR amplification.

[0090] As used herein, the term "adjuvant" refers to a substance that modulates and / or generates an immune response. Generally, an adjuvant is administered in conjunction with an antigen to result in an enhanced immune response to the antigen compared to the antigen alone. Various adjuvants are described herein.

[0091] The terms "CpG oligodeoxynucleotide" and "CpG ODN" herein refer to a DNA molecule of 10-30 nucleotides in length that contains a dinucleotide of cytosine and guanine separated by a phosphate (also referred to herein as a "CpG" dinucleotide, or "CpG"). The CpG ODN of the present disclosure contains at least one unmethylated CpG dinucleotide; that is, the cytosine in the CpG dinucleotide is not methylated (i.e., is not a 5-methylcytosine). The CpG ODN may have a partial or complete phosphorothioate (PS) backbone.

[0092] As used herein, "pharmacologically acceptable" or "pharmacologically compatible" means a substance that is not biologically or otherwise undesirable, e.g., the substance may be incorporated into a pharmaceutical composition administered to a patient without causing significant undesirable biological effects or interacting in a deleterious manner with any of the other components of the composition in which it is contained. A pharma- ceutical acceptable carrier or excipient preferably meets the required standards of toxicity and manufacturing testing and / or is included in the Inactive Ingredients Guide prepared by the U.S. Food and Drug Administration.

[0093] For any of the structural and functional characteristics described herein, methods for determining these characteristics are known in the art.

[0094] As used herein, a "microfluidic system" refers to a system in which small volumes (e.g., mL, nL, pL, fL) of fluid are processed to achieve discrete processing of small volumes of liquid. Certain implementations described herein include multiplexing, automation, and high-throughput screening. Fluids (e.g., buffers, solutions, payload-containing solutions, or cell suspensions) can be moved, mixed, separated, or otherwise processed. In certain embodiments described herein, a microfluidic system is used to apply a mechanical constriction to cells suspended in a buffer, inducing a perturbation (e.g., a hole) within the cell, thereby allowing the payload or compound to enter the cytosol of the cell.

[0095] As used herein, a "constriction" may refer to a portion of a microfluidic channel defined by an inlet portion, a center point, and an outlet portion, where the center point is defined by a width, a length, and a depth. In other examples, a constriction may refer to or be a portion of a pore. A pore may be included on a surface (e.g., a filter and / or a membrane).

[0096] For any of the structural and functional characteristics described herein, methods for determining these characteristics are known in the art.

[0097] Treatment method In some aspects, methods of treating HPV-associated disease in an individual are provided, the methods comprising administering to the individual an effective amount of a composition comprising PBMCs, the PBMCs comprising at least one HPV antigen delivered intracellularly, in some embodiments, the methods further comprise administering to the individual an effective amount of one or more immune checkpoint inhibitors.

[0098] In some aspects, methods are provided for treating HPV-associated disease in an individual, the methods comprising administering to the individual an effective amount of a composition comprising PBMCs, the PBMCs comprising at least one HPV antigen to be delivered intracellularly, and administering to the individual an effective amount of an antagonist of TLA-4 and / or an antagonist of PD-1 / PD-L1.

[0099] In some aspects, a method of treating HPV-associated disease in an individual is provided, the method comprising administering to the individual an effective amount of a composition comprising PBMCs, the effective amount being about 0.5×10 4 cells / kg ~ approx. 5.0×10 9 cells / kg, and the PBMCs contain at least one HPV antigen that is delivered intracellularly.

[0100] In some aspects, a method of treating HPV-associated disease in an individual is provided, the method comprising administering to the individual an effective amount of a composition comprising PBMCs, the effective amount being about 0.5×10 6 cells / kg ~ approx. 5.0×10 6 cells / kg, and the PBMCs contain at least one HPV antigen that is delivered intracellularly.

[0101] In some embodiments, the HPV-related disease is HPV-related cancer.In some embodiments, the HPV-related cancer is cervical cancer, perianal cancer, anogenital cancer, oral cancer, salivary gland cancer, oropharyngeal cancer, vaginal cancer, vulvar cancer, penile cancer, skin cancer, esophageal cancer, or head and neck cancer.In some embodiments, the HPV-related disease is HPV-related infectious disease.

[0102] In some embodiments, an effective amount of PBMCs is about 0.5×10 4 , 1.0×10 4 , 0.5×10 5 , 1.0×10 5 , 0.5×10 6 , 1.0×10 6 , 0.5×10 7 , 1.0×10 7 , 0.5×10 8 , 1.0×10 8 , 0.5×10 9 , and 1.0×10 9 In some embodiments, the effective amount is about 0.5×10 4 ~Approx. 1.0×10 4 , about 1.0×10 5 ~about 0.5×10 5 , about 0.5×10 5 ~Approx. 1.0×10 5 , about 1.0×10 5 ~about 0.5×10 6 , about 0.5×10 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , or approximately 0.5 × 10 9 ~Approx. 1.0×10 9 In some embodiments, a method of treating HPV-associated cancer in an individual is provided, the method comprising administering to the individual an effective amount of a composition comprising PBMCs, the effective amount being about 0.5×10 6 g ~ approx. 5×10 6 PBMC / kg, the PBMC containing at least one HPV antigen delivered intracellularly.

[0103] In some embodiments, the method further comprises administering an effective amount of one or more immune checkpoint inhibitors. Exemplary immune checkpoint inhibitors include, but are not limited to, antagonists of PD-1, PD-L1, CTLA-4, LAG3, TIM-3, TIGIT, VISTA, TIM1, B7-H4 (VTCN1), or BTLA. In some embodiments, the immune checkpoint inhibitor is one or more antagonists of PD-1, PD-L1, CTLA-4, LAG3, TIM-3, TIGIT, VISTA, TIM1, B7-H4 (VTCN1), or BTLA. In some embodiments, the immune checkpoint inhibitor is one or more of an antibody that binds to PD-1, an antibody that binds to PD-L1, an antibody that binds to CTLA-4, an antibody that binds to LAG3, an antibody that binds to TIM-3, an antibody that binds to TIGIT, an antibody that binds to VISTA, an antibody that binds to TIM-1, an antibody that binds to B7-H4, or an antibody that binds to BTLA. In further embodiments, the antibody may be a full-length antibody or any variant, such as, but not limited to, an antibody fragment, a single chain variable fragment (ScFv), or a fragment antigen binding (Fab). In further embodiments, the antibody may be bispecific, trispecific, or multispecific. In some embodiments, the immune checkpoint inhibitor is one or more chemical compounds that bind to and / or inhibit one or more of PD-1, PD-L1, CTLA-4, LAG3, TIM-3, TIGIT, VISTA, TIM1, B7-H4 (VTCN1), or BTLA. In some embodiments, the immune checkpoint inhibitor is one or more peptides that bind to and / or inhibit one or more of PD-1, PD-L1, CTLA-4, LAG3, TIM-3, TIGIT, VISTA, TIM1, B7-H4 (VTCN1), or BTLA. In some embodiments, the immune checkpoint inhibitor targets PD-1. In some embodiments, the immune checkpoint inhibitor targets PD-L1. In some embodiments, the immune checkpoint inhibitor targets CTLA-4.

[0104] In some embodiments, a method of treating HPV-associated cancer in an individual is provided, the method comprising administering to the individual an effective amount of a composition comprising PBMCs, the PBMCs comprising at least one HPV antigen to be delivered intracellularly, and administering an effective amount of one or more immune checkpoint inhibitors. In some embodiments, a method of treating HPV-associated cancer in an individual is provided, the method comprising administering to the individual an effective amount of a composition comprising PBMCs, the effective amount being about 0.5×10 6 ~Approx. 5×10 6 and administering PBMCs, the PBMCs comprising at least one HPV antigen to be delivered intracellularly, and administering an effective amount of one or more immune checkpoint inhibitors. In some embodiments, the immune checkpoint inhibitor is an antagonist of CTLA-4. In some embodiments, the immune checkpoint inhibitor is an antagonist of PD-1. In some embodiments, the immune checkpoint inhibitor is an antagonist of PD-L1. In some embodiments, the one or more checkpoint inhibitors comprise an antagonist of CTLA-4, an antagonist of PD-1, and / or an antagonist of PD-L1. In some embodiments, the immune checkpoint inhibitor is an antibody that binds CTLA-4. In some embodiments, the antagonist of PD-1 is an antibody that binds PD-1. In some embodiments, the antagonist of PD-L1 is an antibody that binds PD-L1. In some embodiments, the one or more checkpoint inhibitors comprise an antibody that binds CTLA-4, an antibody that binds PD-1, and / or an antibody that binds PD-L1.

[0105] In some embodiments, a method of treating HPV-associated cancer in an individual is provided, the method comprising administering to the individual an effective amount of a composition comprising PBMCs, the PBMCs comprising at least one HPV antigen delivered intracellularly, and administering an effective amount of an antagonist of CTLA-4, an antagonist of PD-1, and / or an antagonist of PD-L1. In some embodiments, a method of treating HPV-associated cancer in an individual is provided, the method comprising administering to the individual an effective amount of a composition comprising PBMCs, the PBMCs comprising at least one HPV antigen delivered intracellularly, and administering an effective amount of an antibody that binds CTLA-4, an antibody that binds PD-1, and / or an antibody that binds PD-L1. In some embodiments, the antibody that binds PD-1 is nivolumab. In some embodiments, the antibody that binds PD-1 is pembrolizumab. In some embodiments, the antibody that binds PD-L1 is atezolizumab. In some embodiments, the antibody that binds CTLA-4 is ipilimumab. In some embodiments, an antibody that binds CTLA-4 is administered to the individual. In some embodiments, an antibody that binds PD-L1 is administered to the individual. In some embodiments, an antibody that binds PD-1 is administered to the individual.

[0106] In some aspects, a method of stimulating an immune response to an HPV antigen in an individual is provided, the method comprising administering to the individual an effective amount of a composition comprising PBMCs, the PBMCs comprising at least one HPV antigen, and the at least one HPV antigen being delivered intracellularly to the PBMCs. In some embodiments, the PBMCs further comprise an adjuvant. In some embodiments, the method comprises administering an effective amount of any of the compositions described herein. In some embodiments, the individual has cancer.

[0107] In some aspects, a method of suppressing tumor growth in an individual is provided, the method comprising administering to the individual an effective amount of a composition comprising PBMCs, the PBMCs comprising at least one HPV antigen, and the at least one HPV antigen being delivered intracellularly to the PBMCs. In some embodiments, the PBMCs further comprise an adjuvant. In some embodiments, the method comprises administering an effective amount of any of the compositions described herein. In some embodiments, the individual has cancer.

[0108] In some aspects, a method of vaccinating an individual in need thereof is provided, the method comprising administering to the individual an effective amount of a composition comprising PBMCs, the PBMCs comprising at least one HPV antigen, and the at least one HPV antigen being delivered intracellularly to the PBMCs. In some embodiments, the PBMCs further comprise an adjuvant. In some embodiments, the method comprises administering an effective amount of any of the compositions described herein. In some embodiments, the individual has cancer.

[0109] In some aspects, a method of treating cancer in an individual is provided, the method comprising administering to the individual an effective amount of a composition comprising PBMCs, the PBMCs comprising at least one HPV antigen, and the at least one HPV antigen being delivered intracellularly to the PBMCs. In some embodiments, the PBMCs further comprise an adjuvant. In some embodiments, the method comprises administering an effective amount of any of the compositions described herein.

[0110] In some aspects, a method is provided for stimulating an immune response to HPV antigens in an individual, the method comprising: a) passing a cell suspension comprising input PBMCs through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing perturbation of the input PBMCs sufficient to allow HPV antigens or HPV antigens and adjuvant to pass through to form perturbed input PBMCs; b) culturing the perturbed PBMCs with HPV antigens or HPV antigens and adjuvant for a sufficient time to allow HPV antigens or HPV antigens and adjuvant to enter the perturbed input PBMCs, thereby generating PBMCs comprising HPV antigens or HPV antigens and adjuvant; and c) administering to the individual an effective amount of the HPV antigens or HPV antigens and adjuvant comprising PBMCs.

[0111] In some aspects, a method is provided for inhibiting tumor growth in an individual, the method comprising: a) passing a cell suspension comprising input PBMCs through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing perturbation of the input PBMCs sufficient to allow HPV antigens or HPV antigens and adjuvant to pass through to form perturbed input PBMCs; b) culturing the perturbed PBMCs with HPV antigens or HPV antigens and adjuvant for a sufficient time to allow HPV antigens or HPV antigens and adjuvant to enter the perturbed input PBMCs, thereby generating PBMCs comprising HPV antigens or HPV antigens and adjuvant; and c) administering to the individual an effective amount of the PBMCs comprising HPV antigens or HPV antigens and adjuvant.

[0112] In some aspects, there is provided a method for vaccinating an individual in need thereof, the method comprising: a) passing a cell suspension comprising input PBMCs through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing perturbation of the input PBMCs sufficient to allow HPV antigens or HPV antigens and adjuvant to pass through to form perturbed input PBMCs; b) culturing the perturbed PBMCs with HPV antigens or HPV antigens and adjuvant for a sufficient time to allow HPV antigens or HPV antigens and adjuvant to enter the perturbed input PBMCs, thereby generating PBMCs comprising HPV antigens or HPV antigens and adjuvant; and c) administering to the individual an effective amount of the PBMCs comprising HPV antigens or HPV antigens and adjuvant.

[0113] In some aspects, a method is provided for treating cancer in an individual, the method comprising: a) passing a cell suspension comprising input PBMCs through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing perturbation of the input PBMCs sufficient to allow HPV antigens or HPV antigens and adjuvant to pass through to form perturbed input PBMCs; b) culturing the perturbed PBMCs with HPV antigens or HPV antigens and adjuvant for a sufficient time to allow HPV antigens or HPV antigens and adjuvant to enter the perturbed input PBMCs, thereby generating PBMCs comprising HPV antigens or HPV antigens and adjuvant; and c) administering to the individual an effective amount of PBMCs comprising HPV antigens or HPV antigens and adjuvant.

[0114] In some embodiments of any method, use, or composition described herein, the method includes: a) passing a cell suspension comprising input PBMCs through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing a perturbation of the input PBMCs sufficient to allow HPV antigens to pass through to form perturbed input PBMCs; b) culturing the perturbed input PBMCs with HPV antigens for a sufficient time to allow HPV antigens to enter the perturbed input PBMCs, thereby producing modified PBMCs comprising HPV antigens; and c) administering to the individual an effective amount of the modified PBMCs comprising HPV antigens.

[0115] In some embodiments, a composition is provided for stimulating an immune response to HPV proteins in an individual, the composition comprising an effective amount of any one of the compositions comprising PBMCs comprising at least one HPV antigen described herein. In some embodiments, a composition is provided for inhibiting tumor growth, the composition comprising an effective amount of any one of the compositions comprising PBMCs comprising at least one HPV antigen described herein. In some embodiments, the individual has cancer. In some embodiments, a composition is provided for treating cancer in an individual, the composition comprising any one of the compositions comprising PBMCs comprising at least one HPV antigen described herein. In some embodiments, the cancer is cervical cancer, perianal cancer, anogenital cancer, oral cancer, salivary gland cancer, oropharyngeal cancer, vaginal cancer, vulvar cancer, penile cancer, skin cancer, head and neck cancer, or esophageal cancer.

[0116] In some embodiments, a composition is provided for stimulating an immune response to an HPV protein in an individual, the composition comprising an effective amount of any one of the compositions comprising PBMCs comprising at least one HPV antigen described herein. In some embodiments, a composition is provided for inhibiting tumor growth, the composition comprising an effective amount of any one of the compositions comprising PBMCs comprising at least one HPV antigen described herein. In some embodiments, the individual has cancer. In some embodiments, a composition is provided for treating cancer in an individual, the composition comprising any one of the compositions comprising PBMCs comprising at least one HPV antigen described herein.

[0117] In some embodiments, there is provided a use of a composition comprising an effective amount of PBMCs in the manufacture of a medicament for stimulating an immune response to an HPV antigen, the composition comprising an effective amount of any one of the compositions comprising PBMCs comprising at least one HPV antigen described herein. In some embodiments, there is provided a use of a composition comprising an effective amount of PBMCs in the manufacture of a medicament for reducing tumor growth in an individual, the composition comprising an effective amount of any one of the compositions comprising PBMCs comprising at least one HPV antigen described herein. In some embodiments, the individual has cancer. In some embodiments, there is provided a use of a composition comprising an effective amount of PBMCs in the manufacture of a medicament for treating cancer in an individual, the composition comprising an effective amount of any one of the compositions comprising PBMCs comprising at least one HPV antigen described herein.

[0118] In some embodiments, there is provided a use of a composition comprising an effective amount of PBMCs in the manufacture of a medicament for stimulating an immune response to an HPV antigen protein, the composition comprising an effective amount of any one of the compositions comprising PBMCs comprising at least one HPV antigen described herein. In some embodiments, there is provided a use of a composition comprising an effective amount of PBMCs in the manufacture of a medicament for reducing tumor growth in an individual, the composition comprising an effective amount of any one of the compositions comprising PBMCs comprising at least one HPV antigen described herein. In some embodiments, the individual has cancer. In some embodiments, there is provided a use of a composition comprising an effective amount of PBMCs in the manufacture of a medicament for treating cancer in an individual, the composition comprising an effective amount of any one of the compositions comprising PBMCs comprising at least one HPV antigen described herein.

[0119] In some embodiments of the methods, uses, or compositions described herein, the individual has cancer. In some embodiments, the cancer is cervical cancer, perianal cancer, anogenital cancer, oral cancer, salivary gland cancer, oropharyngeal cancer, vaginal cancer, vulvar cancer, penile cancer, skin cancer, head and neck cancer, or esophageal cancer. In some embodiments, the cancer is HPV-associated cancer. In some embodiments, the cancer is localized cancer. In some embodiments, the cancer is localized cancer. In some embodiments, the cancer is localized advanced cancer. In some embodiments, the cancer is metastatic cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is a liquid cancer.

[0120] In some embodiments, the cancer is refractory to therapeutic treatment with surgery, radiation, and / or chemoradiotherapy. In some embodiments, the cancer has progressed after previous systemic chemotherapy with a platinum-based regimen in the adjuvant or recurrent setting. In some embodiments, the cancer has progressed after previous chemotherapy treatment with one or more of cisplatin, paclitaxel, carboplatin, and / or 5FU. In some embodiments, the cancer has progressed after previous immune checkpoint inhibitor treatment. In some embodiments, the cancer has progressed after prior treatment with one or more of pembrolizumab, bevacizumab, and / or pembrolizumab. In some embodiments, the cancer was treated with a platinum agent. In some embodiments, the cancer is platinum resistant. In some embodiments, the individual has progressive disease during or after completion of a recent prior treatment. In some embodiments, the cancer is cervical cancer. In some embodiments, the cancer is recurrent or metastatic cervical cancer.

[0121] In some embodiments, the cancer is refractory to therapeutic treatment with surgery, radiation, and / or chemoradiotherapy. In some embodiments, the cancer has progressed after at least one (e.g., 1, 2, 3, 4, 5, or more) prior platinum-based chemotherapy in the initial, adjuvant, or recurrent setting, and checkpoint immunotherapy is provided. In some embodiments, the cancer has progressed after prior chemotherapy treatment with one or more of cisplatin, paclitaxel, carboplatin, and / or 5FU. In some embodiments, the cancer has progressed after prior immune checkpoint inhibitor treatment. In some embodiments, the cancer has progressed after prior treatment with one or more of pembrolizumab, bevacizumab, and / or pembrolizumab. In some embodiments, the cancer has been treated with a platinum agent. In some embodiments, the cancer is platinum resistant. In some embodiments, the individual has relapsed after platinum-containing definitive chemoradiotherapy or adjuvant chemoradiotherapy, and platinum rechallenge at the time of relapse is not considered beneficial. In some embodiments, the cancer is head and neck cancer. In some embodiments, the cancer is recurrent or metastatic head and neck cancer.

[0122] In some embodiments, the width of the constriction is about 10% to about 99% of the average diameter of the PBMCs. In some embodiments, the width of the constriction is any one of about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 20% to about 60%, about 40% to about 60%, about 30% to about 45%, about 50% to about 99%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 60% to about 90%, about 60% to about 80%, or about 60% to about 70% of the average diameter of the input PBMCs having the smallest diameter in the population of PBMCs. In some embodiments, the width of the constriction is about 3 μm to about 5 μm, about 3 μm to about 3.5 μm, about 3.5 μm to about 4 μm, about 4 μm to about 4.5 μm, about 3.2 μm to about 3.8 μm, about 3.8 μm to about 4.3 μm, about 4.2 μm to about 6 μm, or about 4.2 μm to about 4.8 μm. In some embodiments, the width of the constriction is 4.5 μm. In some embodiments, the width of the constriction is less than or equal to about any one of 2 μm, 2.5 μm, 3 μm, 3.5 μm, 4 μm, 4.5 μm, 5 μm, 5.5 μm, 6 μm, 6.5 μm, 7 μm, 7.5 μm, 8 μm, 8.5 μm, 9 μm, 9.5 μm, 10 μm, 10.5 μm, 11 μm, 11.5 μm, 12 μm, 12.5 μm, 13 μm, 13.5 μm, 14 μm, 14.5 μm, or 15 μm. In some embodiments, the cell suspension comprising the input PBMCs is passed through multiple constrictions, and the multiple constrictions are arranged in series and / or parallel.

[0123] In some embodiments, the input PBMCs are autologous to the individual. In some embodiments, the input PBMCs are allogeneic to the individual. In some embodiments, the modified PBMCs comprising HPV antigens are autologous to the individual. In some embodiments, the modified PBMCs comprising HPV antigens are allogeneic to the individual.

[0124] In some embodiments of any one of the methods, uses, or compositions described herein, the PBMCs are cultured with the adjuvant for a time sufficient to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant for about 1 to about 24 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant for about 2 to about 10 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant for about 3 to about 6 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant for any one of about 1 hour, 2 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 8 hours, 12 hours, 16 hours, 20 hours, or 24 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant for about 4 hours to condition the PBMCs. In some embodiments, the PBMCs are conditioned before HPV antigen or a nucleic acid encoding the HPV antigen is introduced into the PBMCs. In some embodiments, the PBMCs are conditioned after HPV antigen or a nucleic acid encoding the HPV antigen is introduced into the PBMCs. In some embodiments, the adjuvant used for conditioning is CpG oligodeoxynucleotide (ODN), LPS, IFN-α, IFN-β, IFN-γ, alpha-galactosylceramide, STING agonist, cyclic dinucleotide (CDN), RIG-I agonist, polyinosinic-polycytidyl (poly I:C), R837, R848, TLR3 agonist, TLR4 agonist, or TLR9 agonist. In some embodiments, the adjuvant is CpG oligodeoxynucleotide (ODN). In some embodiments, the adjuvant is CpG 7909.

[0125] In some embodiments, the PBMCs comprise B cells, and one or more costimulatory molecules are upregulated in B cells of the conditioned PBMCs compared to B cells of the unconditioned PBMCs. In some embodiments, one or more costimulatory molecules are upregulated in B cells of the conditioned PBMCs compared to B cells of the unconditioned PBMCs. In some embodiments, the costimulatory molecules are CD80 and / or CD86. In some embodiments, the conditioned PBMCs have increased expression of one or more of IFN-γ, IL-6, MCP-1, MIP-1β, IP-10, or TNF-α compared to the unconditioned PBMCs. In some embodiments, the expression of one or more of IFN-γ, IL-6, MCP-1, MIP-1β, IP-10, or TNF-α is increased by more than about 1.2-fold, 1.5-fold, 1.8-fold, 2-fold, 3-fold, 4-fold, 5-fold, 8-fold, or 10-fold compared to the unconditioned PBMCs.

[0126] In some embodiments, the PBMCs are human cells. In some embodiments, the PBMCs are human cells. * 02. HLA-A * 01. HLA-A * 03. HLA-A * 24. HLA-A * 11. HLA-A * 26. HLA-A * 32. HLA-A * 31. HLA-A * 68, HLA-A * 29. HLA-A * 23. HLA-B * 07. HLA-B * 44. HLA-B * 08. HLA-B * 35. HLA-B * 15. HLA-B * 40, HLA-B * 27. HLA-B * 18. HLA-B * 51. HLA-B * 14. HLA-B * 13. HLA-B * 57, HLA-B *38. HLA-C * 07. HLA-C * 04. HLA-C * 03. HLA-C * 06. HLA-C * 05. HLA-C * 12. HLA-C * 02. HLA-C * 01. HLA-C * 08, or HLA-C * The PBMCs are human cells having haplotype 16. In some embodiments, the plurality of PBMCs comprises two or more of T cells, B cells, NK cells, monocytes, dendritic cells, or NK-T cells. In some embodiments, the PBMCs are one or more of T cells, B cells, NK cells, monocytes, dendritic cells, and / or NK-T cells.

[0127] In some embodiments, the PBMCs are further modified to increase expression of one or more costimulatory molecules. In some embodiments, the costimulatory molecules are B7-H2 (ICOSL), B7-1 (CD80), B7-2 (CD86), CD70, LIGHT, HVEM, CD40, 4-1BBL, OX40L, TL1A, GITRL, CD30L, TIM4, SLAM, CD48, CD58, CD155, or CD112. In some embodiments, the PBMCs are further modified to increase expression of one or more cytokines. In some embodiments, the cytokines are IL-10, IL-15, IL-12, IL-2, IFN-α, IFN-γ, or IL21.

[0128] In some embodiments, the HPV antigen is a pool of multiple polypeptides that elicit responses to the same and / or different HPV antigens. In some embodiments, the HPV antigen is a polypeptide that includes one or more antigenic HPV epitopes and one or more heterologous peptide sequences. In some embodiments, the HPV antigen is complexed with other antigens or adjuvants. In some embodiments, the HPV antigen can be processed into MHC class I restricted peptides. In some embodiments, the HPV antigen can be processed into MHC class II restricted peptides.

[0129] In some embodiments, the method includes multiple administrations of PBMCs comprising at least one HPV antigen. In some embodiments, the method includes about 3 to about 9 administrations of PBMCs comprising HPV antigen. In some embodiments, the method includes about any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 administrations of PBMCs comprising HPV antigen. In some embodiments, the method includes sequential administrations of PBMCs comprising HPV antigen, if desired. In some embodiments, the time interval between two consecutive administrations of PBMCs comprising HPV antigen is between about 1 day and about 30 days. In some embodiments, the time interval between two consecutive administrations of PBMCs comprising HPV antigen is about 21 days. In some embodiments, the time interval between two consecutive administrations of PBMCs comprising HPV antigens is any one of about 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, 14, 16, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or 150 days. In some embodiments, the time interval between the first two consecutive administrations of PBMCs comprising HPV antigens is 1 or 2 days. In some embodiments, the time interval between the first two consecutive administrations of PBMCs comprising HPV antigens is 1 or 2 days, and the method includes more than two administrations of PBMCs comprising HPV antigens (e.g., but not limited to, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more administrations). In some embodiments, the PBMCs containing the HPV antigens are administered intravenously, intratumorally, orally and / or subcutaneously. In some embodiments, the PBMCs containing the HPV antigens are administered intravenously.

[0130] In some embodiments, the composition further comprises an adjuvant. In some embodiments, the adjuvant is CpG oligodeoxynucleotide (ODN), LPS, IFN-α, IFN-β, IFN-γ, alpha-galactosylceramide, STING agonist, cyclic dinucleotide (CDN), RIG-I agonist, polyinosinic-polycytidylic acid, R837, R848, TLR3 agonist, TLR4 agonist, or TLR9 agonist. In some embodiments, the adjuvant is CpG oligodeoxynucleotide. In some embodiments, the adjuvant is poly I:C.

[0131] In some embodiments, the individual is HLA-A * 02. HLA-A * 01. HLA-A * 03. HLA-A * 24. HLA-A * 11. HLA-A * 26. HLA-A * 32. HLA-A * 31. HLA-A * 68, HLA-A * 29. HLA-A * 23. HLA-B * 07. HLA-B * 44. HLA-B * 08. HLA-B * 35. HLA-B * 15. HLA-B * 40, HLA-B * 27. HLA-B * 18. HLA-B * 51. HLA-B * 14. HLA-B * 13. HLA-B * 57, HLA-B * 38. HLA-C * 07. HLA-C * 04. HLA-C * 03. HLA-C * 06. HLA-C * 05. HLA-C * 12. HLA-C * 02. HLA-C * 01. HLA-C *08, or HLA-C * The results were positive for expression of 16.

