Micellar nanoparticles and uses thereof

Abstract

The present disclosure includes cationic carrier units comprising (i) a water-soluble polymer, (ii) a positively charged carrier, (iii) a hydrophobic portion, and (iv) a cross-linking portion, where when the cationic carrier units are mixed with an anionic payload (e.g., an antisense oligonucleotide) that electrostatically interacts with the cationic carrier units, the resulting composition self-assembles into micelles encapsulating the anionic payload in its core. The cationic carrier units may also include tissue-specific targeting moieties, which will be presented on the surface of the micelles. The present disclosure also includes micelles comprising the cationic carrier units of the present disclosure, methods for making the cationic carrier units and micelles, pharmaceutical compositions comprising the micelles, and even methods for treating a disease or condition comprising administering the micelles to a subject in need of such treatment.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This PCT application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 199,471, filed December 30, 2020, No. 63 / 260,782, filed August 31, 2021, and No. 63 / 260,989, filed September 8, 2021, each of which is incorporated by reference in its entirety herein.

[0002] Reference to Electronically Submitted Sequence Listing The contents of the electronically submitted Sequence Listing, submitted with this application in the form of an ASCII text file (Name: 4366_039PC03_Seqlisting_ST25; Size: 15,966 bytes; Created: December 27, 2021), are hereby incorporated by reference in their entirety into this specification.

[0003] The present disclosure provides cationic carrier units and micelle systems that can be used to deliver anionic payloads (eg, oligonucleotides) across physiological permeability barriers (eg, the blood-brain barrier). [Background technology]

[0004] In the body, there are certain barriers that limit the permeability of drugs through membranes. Thus, only certain substances can pass through this type of membrane. Among the important and special physiological barriers are the blood-brain barrier and cell membranes. The blood-brain barrier (BBB) ​​is a highly selective semi-permeable boundary that separates the circulating blood from the brain and extracellular fluid in the central nervous system (CNS). The blood-brain barrier is formed by endothelial cells of the capillary walls, the astrocyte endfeet that cover the capillaries, and pericytes embedded in the capillary basement membrane. This system allows the passage of water, some gases, and lipid-soluble molecules by passive diffusion, as well as the selective transport of molecules such as glucose and amino acids that are important for neurological function.

[0005] The blood-brain barrier restricts the passage of pathogens into the cerebrospinal fluid (CSF), solutes in the blood, and the diffusion of large or hydrophilic molecules, while allowing the diffusion of O2, CO2, hydrophobic molecules (e.g., hormones), and small polar molecules (Johansen et al., (2017) Journal of Cerebral Blood Flow and Metabolism. Epub(4):659-668). The BBB excludes nearly 100% of large molecule neurotherapeutics and more than 98% of all molecular drugs from the brain. Daneman & Prat (2015) “The Blood Brain Barrier” Cold Spring Harbor Perspectives in Biology 7(1):a020412. Overcoming the difficulty of delivering therapeutics to specific regions of the brain is a major challenge in the treatment of many brain diseases. Thus, therapeutic molecules that would otherwise be effective in diagnosis and treatment do not cross the BBB in adequate amounts.

[0006] Intracellular targeting is also often difficult because exogenous molecules must first cross the cell membrane to reach the cytosol. The cell membrane is selectively permeable to non-polar therapeutic agents that are lipid-soluble and can cross the cell membrane. On the other hand, highly charged therapeutic agents such as oligonucleotides are effectively excluded by the cell membrane.

[0007] Polynucleotides do not easily penetrate cell membranes due to charge repulsion between the negatively charged membrane and the large negative charge of polynucleotides. As a result, polynucleotides have low bioavailability and poor cellular uptake (usually less than 1%) (Dheur et al, Nucleic Acid Drug Dev., 9:522 (1999); Park et al, J Controlled Release, 93:188 (2003)). Since most polynucleotides are generally larger than 5,000 Da, they cannot easily diffuse through cell membranes, and cellular uptake is mainly limited to pinocytosis or endocytosis processes. Once inside the cell, polynucleotides may accumulate in lysosomal compartments, limiting their access to the cytoplasm or nucleus. Parenterally administered polynucleotides are highly susceptible to rapid degradation by nucleases both inside and outside the cytoplasm. Studies have shown rapid degradation of polynucleotides in the blood following intravenous administration, with a half-life of approximately 30 minutes (Geary et al, J. Pharmacol. Exp. Ther. 296:890-897 (2001)).

[0008] Thus, the problems facing the delivery of polynucleotides, such as antisense oligonucleotides, can be roughly divided into two parts. First, therapeutic polynucleotides must be formulated in such a way that they can be delivered to the cytoplasm, and second, the polynucleotide must reach the cell nucleus in an intact and fully functional form. Despite the progress in the application of oligonucleotides and oligonucleotide analogues as therapeutic agents, there is a need for delivery systems that provide improved pharmacological properties, such as serum stability, delivery to the correct organ, tissue or cell, and membrane-permeable delivery. In attempts to improve the transmembrane delivery of nucleic acids and oligonucleotides, protein carriers, antibody carriers, liposome delivery systems, electroporation, direct injection, cell fusion, viral vectors, and calcium phosphate-mediated transformation have been used. However, many of these techniques are limited by the cell types that can transmembrane transport and the conditions required to achieve such transport. Therefore, there is a need for a delivery system that can selectively direct charged therapeutic agents (e.g., antisense oligonucleotides such as antimirs) to specific target cells or tissues and across permeability barriers (e.g., plasma membrane or BBB), while improving serum stability and / or resistance to endogenous degradative enzymes (e.g., RNases). [Prior art documents] [Non-patent literature]

[0009] [Non-Patent Document 1] Johansen et al.,(2017)Journal of Cerebral Blood Flow and Metabolism.Epub(4):659-668 [Non-Patent Document 2] Daneman & Prat(2015)“The Blood Brain Barrier” Cold Spring Harbor Perspectives in Biology 7(1):a020412 [Non-Patent Document 3] Dheur et al, Nucleic Acid Drug Dev.,9:522(1999) [Non-Patent Document 4] Park et al,J Controlled Release,93:188(2003) [Non-Patent Document 5] Geary et al,J.Pharmacol.Exp.Ther.296:890-897(2001) Summary of the Invention

[0010] The present disclosure relates to the following scheme: [CC]-L1-[CM]-L2-[HM] (Scheme I), [CC]-L1-[HM]-L2-[CM] (Scheme II), [HM]-L1-[CM]-L2-[CC] (scheme III), [HM]-L1-[CC]-L2-[CM] (scheme IV), [CM]-L1-[CC]-L2-[HM] (Scheme V), or [CM]-L1-[HM]-L2-[CC] (scheme VI), (In the formula, CC is a positively charged carrier moiety, CM is a bridging moiety, HM is a hydrophobic moiety, L1 and L2 are independently an optional linker; A cationic carrier unit is provided in which the number of HMs is less than about 50% relative to [CC] and [CM].

[0011] In some embodiments, the number of HM is about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, or less than about 1% relative to [CC] and [CM]. In some embodiments, the number of HM is about 50% to about 1%, about 50% to about 5%, about 50% to about 10%, about 50% to about 15%, about 50% to about 20%, about 50% to about 25%, about 50% to about 30%, about 50% to about 35%, about 50% to about 40%, about 50% to about 45%, about 45% to about 1%, about 45% ~ about 5%, about 45% to about 10%, about 45% to about 15%, about 45% to about 20%, about 45% to about 25%, about 45% to about 30%, about 45% to about 35%, about 45% to about 40%, about 40% to 1%, about 50% to about 5%, about 40% to about 10%, about 40% to about 15%, about 40% to about 20%, about 40% to about 25%, about 40% to about 30% , about 40% to about 35%, about 35% to about 1%, about 35% to about 5%, about 35% to about 10%, about 35% to about 15%, about 35% to about 20%, about 35% to about 25%, about 35% to about 30%, about 30% to about 1%, about 30% to about 5%, about 30% to about 10%, about 30% to about 15%, about 30% to about 20%, about 30% to about 25%, about 25% to about 1%, about 25% to about 5%, about 25% to about 10%, about 25% to about 15%, about 25% to about 20%, about 20% to about 1%, about 20% to about 5%, about 20% to about 10%, about 20% to about 15%, about 15% to about 1%, about 15% to about 5%, about 15% to about 10%, about 10% to about 1%, about 10% to about 5%, or about 5% to about 1%. In some embodiments, the number of HMs is about 50% to about 40%, about 40% to about 30%, about 30% to about 20%, about 20% to about 10%, about 10% to about 5%, and about 5% to about 1%. In some embodiments, the number of HMs is about 50%, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 5%, or about 1%.

[0012] In some embodiments, the cationic carrier unit can interact with the anionic payload. In some embodiments, the anionic payload comprises a nucleotide sequence having a length of less than 200 nucleotides. In some embodiments, the anionic payload comprises a nucleotide sequence having a length of less than about 150, about 140, about 130, about 120, about 110, about 100, about 90, about 80, about 70, about 60, about 50, about 40, about 30, about 25, about 24, about 23, about 22, about 21, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 12, about 11, or about 10 nucleotides. In some embodiments, the anionic payload comprises a nucleotide sequence having a length of about 30 to about 10, about 25 to about 11, about 30 to about 15, about 25 to about 15, about 24 to about 15, or about 23 to about 15 nucleotides. In some embodiments, the anionic payload comprises a nucleotide sequence having a length of about 30, about 29, about 28, about 27, about 26, about 25, about 24, about 23, about 22, about 21, about 20, about 19, about 18, about 17, about 16, about 15, about 14, or about 13 nucleotides. In some embodiments, the anionic payload comprises a nucleotide sequence having a length of about 22 nucleotides. In some embodiments, the anionic payload comprises an mRNA, miRNA, miRNA sponge, tough decoy miRNA, antimir, small RNA, rRNA, siRNA, shRNA, gDNA, cDNA, pDNA, PNA, BNA, antisense oligonucleotide (ASO), aptamer, cyclic dinucleotide, or any combination thereof.

[0013] In some embodiments, the cationic carrier unit further comprises a water-soluble polymer (WP). In some embodiments, the water-soluble polymer is attached to [CC], [HM], or [CM]. In some embodiments, the water-soluble polymer is attached to the N-terminus of [CC], [HM], or [CM]. In some embodiments, the water-soluble polymer is attached to the C-terminus of [CC], [HM], or [CM]. In some embodiments, the cationic carrier unit is [WP]-L3]-[CC]-L1-[CM]-L2-[HM] (scheme I'), [WP]-L3]-[CC]-L1-[HM]-L2-[CM] (scheme II'), [WP]-L3]-[HM]-L1-[CM]-L2-[CC] (scheme III'), [WP]-L3]-[HM]-L1-[CC]-L2-[CM] (scheme IV'), [WP]-L3]-[CM]-L1-[CC]-L2-[HM] (scheme V'), or [WP]-L3]-[CM]-L1-[HM]-L2-[CC] (Scheme VI').

[0014] In some embodiments, the water soluble polymer comprises a poly(alkylene glycol), a poly(oxyethylated polyol), a poly(olefinic alcohol), a poly(vinylpyrrolidone), a poly(hydroxyalkyl methacrylamide), a poly(hydroxyalkyl methacrylate), a poly(saccharide), a poly(α-hydroxy acid), a poly(vinyl alcohol), a polyglycerol, a polyphosphazene, a polyoxazoline ("POZ"), a poly(N-acryloylmorpholine), or any combination thereof. In some embodiments, the water soluble polymer comprises a polyethylene glycol ("PEG"), a polyglycerol, or a poly(propylene glycol) ("PPG"). In some embodiments, the water soluble polymer comprises a poly(alkylene glycol) having the following formula: [ka] (wherein n is 1 to 1000).

[0015] In some embodiments, n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141. In some embodiments, n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, or about 150 to about 160.

[0016] In some embodiments, the water soluble polymer is linear, branched, or dendritic.In some embodiments, the cationic carrier moiety comprises one or more basic amino acids. In some embodiments, the cationic carrier moiety is at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41 at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, at least 50, at least about 51, at least about 52, at least about 53, at least about 54, at least about 55, at least about 56, at least about 57, at least about 58, at least about 59, at least about 60, at least about 61, at least about 62, at least about 63, at least about 64, at least about 65, at least about 66, at least about 67, at least about 68, at least about 69, at least about 70, at least about 71, at least about 72, at least about 73, at least about 74, at least about 75, at least about 76, at least about 77, at least about 78, at least about 79, or at least about 80 basic amino acids.In some embodiments, the cationic carrier moiety comprises at least 20, at least about 30, at least about 40, at least about 50, at least 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, or at least about 150 basic amino acids.

[0017] In some embodiments, the cationic carrier moiety is about 10 to about 60, about 15 to about 60, about 20 to about 60, about 25 to about 60, about 30 to about 60, about 35 to about 60, about 40 to about 60, about 10 to about 55, about 15 to about 55, about 20 to about 55, about 25 to about 55, about 30 to about 55, about 35 to about 55, about 40 to about 55, about 10 to about 50, about 15 to about 50, about 20 to about 50, about 25 to about 50, about 30 to about 50, about 35 to about 50, about 40 to about 55, about 50, about 10 to about 45, about 15 to about 45, about 20 to about 45, about 25 to about 45, about 30 to about 45, about 35 to about 45, about 40 to about 45, about 10 to about 40, about 15 to about 40, about 20 to about 40, about 25 to about 40, about 30 to about 40, about 35 to about 40, about 10 to about 35, about 15 to about 35, about 20 to about 35, about 25 to about 35, about 30 to about 35, about 35 to about 35, about 40 to about 35, or about 40 to about 35 basic amino acids.

[0018] In some embodiments, the cationic carrier moiety comprises about 30 to about 50 basic amino acids. In some embodiments, the cationic carrier moiety comprises about 10, about 20, about 30, about 40, about 50, or about 60 basic amino acids. In some embodiments, the basic amino acids comprise arginine, lysine, histidine, or any combination thereof. In some embodiments, the cationic carrier moiety comprises about 20, about 30, about 40, about 50, or about 60 lysines. In some embodiments, the cationic carrier moiety comprises about 32 lysines.

[0019] In some embodiments, the cross-linking moiety comprises one or more amino acids linked to a cross-linking agent. In some embodiments, the cross-linking agent comprises a thiol group, a thiol derivative, or any combination thereof. In some embodiments, the cross-linking moiety comprises a thiol group.

[0020] In some embodiments, the amino acids of the bridging moiety include at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, or at least 40 basic amino acids. In some embodiments, the amino acids in the crosslinked portion are about 1 to about 40, about 5 to about 40, about 10 to about 40, about 15 to about 40, about 20 to about 40, about 1 to about 35, about 5 to about 35, about 10 to about 35, about 15 to about 35, about 20 to about 35, about 1 to about 30, about 5 to about 30, about 10 to about 30, about 15 to about 30, about 20 about 30, about 1 to about 25, about 5 to about 25, about 10 to about 25, about 15 to about 25, about 20 to about 25, about 1 to about 20, about 5 to about 20, about 10 to about 20, about 15 to about 20, about 1 to about 15, about 5 to about 15, about 10 to about 15, about 1 to about 10, about 5 to about 10, or about 1 to about 5 basic amino acids.

[0021] In some embodiments, the amino acids of the bridging moiety comprise about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or about 30 basic amino acids. In some embodiments, the basic amino acids of the bridging moiety comprise arginine, lysine, histidine, or any combination thereof. In some embodiments, the basic amino acids of the bridging moiety include about 5, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 25, about 30, or about 40 lysines. In some embodiments, the basic amino acids of the bridging moiety include about 10 to about 20 lysines. In some embodiments, the basic amino acids of the bridging moiety include about 16 lysines.

[0022] In some aspects, the hydrophobic moiety can modulate an immune response, an inflammatory response, or a tissue microenvironment. In some aspects, the hydrophobic moiety can modulate an immune response. In some aspects, the hydrophobic moiety can modulate a tumor microenvironment in a subject having a tumor.

[0023] In some embodiments, the hydrophobic moiety is capable of inhibiting or reducing hypoxia in the tumor microenvironment. In some embodiments, the hydrophobic moiety comprises one or more amino acids linked to an imidazole derivative, an amino acid, a vitamin, or any combination thereof.

[0024] In some embodiments, the hydrophobic moiety can inhibit or reduce inflammatory responses. In some embodiments, the hydrophobic moiety is one or more amino acids attached to the vitamin. In some embodiments, the vitamin comprises a cyclic ring or a cyclic heteroatom ring and a carboxyl group or a hydroxyl group.

[0025] In some embodiments, the vitamin comprises the formula: [ka] wherein each of Y1 and Y2 is independently selected from C, N, O, and S; and n is 1 or 2.

[0026] In some embodiments, the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof. In some embodiments, the vitamin is vitamin B3.

[0027] In some embodiments, the hydrophobic moieties are at least 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, , at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, at least about 50, at least about 51, at least about 52, at least about 53, at least about 54, at least about 55, at least about 56, at least about 57, at least about 58, at least about 59, at least about 60, at least about 61, at least about 62, at least about 63, at least about 64, at least about 65, at least about 66, at least about 67, at least about 68, at least about 69, at least about 70, at least about 71, at least about 72, at least about 73, at least about 74, at least about 75, at least about 76, at least about 77, at least about 78, at least about 79, or at least about 80 amino acids.In some embodiments, the hydrophobic portion comprises at least 20, at least about 30, at least about 40, at least about 50, at least 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least about 120, at least about 130, at least about 140, or at least about 150 amino acids, each attached to a vitamin. In some embodiments, the hydrophobic moieties are about 10 to about 60, about 15 to about 60, about 20 to about 60, about 25 to about 60, about 30 to about 60, about 35 to about 60, about 40 to about 60, about 10 to about 55, about 15 to about 55, about 20 to about 55, about 25 to about 55, about 30 to about 55, about 35 to about 55, about 40 to about 55, about 10 to about 50, about 15 to about 50, about 20 to about 50, about 25 to about 50, about 30 to about 50, about 35 to about 50 , about 40 to about 50, about 10 to about 45, about 15 to about 45, about 20 to about 45, about 25 to about 45, about 30 to about 45, about 35 to about 45, about 40 to about 45, about 10 to about 40, about 15 to about 40, about 20 to about 40, about 25 to about 40, about 30 to about 40, about 35 to about 40, about 10 to about 35, about 15 to about 35, about 20 to about 35, about 25 to about 35, about 30 to about 35, about 35 to about 35, about 40 to about 35, or about 40 to about 35 amino acids. In some embodiments, the hydrophobic portion comprises about 10, about 20, about 30, about 40, about 50, or about 60 amino acids, each attached to a vitamin.

[0028] In some embodiments, the hydrophobic portion comprises about 10 amino acids, about 20 amino acids, about 30 amino acids, about 40 amino acids, or about 50 amino acids, each bound to vitamin B3.

[0029] In some embodiments, the cationic carrier unit comprises about 25 to about 40 lysines, the bridging portion comprises about 10 to about 20 lysine-thiols, and the hydrophobic portion comprises about 25 to about 40 lysine-vitamin B3. In some embodiments, the cationic carrier portion comprises about 30 to about 35 lysines, the bridging portion comprises about 13 to about 20 lysine-thiols, and the hydrophobic portion comprises about 30 to about 35 lysine-vitamin B3. In some embodiments, the cationic carrier portion comprises about 32 lysines, the bridging portion comprises about 16 lysine-thiols, and the hydrophobic portion comprises about 32 lysines-vitamin B3.

[0030] In some embodiments, the cationic carrier unit comprises about 35 to about 60 lysines, the bridging moiety comprises about 5 to about 15 lysine-thiols, and the hydrophobic moiety comprises about 15 to about 30 lysine-vitamin B3.

[0031] In some embodiments, the cationic carrier unit comprises a water-soluble biopolymer moiety, the water-soluble biopolymer moiety comprising about 120 to about 130 PEG units.

[0032] In some embodiments, the cationic carrier unit further comprises a targeting moiety (TM). In some embodiments, the targeting moiety can target a tissue. In some embodiments, the tissue is liver, brain, kidney, lung, ovary, pancreas, thyroid, breast, stomach, or any combination thereof. In some embodiments, the targeting moiety can be transported by large neutral amino acid transporter 1 (LAT1). In some embodiments, the targeting moiety is an amino acid. In some embodiments, the targeting moiety comprises a branched chain or aromatic amino acid. In some embodiments, the targeting moiety is phenylalanine, valine, leucine, and / or isoleucine. In some embodiments, the amino acid is phenylalanine. In some embodiments, the targeting moiety is linked to a water soluble polymer. In some embodiments, the targeting moiety is linked to a water soluble polymer by a linker.