[0132] Immune checkpoints are regulators of the immune system and suppress immune responses. Immune checkpoint inhibitors can be used to promote enhanced immune responses. In some embodiments, a composition comprising PBMCs containing HPV antigens is administered in combination with administration of an immune checkpoint inhibitor. In some embodiments, a composition comprising PBMCs containing HPV antigens and an immune checkpoint inhibitor are administered simultaneously. In some embodiments, a composition comprising PBMCs containing HPV antigens and an immune checkpoint inhibitor are administered sequentially. In some embodiments, an immune checkpoint inhibitor and / or PBMCs containing HPV antigens are administered intravenously, intratumorally, orally, and / or subcutaneously. In some embodiments, a PBMC containing HPV antigens is administered intravenously. In some embodiments, an immune checkpoint inhibitor is administered intravenously, intratumorally, orally, and / or subcutaneously.

[0133] In some embodiments, the composition comprising PBMCs containing HPV antigens is administered before administration of an immune checkpoint inhibitor. In some embodiments, the composition comprising PBMCs containing HPV antigens is administered after administration of an immune checkpoint inhibitor. For example, the composition comprising PBMCs containing HPV antigens is administered about 1 hour to about 1 week before administration of an immune checkpoint inhibitor. For example, in some embodiments, the composition comprising PBMCs containing HPV antigens is administered about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 14 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 30 hours, about 36 hours, about 42 hours, about 48 hours, about 60 hours, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days before administration of an immune checkpoint inhibitor. In some embodiments, the composition comprising PBMCs containing the HPV antigen is administered about 1 hour to about 2 hours, about 2 hours to about 3 hours, about 3 hours to about 4 hours, about 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to about 10 hours, about 10 hours to about 12 hours, about 12 hours to about 14 hours, about 14 hours to about 16 hours, about 16 hours to about 18 hours, about 18 hours to about 20 hours, about 20 hours to about 24 hours, about 24 hours to about 30 hours, about 30 hours to about 36 hours, about 36 hours to about 42 hours, about 42 hours to about 48 hours, about 48 hours to about 60 hours, about 60 hours to about 3 days, about 3 days to about 4 days, about 4 days to about 5 days, about 5 days to about 6 days, or about 6 days to about 7 days prior to administration of the immune checkpoint inhibitor.

[0134] In some embodiments, the composition comprising PBMCs containing HPV antigens is administered about 7 days, about 10 days, about 14 days, about 18 days, about 21 days, about 24 days, about 28 days, about 30 days, about 35 days, about 40 days, about 45 days, or about 50 days prior to administration of an immune checkpoint inhibitor. In some embodiments, the composition comprising PBMCs containing HPV antigens is administered about 7 days to about 10 days, about 10 days to about 14 days, about 14 days to about 18 days, about 18 days to about 21 days, about 21 days to about 24 days, about 24 days to about 28 days, about 28 days to about 30 days, about 30 days to about 35 days, about 35 days to about 40 days, about 40 days to about 45 days, or about 45 days to about 50 days prior to administration of an immune checkpoint inhibitor.

[0135] In some embodiments, the composition comprising PBMCs containing HPV antigens is administered after administration of an immune checkpoint inhibitor. For example, the composition comprising PBMCs containing HPV antigens is administered about 1 hour to about 1 week after administration of an immune checkpoint inhibitor. For example, in some embodiments, the composition comprising PBMCs containing HPV antigens is administered about 1 hour, about 2 hours, about 3 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 14 hours, about 16 hours, about 18 hours, about 20 hours, about 24 hours, about 30 hours, about 36 hours, about 42 hours, about 48 hours, about 60 hours, about 3 days, about 4 days, about 5 days, about 6 days, or about 7 days after administration of an immune checkpoint inhibitor. In some embodiments, the composition comprising PBMCs containing the HPV antigen is administered about 1 hour to about 2 hours, about 2 hours to about 3 hours, about 3 hours to about 4 hours, about 4 hours to about 6 hours, about 6 hours to about 8 hours, about 8 hours to about 10 hours, about 10 hours to about 12 hours, about 12 hours to about 14 hours, about 14 hours to about 16 hours, about 16 hours to about 18 hours, about 18 hours to about 20 hours, about 20 hours to about 24 hours, about 24 hours to about 30 hours, about 30 hours to about 36 hours, about 36 hours to about 42 hours, about 42 hours to about 48 hours, about 48 hours to about 60 hours, about 60 hours to about 3 days, about 3 days to about 4 days, about 4 days to about 5 days, about 5 days to about 6 days, or about 6 days to about 7 days after administration of the immune checkpoint inhibitor.

[0136] In some embodiments, the composition comprising PBMCs containing HPV antigens is administered about 7 days, about 10 days, about 14 days, about 18 days, about 21 days, about 24 days, about 28 days, about 30 days, about 35 days, about 40 days, about 45 days, or about 50 days after administration of an immune checkpoint inhibitor. In some embodiments, the composition comprising PBMCs containing HPV antigens is administered about 7 days to about 10 days, about 10 days to about 14 days, about 14 days to about 18 days, about 18 days to about 21 days, about 21 days to about 24 days, about 24 days to about 28 days, about 28 days to about 30 days, about 30 days to about 35 days, about 35 days to about 40 days, about 40 days to about 45 days, or about 45 days to about 50 days after administration of an immune checkpoint inhibitor.

[0137] In some embodiments, the method includes multiple administrations of the composition comprising PBMCs comprising HPV antigens and / or multiple administrations of the immune checkpoint inhibitor. For example, in some embodiments, the method includes two administrations, three administrations, four administrations, five administrations, six administrations, seven administrations, eight administrations, nine administrations, ten administrations, eleven administrations, twelve administrations, thirteen administrations, fourteen administrations, or fifteen administrations of the composition comprising PBMCs comprising HPV antigens and / or the immune checkpoint inhibitor. For example, in some embodiments, the method includes less than five administrations, less than ten administrations, less than fifteen administrations, less than twenty administrations, less than twenty-five administrations, less than thirty administrations, less than fifty administrations, less than seventy-five administrations, less than one hundred administrations, or less than two hundred administrations of the composition comprising PBMCs comprising HPV antigens and / or the immune checkpoint inhibitor.

[0138] Exemplary immune checkpoint inhibitors include, but are not limited to, those that target PD-1, PD-L1, CTLA-4, LAG3, TIM-3, TIGIT, VISTA, TIM1, B7-H4 (VTCN1), or BTLA. In some embodiments, the immune checkpoint inhibitor targets one or more of PD-1, PD-L1, CTLA-4, LAG3, TIM-3, TIGIT, VISTA, TIM1, B7-H4 (VTCN1), or BTLA. In some embodiments, the immune checkpoint inhibitor is one or more of an antibody that binds to PD-1, an antibody that binds to PD-L1, an antibody that binds to CTLA-4, an antibody that binds to LAG3, or an antibody that binds to TIM-3, an antibody that binds to TIGIT, an antibody that binds to VISTA, an antibody that binds to TIM-1, an antibody that binds to B7-H4, or an antibody that binds to BTLA. In further embodiments, the antibody may be a full-length antibody or any variant, such as, but not limited to, an antibody fragment, a single chain variable fragment (ScFv), or a fragment antigen binding (Fab). In further embodiments, the antibody may be bispecific, trispecific, or multispecific. In some embodiments, the immune checkpoint inhibitor is one or more chemical compounds that bind to and / or inhibit one or more of PD-1, PD-L1, CTLA-4, LAG3, TIM-3, TIGIT, VISTA, TIM1, B7-H4 (VTCN1), or BTLA. In some embodiments, the immune checkpoint inhibitor is one or more peptides that bind to and / or inhibit one or more of PD-1, PD-L1, CTLA-4, LAG3, TIM-3, TIGIT, VISTA, TIM1, B7-H4 (VTCN1), or BTLA. In some embodiments, the immune checkpoint inhibitor targets PD-1. In some embodiments, the immune checkpoint inhibitor targets PD-L1.

[0139] In some embodiments, there is provided a plurality of PBMCs comprising at least one HPV antigen for use in a method of stimulating an immune response in an individual, according to any one of the methods described herein.

[0140] In some embodiments of any one of the methods of treating HPV-associated cancer described herein, the treatment includes any or all of killing cancer cells, inhibiting the growth of cancer cells, inhibiting the replication of cancer cells, reducing overall tumor burden, and ameliorating one or more symptoms associated with the disease. In some embodiments, the method of treating HPV-associated cancer is more effective in patients with low tumor burden than in patients with high tumor burden. In some embodiments, the method of treating HPV-associated cancer results in a higher rate of one or more of the following: killing cancer cells, inhibiting the growth of cancer cells, inhibiting the replication of cancer cells, reducing overall tumor burden, and improving one or more symptoms associated with the disease in patients with lower tumor burden compared to patients with high tumor burden.

[0141] Composition of PBMCs containing HPV antigens In some embodiments of the methods of treatment described herein, the PBMCs contain an HPV antigen and an adjuvant that are delivered intracellularly. In some embodiments, the PBMCs containing at least one HPV antigen are conditioned. In some embodiments, the PBMCs containing at least one HPV antigen are conditioned by a process of culturing the PBMCs with the adjuvant at about 37° C. for about 2 hours to about 10 hours, about 3 hours to about 6 hours, or about 4 hours to condition the PBMCs.

[0142] In some embodiments, the method of treatment includes administering an effective amount of PBMCs comprising at least one HPV antigen, where the PBMCs comprising at least one HPV antigen are prepared by: a) passing a cell suspension comprising input PBMCs through a cell-transforming constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing a perturbation of the input PBMCs sufficient to allow the at least one HPV antigen to pass to form a perturbed input PBMC, and b) culturing the perturbed input PBMCs with at least one HPV antigen for a sufficient time to allow the at least one HPV antigen to enter the perturbed input PBMC, thereby generating a modified PBMC comprising at least one HPV antigen. In some embodiments, the HPV antigen comprises an amino acid sequence of any one of SEQ ID NOs: 1-4 and 18-25. In some embodiments, the HPV antigen comprises an amino acid sequence having at least 90% identity to any one of SEQ ID NOs: 1-4 and 18-25.

[0143] In some embodiments, the method includes administering an effective amount of PBMCs comprising HPV antigens and adjuvants, the PBMCs comprising HPV antigens and adjuvants being prepared by: a) passing a cell suspension comprising input PBMCs through a cell-deforming constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing a perturbation of the input PBMCs sufficient to allow the HPV antigens and adjuvants to pass to form perturbed input PBMCs, and b) culturing the perturbed input PBMCs with HPV antigens and adjuvants for a sufficient time to allow the HPV antigens and adjuvants to enter the perturbed input PBMCs, thereby generating modified PBMCs comprising HPV antigens and adjuvants. In some embodiments, the HPV antigen comprises an amino acid sequence of any one of SEQ ID NOs: 1-4 and 18-25. In some embodiments, the HPV antigen comprises an amino acid sequence having at least 90% identity to any one of SEQ ID NOs: 1-4 and 18-25.

[0144] In some aspects, a composition of PBMCs comprising at least one HPV antigen is provided, where the PBMCs comprising at least one HPV antigen are prepared by: a) passing a cell suspension comprising input PBMCs through a cell-deforming constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing a perturbation of the input PBMCs sufficient to allow the at least one HPV antigen to pass to form a perturbed input PBMC, and b) culturing the perturbed input PBMCs with at least one HPV antigen for a sufficient time to allow the at least one HPV antigen to enter the perturbed input PBMC, thereby generating a modified PBMC comprising at least one HPV antigen. In some embodiments, the HPV antigen comprises an amino acid sequence of any one of SEQ ID NOs: 1-4 and 18-25. In some embodiments, the HPV antigen comprises an amino acid sequence having at least 90% identity to any one of SEQ ID NOs: 1-4 and 18-25.

[0145] In some embodiments, the width of the constriction is about 10% to about 99% of the average diameter of the input PBMCs. In some embodiments, the width of the constriction is any one of about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 20% to about 60%, about 40% to about 60%, about 30% to about 45%, about 50% to about 99%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 60% to about 90%, about 60% to about 80%, or about 60% to about 70% of the average diameter of the input PBMCs having the smallest diameter in the population of PBMCs. In some embodiments, the width of the constriction is any one of about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 20% to about 60%, about 40% to about 60%, about 30% to about 45%, about 50% to about 99%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 60% to about 90%, about 60% to about 80%, or about 60% to about 70% of the average diameter of the input PBMCs. In some embodiments, the width of the constriction is about 3 μm to about 5 μm, about 3 μm to about 3.5 μm, about 3.5 μm to about 4 μm, about 4 μm to about 4.5 μm, about 3.2 μm to about 3.8 μm, about 3.8 μm to about 4.3 μm, about 4.2 μm to about 6 μm, or about 4.2 μm to about 4.8 μm. In some embodiments, the width of the constriction is 4.5 μm. In some embodiments, the width of the constriction is less than or equal to about 2 μm, 2.5 μm, 3 μm, 3.5 μm, 4 μm, 4.5 μm, 5 μm, 5.5 μm, 6 μm, 6.5 μm, 7 μm, 7.5 μm, 8 μm, 8.5 μm, 9 μm, 9.5 μm, 10 μm, 10.5 μm, 11 μm, 11.5 μm, 12 μm, 12.5 μm, 13 μm, 13.5 μm, 14 μm, 14.5 μm, or 15 μm. In some embodiments, the cell suspension comprising the input PMBCs is passed through a plurality of constrictions, the plurality of constrictions being arranged in series and / or in parallel. In some embodiments, the cell suspension comprising the input PBMCs is passed through a plurality of constrictions, the plurality of constrictions being arranged in series and / or in parallel.

[0146] In some embodiments, the HPV antigen is a pool of multiple polypeptides that elicit responses to the same and / or different HPV antigens. In some embodiments, the HPV antigen is a polypeptide that includes one or more antigenic HPV epitopes and one or more heterologous peptide sequences. In some embodiments, the HPV antigen is complexed with other antigens or adjuvants. In some embodiments, the HPV antigen can be processed into MHC class I restricted peptides. In some embodiments, the HPV antigen can be processed into MHC class II restricted peptides.

[0147] In some embodiments, the composition further comprises an adjuvant.In some embodiments, the adjuvant is CpG oligodeoxynucleotide (ODN), LPS, IFN-α, IFN-β, IFN-γ, alpha-galactosylceramide, STING agonist, cyclic dinucleotide (CDN), RIG-I agonist, polyinosinic-polycytidylic acid (poly I:C), R837, R848, TLR3 agonist, TLR4 agonist, or TLR9 agonist.In some embodiments, the adjuvant is polyinosinic-polycytidylic acid (poly I:C).

[0148] Dosage and Regimen In some embodiments, a method of treating HPV-associated disease in an individual is provided, the method comprising administering to the individual an effective amount of a composition comprising PBMCs, the effective amount being about 0.5×10 6 g ~ approx. 5×10 6 cells / kg, and the PBMCs contain at least one HPV antigen delivered intracellularly. In some embodiments, the method further comprises administering an effective amount of one or more immune checkpoint inhibitors.

[0149] In some embodiments according to any one of the methods described herein, the effective amount of PBMCs comprises 0.5×10 6 ~Approx. 5×10 6 In some embodiments, an effective amount of PBMCs comprising at least one HPV antigen comprises about 0.5×10 4, 1.0×10 4 , 0.5×10 5 , 1.0×10 5 , 0.5×10 6 , 1.0×10 6 , 0.5×10 7 , 1.0×10 7 , 0.5×10 8 , 1.0×10 8 , 0.5×10 9 , and 1.0×10 9 In some embodiments, the effective amount is about 0.5×10 4 ~Approx. 1.0×10 4 , about 1.0×10 5 ~about 0.5×10 5 , about 0.5×10 5 ~Approx. 1.0×10 5 , about 1.0×10 5 ~about 0.5×10 6 , about 0.5×10 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , or approximately 0.5 × 10 9 ~Approx. 1.0×10 9 In some embodiments, a method of treating HPV-associated cancer in an individual is provided, the method comprising administering to the individual an effective amount of a composition comprising PBMCs, the effective amount being about 0.5×10 6 g ~ approx. 5×10 6 cells / kg, and the PBMCs contain at least one HPV antigen that is delivered intracellularly.

[0150] In some embodiments, the method further comprises administering an effective amount of an immune checkpoint inhibitor, wherein the immune checkpoint inhibitor targets CTLA-4. In some embodiments, the immune checkpoint inhibitor is an antagonist of CTLA-4. In some embodiments, the immune checkpoint inhibitor is an antibody that binds to CTLA-4. In some embodiments, the immune checkpoint inhibitor is ipilimumab. In some embodiments, the effective amount of ipilimumab is anywhere from about 0.1 mg / kg to about 30 mg / kg. In some embodiments, the effective amount of ipilimumab is anywhere from about 1 mg / kg to about 3 mg / kg. In some embodiments, the effective amount of ipilimumab is any one of about 0.1, 0.2, 0.5, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0, 2.2, 2.4, 2.6, 2.8, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, or about 30 mg / kg. In some embodiments, the effective amount of ipilimumab is any one of about 0.1-0.2, 0.2-0.5, 0.5-1.0, 1.0-1.2, 1.2-1.4, 1.4-1.6, 1.6-1.8, 1.8-2.0, 2.0-2.2, 2.2-2.4, 2.4-2.6, 2.6-2.8, 2.8-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-12, 12-14, 14-16, 16-18, 18-20, 20-25, or 25-30 mg / kg.

[0151] In some embodiments, the method further comprises administering an effective amount of an immune checkpoint inhibitor, wherein the immune checkpoint inhibitor targets PD-1. In some embodiments, the immune checkpoint inhibitor is an antagonist of PD-1. In some embodiments, the immune checkpoint inhibitor is an antibody that binds to PD-1. In some embodiments, the immune checkpoint inhibitor is nivolumab. In some embodiments, the effective amount of nivolumab is about 30 mg to about 1000 mg. In some embodiments, the effective amount of nivolumab is any one of about 300 mg to about 400 mg. In some embodiments, the effective amount of nivolumab is about 360 mg. In some embodiments, the effective amount of nivolumab is any one of about 30, 50, 100, 150, 200, 250, 300, 320, 340, 360, 380, 400, 450, 500, 550, 600, 700, 800, 900, or 1000 mg. In some embodiments, the effective amount of ipilimumab is any one of about 30-50, 50-100, 100-150, 150-200, 200-250, 250-300, 300-320, 320-340, 340-360, 360-380, 380-400, 400-450, 500-550, 550-600, 600-700, 700-800, 800-900, or 900-1000 mg.

[0152] In some embodiments, the method further comprises administering an effective amount of an immune checkpoint inhibitor, wherein the immune checkpoint inhibitor targets PD-L1. In some embodiments, the immune checkpoint inhibitor is an antagonist of PD-L1. In some embodiments, the immune checkpoint inhibitor is an antibody that binds to PD-L1. In some embodiments, the immune checkpoint inhibitor is atezolizumab. In some embodiments, the effective amount of atezolizumab is about 100 mg to about 2500 mg. In some embodiments, the effective amount of atezolizumab is about 900 mg to about 1500 mg. In some embodiments, the effective amount of atezolizumab is about 1200 mg. In some embodiments, the effective amount of atezolizumab is any one of about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1100, 1150, 1200, 1250, 1300, 1400, 1500, 1600, 1800, 2000, 2200, or 2500 mg. In some embodiments, the effective amount of atezolizumab is any one of about 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, 1000-1100, 1100-1200, 1200-1300, 1300-1400, 1400-1500, 1500-1600, 1600-1800, 1800-2000, 2000-2200, or 2200-2500 mg.

[0153] In some embodiments, the treatment method includes multiple (e.g., any of 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) cycles of administering PBMCs described herein to an individual. For example, in some embodiments, a method is provided for vaccinating an individual against an antigen by administering to the individual 2, 3, 4, 5, 6, 7, 8, 9, 10 or more times PBMCs containing at least one HPV antigen, produced by passing input PBMCs through a constriction to form a perturbed input PBMC such that at least one HPV antigen enters the PBMC. In some embodiments, the period between any two consecutive administrations of modified PBMCs is at least about 1 day (at least about 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, or any of the longer periods inclusive of these values).

[0154] In some embodiments according to any one of the methods described herein, the composition comprising PBMCs is administered in any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 week cycles. In some embodiments, the composition comprising PBMCs is administered on day 1 of any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 week cycles. In some embodiments, the composition comprising PBMCs is administered in a 3 week cycle. In some embodiments, the composition comprising PBMCs is administered in a 6 week cycle. In some embodiments, the composition comprising PBMCs is administered on one or more of days 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of a treatment cycle. In some embodiments, the composition comprising PBMCs is administered on day 1 of a treatment cycle. In some embodiments, the composition comprising PBMCs is administered on day 2 of a treatment cycle. In some embodiments, the composition comprising PBMCs is administered on days 1 and 2 of a treatment cycle. In some embodiments, the composition comprising PBMCs is administered on days 1 and 3 of a treatment cycle. In some embodiments, the composition comprising PBMCs is administered on day 8 of a treatment cycle. In some embodiments, the composition comprising PBMCs is administered on day 1 of a three-week cycle. In some embodiments, the composition comprising PBMCs is further administered on day 2 of a three-week cycle. In some embodiments, the composition comprising PBMCs is administered in three-week cycles until the PBMC composition supply is exhausted or for one year. In some embodiments, the composition comprising PBMCs is administered to an individual for at least about three months, six months, nine months, one year, or two years.

[0155] In some embodiments, about 0.5×10 4 , 1.0×10 4 , 0.5×10 5 , 1.0×10 5 , 0.5×10 6 , 1.0×10 6 , 0.5×10 7 , 1.0×10 7 , 0.5×10 8 , 1.0×10 8 , 0.5×109 , and 1.0×10 9 cells / kg or 0.5×10 PBMCs are administered on day 1 of each three-week cycle. 6 cells / kg ~ approx. 5×10 6 Cells / kg are administered on day 1 of each three-week cycle. In some embodiments, about 0.5×10 6 cells / kg, approximately 2.5×10 6 cells / kg, or approximately 5.0 x 10 6 Cells / kg are administered on day 1 of each three-week cycle. In some embodiments, about 0.5×10 4 , 1.0×10 4 , 0.5×10 5 , 1.0×10 5 , 0.5×10 6 , 1.0×10 6 , 0.5×10 7 , 1.0×10 7 , 0.5×10 8 , 1.0×10 8 , 0.5×10 9 , and 1.0×10 9 Any one of the cells / kg is administered on day 2 of each three-week cycle. In some embodiments, about 0.5×10 4 , 1.0×10 4 , 0.5×10 5 , 1.0×10 5 , 0.5×10 6 , 1.0×10 6 , 0.5×10 7 , 1.0×10 7 , 0.5×10 8 , 1.0×10 8 , 0.5×10 9 , and 1.0×10 9 Either one of the cells / kg was administered on days 1 and 2 of the first three-week cycle, with approximately 0.5 × 10 4 , 1.0×10 4 , 0.5×10 5 , 1.0×10 5 , 0.5×10 6 , 1.0×10 6 , 0.5×10 7, 1.0×10 7 , 0.5×10 8 , 1.0×10 8 , 0.5×10 9 , and 1.0×10 9 Any one of the cells / kg is administered on day 1 of a subsequent three-week cycle. In some embodiments, about 0.5×10 6 cells / kg, approximately 2.5×10 6 cells / kg, or approximately 5.0 x 10 6 Cells / kg were administered on days 1 and 2 of the first three-week cycle at approximately 0.5 × 10 6 cells / kg, approximately 2.5×10 6 cells / kg, or approximately 5.0 x 10 6 Cells / kg are administered on day 1 of a subsequent three-week cycle. In some embodiments, about 0.5×10 6 cells / kg ~ approx. 5×10 6 Cells / kg are administered on day 2 of each three-week cycle. In some embodiments, about 0.5×10 6 cells / kg, approximately 2.5×10 6 cells / kg, or approximately 5.0 x 10 6 Cells / kg are administered on day 2 of each three-week cycle. In some embodiments, 0.5×10 6 Cells / kg are administered on day 1 of each three-week cycle. In some embodiments, 0.5×10 6 Cells / kg were administered on day 1 of each three-week cycle, at a dose of 0.5 × 10 6 Cells / kg are administered on day 2 of each three-week cycle. In some embodiments, 0.5×10 6 Cells / kg were administered on day 1 of each three-week cycle, at a dose of 0.5 × 10 6 Cells / kg are administered on day 3 of each three-week cycle. In some embodiments, 2.5×10 6 Cells / kg are administered on day 1 of each three-week cycle. In some embodiments, 2.5×10 6 Cells / kg were administered on day 1 of each three-week cycle, at a dose of 2.5 × 10 6 Cells / kg are administered on day 2 of each three-week cycle. In some embodiments, 2.5×10 6Cells / kg were administered on day 1 of each three-week cycle, at a dose of 2.5 × 10 6 Cells / kg are administered on day 3 of each three-week cycle. In some embodiments, 2.5×10 6 Cells / kg are administered on day 1 of each three-week cycle. In some embodiments, 5×10 6 Cells / kg were administered on day 1 of each three-week cycle, at a dose of 5 × 10 6 Cells / kg are administered on day 2 of each three-week cycle. In some embodiments, 5×10 6 Cells / kg were administered on day 1 of each three-week cycle, at a dose of 5 × 10 6 Cells / kg are administered on day 3 of each three-week cycle.

[0156] In some embodiments, the method further comprises administering an effective amount of one or more of an immune checkpoint inhibitor, the immune checkpoint inhibitor targeting CTLA-4, PD-1 and / or PD-L1. In some embodiments, the antibody that binds CTLA-4, and / or the antibody that binds PD-1, and / or the antibody that binds PD-L1 are administered 1, 2, 3, 4, 5, 6 or more times per cycle. In some embodiments, the antibody that binds CTLA-4, and / or the antibody that binds PD-1, and / or the antibody that binds PD-L1 are administered once per three-week cycle. In some embodiments, the antibody that binds CTLA-4 is administered once per three-week cycle. In some embodiments, the antibody that binds PD-1 is administered once per three-week cycle. In some embodiments, the antibody that binds PD-L1 is administered once per three-week cycle. In some embodiments, the antibody that binds CTLA-4 is administered once every two three-week cycles. In some embodiments, the antibody that binds PD-1 is administered once every two three-week cycles. In some embodiments, the antibody that binds PD-L1 is administered once every two three-week cycles.

[0157] In some embodiments of any one of the methods described herein, the immune checkpoint inhibitor is administered in any one of a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 week cycle. In some embodiments, the immune checkpoint inhibitor is administered on day 1 of any one of a 1-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10 week cycle. In some embodiments, the immune checkpoint inhibitor is administered one or more times on any one of days 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of a treatment cycle.

[0158] In some embodiments, the immune checkpoint inhibitor is an antibody that binds to CTLA-4, and the antibody that binds to CTLA-4 is administered on day 1 of each three-week cycle. In some embodiments, the antibody that binds to CTLA-4 is administered over up to four doses. In some embodiments, the effective amount of the antibody that binds to CTLA-4 is about 1 mg / kg to about 3 mg / kg. In some embodiments, the antibody that binds to CTLA-4 is ipilimumab. In some embodiments, the ipilimumab is administered at a dose of about 1 mg / kg to about 3 mg / kg. In some embodiments, the antibody that binds to CTLA-4 is ipilimumab, and the ipilimumab is administered at a dose of about 3 mg / kg on day 1 of each three-week cycle.

[0159] In some embodiments, the immune checkpoint inhibitor is an antibody that binds to PD-1, and the antibody that binds to PD-1 is administered on day 8 of the first three-week cycle and on day 1 of each three-week cycle thereafter. In some embodiments, the antibody that binds to PD-1 is nivolumab. In some embodiments, the nivolumab is administered at a dose of about 360 mg. In some embodiments, the antibody that binds to PD-1 is nivolumab, and the nivolumab is administered at a dose of about 360 mg on day 8 of the first three-week cycle and on day 1 of each cycle thereafter.

[0160] In some embodiments, the one or more immune checkpoint inhibitors include an antibody that binds CTLA-4 and an antibody that binds PD-1, and the antibody that binds CTLA-4 is administered on day 1 of every other three-week cycle (i.e., day 1 of each six-week cycle, or day 1 of the first three-week cycle of two three-week cycles), and the antibody that binds PD-1 is administered on day 8 of the first three-week cycle and day 1 of each three-week cycle thereafter. In some embodiments, the antibody that binds CTLA-4 is ipilimumab, and the antibody that binds PD-1 is nivolumab. In some embodiments, ipilimumab is administered at a dose of about 1 mg / kg. In some embodiments, nivolumab is administered at a dose of about 360 mg. In some embodiments, the antibody that binds CTLA-4 is ipilimumab, which is administered at a dose of about 1 mg / kg on day 1 of every other three-week cycle (i.e., day 1 of every six-week cycle, or day 1 of the first three-week cycle of two three-week cycles), and the antibody that binds PD-1 is nivolumab, which is administered at a dose of about 360 mg on day 8 of the first three-week cycle and day 1 of each cycle thereafter.

[0161] In some embodiments, the immune checkpoint inhibitor is an antibody that binds to PD-L1, and the antibody that binds to PD-L1 is administered on day 8 of the first three-week cycle and on day 1 of each three-week cycle thereafter. In some embodiments, the antibody that binds to PD-L1 is atezolizumab. In some embodiments, the atezolizumab is administered at a dose of about 1200 mg. In some embodiments, the antibody that binds to PD-1 is atezolizumab, and the atezolizumab is administered at a dose of about 1200 mg on day 8 of the first three-week cycle and on day 1 of each cycle thereafter.

[0162] Methods for generating compositions of PBMCs containing HPV antigens In some embodiments, a method is provided for producing a composition comprising PBMCs comprising at least one HPV antigen, wherein the at least one HPV antigen is delivered intracellularly to the PBMCs. For example, a method for producing a composition for use in the therapeutic methods described herein. In some embodiments, a method is provided for producing a composition comprising PBMCs comprising an HPV antigen and an adjuvant, wherein the HPV antigen and the adjuvant are delivered intracellularly to the PBMCs.

[0163] In some embodiments, PBMCs comprising at least one HPV antigen are prepared by a process comprising: a) passing a cell suspension comprising a population of input PBMCs through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing a perturbation of the input PBMCs sufficient to allow the at least one HPV antigen to pass through to form a perturbed input PBMC; and b) culturing the population of perturbed input PBMCs with at least one HPV antigen and an adjuvant for a time sufficient to allow the antigen to enter the perturbed input PBMCs, thereby generating a modified PBMC comprising at least one HPV antigen.

[0164] In some embodiments, the HPV antigen comprises a peptide derived from HPV E6. In some embodiments, the HPV antigen comprises a peptide derived from HPV E7. In some embodiments, the HPV antigen comprises a peptide derived from HPV E6.

[0165] In some embodiments, the width of the constriction is about 10% to about 99% of the average diameter of the input PBMCs. In some embodiments, the width of the constriction is any one of about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 20% to about 60%, about 40% to about 60%, about 30% to about 45%, about 50% to about 99%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 60% to about 90%, about 60% to about 80%, and about 60% to about 70% of the average diameter of the input PBMCs. In some embodiments, the width of the constriction is about 3 μm to about 15 μm. In some embodiments, the width of the constriction is about 3 μm to about 10 μm. In some embodiments, the width of the constriction is about 3 μm to about 6 μm. In some embodiments, the width of the narrowed portion is about 4.2 μm to about 6 μm. In some embodiments, the width of the narrowed portion is about 4.2 μm to about 4.8 μm. In some embodiments, the width of the narrowed portion is about 3 μm to about 5 μm. In some embodiments, the width of the narrowed portion is about 3 μm to about 3.5 μm. In some embodiments, the width of the narrowed portion is about 3.5 μm to about 4 μm. In some embodiments, the width of the narrowed portion is about 4 μm to about 4.5 μm. In some embodiments, the width of the narrowed portion is about 3.2 μm to about 3.8 μm. In some embodiments, the width of the narrowed portion is about 3.8 μm to about 4.3 μm. In some embodiments, the width of the constriction is any one of or less than about 2 μm, 2.5 μm, 3 μm, 3.5 μm, 4 μm, 4.5 μm, 5 μm, 5.5 μm, 6 μm, 6.5 μm, 7 μm, 7.5 μm, 8 μm, 8.5 μm, 9 μm, 9.5 μm, 10 μm, 10.5 μm, 11 μm, 11.5 μm, 12 μm, 12.5 μm, 13 μm, 13.5 μm, 14 μm, 14.5 μm, or 15 μm. In some embodiments, the width of the constriction is less than or equal to about 3.0 μm, 3.1 μm, 3.2 μm, 3.3 μm, 3.4 μm, 3.5 μm, 3.6 μm, 3.7 μm, 3.8 μm, 3.9 μm, 4.0 μm, 4.1 μm, 4.2 μm, 4.3 μm, 4.4 μm, 4.5 μm, 4.6 μm, 4.7 μm, 4.8 μm, 4.9 μm, or 5.0 μm. In some embodiments, the width of the constriction is 4.5 μm.In some embodiments, the cell suspension comprising the input PBMCs is passed through multiple constrictions, where the multiple constrictions are arranged in series and / or in parallel.

[0166] In some embodiments, the HPV antigen is a pool of multiple polypeptides that elicit a response to the same and / or different HPV antigens. In some embodiments, the HPV antigen is a polypeptide that includes one or more antigenic HPV epitopes and one or more heterologous peptide sequences. In some embodiments, the HPV antigen is delivered with other antigens or adjuvants. In some embodiments, the HPV antigen is a polypeptide that includes one or more antigenic HPV epitopes and one or more heterologous peptide sequences. In some embodiments, the HPV antigen is complexed with itself, with other antigens, or with an adjuvant. In some embodiments, the HPV is HPV-16 or HPV-18. In some embodiments, the HPV antigen is composed of HLA-A2-specific epitopes. In some embodiments, the HPV antigen is HPV E6 or HPV E7 antigen. In some embodiments, the antigen includes peptides derived from HPV E6 and / or E7. In some embodiments, the antigen includes HLA-A2-restricted peptides derived from HPV E6 and / or E7. In some embodiments, HPV antigens are capable of being processed into MHC class I restricted peptides. In some embodiments, HPV antigens are capable of being processed into MHC class II restricted peptides.

[0167] In some embodiments, the composition further comprises an adjuvant.In some embodiments, the adjuvant is CpG oligodeoxynucleotide (ODN), LPS, IFN-α, IFN-β, IFN-γ, alpha-galactosylceramide, STING agonist, cyclic dinucleotide (CDN), RIG-I agonist, polyinosinic-polycytidylic acid (poly I:C), R837, R848, TLR3 agonist, TLR4 agonist, or TLR9 agonist.In some embodiments, the adjuvant is polyinosinic-polycytidylic acid (poly I:C).

[0168] HPV antigenIn some embodiments of the methods described herein, the exogenous antigen is an HPV antigen. Papillomaviruses are small, non-enveloped DNA viruses with a virion size of about 55 nm in diameter. More than 100 HPV genotypes have been fully characterized, and many more are estimated to exist. HPV is a known cause of cervical cancer, as well as some vulvar, vaginal, penile, oropharyngeal, anal, and rectal cancers. Most HPV infections are asymptomatic and resolve spontaneously, but persistent infection with one of the oncogenic HPV types can progress to precancerous conditions or cancer. Other HPV-related diseases include common warts, plantar warts, flat warts, anogenital warts, anal lesions, epidermodysplasia, focal epithelial hyperplasia, oral papillomas, warty cysts, laryngeal papillomas, squamous intraepithelial lesions (SIL), cervical intraepithelial neoplasia (CIN), vulvar intraepithelial neoplasia (VIN), and vaginal intraepithelial neoplasia (VAIN). Many of the known HPV types cause benign lesions, and a subset are carcinogenic. Based on epidemiological and phylogenetic relationships, HPV types are classified into fifteen "high-risk types" (HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, and 82) and three "presumed high-risk types" (HPV26, 53, and 66), both of which are known to manifest as low- and high-grade cervical changes and cancers, as well as other anogenital cancers, such as vulvar, vaginal, penile, anal, and perianal cancers, and head and neck cancers. Recently, an association of high-risk types HPV16 and 18 with breast cancer has also been described. Eleven HPV types classified as "low-risk types" (HPV types 6, 11, 40, 42, 43, 44, 54, 61, 70, 72, and 81) are known to manifest as benign and low-grade cervical changes, genital warts, and recurrent respiratory papillomas. Cutaneous HPV types 5, 8, and 92 are associated with skin cancer. In some HPV-associated cancers, the immune system is depressed and the antitumor response is correspondingly severely impaired. See Sursh and Burtness, Am J Hematol Oncol 13(6):20-27(2017).In some embodiments, the exogenous antigen is a pool of multiple polypeptides that elicit responses to the same and / or different antigens. In some embodiments, the antigens in the pool of multiple antigens do not reduce the immune response to other antigens in the pool of multiple antigens. In some embodiments, the HPV antigen is a polypeptide that includes an antigenic HPV epitope and one or more heterologous peptide sequences. In some embodiments, the HPV antigen is complexed with itself, with other antigens, or with an adjuvant. In some embodiments, the HPV is HPV-16 or HPV-18. In some embodiments, the HPV antigen is composed of HLA-A2-specific epitopes. In some embodiments, the HPV antigen is HPV E6 or HPV E7 antigen. In some embodiments, the antigen includes peptides derived from HPV E6 and / or E7. In some embodiments, the antigen includes HLA-A2-restricted peptides derived from HPV E6 and / or E7. In some embodiments, the antigen comprises an HLA-A2 restricted peptide derived from HPV E6 and / or E7, the HLA-A2 restricted peptide comprising the amino acid sequence of any one of SEQ ID NOs: 1-4. In some embodiments, the HLA-A2 restricted peptide comprises the amino acid sequence of SEQ ID NO: 1. In some embodiments, the HLA-A2 restricted peptide comprises the amino acid sequence of SEQ ID NO: 2. In some embodiments, the HLA-A2 restricted peptide comprises the amino acid sequence of SEQ ID NO: 3. In some embodiments, the HLA-A2 restricted peptide comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments, the HLA-A2 restricted peptide comprises the amino acid sequence of any one of SEQ ID NOs: 18-25. In some embodiments, the HPV antigen comprises an amino acid sequence having at least 90% similarity to any one of SEQ ID NOs: 18-25. In some embodiments, the HPV antigen comprises an amino acid sequence having at least 90% similarity to SEQ ID NO: 18. In some embodiments, the HPV antigen comprises an amino acid sequence having at least 90% similarity to SEQ ID NO: 19. In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 20. In some embodiments, the HPV antigen consists of the amino acid sequence of SEQ ID NO: 21. In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 22.In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 23. In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 24. In some embodiments, the HPV antigen comprises the amino acid sequence of SEQ ID NO: 25. In some embodiments, the HPV antigen comprises the amino acid sequence of any one of SEQ ID NOs: 18-25. In some embodiments, the HPV antigen is a plurality of antigens comprising at least one of the amino acid sequences of any one of SEQ ID NOs: 18-25. In some embodiments, the exogenous antigen is a plurality of antigens comprising 2, 3, 4, 5, 6, 7, or 8 amino acid sequences of any one of SEQ ID NOs: 18-25. In some embodiments, the exogenous antigen is a plurality of antigens comprising an amino acid sequence having at least 90% similarity to SEQ ID NO: 19 and an amino acid sequence having at least 90% similarity to SEQ ID NO: 23. In some embodiments, the exogenous antigen is a plurality of antigens comprising the amino acid sequence of SEQ ID NO: 19 and the amino acid sequence of SEQ ID NO: 23. In some embodiments, the plurality of antigens is comprised within a pool of non-covalently linked peptides. In some embodiments, the plurality of antigens is comprised within a pool of non-covalently linked peptides, each peptide comprising no more than one antigen, hi some embodiments, the plurality of antigens is comprised within a pool of non-covalently linked peptides, wherein the amino acid sequence of SEQ ID NO: 19 and the amino acid sequence of SEQ ID NO: 25 are contained within separate peptides.

[0169] In some embodiments, the HPV antigen is in a pool of polypeptides that elicit a response to the same and / or different HPV antigens. In some embodiments, an antigen in the pool of antigens does not reduce the immune response to other antigens in the pool of antigens. In some embodiments, the HPV antigen is a polypeptide that includes an antigenic HPV antigen and one or more heterologous peptide sequences. In some embodiments, the HPV antigen is complexed with itself, with other antigens, or with an adjuvant. In some embodiments, the HPV antigen is comprised of an HLA-A2-specific epitope. In some embodiments, the HPV antigen is comprised of an HLA-A11-specific epitope. In some embodiments, the HPV antigen is comprised of an HLA-B7-specific epitope. In some embodiments, the HPV antigen is comprised of an HLA-C8-specific epitope. In some embodiments, the HPV antigen comprises a portion or all of the N-terminal domain of a full-length HPV protein.

[0170] In some embodiments according to any one of the methods described herein, the PBMCs comprise a plurality of HPV antigens comprising a plurality of immunogenic epitopes. In further embodiments, after administration of the PBMCs comprising a plurality of antigens comprising a plurality of immunogenic epitopes to an individual, none of the plurality of immunogenic epitopes reduces the immune response in the individual against any of the other immunogenic epitopes. In some embodiments, the HPV antigen is a polypeptide and the immunogenic epitope is an immunogenic peptide epitope. In some embodiments, the immunogenic peptide epitope is fused to an N-terminally flanking polypeptide and / or a C-terminally flanking polypeptide. In some embodiments, the HPV antigen is a polypeptide comprising an immunogenic peptide epitope and one or more heterologous peptide sequences. In some embodiments, the HPV antigen is a polypeptide comprising an immunogenic peptide epitope flanked at the N-terminus and / or C-terminus by a heterologous peptide sequence. In some embodiments, the flanking heterologous peptide sequence is derived from a disease-associated immunogenic peptide. In some embodiments, the flanking heterologous peptide sequence is a non-naturally occurring sequence. In some embodiments, the flanking heterologous peptide sequences are derived from immunogenic synthetic long peptides (SLPs). In some embodiments, HPV antigens are capable of being processed into MHC class I-restricted and / or MHC class II-restricted peptides.

[0171] Adjuvants As used herein, the term "adjuvant" can refer to a substance that modulates and / or produces an immune response either directly or indirectly. In some embodiments of the present invention, an adjuvant is delivered intracellularly to a PBMC population to form a modified PBMC that includes the adjuvant. In some examples, an adjuvant is administered in conjunction with PBMCs that include HPV antigens that enhance the immune response to the HPV antigen compared to the HPV antigen alone. In some embodiments, the PBMCs are cultured with an adjuvant before, during, or after the passage of the PBMCs through the constriction to promote conditioning (such as, but not limited to, maturation) of the PBMCs. The adjuvant can be used to boost the induction of immune cell responses (e.g., T cell responses) to HPV antigens. Exemplary adjuvants include, but are not limited to, stimulator of interferon genes (STING) agonists, retinoic acid-inducible gene I (RIG-I) agonists, and agonists of TLR3, TLR4, TLR7, TLR8, and / or TLR9. Exemplary adjuvants include, but are not limited to, CpG ODN, interferon-α (IFN-α), polyinosinic:polycytidylic acid (poly I:C), imiquimod (R837), resiquimod (R848), or lipopolysaccharide (LPS). In some embodiments, the adjuvant is ODN, LPS, IFN-α, IFN-β, IFN-γ, alpha-galactosylceramide, STING agonist, cyclic dinucleotide (CDN), RIG-I agonist, polyinosinic:polycytidylic acid (poly I:C), R837, R848, TLR3 agonist, TLR4 agonist, or TLR9 agonist. In certain embodiments, the adjuvant is CpG ODN. In some embodiments, the adjuvant is CpG ODN. In some embodiments, the CpG ODN is a class A CpG ODN, a class B CpG ODN, or a class C CpG ODN.In some embodiments, the CpG ODN adjuvant comprises a selection from the group of CpG ODN 1018, CpG ODN 1585, CpG ODN 2216, CpG ODN 2336, CpG ODN 1668, CpG ODN 1826, CPG ODN 2006, CpG ODN 2007, CpG ODN BW006, CpG ODN D-SL01, CpG ODN 2395, CpG ODN M362, CpG ODN D-SL03. In some embodiments, the CpG ODN adjuvant is a CpG ODN 1826 (TCCATGACGTTCCTGACGTT (SEQ ID NO: 30)) or CpG ODN 2006 (also known as CpG 7909) (TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 31)) oligonucleotide. In some embodiments, the adjuvant is CpG 7909. In some embodiments, the RIG-I agonist comprises polyinosinic:polycytidylic acid (poly I:C). Multiple adjuvants can also be used in combination with HPV antigens to enhance the induction of immune responses. In some embodiments, the PBMCs comprising HPV antigens further comprise multiple adjuvants. In some embodiments, the PBMCs comprising HPV antigens are conditioned with multiple adjuvants. Multiple adjuvants can also be used in combination with HPV antigens to enhance the induction of immune responses. In some embodiments, the PBMCs comprising HPV antigens further comprise multiple adjuvants. In some embodiments, the PBMCs comprising the HPV antigen further comprise any combination of the adjuvants CpG ODN, LPS, IFN-α, IFN-β, IFN-γ, alpha-galactosylceramide, STING agonist, cyclic dinucleotide (CDN), RIG-I agonist, polyinosinic:polycytidylic acid (poly I:C), R837, R848, TLR3 agonist, TLR4 agonist, or TLR9 agonist.In some embodiments, the PBMCs comprising the HPV antigen further comprise any combination of the adjuvants CpG ODN, LPS, IFN-α, IFN-β, IFN-γ, alpha-galactosylceramide, STING agonist, cyclic dinucleotide (CDN), RIG-I agonist, polyinosinic:polycytidylic acid (poly I:C), R837, R848, TLR3 agonist, TLR4 agonist, or TLR9 agonist.

[0172] PBMC constituent cells In some embodiments, the methods disclosed herein provide for administration of an effective amount of a composition of PBMCs comprising at least one HPV antigen to an individual in need thereof, wherein the at least one HPV antigen is delivered intracellularly. In some embodiments, the composition of PBMCs is a composition of immune cells. In some embodiments, the composition of PBMCs comprises a plurality of PBMCs. In some embodiments, the PBMCs are one or more of T cells, B cells, NK cells, monocytes, dendritic cells, and / or NK-T cells.

[0173] In certain embodiments of the present invention, the cells comprising the HPV antigens of the composition are PBMCs. As used herein, PBMCs can be isolated by apheresis, such as leukapheresis, from whole blood obtained from an individual. Also provided are PBMC compositions reconstituted by mixing different pools of PBMCs from the same individual or different individuals. In other examples, PBMCs can also be reconstituted by mixing different cell populations into a mixed cell composition with a generated profile. In some embodiments, the cell population used to reconstitute the PBMCs is a mixed cell population (e.g., a mixture of one or more of T cells, B cells, NK cells, or monocytes). In some embodiments, the cell population used to reconstitute the PBMCs is a purified cell population (e.g., purified T cells, B cells, NK cells, or monocytes). In additional examples, the different cell populations used to reconstitute the PBMC composition can be isolated from the same individual (e.g., autologous) or from different individuals (e.g., allogeneic and / or xenogeneic).

[0174] Thus, in some embodiments of the methods described herein, the plurality of PBMCs comprises one or more of T cells, B cells, NK cells, monocytes, dendritic cells, or NK-T cells. In some embodiments, the plurality of PBMCs comprises T cells, B cells, NK cells, monocytes, dendritic cells, or NK-T cells. In some embodiments, the plurality of PBMCs comprises one or more of CD3+ T cells, CD20+ B cells, CD14+ monocytes, and CD56+ NK cells. In some embodiments, the plurality of PBMCs comprises T cells, B cells, NK cells, and monocytes, and the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the plurality of PBMCs is essentially the same as the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in whole blood. In some embodiments, the plurality of PBMCs comprises T cells, B cells, NK cells, and monocytes, and the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the plurality of PBMCs is essentially the same as the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in a leukapheresis product derived from whole blood. In some embodiments, the plurality of PBMCs comprises T cells, B cells, NK cells, and monocytes, and the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the plurality of PBMCs differs from the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in whole blood by no more than any one of 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, or 50%. In some embodiments, the plurality of PBMCs comprises T cells, B cells, NK cells, and monocytes, and the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the plurality of PBMCs differs by any one of 10% or less from the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the whole blood. In some embodiments, the plurality of PBMCs comprises T cells, B cells, NK cells, and monocytes, and the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the plurality of PBMCs differs by any one of 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, or 50% or less from the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in a leukapheresis product derived from whole blood.In some embodiments, the plurality of PBMCs comprises T cells, B cells, NK cells, and monocytes, and the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in the plurality of PBMCs differs by any one of 10% or less from the ratio of T cells, B cells, NK cells, and monocytes to the total number of PBMCs in a whole blood-derived leukapheresis product.

[0175] In some embodiments of the methods described herein, about 25% to about 80% of the modified PBMCs are T cells. In some embodiments, about 1.5% to about 30% of the modified PBMCs are B cells. In some embodiments, about 3% to about 35% of the modified PBMCs are NK cells. In some embodiments, about 4% to about 45% of the modified PBMCs are NK cells.

[0176] In some embodiments according to the methods described herein, at least about any one of 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 80% of the PBMCs are T cells. In some embodiments, at least about 25% of the PBMCs are T cells. In some embodiments, at least about any one of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 7.5%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, or 30% of the PBMCs are B cells. In some embodiments, at least about 1.5% of the PBMCs are B cells. In some embodiments, at least about any one of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 4%, 5%, 6%, 7%, 7.5%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, or 30% of the PBMCs are NK cells. In some embodiments, at least about 3% of the PBMCs are NK cells. In some embodiments, at least about any one of 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 14%, 16%, 18%, 20%, 25%, 30%, 35%, 40%, or 45% of the PBMCs are monocytes. In some embodiments, at least about 4% of the PBMCs are monocytes. In some embodiments, at least about 25% of the PBMCs are T cells, at least about 1.5% of the PBMCs are B cells, at least about 3% of the PBMCs are NK cells, and at least about 4% of the PBMCs are monocytes.

[0177] In some embodiments according to the methods described herein, no more than about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% of the PBMCs are T cells. In some embodiments, no more than about 80% of the PBMCs are T cells. In some embodiments, no more than about 5%, 10%, 12%, 14%, 16%, 18%, 20%, 22%, 25%, 30%, 35%, 40%, or 50% of the PBMCs are B cells. In some embodiments, no more than about 30% of the PBMCs are B cells. In some embodiments, no more than about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or 60% of the PBMCs are NK cells. In some embodiments, no more than about 35% of the PBMCs are NK cells. In some embodiments, no more than about any one of 5%, 10%, 12%, 14%, 16%, 18%, 20%, 22%, 25%, 30%, 35%, 40%, or 50% of the PBMCs are monocytes. In some embodiments, no more than about 45% of the PBMCs are monocytes. In some embodiments, no more than about 80% of the PBMCs are T cells, no more than about 30% of the PBMCs are B cells, no more than about 20% of the PBMCs are NK cells, and no more than about 45% of the PBMCs are monocytes.

[0178] In some embodiments of the methods described herein, about 20%-25%, 25%-30%, 30%-35%, 35%-40%, 40%-45%, 45%-50%, 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, or 75%-80% of the modified PBMCs are T cells. In some embodiments, about 25% to about 80% of the modified PBMCs are T cells. In some embodiments, about 1% to 1.5%, 1.5% to 2.5%, 2.5% to 4%, 4% to 6%, 6% to 8%, 8% to 10%, 10% to 12%, 12% to 14%, 14% to 16%, 16% to 20%, 20% to 25%, or 25% to 30% of the modified PBMCs are B cells. In some embodiments, about 2.5% to about 14% of the modified PBMCs are B cells. In some embodiments, about 1% to 2%, 2% to 3%, 3% to 5%, 5% to 8%, 8% to 10%, 10% to 12%, 12% to 14%, 14% to 16%, 16% to 20%, 20% to 25%, 25% to 30%, 30% to 35%, or 35% to 40% of the modified PBMCs are NK cells. In some embodiments, about 3.0% to about 35% of the modified PBMCs are NK cells. In some embodiments, any one of about 2% to 4%, 4% to 6%, 6% to 8%, 8% to 10%, 10% to 12%, 12% to 14%, 14% to 16%, 16% to 20%, 20% to 25%, 25% to 30%, 30% to 35%, 35% to 40%, or 30% to 45% of the modified PBMCs are monocytes. In some embodiments, about 4% to about 45% of the modified PBMCs are monocytes. In some embodiments, about 25% to about 80% of the modified PBMCs are T cells, about 1.5% to about 30% of the modified PBMCs are B cells, about 3% to about 35% of the modified PBMCs are NK cells, and about 4% to about 45% of the modified PBMCs are monocytes. In some embodiments, about 25% to about 80% of the modified PBMCs are T cells, about 1.5% to about 30% of the modified PBMCs are B cells, about 3% to about 20% of the modified PBMCs are NK cells, and about 4% to about 45% of the modified PBMCs are monocytes.In some embodiments, about 25% to about 70% of the modified PBMCs are T cells, about 2.5% to about 14% of the modified PBMCs are B cells, about 3.5% to about 20% of the modified PBMCs are NK cells, and about 4% to about 25% of the modified PBMCs are monocytes.

[0179] As used herein, PBMCs can also be generated after manipulating the composition of a mixed cell population of mononuclear blood cells (e.g., lymphocytes and monocytes). In some cases, PBMCs are generated after reducing (e.g., depleting) a specific subpopulation (e.g., B cells) in a mixed cell population of mononuclear blood cells. The composition in a mixed cell population of mononuclear blood cells in an individual can be manipulated to make the cell population more closely resemble the leukapheresis product from whole blood of the same individual. In other examples, the composition in a mixed cell population of mononuclear blood cells (e.g., mouse splenocytes) can also be manipulated to make the cell population more closely resemble the human PBMCs isolated from the leukapheresis product from human whole blood.

[0180] In some embodiments of the present invention, the PMBC composition comprising at least one HPV antigen is a population of cells found in PBMCs. In some embodiments, the PMBC composition comprising at least one HPV antigen comprises one or more of T cells, B cells, NK cells, monocytes, dendritic cells, or NK-T cells. In some embodiments, the PMBC composition comprising at least one HPV antigen comprises one or more of CD3+ T cells, CD20+ B cells, CD14+ monocytes, and CD56+ NK cells. In some embodiments, the PMBC composition comprising at least one HPV antigen comprises at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% T cells. In some embodiments, the PMBC composition comprising at least one HPV antigen comprises 100% T cells. In some embodiments, the PMBC composition comprising at least one HPV antigen comprises at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% B cells. In some embodiments, the composition of PMBCs comprising at least one HPV antigen comprises 100% B cells. In some embodiments, the composition of PMBCs comprising at least one HPV antigen comprises at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% NK cells. In some embodiments, the composition of PMBCs comprising at least one HPV antigen comprises 100% NK cells. In some embodiments, the composition of PMBCs comprising at least one HPV antigen comprises at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% monocytes. In some embodiments, the composition of PMBCs comprising at least one HPV antigen comprises 100% monocytes. In some embodiments, the composition of PMBCs comprising at least one HPV antigen comprises at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% dendritic cells. In some embodiments, the composition of PMBCs comprising at least one HPV antigen comprises 100% dendritic cells. In some embodiments, a composition of PMBCs comprising at least one HPV antigen comprises at least any of 70%, 75%, 80%, 85%, 90%, 95%, or 99% NK-T cells.In some embodiments, the composition of PMBCs comprising at least one HPV antigen comprises 100% NK-T cells.

[0181] Feasibility of producing PBMCs containing at least one HPV antigen In some embodiments of any one of the methods or compositions described herein, the viability of the PBMCs comprising at least one HPV antigen is at least about any one of 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 98%. In some embodiments, the viability of the PBMCs comprising at least one HPV antigen is at least about 90%.

[0182] In some embodiments, the method of treatment comprises administering an effective amount of PBMCs comprising at least one HPV antigen, wherein the PBMCs comprising at least one HPV antigen are prepared by: a) passing a cell suspension comprising input PBMCs through a cell-deforming constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing a perturbation of the input PBMCs sufficient to allow the at least one HPV antigen to pass to form a perturbed input PBMC; and b) culturing the perturbed input PBMCs with at least one HPV antigen for a sufficient time to allow the at least one HPV antigen to enter the perturbed input PBMC, thereby generating modified PBMCs comprising at least one HPV antigen, wherein the viability of the PBMCs comprising at least one HPV antigen is at least any one of about 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 98%.