[0033] The present disclosure also provides micelles comprising a cationic carrier unit as disclosed herein and an anionic payload, wherein the cationic carrier moiety and the anionic payload of the cationic carrier complex are bonded to each other. In some aspects, the bond is a covalent bond. In other aspects, the bond is a non-covalent bond. In some aspects, the bond is an ionic bond.

[0034] In some embodiments, the positive charges of the cationic carrier moieties of the cationic carrier units are sufficient to form micelles when mixed with an anionic payload in solution, and the overall ionic ratio of the positive charges of the cationic carrier moieties of the cationic carrier units to the negative charges of the anionic payload in solution is about 1:3 to about 3:1. In some embodiments, the positive charges of the cationic carrier moieties of the cationic carrier units are sufficient to form micelles when mixed with an anionic payload in solution, and the overall ionic ratio of the positive charges of the cationic carrier moieties of the cationic carrier units to the negative charges of the anionic payload in solution is about 1:3, about 1:2.5, about 1:2, about 1:1.5, about 1:1, about 1:0.5, about 0.5:1, about 1.5:1, about 2:1, about 2.5:1, or about 3:1. In some embodiments, the positive charges of the cationic carrier moieties of the cationic carrier units are sufficient to form micelles when mixed in solution with an anionic payload, and the overall ionic ratio of the positive charges of the cationic carrier moieties of the cationic carrier units to the negative charges of the anionic payload in solution is about 1:3, about 1:2.5, about 1:2, about 1:1.5, about 1:1, about 1:0.5, about 0.5:1, about 1.5:1, about 2:1, about 2.5:1, or about 3:1. In some embodiments, the positive charges of the cationic carrier moieties of the cationic carrier units are sufficient to form micelles when mixed in solution with an anionic payload, and the overall ionic ratio of the positive charges of the cationic carrier moieties of the cationic carrier units to the negative charges of the anionic payload in solution is about 1:1.

[0035] In some embodiments, the cationic carrier unit can protect the anionic payload from degradation by DNases and / or RNases, hi some embodiments, the anionic payload is not covalently conjugated to the cationic carrier unit and / or the anionic payload interacts with the cationic carrier moiety of the cationic carrier unit only through ionic interactions.

[0036] In some embodiments, the half-life of the anionic payload is extended compared to the half-life of a free anionic payload that is not incorporated into a micelle. In some embodiments, the ionic ratio of the positive charges of the cationic carrier moieties of the cationic carrier units in the micelle to the negative charges of the anionic payload is about 3:1, about 2.9:1, about 2.8:1, about 2.7:1, about 2.6:1, about 2.5:1, about 2.4:1, about 2.3:1, about 2.2:1, about 2:1, about 1.9:1, about 1.8:1, about 1.7:1, about 1.6:1, about 1.5:1, about 1.8:1, about 1.9:1, about 1.8:1, about 1.7:1, about 1.6:1, about 1.5:1, about 1.8:1, about 1.9:1, about 1.8:1, about 1.7:1, about 1.8 ... 1.4:1, about 1.3:1, about 1.2:1, about 1.1:1, about 1:1, about 1:1.1, about 1:1.2, about 1:1.3, about 1:1.4, about 1:1.5, about 1:1.6, about 1:1.7, about 1:1.8, about 1:1.9, about 1:2, about 1:2.1, about 1:2.2, about 1:2.3, about 1:2.4, about 1:2.5, about 1:2.6, about 1:2.7, about 1:2.8, about 1:2.9, or about 1:3. In some embodiments, the ionic ratio of the positive charges of the cationic carrier moieties of the cationic carrier units in the micelle to the negative charges of the anionic payload is about 3:1 to about 1:3.

[0037] In some embodiments, the diameter of the micelles is about 1 nm to about 100 nm, about 10 nm to about 100 nm, about 10 nm to about 90 nm, about 10 nm to about 80 nm, about 10 nm to about 70 nm, about 20 nm to about 100 nm, about 20 nm to about 90 nm, about 20 nm to about 80 nm, about 20 nm to about 70 nm, about 30 nm to about 100 nm, about 30 nm to about 90 nm, about 30 nm to about 80 nm, about 30 nm to about 70 nm, about 40 nm to about 100 nm, about 40 nm to about 90 nm, about 40 nm to about 80 nm, or about 40 nm to about 70 nm.

[0038] In some embodiments, the anionic payload comprises a nucleic acid. In some embodiments, the nucleic acid comprises an mRNA, miRNA, miRNA sponge, tough decoy miRNA, antimir, small RNA, rRNA, siRNA, shRNA, gDNA, cDNA, pDNA, PNA, BNA, antisense oligonucleotide (ASO), aptamer, cyclic dinucleotide, or any combination thereof. In some embodiments, the nucleic acid comprises at least one nucleoside analog. In some embodiments, the nucleoside analog comprises locked nucleic acid (LNA); 2'-0-alkyl RNA; 2'-amino DNA; 2'-fluoro DNA; arabino nucleic acid (ANA); 2'-fluoro ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleoside (cEt), 2'-0-methyl nucleic acid (2'-OMe), 2'-0-methoxyethyl nucleic acid (2'-MOE), or any combination thereof.

[0039] In some embodiments, the nucleic acid comprises a nucleotide sequence having a length of 5-30 nucleotides. In some embodiments, the nucleotide sequence is 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, the nucleotide sequence has a backbone comprising phosphodiester bonds, phosphotriester bonds, methylphosphonate bonds, phosphoramidate bonds, phosphorothioate bonds, and combinations thereof. In some embodiments, the nucleic acid comprises a nucleotide sequence set forth in SEQ ID NO: 18 (miR-485 3p inhibitor).

[0040] The present disclosure also provides compositions comprising the cationic carrier units and negatively charged molecules disclosed herein. Pharmaceutical compositions comprising the cationic carrier units, compositions, or micelles disclosed herein and a pharma- ceutically acceptable carrier are also provided.

[0041] The present disclosure also provides a method of preparing a cationic carrier unit disclosed herein, comprising linking the cationic carrier moiety with a bridging moiety and a hydrophobic moiety. In some embodiments, the method further comprises linking a water-soluble polymer with a targeting moiety. In some embodiments, the method of preparing a micelle disclosed herein comprises mixing a cationic carrier unit and an anionic payload in a solution at an ionic ratio of 1:1. In some embodiments, the method of preparing a micelle disclosed herein comprises mixing a cationic carrier unit and an anionic payload in a solution at an ionic ratio of 2:1. In some embodiments, the method of preparing a micelle disclosed herein comprises mixing a cationic carrier unit and an anionic payload in a solution at an ionic ratio of about 1:3 to about 3:1. In some embodiments, the method further comprises purifying the micelle.

[0042] The present disclosure also provides a method of treating a disease or condition in a subject in need thereof, comprising administering to the subject a micelle or pharmaceutical composition of the present disclosure. In some embodiments, the anionic payload in the core of the micelle exhibits a longer half-life than a corresponding anionic payload that is not incorporated in the micelle. In some embodiments, the subject is a mammal.

[0043] The present disclosure also provides a method of reducing inflammation in a subject suffering from a neurodegenerative disease, the method comprising administering to the subject a therapeutically effective amount of a micelle disclosed herein.

[0044] The present disclosure also provides a method of restoring and / or inducing neurogenesis in a subject suffering from a neurodegenerative disease, the method comprising administering to the subject a therapeutically effective amount of a micelle disclosed herein.

[0045] The present disclosure also provides a method of improving cognitive function in a subject suffering from a neurodegenerative disease, the method comprising administering to the subject a therapeutically effective amount of a micelle disclosed herein.

[0046] In some aspects, the neurodegenerative disease is Alzheimer's disease.

[0047] The present disclosure also provides a method of reducing amyloid plaque burden in a subject suffering from Alzheimer's disease, the method comprising administering to the subject a therapeutically effective amount of a micelle disclosed herein. [Brief description of the drawings]

[0048] [Figure 1A] 1 shows exemplary structures of carrier units and micelles of the present disclosure. Exemplary carrier units include an optional tissue-specific targeting moiety, a water-soluble polymer, and a cationic carrier unit that includes a cationic moiety, a cross-linking moiety, and a hydrophobic moiety, each of which can interact with an anionic payload. [Figure 1B] 1 shows exemplary structures of carrier units and micelles of the present disclosure. In some embodiments, the cationic carrier and the anionic payload are not tethered and interact electrostatically. FIG. 2 shows a schematic diagram of an anionic payload. [Figure 1C] 1A and 1B show exemplary structures of carrier units and micelles of the present disclosure. In some embodiments, the cationic carrier and the anionic payload are tethered and interact electrostatically. 1B shows a schematic diagram of a micelle comprising a cationic carrier and an anionic payload of FIG. [Figure 1D] 1 shows exemplary structures of carrier units and micelles of the present disclosure. 2 shows schematic diagrams of siRNA and cholesterol-conjugated siRNA (e.g., anionic payload).

[0049] [Diagram 2](A)-(I) Exemplary compositions of cationic carrier units are shown. (A) A carrier unit includes a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit that includes 60 lysine residues, where all lysine residues are unmodified (e.g., contain positively charged amines, e.g., -NH3+). (B) A carrier unit includes a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit that includes 45 lysine residues, where 30 lysine residues are unmodified (e.g., contain positively charged amines, e.g., -NH3+), and 15 lysine residues are modified to include a hydrophobic moiety (e.g., a vitamin). (C) shows a carrier unit comprising a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 60 lysine residues, where 30 lysine residues are unmodified (e.g., contain positively charged amines, e.g., -NH3+), and 30 lysine residues are modified to contain hydrophobic moieties (e.g., vitamins). (D) shows a carrier unit comprising a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 60 lysine residues, where 30 lysine residues are unmodified (e.g., contain positively charged quaternary amines), 10 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 20 lysine residues are modified to contain hydrophobic moieties (e.g., vitamins). (E) A carrier unit comprising a targeting moiety, a water soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, where 60 lysine residues are unmodified (e.g., comprise positively charged quaternary amines), 5 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 15 lysine residues are modified to comprise a hydrophobic moiety (e.g., a vitamin).(F) shows a carrier unit comprising a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, with the exception that 50 lysine residues are unmodified (e.g., contain positively charged quaternary amines), 5 lysine residues are modified for cross-linking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 25 lysine residues are modified to contain a hydrophobic moiety (e.g., vitamin). (G) shows a carrier unit comprising a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, with the exception that 45 lysine residues are unmodified (e.g., contain positively charged quaternary amines), 5 lysine residues are modified for cross-linking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 30 lysine residues are modified to contain a hydrophobic moiety (e.g., vitamin). (H) shows a carrier unit comprising a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, with the exception that 40 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3+), 10 lysine residues are modified for cross-linking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin). (I) shows a carrier unit comprising a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, with the exception that 35 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3+), 15 lysine residues are modified for cross-linking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).

[0050] [Diagram 3]1H-NMR characterization of tissue-specific targeting polymer structures and carriers for nucleotide micelle delivery. The 1H-NMR chart corresponding to the targeting moiety (labeled "targeting molecule") shows that the targeting moiety (an amino acid moiety with a cyclic structure that binds to the LAT1 target in brain endothelial cells) was successfully synthesized. The second 1H-NMR chart (labeled "polymer") shows that the cationic PEG block copolymer (also containing a cationic carrier moiety and a hydrophobic moiety) was also synthesized.

[0051] [Figure 4](A)-(E) Exemplary compositions of cationic carrier units of antisense oligonucleotide (ASO) micelles are shown. (A) A carrier unit is shown that includes a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit that includes 60 lysine residues, where 60 lysine residues are unmodified (e.g., contain positively charged amines, e.g., -NH3+). (B) A carrier unit is shown that includes a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit that includes 45 lysine residues, where 30 lysine residues are unmodified (e.g., contain positively charged amines, e.g., -NH3+), and 15 lysine residues are modified to include a hydrophobic moiety (e.g., a vitamin). (C) shows a carrier unit comprising a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 60 lysine residues, with the exception that 30 lysine residues are unmodified (e.g., contain positively charged amines, e.g., -NH3+), and 30 lysine residues are modified to contain hydrophobic moieties (e.g., vitamins). (D) shows a carrier unit comprising a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 60 lysine residues, with the exception that 30 lysine residues are unmodified (e.g., contain positively charged amines, e.g., -NH3+), 10 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 20 lysine residues are modified to contain hydrophobic moieties (e.g., vitamins). (E) A carrier unit comprising a targeting moiety, a water soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, where 35 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3+), 15 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).

[0052] [Figure 5A] Figure 4 shows particle size and count rate at increasing N / P ratios for different compositions of cationic carrier units and antisense oligonucleotide (ASO) micelles as measured by Zetasizer. A schematic diagram of compound A is shown (see Figure 4(A)). Figure 4 shows the count rate, polydispersity index (PDI) and particle size of micelles containing 21-mer nucleotides (e.g., anionic payloads) and compounds A-D and I as cationic carrier units with N / P ratios ranging from 0.2 to 2.4. [Figure 5B] Figure 4 shows particle size and count rate at increasing N / P ratios for different compositions of cationic carrier units and antisense oligonucleotide (ASO) micelles as measured by Zetasizer. A schematic diagram of compound B is shown (see Figure 4(B)). Figure 4 shows count rate, polydispersity index (PDI) and particle size of micelles containing 21-mer nucleotides (e.g., anionic payloads) and compounds A-D and I as cationic carrier units with N / P ratios from 0.2 to 2.4. [Figure 5C] Figure 4 shows particle size and count rate at increasing N / P ratios for different compositions of cationic carrier units and antisense oligonucleotide (ASO) micelles as measured by Zetasizer. A schematic diagram of compound C is shown (see Figure 4(C)). Figure 4 shows count rate, polydispersity index (PDI) and particle size of micelles containing 21-mer nucleotides (e.g., anionic payloads) and compounds A-D and I as cationic carrier units with N / P ratios from 0.2 to 2.4. [Figure 5D] Figure 4 shows particle size and count rate at increasing N / P ratios for different compositions of cationic carrier units and antisense oligonucleotide (ASO) micelles as measured by Zetasizer. A schematic diagram of compound D is shown (see Figure 4(D)). Figure 4 shows count rate, polydispersity index (PDI) and particle size of micelles containing 21-mer nucleotides (e.g., anionic payloads) and compounds A-D and I as cationic carrier units with N / P ratios from 0.2 to 2.4. [Figure 5E]Figure 4 shows particle size and count rate at increasing N / P ratios for different compositions of cationic carrier units and antisense oligonucleotide (ASO) micelles as measured by Zetasizer. A schematic diagram of compound I is shown (see Figure 4(E)). Figure 4 shows count rate, polydispersity index (PDI) and particle size of micelles containing 21-mer nucleotides (e.g., anionic payloads) and compounds A-D and I as cationic carrier units with N / P ratios from 0.2 to 2.4.

[0053] [Figure 6] Figure 1 shows that expression of SIRT1 and PGC-1α is increased in mouse brain cortex after a single intracerebroventricular administration of micelles encapsulating miR-485 inhibitor (SEQ ID NO: 18) (shown as "RNA"). Expression levels of SIRT1 (left graph) and PGC-1α (right graph) are shown 6, 24, 48, and 72 hours after administration of miR-485 inhibitor-loaded micelles (100 μg / mouse). Expression levels of SIRT1 and PGC-1α are shown normalized to control (i.e., expression levels in mice not treated with miR-485 inhibitor). Percentage values ​​shown represent the average increase (%) in expression of SIRT1 and PGC-1α relative to control 48 hours after administration of miR-485 inhibitor. p-values ​​shown represent p-values ​​of t-test.

[0054] [Figure 7]Figure 1 shows that expression of SIRT1 and PGC-1α is increased in the hippocampus of mice after a single intracerebroventricular administration of RNA-loaded micelles, i.e., micelles encapsulating miR-485 inhibitor (SEQ ID NO: 18). Expression levels of SIRT1 (left graph) and PGC-1α (right graph) are shown 6, 24, 48, and 72 hours after administration of miR-485 inhibitor (100 μg / mouse). Expression levels of SIRT1 and PGC-1α are shown normalized to control (i.e., expression levels in mice not treated with miR-485 inhibitor). Percentage values ​​shown represent the average increase (%) in expression of SIRT1 and PGC-1α relative to control 24 hours after administration of miR-485 inhibitor. p-values ​​shown represent p-values ​​of t-test.

[0055] [Figure 8] Figure 2 shows that CD36 expression is increased in mouse brain after a single intracerebroventricular administration of micelles containing miR-485 inhibitor (100 μg / mouse). CD36 expression levels are shown 24, 48, 72, and 120 hours after administration of miR-485 inhibitor (100 μg / mouse). CD36 expression is shown normalized to control (i.e., expression level in mice not treated with miR-485 inhibitor). Percentage values ​​shown represent the average increase (%) in CD36 expression over control 48 hours after administration of miR-485 inhibitor. p-values ​​shown represent the p-value of a t-test.

[0056] [Figure 9] FIG. 1 shows a schematic representation of the molecular forces driving micelle formation between cholesterol-conjugated siRNA and carrier units described herein.

[0057] [Figure 10](A)-(D) Exemplary compositions of cationic carrier units of cholesterol-conjugated siRNA micelles. (A) A carrier unit comprising a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, where 60 lysine residues are unmodified (e.g., containing a positively charged amine, e.g., -NH3+), 5 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 15 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin). (B) shows a carrier unit comprising a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, with the exception that 50 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3+), 5 lysine residues are modified for cross-linking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 25 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin). (C) shows a carrier unit comprising a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, with the exception that 45 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3+), 5 lysine residues are modified for cross-linking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin). (D) A carrier unit comprising a targeting moiety, a water soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, where 40 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3+), 10 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).

[0058] [Figure 11] (A)-(D) show the molar ratio of polymer (eg, carrier units) to cholesterol-conjugated siRNA and their corresponding particle sizes (nanometers) for the micelles shown in Figures 10A-10D, respectively.

[0059] [Figure 12] A chart showing the change in micelle encapsulation efficiency due to hydrophobic interactions for the carrier units shown in Figures 10(A) to 10(D) is shown.

[0060] [Figure 13] Optimal carrier units for micellar encapsulation of cholesterol-conjugated siRNA (e.g., 14-30 mer) are shown.

[0061] [Figure 14] 1 shows the molecular forces for micelle formation between siRNA and a polymer (eg, a carrier unit described herein).

[0062] [Figure 15](A)-(E) Exemplary compositions of cationic carrier units of siRNA (e.g., 21-mer) micelles are shown. (A) A carrier unit including a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit including 80 lysine residues, where 60 lysine residues are unmodified (e.g., include a positively charged amine, e.g., -NH3+), 5 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 15 lysine residues are modified to include a hydrophobic moiety (e.g., a vitamin). (B) shows a carrier unit comprising a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, with the exception that 50 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3+), 5 lysine residues are modified for cross-linking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 25 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin). (C) shows a carrier unit comprising a targeting moiety, a water-soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, with the exception that 45 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3+), 5 lysine residues are modified for cross-linking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin). (D) A carrier unit comprising a targeting moiety, a water soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, where 40 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3+), 10 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).(E) A carrier unit comprising a targeting moiety, a water soluble polymer (e.g., polyethylene glycol), and a cationic carrier unit comprising 80 lysine residues, where 35 lysine residues are unmodified (e.g., contain a positively charged amine, e.g., -NH3+), 15 lysine residues are modified for crosslinking (e.g., linked to a thiol, alkylthiol, or lysine-thiol), and 30 lysine residues are modified to contain a hydrophobic moiety (e.g., a vitamin).