[0183] In some embodiments of any one of the methods or compositions described herein, the end-to-end processing time of the PBMCs comprising at least one HPV antigen (e.g., processing including one or more of the following: elutriation of the patient's leukopak, manipulation of the composition of the PBMCs, generation and / or preparation of the PBMCs comprising at least one HPV antigen, etc.) is any one of about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours. In some embodiments, the end-to-end processing time of the PBMCs comprising at least one HPV antigen is about 15 hours.

[0184] In some embodiments, the method of treatment comprises administering an effective amount of PBMCs comprising at least one HPV antigen, wherein the PBMCs comprising at least one HPV antigen are prepared by: a) passing a cell suspension comprising input PBMCs through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing a perturbation of the input PBMCs sufficient to allow the at least one HPV antigen to pass to form a perturbed input PBMC; and b) culturing the perturbed input PBMCs with at least one HPV antigen for a sufficient time to allow the at least one HPV antigen to enter the perturbed input PBMCs, thereby generating modified PBMCs comprising at least one HPV antigen, wherein the end-to-end processing time for the PBMCs comprising at least one HPV antigen is any one of about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours.

[0185] In some embodiments, modified PBMCs comprising at least one HPV antigen, according to any one of the methods or compositions described herein, can stimulate IFNγ-secretion of at least about 300 pg / mL when co-cultured with HPV antigen-specific responder T cells. In some embodiments, modified PBMCs comprising at least one HPV antigen can stimulate IFNγ-secretion of at least about 300, 500, 750, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, or 10000 pg / mL when co-cultured with HPV antigen-specific responder T cells. In some embodiments, at least about 90% of the batches of modified PBMCs comprising at least one HPV antigen can stimulate IFNγ-secretion of at least about 300 pg / mL when co-cultured with HPV antigen-specific responder T cells. In some embodiments, at least about 50%, 60%, 70%, 80%, 90%, 95% or 98% of any one of the batches of modified PBMCs comprising at least one HPV antigen can stimulate at least about 300 pg / mL of IFNγ-secretion when co-cultured with HPV antigen-specific responder T cells. In some embodiments, 100% of the batch of modified PBMCs comprising at least one HPV antigen can stimulate at least about 300 pg / mL of IFNγ-secretion when co-cultured with HPV antigen-specific responder T cells.

[0186] In some embodiments, the method of treatment comprises administering an effective amount of PBMCs comprising at least one HPV antigen, the PBMCs being prepared by: a) passing a cell suspension comprising input PBMCs through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing a perturbation of the input PBMCs sufficient to allow the at least one HPV antigen to pass through to form a perturbed input PBMC; and b) passing the perturbed input PBMCs through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing a perturbation of the input PBMCs sufficient to allow the at least one HPV antigen to pass through to form a perturbed input PBMC. and culturing for a time sufficient to allow at least one HPV antigen to enter the perturbed input PBMCs, thereby generating modified PBMCs comprising the at least one HPV antigen, wherein the modified PBMCs comprising the at least one HPV antigen are capable of stimulating IFNγ-secretion of at least about any one of 300, 500, 750, 1000, 1500, 2000, 3000, 4000, 5000, 6000, 7000, or 10000 pg / mL when co-cultured with HPV antigen-specific responder T cells.

[0187] In some embodiments, the method of treatment comprises administering an effective amount of PBMCs comprising at least one HPV antigen, wherein the PBMCs comprising at least one HPV antigen are prepared by: a) passing a cell suspension comprising input PBMCs through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing a perturbation of the input PBMCs sufficient to allow the at least one HPV antigen to pass to form a perturbed input PBMC; and b) culturing the perturbed input PBMCs with at least one HPV antigen for a sufficient time to allow the at least one HPV antigen to enter the perturbed input PBMC, thereby generating modified PBMCs comprising at least one HPV antigen, wherein at least two or more batches of modified PBMCs are prepared, wherein at least about 50%, 60%, 70%, 80%, 90%, 95% or 98% of any one batch of modified PBMCs comprising at least one HPV antigen are capable of stimulating IFNγ-secretion of at least about 300 pg / mL when co-cultured with HPV antigen-specific responder T cells.

[0188] Further modification of PBMCs with at least one HPV antigen In some embodiments according to any one of the methods described herein, the composition of PBMCs further comprises an agent that enhances viability and / or function of PBMCs compared to a corresponding composition of PBMCs without the agent. In some embodiments, the composition of PBMCs further comprises an agent that enhances viability and / or function of PBMCs upon freeze-thaw cycling compared to a corresponding composition of PBMCs without the agent. In some embodiments, the agent is a cryopreservation agent and / or a cryoprotectant. In some embodiments, neither the cryopreservation agent nor the cryoprotectant causes more than 10% or 20% cell death in the PBMC composition comprising the agent compared to a corresponding composition of PBMCs without the agent prior to any freeze-thaw cycle. In some embodiments, freeze-thaw cycling of a PBMC composition comprising a cryopreservation agent and / or a cryoprotectant causes a 10%, 20%, 30%, 40%, or 50% reduced loss of viable cells compared to a freeze-thaw cycling of a corresponding PBMC composition without a cryopreservation agent and a cryoprotectant. In some embodiments, at least about 70%, about 80%, about 90%, or 95% of the PBMCs are viable after up to 1, 2, 3, 4, or 5 freeze-thaw cycles. In some embodiments, at least about 70%, about 80%, or 90% of the PBMCs are viable after up to 1, 2, 3, 4, or 5 freeze-thaw cycles. In some embodiments, the agent is an endocytosis enhancing compound, stabilizer, or cofactor. In some embodiments, the agent is albumin. In some embodiments, the albumin is mouse, bovine, or human albumin. In some embodiments, the agent is one or more of mouse, bovine, or human albumin. In some embodiments, the agent is human albumin. In some embodiments, the agent is one or more of divalent metal cations, glucose, ATP, potassium, glycerol, trehalose, D-sucrose, PEG1500, L-arginine, L-glutamine, or EDTA. In some embodiments, the divalent metal cation is one or more of Mg2+, Zn2+, or Ca2+.In some embodiments, the agent is one or more of sodium pyruvate, adenine, trehalose, dextrose, mannose, sucrose, human serum albumin (HSA), DMSO, HEPES, glycerol, glutathione, inosine, dibasic sodium phosphate, monobasic sodium phosphate, sodium metal ion, potassium metal ion, magnesium metal ion, chloride, acetate, gluconate, sucrose, potassium hydroxide, or sodium hydroxide. In some embodiments, the agent is one or more of sodium pyruvate, adenine, Rejuvesol®, trehalose, dextrose, mannose, sucrose, human serum albumin (HSA), PlasmaLyte®, DMSO, Cryostor® CS2, Cryostor® CS5, Cryostor® CS10, Cryostor® CS15, HEPES, glycerol, glutathione, HypoThermosol®.

[0189] In some embodiments according to any one of the methods described herein, the composition of PBMCs comprises a plurality of modified PBMCs further modified to increase expression of one or more costimulatory molecules. In some embodiments, the costimulatory molecule is B7-H2 (ICOSL), B7-1 (CD80), B7-2 (CD86), CD70, LIGHT, HVEM, CD40, 4-1BBL, OX40L, TL1A, GITRL, CD30L, TIM4, SLAM, CD48, CD58, CD155, or CD112. In some embodiments, the plurality of modified PBMCs comprises a nucleic acid that results in increased expression of one or more costimulatory molecules. In some embodiments, the plurality of modified PBMCs comprises an mRNA that results in increased expression of one or more costimulatory molecules. In some embodiments, the costimulatory molecule is a signal 2 effector in stimulating T cell activation.

[0190] In some embodiments according to any one of the methods described herein, the modified PBMCs are further modified to increase expression of one or more cytokines. In some embodiments, the cytokine is one or more of IL-2, IL-12, IL-21, or IFNα2. In some embodiments, the plurality of modified PBMCs comprises a nucleic acid that results in increased expression and / or secretion of one or more cytokines. In some embodiments, the cytokine is a signal 3 effector in stimulating T cell activation.

[0191] In some embodiments according to any one of the methods described herein, at least one cell in the plurality of modified PBMCs is positive for expression of HLA-A2. In some embodiments, the modified PBMCs comprise a further modification to modulate MHC class I expression. In some embodiments, the modified PBMCs comprise a further modification to modulate expression of HLA-A02 MHC class I. In some embodiments, the modified PBMCs comprise a further modification to modulate expression of HLA-A * 11 Further modifications to regulate expression of MHC class I. In some embodiments, the modified PBMCs include those that are HLA-B * 07 Further modifications to modulate expression of MHC class I. In some embodiments, the modified PBMCs include HLA-C * 08 Includes further modifications to regulate expression of MHC class I. Agents that can result in upregulation of HLA expression include, but are not limited to, IFNγ, IFNα, IFNβ, and radiation.

[0192] In some embodiments, the modified PBMCs comprise further modifications to modulate MHC class II expression. In some embodiments, the innate immune response mounted in an individual in response to administration of the modified PBMCs in an allogeneic context is reduced compared to the innate immune response mounted in an individual in response to administration of the modified PBMCs without the corresponding further modifications in an allogeneic context. In some embodiments, the circulating half-life of the modified PBMCs in an administered individual is increased compared to the circulating half-life of the corresponding modified PBMCs without the further modifications in the administered individual. In some embodiments, the circulating half-life of the modified PBMCs in an administered individual is increased by any one of about 10%, 25%, 50%, 75%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 25-fold, 50-fold, 100-fold, 200-fold, or 500-fold or more compared to the circulating half-life of the corresponding modified PBMCs without the further modifications in the administered individual. In some embodiments, the circulating half-life of the modified PBMCs in an administered individual is essentially the same as the circulating half-life of the corresponding modified PBMCs that do not comprise further modifications in the administered individual.

[0193] In some embodiments of any one of the methods described herein, the process further comprises culturing the composition of PBMCs with an agent that enhances viability and / or function of PBMCs compared to corresponding PBMCs prepared without the additional culturing step.

[0194] In some embodiments, the composition is 0.5×10 4 , 1.0×10 4 , 0.5×10 5 , 1.0×10 5 , 0.5×10 6 , 1.0×10 6 , 0.5×10 7 , 1.0×10 7 , 0.5×10 8 , 1.0×10 8 , 0.5×10 9 , 1.0×10 9 , 0.5×10 10 , 1.0×10 10In some embodiments, the effective amount is about 0.5×10 4 ~Approx. 1.0×10 4 , about 1.0×10 5 ~about 0.5×10 5 , about 0.5×10 5 ~Approx. 1.0×10 5 , about 1.0×10 5 ~about 0.5×10 6 , about 0.5×10 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , or approximately 0.5 × 10 9 ~Approx. 1.0×10 9 In some embodiments, the composition comprises 1×10 PBMC / mL. 4 , 1×10 5 , 1×10 6 , 2×10 6 , 3×10 6 , 4×10 6 , 5×10 6 , 6×10 6 , 7×10 6 , 8×10 6 , 9×10 6 , 1×10 7 , 1×10 8 In some embodiments, the composition comprises about 1×10 PBMC / mL. 6 PBMC / mL ~ approx. 1×10 7 Contains PBMC / mL.

[0195] In some embodiments, the composition comprises about 5×10 4 ~Approx. 5×10 9 In some embodiments, the composition comprises about 5×10 PBMCs. 6 ~Approx. 5×10 7In some embodiments, the composition comprises 0.5×10 PBMCs. 4 , 1.0×10 4 , 0.5×10 5 , 1.0×10 5 , 0.5×10 6 , 1.0×10 6 , 0.5×10 7 , 1.0×10 7 , 0.5×10 8 , 1.0×10 8 , 0.5×10 9 , 1.0×10 9 , and 5.0 × 10 9 In some embodiments, the composition comprises 0.5×10 PBMCs. 4 ~Approx. 1.0×10 4 , about 1.0×10 5 ~about 0.5×10 5 , about 0.5×10 5 ~Approx. 1.0×10 5 , about 1.0×10 5 ~about 0.5×10 6 , about 0.5×10 6 ~Approx. 1.0×10 6 , about 1.0×10 6 ~about 0.5×10 7 , about 0.5×10 7 ~Approx. 1.0×10 7 , about 1.0×10 7 ~about 0.5×10 8 , about 0.5×10 8 ~Approx. 1.0×10 8 , about 1.0×10 8 ~about 0.5×10 9 , about 0.5×10 9 ~Approx. 1.0×10 9 , or approximately 1.0 × 10 9 ~Approx. 5×10 9 In some embodiments, the composition comprises any one of 1×10 PBMCs. 7 , 2×10 7 , 3×10 7 , 4×10 7 , 5×10 7 , 6×10 7 , 7×10 7 , 8×10 7 , 9×107 , and 1 × 10 8 In some embodiments, the composition comprises about 2×10 PBMCs. 7 PBMC ~ approx. 3×10 7 In some embodiments, the composition comprises 2.1×10 PBMCs. 7 , 2.2×10 7 , 2.3×10 7 , 2.4×10 7 , 2.5×10 7 , 2.6×10 7 , 2.7×10 7 , 2.8×10 7 , 2.9×10 7 , and 3.0 × 10 7 In some embodiments, the composition comprises about 2.75×10 PBMCs. 7 In some embodiments, the composition comprises about 2.5×10 PBMCs. 7 Contains PBMCs.

[0196] In some embodiments, the composition comprises a cryopreservation medium. In some embodiments, the composition comprises a cryopreservation medium at a concentration of 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% (w / w). In some embodiments, the composition comprises a cryopreservation medium at a concentration of about 20%-25%, 25%-30%, 30%-35%, 35%-40%, 40%-45%, 45%-50%, 50%-55%, 55%-60%, 60%-65%, 65%-70%, 70%-75%, 75%-80%, or 80%-85% (w / w).

[0197] In some embodiments, the composition comprises a cryopreservation medium. In some embodiments, the composition comprises a cryopreservation medium in a proportion of about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% (w / w). In some embodiments, the composition comprises a cryopreservation medium in a proportion of about 10%-15%, 15%-20%, 20%-25%, 25%-30%, 30%-35%, 35%-40%, 40%-45%, 45%-50%, 50%-55%, 55%-60%, 60%-65%, or 65%-70% (w / w).

[0198] In some embodiments, the composition comprises human serum albumin at a percentage of about 2%, 3%, 4%, 5%, 8%, or 10% (w / w). In some embodiments, the composition comprises human serum albumin at a percentage of about 2%-3%, 3%-5%, 5%-8%, or 8-10% (w / w). In some embodiments, the human serum albumin is added to the formulation as a human serum albumin preparation. In some embodiments, the percentage of human serum albumin solution in the formulation is about 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% (w / w). In some embodiments, the percentage of human serum albumin solution in the formulation is about 10%-15%, 15%-20%, 20%-25%, 25%-30%, 30%-35%, 35%-40%, 40%-45%, or 45%-50% (w / w).

[0199] In some embodiments, the pH of the formulation is about 5.0 to about 9.5. In some embodiments, the pH of the formulation is about 6.0 to about 8.5. In some embodiments, the pH of the formulation is about 7.4. In some embodiments, the pH of the formulation is about any one of 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10. In some embodiments, the pH of the formulation is about any one of 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, or 8.0. In some embodiments, the pH of the formulation is about 5 to about 6, about 6 to about 7, about 7 to about 8, about 8 to about 9, or about 9 to about 10. In some embodiments, the pH of the formulation is any one of about 7 to about 7.1, about 7.1 to about 7.2, about 7.2 to about 7.3, about 7.3 to about 7.4, about 7.4 to about 7.5, about 7.5 to about 7.6, about 7.6 to about 7.7, about 7.7 to about 7.8, about 7.8 to about 7.9, or about 7.9 to about 8.0.

[0200] In some embodiments, the cryopreservation medium comprises CryoStor® CS10. In some embodiments, the composition comprises about 5×10 6 ~Approx. 5×10 7 Contains PBMCs.

[0201] In some embodiments, the composition comprising PBMCs comprises: a) about 5×10 6 PBMC ~ approx. 5×10 7 The composition comprises PBMCs, b) a cryopreservation medium in a proportion of about 40% to about 60% (w / w), c) a cryopreservation medium in a proportion of about 25% to about 35% (w / w), and d) about 3% to about 8% (w / w) human serum albumin, and the pH of the composition is about pH 6.0 to about pH 8.5.

[0202] In some embodiments, the composition comprising PBMCs comprises: a) about 1×10 6 PBMC / mL ~ approx. 1×10 7PBMC / mL, b) a cryopreservation medium at a ratio of about 40% to about 60% (w / w), c) a low-temperature preservation medium at a ratio of about 25% to about 35% (w / w), and d) about 3% to about 8% (w / w) human serum albumin, and the pH of the composition is about pH 6.0 to about pH 8.5.

[0203] In some embodiments, the composition comprising PBMCs comprises: a) about 2.75×10 7 PBMCs, b) a cryopreservation medium in a proportion of about 50% (w / w), c) a cryopreservation medium in a proportion of about 30% (w / w), and d) human serum albumin in a proportion of about 5% (w / w), wherein the pH of the composition is about pH 7.4.

[0204] In some embodiments, the composition comprising PBMCs comprises: a) about 5×10 6 PBMC / mL, b) a cryopreservation medium in a proportion of about 50% (w / w), c) a cryopreservation medium in a proportion of about 30% (w / w), and d) a human serum albumin in a proportion of about 5% (w / w), and the pH of the composition is about pH 7.4.

[0205] In some embodiments, the composition comprising PBMCs comprises: a) about 5×10 6 PBMC ~ approx. 5×10 7 a) PBMCs; b) a cryopreservation medium in a proportion of about 65% to about 95% (w / w); and c) human serum albumin in a proportion of about 3% to about 8% (w / w), and the pH of the composition is about pH 6.0 to about pH 8.5.

[0206] In some embodiments, the composition comprising PBMCs comprises: a) about 1×10 6 PBMC / mL ~ approx. 1×10 7 PBMC / mL, b) a cryopreservation medium in a proportion of about 65% to about 95% (w / w), and c) human serum albumin in a proportion of about 3% to about 8% (w / w), and the pH of the composition is about pH 6.0 to about pH 8.5.

[0207] In some embodiments, the composition comprising PBMCs comprises: a) about 2.75×10 7PBMCs, b) a cryopreservation medium in a proportion of about 80% (w / w), and c) human serum albumin in a proportion of about 5% (w / w), wherein the pH of the composition is about pH 7.4.

[0208] In some embodiments, the composition comprising PBMCs comprises: a) about 5×10 6 PBMC / mL, b) a cryopreservation medium in a proportion of about 80% (w / w), and c) human serum albumin in a proportion of about 5% (w / w), and the pH of the composition is about pH 7.4.

[0209] Constriction used to generate a composition of PBMCs containing HPV antigens In some embodiments, the present invention provides a composition of PBMCs that contains HPV antigens that stimulate immune responses. In some embodiments, the HPV antigens are delivered intracellularly to PBMCs. Methods for introducing payloads into PBMCs are known in the art.

[0210] In some embodiments, the HPV antigen is introduced into the PBMC by passing the cell through a constriction, such that a transient pore is introduced into the membrane of the cell, thereby allowing the HPV antigen to enter the cell. Examples of delivery of compounds into cells through a constriction are provided by WO2013 / 059343, WO2015 / 023982, WO2016 / 070136, WO2017041050, WO2017008063, WO2017 / 192785, WO2017 / 192786, WO2019 / 178005, WO2019 / 178006, WO2020 / 072833, WO2020 / 154696, and International Publication No. WO2020 / 176789.

[0211] In some embodiments, the HPV antigens and adjuvants are delivered into the PBMCs to produce the PBMCs of the present invention by passing a cell suspension containing the PBMCs through a constriction, which deforms the input PBMCs, thereby causing a perturbation of the input PBMCs such that the HPV antigens and adjuvants enter the perturbed input PBMCs. In some embodiments, the constriction is included within a microfluidic channel. In some embodiments, multiple constrictions can be arranged in parallel and / or in series within the microfluidic channel.

[0212] In some embodiments, the constriction in the microfluidic channel comprises an inlet portion, a center point, and an outlet portion. In some embodiments, the length, depth, and width of the constriction in the microfluidic channel can vary. In some embodiments, the width of the constriction in the microfluidic channel is a function of the diameter of PBMC cells. Methods for determining the diameter of PBMC are known in the art, such as high content imaging, cell counter, or flow cytometry.

[0213] In some embodiments, the width of the constriction is about 10% to about 99% of the average diameter of the input PBMCs. In some embodiments, the width of the constriction is any one of about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 20% to about 60%, about 40% to about 60%, about 30% to about 45%, about 50% to about 99%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 60% to about 90%, about 60% to about 80%, or about 60% to about 70% of the average diameter of the input PBMCs having the smallest diameter in the population of PBMCs. In some embodiments, the width of the constriction is any one of about 10% to about 90%, about 10% to about 80%, about 10% to about 70%, about 20% to about 60%, about 40% to about 60%, about 30% to about 45%, about 50% to about 99%, about 50% to about 90%, about 50% to about 80%, about 50% to about 70%, about 60% to about 90%, about 60% to about 80%, or about 60% to about 70% of the average diameter of the input PBMCs.

[0214] In some embodiments of delivery of HPV antigens to PBMCs by the constriction, the width of the constriction is about 3 μm to about 15 μm. In some embodiments, the width of the constriction is about 3 μm to about 10 μm. In some embodiments, the width of the constriction is about 3 μm to about 6 μm. In some embodiments, the width of the constriction is about 4.2 μm to about 6 μm. In some embodiments, the width of the constriction is about 4.2 μm to about 4.8 μm. In some embodiments, the width of the constriction is about 3 μm to about 5 μm. In some embodiments, the width of the constriction is about 3 μm to about 3.5 μm. In some embodiments, the width of the constriction is about 3.5 μm to about 4 μm. In some embodiments, the width of the constriction is about 4 μm to about 4.5 μm. In some embodiments, the width of the constriction is about 3.2 μm to about 3.8 μm. In some embodiments, the width of the constriction is about 3.8 μm to about 4.3 μm, In some embodiments, the width of the constriction is any one or less than about 2 μm, 2.5 μm, 3 μm, 3.5 μm, 4 μm, 4.5 μm, 5 μm, 5.5 μm, 6 μm, 6.5 μm, 7 μm, 7.5 μm, 8 μm, 8.5 μm, 9 μm, 9.5 μm, 10 μm, 10.5 μm, 11 μm, 11.5 μm, 12 μm, 12.5 μm, 13 μm, 13.5 μm, 14 μm, 14.5 μm, or 15 μm. In some embodiments, the width of the constriction is less than or equal to about 3.0 μm, 3.1 μm, 3.2 μm, 3.3 μm, 3.4 μm, 3.5 μm, 3.6 μm, 3.7 μm, 3.8 μm, 3.9 μm, 4.0 μm, 4.1 μm, 4.2 μm, 4.3 μm, 4.4 μm, 4.5 μm, 4.6 μm, 4.7 μm, 4.8 μm, 4.9 μm, or 5.0 μm. In some embodiments, the width of the constriction is 4.5 μm.

[0215] Examples of parameters that may affect the delivery of compounds into PBMCs include, but are not limited to, the dimensions of the constriction, the angle of incidence of the constriction, the surface properties of the constriction (e.g., roughness, chemical modification, hydrophilicity, hydrophobicity, etc.), the flow rate during operation (e.g., the transit time of cells through the constriction), the cell concentration, the concentration of the compound in the cell suspension, the buffer in the cell suspension, and the length of time the PBMCs are collected or cultured after passing through the constriction, which may affect the passage of the delivered compound into the PBMCs. Further parameters that affect the delivery of compounds to the PBMCs may include the velocity of the input PBMCs at the constriction, the shear rate at the constriction, the viscosity of the cell suspension, the velocity component perpendicular to the flow rate, and the time in the constriction. In addition, multiple chips containing channels in series and / or parallel may affect the delivery to the PBMCs. Multiple chips in parallel may be useful to enhance throughput. Such parameters may be designed to control the delivery of compounds. In some embodiments, the cell concentration is between about 10 and at least about 10 12 In some embodiments, the delivery compound concentration can be in the range of about 10 ng / mL to about 1 g / mL, or any concentration or concentration range therebetween. In some embodiments, the delivery compound concentration can be in the range of about 1 pM to at least about 2M, or any concentration or concentration range therebetween.

[0216] In some embodiments, the concentration of HPV antigen cultured with PBMCs is about 0.01 μM to about 10 mM. For example, in some embodiments, the concentration of HPV antigen cultured with PBMCs is less than about 0.01 μM, less than about 0.1 μM, less than about 1 μM, less than about 10 μM, less than about 100 μM, less than about 1 mM, or less than about 10 mM. In some embodiments, the concentration of HPV antigen cultured with PBMCs is greater than about 10 mM. In some embodiments, the concentration of HPV antigen cultured with PBMCs is about 0.01 μM to about 0.1 μM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or about 1 mM to about 10 mM. In some embodiments, the concentration of HPV antigen cultured with PBMCs is about 0.1 μM to about 1 mM. In some embodiments, the concentration of HPV antigen cultured with PBMCs is about 0.1 μM to about 10 mM. In some embodiments, the concentration of HPV antigen cultured with PBMCs is 1 μM.

[0217] In some embodiments, the molar ratio of antigen to adjuvant cultured with perturbed input PBMCs is anywhere from about 10000:1 to about 1:10000. For example, in some embodiments, the molar ratio of antigen to adjuvant cultured with perturbed input PBMCs is any of about 10000:1, about 1000:1, about 100:1, about 10:1, about 1:1, about 1:10, about 1:100, about 1:1000, or about 1:10000. In some embodiments, the molar ratio of antigen to adjuvant cultured with perturbed input P is about 10000:1 to about 1000:1, about 1000:1 to about 100:1, about 100:1 to about 10:1, about 10:1 to about 1:1, about 1:1 to about 1:10, about 1:10 to about 1:100, about 1:100 to about 1:1000, about 1:1000 to about 1:10000. In some embodiments, the molar ratio of antigen to adjuvant cultured with perturbed input PBMC is about 200:1. In some embodiments, the molar ratio of antigen to adjuvant cultured with perturbed input PBMC is about 20:1.

[0218] In some embodiments, the modified PBMCs contain an adjuvant at a concentration of about 1 nM to about 1 mM. For example, in some embodiments, the modified PBMCs contain an adjuvant at a concentration of about 0.01 μM, about 0.1 μM, about 1 μM, about 10 μM, about 100 μM, about 1 mM, or less than about 10 mM. In some embodiments, the modified PBMCs contain an adjuvant at a concentration of greater than about 10 mM. In some embodiments, the modified PBMCs contain an adjuvant at a concentration of about 1 nM to about 10 nM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or about 1 mM to about 10 mM. In some embodiments, the modified PBMCs contain an adjuvant at a concentration of about 0.1 μM to about 1 mM. In some embodiments, the modified PBMCs comprise an adjuvant at a concentration of about 1 μM.

[0219] In some embodiments, the modified PBMCs contain an antigen at a concentration of about 1 nM to about 1 mM. For example, in some embodiments, the modified PBMCs contain an antigen at a concentration of about 0.01 μM, about 0.1 μM, about 1 μM, about 10 μM, about 100 μM, about 1 mM, or less than about 10 mM. In some embodiments, the modified PBMCs contain an antigen at a concentration of more than about 10 mM. In some embodiments, the modified PBMCs contain an antigen at a concentration of about 1 nM to about 10 nM, about 0.1 μM to about 1 μM, about 1 μM to about 10 μM, about 10 μM to about 100 μM, about 100 μM to about 1 mM, or about 1 mM to about 10 mM. In some embodiments, the modified PBMCs contain an antigen at a concentration of about 0.1 nM to about 1 mM. In some embodiments, the modified PBMCs contain an antigen at a concentration of about 1 μM.