[0063] [Figure 16A] Figure 15 shows particle size and count rates for different compositions of cationic carrier units and siRNA (e.g., 21-mer) micelles with increasing N / P ratios as measured by Zetasizer. A schematic diagram of compound E is shown (see Figure 15(A)). Also shown are count rates and particle sizes for micelles containing 21-mer nucleotides (e.g., anionic payloads) and compounds E-I as cationic carrier units with N / P ratios ranging from 0.2 to 2.4. [Figure 16B] The particle size and count rate as measured by Zetasizer for different compositions of cationic carrier units and siRNA (e.g., 21-mer) micelles with increasing N / P ratios are shown. A schematic diagram of compound F is shown (see FIG. 15(B)). Also shown are the count rates and particle sizes of micelles containing 21-mer nucleotides (e.g., anionic payloads) and compounds E-I as cationic carrier units with N / P ratios ranging from 0.2 to 2.4. [Figure 16C] The particle size and count rate for different compositions of cationic carrier units and siRNA (e.g., 21-mer) micelles at increasing N / P ratios as measured by Zetasizer. A schematic diagram of compound G is shown (see FIG. 15(C)). Also shown are the count rates and particle sizes of micelles containing 21-mer nucleotides (e.g., anionic payloads) and compounds E-I as cationic carrier units with N / P ratios ranging from 0.2 to 2.4. [Figure 16D]The particle size and count rate as measured by Zetasizer for different compositions of cationic carrier units and siRNA (e.g., 21-mer) micelles with increasing N / P ratios are shown. A schematic diagram of compound H is shown (see FIG. 15(D)). Also shown are the count rates and particle sizes of micelles containing 21-mer nucleotides (e.g., anionic payloads) and compounds E-I as cationic carrier units with N / P ratios ranging from 0.2 to 2.4. [Figure 16E] Figure 15 shows particle size and count rates for different compositions of cationic carrier units and siRNA (e.g., 21-mer) micelles with increasing N / P ratios as measured by Zetasizer. A schematic diagram of compound I is shown (see Figure 15(E)). Also shown are count rates and particle sizes for micelles containing 21-mer nucleotides (e.g., anionic payloads) and compounds E-I as cationic carrier units with N / P ratios ranging from 0.2 to 2.4.

[0064] [Figure 17] (A)-(E) show the molar ratio of polymer (eg, carrier unit) to siRNA for the micelles of Figures 15(A)-15(E) (i.e., compounds E, F, G, H, and I), respectively.

[0065] [Figure 18] Optimal carrier units for micellar encapsulation of siRNA (e.g., 14-30 mer) are shown.

[0066] [Figure 19] Figure 2 shows the cell viability of GL261 Red-FLuc cells after treatment with different concentrations of siRNA micelles.

[0067] [Figure 20] (A) and (B) show the in vitro mRNA knockdown efficacy of siRNA micelles using a luciferase assay as measured by IVIS®. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0068] The present disclosure is directed to carrier units that include a water-soluble biopolymer moiety (e.g., PEG), a charged moiety (e.g., polylysine), a cross-linking moiety, and a hydrophobic moiety. A cationic carrier unit can be packaged into a micelle when the unit interacts with an anionic payload, where the payload is located in the core of the micelle, the water-soluble biopolymer moiety faces the solvent, the cross-linking moiety cross-links one unit with another carrier unit, and the hydrophobic moiety is exposed on the surface of the micelle. Non-limiting examples of various embodiments are provided in the present disclosure.

[0069] Prior to describing the disclosure in more detail, it should be understood that the disclosure is not limited to specific compositions or process steps, as the specific compositions or process steps described may of course vary. As will be apparent to one of ordinary skill in the art upon reading this disclosure, each of the individual aspects described and illustrated herein has distinct components and features that may be readily separated from or combined with the features of any of the other several aspects without departing from the scope or spirit of the disclosure. Any recited method may be carried out in the order of events recited or in any other order that is logically possible.

[0070] The headings provided herein are not intended to be limitations of the various aspects of the disclosure, which aspects may be defined by reference to the entire specification. It should also be understood that the terminology used herein is for the purpose of describing particular aspects only and is not intended to be limiting, since the scope of the disclosure is limited only by the appended claims.

[0071] Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.

[0072] I. Definition In order that this specification may be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the Detailed Description.

[0073] It should be noted that an entity designated with the term "a" or "an" refers to one or more of that entity, e.g., "a nucleotide sequence" is understood to represent one or more nucleotide sequences. Thus, "a" (or "an"), as well as "one or more" and "at least one" may be used interchangeably in this disclosure. It should also be noted that the claims may be drafted to exclude any optional element. Thus, this statement shall serve as a predicate to the use of exclusive language such as "only", "only", and the like, or to the use of a limitation by negative in connection with the recitation of claim elements.

[0074] Furthermore, as used herein, "and / or" should be understood as a specific disclosure of each of two particular features or elements with or without the other. Thus, the term "and / or" used herein in phrases such as "A and / or B" is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to include each of the following embodiments: A, B, and C, A, B, or C, A or C, A or B, B or C, A and C, A and B, B and C, A (only), B (only), and C (only).

[0075] Whenever an embodiment is described in this specification using the term "comprising," it should be understood that other similar embodiments described using the terms "consisting of" and / or "consisting essentially of" are also provided.

[0076] Unless otherwise defined, all technical and scientific terms used herein shall have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. For example, Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press, The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press, and Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press provide those of ordinary skill in the art with a general dictionary of many of the terms used in this disclosure.

[0077] Units, prefixes, and symbols are indicated in the format accepted by their Systeme International de Unites (SI). Numeric ranges are intended to be inclusive of the numerical values ​​defining the range. When a range of numerical values ​​is described, it is to be understood that each intervening integer value between the stated upper and lower limits of the range, and each fraction thereof, is also specifically disclosed, along with each subrange between such values. Although the upper and lower limits of any range may be independently included or excluded from the range, each range in which either limit is included, neither limit is included, or both limits are included is also encompassed by the disclosure. Thus, ranges described herein are understood to be shorthand notations of all values ​​within the range, including the stated endpoints. For example, a range of 1 to 10 is understood to include any number, combination of numbers, or subrange from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.

[0078] When a value is explicitly stated, it should be understood that values ​​that are approximately the same number or amount as the stated value are also included within the scope of the disclosure. When a combination is disclosed, each subcombination of the elements of the combination is also specifically disclosed and is included within the scope of the disclosure. Conversely, when different elements or groups of elements are disclosed separately, their combinations are also disclosed. When any element of a disclosure is disclosed as having multiple options, examples of the disclosure in which each option is excluded, alone or in any combination with other options, are also disclosed herein. In other words, multiple elements of a disclosure can have such an exclusion, and all combinations of elements with such exclusion are disclosed herein.

[0079] Nucleotides are referred to by their universally accepted single-letter abbreviations. Unless otherwise noted, nucleotide sequences are written from left to right in a 5' to 3' orientation. Nucleotides are referred to herein by the commonly known single-letter symbols for nucleotides recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Thus, "a" represents adenine, "c" represents cytosine, "g" represents guanine, "t" represents thymine, and "u" represents uracil.

[0080] Amino acid sequences are written from left to right in the amino to carboxyl terminus direction. Amino acids are represented herein by the commonly known three letter or one letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.

[0081] The term "about" is used herein to mean approximately, roughly, roughly, or within a range. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values ​​set forth. In general, the term "about" can modify a numerical value above and below the stated value, for example, by a variance of 10 percent (higher or lower) above or below.

[0082] The terms "administration", "administering" and grammatical variations thereof refer to the introduction of a composition, such as a micelle, of the present disclosure, into a subject by a pharma- ceutically acceptable route. The introduction of a composition, such as a micelle, of the present disclosure into a subject is by any suitable route, including intratumoral, oral, pulmonary, intranasal, parenteral (intravenous, intraarterial, intramuscular, intraperitoneal, or subcutaneous), rectal, intralymphatic, intrathecal, periocular, or topical. Administration includes self-administration and administration by another. The appropriate route of administration allows the composition or agent to perform its intended function. For example, if the appropriate route is intravenous, the composition is administered by introducing the composition or agent into the subject's vein.

[0083] As used herein, the term "approximately" when applied to one or more values ​​to which it refers refers to a value similar to a stated reference value. In certain embodiments, the term "approximately" refers to a range of values ​​within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less (above or below a number) in either direction of the stated reference value, unless otherwise stated or otherwise clear from the context (except where such number exceeds 100% of the possible values).

[0084] As used herein, the term "conserved" refers to nucleotides or amino acid residues of polynucleotide or polypeptide sequences, respectively, that are invariably found in the same position in two or more sequences that are being compared. Relatively conserved nucleotides or amino acids are those that are more conserved between related sequences than nucleotides or amino acids that occur in other parts of the sequences.

[0085] Any amino acid, such as lysine, used in conjunction with the cationic carrier may be substituted with its natural side group (e.g., the -NH +), or by having a modified side group. Any amino acid used in conjunction with a cross-linking or hydrophobic moiety, e.g., lysine, may not bear a positive charge and may be attached to a cross-linking agent (e.g., a thiol) or hydrophobic agent (e.g., vitamin B3) by an amide bond or a linker, respectively.

[0086] As used herein, the term "N / P ratio" refers to the molar ratio of protonated amine in the cationic carrier moiety of the cationic carrier unit to phosphate in the anionic payload when the cationic carrier unit and the anionic payload are mixed together in solution.

[0087] In some embodiments, two or more sequences are said to be "fully conserved" or "identical" if they are 100% identical to each other. In some embodiments, two or more sequences are said to be "highly conserved" if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to each other. In some embodiments, two or more sequences are said to be "highly conserved" if they are about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to each other. In some embodiments, two or more sequences are said to be "conserved" if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to each other. In some embodiments, two or more sequences are said to be "conserved" if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another. Sequence conservation can apply to the entire length of a polynucleotide or polypeptide, or to portions, regions, or features thereof.

[0088] As used herein, the term "derived from" refers to a component that is isolated or produced from a particular molecule or organism using a particular molecule or organism or information (e.g., amino acid or nucleic acid sequence). For example, a nucleic acid sequence derived from a second nucleic acid sequence may contain a nucleotide sequence that is identical or substantially similar to the nucleotide sequence of the second nucleic acid sequence. In the case of a nucleotide or polypeptide, the derived species may be obtained, for example, by naturally occurring mutagenesis, artificially directed mutagenesis, or artificially random mutagenesis. The mutagenesis used to derive a nucleotide or polypeptide may be intentionally directed or intentionally random, or a combination of each. Mutagenesis of a nucleotide or polypeptide to create a different nucleotide or polypeptide derived from the first one may be a random event (e.g., caused by polymerase infidelity), and identification of the derived nucleotide or polypeptide may be made, for example, by a suitable screening method described herein. Mutagenesis of a polypeptide usually involves the manipulation of a polynucleotide that encodes the polypeptide.In some embodiments, a nucleotide or amino acid sequence derived from a second nucleotide or amino acid sequence has a similar sequence identity to the second nucleotide or amino acid sequence, respectively, of at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 110%, at least about 111%, at least about 112%, at least about 113%, at least about 114%, at least %, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity, where the first nucleotide or amino acid sequence retains the biological activity of the second nucleotide or amino acid sequence.

[0089] The terms "complementary" and "complementarity" refer to two or more oligomers (i.e., each containing a nucleobase sequence) related to each other by Watson-Crick base pairing rules, or between an oligomer and a target gene. For example, the nucleobase sequence "TGA(5'→3')" is complementary to the nucleobase sequence "ACT(3'→5')". Complementarity can be "partial", in which fewer than all of the nucleobases of a given nucleobase sequence match another nucleobase sequence according to the base pairing rules. For example, in some embodiments, the complementarity between a given nucleobase sequence and another nucleobase sequence can be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. Or, as an example, "perfect" or "complete" (100%) complementarity can exist between a given nucleobase sequence and another nucleobase sequence. The degree of complementarity between nucleobase sequences significantly affects the efficiency and strength of hybridization between the sequences.

[0090] The term "downstream" refers to a nucleotide sequence that is located 3' of a reference nucleotide sequence. In certain embodiments, the downstream nucleotide sequence relates to a sequence that follows the transcription start point. For example, the translation start codon of a gene is located downstream of the transcription start site.

[0091] The terms "excipient" and "carrier" are used interchangeably and refer to an inert substance added to a pharmaceutical composition to further facilitate administration of a compound.

[0092] As used herein, the term "homology" refers to the overall relatedness between polymer molecules, such as between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In general, the term "homology" refers to the evolutionary relationship of two molecules. Thus, two homologous molecules share a common evolutionary ancestry. In the context of this disclosure, the term homology encompasses both identity and similarity.

[0093] In some embodiments, polymer molecules are considered to be "homologous" to one another if at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of the monomers in the molecules are identical (exactly the same monomers) or similar (conservative substitutions). The term "homologous" necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences).

[0094] As used herein, the term "identity" refers to the overall monomer conservation between polymer molecules, e.g., between polypeptide molecules or polynucleotide molecules (e.g., DNA molecules and / or RNA molecules). The term "identical" without any additional modifiers, e.g., "protein A is identical to protein B," means that the sequences are 100% identical (100% sequence identity). For example, describing two sequences as "70% identical" is equivalent to describing them as having, e.g., "70% sequence identity."

[0095] The calculation of the percent identity (%) of two polypeptide or polynucleotide sequences can be performed, for example, by aligning the two sequences for optimal comparison (e.g., gaps can be introduced into one or both of the first and second polypeptide or polynucleotide sequences for optimal alignment, and non-identical sequences can be ignored for comparison). In certain embodiments, the length of the sequence aligned for comparison is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or about 100% of the full length of the reference sequence. The amino acids at corresponding amino acid positions, or bases in the case of polynucleotides, are then compared.

[0096] When a position in the first sequence is occupied by the same amino acid as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap. The comparison of sequences and the determination of the percent identity between two sequences can be accomplished using a mathematical algorithm.

[0097] Suitable software programs are available from a variety of commercial sources and are available for alignment of both protein and nucleotide sequences. One suitable program for determining percent sequence identity is bl2seq, which is part of the BLAST package of programs available from the U.S. government's National Center for Biotechnology Information BLAST website (blast.ncbi.nlm.nih.gov). Bl2seq performs comparisons between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, whereas BLASTP is used to compare amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water, or Matcher, which are part of the EMBOSS bioinformatics suite and available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa.

[0098] Sequence alignment can be performed using methods known in the art, such as MAFFT, Clustal (ClustalW, Clustal X, or Clustal Omega), MUSCLE, and the like.

[0099] Different regions in a single polynucleotide or polypeptide target sequence that aligns with a polynucleotide or polypeptide reference sequence can each have their own percent sequence identity. Note that percent sequence identity is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, and 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. Note that length values ​​are always integers.

[0100] In certain embodiments, the percentage identity (%ID) or identity of a first amino acid sequence (or nucleic acid sequence) to a second amino acid sequence (or nucleic acid sequence) is calculated as %ID=100×(Y / Z), where Y is the number of amino acid residues (or nucleic acid bases) that are evaluated as perfect matches in an alignment of the first and second sequences (aligned by visual inspection or by a specific sequence alignment program), and Z is the total number of residues in the second sequence. If the length of the first sequence is greater than the length of the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence.

[0101] Those skilled in the art will understand that the generation of sequence alignment for calculating the sequence identity percentage is not limited to binary sequence comparison performed only by primary sequence data. It will also be understood that sequence alignment can be generated by integrating sequence data with data from heterogeneous sources, such as structural data (e.g., protein crystal structures), functional data (e.g., mutation locations), or phylogenetic data. A suitable program for integrating heterogeneous data to generate multiple sequence alignments is available at www.tcoffee.org, alternatively, for example, T-Coffee available from EBI. It will also be understood that the final alignment used to calculate the sequence identity percentage can be managed either automatically or manually.

[0102] As used herein, the terms "isolated," "purified," "extracted," and grammatical variations thereof are used interchangeably and refer to a preparation of the desired composition of the present disclosure that has undergone one or more purification processes. In some aspects, as used herein, isolation or purification is a process of removing, partially removing (e.g., a fraction of), the composition of the present disclosure from a sample containing contaminants. In some aspects, the isolated composition has no detectable undesirable activity, or alternatively, the level or amount of the undesirable activity is below an acceptable level or amount. In other aspects, the isolated composition has an amount and / or concentration of the desired composition of the present disclosure that is above an acceptable amount and / or concentration and / or activity. In other aspects, the isolated composition is concentrated compared to the starting material from which the composition is obtained. This enrichment can be at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.9%, at least about 99.99%, at least about 99.999%, at least about 99.9999%, or more than 99.9999% compared to the starting material. In some embodiments, the isolated preparation is substantially free of residual biological products. In some embodiments, the isolated preparation is 100%, at least about 99%, at least about 98%, at least about 97%, at least about 96%, at least about 95%, at least about 94%, at least about 93%, at least about 92%, at least about 91%, or at least about 90% free of any contaminating biological material. The remaining biological products may include non-biological materials (including chemicals) or unwanted nucleic acids, proteins, lipids, or metabolic products.

[0103] As used herein, the term "linked" refers to a first amino acid sequence or polynucleotide sequence that is covalently or non-covalently linked to a second amino acid sequence or polynucleotide sequence, respectively. The first amino acid or polynucleotide sequence may be directly linked or juxtaposed to the second amino acid or polynucleotide sequence, or alternatively, an intervening sequence may be covalently linked from the first sequence to the second sequence. The term "linked" does not only mean the fusion of the first polynucleotide sequence to the second polynucleotide sequence at the 5' or 3' end, but also includes the insertion of the entire first polynucleotide sequence (or the second polynucleotide sequence, respectively) into any two nucleotides in the second polynucleotide sequence (or the first polynucleotide sequence). The first polynucleotide sequence may be linked to the second polynucleotide sequence by a phosphodiester bond or a linker. The linker may be, for example, a polynucleotide.

[0104] The terms "miRNA" or "miR" or "microRNA" are used interchangeably and refer to microRNA molecules found in eukaryotes that are involved in RNA-based gene regulation. The term is used to refer to single-stranded RNA molecules processed from precursors. The names of miRNAs and their sequences relevant to this disclosure are provided herein. MicroRNAs recognize and bind to target mRNAs through imperfect base pairing, resulting in destabilization or translational inhibition of the target mRNA, thereby downregulating target gene expression. Conversely, targeting of miRNAs with molecules that contain miRNA binding sites (generally molecules that contain sequences complementary to the seed region of the miRNA) can reduce or inhibit the translational inhibition induced by the miRNA, resulting in upregulation of the target gene.

[0105] The term "mismatch" or "multiple mismatches" refers to one or more nucleobases (whether contiguous or separated) in an oligomer nucleobase sequence that do not match the target pre-mRNA according to base pairing rules. While perfect complementarity is often desired, some embodiments may include one or more, but preferably six, five, four, three, two, or one mismatches to the target pre-mRNA. Variations at any position within the oligomer are included. In certain embodiments, the antisense oligomers of the present disclosure include variations in nucleobase sequence near the ends, variations internally, and when present, are usually within about 6, 5, 4, 3, 2, or 1 subunit of the 5' and / or 3' ends. In certain embodiments, one, two, or three nucleobases may be removed and still provide accurate binding.

[0106] As used herein, the terms "modulate" and "modify" and grammatical variations thereof, when applied to a particular concentration, level, expression, function, or behavior, generally refer to the ability to increase or decrease, e.g., directly or indirectly, by promoting / stimulating / upregulating or interfering with / inhibiting / downregulating, a particular concentration, level, expression, function, or behavior, e.g., to act as an antagonist or agonist. In some cases, a modulator may increase and / or decrease a particular concentration, level, activity, or function compared to a control, or compared to an average level of activity generally expected, or compared to a control level of activity.

[0107] "Nucleic acid", "nucleic acid molecule", "nucleotide sequence", "polynucleotide", and grammatical variations thereof, are used interchangeably and refer to ribonucleosides (adenosine, guanosine, uridine, or cytidine; "RNA molecule") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, thymidine, or deoxycytidine; "DNA molecule") in the phosphate polymeric form, either in single-stranded form or double-stranded helices, or any phosphoester analogs thereof, such as phosphorothioates and thioesters. A single-stranded nucleic acid sequence refers to single-stranded DNA (ssDNA) or single-stranded RNA (ssRNA). Double-stranded DNA-DNA, DNA-RNA, and RNA-RNA helices are possible. The terms nucleic acid molecule, and in particular DNA or RNA molecule, refer only to the primary and secondary structure of the molecule and are not limited to any particular tertiary form. Thus, the term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA, and chromosomes. When describing the structure of a particular double-stranded DNA molecule, the sequence may be described herein according to the normal convention of providing only the sequence in the 5' to 3' direction along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to mRNA). A "recombinant DNA molecule" is a DNA molecule that has been subjected to molecular biological manipulation. DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA. A "nucleic acid composition" of the present disclosure comprises one or more nucleic acids as described herein.

[0108] As used herein, the phrases "parenteral administration" and "administered parenterally" refer to modes of administration other than enteral and topical administration, usually by injection, including, but not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.