[0220] In some embodiments, the molar ratio of antigen to adjuvant in the modified PBMCs is anywhere from about 10000:1 to about 1:10000. For example, in some embodiments, the molar ratio of antigen to adjuvant in the modified PBMCs is any of about 10000:1, about 1000:1, about 100:1, about 10:1, about 1:1, about 1:10, about 1:100, about 1:1000, or about 1:10000. In some embodiments, the molar ratio of antigen to adjuvant in the modified PBMCs is about 10000:1 to about 1000:1, about 1000:1 to about 100:1, about 100:1 to about 10:1, about 10:1 to about 1:1, about 1:1 to about 1:10, about 1:10 to about 1:100, about 1:100 to about 1:1000, or about 1:1000 to about 1:10000. In some embodiments, the molar ratio of antigen to adjuvant in the modified PBMCs is about 200:1. In some embodiments, the molar ratio of antigen to adjuvant in the modified PBMCs is about 20:1.

[0221] Acclimation of PBMCs In some embodiments according to any one of the methods described herein, the PBMCs comprising at least one HPV antigen are conditioned. In further embodiments, the PBMCs are mature. In some embodiments, the PBMCs are conditioned following constriction-mediated delivery. In some embodiments, the PBMCs comprising at least one HPV antigen are cultured with an adjuvant for a sufficient time to condition the cells comprising the HPV antigen delivered by the constriction, thereby generating a composition of conditioned cells comprising at least one HPV antigen. In some embodiments, the PBMCs are conditioned following constriction-mediated delivery. In some embodiments, the PBMCs comprising the HPV antigen delivered by the constriction are cultured with an adjuvant for a sufficient time to condition the PBMCs comprising the mutant HPV antigen delivered by the constriction, thereby generating a composition of conditioned PBMCs comprising at least one HPV antigen. In some embodiments, the adjuvant is CpG oligodeoxynucleotide (ODN), LPS, IFN-α, STING agonist, RIG-I agonist, poly I:C, R837, R848, TLR3 agonist, TLR4 agonist, or TLR9 agonist. In some embodiments, the adjuvant is CpG ODN 2006 (also known as CpG 7909) (TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO: 31)). In some embodiments, the adjuvant is CpG 7909. In some embodiments, the adjuvant is CpG7909 oligodeoxynucleotide (ODN).

[0222] In some aspects, there is provided a composition of conditioned PBMCs comprising at least one HPV antigen prepared by a process comprising the steps of: a) passing a cell suspension comprising a population of input PBMCs through a cell deformation constriction, the width of the constriction being a function of the input PBMCs in suspension, thereby causing a perturbation of the input PBMCs sufficient to allow the at least one HPV antigen to pass to form perturbed input PBMCs, b) culturing the perturbed input PBMCs with at least one HPV antigen for a sufficient time to allow the at least one HPV antigen to enter the perturbed PBMCs, thereby producing modified PBMCs comprising at least one HPV antigen, and c) culturing the modified PBMCs comprising the HPV antigen delivered by the constriction with an adjuvant for a sufficient time to condition the modified PBMCs comprising the HPV antigen delivered by the constriction, thereby producing a composition of conditioned PBMCs comprising at least one HPV antigen. In some embodiments, the process further comprises isolating the modified PBMCs comprising the HPV antigen from the cell suspension prior to culturing with the adjuvant to condition the modified PBMCs. In some embodiments, the adjuvant is a CpG7909 oligodeoxynucleotide (ODN).

[0223] In some embodiments, the PBMCs are conditioned prior to constriction-mediated delivery. In some embodiments, the PBMCs are cultured with an adjuvant for a sufficient time to condition the PBMCs, thereby conditioning the PBMCs. In some embodiments, a composition of conditioned PBMCs comprising at least one HPV antigen is provided, prepared by a process comprising the steps of: a) culturing the PBMCs with an adjuvant for a sufficient time to condition the PBMCs, thereby producing conditioned PBMCs; b) passing a cell suspension comprising the conditioned PBMCs through a cell-deforming constriction, the width of the constriction being a function of the diameter of the PBMCs in suspension, thereby causing a perturbation of the PBMCs sufficient to allow the at least one HPV antigen to pass through to form a conditioned perturbed PBMC; and c) culturing the conditioned perturbed PBMCs with at least one HPV antigen for a sufficient time to allow the at least one HPV antigen to enter the conditioned perturbed PBMCs, thereby producing a conditioned PBMC comprising at least one HPV antigen. In some embodiments, the process further comprises isolating the conditioned PBMCs from the adjuvant prior to passing the conditioned PBMCs through a cell transformation constriction. In some embodiments, the adjuvant is a CpG7909 oligodeoxynucleotide (ODN).

[0224] In some embodiments of any one of the methods described herein, the PBMCs comprising at least one HPV antigen are cultured with the adjuvant for about 1 to about 24 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant for about 2 to about 10 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant for about 3 to about 6 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant for any one of about 1 hour, 2 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 8 hours, 12 hours, 16 hours, 20 hours, or 24 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant for about 4 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant at a temperature of any one of about 4, 8, 12, 16, 20, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40° C. In some embodiments, the PBMCs are cultured with the adjuvant at about 37° C. In some embodiments, the PBMCs are cultured with the adjuvant for about 4 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant at about 37° C. for about 4 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with CpG 7909 for about 4 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with CpG 7909 at about 37° C. for about 4 hours to condition the PBMCs. In some embodiments, PBMCs are cultured with CpG 7909 at about 0.20 mg / mL, 0.25 mg / mL, 0.30 mg / mL, 0.35 mg / mL, 0.40 mg / mL, 0.45 mg / mL, or 0.50 mg / mL, or any concentration therebetween. In some embodiments, PBMCs are cultured with CpG 7909 at a concentration of about 0.35 mg / mL. In some embodiments, PBMCs are cultured with CpG 7909 at a concentration of about 0.35 mg / mL and at about 37° C. for about 4 hours to allow the PBMCs to become conditioned.

[0225] In some embodiments, a plurality of conditioned PBMCs comprising at least one HPV antigen is provided, prepared by culturing a plurality of PBMCs comprising at least one HPV antigen with an adjuvant for a time sufficient to condition the PBMCs, thereby generating a plurality of conditioned PBMCs comprising at least one HPV antigen. In some embodiments, a plurality of conditioned PBMCs comprising at least one HPV antigen is provided, prepared by culturing a plurality of PBMCs with an adjuvant for a time sufficient to condition the PBMCs prior to introduction of the at least one HPV antigen to the PBMCs, thereby generating a plurality of conditioned PBMCs comprising at least one HPV antigen.

[0226] In some embodiments of any of the conditioned PBMCs described herein, the PBMCs are cultured with the adjuvant for about 1 to about 24 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant for about 2 to about 10 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant for about 3 to about 6 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant for any one of about 1 hour, 2 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 8 hours, 12 hours, 16 hours, 20 hours, or 24 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant for about 4 hours to condition the PBMCs. In some embodiments, the PBMCs are cultured with the adjuvant at a temperature of any one of about 4, 8, 12, 16, 20, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40° C. In some embodiments, the PBMCs are cultured with the adjuvant at about 37° C. In some embodiments, the PBMCs containing at least one HPV antigen are conditioned by a process comprising culturing the PBMCs with the adjuvant at about 37° C. for about 2 hours to about 10 hours, about 3 hours to about 6 hours, or about 4 hours to condition the PBMCs.

[0227] In some embodiments of any one of the plurality of conditioned PBMCs described herein, one or more costimulatory molecules are upregulated in the plurality of conditioned modified PBMCs compared to the plurality of unconditioned modified PBMCs. In some embodiments, one or more costimulatory molecules are upregulated in a subpopulation of cells in the plurality of conditioned modified PBMCs compared to a subpopulation of cells in the plurality of unconditioned modified PBMCs. In some embodiments, one or more costimulatory molecules are upregulated in B cells of the plurality of conditioned modified PBMCs compared to B cells in the plurality of unconditioned modified PBMCs. In some embodiments, the costimulatory molecule is CD80 and / or CD86. In some embodiments, the costimulatory molecule is CD86. In some embodiments, CD80 and / or CD86 are upregulated by more than about 1.2-fold, 1.5-fold, 1.8-fold, 2-fold, 3-fold, 4-fold, 5-fold, 8-fold, or more than 10-fold in B cells of the plurality of conditioned modified PBMCs compared to B cells in the plurality of unconditioned modified PBMCs. In some embodiments, CD80 and / or CD86 are upregulated in B cells of the conditioned plurality of modified PBMCs by about 1.2-fold to about 1.5-fold, about 1.5-fold to about 1.8-fold, about 1.8-fold to about 2-fold, about 2-fold to about 3-fold, about 3-fold to about 4-fold, about 4-fold to about 5-fold, about 5-fold to about 8-fold, about 8-fold to about 10-fold, about 10-fold to about 20-fold, about 20-fold to about 50-fold, about 50-fold to about 100-fold, about 100-fold to about 200-fold, about 200-fold to about 500-fold, or more than about 500-fold in B cells of the conditioned plurality of modified PBMCs compared to B cells in the unconditioned plurality of modified PBMCs. In some embodiments, expression of one or more of IFN-γ, IL-6, MCP-1, MIP-1β, IP-10, or TNF-α is increased in the conditioned plurality of modified PBMCs compared to the unconditioned plurality of modified PBMCs. In some embodiments, expression of one or more of IFN-γ, IL-6, MCP-1, MIP-1β, IP-10, or TNF-α is increased in the conditioned plurality of modified PBMCs compared to a subpopulation in the unconditioned plurality of modified PBMCs.In some embodiments, expression of one or more of IFN-γ, IL-6, MCP-1, MIP-1β, IP-10, or TNF-α is increased by more than about 1.2-fold, 1.5-fold, 1.8-fold, 2-fold, 3-fold, 4-fold, 5-fold, 8-fold, or 10-fold in conditioned modified PBMCs compared to non-conditioned modified PBMCs. In some embodiments, expression of one or more of IFN-γ, IL-6, MCP-1, MIP-1β, IP-10, or TNF-α is increased by any of about 1.2-fold to about 1.5-fold, about 1.5-fold to about 1.8-fold, about 1.8-fold to about 2-fold, about 2-fold to about 3-fold, about 3-fold to about 4-fold, about 4-fold to about 5-fold, about 5-fold to about 8-fold, about 8-fold to about 10-fold, about 10-fold to about 20-fold, about 20-fold to about 50-fold, about 50-fold to about 100-fold, about 100-fold to about 200-fold, about 200-fold to about 500-fold, or more than about 500-fold in conditioned modified PBMCs compared to non-conditioned modified PBMCs.

[0228] Systems and Kits In some aspects, the present invention provides a system comprising one or more of a constriction, a PBMC cell suspension, an HPV antigen, or an adjuvant for use in the methods disclosed herein. The system can include any of the embodiments described in the methods disclosed above, including a surface having microfluidic channels or pores for providing a cell deformation constriction, a cell suspension, cell perturbation, delivery parameters, compounds, and / or applications, etc. In some embodiments, the cell deformation constriction is sized for delivery to PBMCs. In some embodiments, delivery parameters such as operating flow rate, cell and compound concentration, velocity of cells within the constriction, and composition of the cell suspension (e.g., osmolality, salt concentration, serum content, cell concentration, pH, etc.) are optimized to maximize the response of the compound to suppress immune responses or induce tolerance.

[0229] Also provided are kits or articles of manufacture for use in treating individuals with HPV-associated cancer. In some embodiments, the kits include PBMCs containing intracellular HPV antigens and intracellular adjuvants. In some embodiments, the kits include one or more of a constriction, a PBMC suspension, an HPV antigen, or an adjuvant for use in generating PBMCs for use in treating individuals with HPV-associated disease, such as cancer. In some embodiments, the kits include the compositions described herein (e.g., a microfluidic channel or surface containing pores, a cell suspension, and / or a compound) in suitable packaging. Suitable packaging materials are known in the art and include, for example, vials (such as sealed vials), containers, ampoules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. These articles may further be sterilized and / or sealed.

[0230] The invention also provides kits containing components of the methods described herein and may further include instructions for carrying out the methods of treating an individual with an HPV-associated cancer and / or instructions for introducing at least one HPV antigen into PBMCs. The kits described herein may further include other materials, including other buffers, diluents, filters, needles, syringes, and inserts with instructions for carrying out any of the methods described herein, such as instructions for treating an individual with an HPV-associated cancer or instructions for generating PBMCs containing at least one HPV antigen within the cells.

[0231] Exemplary embodiments Embodiment 1. 1. A method of treating a human papillomavirus (HPV) associated cancer in an individual, comprising: administering to the individual an effective amount of a composition comprising peripheral blood mononuclear cells (PBMCs), the PBMCs comprising at least one HPV antigen to be delivered intracellularly; administering to the individual an effective amount of a CTLA-4 antagonist and / or a PD-1 / PD-L1 antagonist.

[0232] Embodiment 2. 2. The method of embodiment 1, wherein the antagonist of CTLA4 is an antibody that binds to CTLA4.

[0233] Embodiment 3. The method of embodiment 1 or 2, wherein the PD-1 / PD-L1 antagonist is an antibody that binds to PD-1 or an antibody that binds to PD-L1.

[0234] Embodiment 4. 4. The method of any one of embodiments 1-3, wherein an antibody that binds CTLA-4 and an antibody that binds PD-1 are administered to the individual.

[0235] Embodiment 5. 4. The method of any one of embodiments 1-3, wherein an antibody that binds CTLA-4 is administered to the individual and an antibody that binds PD-L1 is administered to the individual.

[0236] Embodiment 6. The method of any one of embodiments 2 to 5, wherein the antibody that binds to CTLA-4 is ipilimumab.

[0237] Embodiment 7. The method of any one of embodiments 3, 4 and 6, wherein the antibody that binds to PD-1 is nivolumab.

[0238] Embodiment 8. The method of any one of embodiments 3, 4 and 6, wherein the antibody that binds to PD-1 is pembrolizumab.

[0239] EMBODIMENT 9. The method of any one of embodiments 3, 4 and 6, wherein the antibody that binds to PD-L1 is atezolizumab.

[0240] Embodiment 10. A method for treating an HPV+ recurrent, locally advanced, or metastatic tumor in an individual, comprising administering to the individual an effective amount of a composition comprising peripheral blood mononuclear cells (PBMCs), the PBMCs comprising at least one HPV antigen delivered intracellularly.

[0241] Embodiment 11. 11. The method of embodiment 10, wherein the composition comprising the PBMCs is administered in combination with one or more immune checkpoint inhibitors.

[0242] Embodiment 12. 12. The method of embodiment 11, wherein the checkpoint inhibitor is an antagonist of CTLA-4 and / or an antagonist of PD-1 / PD-L1 to the individual.

[0243] Embodiment 13. 13. The method of embodiment 11 or 12, wherein the one or more immune checkpoint inhibitors are an antibody that binds to PD-L1, CTLA-4, or PD-1.

[0244] Embodiment 14. The method according to any one of embodiments 11 to 13, wherein the composition comprising PBMCs is administered in combination with an antibody that binds to CTLA-4 and an antibody that binds to PD1.

[0245] EMBODIMENT 15. 14. The method of embodiment 13, wherein the antibody that binds to PD-L1 is atezolizumab.

[0246] Embodiment 16. The method of any one of embodiments 13-15, wherein the antibody that binds to CTLA-4 is ipilimumab.

[0247] EMBODIMENT 17. The method of any one of embodiments 13, 14, and 16, wherein the antibody that binds to PD-1 is nivolumab.

[0248] Embodiment 18. 17. The method of any one of embodiments 13, 14, and 16, wherein the antibody that binds to PD-1 is pembrolizumab.

[0249] EMBODIMENT 19. 19. The method according to any one of the preceding embodiments, wherein the at least one HPV antigen is an HPV-16 antigen or an HPV-18 antigen.

[0250] EMBODIMENT 20. 20. The method of embodiment 19, wherein the at least one HPV antigen comprises a peptide derived from HPV E6 and / or E7.

[0251] EMBODIMENT 21. 21. The method according to any one of the preceding embodiments, wherein at least one HPV antigen comprises an HLA-A2 restricted peptide derived from HPV E6 and / or E7.

[0252] EMBODIMENT 22. The method according to embodiment 21, wherein the HLA-A2 restricted peptide comprises any one of the amino acid sequences of SEQ ID NOs: 1 to 4.

[0253] EMBODIMENT 23. 21. The method according to any one of the preceding embodiments, wherein at least one HPV antigen comprises an amino acid sequence of any one of SEQ ID NOs: 18-25.

[0254] EMBODIMENT 24. The method according to any one of the preceding embodiments, wherein the PBMCs comprise an antigen comprising the amino acid sequence of SEQ ID NO: 19 and an antigen comprising the amino acid sequence of SEQ ID NO: 23.

[0255] 25. 25. The method according to any one of embodiments 1 to 24, wherein the individual is a human.

[0256] 26. If the individual is HLA-A * The method of any one of embodiments 1 to 25, wherein the patient is positive for 02.

[0257] EMBODIMENT 27. PBMCs were HLA-A * The method of any one of embodiments 1 to 26, wherein the patient is positive for 02.

[0258] 28. 28. The method of any one of embodiments 1-27, wherein the PBMCs are autologous to the individual.

[0259] 29. 29. The method of any one of embodiments 1-28, wherein the individual is positive for Human Immunodeficiency Virus (HIV).

[0260] EMBODIMENT 30. 30. The method of any one of embodiments 1-29, wherein the HPV-associated cancer is head and neck cancer, cervical cancer, anal cancer, or esophageal cancer.

[0261] EMBODIMENT 31. 31. The method according to any one of embodiments 1 to 30, wherein the composition comprising PBMCs is administered intravenously.

[0262] EMBODIMENT 32. The method according to any one of embodiments 1-9 or 12-31, wherein the antagonist of CTLA-4 and / or the antagonist of PD-1 / PD-La is administered intravenously, orally, or subcutaneously.

[0263] EMBODIMENT 33. The method of any one of embodiments 2-9 or 13-32, wherein the antibody that binds to CTLA-4 and / or the antibody that binds to PD-1 and / or the antibody that binds to PD-L1 is administered intravenously.

[0264] EMBODIMENT 34. An effective amount of PBMCs containing at least one HPV antigen is about 0.5×10 6 cells / kg ~ approx. 5.0×10 6 The method according to any one of the preceding embodiments, wherein the amount of cells per kg is 100 mg / kg.

[0265] EMBODIMENT 35. The method according to any one of embodiments 6-9 or 16-34, wherein the effective amount of ipilimumab is from about 1 mg / kg to about 3 mg / kg.

[0266] 36. The method of any one of embodiments 7 or 17-35, wherein the effective amount of nivolumab is about 360 mg / kg.

[0267] 37. The method of any one of embodiments 9, 15, 16, or 19-36, wherein the effective amount of atezolizumab is about 1200 mg / kg.

[0268] 38. 38. The method of any one of embodiments 1-37, wherein the composition comprising PBMCs is delivered on day 1 of a three-week cycle.

[0269] 39. The method according to any one of embodiments 1 to 38, wherein the composition comprising PBMCs is further administered on day 2 of the first three-week cycle.

[0270] EMBODIMENT 40. Approximately 0.5×10 6 cells / kg, approximately 2.5×10 6 cells / kg, approximately 5.0×10 6 The method of embodiment 38 or 39, wherein the cells / kg are administered on day 1 of each three-week cycle.

[0271] EMBODIMENT 41. Approximately 0.5×10 6 cells / kg, approximately 2.5×10 6 cells / kg, approximately 5.0×10 6 The method of embodiment 39 or 40, wherein the cells / kg are administered on day 2 of the first three-week cycle.

[0272] EMBODIMENT 42. The method of any one of embodiments 2-9 or 13-41, wherein the antibody that binds CTLA-4 and / or the antibody that binds PD-1 and / or the antibody that binds PD-L1 is administered once every three-week cycle.

[0273] EMBODIMENT 43. The method of any one of embodiments 38-42, wherein the antibody that binds CTLA-4 is administered on day 1 of each three-week cycle.

[0274] EMBODIMENT 44. The method of any one of embodiments 38-42, wherein the antibody that binds to CTLA-4 is administered once per two three-week cycles.

[0275] EMBODIMENT 45. The method of any one of embodiments 38-44, wherein the antibody that binds to CTLA-4 is ipilimumab, and the ipilimumab is administered at a dose of about 3 mg / kg.

[0276] EMBODIMENT 46. The method of any one of embodiments 42-45, wherein the antibody that binds PD-1 is administered on day 8 of the first three week cycle and on day 1 of each cycle thereafter.

[0277] EMBODIMENT 47. 47. The method of embodiment 46, wherein the antibody that binds PD-1 is nivolumab, and the nivolumab is administered at a dose of about 360 mg.

[0278] 48. The method of any one of embodiments 38-42, wherein the antibody that binds CTLA-4 is ipilimumab, and ipilimumab is administered at a dose of about 1 mg / kg on day 1 of the first three week cycle of two three week cycles, and the antibody that binds PD-1 is administered at a dose of about 360 mg on day 8 of the first three week cycle and day 1 of each cycle thereafter.

[0279] 49. The method of any one of embodiments 38-45, wherein the antibody that binds PD-1 is administered on day 8 of the first three week cycle and on day 1 of each cycle thereafter.

[0280] EMBODIMENT 50. 49. The method of embodiment 48, wherein the antibody that binds PD-L1 is atezolizumab, and the atezolizumab is administered at a dose of about 1200 mg.

[0281] EMBODIMENT 51. 50. The method of any one of embodiments 1-49, wherein the composition comprising PBMCs is administered to the individual for at least about three months, six months, nine months, or one year.

[0282] EMBODIMENT 52. A composition comprising PBMCs, a) Approximately 5 × 10 6 PBMC ~ approx. 5×10 7 PBMCs, b) a cryopreservation medium with a ratio of about 40% to about 60% (w / w); c) a cryopreservation medium in a proportion of about 25% to about 35% (w / w); and d) about 3% to about 8% (w / w) human serum albumin; 52. The method according to any one of the preceding embodiments, wherein the pH of the formulation is from about pH 6.0 to about pH 8.5.

[0283] EMBODIMENT 53. A composition comprising PBMCs, a) Approx. 2.75 x 10 7 PBMCs, b) a cryopreservation medium in a proportion of about 50% (w / w); c) a cryopreservation medium in a proportion of about 30% (w / w), and d) human serum albumin in a proportion of about 5% (w / w); 53. The method according to any one of embodiments 1-52, wherein the pH of the formulation is about pH 7.4.

[0284] EMBODIMENT 54. A composition comprising PBMCs, a) Approximately 1 × 10 6 PBMC / mL ~ approx. 1×10 7 PBMC / mL, b) a cryopreservation medium with a ratio of about 40% to about 60% (w / w); c) a cryopreservation medium in a proportion of about 25% to about 35% (w / w); and d) about 3% to about 8% (w / w) human serum albumin; 54. The method according to any one of the preceding embodiments, wherein the pH of the formulation is from about pH 6.0 to about pH 8.5.

[0285] EMBODIMENT 55. A composition comprising PBMCs, a) Approximately 5 × 10 6 PBMC / mL, b) a cryopreservation medium in a proportion of about 50% (w / w); c) a cryopreservation medium in a proportion of about 30% (w / w), and d) human serum albumin in a proportion of about 5% (w / w); 55. The method according to any one of embodiments 1-54, wherein the pH of the formulation is about pH 7.4.

[0286] EMBODIMENT 56. A composition comprising PBMCs, a) Approximately 5 × 10 6 PBMC ~ approx. 5×10 7 PBMCs, b) a cryopreservation medium having a ratio of about 65% to about 95% (w / w); c) about 3% to about 8% (w / w) human serum albumin; 52. The method according to any one of the preceding embodiments, wherein the pH of the formulation is from about pH 6.0 to about pH 8.5.

[0287] EMBODIMENT 57. A composition comprising PBMCs, a) Approximately 1 × 10 6 PBMC / mL ~ approx. 1×10 7 PBMC / mL, b) a cryopreservation medium having a ratio of about 65% to about 95% (w / w); c) about 3% to about 8% (w / w) human serum albumin; 52. The method according to any one of the preceding embodiments, wherein the pH of the formulation is from about pH 6.0 to about pH 8.5.

[0288] EMBODIMENT 58. A composition comprising PBMCs, a) Approximately 2.5 x 10 7 PBMCs, b) a cryopreservation medium with a proportion of about 80% (w / w); c) human serum albumin in a proportion of about 5% (w / w); 52. The method according to any one of the preceding embodiments, wherein the pH of the formulation is about pH 7.4.

[0289] EMBODIMENT 59. A composition comprising PBMCs, a) Approximately 5 × 10 6 PBMC / mL, b) a cryopreservation medium with a proportion of about 80% (w / w); c) human serum albumin in a proportion of about 5% (w / w); 52. The method according to any one of the preceding embodiments, wherein the pH of the formulation is about pH 7.4.

[0290] 60. The method of any one of embodiments 52 to 59, wherein the cryopreservation medium is CryoStor® CS10.

[0291] 61. The method of any one of embodiments 52 to 55, wherein the cryopreservation medium is HypoThermasol® FRS.

[0292] 62. The method of any one of embodiments 1-61, wherein the PBMCs comprise two or more of T cells, B cells, NK cells, or monocytes.

[0293] 63. The method of any one of embodiments 1-62, wherein the PBMCs comprise T cells, B cells, NK cells, and monocytes.

[0294] 64. (a) about 25% to about 80% of PBMCs are T cells; (b) about 1.5% to about 30% of PBMCs are B cells; (c) about 3.0% to about 20% of the PBMCs are NK cells, or (d) The method of any one of embodiments 1 to 63, wherein about 4.0% to about 45% of the PBMCs are monocytes.

[0295] 65. PBMCs containing at least one HPV antigen, a) passing a cell suspension comprising a population of input PBMCs through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in suspension, thereby causing a perturbation of the input PBMCs sufficient to allow at least one HPV antigen to pass therethrough to form a perturbed input PBMC; The method according to any one of embodiments 1 to 64, wherein the population of perturbed input PBMCs is prepared by a process comprising: b) culturing a population of perturbed input PBMCs with at least one HPV antigen for a period of time sufficient to allow the antigen to enter the perturbed input PBMCs, thereby generating PBMCs comprising at least one HPV antigen.

[0296] 66. 66. The method of embodiment 65, wherein the diameter of the constriction is from about 4.2 μm to about 6 μm or from about 4.2 μm to about 4.8 μm.

[0297] 67. 67. The method according to any one of the preceding embodiments, wherein the PBMCs containing at least one HPV antigen are conditioned.

[0298] 68. 68. The method of embodiment 67, wherein the PBMCs containing at least one HPV antigen are conditioned by a process comprising culturing the PBMCs with an adjuvant at about 37°C for about 2 hours to about 10 hours, about 3 hours to about 6 hours, or about 4 hours to conditioned the PBMCs.

[0299] 69. The method of embodiment 68, wherein the adjuvant is CpG oligodeoxynucleotide (ODN), LPS, IFN-α, a STING agonist, a RIG-I agonist, poly I:C, R837, R848, a TLR3 agonist, a TLR4 agonist, or a TLR9 agonist.

[0300] EMBODIMENT 70. The method of embodiment 68 or 69, wherein the adjuvant is a CpG7909 oligodeoxynucleotide (ODN). EXAMPLES

[0301] Those skilled in the art will recognize that some embodiments are possible within the scope and spirit of the present invention. The present invention will now be described in more detail with reference to the following non-limiting examples. The following examples further illustrate the present invention but, of course, should not be construed as in any way limiting its scope. Example 1 Phase I Study of Safety and Tolerability of SQZ-PBMC-HPV

[0302] HLA A with recurrent, locally advanced, or metastatic HPV16-positive solid tumors * A Phase 1, open-label, multicenter study of safety and tolerability, antitumor activity, and immunogenicity and pharmacodynamic effects of SQZ-PBMC-HPV as monotherapy and in combination with (1) atezolizumab, (2) ipilimumab, (3) nivolumab, and (4) nivolumab + ipilimumab will be conducted in 02+ patients.

[0303] SQZ PBMC HPV was HLA-A serogroup positive (HLA-A *SQZ PBMC HPV is an antigen presenting peripheral blood mononuclear cell (PBMC) product for the treatment of human papillomavirus (HPV) strain 16 positive (HPV16+) cancers in human leukocyte antigen (HLA) serotype 02+) patients. SQZ PBMC HPV consists of autologous PBMCs presenting immunogenic epitopes of the E6 and E7 proteins of HPV16. PBMCs consist primarily of T cells, monocytes, natural killer cells, and B cells. The PBMC-HPV drug substance is formulated into SQZ PBMC HPV containing freezing medium and then cryopreserved. SQZ PBMC HPV is stored under cryopreservation and thawed at the time of use.