[0109] The terms "pharmaceutically acceptable carrier", "pharmaceutically acceptable excipient", and grammatical variations thereof, include any agent approved by a regulatory agency of the U.S. Federal government for use in animals, including humans, or listed in the U.S. Pharmacopeia, as well as any carrier or diluent that does not cause the production of undesirable physiological effects to an extent that would prohibit administration of the composition to a subject, and does not inhibit the biological activity and properties of the compound being administered. Included are excipients and carriers that are generally safe, non-toxic, and desirable, and that are useful in preparing pharmaceutical compositions.

[0110] As used herein, the term "pharmaceutical composition" refers to one or more of the compounds described herein, such as, for example, the micelles of the present disclosure, mixed or admixed with or suspended in one or more other chemical components, such as pharma- ceutically acceptable carriers and excipients. One purpose of a pharmaceutical composition is to facilitate administration of a micelle preparation to a subject.

[0111] As used herein, the term "polynucleotide" refers to a polymer of any length of nucleotides, including ribonucleotides, deoxyribonucleotides, their analogs, or mixtures thereof. The term refers to the primary structure of the molecule. Thus, the term includes triple-, double-, and single-stranded deoxyribonucleic acid ("DNA"), as well as triple-, double-, and single-stranded ribonucleic acid ("RNA"). The term also includes modified polynucleotides, for example, by alkylation and / or capping, as well as unmodified forms of polynucleotides.

[0112] More specifically, the term "polynucleotide" includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, hRNA, siRNA, and mRNA, whether spliced ​​or unspliced, any other type of polynucleotide that is an N- or C-glycoside of purine or pyrimidine bases, as well as other polymers that contain non-nucleotide backbones, such as polyamides (e.g., peptide nucleic acids, "PNAs") and polymorpholino polymers, and other sequence-specific synthetic nucleic acid polymers, provided they contain nucleobases in an arrangement that allows for base pairing and base stacking as found in DNA and RNA.

[0113] In some embodiments of the present disclosure, polynucleotide can be an oligonucleotide, such as, for example, antisense oligonucleotide.In some embodiments, oligonucleotide is RNA.In some embodiments, RNA is synthetic RNA.In some embodiments, synthetic RNA comprises at least one non-natural nucleobase.In some embodiments, all nucleobases of a certain type are replaced with non-natural nucleobases (for example, all uridines in the polynucleotides disclosed herein can be replaced with non-natural nucleobases, such as 5-methoxyuridine).

[0114] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. Polymers may contain modified amino acids. These terms encompass amino acid polymers that are naturally modified or modified by intervention, such as, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. For example, polypeptides containing one or more amino acid analogs (including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine), and other modifications known in the art, are also included within the definition. As used herein, the term "polypeptide" refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments, and other equivalents, variants, and analogs of the above. A polypeptide may be a single polypeptide or a multi-molecular complex, such as a dimer, trimer, or tetramer. They may also include single chain or multi-chain polypeptides. Most commonly, disulfide bonds are found in multi-chain polypeptides. The term polypeptide may also apply to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of corresponding naturally occurring amino acids. In some embodiments, a "peptide" may be 50 amino acids or less in length, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.

[0115] As used herein, the terms "prevent", "preventing", and variations thereof, refer to partially or completely delaying the onset of a disease, disorder, and / or condition; partially or completely delaying the onset of one or more symptoms, characteristics, or clinical signs of a particular disease, disorder, and / or condition; partially or completely delaying the onset of one or more symptoms, characteristics, or signs of a particular disease, disorder, and / or condition; partially or completely delaying the progression of a particular disease, disorder, and / or condition; and / or reducing the risk of developing a pathology associated with a disease, disorder, and / or condition. In some embodiments, prevention of an outcome is achieved by prophylactic treatment.

[0116] As used herein, "prophylaxis" refers to a therapeutic action or course of action used to prevent the onset of a disease or condition or to prevent or delay the symptoms associated with a disease or condition.

[0117] As used herein, "prophylaxis" refers to measures taken to maintain health, prevent or delay the onset of bleeding episodes, or prevent or delay symptoms associated with a disease or condition.

[0118] As used herein, the term "similarity" refers to the overall relatedness between polymer molecules, e.g., between polynucleotide molecules (e.g., DNA and / or RNA molecules) and / or between polypeptide molecules. Calculation of percent similarity between polymer molecules relative to each other can be performed similarly to calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as understood in the art. It is understood that percent similarity depends on the comparison measure used, i.e., whether amino acids are compared according to, for example, their evolutionary closeness, charge, volume, flexibility, polarity, hydrophobicity, aromaticity, isoelectric point, antigenicity, or a combination thereof.

[0119] The terms "subject," "patient," "individual," and "host," and variations thereof, are used interchangeably herein and refer to any mammalian subject for which diagnosis, treatment, or therapy is desired, including, but not limited to, humans, domestic animals (e.g., dogs, cats, etc.), livestock (e.g., cows, sheep, pigs, horses, etc.), and laboratory animals (e.g., monkeys, rats, mice, rabbits, guinea pigs, etc.), particularly humans. The methods described herein are applicable to both human therapy and veterinary applications.

[0120] As used herein, the phrase "subject in need thereof" includes subjects, such as mammalian subjects, who would benefit from administration of the micelles of the present disclosure, for example, to improve hemostasis.

[0121] As used herein, the expressions "systemic administration," "systemically administered," "peripheral administration," and "administered peripherally" refer to administration of a compound, drug, or other substance other than directly into the central nervous system, such that it enters the patient's system and is therefore subject to metabolism and other similar processes, e.g., subcutaneous administration.

[0122] As used herein, the term "therapeutically effective amount" refers to an amount of a reagent or pharmaceutical compound, including a micelle of the present disclosure, sufficient to produce a desired therapeutic, pharmacological, and / or physiological effect on a subject in need thereof. A therapeutically effective amount may be a "prophylactically effective amount" where prevention may be considered treatment.

[0123] As used herein, the term "treat", "treatment" or "treating" refers to, for example, reducing the severity of a disease or condition, reducing the duration of a disease course, improving or eliminating one or more symptoms associated with a disease or condition, providing a beneficial effect to a subject having a disease or condition without necessarily curing the disease or condition. This term also includes the prevention or prophylaxis of a disease or condition or its symptoms. In one embodiment, the term "treating" or "treatment" refers to inducing an immune response against an antigen in a subject.

[0124] The term "upstream" refers to a nucleotide sequence that is 5' to a reference nucleotide sequence.

[0125] II. Carrier Unit The present disclosure provides carrier units that can self-assemble into micelles or can be incorporated into micelles. The carrier units of the present disclosure include a water-soluble biopolymer moiety (e.g., PEG), a charged carrier moiety, a cross-linking moiety, and a hydrophobic moiety. In some embodiments, the charged carrier moiety is cationic (e.g., polylysine), as illustrated in Figures 1A-1D and 2A-2I. In some embodiments, the cationic charged carrier moiety and the anionic payload can interact electrostatically with each other. When the cationic charged carrier moiety and the anionic charged payload are mixed together, they can neutralize each other to produce a carrier unit:payload complex. The resulting carrier unit:payload complex can have a "head" that includes the water-soluble biopolymer moiety and a "tail" that includes the cationic carrier moiety electrostatically bound to the anionic payload.

[0126] The carrier unit:payload complexes may self-associate, alone or in combination with other molecules, to provide micelles in which the anionic payload resides in the core of the micelle and the water-soluble biopolymer portion faces the solvent. The term "micelles of the present disclosure" encompasses not only typical micelles, but also small particles, mini-micelles, micelles, rod-shaped structures, or polymersomes. Given that polymersomes include a lumen, it is to be understood that all disclosures relating to the "core" of a typical micelle apply equally to the lumen in polymersomes that include carrier units of the present disclosure.

[0127] The carrier units of the present disclosure may include a targeting moiety (e.g., a targeting ligand) covalently attached to a water-soluble biopolymer moiety by one or more optional linkers. When a micelle is formed, the targeting moiety may be located on the surface of the micelle and may deliver the micelle to a specific target tissue, a specific cell type, and / or facilitate transport through a physiological barrier (e.g., the cell plasma membrane or the BBB) (FIG. 1C). In some embodiments, micelles of the present disclosure may include more than one type of targeting moiety.

[0128] The carrier unit of the present disclosure may also include a hydrophobic moiety (HM) covalently bound to the charged cationic carrier moiety. The hydrophobic moiety can, for example, have a therapeutic effect, a co-therapeutic effect, or positively affect the homeostasis of a target cell or tissue. In some embodiments, the HM includes one or more amino acids. In some embodiments, the HM includes one or more amino acids linked to a hydrophobic molecule (e.g., a vitamin). In some embodiments, the HM includes one or more lysine residues covalently bound to a hydrophobic molecule (e.g., a vitamin).

[0129] In some embodiments, the anionic payload is not covalently linked to the carrier unit, however, in other embodiments, the cationic payload may be covalently linked to the cationic carrier unit, e.g., a linker, such as a cleavable linker.

[0130] Non-limiting examples of various aspects are given in the present disclosure.The present disclosure is particularly related to the use of cationic carrier units to deliver anionic payloads, such as nucleic acids.However, it will be clear to those skilled in the art that the present disclosure can be similarly applied to the delivery of cationic payloads or neutral payloads by reversing the charge of the carrier moiety and the payload (i.e., using an anionic carrier moiety in the carrier unit to deliver cationic payloads), or by using a neutral payload linked to a cationic or anionic adaptor that electrostatically interacts with the anionic or cationic carrier moiety, respectively.

[0131] Thus, in one aspect, the present disclosure provides compounds according to Schemes I-VI: [CC]-L1-[CM]-L2-[HM] (Scheme I), [CC]-L1-[HM]-L2-[CM] (Scheme II), [HM]-L1-[CM]-L2-[CC] (scheme III), [HM]-L1-[CC]-L2-[CM] (scheme IV), [CM]-L1-[CC]-L2-[HM] (Scheme V), or [CM]-L1-[HM]-L2-[CC] (Scheme VI), (In the formula, CC is a cationic carrier moiety, e.g., polylysine; CM is a bridging moiety, HM is a hydrophobic moiety, e.g., a vitamin, e.g., vitamin B3; L1 and L2 are independently an optional linker; A cationic carrier unit is provided in which the number of HMs is less than about 50% relative to [CC] and [CM].

[0132] In some embodiments, the cationic carrier unit further comprises a water-soluble polymer (WP). In some embodiments, the water-soluble polymer is attached to [CC], [HM], and / or [CM]. In some embodiments, the water-soluble polymer is attached to the N-terminus of [CC], [HM], or [CM]. In some embodiments, the water-soluble polymer is attached to the N-terminus of [CC]. In some embodiments, the water-soluble polymer is attached to the C-terminus of [CC], [HM], or [CM]. In some embodiments, the water-soluble polymer is attached to the C-terminus of [CC].

[0133] In some embodiments, the cationic carrier unit is [WP]-L3-[CC]-L1-[CM]-L2-[HM] (scheme I'), [WP]-L3-[CC]-L1-[HM]-L2-[CM] (scheme II'), [WP]-L3-[HM]-L1-[CM]-L2-[CC] (scheme III'), [WP]-L3-[HM]-L1-[CC]-L2-[CM] (scheme IV'), [WP]-L3-[CM]-L1-[CC]-L2-[HM] (scheme V'), or It contains [WP]-L3-[CM]-L1-[HM]-L2-[CC] (Scheme VI').

[0134] In some embodiments, a cationic carrier unit can interact with an anionic payload, for example electrostatically.

[0135] In some embodiments of the constructs of Schemes I'-VI' above, the [WP] component is linked to at least one targeting moiety, i.e., [T] n -[WP]-..., where n is an integer, e.g., 1, 2, or 3.

[0136] Figures 2(A)-2(I) show schematic diagrams of exemplary cationic carrier units of the present disclosure. For simplicity, the units in Figures 2(A)-2(I) are shown linearly. However, in some embodiments, the carrier unit can include CC, CM, and HM configured as a branched scaffold arrangement (see Figure 3), including, for example, (i) a polymeric CC moiety including a positively charged unit (e.g., polylysine), (ii) a CM (e.g., lysine linked to a crosslinker, e.g., lysine-thiol) attached to the N-terminus or C-terminus of the CC moiety, and (iii) an HM (e.g., lysine linked to a hydrophobic substance, e.g., lysine linked to vitamin B3) attached to the N-terminus or C-terminus of the CM.

[0137] When cationic carrier units of the present disclosure are mixed with an anionic payload (e.g., a nucleic acid) at an ionic ratio of about 5: about 1 (i.e., when the number of negative charges in the anionic payload is about 5 times greater than the number of positive charges in the cationic carrier moiety) to about 1: about 5 (i.e., when the number of positive charges in the cationic carrier moiety is about 5 times greater than the number of negative charges in the anionic payload), a cationic carrier unit:anionic payload complex is formed having unchanged hydrophilic portions (including WP moieties) and significantly more hydrophobic portions (attributed to the bonds between the cationic carrier moiety plus hydrophobic portions and the bridging portion and the anionic payload) due to neutralization of the negative charges in the anionic payload by the positive charges in the cationic carrier moiety, primarily via electrostatic interactions.

[0138] In some embodiments, the hydrophobic moiety can contribute its own positive charge to the positive charge of the cationic carrier moiety which interacts with the negative charge of the anionic payload. It should be understood that references to interactions (e.g., electrostatic interactions) between the cationic carrier moiety and the anionic payload also encompass interactions between the charges of the hydrophobic moiety and the cationic carrier moiety and the charge of the anionic payload.

[0139] The increased hydrophobicity of the cationic carrier moiety of the cationic carrier unit due to neutralization of the positive charge by electrostatic interaction with the negative charge of the anionic payload results in an amphiphilic complex. Such an amphiphilic complex, alone or in combination with other amphiphilic components, can self-assemble into micelles. The resulting micelles contain the WP moiety facing the solvent (i.e., the WP moiety faces the exterior surface of the micelle) (Figure 1C), whereas the CC, CM, and HM moieties, as well as the attached payload (e.g., a nucleotide sequence, e.g., an oligonucleotide, siRNA, shRNA, "antimir," or any combination thereof) reside in the core of the micelle.

[0140] In some particular embodiments, the cationic carrier unit is (a) a WP moiety, wherein the water soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), where n is from about 120 to about PEG 130 (e.g., PEG is PEG 5000 or PEG 6000); (b) a CC moiety, the cationic carrier moiety comprising, for example, about 30 to about 40 lysines (e.g., linear poly(L-lysine)n, where n is about 30 to about 40), polyethyleneimine (PEI), or chitosan; (c) a CM moiety, the cross-linking moiety comprising about 10 to about 20 lysines (e.g., 10 to 20 lysine-thiols), each of which is bound to a cross-linking agent; (c) an HM portion, the hydrophobic portion having about 30 to about 40 lysines, each bound to a vitamin B3 unit.

[0141] In some embodiments, the cationic carrier unit is (a) a CC moiety, wherein the cationic carrier moiety comprises about 30 to about 35 lysines, e.g., about 32 lysines; (b) a CM moiety, the cross-linking moiety comprising about 15 lysines to about 20 lysines, e.g., 16 lysines (e.g., lysine-thiol), each of which is bound to a cross-linking agent; (c) an HM portion, the hydrophobic portion comprising about 30 to about 35 lysines, for example about 32 lysines (e.g., lysine-vitamin B3), each of which is bound to a hydrophobic substance.

[0142] In some particular embodiments, the cationic carrier unit is (a) a CC moiety, wherein the cationic carrier moiety comprises about 25 to about 35 lysines, e.g., about 30, 31, or 32 lysines; (b) a CM moiety, the cross-linking moiety comprising about 15 lysines to about 20 lysines, e.g., 15, 16, or 17 lysines (e.g., lysine-thiol), each of which is bound to a cross-linking agent; (c) an HM portion, wherein the hydrophobic portion contains about 25 to about 35 lysines, e.g., about 30, 31, or 32 lysines (e.g., lysine-vitamin B3), each of which is bound to a hydrophobic substance.

[0143] In some embodiments, the cationic carrier unit is (a) a CC moiety, wherein the cationic carrier moiety comprises about 30 to about 60 lysines, e.g., about 60 lysines; (b) a CM moiety, the cross-linking moiety comprising about 5 lysines to about 15 lysines, e.g., 5 lysines (e.g., lysine-thiol), each of which is bound to a cross-linking agent; (c) an HM portion, the hydrophobic portion comprising about 15 to about 30 lysines, for example about 15 lysines (e.g., lysine-vitamin B3), each of which is bound to a hydrophobic substance.

[0144] In some embodiments, the cationic carrier unit is (a) a CC moiety, wherein the cationic carrier moiety comprises about 30 to about 60 lysines, e.g., about 50 lysines; (b) a CM moiety, the cross-linking moiety comprising about 5 lysines to about 15 lysines, e.g., 5 lysines (e.g., lysine-thiol), each of which is bound to a cross-linking agent; (c) an HM portion, the hydrophobic portion comprising about 15 to about 30 lysines, for example about 25 lysines (e.g., lysine-vitamin B3), each of which is bound to a hydrophobic substance.

[0145] In some embodiments, the cationic carrier unit is (a) a CC moiety, wherein the cationic carrier moiety comprises about 30 to about 60 lysines, e.g., about 45 lysines; (b) a CM moiety, the cross-linking moiety comprising about 5 lysines to about 15 lysines, e.g., 5 lysines (e.g., lysine-thiol), each of which is bound to a cross-linking agent; (c) an HM portion, the hydrophobic portion comprising about 15 to about 30 lysines, for example about 30 lysines (e.g., lysine-vitamin B3), each of which is bound to a hydrophobic substance.

[0146] In some embodiments, the cationic carrier unit is (a) a CC moiety, wherein the cationic carrier moiety comprises about 30 to about 60 lysines, e.g., about 40 lysines; (b) a CM moiety, the cross-linking moiety comprising about 5 lysines to about 15 lysines, e.g., 10 lysines (e.g., lysine-thiol), each of which is bound to a cross-linking agent; (c) an HM portion, the hydrophobic portion comprising about 15 to about 30 lysines, for example about 30 lysines (e.g., lysine-vitamin B3), each of which is bound to a hydrophobic substance.

[0147] In some embodiments, the cationic carrier unit is (a) a CC moiety, wherein the cationic carrier moiety comprises about 30 to about 60 lysines, e.g., about 35 lysines; (b) a CM moiety, the cross-linking moiety comprising about 5 lysines to about 15 lysines, e.g., 15 lysines (e.g., lysine-thiol), each of which is bound to a cross-linking agent; (c) an HM portion, the hydrophobic portion comprising about 15 to about 30 lysines, for example about 30 lysines (e.g., lysine-vitamin B3), each of which is bound to a hydrophobic substance.

[0148] In some embodiments, the cationic carrier unit is (a) a CC moiety, in which the number of cationic carrier moieties is the number of charges (e.g., the charge of the siRNA) (e.g., about 13 to about 30 for 14-mers to 31-mers) / 2; (b) a CM moiety, the CM moiety having a number of cross-linking moieties (e.g., lysine-thiol) of at least 1, at least 2, at least 3, or more; (c) a HM portion, wherein the hydrophobic portion is bound to a hydrophobic substance (e.g., lysine-vitamin B3), and the ratio of the CM portion to the HM portion is 1:3; The total number of (anion charge / 2) (X) + number of CMs (Y) + number of HMs (Z) is 17 or more.

[0149] In some embodiments, the cationic carrier unit further comprises at least one targeting moiety attached to the WP portion of the cationic carrier unit, hi some embodiments, the number and / or density of targeting moieties presented on the surface of the micelle can be controlled by using a particular ratio of cationic carrier units with a targeting moiety to cationic carrier units without a targeting moiety. In some embodiments, the ratio of cationic carrier units with a targeting moiety to cationic carrier units without a targeting moiety is at least about 1:5, at least about 1:10, at least about 1:20, at least about 1:30, at least about 1:40, at least about 1:50, at least about 1:60, at least about 1:70, at least about 1:80, at least about 1:90, at least about 1:100, at least about 1:120, at least about 1:140, at least about 1:160, at least about 1:180, at least about 1:200, at least about 1:250, at least about 1:300, at least about 1:350, at least about 1:400, at least about 1:450, at least about 1:500, at least about 1:600, at least about 1:700, at least about 1:800, at least about 1:900, or at least about 1:1000.