[0304] SQZ-PBMC-HPV drug substance expresses HPV16 HLA-A delivered in the cytosol during the manufacturing process. * 02 consisted of autologous PBMCs bearing synthetic long peptides (SLPs) containing restricted E6 and E7 epitopes. [ka]

[0305] The PBMC-HPV cells are then matured with the CpG oligodeoxynucleotide, CpG 7909. This maturation of the PBMC HPV during the manufacturing process facilitates endogenous T cells to be stimulated with antigen in the appropriate context. overview

[0306] The study population consisted of HLA-A resistant pts with advanced HPV16+ solid tumors (head and neck, cervical cancer, and other tumor types). * Patients who are HLA A 02+ * HPV 02+ status and HPV16+ tumor status must be confirmed via laboratory report and all eligibility criteria must be met prior to patient leukapheresis. Patients with locally confirmed HPV16+ status may have central confirmation from a fresh tumor biopsy taken at screening if documentation of laboratory verification is deemed insufficient by the sponsor.

[0307] Eligible patients will undergo a single leukapheresis at the study site. The leukapheresis product will be sent to a manufacturer for production of each patient's personalized autologous cell therapy. A frozen vial of SQZ PBMC HPV will then be sent to the study site for administration.

[0308] The study will have three parts: Part 1 will consist of dose escalation to determine the safety profile and RP2D of SQZ-PBMC-HPV monotherapy. Part 2 of the study will evaluate the safety and preliminary efficacy of SQZ-PBMC-HPV in combination with an immune checkpoint inhibitor. Part 3 will evaluate the SQZ-PBMC-HPV monotherapy RP2D in four dose expansion cohorts. Each cohort in Part 3 will enroll up to 29 patients.

[0309] Four dose-expansion cohorts will be evaluated using an optimal Simon two-stage design. In the first stage, up to 10 HIV-negative patients will be enrolled. If at least one response is observed in these 10 patients, an additional 19 patients will be enrolled, for a total of 29.

[0310] In all cohorts, SQZ PBMC-HPV will be administered every 3 weeks for up to one year or until the supply of SQZ-PBMC-HPV is exhausted or treatment discontinuation criteria are met, whichever occurs first.

[0311] All patients in Part 1 and Part 2 will be observed for at least 4 hours after each dose of SQZ PBMC-HPV. In addition, the first two patients in each cohort will be observed for at least 23 hours after their first dose of SQZ PBMC-HPV.

[0312] Tumor assessments will be performed throughout the study by RECIST 1.1 and iRECIST until disease progression, unacceptable toxicity, withdrawal of consent, death, or 2 years from the date of first administration of SQZ PBMC HPV, whichever occurs first. Patients who experience disease progression by RECIST 1.1 may continue treatment to allow for confirmation of disease progression if considered to be in the best interest of the treating investigator, i.e., iCPD by iRECIST (Seymour et al., 2017).

[0313] After the final dose of study drug, follow-up visits will be conducted to monitor safety and tolerability and to assess overall survival. Part 1: Escalation Phase (SQZ-PBMC-HPV Monotherapy)

[0314] The planned dose cohorts for the escalation phase are shown in Table 1. The traditional 3+3 design is intended to evaluate safety and tolerability, but it may be prudent to treat up to six additional patients in a cohort to further investigate safety and tolerability, immunogenic effects, and antitumor activity. In this modified 3+3 design, there will be a maximum of 12 patients per cohort.

[0315] DLT evaluation will be completed in all cohorts for the monotherapy RP2D regimens. The RP2D regimen will be selected based on review of all available safety, tolerability, immunogenicity, and other pharmacodynamic and antitumor data.

[0316] Once the RP2D regimen is defined, Part 2 (combination safety phase) and Part 3 (monotherapy dose expansion phase) will begin. [Table 1] DLT = dose-limiting toxicity; iRECIST = modified RECIST criteria for inclusion in immunotherapy solid tumor trials; RECIST = Response Evaluation Criteria in Solid Tumors version 1.1 a. SQZ-PBMC-HPV administration will continue every 3 weeks until treatment discontinuation criteria are met, or the supply of SQZ-PBMC-HPV is exhausted, or for up to 1 year, whichever occurs first. Patients who experience disease progression by RECIST 1.1 may continue administration to allow for confirmation of disease progression if considered in the best interest of the treating investigator, i.e., iCPD by iRECIST (Seymour et al., 2017). b. In cycle 1, patients received SQZ-PBMC-HPV on days 1 and 2. can.

[0317] Tumor assessments will be performed throughout the study until disease progression by RECIST 1.1 or iRECIST.Follow-up visits will be conducted after the final dose of study drug to monitor safety and tolerability, immunogenicity effects, and tumor assessments.

[0318] Patients will be evaluated in a modified 3+3 dose escalation design. Patients will receive at least two dose levels of SQZ PBMC HPV (0.5×10 6 viable cells / kg and 2.5 x 10 6 SQZ-PBMC-HPV (100 mg / kg viable cells) will be evaluated as monotherapy (Cohorts 1, 2, and 3). Patients in Cohort 1 and Cohort 2 will receive SQZ-PBMC-HPV on day 1 of each 21-day cycle (single priming), and patients in Cohort 3 will receive SQZ-PBMC-HPV on days 1 and 2 of cycle 1 (double priming) and on day 1 of each cycle thereafter (see Figure 1). In each cohort, the first two patients must complete day 8 of cycle 1 before additional patients in the cohort can be treated with that cohort.

[0319] Patients must have sufficient autologous drug to complete at least three complete SQZ-PBMC-HPV doses administered in a cohort or be assigned to a lower dose cohort.

[0320] Although the traditional 3+3 design is intended to assess safety and tolerability, it may be prudent to treat up to six additional patients in a cohort to further investigate safety and tolerability, immunogenic effects, and antitumor activity. In this modified 3+3 design, there is a maximum of 12 patients per cohort.

[0321] RP2D regimens will be selected based on review of all available safety, tolerability, immunogenicity, and other pharmacodynamic and antitumor data. DLT evaluation has been completed in all cohorts for monotherapy RP2D regimens.

[0322] Patients will be enrolled in a rolling manner across all study sites, i.e., no more than two patients in a cohort will receive their first dose of SQZ PBMC-HPV within 1 week of each other.

[0323] Patients will be monitored for the occurrence of DLTs for 28 days after the first dose of SQZ PBMC-HPV in the monotherapy cohort. According to the modified 3+3 rule, the minimum number of patients required to confirm the safety of a cohort with respect to DLTs is 3 with 0 DLTs, 6 with ≤1 DLT, 9 with ≤2 DLTs, or 12 with ≤3 DLTs.

[0324] Dosing regimens are listed below, although intermediate dose levels may be selected, as appropriate, based on review of available safety data. 5×10 6 Viable cells / kg (single prime) 5×10 6 Viable cells / kg (double prime) Lower dose levels (single or double prime)

[0325] After the first 3 patients at a given dose level complete the DLT observation period, 6 to 12 patients will be considered for dose escalation or expansion and will be considered for safety evaluable by review of safety data. The DLT observation period will be defined as 28 days in Part 1.

[0326] If no DLT is observed in any of the first three enrolled patients at a given dose level throughout the DLT observation period, the next higher dose level cohort will be opened for enrollment. If one of the first three patients experiences a DLT, three more patients will be enrolled (for a total of six evaluable patients at the same dose level). If more than one of the first three patients or more than two of the six patients experience a DLT, further dose escalation will not be considered, and this will be the maximum administered dose (MAD). The RP2D may be a previously evaluated, lower dose level, or an alternative intermediate dose level may be selected for further evaluation. The RP2D determination will be made based on safety data obtained from at least six patients. The RP2D will be further evaluated in part 2 (combination safety phase) and part 3 (monotherapy dose expansion phase) of the study. Alternatively, the RP2D will be declared based on pharmacodynamic evaluation, determining that the maximum biological effect has been achieved and that patients would not benefit from further dose escalation.

[0327] Patients will be considered unevaluable if they are unable to complete the DLT observation period for any reason other than safety or if the pharmacodynamic assessments are insufficient to define the biological effect of the study therapy. Part 1 patients who are considered unevaluable may be replaced in consultation with the investigator and sponsor.

[0328] Adverse events occurring after any dose should have improved to less than grade 2 at the time of the subsequent dose. Similarly, AESIs occurring after any dose should have improved to less than grade 2 at the time of the subsequent dose. In cohort 3, if these retreatment criteria are met, the second SQZ PBMC-HPV dose should be administered during the 23-hour or greater observation period (i.e., 16-24 hours after the first dose). Patients will be observed for at least 4 hours after the second priming dose. The minimum interval between the two doses will be 16 hours. Part 2: Combination safety phase (SQZ-PBMC-HPV + checkpoint inhibitors)

[0329] Once the SQZ-PBMC-HPV monotherapy RP2D is defined, a combination safety phase will begin. The SQZ-PBMC-HPV dose evaluated during the combination safety exploration will be selected based on review of all available safety, tolerability, immunogenicity, and other pharmacodynamic and antitumor data.

[0330] Cohorts are defined by SQZ PBMC HPV RP2D and combination partner. SQZ-PBMC-HPV is administered at the RP2D in cohorts 4, 5, 6, and 7. Cohort 4: SQZ-PBMC-HPV(RP2D) + atezolizumab (1200mg every 3 weeks) Cohort 5: SQZ-PBMC-HPV(RP2D) + ipilimumab (3mg / kg every 3 weeks, up to 4 doses as tolerated) Cohort 6: SQZ-PBMC-HPV(RP2D) + nivolumab (360mg every 3 weeks) Cohort 7 (subject to safety evaluation of 6 patients treated in cohorts 5 and 6, respectively): SQZ-PBMC-HPV(RP2D) + nivolumab (360 mg every 3 weeks) and ipilimumab (1 mg / kg every 6 weeks)

[0331] Enrollment into part 2 will begin with cohorts 4, 5, and 6. Once six patients in cohorts 5 and 6 have each been enrolled and successfully completed the 42-day DLT evaluation period, i.e., less than 33% of patients experience DLT, cohort 7 will begin enrollment. Based on available safety data from both cohorts, it will be decided whether the dose regimen of SQZ-PBMC-HPV selected for cohorts 5 and 6 will be selected for cohort 7 or to start with a lower dose regimen. Once the lower dose of SQZ-PBMC-HPV for cohort 7 is decided, six patients will be enrolled initially and observed for 42 days. If the SSC deems the combination safe because less than 33% of patients experience DLT, the dose of SQZ-PBMC-HPV can be escalated to the full monotherapy RP2D and enrollment can continue until a maximum of 12 patients are enrolled.

[0332] All patients will be evaluated for safety and tolerability and preliminary evidence of anti-tumor response. Cohort 4 - SQZ-PBMC-HPV + Atezolizumab

[0333] In cycle 1, SQZ-PBMC-HPV is administered IV according to the RP2D determined in part 1, i.e., as a double prime on days 1 and 2 or as a single prime dose on day 1. Atezolizumab 1200 mg is administered IV over 60 minutes on day 8 of cycle 1. In subsequent cycles, atezolizumab is administered on day 1 of each 3-week cycle after SQZ PBMC HPV and continued for up to 2 years or until one of the treatment discontinuation criteria is met (Figure 2). SQZ PBMC-HPV is administered at 3-week intervals until a treatment discontinuation criterion is met, or until the supply of SQZ-PBMC-HPV is exhausted, or for up to 1 year, whichever occurs first. Cohort 5 - SQZ-PBMC-HPV+ipilimumab

[0334] In cycle 1, SQZ-PBMC-HPV is administered IV according to the RP2D determined in part 1, i.e., as a double prime on days 1 and 2, or as a single prime dose on day 1. Ipilimumab, 3 mg / kg, is administered IV over 90 minutes before SQZ PBMC HPV is administered on day 1. In cycles 2, 3, and 4, ipilimumab is administered on day 1 after administration of SQZ-PBMC-HPV. Ipilimumab is administered for up to 4 cycles. SQZ-PBMC-HPV is administered at 3-week intervals until treatment discontinuation criteria are met, or until the supply of SQZ-PBMC-HPV is exhausted, or for up to 1 year, whichever occurs first (Figure 3). Cohort 6-SQZ-PBMC-HPV+Nivolumab

[0335] In cycle 1, SQZ-PBMC-HPV is administered IV according to the RP2D determined in part 1, i.e., as a double prime on days 1 and 2 or as a single prime dose on day 1. On day 8 of cycle 1, nivolumab is administered IV over 30 minutes at a dose of 360 mg. In subsequent cycles, SQZ-PBMC-HPV is followed by nivolumab on day 1 every 3 weeks. Nivolumab may be administered every 3 weeks for up to 2 years or until discontinuation criteria are met. SQZ-PBMC-HPV is administered at 3-week intervals until discontinuation criteria are met, or until the supply of SQZ-PBMC-HPV is exhausted, or for up to 1 year, whichever occurs first (Figure 4). Cohort 7 - SQZ-PBMC-HPV + Nivolumab + Ipilimumab

[0336] In cycle 1, SQZ-PBMC-HPV will be administered IV according to the RP2D determined in part 1, i.e., as a double prime on days 1 and 2 or as a single prime dose on day 1. Ipilimumab will be administered IV at a dose of 1 mg / kg over 30 minutes on day 1 prior to SQZ-PBMC-HPV. Nivolumab 360 mg will be administered IV over 30 minutes on day 8 of cycle 1. Nivolumab will be administered on day 1 of the subsequent 3-week cycle after administration of SQZ-PBMC-HPV. Ipilimumab will be administered every 6 weeks after administration of SQZ-PBMC-HPV and nivolumab in subsequent cycles. Nivolumab and ipilimumab may be administered for 2 years from day 1 of cycle 1 until one of the treatment discontinuation criteria is met. SQZ-PBMC-HPV will be administered at 3-week intervals until a discontinuation criterion is met, or until the supply of SQZ-PBMC-HPV is exhausted, or for up to one year, whichever occurs first.

[0337] If a patient meets the discontinuation criteria for a checkpoint inhibitor due to an immune-mediated AE and the investigator is unable to determine whether the event is related to nivolumab or ipilimumab, the patient should discontinue both agents, but may continue with SQZ-PBMC-HPV. Cohort 7 - SQZ-PBMC-HPV + Nivolumab + Ipilimumab

[0338] In cycle 1, SQZ-PBMC-HPV will be administered IV according to the RP2D determined in part 1, i.e., as a double prime on days 1 and 2 or as a single prime dose on day 1. Ipilimumab will be administered IV at a dose of 1 mg / kg over 30 minutes on day 1 prior to SQZ-PBMC-HPV. Nivolumab 360 mg will be administered IV over 30 minutes on day 8 of cycle 1. Nivolumab will be administered on day 1 of the subsequent 3-week cycle after administration of SQZ-PBMC-HPV. Ipilimumab will be administered every 6 weeks after administration of SQZ-PBMC-HPV and nivolumab in subsequent cycles. Nivolumab and ipilimumab may be administered for 2 years from day 1 of cycle 1 until one of the treatment discontinuation criteria is met. SQZ-PBMC-HPV will be administered at 3-week intervals until a discontinuation criterion is met, or until the supply of SQZ-PBMC-HPV is exhausted, or for up to one year, whichever occurs first.

[0339] If a patient meets the discontinuation criteria for a checkpoint inhibitor due to an immune-mediated AE and the investigator is unable to determine whether the event is related to nivolumab or ipilimumab, the patient should discontinue both agents, but may continue with SQZ-PBMC-HPV.

[0340] For all cohorts in part 2, the second SQZ-PBMC-HPV administration on day 2 of cycle 1 will be administered during a ≥23-hour observation period. Adverse events occurring after any dose administration will improve to grade 2 or less at the subsequent dose. Similarly, AESIs occurring after any dose administration will improve to less than grade 2 at the subsequent dose. If these retreatment criteria are met, the second SQZ PBMC HPV administration will be administered during a ≥23-hour observation period (i.e., 16-24 hours after the first dose). Patients will be observed for at least 4 hours after the second priming dose. The minimum interval between the two doses is 16 hours. In each cohort, the first two patients must complete day 14 of cycle 1 before additional patients in the cohort may be treated.

[0341] Patients will be monitored for the occurrence of DLTs for 42 days after their first dose of SQZ PBMC-HPV in the combination therapy cohort.

[0342] If there is a DLT or other significant toxicity in an individual patient, a taper to a lower SQZ PBMC-HPV dose will occur. After review of available safety, efficacy, and pharmacodynamic data from patients in the individual combination safety cohort, it may be determined that double priming is not recommended for one or more dose combinations. In this case, withdrawal of the second (day 2 of cycle 1) dose of SQZ-PBMC-HPV may be recommended. Alternatively, lower dose levels of SQZ-PBMC-HPV may be explored (dose taper). For example, if DLT is observed in more than 33% of patients in the individual combination safety cohort, a cohort evaluating lower SQZ-PTMC-HPV levels will be opened and explored. Part 3: Monotherapy dose expansion

[0343] Once the RP2D regimen is defined for SQZ PBMC HPV monotherapy, a monotherapy dose expansion phase will begin. Patients will be enrolled in disease-specific cohorts to further evaluate safety and tolerability, as well as preliminary evidence of antitumor response. SQZ PBMC HPV will be administered at the RP2D for monotherapy. Enrollment into part 3 can occur in parallel with part 2. Cohort 8: locally advanced or metastatic HPV16+ head and neck cancer. Cohort 9: locally advanced or metastatic HPV16+ cervical cancer. Cohort 10: locally advanced or metastatic HPV16+ anal cancer. Cohort 11: other locally advanced or metastatic HPV16+ cancers.

[0344] Cohorts 8, 9, 10, and 11 will be enrolled in parallel. Each of the four dose expansion cohorts will be enrolled using an optimal Simon two-stage design. In the first stage, up to 10 patients will be enrolled. If at least one response is observed in these 10 HIV-negative patients, an additional 19 patients will be enrolled, for a total of 29.

[0345] Dosing schedule and study duration All patients will undergo a single leukapheresis prior to initiating treatment. Patients will undergo leukapheresis at the study site, typically 8-14 days prior to the first dose of SQZ PBMC HPV. Scheduling of the first dose of SQZ PBMC HPV will take into account site location and shipping logistics.

[0346] A cycle is defined as a 21-day treatment period.

[0347] Patients will receive SQZ PBMC HPV every 3 weeks for up to 1 year until study drug is exhausted or a treatment discontinuation criterion is met, whichever occurs first.

[0348] Accumulating clinical evidence indicates that some subjects treated with immune system stimulants may reveal signs of disease progression (by traditional response criteria) before demonstrating clinical objective responses and / or stable disease. Two hypotheses have been proposed to explain this phenomenon. First, enhanced inflammation within the tumor may result in an increase in tumor size manifested as enlarged index lesions and as newly visible small non-index lesions. Over time, both the malignant and inflammatory parts of the tumor may decrease, leading to overt signs of clinical improvement (Wolchok et al., 2009). Alternatively, in some individuals, the kinetics of tumor growth may initially outweigh antitumor immune activity. Given sufficient time, antitumor activity may prevail and become clinically evident. It is therefore important to assess RECIST 1.1 and iRECIST in parallel at each time point.

[0349] Patients could continue on study treatment after initial RECIST 1.1-defined progression, thus allowing for confirmation of disease progression by iRECIST (Seymour et al., 2017) if the following criteria were met: 1. Investigator-assessed clinical benefit and lack of rapid disease progression 2. Investigator-defined resistance to the investigational drug 3. Stable general condition 4. Treating beyond progression does not delay urgent interventions to prevent serious outcomes from rapidly progressing disease. 5. Absence of complications of disease progression (e.g. CNS metastases)

[0350] Assessment of clinical benefit takes into account whether a subject is clinically worsening and unlikely to receive further benefit from continued treatment.

[0351] The duration of treatment in the monotherapy dose expansion phase (Part 3) will depend on the RP2D regimen selected.

[0352] SQZ PBMC-HPV will be administered at 3-week intervals until treatment discontinuation criteria are met, or the study drug is exhausted, or for up to 1 year, whichever occurs first. Treatment with immune checkpoint inhibitors in cohorts 4, 6, and 7 may continue for 2 years from day 1 of cycle 1. Patients in cohort 5 may complete 4 cycles of ipilimumab before exhausting the SQZ-PBMC-HPV supply, in which case patients may continue with SQZ PBMC-HPV monotherapy until treatment discontinuation criteria are met, or the study drug is exhausted, or for up to 1 year, whichever occurs first.

[0353] Dose-limiting toxicity Patients will be considered evaluable for DLT assessment if: 1) they experience a DLT during the DLT assessment period regardless of cell dose received, or 2) they do not experience a DLT during the DLT assessment period after receiving at least 70% of the intended dose of SQZ-PBMC-HPV during the DLT assessment period. Patients who do not experience a DLT but receive less than 70% of the intended SQZ-PBMC-HPV dose during the DLT assessment period will not be considered evaluable for DLT and will be replaced.

[0354] Patients experiencing DLTs that are not IRRs will be discontinued from the study. If continued treatment with the investigational drug is in the patient's best interest, subsequent treatment will be determined by the investigator in consultation with the sponsor. For IRRs, premedication or dosing rate will be adjusted to allow the patient to remain on the study.

[0355] DLTs are defined as AEs or laboratory abnormalities unrelated to disease, disease progression, intercurrent illness, concomitant medications / treatments, or environmental factors, but related to SQZ-PBMC-HPV (either alone or in combination), assessed by the principal investigator and confirmed by the SSC, occurring within either the first 28 days of monotherapy or the first 42 days of combination therapy, and meeting any of the predefined criteria listed below using the National Cancer Institute (NCI) Common Terminology Criteria for Adverse Events (CTCAE) version 5.0. CRS and neurotoxicity will be graded using the American Society for Transplantation and Cellular Therapy (ASTCT) consensus grading, referenced in sections 6.2.2 and 6.2.3, respectively. non-hematological toxicity Grade 4 or Grade 5 Grade 1 or less or grade 3 toxicity not improving to baseline within 7 days despite optimal supportive care. Excludes grade 3 CRS or neurotoxicity not improving to grade 2 or less within 24 hours. Grade 3 laboratory values ​​lasting more than 7 days and requiring medical intervention. Grade >3 hepatotoxicity lasting >48 hours, with the following exceptions: For patients with baseline grade 2 aspartate aminotransferase (AST), alanine aminotransferase (ALT), and / or alkaline phosphatase abnormalities, only increases to >8 × ULN lasting >48 hours are considered DLTs. Abnormal liver tests meeting Hy's law criteria. blood toxicity Any grade 5 toxicity. Any grade 4 anemia. Any grade 3 or greater febrile neutropenia. Grade 4 or greater neutropenia (absolute neutrophil count <500 / μL) lasting more than 7 days. Grade 4 or greater thrombocytopenia (<25,000 / μL). Grade 3 or greater thrombocytopenia (<50,000 / μL) lasting more than 7 days that is associated with clinically significant bleeding. Any TEAE possibly related to SQZ-PBMC-HPV (either alone or in combination) resulting in permanent discontinuation or delay of >14 days on at least day 1 of cycle 2 of scheduled SQZ PBMC HPV administration. Any other event that, in the judgment of the Investigator and Sponsor, is deemed to be a DLT.

[0356] The following events are not considered DLT: Amylase levels of ≥ grade 3 or isolated grade 3 lipase levels without clinical or radiographic evidence of pancreatitis. Grade 3 CRS that improves to grade 2 or less within 24 hours with or without symptomatic treatment. Grade 3 skin rash that improves to Grade 2 or less within 7 days with or without appropriate supportive care. Immediate hypersensitivity reactions occurring within 2 hours of administration of the cell product that are reversible in 24 hours to less than Grade 2. Grade 1 or grade 2 electrolyte abnormalities that are corrected within 72 hours without clinical sequelae. Alopecia.

[0357] Grade 3 IRRs that can be adequately managed with the addition of premedication or a change in infusion rate are not considered DLTs unless these changes are considered to apply to all subsequent patients enrolled in the study. If the changes apply to all subsequent patients, the cohort will reopen for DLT assessment. Patients who experience a grade 3 infusion reaction may remain on the study with a change in premedication or infusion rate.

[0358] If the MTD has not been reached in any cohort, additional cell dose levels or regimens will be tested. If an AE falls within the definition of a DLT but is unrelated to SQZ-PBMC-HPV, the finding will be reviewed by the SSC.

[0359] Discontinuation criteria for cohorts, discontinuation of dose escalation or progression into cohorts, and termination of the study

[0360] The modified 3+3 rule defines the final decision to declare a cohort safe. The minimum number of patients required to confirm a cohort as safe is 3 with 0 DLTs and can be increased up to 12 to confirm the cohort is safe (i.e., <33% patients with DLTs, e.g., <2 DLTs in 6 patients, <3 DLTs in 9 patients, or <4 DLTs in 12 patients, any of which confirms the safety of the cohort). If none of the cohorts demonstrate that the MTD has been reached, additional cell dose levels or regimens may be tested. If an AE is included in the definition of a DLT but is unrelated to SQZ-PBMC-HPV.

[0361] AEs that meet the definition of a DLT and occur outside the DLT period will not be counted as DLTs, but instead will be considered in the overall safety assessment of a given cohort and in the selection of the RP2D regimen.

[0362] The cohort stopping rule is the occurrence of >3 DLTs in up to 12 patients receiving investigational drug within the same dose cohort (approximately 33%). If a stopping rule is triggered, one of the following recommendations will be made: The previous tolerated dose level will be declared as the MTD. A dose level is declared as the MAD level without observing a DLT, therefore the RP2D is not the MTD. Studies at intermediate dose levels are recommended. We recommend modifications to the protocol to improve patient safety. Discontinue enrolment and / or the study.

[0363] Patient dosing may be discontinued for patient safety based on these general safety criteria. Any SAE that was potentially life-threatening and assessed by the medical monitor as related to the study drug. Any other clinically significant change that presents significant tolerability concerns to the Investigator or Sponsor.

[0364] Clinical trial population HLA-A with advanced HPV16+ solid tumors (head and neck, cervical cancer, and other tumor types) * 02+ patients. Additionally, HIV positive patients will be permitted to enroll in the combination safety phase. In the titration phase, enrollment of HIV positive patients should be discussed with the sponsor.