[0150] In some embodiments, the cationic carrier unit is (i) a targeting moiety (A) that targets the transporter LAT1 (e.g., phenylalanine); (ii) a water soluble polymer that is PEG; and (iii) a cationic carrier moiety comprising a cationic polymer block that is lysine; (iv) a cross-linking moiety comprising a cross-linked polymer block that is a lysine linked to the cross-linking moiety; (v) a hydrophobic moiety comprising a hydrophobic polymer block that is a lysine linked to vitamin B3.

[0151] In some embodiments, the cationic carrier unit is (i) a targeting moiety (A) that targets the transporter LAT1 (e.g., phenylalanine); (ii) a water-soluble polymer which is PEG, where n=100 to 200, for example, 100 to 150, for example, 120 to 130; and (iii) a cationic carrier moiety comprising a cationic polymer block, e.g., polylysine; (iv) a cross-linking moiety comprising a cross-linked polymer block that is a lysine linked to the cross-linking moiety; (v) a hydrophobic moiety comprising a hydrophobic polymer block that is a lysine linked to vitamin B3.

[0152] In some embodiments, the cationic carrier unit is (i) a targeting moiety (A) that targets the transporter LAT1 (e.g., phenylalanine); (ii) a water-soluble polymer which is PEG, where n=100 to 200, for example, 100 to 150, for example, 120 to 130; and (iii) a cationic carrier moiety comprising a cationic polymer block, for example, 10 to 100 lysines, for example, 10 to 50 lysines, for example, 30 to 40 lysines; (iv) a cross-linking moiety comprising a cross-linked polymer block that is a lysine linked to the cross-linking moiety; (v) a hydrophobic moiety comprising a hydrophobic polymer block that is a lysine linked to vitamin B3.

[0153] In some embodiments, the cationic carrier unit is (i) a targeting moiety (A) that targets the transporter LAT1 (e.g., phenylalanine); (ii) a water-soluble polymer which is PEG, where n=100 to 200, for example, 100 to 150, for example, 120 to 130; and (iii) a cationic carrier moiety comprising a cationic polymer block (e.g., 10-100 lysines, e.g., 10-50 lysines, e.g., 30-40 lysines); and (iv) a cross-linking moiety comprising a cross-linked polymer block that is a lysine linked to the cross-linking moiety (e.g., 10-30 lysine-thiols, e.g., 10-20 lysine-thiols); (v) a hydrophobic moiety comprising a hydrophobic polymer block that is a lysine linked to vitamin B3.

[0154] In some embodiments, the cationic carrier unit is (i) a targeting moiety (A) that targets the transporter LAT1 (e.g., phenylalanine); (ii) a water-soluble polymer which is PEG, where n=100 to 200, for example, 100 to 150, for example, 120 to 130; and (iii) a cationic carrier moiety comprising a cationic polymer block (e.g., 10-100 lysines, e.g., 10-50 lysines, e.g., 30-40 lysines); and (iv) a cross-linking moiety comprising a cross-linked polymer block that is a lysine linked to the cross-linking moiety (e.g., 10-30 lysine-thiols, e.g., 10-20 lysine-thiols); (v) a hydrophobic moiety comprising a hydrophobic polymer block that is a lysine linked to vitamin B3 (e.g., 10-50 lysines-vitamin B3, e.g., 30-40 lysines-vitamin B3).

[0155] In some embodiments, the cationic carrier unit includes HM, and the number of HM is about 50% to about 1%, about 50% to about 5%, about 50% to about 10%, about 50% to about 15%, about 50% to about 20%, about 50% to about 25%, about 50% to about 30%, about 50% to about 35%, about 50% to about 40%, about 50% to about 40%, about 50% to about 40%, or about 50% to about 40% relative to [CC] and [CM]. 5%, about 45% to about 1%, about 45% to about 5%, about 45% to about 10%, about 45% to about 15%, about 45% to about 20%, about 45% to about 25%, about 45% to about 30%, about 45% to about 35%, about 45% to about 40%, about 40% to about 1%, about 50% to about 5%, about 40% to about 10%, about 40% to about 15%, about 40% to about 20%, about 40% to about 25 %, about 40% to about 30%, about 40% to about 35%, about 35% to about 1%, about 35% to about 5%, about 35% to about 10%, about 35% to about 15%, about 35% to about 20%, about 35% to about 25%, about 35% to about 30%, about 30% to about 1%, about 30% to about 5%, about 30% to about 10%, about 30% to about 15%, about 30 to about 20%, about 30% to about 25% , about 25% to about 1%, about 25% to about 5%, about 25% to about 10%, about 25% to about 15%, about 25% to about 20%, about 20% to about 1%, about 20% to about 5%, about 20% to about 10%, about 20% to about 15%, about 15% to about 1%, about 15% to about 5%, about 15% to about 10%, about 10% to about 1%, about 10% to about 5%, or about 5% to about 1%. In some embodiments, the number of HMs is about 50% to about 40%, about 40% to about 30%, about 30% to about 20%, about 20% to about 10%, about 10% to about 5%, or about 5% to about 1%. In some embodiments, the number of HM is about 50%, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 5%, or about 1%. In some embodiments, the number of HM is about 40% relative to [CC] and [CM]. In some embodiments, the number of HM is expressed as a ratio of [HM] to [CC] and [CM].

[0156] In some embodiments, the cationic carrier unit of the present disclosure interacts with an antisense oligonucleotide payload targeting miR-485-3p, such as AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18). In some embodiments, the carrier unit complexed with the payload forms a micelle.

[0157] In some embodiments, a vitamin B3 unit is introduced into the side chain of the HM moiety by a coupling reaction between, for example, the NH2 group of lysine and the COOH group of vitamin B3 in the presence of suitable conjugation reagents, such as 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxysuccinimide (NHS).

[0158] The present disclosure provides compositions comprising a carrier unit (e.g., a cationic carrier unit) of the present disclosure. In other aspects, the present disclosure provides complexes comprising a carrier unit (e.g., a cationic carrier unit) of the present disclosure non-covalently bound to a payload (e.g., an anionic payload such as a nucleotide sequence, e.g., an oligonucleotide, siRNA, shRNA, "antimir", or any combination thereof), where the carrier unit and the payload interact electrostatically. In other aspects, the present disclosure provides conjugates comprising a carrier unit (e.g., a cationic carrier unit) of the present disclosure covalently bound to a payload (e.g., an anionic payload such as a nucleotide sequence, e.g., an oligonucleotide, siRNA, shRNA, "antimir", or any combination thereof), where the carrier unit and the payload interact electrostatically. In some aspects, the carrier unit and the payload can be linked by a cleavable linker. In some aspects, the carrier unit and the payload can covalently interact in addition to electrostatically interacting (e.g., after electrostatic interaction, the carrier unit and the payload can be "locked" by a disulfide bond or a cleavable bond).

[0159] In some specific embodiments, the cationic carrier unit comprises a water soluble polymer comprising PEG having about 120 to about 130 units, a cationic carrier moiety comprising polylysine having about 30 to about 40 lysine units, a bridging moiety comprising about 10 to about 20 lysine-thiol units, and a hydrophobic moiety comprising about 30 to about 40 lysine units linked to vitamin B3.

[0160] In some embodiments, the cationic carrier unit is associated with a negatively charged payload (e.g., a nucleotide sequence, such as an oligonucleotide (e.g., an antisense oligonucleotide), an siRNA, an shRNA, an "antimir," or any combination thereof) that interacts with the cationic carrier unit through at least one ionic bond (i.e., through an electrostatic interaction) with a cationic carrier moiety of the cationic carrier unit.

[0161] Specific components of the cationic carrier units of the present disclosure are disclosed in detail below.

[0162] A water-soluble biopolymer In some embodiments, the cationic carrier unit of the present disclosure comprises at least one water-soluble biopolymer. As used herein, the term "water-soluble biopolymer" refers to a biocompatible, biologically inert, non-immunogenic, non-toxic, and hydrophilic polymer, such as PEG.

[0163] In some embodiments, the water soluble polymer comprises poly(alkylene glycol), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkyl methacrylamide), poly(hydroxyalkyl methacrylate), poly(saccharide), poly(α-hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazoline ("POZ"), poly(N-acryloylmorpholine), or any combination thereof. In some embodiments, the water soluble biopolymer is linear, branched, or dendritic.

[0164] In some embodiments, the water-soluble biopolymer comprises polyethylene glycol ("PEG"), polyglycerol ("PG"), or poly(propylene glycol) ("PPG"). Many biologics are now manufactured with PPG instead of PEG because PPG is less toxic than PEG.

[0165] In some embodiments, the water soluble biopolymer has the formula R 3 -(O-CH2-CH2) n - or R 3 -(0-CH2-CH2) n -O-(wherein, R 3 is hydrogen, methyl, or ethyl, and n has a value from 2 to 200. In some embodiments, the PEG has the formula: [ka] In the formula, n is 1 to 1,000.

[0166] In some embodiments, n of PEG is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, , 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113 , 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 20A, 201, 201, 202, 203, 204 8, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 189, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200.

[0167] In some embodiments, n is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about 450, at least about 460, at least about 470, at least about 480, at least about 490, at least about 500, at least about 510, at least about 520, at least about 530, at least about 540, at least about 550, at least about 560, at least about 670, at least about 580, at least about 590, at least about 600, at least about 610, at least about 620, at least about 630, at least about 640, at least about 650, at least about 660, at least about 670, at least about 680, at least about 690, at least about 700, at least about 710, at least about 720, at least about 730, at least about 740, at least about 750, at least about 760, at least about 770, at least about 780, at least about 790, at least about 800, at least about 810, at least about 820, at least about 830, at least about 840, at least about 850, at least about 860, at least about 870, at least about 880, at least about 890, at least about 900, at least about 910, at least about 920, at least about 930, at least about 940, at least about 950, at least about 960, at least about 970, at least about 980, at least about 990,Or about 1000.

[0168] In some embodiments, n is from about 50 to about 100, from about 100 to about 150, from about 150 to about 200, from about 200 to about 250, from about 250 to about 300, from about 300 to about 350, from about 350 to about 400, from about 400 to about 450, from about 450 to about 500, from about 500 to about 550, from about 550 to about 600, from about 600 to about 650, from about 650 to about 700, from about 700 to about 750, from about 750 to about 800, from about 800 to about 850, from about 850 to about 900, from about 900 to about 950, or from about 950 to about 1000.

[0169] In some embodiments, n is at least about 80, at least about 81, at least about 82, at least about 83, at least about 84, at least about 85, at least about 86, at least about 87, at least about 88, at least about 89, at least about 90, at least about 91, at least about 92, at least about 93, at least about 94, at least about 95, at least about 96, at least about 97, at least about 98, at least about 99, at least about 100, at least about 101, at least about 102, at least about 103, at least about 104, at least about 105, at least about 106, at least about 107, at least about 108, at least about 109, at least 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, at least about 141, at least about 142, at least about 143, at least about 144, at least about 145, at least about 146, at least about 147, at least about 148, at least about 149, at least about 150, at least about 151, at least about 152, at least about 153, at least about 154, at least about 155, at least about 156, at least about 157, at least about 158, at least about 159, or at least about 160.

[0170] In some embodiments, n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 85 to about 95, about 95 to about 105, about 105 to about 115, about 115 to about 125, about 125 to about 135, about 135 to about 145, about 145 to about 155, about 155 to about 165, about 80 to about 100, about 100 to about 120, about 120 to about 140, about 140 to about 160, about 85 to about 105, about 105 to about 125, about 125 to about 145, or about 145 to about 165.

[0171] In some embodiments, n is about 100 to about 150. In some embodiments, n is about 100 to about 140. In some embodiments, n is about 100 to about 130. In some embodiments, n is about 110 to about 150. In some embodiments, n is about 110 to about 140. In some embodiments, n is about 110 to about 130. In some embodiments, n is about 110 to about 120. In some embodiments, n is about 120 to about 150. In some embodiments, n is about 120 to about 140. In some embodiments, n is about 120 to about 130. In some embodiments, n is about 130 to about 150. In some embodiments, n is about 130 to about 140.

[0172] Thus, in some embodiments, the PEG is a branched PEG. Branched PEG has 3-10 PEG chains extending from a central core group. In certain embodiments, the PEG moiety is a monodisperse polyethylene glycol. In the context of the present disclosure, a monodisperse polyethylene glycol (mdPEG) is a PEG having a single, defined chain length and molecular weight. mdPEG is typically produced by separation from a polymerization mixture by chromatography. In certain formulas, the monodisperse PEG moiety is assigned the abbreviation mdPEG.

[0173] In some embodiments, the PEG is a Star PEG. Star PEG has 10-100 PEG chains extending from a central core group. In some embodiments, the PEG is a Comb PEG. Comb PEG typically has multiple PEG chains grafted onto a polymer backbone.

[0174] In certain embodiments, the PEG has a molar mass of about 1000 g / mol to about 2000 g / mol, about 2000 g / mol to about 3000 g / mol, about 3000 g / mol to about 4000 g / mol, about 4000 g / mol to about 5000 g / mol, about 5000 g / mol to about 6000 g / mol, about 6000 g / mol to about 7000 g / mol, or 7000 g / mol to about 8000 g / mol.

[0175] In some embodiments, the PEG is 100 , PEG 200 , PEG 300 , PEG 400 , PEG 500 , PEG 600 , PEG 700 , PEG 800 , PEG 900 , PEG 1000 , PEG 1100 , PEG 1200 , PEG 1300 , PEG 1400 , PEG 1500 , PEG 1600 , PEG 1700 , PEG 1800 , PEG 1900 , PEG 2000 , PEG 2100 , PEG 2200 , PEG 2300 , PEG 2400 , PEG 2500 , PEG 1600 , PEG 1700 , PEG 1800 , PEG 1900 , PEG 2000 , PEG 2100 , PEG 2200 , PEG 2300 , PEG 2400 , PEG 2500、PEG 2600 、PEG 2700 、PEG 2800 、PEG 2900 、PEG 3000 、PEG 3100 、PEG 3200 、PEG 3300 、PEG 3400 、PEG 3500 、PEG 3600 、PEG 3700 、PEG 3800 、PEG 3900 、PEG 4000 、PEG 4100 、PEG 4200 、PEG 4300 、PEG 4400 、PEG 4500 、PEG 4600 、PEG 4700 、PEG 4800 、PEG 4900 、PEG 5000 、PEG 5100 、PEG 5200 、PEG 5300 、PEG 5400 、PEG 5500 、PEG 5600 、PEG 5700 、PEG 5800 、PEG 5900 、PEG 6000 、PEG 6100 、PEG 6200 、PEG 6300 、PEG 6400 、PEG 6500 、PEG 6600 、PEG 6700 、PEG 6800 、PEG 6900 、PEG 7000 、PEG 7100 、PEG 7200 、PEG 7300 、PEG 7400 、PEG 7500 、PEG 7600 、PEG 7700 、PEG 7800 、PEG 7900 、or PEG 8000 In some cases, PEG is PEG 5000 In some cases, PEG is PEG6000 In some embodiments, the PEG is 4000 It is.

[0176] In some embodiments, the PEG is monodisperse, e.g., mPEG. 100 , mPEG 200 , mPEG 300 , mPEG 400 , mPEG 500 , mPEG 600 , mPEG 700 , mPEG 800 , mPEG 900 , mPEG 1000 , mPEG 1100 , mPEG 1200 , mPEG 1300 , mPEG 1400 , mPEG 1500 , mPEG 1600 , mPEG 1700 , mPEG 1800 , mPEG 1900 , mPEG 2000 , mPEG 2100 , mPEG 2200 , mPEG 2300 , mPEG 2400 , mPEG 2500 , mPEG 1600 , mPEG 1700 , mPEG 1800 , mPEG 1900 , mPEG 2000 , mPEG 2100 , mPEG 2200 , mPEG 2300 , mPEG 2400 , mPEG 2500 , mPEG 2600 , mPEG 2700 , mPEG 2800 , mPEG 2900 , mPEG 3000 , mPEG 3100 , mPEG 3200 , mPEG 3300 , mPEG 3400 , mPEG 3500 , mPEG 3600 , mPEG 3700 , mPEG 3800 , mPEG 3900 , mPEG4000 , mPEG 4100 , mPEG 4200 , mPEG 4300 , mPEG 4400 , mPEG 4500 , mPEG 4600 , mPEG 4700 , mPEG 4800 , mPEG 4900 , mPEG 5000 , mPEG 5100 , mPEG 5200 , mPEG 5300 , mPEG 5400 , mPEG 5500 , mPEG 5600 , mPEG 5700 , mPEG 5800 , mPEG 5900 , mPEG 6000 , mPEG 6100 , mPEG 6200 , mPEG 6300 , mPEG 6400 , mPEG 6500 , mPEG 6600 , mPEG 6700 , mPEG 6800 , mPEG 6900 , mPEG 7000 , mPEG 7100 , mPEG 7200 , mPEG 7300 , mPEG 7400 , mPEG 7500 , mPEG 7600 , mPEG 7700 , mPEG 7800 , mPEG 7900 , or mPEG 8000 In some embodiments, the mPEG is 5000 In some embodiments, the mPEG is 6000 In some embodiments, the mPEG is 4000 It is.

[0177] In some embodiments, the water soluble biopolymer portion is a polyglycerol (PG) represented by the formula ((R3-O-(CH2-CHOH-CHO)n-), where R3 is hydrogen, methyl, or ethyl, and n has a value between 3 and 200. In some embodiments, the water soluble biopolymer portion is a polyglycerol (PG) represented by the formula ((R3-O-(CH2-CHOH-CHO)n-), where R3 is hydrogen, methyl, or ethyl, and n has a value between 3 and 200. 3 -O-(CH2-CHOR 5 -CH2-O) n -) and R 5 or a branched polyglycerol of the formula (R 3 -O-(CH2-CHOH-CH2-O) n -) is a linear glycerol chain, and R 3 is hydrogen, methyl, or ethyl. In some embodiments, the water soluble biopolymer moiety has the formula (R 3 -O-(CH2-CHOR 5 -CH2-O) n -) and R 5 is hydrogen, or a hyperbranched polyglycerol of the formula (R 3 -O-(CH2-CHOR 6 -CH2-O) n -) and R 6 is hydrogen, or a glycerol chain of the formula (R 3 -O-(CH2-CHOR 7 -CH2-O) n -) and R 7 A glycerol chain, which is hydrogen, or a glycerol chain of the formula (R 3 -O-(CH2-CHOH-CH2-O) n -) is a linear glycerol chain, and R 3 is hydrogen, methyl, or ethyl. Hyperbranched glycerol and methods for its synthesis are described in Oudshorn et al. (2006) Biomaterials 27:5471-5479; Wilms et al. (20100 Acc. Chem. Res. 43, 129-41, and references cited therein.

[0178] In certain embodiments, PG has a molar mass of about 1000 g / mol to about 2000 g / mol, about 2000 g / mol to about 3000 g / mol, about 3000 g / mol to about 4000 g / mol, about 4000 g / mol to about 5000 g / mol, about 5000 g / mol to about 6000 g / mol, about 6000 g / mol to about 7000 g / mol, or 7000 g / mol to about 8000 g / mol.

[0179] In some embodiments, PG is 100 , P.G. 200 , P.G. 300 , P.G. 400 , P.G. 500 , P.G. 600 , P.G. 700 , P.G. 800 , P.G. 900 , P.G. 1000 , P.G. 1100 , P.G. 1200 , P.G. 1300 , P.G. 1400 , P.G. 1500 , P.G. 1600 , P.G. 1700 , P.G. 1800 , P.G. 1900 , P.G. 2000 , P.G. 2100 , P.G. 2200 , P.G. 2300 , P.G. 2400 , P.G. 2500 , P.G. 1600 , P.G. 1700 , P.G. 1800 , P.G. 1900 , P.G. 2000 , P.G. 2100 , P.G. 2200 , P.G. 2300 , P.G. 2400 , P.G. 2500 , P.G. 2600 , P.G. 2700 , P.G. 2800 , P.G. 2900 , P.G. 3000 , P.G. 3100 , P.G. 3200 , P.G. 3300 , P.G. 3400 , P.G. 3500 , P.G. 3600 , P.G. 3700 , P.G. 3800, P.G. 3900 , P.G. 4000 , P.G. 4100 , P.G. 4200 , P.G. 4300 , P.G. 4400 , P.G. 4500 , P.G. 4600 , P.G. 4700 , P.G. 4800 , P.G. 4900 , P.G. 5000 , P.G. 5100 , P.G. 5200 , P.G. 5300 , P.G. 5400 , P.G. 5500 , P.G. 5600 , P.G. 5700 , P.G. 5800 , P.G. 5900 , P.G. 6000 , P.G. 6100 , P.G. 6200 , P.G. 6300 , P.G. 6400 , P.G. 6500 , P.G. 6600 , P.G. 6700 , P.G. 6800 , P.G. 6900 , P.G. 7000 , P.G. 7100 , P.G. 7200 , P.G. 7300 , P.G. 7400 , P.G. 7500 , P.G. 7600 , P.G. 7700 , P.G. 7800 , P.G. 7900 , or P.G. 8000 In some embodiments, the PG is 5000 In some embodiments, the PG is 6000 In some embodiments, the PG is 4000 It is.

[0180] In some embodiments, the PG is monodisperse, e.g., mPG. 100 , mPG 200 , mPG 300 , mPG 400 , mPG 500 , mPG 600 , mPG 700 , mPG 800 , mPG 900 , mPG1000 、mPG 1100 、mPG 1200 、mPG 1300 、mPG 1400 、mPG 1500 、mPG 1600 、mPG 1700 、mPG 1800 、mPG 1900 、mPG 2000 、mPG 2100 、mPG 2200 、mPG 2300 、mPG 2400 、mPG 2500 、mPG 1600 、mPG 1700 、mPG 1800 、mPG 1900 、mPG 2000 、mPG 2100 、mPG 2200 、mPG 2300 、mPG 2400 、mPG 2500 、mPG 2600 、mPG 2700 、mPG 2800 、mPG 2900 、mPG 3000 、mPG 3100 、mPG 3200 、mPG 3300 、mPG 3400 、mPG 3500 、mPG 3600 、mPG 3700 、mPG 3800 、mPG 3900 、mPG 4000 、mPG 4100 、mPG 4200 、mPG 4300 、mPG 4400 、mPG 4500 、mPG 4600 、mPG 4700 、mPG 4800 、mPG 4900 、mPG 5000 、mPG 5100 、mPG 5200 、mPG 5300 、mPG 5400 、mPG 5500 、mPG 5600 、mPG 5700 、mPG 5800 、mPG5900 , mPG 6000 , mPG 6100 , mPG 6200 , mPG 6300 , mPG 6400 , mPG 6500 , mPG 6600 , mPG 6700 , mPG 6800 , mPG 6900 , mPG 7000 , mPG 7100 , mPG 7200 , mPG 7300 , mPG 7400 , mPG 7500 , mPG 7600 , mPG 7700 , mPG 7800 , mPG 7900 , or mPG 8000 It is.

[0181] In some embodiments, the water soluble biopolymer comprises poly(propylene glycol) ("PPG"). In some embodiments, the PPG is characterized by the following formula, where n has a value of 1-1000: [ka]

[0182] In some embodiments, n of PPG is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58 , 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113 , 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 20A, 201, 201, 202, 203, 204 8, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 189, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200.

[0183] In some embodiments, n of the PPG is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, at least about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about 450, at least about 460, at least about 470, at least about 480, at least about 490, at least about 500, at least about 510, at least about 520, at least about 530, at least about 540, at least about 550, at least about 560, at least about 670, at least about 580, at least about 590, at least about 600, at least about 610, at least about 620, at least about 630, at least about 640, at least about 650, at least about 660, at least about 670, at least about 680, at least about 690, at least about 700, at least about 710, at least about 720, at least about 730, at least about 740, at least about 750, at least about 760, at least about 770, at least about 780, at least about 790, at least about 800, at least about 810, at least about 820, at least about 830, at least about 840, at least about 850, at least about 860, at least about 870, at least about 880, at least about 890, at least about 900, at least about 910, at least about 920, at least about 930, at least about 940, at least about 950, at least about 960, at least about 970, at least about 980, at least about 990,Or about 1000.

[0184] In some embodiments, n of PPG is about 50 to about 100, about 100 to about 150, about 150 to about 200, about 200 to about 250, about 250 to about 300, about 300 to about 350, about 350 to about 400, about 400 to about 450, about 450 to about 500, about 500 to about 550, about 550 to about 600, about 600 to about 650, about 650 to about 700, about 700 to about 750, about 750 to about 800, about 800 to about 850, about 850 to about 900, about 900 to about 950, or about 950 to about 1000.

[0185] In some embodiments, n of PPG is at least about 80, at least about 81, at least about 82, at least about 83, at least about 84, at least about 85, at least about 86, at least about 87, at least about 88, at least about 89, at least about 90, at least about 91, at least about 92, at least about 93, at least about 94, at least about 95, at least about 96, at least about 97, at least about 98, at least about 99, at least about 100, at least about 101, at least about 102, at least about 103, at least about 104, at least about 105, at least about 106, at least about 107, at least about 108, at least about 109, at least 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, at least about 141, at least about 142, at least about 143, at least about 144, at least about 145, at least about 146, at least about 147, at least about 148, at least about 149, at least about 150, at least about 151, at least about 152, at least about 153, at least about 154, at least about 155, at least about 156, at least about 157, at least about 158, at least about 159, or at least about 160.

[0186] In some embodiments, n of PPG is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 85 to about 95, about 95 to about 105, about 105 to about 115, about 115 to about 125, about 125 to about 135, about 135 to about 145, about 145 to about 155, about 155 to about 165, about 80 to about 100, about 100 to about 120, about 120 to about 140, about 140 to about 160, about 85 to about 105, about 105 to about 125, about 125 to about 145, or about 145 to about 165.

[0187] Thus, in some embodiments, the PPG is a branched PPG. Branched PPG has 3-10 PPG chains extending from a central core group. In certain embodiments, the PPG moiety is a monodisperse polyethylene glycol. In the context of the present disclosure, a monodisperse polyethylene glycol (mdPPG) is a PPG having a single, defined chain length and molecular weight. mdPEG is typically produced by separation from a polymerization mixture by chromatography. In certain formulas, the monodisperse PPG moiety is assigned the abbreviation mdPPG.

[0188] In some embodiments, the PPG is a Star PPG. Star PPG has 10 to 100 PPG chains extending from a central core group. In some embodiments, the PPG is a Comb PPG. Comb PPG typically has multiple PPG chains grafted onto the polymer backbone.

[0189] In certain embodiments, the PPG has a molar mass of about 1000 g / mol to about 2000 g / mol, about 2000 g / mol to about 3000 g / mol, about 3000 g / mol to about 4000 g / mol, about 4000 g / mol to about 5000 g / mol, about 5000 g / mol to about 6000 g / mol, about 6000 g / mol to about 7000 g / mol, or 7000 g / mol to about 8000 g / mol.

[0190] In some embodiments, the PPG is 100 , P.P.G.200 、PPG 300 、PPG 400 、PPG 500 、PPG 600 、PPG 700 、PPG 800 、PPG 900 、PPG 1000 、PPG 1100 、PPG 1200 、PPG 1300 、PPG 1400 、PPG 1500 、PPG 1600 、PPG 1700 、PPG 1800 、PPG 1900 、PPG 2000 、PPG 2100 、PPG 2200 、PPG 2300 、PPG 2400 、PPG 2500 、PPG 1600 、PPG 1700 、PPG 1800 、PPG 1900 、PPG 2000 、PPG 2100 、PPG 2200 、PPG 2300 、PPG 2400 、PPG 2500 、PPG 2600 、PPG 2700 、PPG 2800 、PPG 2900 、PPG 3000 、PPG 3100 、PPG 3200 、PPG 3300 、PPG 3400 、PPG 3500 、PPG 3600 、PPG 3700 、PPG 3800 、PPG 3900 、PPG 4000 、PPG 4100 、PPG 4200 、PPG 4300 、PPG 4400 、PPG 4500 、PPG 4600 、PPG 4700 、PPG 4800 、PPG 4900 、PPG 5000 、PPG5100 , P.P.G. 5200 , P.P.G. 5300 , P.P.G. 5400 , P.P.G. 5500 , P.P.G. 5600 , P.P.G. 5700 , P.P.G. 5800 , P.P.G. 5900 , P.P.G. 6000 , P.P.G. 6100 , P.P.G. 6200 , P.P.G. 6300 , P.P.G. 6400 , P.P.G. 6500 , P.P.G. 6600 , P.P.G. 6700 , P.P.G. 6800 , P.P.G. 6900 , P.P.G. 7000 , P.P.G. 7100 , P.P.G. 7200 , P.P.G. 7300 , P.P.G. 7400 , P.P.G. 7500 , P.P.G. 7600 , P.P.G. 7700 , P.P.G. 7800 , P.P.G. 7900 , or PPG 8000 In some embodiments, the PPG is 5000 In some embodiments, the PPG is 6000 In some embodiments, the PPG is 4000 It is.

[0191] In some embodiments, the PPG is monodisperse, e.g., mPPG. 100 , mPPG 200 , mPPG 300 , mPPG 400 , mPPG 500 , mPPG 600 , mPPG 700 , mPPG 800 , mPPG 900 , mPPG 1000 , mPPG 1100 , mPPG 1200 , mPPG 1300 , mPPG 1400 , mPPG 1500 , mPPG 1600 , mPPG 1700 , mPPG 1800、mPPG 1900 、mPPG 2000 、mPPG 2100 、mPPG 2200 、mPPG 2300 、mPPG 2400 、mPPG 2500 、mPPG 1600 、mPPG 1700 、mPPG 1800 、mPPG 1900 、mPPG 2000 、mPPG 2100 、mPPG 2200 、mPPG 2300 、mPPG 2400 、mPPG 2500 、mPPG 2600 、mPPG 2700 、mPPG 2800 、mPPG 2900 、mPPG 3000 、mPPG 3100 、mPPG 3200 、mPPG 3300 、mPPG 3400 、mPPG 3500 、mPPG 3600 、mPPG 3700 、mPPG 3800 、mPPG 3900 、mPPG 4000 、mPPG 4100 、mPPG 4200 、mPPG 4300 、mPPG 4400 、mPPG 4500 、mPPG 4600 、mPPG 4700 、mPPG 4800 、mPPG 4900 、mPPG 5000 、mPPG 5100 、mPPG 5200 、mPPG 5300 、mPPG 5400 、mPPG 5500 、mPPG 5600 、mPPG 5700 、mPPG 5800 、mPPG 5900 、mPPG 6000 、mPPG 6100 、mPPG 6200 、mPPG 6300 、mPPG6400 , mPPG 6500 , mPPG 6600 , mPPG 6700 , mPPG 6800 , mPPG 6900 , mPPG 7000 , mPPG 7100 , mPPG 7200 , mPPG 7300 , mPPG 7400 , mPPG 7500 , mPPG 7600 , mPPG 7700 , mPPG 7800 , mPPG 7900 , or mPPG 8000 In some embodiments, the mPPG is 5000 In some embodiments, the mPPG is 6000 In some embodiments, the mPPG is 4000 It is.

[0192] b. Cationic carrier In some embodiments, the cationic carrier unit of the present disclosure comprises at least one cationic carrier moiety. The term "cationic carrier" refers to a portion or part of the cationic carrier unit of the present disclosure that comprises a plurality of positive charges that can electrostatically interact and bind with an anionic payload (or an anionic carrier bound to a payload). In some embodiments, the number of positive charges or positively charged groups of the cationic carrier is comparable to the number of negative charges or negatively charged groups of the anionic payload (or an anionic carrier bound to a payload). In some embodiments, the cationic carrier comprises a biopolymer, such as a peptide (e.g., polylysine).

[0193] In some embodiments, the cationic carrier comprises one or more basic amino acids (eg, lysine, arginine, histidine, or a combination thereof). In some embodiments, the cationic carrier is at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, at least about 50, at least about 51, at least about 52, at least about 53, at least about 54, at least about 55, at least about 56, at least about 57, at least about 58, at least about 59, at least about 60, at least about 61, at least about 62, at least about 63, at least about 64, at least about 65, at least about 66, at least about 67, at least about 68, at least about 69, at least about 70, at least about 71, at least about 72, at least about 74, at least about 75, at least about 7 at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, at least about 50, at least about 51, at least about 52, at least about 53, at least about 54, at least about 55, at least about 56, at least about 57, at least about 58, at least about 59, at least about 60, at least about 61, at least about 62, at least about 63, At least about 64, at least about 65, at least about 66, at least about 67, at least about 68, at least about 69, at least about 70, at least about 71, at least about 72, at least about 73, at least about 74, at least about 75, at least about 76, at least about 77, at least about 78, at least about 79, at least about 80 basic amino acids, e.g., lysine, arginine, or a combination thereof.

[0194] In some embodiments, the cationic carrier unit comprises at least about 30 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 35 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 40 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 45 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 50 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 55 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 60 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 65 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 70 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 75 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 80 basic amino acids, e.g., lysine.

[0195] In some embodiments, the cationic carrier unit comprises about 30 to about 1000, about 30 to about 900, about 30 to about 800, about 30 to about 700, about 30 to about 600, about 30 to about 500, about 30 to about 400, about 30 to about 300, about 30 to about 200, about 30 to about 100, about 40 to about 1000, about 40 to about 900, about 40 to about 800, about 40 to about 700, about 40 to about 600, about 40 to about 500, about 40 to about 400, about 40 to about 300, about 40 to about 200, or about 40 to about 100 basic amino acids, e.g., lysine. In some embodiments, a basic amino acid, such as lysine, is not modified to have a quaternary amine (eg, a positive charge).

[0196] In some embodiments, the cationic carrier unit comprises about 30 to about 100, about 30 to about 90, about 30 to about 80, about 30 to about 70, about 30 to about 60, about 30 to about 50, about 30 to about 40, about 40 to about 100, about 40 to about 90, about 40 to about 80, about 40 to about 70, about 40 to about 60, about 70 to about 80, about 75 to about 85, about 65 to about 75, about 65 to about 80, about 60 to about 85, or about 40 to about 500 basic amino acids, e.g., lysine.

[0197] In some embodiments, the cationic carrier units are about 100 to about 1000, about 100 to about 900, about 100 to about 800, about 100 to about 700, about 100 to about 600, about 100 to about 500, about 100 to about 400, about 100 to about 300, about 100 to about 200, about 200 to about 1000, about 200 to about 300, about 300 to about 400, about 400 to about 500, about 500 to about 600, about 600 to about 700, about 800 to about 900, about 900 to about 1000, about 1000 to about 2 ... 00 pieces to about 900 pieces, about 200 pieces to about 800 pieces, about 200 pieces to about 700 pieces, about 200 pieces to about 600 pieces, about 200 pieces to about 500 pieces, about 200 pieces to about 400 pieces, about 200 pieces ~300 pieces, ~300~1000 pieces, ~300 ~900 pieces, ~300~800 pieces, ~300~700 pieces, ~300~600 pieces, ~300 pieces About 500 pieces, about 300 pieces to about 400 pieces, about 400 pieces to about 1000 pieces, about 400 pieces to about 900 pieces, about 400 pieces to about 800 pieces, about 400 pieces to about 700 pieces, about 400 pieces to about 600 pieces, about 400 pieces to about 500 pieces, about 500 pieces to about 1000 pieces, about 500 pieces to about 900 pieces, about 500 pieces to about 800 pieces, about 500 pieces to about 700 pieces, about 500 pieces to about 60 pieces 0, about 600 to about 1000, about 600 to about 900, about 600 to about 800, about 600 to about 700, about 700 to about 1000, about 700 to about 900, about 700 to about 800, about 800 to about 1000, about 800 to about 900, or about 900 to about 1000 basic amino acids, such as lysine.

[0198] In some embodiments, the number of basic amino acids, e.g., lysine, arginine, histidine, or combinations thereof, can be adjusted based on the length of the anionic payload (e.g., single-stranded or double-stranded nucleic acid) and / or the charge of the anionic payload. For example, anionic payloads with longer sequences can be paired with a greater number of basic amino acids (e.g., lysine). In some embodiments, the number of basic amino acids, e.g., lysines, of the cationic carrier unit can be calculated so that the molar ratio (N / P ratio) of the protonated amines in the polymer to the phosphates in the anionic payload, e.g., oligonucleotide, e.g., antimir, is about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3. In some embodiments, the number of basic amino acids, e.g., lysines, of the cationic carrier unit is calculated so that the molar ratio (N / P ratio) of the protonated amines in the polymer to the phosphates in the anionic payload, e.g., oligonucleotide, e.g., antimir, is about 1.3 to about 1.7, e.g., about 1.5. In some embodiments, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio (N / P ratio) between the protonated amine in the polymer and the phosphate in the anionic payload, e.g., oligonucleotide, e.g., antimir, is about 1.4. In some embodiments, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio (N / P ratio) between the protonated amine in the polymer and the phosphate in the anionic payload, e.g., oligonucleotide, e.g., antimir, is about 1.6. In some embodiments, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio (N / P ratio) between the protonated amine in the polymer and the phosphate in the anionic payload, e.g., oligonucleotide, e.g., antimir, is about 1.3.In some embodiments, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amines in the polymer to phosphates in the anionic payload, e.g., oligonucleotide, e.g., antimir (N / P ratio) is about 1.7.

[0199] In some embodiments, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amines in the polymer to phosphates in the anionic payload, e.g., cholesterol-conjugated siRNA (N / P ratio) is about 1.0.

[0200] In some embodiments, the number of basic amino acids, e.g., lysines, in a cationic carrier unit is calculated so that the molar ratio of protonated amines in the polymer to phosphates in the anionic payload, e.g., siRNA (N / P ratio) is about 2.0.

[0201] One of skill in the art will understand that since the role of the cationic carrier moiety is to neutralize the negative charges of the payload (e.g., the negative charges in the phosphate backbone of an antisense oligonucleotide) through electrostatic interactions, in some embodiments (e.g., when the payload is a nucleic acid such as an antimir), the length of the cationic carrier, the number of positively charged groups on the cationic carrier, and the distribution and arrangement of the charges present on the cationic carrier will depend on the length and charge distribution of the payload molecule.

[0202] In some embodiments, the cationic carrier comprises about 5 to about 10, about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 35, about 35 to about 40, about 40 to about 45, about 45 to about 50, about 50 to about 55, about 55 to about 60, about 60 to about 65, about 70, about 70 to about 75, or about 75 to about 80 basic amino acids. In some specific embodiments, the positively charged carrier comprises 30 to about 50 basic amino acids. In some specific embodiments, the positively charged carrier comprises 70 to about 80 basic amino acids.

[0203] In some embodiments, the basic amino acids include arginine, lysine, histidine, or any combination thereof. In some embodiments, the basic amino acids are D-amino acids. In some embodiments, the basic amino acids are L-amino acids. In some embodiments, the positively charged carrier comprises D-amino acids and L-amino acids. In some embodiments, the basic amino acids include at least one unnatural amino acid or derivative thereof. In some embodiments, the basic amino acid is arginine, lysine, histidine, L-4-aminomethyl-phenylalanine, L-4-guanidine-phenylalanine, L-4-aminomethyl-N-isopropyl-phenylalanine, L-3-pyridyl-alanine, L-trans-4-aminomethylcyclohexyl-alanine, L-4-piperidinyl-alanine, L-4-aminocyclohexyl-alanine, 4-guanidinobutyric acid, L-2-amino-3-guanidinopropionic acid, DL-5-hydroxylysine, pyrrolidine, 5-hydroxy-L-lysine, methyllysine, hypusine, or any combination thereof. In certain embodiments, the positively charged carrier comprises about 40 lysines. In certain embodiments, the positively charged carrier comprises about 50 lysines. In certain embodiments, the positively charged carrier comprises about 60 lysines. In certain embodiments, the positively charged carrier comprises about 70 lysines. In certain embodiments, the positively charged carrier comprises about 80 lysines. In certain embodiments, the positively charged carrier comprises about 30 lysines. In certain embodiments, the positively charged carrier comprises about 40 lysines. In certain embodiments, the positively charged carrier comprises about 38 lysines. In certain embodiments, the positively charged carrier comprises about 32 lysines. In certain embodiments, the positively charged carrier comprises about 35 lysines.

[0204] In other embodiments, the cationic carrier is at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, or at least 80 cationic groups (e.g., amino groups).In some embodiments, the cationic carrier comprises a polymer or copolymer comprising from about 5 to about 10 cationic groups, from about 10 to about 15 cationic groups, from about 15 to about 20 cationic groups, from about 20 to about 25 cationic groups, from about 25 to about 30 cationic groups, from about 30 to about 35 cationic groups, from about 35 to about 40 cationic groups, from about 40 to about 45 cationic groups, from about 45 to about 50 cationic groups, from about 50 to about 55 cationic groups, from about 55 to about 60 cationic groups, from about 60 to about 65 cationic groups, from about 65 to about 70 cationic groups, from about 70 to about 75 cationic groups, or from about 45 to about 50 cationic groups (e.g., amino groups). In some particular embodiments, the cationic carrier comprises a polymer or copolymer comprising from 30 to about 50 cationic groups (e.g., amino groups). In some specific embodiments, the cationic carrier comprises a polymer or copolymer containing 70 to about 80 cationic groups (e.g., amino groups). In some embodiments, the polymer or copolymer is an acrylate, a polyalcohol, or a polysaccharide.