[0365] Patients may have previously received treatment with a PD-1, PD-L1, or CTLA-4 inhibitor (including ipilimumab, or any other antibody or agent that specifically targets T cell costimulatory or checkpoint pathways). Number of patients

[0366] The number of patients will depend on safety and observed immunogenic effects. It is expected that approximately 9-36 DLT-evaluable patients may be enrolled in the monotherapy titration phase. If none of the planned cohorts demonstrate that the MTD has been reached, additional cell dose levels or regimens may be tested. A total of up to 48 evaluable patients will be enrolled in the combination safety phase (n=12 per cohort). If all cohorts are opened and the second stage of each cohort is opened per predefined success criteria, a total of up to 116 patients will be enrolled in the expansion phase (max n=29 per cohort). Depending on the need to replace patients within the cohorts, it is expected that approximately 173-200 evaluable patients will be treated in the study. If none of the planned cohorts demonstrate that the MTD has been reached, additional cell dose levels or regimens may be tested. Study Inclusion Criteria 1. HLA-A confirmed by genotypic assay from blood * 02+, male or female patient aged 18 years or older. 2. Histologically confirmed, incurable or metastatic solid tumors that are HPV16+ (including but not limited to cervical and head and neck tumors). 3. For cervical cancer not amenable to curative treatment with surgery, radiation, and / or chemoradiotherapy, the cancer must have progressed after prior treatment with systemic chemotherapy with a platinum-based regimen in the adjuvant or recurrent setting. Patients must have progressive disease during or after completion of their most recent prior treatment. For patients who are intolerant to or refuse platinum-based systemic chemotherapy treatment for recurrent disease, the reasons must be documented. 4. For recurrent and metastatic head and neck cancer not amenable to curative treatment with surgery, radiation, and / or chemoradiotherapy, the cancer must have progressed after at least one prior platinum-based chemotherapy in the primary, adjuvant, or recurrent setting and checkpoint immunotherapy must have been offered. Patients who relapse after definitive platinum-containing chemoradiotherapy or adjuvant chemoradiotherapy are eligible if platinum rechallenge at the time of relapse is not considered beneficial. For patients who are intolerant to or refuse platinum-based systemic chemotherapy treatment for recurrent disease, the reasons must be documented. 5. Patients with incurable or metastatic HPV16+ cancer other than cervical or head and neck cancer must have progressed after at least one available standard therapy for incurable disease OR the patient is intolerant to or has refused standard therapy OR the patient has a tumor for which no standard therapy exists. Titration Phase (Part 1) and Combination Safety Phase (Part 2) a. Enrollment of HIV+ patients should be discussed with the sponsor. Diastole (Part 3) b.HIV+ patients should be discussed with the sponsor to not exceed 1 in 6 patients per cohort or multiples. HIV+ patients must have had at least one prior systemic cancer treatment or be ineligible for standard of care. HIV+ patients must meet the following criteria to be eligible: CD4+ T-cell count >350 cells / mL and no history of AIDS-defining opportunistic infections within the past 12 months Enrollment of patients receiving prophylactic antibiotics should be discussed with the sponsor. 6. Eastern Cooperative Oncology Group (ECOG) performance status (PS) is 0-1. 7. Patients must consent to venous access for leukapheresis and, if venous access is an issue, request insertion of a central line. 8. Patients with unresectable or metastatic solid tumors must have biopsy-amenable disease at acceptable clinical risk and agree to undergo fresh biopsy at screening and on day 8 (± 2 days) of cycle 2. a. Lesions in previously irradiated areas may be biopsied so long as there is objective evidence of disease progression prior to study enrollment. 9. At least one measurable lesion by RECIST 1.1. a. Lesions in previously irradiated areas are eligible to be considered measurable if there is objective evidence of lesion progression prior to study enrollment. 10. Adequate organ function and bone marrow reserve as demonstrated by the following laboratory evaluations performed within 14 days prior to leukapheresis: Bone marrow function: absolute neutrophil count ≥ 1000 / μL, hemoglobin ≤ 9 g / dL, platelet count ≥ 75,000 / μL. Note: Transfusions may be available to meet inclusion criteria in stable patients with hemoglobin levels < 9 g / dL. b. Liver function: serum total bilirubin ≤ 1.5 × ULN, serum AST / ALT, ≤ 2.5 × ULN (≤ 5 × ULN in the presence of liver metastases), alkaline phosphatase < 2.5 × ULN, with the following exceptions: patients with liver and bone involvement: alkaline phosphatase ≤ 5 × ULN. i. Patients with inherited disorders of bilirubin metabolism should be discussed with the sponsor. c. Renal function: serum creatinine ≤ 2.5 x ULN or creatinine clearance ≥ 30 mL / min based on either urine collection or Cockcroft-Gault estimate. d. Coagulation Profile: Prothrombin Time (PT), International Normalized Ratio (INR) / Partial Thromboplastin Time (PTT) ≤ 1.5 x ULN. Patients on a stable, maintenance regimen of anticoagulation therapy for at least 30 days prior to leukapheresis may have PT / INR measurements > 1.5 x ULN if the investigator determines the patient is suitable for the study. Appropriate justification must be provided to the sponsor prior to enrollment. 11. Patients with immune-mediated endocrinopathy following treatment with immune checkpoint inhibitors requiring hormone replacement therapy are eligible. a. Patients who require prednisone as part of their hormone replacement therapy are eligible if the daily dose does not exceed 10 mg. 12. Female patients of childbearing potential must: a. Have a negative serum beta-human chorionic gonadotropin (β-hCG) pregnancy test at screening; b. Agree to use dual contraception from the time of informed consent until at least 5 months after the last dose of immune checkpoint inhibitor or SQZ PBMC-HPV. 13. Non-vasectomized male patients must be willing to use condoms from the time of informed consent until at least 5 months after the last dose of immune checkpoint inhibitor or SQZ PBMC HPV. 14. Patients understand and are able to comply with the protocol and have signed the required Informed Consent Forms (ICFs). The appropriate ICFs must be signed before any relevant study procedures are performed. If applicable, the female partner of a male patient will understand and sign the Pregnancy Partner ICF. Exclusion criteria 1. Treatment with anticancer therapy, including investigational therapy, within 2 weeks prior to leukapheresis. For prior therapies with half-lives >3 days, the timing of discontinuation of treatment should be discussed with the sponsor. 2. Patients with Grade ≥ 1 AEs (excluding Grade 2 alopecia) according to NCI CTCAE version 5.0 related to prior treatment with anticancer or investigational therapy that have not improved (i.e., Grade ≥ 1) for at least 2 weeks prior to leukapheresis. 3. History of any grade 4 irAE from previous immunotherapy (patients with endocrinopathy managed with replacement therapy or asymptomatic elevation of serum amylase or lipase are eligible), any irAE that led to permanent discontinuation of previous immunotherapy, or any grade 3 irAE occurring within 6 months prior to leukapheresis. 4. Patients who have been treated with non-corticosteroid immunosuppressants within the past 6 months may not be eligible and should be discussed with the sponsor. 5. Patients with active, known, or suspected autoimmune disease may not be eligible and should be discussed with the sponsor. 6. Patients with a history of allogeneic bone marrow or solid organ transplant may not be eligible and should be discussed with the sponsor. 7. Live virus vaccination within 4 weeks prior to leukapheresis. 8. Systemic treatment with either corticosteroids (prednisone >10 mg per day or equivalent) or other immunosuppressants within 14 days prior to leukapheresis. Inhaled, intranasal, intra-articular, and topical (including ophthalmic) steroids are permitted. The use of steroid replacement for patients with adrenal insufficiency is permitted. The use of fludrocortisone for electrolyte-corticoid replacement in patients with adrenal insufficiency is permitted. 9. Known active central nervous system metastases and / or carcinomatous meningitis. Patients with previously treated brain metastases may participate if they are stable (no evidence of progression by imaging for at least 4 weeks prior to the first dose of study drug and any neurological symptoms have returned to baseline), have no evidence of new or enlarging brain metastases, and have been off steroids for at least 7 days prior to leukapheresis. This exception does not include carcinomatous meningitis, which is excluded regardless of clinical status. 10. History of steroid-requiring interstitial lung disease, idiopathic pulmonary fibrosis, pneumonia (including drug-induced), or organizing pneumonia (e.g., bronchiolitis obliterans, cryptogenic organizing pneumonia). a. Patients with asymptomatic pneumonia who do not require steroid therapy for their pneumonia are eligible. 11. Clinically significant cardiac disease, including unstable angina, acute myocardial infarction, New York Heart Association class III or IV congestive heart failure within 6 months prior to leukapheresis, and arrhythmias requiring treatment. 12. Systemic arterial thrombotic or embolic events, such as cerebrovascular accidents (including ischemic stroke), within 1 month prior to leukapheresis. 13. Systemic venous thrombotic event (e.g., deep vein thrombosis) or pulmonary artery event (e.g., pulmonary embolism) within 1 month prior to leukapheresis. a. Patients with a venous thrombotic event prior to leukapheresis on stable anticoagulation therapy are eligible. 14. History or presence of any clinically significant electrocardiogram abnormality (ECG) in the investigator's opinion. 15. Left ventricular ejection fraction (LVEF) <50%. 16. Major surgery within 2 weeks of leukapheresis. After major surgery more than 2 weeks prior to leukapheresis, all surgical wounds must be healed and free of infection or dehiscence. 17. Any other clinically significant comorbidity, such as active infection, known psychiatric or neurological disorder, or other condition that, in the investigator's judgment, may interfere with compliance with the protocol, interfere with interpretation of the study results, or pose a safety risk to the patient. 18. Known active hepatitis B or C, or active Mycobacterium tuberculosis infection. 19. Patient has a history of alcohol and / or illicit drug abuse within 12 months prior to enrollment. 20. Female patients who are breastfeeding or have a positive serum pregnancy test at the screening visit or enrollment. 21. Patients with a history of allergy or hypersensitivity to any component of SQZ PBMC HPV. 22. History of severe allergic anaphylactic reaction to chimeric, human, or humanized antibodies, or infused proteins (combination cohort only). 23. Known hypersensitivity to atezolizumab, ipilimumab, nivolumab, Chinese hamster ovary cell products, or any components of atezolizumab, ipilimumab, or nivolumab drug products (combination cohorts only).

[0367] Leukapheresis The goal of leukapheresis is to administer approximately 10–14 × 10 9 The goal of the procedure is to provide a WBC yield of 100 cells. Efforts are made to adjust the procedure if a low yield is expected, for example by processing blood volumes up to 15 liters. According to local procedures, and if possible, WBC or complete blood counts are measured during leukopheresis so that the processed blood volume can be increased. If WBC or complete blood counts cannot be measured during leukopheresis, a sample is taken at the end of leukopheresis and, if possible, the WBC count in the leukopak is determined. Results are processed as soon as possible and provided to the sponsor in real time.

[0368] Tumor Response Assessment and Schedule Tumor assessments will be performed at screening (baseline) and tumor response will be assessed by investigators every 9 weeks (± 7 days) for 1 year after the first dose of SQZ PBMC HPV, and then every 12 weeks (± 7 days) until confirmed disease progression by RECIST and iRECIST, unacceptable toxicity, withdrawal of consent, death, or 2 years from the date of first dose of SQZ PBMC HPV, whichever occurs first.

[0369] Disease will be assessed via radiography. Patients who experience disease progression by RECIST 1.1 may continue treatment to allow for confirmation of disease progression if considered in the best interest of the treating investigator, i.e., iCPD by iRECIST (Seymour et al., 2017).

[0370] If a patient discontinues study drug for reasons other than progression, the patient should continue to be imaged according to the schedule outlined above. Radiological assessments should be obtained and recorded on the CRF.

[0371] At screening and all time points thereafter, cervical, anal / rectal, vulva / vagina, and penile cancers require computed tomography (CT) of the torso (chest, abdomen, and pelvis) and all known sites of disease, and oropharyngeal cancers require CT of the head, neck, and chest and other areas of known involvement. If, for a valid reason, a CT scan is not available or adequate tumor evaluation cannot be performed by CT, magnetic resonance imaging (MRI) is permitted and must be communicated to the sponsor at screening. The same radiographic procedures used to evaluate sites of disease at screening will be used throughout the study. For all other advanced solid tumor types, the investigator will image all known sites of disease using the imaging modality the investigator believes is best for that tumor type.

[0372] Brain magnetic resonance imaging is required at screening in all patients with a history of brain metastases, and may be repeated at subsequent time points in any patient with a history of brain metastases and / or who develops symptoms suggestive of brain metastases. If a patient cannot tolerate or has a contraindication to MRI, a CT scan can be used.

[0373] The same assessor will perform the assessments to ensure internal consistency between visits. At the investigator's discretion, CT scans should be repeated whenever PD is suspected. For patients who achieve a partial response (PR) or complete response (CR), tumor assessment should be repeated in 4 weeks to confirm response.

[0374] Pharmacodynamic evaluation including immunogenicity measurements Sample Collection Schedule Tumor biopsy Prior to leukapheresis, patients will undergo a screening tumor biopsy (primary tumor or metastasis), which may be from an actively growing site of a previously irradiated tumor. All patients will be required to have a repeat tumor biopsy of the same primary tumor or metastasis on day 8 (± 2 days) of cycle 2. If possible, an additional repeat tumor biopsy (pre-dose) will be obtained on day 1 (+ 2 days) of cycle 5. This sample is optional. Alternative tumor biopsy time points during treatment may be considered if preliminary data suggest that a change in tumor biopsy time point during treatment would be more appropriate.

[0375] Fresh tumor biopsies taken at screening should be taken from the primary tumor or a metastatic site, and subsequent biopsies should be taken from the same primary tumor or metastasis biopsyed at screening.

[0376] Pharmacodynamic evaluation Whenever possible, baseline samples will be used for longitudinal evaluation of cellular correlates tests, including but not limited to immunophenotyping by flow cytometry including tetramer staining, evaluation of T cell production of cytokines after co-culture with HPV peptides (IFNγ- and granzyme B enzyme-linked immunospot [ELISPOT]), and circulating cell-free HPV16 DNA (cfHPV DNA). Baseline tumor biopsies and selected blood samples will be used for comparison with post-treatment samples only (Table 2). [Table 2] Abbreviations: DNA = deoxynucleic acid, HPV16 = human papillomavirus strain 16, IFNγ = interferon gamma

[0377] Information regarding endogenous immune responses detected via ELISPOT informs immunohistochemical analysis of tumor biopsies.

[0378] Cytokine evaluation From all patients, blood samples for cytokines are collected. Patients with grade 2, 3, or 4 CRS will have additional cytokine plasma levels performed during the grade 2, 3, or 4 CRS event. Blood draws are performed at the time of diagnosis of CRS, when severity increases (e.g., when grade 2 CRS progresses to grade 3 CRS), at the onset of neurological symptoms, and at the time of discharge or recovery.

[0379] Evaluation of a cytokine panel includes, but is not limited to, IFN gamma (IFN gamma) and IL6. CRS can have a delayed onset, but rarely manifests more than 14 days after initiation of treatment. Patients with symptoms consistent with CRS that appear outside of this window are carefully evaluated for other causes.

[0380] Cytokines will be monitored for pharmacodynamic evaluation. Baseline and post-treatment serum samples will be collected to assess anti-tumor immune responses by measuring cytokines that may provide information about drug inflammatory responses.

[0381] Safety assessment Safety will be assessed in the study through observation of all SAEs and nonserious AEs and laboratory abnormalities defined and graded according to NCI CTCAE version 5.0. General safety assessments will include physical examination and specific laboratory evaluations including blood chemistries, coagulation, and blood counts with differentials. SAEs and grade ≥2 AESIs will be reported on an expedited basis for entry into the safety database.

[0382] During study conduct, the aggregate observed safety events (including CRS events that improve to grade 2) will be reviewed and a determination will be made as to whether a given event requires initiation of rolling enrollment of patients after this event. Rolling enrollment in potential additional monotherapy cohorts (part 1) or combination safety cohorts (part 2) will require all subsequent newly enrolled patients in the cohort to be staggered by 1 week. Semi-sequential enrollment of patients may continue in some cohorts, if applicable. Patients will undergo cytokine release assays during the study. Patients with grade 2, 3, or 4 CRS will have additional blood samples taken for safety laboratory and cytokine panel evaluation.

[0383] Exposure to immune checkpoint inhibitors may increase the risk of irAEs, especially autoimmune conditions, so that irAEs are recognized early and promptly treated to avoid potentially serious complications.

[0384] All patients will return to the clinic for a safety follow-up visit within 15-45 days after the last study drug dose. All AEs and SAEs will be recorded until 6 weeks after the last dose of study drug (EOD6W), or 45 days after dropout, or until initiation of another anticancer therapy, whichever occurs first. Only ongoing SAEs determined by the investigator to be possibly, probably, or definitely related to SQZ-PBMC-HPV monotherapy or combination therapy will be tracked.

[0385] Physical examination, height and weight The physical examination will include height (screening only), weight, evaluation of general appearance, as well as evaluation of systems indicated as follows: skin, head, eyes, ears, nose, mouth / throat / neck, thyroid, lymph nodes, respiratory, cardiovascular, gastrointestinal, extremities, musculoskeletal, neurological, and gynecological and genitourinary systems. Capturing weight during the patient's physical examination within 24 hours of leukapheresis is particularly important as patient doses are determined by weight.

[0386] General condition The Eastern Cooperative Oncology Group scales and criteria are used to evaluate the patient's performance status, assess how the disease affects the patient's ability to live daily life, and determine appropriate treatment and prognosis.

[0387] Vital signs Vital signs are collected and include systolic and diastolic blood pressure, heart rate, temperature, and respiratory rate with the patient in a sitting position.

[0388] 12-lead electrocardiogram A 12-lead ECG is performed by qualified facility staff using an ECG device that determines heart rate, PR interval, QRS interval, RR interval, QT interval, and QTc interval, which are collected by QTcB (QTc corrected by Bazett's formula) and QTcF (QTc corrected by Fridericia's formula). During ECG collection, patients are at rest in a quiet environment free of distractions (television, cell phones, etc.) for at least 10 minutes prior to ECG collection.

[0389] All ECGs must be evaluated by a qualified physician for abnormalities.

[0390] Echocardiogram An echocardiogram or multiple gated acquisition (MUGA) scan will be performed at screening to measure LVEF and if clinically indicated.

[0391] Clinical Laboratory Evaluation Samples for clinical laboratory evaluation are collected. The clinical tests outlined in Table 3 will be performed by the facility. Samples for the clinical tests outlined in Table 3 will be collected in appropriate tubes and handled according to the facility's standard procedures.

[0392] Clinical laboratory variables are listed in Table 3. [Table 3] a. The results of these laboratory tests must be obtained prior to leukapheresis or on the day of leukapheresis, with the results available prior to leukapheresis. b. Coagulation parameter results are required the same day or the day after any tumor biopsy. c. Collected at baseline and in CRS cases. Abbreviations: CRS = cytokine release syndrome, T3 = triiodothyronine, T4 = thyroxine, TSH = thyroid-stimulating hormone.

[0393] Adverse events definition Adverse events An AE is any undesirable medical occurrence in a patient that is not necessarily causally related to the investigational drug administered. Thus, an AE can be any undesirable or unintended sign (including abnormal laboratory findings), symptom, or disease that is temporally related to the use of an investigational drug, whether or not it is related to the investigational drug. An adverse event can be a new event, or an existing condition that has increased or worsened in severity or frequency.

[0394] An adverse event can be a clinically significant change from baseline in a physical exam, clinical laboratory test, or other diagnostic investigation.

[0395] In this study, an AE is considered treatment-emergent if its onset is between the administration of study drug and 6 weeks after the last dose of study drug. Serious Adverse Events

[0396] An SAE is any AE that results in any of the following: death. Immediately life threatening. Requires hospitalization or extension of existing hospitalization. Causes persistent or significant impairment or incapacity. Birth abnormalities or birth defects result. A significant medical event that may endanger the patient or require medical intervention to prevent one of the outcomes listed above.

[0397] After the patient signs the ICF, all SAEs occurring before, during, or within 30 days after discontinuing treatment must be recorded on the appropriate clinical procedure form, regardless of whether they are study-related or not. Adverse events of particular interest

[0398] AESIs are AEs (serious or nonserious) of scientific and medical concern specific to an investigational drug that require ongoing observation and immediate notification by the investigator to the sponsor. Characterization and understanding of such AEs may require further investigation. Adverse events of particular interest may be added or removed during the study by protocol amendment.

[0399] The following AEs are considered AESIs: Hypersensitivity, cytokine release, systemic inflammatory response syndrome, events suggestive of systemic inflammatory activation. Influenza-like illness. Infusion reaction syndrome. Immunotherapy-associated irAEs, such as myocarditis, neurological irAEs, hypertransaminasemia of immune-related etiology, and nephritis.

[0400] In addition, the following events will be reported to Sponsor: Suspected overdose of SQZ-PBMC-HPV. Liver test abnormalities fulfilling Hy's Law criteria, i.e., laboratory values ​​of AST or ALT of ≥3×ULN and total bilirubin of ≥2×ULN, and concomitant laboratory values ​​of alkaline phosphatase of <2×ULN, as determined by protocol-specified or unscheduled laboratory tests. Rating severity

[0401] NCI CTCAE version 5.0 is used to assess and grade the severity of AEs and laboratory abnormalities. ASTCT consensus grading is used for CRS and ICANS. Each AE term is mapped to a term and code in the latest version of the International Medical Dictionary for Clinical Trials (MedDRA).

[0402] If an event is not covered in CTCAE Version 5.0, severity should be assessed using the guidelines provided in Table 4. [Table 4] Source: (NIAID, 2003) Abbreviations: CTCAE = Common Terminology Criteria for Adverse Events

[0403] Causal assessment The relationship to the study drug will be assessed by the investigator. Therefore, the AE and SAE reporting forms include the option to attribute causality to SQZ-PBMC-HPV, atezolizumab, ipilimumab, nivolumab, or a combination thereof. For patients receiving combination therapy with SQZ-PBMC-HPV and an immune checkpoint inhibitor, causality will be assessed separately for each protocol-specified therapy. Reasonable suspicion of causality will be attributed to the immune checkpoint inhibitor alone if the event is consistent with immune checkpoint inhibitor labeling.

[0404] The relationship between AEs and study drug (i.e., SQZ-PBMC-HPV, atezolizumab, ipilimumab, nivolumab, or a combination thereof) will be documented as follows: Unequivocal: The AE is clearly related to the study drug. Presumed: The AE is possibly related to the investigational drug. Likely: The AE is possibly related to the investigational drug. Unlikely: The AE is unlikely to be related to the study drug. Unrelated: The AE is clearly not related to the study drug.

[0405] A medically qualified investigator will determine for each AE whether it is reasonably likely that the event was caused by the investigational drug. If there is no good reason to suggest a relationship, the AE will be classified as "unrelated." If there is good reason to suspect a possible causal relationship between the investigational drug and the occurrence of the AE, even if this is not determined, the AE will be considered "related."

[0406] If the relationship between the AE / SAE and the investigational drug is determined to be "definite," "possible," or "presumed," the event will be considered related to the investigational drug for purposes of expedited regulatory reporting. Expectedness

[0407] AEs not listed in the applicable product information (e.g., IB for SQZ-PBMC-HPV, or approved labeling for atezolizumab, ipilimumab, or nivolumab) or whose specificity or severity is inconsistent with those listed will be considered unexpected.

[0408] Efficacy Analysis definition Progression-free survival (PFS) is defined as the time from day 1 of cycle 1 to the first documentation of objective tumor progression (PD, radiological) by RECIST 1.1 or death from any cause. Progression-free survival data will be censored on the date of the last tumor assessment documenting the absence of PD for patients who do not have objective tumor progression and are still on study at the time of analysis, who receive antitumor treatment other than the investigational drug, or who are removed from treatment follow-up prior to documentation of objective tumor progression. Patients who have not had a tumor assessment since enrollment and are not known to have died will have PFS censored on day 1 of cycle 1. To accommodate different practice methods among participating centers, PFS will be assessed by both RECIST 1.1 and iRECIST criteria.

[0409] Overall survival (OS) is defined as the time from cycle 1 day 1 to the date of death from any cause. In the absence of confirmed death, survival time is censor'd to the last day the patient was known to be alive. For patients with missing data beyond cycle 1 day 1, survival time is censor'd to cycle 1 day 1.

[0410] Objective response rate (ORR) is defined as the proportion of patients with CR or PR by RECIST 1.1. Objective response rates are provided as unconfirmed and confirmed ORR. A confirmed response is a response that persists on repeat imaging studies at least 28 days after the initial documentation of the response. Similarly, iORR by iRECIST is also summarized and reported.

[0411] Duration of response (DoR) is defined as the time from the first documented PR or CR to the first documented objective tumor progression or death from any cause. Duration of response data is censored on the date of the last tumor assessment documenting the absence of PD for patients who do not have tumor progression and are still on study at the time of analysis, patients who receive antitumor treatment other than the investigational drug, or patients who are removed from study follow-up before the documentation of objective tumor progression is censored at the last tumor assessment. Similarly, iDoR by iRECIST is also summarized and reported.

[0412] Best overall response (BOR) is determined after all tumor assessments from cycle 1 day 1 to disease progression or death have been recorded. Generally, this is the best response across all assessments. However, confirmation of CR, PR, and stable disease (SD) are also used for BOR determination. To confirm CR or PR, changes in tumor measurements must be confirmed by repeat assessment, which should be 4 weeks (28 days) or more after the response criteria are first met. To confirm SD, at least 12 weeks must have elapsed from cycle 1 day 1, otherwise BOR depends on subsequent assessments. Best overall response is summarized as time to event variables or percentage to best response, using enrollment as the anchor date. Similarly, iBOR by iRECIST is also summarized and reported.

[0413] Disease control rate (DCR) is the proportion of patients with BOR determined as CR, PR, or SD by RECIST 1.1 at a defined time point. All patients in the safety population with measurable disease at baseline and eligible for tumor assessment at 3, 6, and 12 months are considered in the denominator of the DCR rate. Similarly, iNCR by iRECIST is also summarized and reported.

[0414] Stable disease 12 weeks is the proportion of patients whose BOR is determined as CR, PR, or SD by RECIST 1.1 and maintained for at least 12 weeks. All patients in the safety population with measurable disease at baseline and eligible for tumor assessment at 3, 6, and 12 months are considered in the denominator of the percentage. Similarly, SD by iRECIST 12 weeks will also be summarized and reported. analysis

[0415] Efficacy analyses will be performed on the safety population. Antitumor activity (ORR, PFS, OS) will also be described for patients with documented HLA class I expression. If the per-protocol population differs from the safety population, efficacy analyses will also be performed using the PP population.

[0416] Kaplan-Meier methods will be used to estimate median PFS and two-sided 95% confidence intervals. Patients who die, regardless of cause, will be considered to have had an event unless they received subsequent anticancer therapy before death. If they receive subsequent treatment, the patient will be censored at the date of their last evaluable tumor assessment before subsequent treatment. Patients who withdraw consent to the study will be considered to have been censored at the time of their last evaluable tumor assessment before withdrawing consent. Patients who are still alive at the clinical data cut-off date will be censored at their most recent evaluable tumor assessment. All patients lost to follow-up before the clinical data cut-off date will also be considered to have been censored at the time of their last evaluable tumor assessment before they were lost to follow-up.

[0417] Duration of response, time to best overall response, and overall survival will use the same methods as PFS. In addition, iPFS using iRECIST, iBOR, iNCR, and time to iBOR will be analyzed and reported using similar methods.

[0418] Objective response rates (ORR) are presented as percentages with 95% confidence intervals based on exact binomial distribution. Point estimates of ORR and two-sided 95% confidence intervals are provided. DCR and SD lasting at least 12 weeks are reported as point estimates. Safety analysis

[0419] All safety parameters will be analyzed using the safety population, including: AEs, clinical laboratory assessments, vital signs, ECOG, exposure, ECG, ECHO / MUGA and physical examination.

[0420] The primary safety endpoint will be the number of patients with any AE and observed toxicity to SQZ-PBMC-HPV administration, with severity assessed using NCI CTCAE version 5.0. All AEs occurring after the first dose of SQZ-PBMC-HPV will be included in the analysis. Adverse events will be collected from the signing of the informed consent, but the analysis will focus on treatment-emergent AEs.

[0421] AEs will be analyzed using descriptive statistics. For patients with multiple occurrences of a given AE, the highest severity will be used. Adverse events

[0422] AEs will be coded using the current version of the MedDRA coding dictionary.

[0423] An AE is treatment-emergent if it occurs between Day 1 of Cycle 1 and 6 weeks after the last dose of study drug. For AEs with partial onset times, the non-missing date is used to determine if the AE was treatment-emergent. If it cannot be determined when the AE occurred relative to the administration of study drug, the AE is classified as treatment-emergent. Treatment-emergent AEs also include any AE that was present before the first dose of study drug and worsened in toxicity after administration.

[0424] The analysis described in this section is based on TEAEs, which for brevity are referred to in this section simply as AEs.

[0425] Adverse events considered by the investigator to be possibly, probably, or definitely related to the study drug will be classified as related for summary purposes.

[0426] The numbers and percentages of patients with any AE, any related AE, any SAE, any related SAE, any grade ≥ 3 AE, any grade ≥ 3 AE, and the total number of events for each category will be summarized. The number of deaths due to AE, hospitalizations due to AE, and treatment discontinuations due to AE, as well as the number of DLTs and AESIs will be summarized.

[0427] The numbers and percentages of patients with AEs and the total number of AEs will be summarized by organ system class and preferred term. This summarization will be repeated for related AEs, AESIs, SAEs, related SAEs, and grade ≥ 3 AEs, and related grade ≥ 3 AEs.

[0428] All AEs, including non-TEAEs, are documented in a patient list. Patient lists will be generated for AEs leading to discontinuation of study drug, AEs leading to death, SAEs, related AEs, AESIs, DLTs, and severe AEs.

[0429] Clinical Laboratory Evaluation Baseline is defined as the last nonmissing value before first exposure to study drug. This is usually pre-dose cycle day 1, but may be earlier. Actual values ​​and changes from baseline laboratory tests will be summarized at each study visit.