[0205] In some embodiments, a cationic carrier moiety is attached to a single payload molecule, while in other embodiments, a cationic carrier moiety may be attached to multiple payload molecules, which may be the same or different.

[0206] In some embodiments, the ionic ratio of the positive charges of the cationic carrier moiety to the negative charges of the nucleic acid payload is about 5:1, about 4:1, about 3:1, about 2.9:1, about 2.8:1, about 2.7:1, about 2.6:1, about 2.5:1, about 2.4:1, about 2.3:1, about 2.2:1, about 2.1:1, about 2:1, about 1.9:1, about 1.8:1, about 1.7:1, about 1.6:1, about 1.5:1, about 1.4:1, about 1.3:1, about 1.5:1, about 1.6:1, about 1.7:1, about 1.8:1, about 1.9:1, about 1.8:1, about 1.7:1, about 1.8 ... :1, about 1.2:1, about 1.1:1, about 1:1, about 1:1.1, about 1:1.2, about 1:1.3, about 1:1.4, about 1:1.5, about 1:1.6, about 1:1.7, about 1:1.8, about 1:1.9, about 1:2, about 1:2.1, about 1:2.2, about 1:2.3, about 1:2.4, about 1:2.5, about 1:2.6, about 1:2.7, about 1:2.8, about 1:2.9, about 1:3, about 1:4, or about 1:5. In some embodiments, the charge ratio of the positive charge of the cationic carrier moiety to the negative charge of the nucleic acid payload is 1:1. In some embodiments, the charge ratio of the positive charge of the cationic carrier moiety to the negative charge of the nucleic acid payload is 2:1. In some embodiments, the charge ratio of the positive charges of the cationic carrier moiety to the negative charges of the nucleic acid payload is 3:2. In some embodiments, the charge ratio of the positive charges of the cationic carrier moiety to the negative charges of the nucleic acid payload is 2:3. In some embodiments, the charge ratio of the positive charges of the cationic carrier moiety to the negative charges of the nucleic acid payload is 1:1.

[0207] In some embodiments, the cationic carrier moiety has a free end, where the terminal group is a reactive group. In some embodiments, the cationic carrier moiety has a free end (e.g., the C-terminus in a polylysine cationic carrier moiety), where the terminal group is an amino (-NH2) group. In some embodiments, the cationic carrier moiety has a free end, where the terminal group is a sulfhydryl group. In some embodiments, the reactive group of the cationic carrier moiety is attached to a hydrophobic moiety, e.g., a vitamin B3 hydrophobic moiety.

[0208] c.Bridge part In some embodiments, the cationic carrier unit of the present disclosure comprises at least one cross-linking moiety. The term "cross-linking moiety" refers to a chemical moiety or portion of a polymer block that comprises a plurality of substances capable of forming cross-links. In some embodiments, some substances capable of forming cross-links comprise amino acids with cross-linker side chains. In some embodiments, the CM comprises a biopolymer, e.g., a peptide (e.g., polylysine) linked to a cross-linker.

[0209] In some embodiments, the bridging moiety comprises one or more amino acids (e.g., lysine, arginine, histidine, or a combination thereof), in some embodiments, the bridging moiety comprises at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, or at least about 30 amino acids, e.g., lysine, arginine, or a combination thereof, each linked to a crosslinker.

[0210] In some embodiments, each lysine of the bridging moiety has a neutral charge (e.g., comprises a tertiary amine). In some embodiments, each lysine of the bridging moiety comprises a thiol (e.g., lysine-thiol) and a tertiary amine, whereby each lysine has a neutral charge. In some aspects, the bridging moiety forms a crosslink through a tertiary amine. In some aspects, the bridging moiety forms a crosslink through a thiol. As used herein, "lysine" in the context of a bridging moiety refers to a lysine that has a neutral charge (e.g., comprises a tertiary amine) such that the lysine of the bridging moiety does not contribute to the overall charge of the carrier unit. In some embodiments, each lysine of the bridging moiety is linked to a crosslinker by an amide bond.

[0211] In some embodiments, the bridging moiety comprises at least about 5 amino acids (e.g., lysine), each linked to a crosslinker. In some embodiments, the bridging moiety comprises at least about 10 amino acids (e.g., lysine), each linked to a crosslinker. In some embodiments, the bridging moiety comprises at least about 11 amino acids (e.g., lysine), each linked to a crosslinker. In some embodiments, the bridging moiety comprises at least about 12 amino acids (e.g., lysine), each linked to a crosslinker. In some embodiments, the bridging moiety comprises at least about 13 amino acids (e.g., lysine), each linked to a crosslinker. In some embodiments, the bridging moiety comprises at least about 14 amino acids (e.g., lysine), each linked to a crosslinker. In some embodiments, the bridging moiety comprises at least about 15 amino acids (e.g., lysine), each linked to a crosslinker. In some embodiments, the bridging moiety comprises at least about 16 amino acids (e.g., lysine), each linked to a crosslinker. In some embodiments, the bridging moiety comprises at least about 17 amino acids (e.g., lysine), each linked to a cross-linking agent. In some embodiments, the bridging moiety comprises at least about 18 amino acids (e.g., lysine), each linked to a cross-linking agent. In some embodiments, the bridging moiety comprises at least about 19 amino acids (e.g., lysine), each linked to a cross-linking agent. In some embodiments, the bridging moiety comprises at least about 20 amino acids (e.g., lysine), each linked to a cross-linking agent.

[0212] In some embodiments, the cross-linking agent is a thiol. In some embodiments, the cross-linking agent is a thiol derivative.

[0213] C hydrophobic part In some embodiments, the cationic carrier unit of the present disclosure comprises at least one hydrophobic moiety. As used herein, the term "hydrophobic moiety" refers to a molecular entity that can, for example, (i) complement the therapeutic or prophylactic activity of the payload, (ii) modulate the therapeutic or prophylactic activity of the payload, (iii) function as a therapeutic and / or prophylactic agent in a target tissue or cell, (iv) facilitate the transport of the cationic carrier unit through a physiological barrier, such as the BBB and / or the plasma membrane, (v) improve the homeostasis of a target tissue or cell, (vi) provide a positively charged group to the cationic carrier moiety, or (vii) any combination thereof.

[0214] In some aspects, each lysine of the hydrophobic moiety has a neutral charge (e.g., comprises a tertiary amine). In some aspects, each lysine of the hydrophobic moiety comprises a thiol (e.g., lysine-thiol) and a tertiary amine, whereby each lysine has a neutral charge. In some aspects, the hydrophobic moiety is linked to the vitamin via a tertiary amine (e.g., a neutrally charged amine), whereby each lysine of the hydrophobic moiety does not contribute to the overall charge of the carrier unit. In some aspects, the hydrophobic moiety is linked to the vitamin via a thiol, whereby each lysine of the hydrophobic moiety does not contribute to the overall charge of the carrier unit. In some aspects, each lysine of the hydrophobic moiety is linked to the vitamin by an amide bond.

[0215] In some aspects, the hydrophobic moiety can modulate, for example, the immune response, the inflammatory response, or the tissue microenvironment.

[0216] In some embodiments, the hydrophobic moiety capable of modulating immune response may include, for example, tyrosine or dopamine. Tyrosine may be converted to L-dopa, which is then converted to dopamine by a two-step enzymatic reaction. Normally, dopamine levels are low in Parkinson's disease patients. Thus, in some embodiments, tyrosine is the hydrophobic moiety in the cationic carrier unit used to treat Parkinson's disease. Tryptophan may be converted to serotonin, a neurotransmitter believed to play a role in appetite, emotion, and motor, cognitive, and autonomic functions. Thus, in some embodiments, the cationic carrier unit of the present disclosure used to treat diseases or conditions associated with low serotonin levels includes tryptophan as a hydrophobic moiety.

[0217] In some aspects, the hydrophobic moiety may modulate the tumor microenvironment in a tumor-bearing subject, for example, by inhibiting or reducing hypoxia in the tumor microenvironment.

[0218] In some aspects, the hydrophobic moiety comprises, for example, an amino acid linked to an imidazole derivative, a vitamin, or any combination thereof.

[0219] In some embodiments, the hydrophobic moiety is an amino acid (e.g., lysine) linked to an imidazole derivative comprising the formula: [ka] wherein each of G1 and G2 is independently H, an aromatic ring, or 1-10 alkyl, or G1 and G2 together form an aromatic ring and n is 1-10.

[0220] In some embodiments, the hydrophobic moiety comprises an amino acid (e.g., lysine) linked to nitroimidazole. Nitroimidazole functions as an antibiotic. The nitroheterocycle in nitroimidazole can be reductively activated in hypoxic cells, and then can undergo redox recycling or decompose into cytotoxic products. Reduction usually only occurs in anaerobic bacteria or anoxic tissues, so their effect on human cells or aerobic bacteria is relatively small. In some embodiments, the hydrophobic moiety comprises an amino acid (e.g., lysine) linked to metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazole, azanidazole, benznidazole, nitroimidazole, or any combination thereof.

[0221] In some embodiments, the hydrophobic moiety comprises an amino acid (e.g., lysine) linked in the following manner: [ka] [ka]

[0222] In some aspects, the hydrophobic moiety can inhibit or reduce an inflammatory response.

[0223] In some embodiments, the hydrophobic moiety comprises an amino acid (e.g., lysine) linked to the vitamin. In some embodiments, the vitamin comprises a cyclic or heteroatom ring and a carboxyl or hydroxyl group. In some embodiments, the vitamin comprises the formula: [ka] (wherein each of Y1 and Y2 is C, N, O, or S, and n is 1 or 2).

[0224] In some embodiments, the vitamin is selected from the group consisting of vitamin A (retinol), vitamin B1 (thiamine chloride), vitamin B2 (riboflavin), vitamin B3 (niacinamide), vitamin B6 (pyridoxal), vitamin B7 (biotin), vitamin B9 (folic acid), vitamin B12 (cobalamin), vitamin C (ascorbic acid), vitamin D2, vitamin D3, vitamin E (tocopherol), vitamin M, vitamin H, derivatives thereof, and any combination thereof.

[0225] In some embodiments, the vitamin is the following vitamin B3 (also known as niacin or nicotinic acid). [ka]

[0226] In some embodiments, the hydrophobic moieties are at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, at least about 50, at least about 51, at least about 52, at least about 53, at least about 54, at least about 55, at least about 56, at least about 57, at least about 58, at least about 59, at least about 60, at least about 61, at least about 62, at least about 63, at least about 64, at least about 65, at least about 66, at least about 67, at least about 68, at least about 69, at least about 70, at least about 71, at least about 72, at least about 73, at least about The hydrophobic portion comprises at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, or at least about 40 amino acids (e.g., lysine). In some embodiments, the hydrophobic portion comprises at least about 30 amino acids (e.g., lysine), each of which is linked to vitamin B3. In some embodiments, the hydrophobic portion comprises at least about 31 amino acids (e.g., lysine), each of which is linked to vitamin B3. In some embodiments, the hydrophobic portion comprises at least about 32 amino acids (e.g., lysine), each of which is linked to vitamin B3. In some embodiments, the hydrophobic portion comprises at least about 33 amino acids (e.g., lysine), each linked to vitamin B3. In some embodiments, the hydrophobic portion comprises at least about 34 amino acids (e.g., lysine), each linked to vitamin B3. In some embodiments, the hydrophobic portion comprises at least about 35 amino acids (e.g., lysine), each linked to vitamin B3. In some embodiments, the hydrophobic portion comprises at least about 36 amino acids (e.g., lysine), each linked to vitamin B3. In some embodiments, the hydrophobic portion comprises at least about 37 amino acids (e.g., lysine), each linked to vitamin B3. In some embodiments, the hydrophobic portion comprises at least about 38 amino acids (e.g., lysine), each linked to vitamin B3.In some embodiments, the hydrophobic portion comprises at least about 39 amino acids (e.g., lysine) each linked to vitamin B3. In some embodiments, the hydrophobic portion comprises at least about 40 amino acids (e.g., lysine) each linked to vitamin B3.

[0227] In some embodiments, the hydrophobic portion comprises about 20 to about 25 amino acids (e.g., lysine), each bound to vitamin B3, about 25 to about 30 amino acids (e.g., lysine), each bound to vitamin B3, about 30 to about 35 amino acids (e.g., lysine), each bound to vitamin B3, about 35 to about 40 amino acids (e.g., lysine), each bound to vitamin B3, about 40 to about 45 amino acids (e.g., lysine), or about 45 to about 50 amino acids (e.g., lysine), each bound to vitamin B3. In some embodiments, the hydrophobic portion comprises about 20 to about 30 amino acids (e.g., lysine), each bound to vitamin B3, about 30 to about 40 amino acids (e.g., lysine), each bound to vitamin B3, about 40 to about 50 amino acids (e.g., lysine), each bound to vitamin B3, about 25 to about 35 amino acids (e.g., lysine), each bound to vitamin B3, or about 35 to about 45 amino acids (e.g., lysine), each bound to vitamin B3.

[0228] Niacin is the precursor of the coenzymes nicotinamide adenine dinucleotide (NAD) and nicotinamide adenine dinucleotide phosphate (NADP) in vivo. NAD is converted to NADP by phosphorylation in the presence of the enzyme NAD+ kinase. NADP and NAD are coenzymes for many dehydrogenases involved in many hydrogen transfer processes. NAD is important in the catabolism of fats, carbohydrates, proteins, and alcohol, as well as cell signaling and DNA repair, while NADP is primarily important in anabolic reactions, e.g., fatty acid and cholesterol synthesis. Organs with high energy requirements (brain) or high metabolic turnover rates (gut, skin) are usually the most sensitive to their deficiency.

[0229] Niacin exerts a significant anti-inflammatory effect by activating NIACR1 in various tissues, including the brain, gastrointestinal tract, skin, and vascular tissue. Niacin has been shown to attenuate neuroinflammation and may have efficacy in treating neuroimmune disorders such as multiple sclerosis and Parkinson's disease. See Offermanns & Schwaninger (2015) Trends in Molecular Medicine 21:245-266; Chai et al. (2013) Current Atherosclerosis Reports 15:325; Graff et al. (2016) Metabolism 65:102-13; and Wakade & Chong (2014) Journal of the Neurological Sciences 347:34-8, which are incorporated herein by reference in their entirety.

[0230] d. Targeting moiety In some embodiments, the cationic carrier unit comprises a targeting moiety, which is optionally linked to the water-soluble polymer by a linker. As used herein, the term "targeting moiety" refers to a biorecognition molecule that binds to a specific biological substance or site. In some embodiments, the targeting moiety is specific for a certain target molecule (e.g., a ligand that targets a receptor or an antibody that targets a surface protein), tissue specific (e.g., a molecule that preferentially transports micelles to a specific organ or tissue, such as the liver, brain, or endothelium), or facilitates transport through physiological barriers (e.g., a peptide or other molecule that can facilitate transport through the blood-brain barrier or plasma membrane).

[0231] To target a payload (e.g., a nucleotide molecule, e.g., an antisense oligonucleotide that binds to a microRNA) in accordance with the present disclosure, the targeting moiety can be linked to a cationic carrier unit and thereby to the outer surface of the micelle, while the micelle has the payload encapsulated within its core.

[0232] In some embodiments, the targeting moiety is a targeting moiety that can target the micelles of the present disclosure to tissue.In some embodiments, the tissue is liver, brain, kidney, lung, ovary, pancreas, thyroid, breast, stomach, or any combination thereof.In some embodiments, the tissue is cancer tissue, such as liver cancer, brain cancer, kidney cancer, lung cancer, ovarian cancer, pancreatic cancer, thyroid cancer, breast cancer, stomach cancer, or any combination thereof.

[0233] In certain embodiments, the tissue is the liver. In certain embodiments, the targeting moiety that targets the liver is cholesterol. In other embodiments, the targeting moiety that targets the liver is a ligand that binds to the asialoglycoprotein receptor targeting moiety. In some embodiments, the asialoglycoprotein receptor targeting moiety comprises a GalNAc cluster. In some embodiments, the GalNAc cluster is a monovalent, bivalent, trivalent, or tetravalent GalNAc cluster.

[0234] In another embodiment, the tissue is pancreas.In some embodiments, the targeting moiety that targets pancreas comprises a ligand that targets αvβ3 integrin receptor on pancreatic cells.In some embodiments, the targeting moiety comprises an arginylglycyl aspartic acid (RGD) peptide sequence (L-arginyl-glycyl-L-aspartic acid, Arg-Gly-Asp).

[0235] In some embodiments, the tissue is a tissue of the central nervous system, for example, a nervous tissue. In some embodiments, the targeting moiety that targets the central nervous system can be transported by large neutral amino acid transporter 1 (LAT1). LAT1 (SLC7A5) is a transporter for the uptake of both large neutral amino acids and some pharmaceuticals. LAT1 can transport drugs such as L-dopa or gabapentin.

[0236] In some embodiments, the targeting moiety comprises glucose, e.g., D-glucose, which can bind to glucose transporter 1 (or GLUT1) and cross the BBB. GLUT1, also known as solute transporter family 2 facilitative glucose transporter member 1 (SLC2A1), is a uniporter protein that is encoded by the SLC2A1 gene in humans. GLUT1 facilitates the transport of glucose through the plasma membrane of mammalian cells. This gene encodes the main glucose transporter in the mammalian blood-brain barrier.

[0237] In some embodiments, the targeting moiety comprises galactose (e.g., D-galactose) that can bind to the GLUT1 transporter and cross the BBB. In some embodiments, the targeting moiety comprises glutamate that can bind to an acetylcholinesterase inhibitor (AChEI) and / or an EAAT inhibitor and cross the BBB. Acetylcholinesterase is an enzyme that is a major member of the cholinesterase enzyme family. Acetylcholinesterase inhibitors (AChEIs) are inhibitors that inhibit acetylcholinesterase from breaking down acetylcholine into choline and acetate, thereby increasing both the level and duration of action of the neurotransmitter acetylcholine in the central nervous system, autonomic ganglia, and neuromuscular junctions, where acetylcholine receptors are abundant. Acetylcholinesterase inhibitors are one of two types of cholinesterase inhibitors, the other being butyrylcholinesterase inhibitors.

[0238] In some embodiments, the targeting moiety is GABA, which can bind to GABA receptor and pass through the BBB.GABA receptor is a class of receptors that respond to the neurotransmitter gamma-aminobutyric acid (GABA), which is the main inhibitory compound in the central nervous system of mature vertebrates.There are two classes of GABA receptors: GABAA and GABAB.GABA receptors are ligand-gated ion channels (also known as ionotropic receptors), while GABAB receptors are G protein-coupled receptors, also known as metabotropic receptors.

[0239] In some embodiments, the targeting moiety comprises a tyrosine that can bind to LAT1 and cross the BBB. In some embodiments, the targeting moiety comprises a lysine that can bind to LAT1 and cross the BBB. In some embodiments, the targeting moiety comprises a glutamine that can bind to LAT1 and cross the BBB. In some embodiments, the targeting moiety comprises a phenylalanine that can bind to GABA receptors, LAT1, CNS reverse transcriptase inhibitors, and / or dopamine (DA) receptors and cross the BBB. Dopamine receptors are a class of G protein-coupled receptors that are prominent in the vertebrate central nervous system (CNS). Dopamine receptors activate different effectors not only by G protein coupling but also by signal transduction through different protein (dopamine receptor-interacting protein) interactions. The neurotransmitter dopamine is the major endogenous ligand of dopamine receptors.

[0240] Dopamine receptors are believed to be involved in many neurological processes, including motivation, pleasure, cognition, memory, learning, and fine motor control, as well as regulating neuroendocrine signaling.Abnormal dopamine receptor signaling and dopaminergic neuronal function have been implicated in several neuropsychiatric disorders.Therefore, dopamine receptors are a common target of neurological drugs, and antipsychotic drugs are often dopamine receptor antagonists, while psychostimulants are usually indirect agonists of dopamine receptors.