[0430] Laboratory test results will be classified according to NCI CTCAE version 5.0 and investigator determined. If more than one laboratory test result is reported per study visit per parameter, the result resulting in the most severe classification will be selected for analysis. Shift tables will be created to show the maximum change from baseline in graded laboratory parameters.

[0431] All clinical laboratory evaluations are listed.

[0432] Patients with clinically significant abnormal laboratory results are listed. This list includes all results of laboratory parameters that the investigator determined to be abnormal and clinically significant for the patient during the study visit.

[0433] Vital signs Baseline is defined as the last nonmissing value before first exposure to study drug. Actual values ​​and changes from baseline of vital signs will be summarized at study visits and time points. All vital sign data will be presented in the patient listing.

[0434] Vital sign values ​​will be classified according to clinical significance as determined by the investigator. The number of patients with non-missing results, the number and percentage of patients with non-clinically significant results, and clinically significant results will be summarized by study visit and study time point. If more than one vital sign result is reported per study visit and study time point per parameter, the result resulting in the most severe classification will be selected for analysis.

[0435] Patients with clinically significant vital sign values ​​are listed. This list includes all results of vital sign parameters that the investigator determined to be clinically significant for the patient across study time points.

[0436] Physical Examination Abnormal physical examination findings are listed. 12 lead ECG

[0437] ECG results are presented in a shift table (normal, clinically non-significant abnormal, abnormal, clinically significant or greater) showing the maximum change from baseline. All ECG results are displayed in the patient list.

[0438] Other Safety Variables 29T2All safety data are listed.

[0439] ECOG PS and change from baseline in ECOG PS will be summarized at each scheduled visit at which it is collected. Change from baseline in ECOG PS will be summarized as a continuous and categorical variable. A decrease of 1 or more points from baseline will be classified as "improvement" from baseline. An increase of 1 or more points from baseline will be classified as "worsening" from baseline. Improvement, worsening, and unchanged ECOG PS from baseline will be summarized as a categorical variable by treatment at each post-enrollment time point at which ECOG PS is assessed.

[0440] Pharmacodynamic analysis Biomarkers will be summarized for each time point, change from baseline and % change from baseline. Correlations between pharmacodynamic markers and SQZ-PBMC-HPV will be explored in a descriptive and graphical manner.

[0441] Descriptive statistics (mean, standard deviation, median, minimum, maximum, and geometric mean) for each marker will be reported. Graphs of individual values ​​over time by dose group will be presented.

[0442] Example 2 Analysis of Cohorts 1-3 Cell Squeeze® technology has demonstrated a robust ability to deliver antigens directly into the cytosol, thereby circumventing the cross-presentation process on which most vaccines rely, allowing efficient MHC-I presentation and antigen-specific CD8 T cell activation. Preclinical data demonstrate superior CD8 T cell activation and antitumor efficacy in vitro and in vivo.

[0443] FIG. 6 shows the predicted mechanism of action of the SQZ-PBMC-HPV-101 clinical trial generated by Cell Squeeze® technology, where the SQZ-PBMC-HPV vaccine directly stimulates CD8 T cell responses: 1. Peripheral blood mononuclear cells (PBMCs) are obtained from patients by leukapheresis and mixed with HPV16 E6 and E7 synthetic long peptides (SLPs). 2. Cell Squeeze® technology uses rapid mechanical deformation of PBMCs to transiently disrupt the membrane and deliver E6 and E7 antigen cargo directly into the cytoplasm 3. The resulting antigen-presenting cells (APCs) are matured with CpG7909 4. SQZ-PBMC-HPV are not genetically modified by this process and can be cryopreserved for storage and shipment to patients 5. Preclinical data demonstrates that murine SQZ™ APCs home to lymphoid organs to drive antigen-specific CD8 T cell activation 6. In preclinical models, activated T cells based at the tumor site induce tumor cell death and form memory that provides long-term protection. SQZ-PBMC-HPV demonstrated dramatic improvements in vaccine efficacy when evaluated against other technologies in preclinical models.

[0444] As shown in Figure 7, the primary study objectives of the SQZ-PBMC-HPV-101 clinical trial include safety with a 28-day DLT period for monotherapy and safety with a 42-day DLT period for combination with a checkpoint inhibitor (CPI). Secondary study objectives include safety and tolerability, efficacy (such as ORR by RECIST 1.1), and pharmacodynamic markers.

[0445] method SQZ-PBMC-HPV-101 is enrolling patients with incurable HPV16+ cancer progressing after unlimited prior therapy (Figure 7).

[0446] Eligible patients must have ECOG 0-1, adequate organ function, and biopsy-amenable disease with acceptable clinical risk.

[0447] Patients underwent a single leukapheresis at the study site and the SQZ-PBMC-HPV batch was manufactured at Lonza, Postsmouth, NH. The SQZ-PBMC-HPV was not genetically modified. The vein-to-vein transit time was approximately 1 week.

[0448] Batch characterization was performed prior to batch release and included cell viability and induction of IFN-γ secretion.

[0449] Outpatient SQZ-PBMC-HPV was administered IV every 3 weeks without any prior conditioning regimen, and the first and second patients in each cohort were observed over a 23-h period.

[0450] Double antigen priming (DP) was introduced in cohort 3 and was performed on days 1 and 2 of cycle 1.

[0451] The DLT period was 28 days in the monotherapy phase and 42 days in the combination phase.

[0452] Dose escalation of monotherapy was performed according to the 3+3 rule. Up to 12 patients will be enrolled in every cohort.

[0453] Tumor biopsies were collected at baseline and C2D8, processed into FFPE blocks, sectioned, and stained on an automated immunohistochemistry stainer using qualified monoplex, dualplex, and triplex assays.

[0454] The treatment duration for each patient was determined by their assigned dose and the number of vials in their manufacturing batch.

[0455] Responses were assessed via RECIST 1.1 and iRECIST.

[0456] Patient demographics, disease characteristics, and occurrence of treatment-emergent adverse events (TEAEs) Table 5 shows the demographic and disease characteristics of the enrolled patients. [Table 5]

[0457] Table 6 shows the disposition of enrolled patients. [Table 6] *Until protocol v1.2, there was a limit of 3 doses. After v2.0 was approved, patients could receive only available doses. ^Treatment was limited to three doses prior to protocol version 2.0. 1 The patient was released to hospice and subsequently died.

[0458] Table 7 provides an overview of causal TEAEs reported in two or more patients. [Table 7]

[0459] Manufacturability of SQZ-PBMC-HPV The manufacturing process is <24 hours per patient, allowing for the production of multiple doses from a single run. Dramatic improvements in manufacturing and release testing support an intravenous time of approximately 1 week.

[0460] As shown in Figures 8A and B, production of SQZ-PBMC-HPV demonstrated a mean viability of approximately 90% with a mean end-to-end process time of less than 24 hours. As shown in Figure 8C, SQZ-PBMC-HPV generated from all patient batches presented HPV antigens as demonstrated by their ability to induce T cell activity assayed by responsive T cell IFN-γ secretion.

[0461] Treatment results Treatment outcomes are summarized in Figure 9, which provides an overview of best overall response (BOR), survival on study (days), and Royal Marsden Hospital (RMH)1 scores across all cohorts (shading based on score). As shown in Figure 9, all Cohort 3 patients had an RMH score of 2 and did not have a significant increase in CD8 tumor-infiltrating lymphocytes.

[0462] Patient Case Studies Patients with different tumor burdens were selected for further case studies.

[0463] Case Study Patient 2 A 65-year-old woman with cervical cancer enrolled in cohort 1 3.5 years after diagnosis after treatment with (1) cisplatin / paclitaxel / bevacizumab [BOR=CR] and (2) pembrolizumab [BOR=PD] (0.5e6 / kg q3w).

[0464] Low tumor burden, ECOG and Royal Marsden Hospital (RMH)-1 scores of 0 and 1 at baseline, respectively, >10 months on trial.

[0465] Tumor burden 1 target lesion (TL) (SOD of 15mm) and 3 NTL (2 lymph nodes, lung). Best overall response by RECIST 1.1:SD.

[0466] FIG. 10 shows a decrease in tumor growth kinetics (FIG. 10A), IHC image analysis results show a two-fold increase in CD8 TILs in the central tumor (FIG. 10B, C2D8 compared to screening), and an example IHC image further shows an increase in CD8 TILs (FIG. 10C, arrow).

[0467] Case Study Patient 7 A 67-year-old man with head and neck cancer was enrolled in cohort 2 (2.5e6 / kg q3w) 1 year after diagnosis following treatment with carboplatin / 5FU / pembrolizumab (BOR=PR).

[0468] High tumor burden, ECOG score of 1 and Royal Marsden Hospital (RMH) score of 0 at baseline, >3 months on trial.

[0469] Tumor burden 2 TL: 69mm SOD, 1 NTL (lymph node). Best overall response by RECIST 1.1: SD.

[0470] Figure 11 shows a decrease in tumor growth kinetics (Figure 11A), IHC image analysis results show a 6-fold increase in CD8 TILs in the median tumor during treatment (Figure 11B, compared to C2D8 screening) and an example IHC image shows a significant increase in CD8 TILs (Figure 11C, arrow).

[0471] conclusion Safety and Tolerability SQZ-PBMC-HPV was safe and well tolerated at all dose levels in patients receiving 2 to 10 doses. No DLTs or G>2 treatment-related SAEs were observed.

[0472] manufacturability All batches were manufactured under cGMP consistent with specifications, yielding multiple cryopreserved doses in less than 24 hours, allowing an intervenous time of approximately one week. · A product characterization assay based on T cell activity (IFN-γ secretion) confirmed antigen presentation in all patient batches, independent of medical history or individual patient RMH Phase 1 score.

[0473] Biomarkers In the case study, increased immune activity was observed in patients such as patients 2 and 7. Six of nine patients in the high-dose cohort had an RMH Phase 1 score of 2 at baseline, reflecting progressive disease and immunocompromised patients. · Two case studies suggest that less advanced patients with a lower tumor burden, such as patient 2, may have a higher chance of clinical benefit.

[0474] Future Developments: Once evaluation of current dose levels is complete, a safety combination phase with immune checkpoint inhibitors is anticipated to begin.

[0475] Example 3 Tumor biomarker analysis Tumor samples from patients enrolled in the clinical trial described in Example 2 were evaluated for biomarker expression. Tumor biopsies were collected at baseline and on day 8 of cycle 2 (C2D8), processed into FFPE blocks, sectioned, and IHC stained on an automated immunohistochemistry stainer using qualified monoplex, dualplex, and triplex assays.

[0476] The cohorts described in this example are shown in Table 8. [Table 8]

[0477] result Adverse events SQZ-PBMC-HPV appears to be safe and well tolerated. Adverse events during biomarker testing are shown in Table 9. [Table 9] * Common associated AEs (>1 patient): fatigue, hypotension, infusion-related reactions, nausea, pruritus. M = million, SP = single prime, DP = double prime, AE = adverse event.

[0478] No subjects met pre-specified DLT criteria

[0479] Three AESIs were reported in two patients:

[0480] Grade 2 cytokine release syndrome (CRS) and grades 1 and 2 immune-related reactions

[0481] No relevant grade ≥3 SAEs were reported:

[0482] Grade 2 (related) - CRS (1 point)

[0483] Related AEs in 1 patient: Grade 3+ (anemia)

[0484] One patient had one delayed dose due to nasal congestion.

[0485] No DLTs, related AEs leading to discontinuation, or fatal related AEs were observed.

[0486] Biomarker Testing CD8+ cell density in whole tumor tissue is shown in Figure 12. Tumors were also scored as desert (lack of immune cells), excluded (immune cells only at the periphery), or inflamed.

[0487] The CD8+ cell density among granzyme B (GZMB+) cells is shown in Figure 13. The density of CD8+ / Ki67+ cells is shown in Figure 14, and the density of CD8+ / Ki67- cells is shown in Figure 15. MHC-1 expression is shown in Figure 16 based on H-score. The % cells in the following MHC categories MHC-, MHC-1 low, MHC-1 medium, and MHC-1 high are also shown. Scoring includes the intensity of staining and the percentage of cells stained positively at each intensity. The staining signal is divided into four different intensity categories: 0: no staining, 1+: weak staining (visible at high magnification), 2+: intermediate (or moderate) staining (visible at low magnification), 3+: strong staining (noticeable even at low magnification).

[0488] The percentage of tumor cells expressing PD-L1 is shown in Figure 17.

[0489] HPV E6 expression is shown in Figure 18 based on H-score. The % cells in the following HPV categories are also shown: HPV-, HPV16 +1, HPV16 +2 HPV16 +3, and HPV16 +4. Cells with 1-3 probe spots = +1, 4-9 spots = +2, 10-13 spots = +3, and >14 spots = +4.

[0490] HPV E7 expression is shown in Figure 19 based on H-score. The % cells in the following HPV categories are also shown: HPV-, HPV16 +1, HPV16 +2 HPV16 +3, and HPV16 +4. Cells with 1-3 probe spots = +1, 4-9 spots = +2, 10-13 spots = +3, and >14 spots = +4. Biopsies from patients in cohorts 1-3 were evaluated for PD1 expression (Figure 20).

[0491] Selected Patient Overview 112-068 (Cohort 3a) A 52-year-old male with squamous cell carcinoma of the oropharynx was enrolled in the highest dose cohort (5.0M cells / kg DP). Initial diagnosis 3.7 years ago and subsequent treatment with 6 systemic therapies: cisplatin, carbo / 5FU / pembro (BOR=PD), docetaxel, cetuximab, anti-TGFβ / pembro (BOR=PD), and cetuximab / paclitaxel. Large primary lesion with significant symptom burden. Received all 7 doses of SQZ-PBMC-HPV with few low-grade related AEs (G1 flushing, G1 fatigue). Day 28 treatment biopsy showed an 8-fold increase in CD8 infiltrating tumor with a reflex increase in PD-L1 expression. Radiographic response, including confirmed CR on target lesion (mediastinal lymph node (RECIST 1.1)) with new skin lesion at last tumor evaluation. Improvement in symptoms (dysphagia) and gross improvement of lesions on physical examination.

[0492] Tumors transitioned from desert (no immune cells) to inflamed. Patients showed the highest CD8 infiltration (and effector molecule GZMB expression on CD8+ cells). There was no change in proliferating (Ki67+) CD8+ cells. Increases in MHC-I and PD-L1 were observed. Patients showed the highest E6 and E7 expression in tumors at baseline and the greatest change after treatment.

[0493] A more detailed analysis of the immunophenotype of the central tumor of this patient is shown in Figure 21. The right panel shows the CD8+ cell density in the stroma and parenchyma of the tumor. The middle panel shows the density of CTL, Treg and NK function of immune cells in the tumor based on the expression of CD8, GZMB and FoxP3 in a triplex assay. The right panel shows the percentage of cells that are CD8+ and GZMB+. These results are further substantiated by immunohistochemistry (Figure 22).

[0494] A more detailed analysis of the density of proliferating / activated CD8+ cells is shown in FIG.

[0495] As shown in Figure 24, increased expression of PD-L1 was observed.

[0496] As shown in Figure 25, the number of MHC-1 cells in the tumor was increased by C2D8 (left panel, top), including an increase in the proportion of MHC-1 high cells. In contrast, the number of cells expressing HPV16 E6 and HPV16 E7 was decreased by C2D8 (left panel, bottom). These results are also shown by immunohistochemistry (right panel).

[0497] Tumor growth kinetics are shown in FIG.

[0498] 103-027 (Cohort 2) This patient's tumor was inflamed at the start of the study, and inflammation was increased by C2D8. There was a significant increase in CD8 infiltrate (with no change in effector molecule GZMB expression on CD8+ cells). This patient had maximal proliferation of CD8+ cells as measured by CD8+ / Ki67+. There was no significant change in MHC-I and PD-L1 expression.

[0499] A more detailed analysis of the immune phenotype of this patient is shown in Figure 27. The right panel shows the CD8+ cell density of the central tumor in the tumor stroma and parenchyma. The middle panel shows the density of CTL, Treg and NK function of immune cells in the tumor based on the expression of CD8, GZMB and FoxP3 in a triplex assay. The right panel shows the percentage of cells that are CD8+ and GZMB+. These results are further substantiated by immunohistochemistry (Figure 28).

[0500] A more detailed analysis of the density of proliferating / activated CD8+ cells is shown in FIG.

[0501] As shown in Figure 30, expression of PD-1 and PD-L1 remained roughly the same.

[0502] As shown in Figure 31, the number of MHC-1 cells in the tumor remained roughly the same, but the proportion of MHC-1 high cells increased (left panel, top). In contrast, the number of cells expressing HPV16 E6 and HPV16 E7 was reduced by C2D8 (left panel, bottom). These results are also shown by immunohistochemistry (right panel).

[0503] 103-008 (Cohort 1) This patient's tumor was inflamed at study entry, and inflammation was increased by C2D8. A trend toward increased CD8 infiltration was observed, but there was no change in expression of the effector molecule GZMB on CD8+ cells. No changes were observed in proliferating (Ki67+) CD8+ cells. No changes were observed in PD-L1. There was no change in E6 and E7 expression in tumors at baseline or after treatment.

[0504] A more detailed analysis of the immune phenotype of this patient is shown in Figure 32. The right panel shows the CD8+ cell density of the central tumor in the tumor stroma and parenchyma. The middle panel shows the density of CTL, Treg and NK function of immune cells in the tumor based on the expression of CD8, GZMB and FoxP3 FoxP3 in a triplex assay. The right panel shows the percentage of cells that are CD8+ and GZMB+. These results are further substantiated by immunohistochemistry (Figure 33).

[0505] A more detailed analysis of the density of proliferating / activated CD8+ cells is shown in FIG.

[0506] Expression of PD-1 remained similar in C2D8 as shown in Figure 35. PD-L1 was not detected in either the initial screening or C2D8.

[0507] As shown in Figure 36, the number of MHC-1 cells in the tumors was similar (left panel, top), as were the numbers of cells expressing HPV16 E6 and HPV16 E7 (left panel, bottom). These results are also shown by immunohistochemistry (right panel).

Table 10-1

Table 10-2

Table 10-3

Claims

1. 1. A combination for treating a human papillomavirus (HPV) associated cancer in an individual, comprising: a composition comprising peripheral blood mononuclear cells (PBMCs), the PBMCs comprising at least one HPV antigen to be delivered intracellularly; and an antagonist of CTLA-4 and / or an antagonist of PD-1 / PD-L1; A combination comprising: (a) the CTLA4 antagonist is an antibody that binds to CTLA4; and / or (b) the PD-1 / PD-L1 antagonist is an antibody that binds to PD-1 or an antibody that binds to PD-L1; The combination according to claim 1. (a) an antibody that binds to CTLA-4 and an antibody that binds to PD-1 are administered to the individual; or (b) an antibody that binds to CTLA-4 is administered to the individual, and an antibody that binds to PD-L1 is administered to the individual. A combination according to claim 1 or 2. (a) the antibody that binds to CTLA-4 is ipilimumab, and / or (b) the antibody that binds to PD-1 is nivolumab or pembrolizumab, and / or (c) the antibody that binds to PD-L1 is atezolizumab; A combination according to claim 2 or 3.

5. HPV in individuals ＋ A composition for treating a recurrent, locally advanced, or metastatic tumor, the composition comprising peripheral blood mononuclear cells (PBMCs), the PBMCs comprising at least one HPV antigen delivered intracellularly.

6. The composition of claim 5, wherein the composition comprising the PBMCs is administered in combination with one or more immune checkpoint inhibitors.

7. The one or more immune checkpoint inhibitors (a) an antagonist of CTLA-4 and / or an antagonist of PD-1 / PD-L1; and / or (b) an antibody that binds to PD-L1, CTLA-4, or PD-1; The composition of claim 6.

8. (a) The antibody that binds to PD-L1 is atezolizumab. (b) the antibody that binds to CTLA-4 is ipilimumab; (c) the antibody that binds to PD-1 is nivolumab or pembrolizumab; The composition of claim 7.

9. The at least one HPV antigen is (a) is an HPV-16 antigen or an HPV-18 antigen, and / or (b) comprising peptides derived from HPV E6 and / or E7; and / or (c) comprising an HLA-A2-restricted peptide derived from HPV E6 and / or E7; A combination or composition according to any one of claims 1 to 8. (a) The individual is HLA-A ＊ 02 positive, and / or (b) the PBMCs are positive for HLA-A*02, and / or (c) the PBMCs are autologous to the individual; A combination or composition according to any one of claims 1 to 9.

11. The composition comprising PBMCs, (a) is administered intravenously; and / or (b) delivered on day 1 of a three-week cycle, and optionally further administered on day 2 of the first three-week cycle; and / or (c) administered to the individual for at least about three months, six months, nine months, or one year. A combination or composition according to any one of claims 1 to 10. (a) the CTLA-4 antagonist and / or the PD-1 / PD-L1 antagonist are administered intravenously, orally, or subcutaneously; and / or (b) the antibody that binds to CTLA-4, and / or the antibody that binds to PD-1, and / or the antibody that binds to PD-L1, is administered intravenously; A combination or composition according to any one of claims 1 to 4 and 7 to 11.

13. The effective amount of PBMCs containing at least one HPV antigen is about 0.5×10 ６ cells / kg ~ approx. 5.0×10 ６ The combination or composition according to any one of claims 1 to 12, wherein the amount of the combination or composition is cells / kg. (a) the effective amount of ipilimumab is from about 1 mg / kg to about 3 mg / kg, and / or (b) the effective amount of nivolumab is about 360 mg; and / or (c) the effective amount of atezolizumab is about 1200 mg; A combination or composition according to any one of claims 4 and 8 to 13. Claim 15: (a) Approximately 0.5×10 ６ cells / kg, approximately 2.5×10 ６ cells / kg, approximately 5.0×10 ６ and / or wherein the cells / kg are administered on day 1 of each three-week cycle; (b) about 0.5×10 6 cells / kg, about 2.5×10 6 cells / kg, or about 5.0×10 6 cells / kg are administered on day 2 of the first three-week cycle; A combination or composition according to claim 11.

16. 16. The combination or composition according to any one of claims 2 to 4 and 7 to 15, characterized in that the antibody that binds to CTLA-4, and / or the antibody that binds to PD-1, and / or the antibody that binds to PD-L1 are administered once per three-week cycle.

17. The antibody that binds to CTLA-4 is (a) administered on day 1 of each three-week cycle; and / or (b) administered once per two three-week cycles; and / or (c) ipilimumab, wherein the ipilimumab is (i) administered at a dose of about 3 mg / kg, or (ii) administered at a dose of about 1 mg / kg on day 1 of the first three week cycle of two three week cycles, and the antibody that binds PD-1 is administered at a dose of about 360 mg on day 8 of the first three week cycle and day 1 of each cycle thereafter. A combination or composition according to any one of claims 11 to 15.

18. The antibody that binds to PD-1 is (a) administered on day 8 of the first three-week cycle and on day 1 of each cycle thereafter; and / or (b) nivolumab, wherein the nivolumab is administered at a dose of about 360 mg.

18. A combination or composition according to claim 16 or 17.

19. The antibody that binds to PD-L1 is (a) administered on day 8 of the first three-week cycle and on day 1 of each cycle thereafter; and / or (b) atezolizumab, wherein the atezolizumab is administered at a dose of about 1200 mg. A combination or composition according to any one of claims 11 to 17.

20. The composition comprising PBMCs, (i) a) About 5×10 ６ PBMC~about 5×10 ７ PBMC, b) a cryopreservation medium in a proportion of about 40% to about 60% (w / w); c) a cryopreservation medium in a proportion of about 25% to about 35% (w / w); and d) about 3% to about 8% (w / w) human serum albumin; the pH of the formulation is from about pH 6.0 to about pH 8.5; or (ii) a) Approximately 2.75×10 7 PBMCs, b) a cryopreservation medium in a proportion of about 50% (w / w); c) a cryopreservation medium in a proportion of about 30% (w / w); and d) human serum albumin in a proportion of about 5% (w / w); the pH of the formulation is about pH 7.4, or (iii) a) Approximately 5×10 6 PBMC / mL, b) a cryopreservation medium in a proportion of about 50% (w / w); c) a cryopreservation medium in a proportion of about 30% (w / w); and d) human serum albumin in a proportion of about 5% (w / w); the pH of the formulation is about pH 7.4, or (iv) a) about 1×10 6 PBMC / mL to about 1×10 7 PBMC / mL, b) a cryopreservation medium in a proportion of about 40% to about 60% (w / w); c) a cryopreservation medium in a proportion of about 25% to about 35% (w / w); and d) about 3% to about 8% (w / w) human serum albumin; the pH of the formulation is from about pH 6.0 to about pH 8.5; or (v) a) Approximately 5×10 6 PBMC to approximately 5×10 7 PBMC, b) a cryopreservation medium in a proportion of about 65% to about 95% (w / w); c) about 3% to about 8% (w / w) human serum albumin; the pH of the formulation is from about pH 6.0 to about pH 8.5; or (vi) a) about 1×10 6 PBMC / mL to about 1×10 7 PBMC / mL, b) a cryopreservation medium in a proportion of about 65% to about 95% (w / w); c) about 3% to about 8% (w / w) human serum albumin; the pH of the formulation is from about pH 6.0 to about pH 8.5; or (vii) a) Approximately 2.5×10 7 PBMCs, b) a cryopreservation medium in a proportion of about 80% (w / w); c) about 5% (w / w) human serum albumin; the pH of the formulation is about pH 7.4, or (viii) a) Approximately 5×10 6 PBMC / mL, b) a cryopreservation medium in a proportion of about 80% (w / w); c) about 5% (w / w) human serum albumin; The pH of the formulation is about pH 7.

4. A combination or composition according to any one of claims 1 to 19.

21. 21. The combination or composition of claim 20, wherein the cryopreservation medium is CryoStor® CS10 and / or the cryopreservation medium is HypoThermasol® FRS.

22. The PBMCs (a) two or more of T cells, B cells, NK cells, or monocytes; and / or (b) T cells, B cells, NK cells, and monocytes The combination or composition according to any one of claims 1 to 21, comprising:

23. (a) about 25% to about 80% of the PBMCs are T cells; (b) about 1.5% to about 30% of the PBMCs are B cells; (c) about 3.0% to about 20% of the PBMCs are NK cells, or (d) about 4.0% to about 45% of the PBMCs are monocytes.

24. The PBMCs containing the at least one HPV antigen are a) passing a cell suspension comprising a population of input PBMCs through a cell deformation constriction, the diameter of the constriction being a function of the diameter of the input PBMCs in the suspension, thereby causing a perturbation of the input PBMCs sufficient to allow the at least one HPV antigen to pass therethrough to form a perturbed input PBMC; 24. The combination or composition of any one of claims 1 to 23, prepared by a process comprising: b) culturing said population of perturbed input PBMCs with said at least one HPV antigen for a time sufficient to allow said antigen to enter said perturbed input PBMCs, thereby generating said PBMCs comprising said at least one HPV antigen.

25. 25. The combination or composition of claim 24, wherein the diameter of the constriction is from about 4.2 μm to about 6 μm or from about 4.2 μm to about 4.8 μm.

26. The PBMCs containing the at least one HPV antigen are (a) is habituated; and / or (b) for conditioning the PBMCs, the PBMCs are conditioned by a process comprising culturing the PBMCs with an adjuvant at about 37° C. for about 2 hours to about 10 hours, about 3 hours to about 6 hours, or about 4 hours; A combination or composition according to any one of claims 1 to 25.

27. The adjuvant is (a) a CpG oligodeoxynucleotide (ODN), LPS, IFN-α, a STING agonist, a RIG-I agonist, poly I:C, R837, R848, a TLR3 agonist, a TLR4 agonist, or a TLR9 agonist; or (b) CpG7909 oligodeoxynucleotide (ODN) 27. The combination or composition of claim 26,

28. A composition for treating a human papillomavirus (HPV) associated cancer in an individual, the composition comprising peripheral blood mononuclear cells (PBMCs), the PBMCs comprising at least one HPV antigen delivered intracellularly, and the composition being administered to the individual in combination with a CTLA-4 antagonist and / or a PD-1 / PD-L1 antagonist.

29. A composition for treating human papillomavirus (HPV) associated cancer in an individual, the composition comprising a CTLA-4 antagonist and / or a PD-1 / PD-L1 antagonist, the composition being administered in combination with a composition comprising peripheral blood mononuclear cells (PBMCs), the PBMCs comprising at least one HPV antigen delivered intracellularly.