[0241] In some embodiments, the targeting moiety comprises a valine capable of binding to a CNS reverse transcriptase inhibitor and crossing the BBB. In some embodiments, the targeting moiety comprises a tryptophan capable of binding to a GABA receptor and / or a CNS reverse transcriptase inhibitor and crossing the BBB. In some embodiments, the targeting moiety comprises a leucine capable of binding to a GABA receptor and / or a CNS reverse transcriptase inhibitor and crossing the BBB. In some embodiments, the targeting moiety comprises a methionine capable of binding to a GABA receptor and / or a CNS reverse transcriptase inhibitor and crossing the BBB. In some embodiments, the targeting moiety comprises a histidine capable of binding to a GABA receptor and crossing the BBB. In some embodiments, the targeting moiety comprises an isoleucine capable of binding to a CNS reverse transcriptase inhibitor and crossing the BBB. In some embodiments, the targeting moiety comprises a glutathione capable of binding to a GSH transporter and crossing the BBB. In some embodiments, the targeting moiety comprises a glutathione-Met capable of binding to a GSH transporter and crossing the BBB. In some embodiments, the targeting moiety comprises urea / thiourea, which can bind to nitric oxide synthase (NOS) and can bind to the BBB. In some embodiments, the targeting moiety comprises NAD+ / NADH, which can cross the BBB by redox mechanism. In some embodiments, the targeting moiety comprises purine and can cross the BBB. Further examples of targeting moieties for targeting the CNS are shown in Sutera et al. (2016): Small endogenous molecules as moiety to improve targeting of CNS drugs, Expert Opinion on Drug Delivery, DOI:10.1080 / 17425247.2016.1208651, which is incorporated herein by reference in its entirety.

[0242] In some embodiments, the tissue targeted by the targeting moiety is skeletal muscle. In some embodiments, the targeting moiety that targets skeletal muscle can be transported by large neutral amino acid transporter 1 (LAT1).

[0243] LAT1 is expressed in many cell types, including T cells, cancer cells, and brain endothelial cells. LAT1 is consistently expressed at high levels in brain microvascular endothelial cells. Targeting the micelles of the present disclosure to LAT1 allows delivery through the BBB, since solute transporters are primarily present in the BBB. In some embodiments, the targeting moiety that targets the micelles of the present disclosure to the LAT1 transporter is an amino acid, e.g., a branched or aromatic amino acid. In some embodiments, the amino acid is valine, leucine, and / or isoleucine. In some embodiments, the amino acid is tryptophan and / or tyrosine. In some embodiments, the amino acid is tryptophan. In other embodiments, the amino acid is tyrosine.

[0244] In some embodiments, the targeting moiety is a LAT1 ligand selected from tryptophan, tyrosine, phenylalanine, tryptophan, methionine, thyroxine, melphalan, L-dopa, gabapentin, 3,5-I-diiodotyrosine, 3-iodo-I-tyrosine, fenclonine, acivicin, leucine, BCH, methionine, histidine, valine, or any combination thereof.

[0245] In some embodiments, the LAT1 ligand is selected from the group consisting of: [1] l-phenylalanine, [2] o-sarcolysine, [3] m-sarcolysine, [4] melphalan, [5] 2-amino-2-norbornane carboxylic acid (BCH), [6] (±)-2-amino-1,2,3,4-tetrahydro-2-naphthoic acid, [7] dl-2-NAM-5, [8] dl-2-NAM-6, [9] dl-2-NAM-7, and

[10] dl-2-NAM-8.

[11] dl-Dechlorinated NAM,

[12] dl-1-NAM-7,

[13] (±)-2-aminoindan-2-carboxylic acid,

[14] (±)-2-aminobenzo-bicyclo-[2.2.1]heptane-2'-exo-carboxylic acid,

[15] (±)-2-amino-(bis-2-chloroethyl)-5-aminoindan-2-carboxylic acid,

[16] (±)-2-endo-amino-bis(2-chloroethyl)-7'-aminobenzobicyclo[2.2.1] Heptane-2-exo-carboxylic acid,

[17] l-6-diazo-5-oxo-norleucine (l-DON),

[18] acivicin,

[19] azaserine,

[20] buthionine sulfoximine (BSO),

[21] l-1-naphthylalanine,

[22] o-benzyl-l-tyrosine,

[23] l-2-amino-nonanoic acid,

[24] l-tyrosine,

[25] α-methyltyrosine,

[26] l-dopa,

[27] α-methyldopa,

[28] 3-o-methyl tildopa,

[29] droxidopa,

[30] carbidopa,

[31] dopamine,

[32] tyramine,

[33] α-methylphenylalanine,

[34] N-methylphenylalanine,

[35] phenylalanine methyl ester,

[36] gabapentin,

[37] 3,3'-diiodothyronine,

[38] l-T3,

[39] 3',5',3-triiodothyronine (rl-T3), or

[40] l-T4, or any combination thereof. [ka] [ka] , or any combination thereof.

[0246] In some embodiments, the LAT1 ligand is a LAT1-targeted prodrug as shown below. [ka] , or any combination thereof.

[0247] See Singh & Ecker (2018) “Insights into the Structure, Function, and Ligand Discovery of the Large Neutral Amino Acid Transporter 1, LAT1,” Int. J. Mol. Sci. 19:1278; Geier et al. (2013) “Structure-based ligand discovery for the Large-neutral Amino Acid Transporter 1, LAT-1,” Proc. Natl. Acad. Sci. USA 110:5480-85; and Chien et al. (2018) “Reevaluating the Substrate Specificity of the L-type Amino Acid Transporter (LAT1),” J. Med. Chem. 61:7358-73, which are incorporated by reference in their entireties.

[0248] Non-limiting examples of targeting moieties are described below.

[0249] i. Ligand A ligand serves as a type of targeting moiety, defined as a substance capable of selectively binding with selective (or specific) affinity to another substance. A ligand is usually, but not necessarily, recognized and bound by a larger specific binding entity or "binding partner" or "receptor". Examples of ligands suitable for targeting are, among others, antigens, haptens, biotin, biotin derivatives, lectins, galactosamine and fucosylamine moieties, receptors, substrates, coenzymes, and cofactors.

[0250] As applied to the micelles of the present disclosure, the ligands include antigens or haptens that can be bound by or to their corresponding antibodies or fragments thereof. Viral antigens or hemagglutinins and neuraminidases and nucleocapsids, including those from any DNA and RNA virus, AIDS, HIV, and hepatitis viruses, adenoviruses, alphaviruses, arenaviruses, coronaviruses, flaviviruses, herpesviruses, myxoviruses, oncornaviruses, papovaviruses, paramyxoviruses, parvoviruses, picornaviruses, poxviruses, reoviruses, rhabdoviruses, rhinoviruses, togaviruses, and viroids; Gram-negative and Gram-positive bacteria, Acinetobacter spp., Achromobacter spp., Bacteroides spp., C. cerevisiae ... Also included are any bacterial antigens, including those of the genera Lostridium, Chlamydia, Enterobacteriaceae, Haemophilus, Lactobacillus, Neisseria, Staphyloccus, or Streptoccocus; any fungal antigens, including those of the genera Aspergillus, Candida, Coccidiodes, mycosis, phycomycetes, and yeast; any mycoplasma antigen; any rickettsia antigen; any protozoan antigen; any parasitic antigen; any human antigen, including those of blood cells, virus-infected cells, genetic markers, heart disease, oncoproteins, plasma proteins, complement factors, and rheumatoid factors. Also included are cancer and tumor antigens, such as alpha-fetoprotein, prostate-specific antigen (PSA) and CEA, cancer markers, and oncoproteins, among others.

[0251] Other substances that can serve as ligands for targeting the micelles of the present disclosure include certain vitamins (i.e., folic acid, B 12 ), steroids, prostaglandins, carbohydrates, lipids, antibiotics, drugs, digoxin, insecticides, narcotics, neurotransmitters, and substances that are used or modified to function as ligands.

[0252] In some embodiments, the targeting moiety includes proteins or protein fragments (e.g., hormones, toxins) and synthetic or natural polypeptides that have cell affinity. Ligands also include various substances that have selective affinity for ligators, which are produced by recombinant DNA, genetic engineering, and molecular engineering. Except as otherwise indicated, the ligands of the present disclosure also include those defined in U.S. Patent No. 3,817,837, which is incorporated herein by reference in its entirety.

[0253] ii. Ligator Ligators function as a type of targeting moiety, which is defined in this disclosure as a specific binding entity or "partner" or "receptor" that is usually, but not necessarily, larger than the ligand that can bind. For the purposes of this disclosure, a ligator can be a specific substance or material or chemical or "reactant" that can selectively bind with a specific ligand by affinity. Ligators can be proteins such as antibodies, non-protein binding entities, or "specifically reactive entities."

[0254] Ligators, as applied to this disclosure, include antibodies, which are defined to include all classes of antibodies, monoclonal antibodies, chimeric antibodies, Fab fragments, fragments and derivatives thereof. The term "antibody" includes immunoglobulins and fragments thereof, whether natural or wholly or partially synthetically produced. The term also includes any protein having a binding domain that is homologous to an immunoglobulin binding domain. "Antibody" further includes polypeptides comprising a framework region derived from an immunoglobulin gene or fragments thereof that specifically bind and recognize an antigen. The use of the term antibody includes full length, polyclonal, monoclonal, and recombinant antibodies, fragments thereof, and is further intended to include single chain antibodies, humanized antibodies, murine antibodies, chimeric, mouse / human, mouse / primate, primate / human monoclonal antibodies, anti-idiotypic antibodies, antibody fragments, such as scFv, scFab, (scFab)2, (scFv)2, Fab, Fab', and F(ab')2, F(ab1)2, Fv, dAb, and Fd fragments, diabodies, and antibody related polypeptides. Antibodies include bispecific and multispecific antibodies, so long as they have the desired biological activity or function. In some aspects of the present disclosure, the targeting moiety is an antibody or molecule, including an antigen-binding fragment thereof. In some aspects, the antibody is a nanobody. In some aspects, the antibody is an ADC. The terms "antibody drug conjugate" and "ADC" are used interchangeably and refer to, for example, an antibody covalently linked to a therapeutic agent (sometimes referred to herein as a drug, agent, or active pharmaceutical ingredient) or agent. In some aspects of the disclosure, the targeting moiety is an antibody drug conjugate.

[0255] In certain circumstances, the present disclosure is also applicable to the use of other substances as ligators. For example, other ligators suitable for targeting include naturally occurring receptors, any hemagglutinin and cell membrane and nucleus derivatives that specifically bind to hormones, vitamins, drugs, antibiotics, cancer markers, genetic markers, viruses, and histocompatibility markers. Another class of ligators includes any RNA and DNA binding substances, such as polyethyleneimine (PEI) and polypeptides or proteins, such as histones and protamines.

[0256] Other ligators include enzymes, especially cell surface enzymes such as neuraminidase, plasma proteins, avidin, streptavidin, chiron, cavitand, thyroglobulin, intrinsic factor, globulins, chelating agents, detergents, organometallic substances, staphylococcal protein A, protein G, ribosomes, bacteriophages, cytochromes, lectins, certain resins, and organic polymers.

[0257] Targeting moieties also include any protein, protein fragment, or polypeptide that has an affinity for the surface of any cell, tissue, or microorganism, produced by various substances, such as recombinant DNA, genetic engineering, and molecular engineering. Thus, in some embodiments, the targeting moiety directs the micelles of the present disclosure to a particular tissue (i.e., liver tissue or brain tissue), a particular type of cell (e.g., certain types of cancer cells), or a physiological compartment or barrier (e.g., the BBB).

[0258] e. Linker As mentioned above, the cationic carrier unit disclosed herein may include one or more linkers, for example, as shown in Figures 2(A)-(I). As used herein, the term "linker" refers to a peptide or polypeptide sequence (e.g., a synthetic peptide or polypeptide sequence), or a non-peptide linker whose main function is to link two moieties in the cationic carrier unit disclosed herein. In some embodiments, the cationic carrier unit of the present disclosure may include at least one linker linking a tissue-specific targeting moiety (TM) with a water-soluble polymer (WS), at least one linker linking a water-soluble biopolymer (WP) with a cationic carrier (CC) or a hydrophobic moiety (HM) or a bridging moiety (CM), at least one linker linking a cationic carrier (CC) with a hydrophobic moiety (HM), or any combination thereof. In some embodiments, two or more linkers can be linked in series.

[0259] When multiple linkers are present in the cationic carrier unit disclosed herein, each of the linkers can be the same or different.In general, the linker provides flexibility to the cationic carrier unit.The linker is not usually cleaved, but in certain embodiments, such cleavage may be desirable.Thus, in some embodiments, the linker can include one or more protease cleavage sites, which can be located within the sequence of the linker or adjacent to the linker at either end of the linker sequence.

[0260] In one embodiment, the linker is a peptide linker. In some embodiments, the peptide linker can comprise at least about 2, at least about 3, at least about 4, at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, or at least about 100 amino acids.

[0261] In some embodiments, the peptide linker can comprise at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 amino acids.

[0262] In other embodiments, the peptide linker can comprise at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least 550, at least about 600, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, or at least about 1,000 amino acids.

[0263] The peptide linker can contain 1 to about 5 amino acids, 1 to about 10 amino acids, 1 to about 20 amino acids, about 10 to about 50 amino acids, about 50 to about 100 amino acids, about 100 to about 200 amino acids, about 200 to about 300 amino acids, about 300 to about 400 amino acids, about 400 to about 500 amino acids, about 500 to about 600 amino acids, about 600 to about 700 amino acids, about 700 to about 800 amino acids, about 800 to about 900 amino acids, or about 900 to about 1000 amino acids.

[0264] Examples of peptide linkers are well known in the art. In some embodiments, the linker is a glycine / serine linker. In some embodiments, the peptide linker is a glycine / serine linker according to the formula [(Gly)n-Ser]m, where n is any integer between 1 and 100, and m is any integer between 1 and 100. In other embodiments, the glycine / serine linker is according to the formula [(Gly)x-Sery]z (SEQ ID NO: 1), where x is an integer between 1 and 4, y is 0 or 1, and z is an integer between 1 and 50. In one embodiment, the peptide linker comprises the sequence Gn, where n can be an integer between 1 and 100. In a particular embodiment, the sequence of the peptide linker is GGGG (SEQ ID NO: 2).

[0265] In some embodiments, the peptide linker can comprise the sequence (GlyAla)n (SEQ ID NO:3), where n is an integer from 1 to 100. In other embodiments, the peptide linker can comprise the sequence (GlyGlySer)n (SEQ ID NO:4), where n is an integer from 1 to 100.

[0266] In other embodiments, the peptide linker comprises the sequence (GGGS)n (SEQ ID NO:5). In still other embodiments, the peptide linker comprises the sequence (GGS)n(GGGGS)n (SEQ ID NO:6). In these examples, n can be an integer from 1 to 100. In other examples, n can be an integer from 1 to 20, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0267] Examples of linkers include, but are not limited to, GGG, SGGSGGS (SEQ ID NO: 7), GGSGGSGGSGGSGGG (SEQ ID NO: 8), GGSGGSGGGGSGGGGS (SEQ ID NO: 9), GGSGGSGGSGGSGGSGGS (SEQ ID NO: 10), or GGGGSGGGGSGGGGGS (SEQ ID NO: 11). In other embodiments, the linker is a poly-G sequence (GGGG)n (SEQ ID NO: 12), where n can be an integer from 1 to 100.

[0268] In one embodiment, the peptide linker is synthetic, i.e., non-natural. In one embodiment, the peptide linker comprises a peptide (or polypeptide) (e.g., a natural or non-natural peptide) that comprises an amino acid sequence that links or genetically fuses a first linear sequence of amino acids to a second linear sequence of amino acids to which the first linear sequence is not naturally linked or genetically fused. For example, in one embodiment, the peptide linker can comprise a non-natural polypeptide that is a modified form of a naturally occurring polypeptide (e.g., including mutations such as additions, substitutions, or deletions). In another embodiment, the peptide linker can comprise a non-natural amino acid. In another embodiment, the peptide linker can comprise a naturally occurring amino acid that occurs in a linear sequence that does not occur in nature. In yet another embodiment, the peptide linker can comprise a naturally occurring polypeptide sequence.

[0269] In some embodiments, the linker comprises a non-peptide linker. In other embodiments, the linker consists of a non-peptide linker. In some embodiments, the non-peptide linker can be, for example, maleimidocaproyl (MC), maleimidopropanoyl (MP), methoxyl polyethylene glycol (MPEG), 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate succinimidyl (SMCC), m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), 4-(p-maleimidophenyl)butyrate succinimidyl (SMPB), (4-iodoacetyl)aminobenzoate N-succinimidyl (SIAB), 6-[3-(2-pyridyldithio)-propionamido]hexanoate succinimidyl (LC-SPDP), 4-succinimidyloxycarbonyl-α-methyl-α-(2-pyridyldithio)toluene (SMPT), and the like (see U.S. Pat. No. 7,375,078).

[0270] The linker can be introduced into the polypeptide sequence using techniques known in the art (e.g., chemical conjugation, recombinant technology, or peptide synthesis). The modification can be confirmed by DNA sequence analysis. In some embodiments, the linker can be introduced using recombinant technology. In other embodiments, the linker can be introduced using solid-phase peptide synthesis. In certain embodiments, the cationic carrier unit disclosed herein can simultaneously contain one or more linkers introduced using recombinant technology and one or more linkers introduced using solid-phase peptide synthesis or chemical conjugation methods known in the art. In some embodiments, the linker comprises a cleavage site.

[0271] III. Payload As used herein, the term "payload" refers to a biologically active molecule, e.g., a therapeutic agent, which may be interactive with the cationic carrier units of the present disclosure, either by itself or via an adaptor, and which may be included in the core of the micelles of the present disclosure.

[0272] Other bioactive molecules include antivirals, nucleic acids, and other antivirals including those against any DNA and RNA virus, AIDS, HIV and hepatitis viruses, adenoviruses, alphaviruses, arenaviruses, coronaviruses, flaviviruses, herpesviruses, myxoviruses, oncornaviruses, papovaviruses, paramyxoviruses, parvoviruses, picornaviruses, poxviruses, reoviruses, rhabdoviruses, rhinoviruses, togaviruses and viroids; gram-negative and gram-positive bacteria, Acinetobacter spp., Achromobacter spp., Bacteroides spp., Clostridium spp., Chlamydia spp., and the like. any antibacterial drug, nucleic acid, and other antibacterial substance including against lamydia, enterobacteria, Haemophilus, Lactobacillus, Neisseria, Staphyloccus, or Streptoccocus; any antifungal drug, nucleic acid, and other antifungal substance including against Aspergillus, Candida, Coccidiodes, mycosis, phycomycetes, and yeast; any drug, nucleic acid, and other substance against mycoplasma and rickettsia; any antiprotozoan drug, nucleic acid, and other substance; any antiparasitic drug, nucleic acid, and other substance; any drug, nucleic acid, and other substance against heart disease, tumors, and virus-infected cells.

[0273] (a) Nucleic acid In some embodiments, the bioactive molecule (payload) is a nucleic acid, such as RNA or DNA. Suitable nucleic acid active agents for delivery using the micelles of the present disclosure include oligonucleotides, such as all types of RNA and all types of DNA, including probes and primers used in polymerase chain reaction (PCR), hybridization, or DNA sequencing. In some embodiments, the nucleic acid includes mRNA, miRNA, miRNA sponge, tough decoy miRNA (TD), antimir (antagomir), small RNA, rRNA, siRNA, shRNA, gDNA, cDNA, pDNA, PNA, BNA, antisense oligonucleotide (ASO), aptamer, cyclic dinucleotide, or any combination thereof.

[0274] In some embodiments, the bioactive molecule (payload) comprises a small interfering RNA (siRNA), which is a double-stranded RNA that can induce sequence-specific post-transcriptional gene silencing, thereby reducing or even inhibiting gene expression. For example, siRNA can cause specific degradation of a homologous RNA molecule, such as an mRNA, within the region of sequence homology between both the siRNA and the target RNA. Non-limiting exemplary siRNAs are disclosed in WO02 / 44321, which is incorporated by reference in its entirety. In some embodiments, the siRNA can be about 20-27 base pairs in length.

[0275] In some embodiments, siRNA can be chemically modified. In some embodiments, siRNA can be bound to cholesterol. In some embodiments, cholesterol can be bound to the 3' end of the sense strand or antisense strand of siRNA. In some embodiments, cholesterol can be bound to the 5' end of the sense strand or antisense strand of siRNA. In some embodiments, cholesterol can be bound to both the 3' and 5' ends of the sense strand or antisense strand of siRNA.

[0276] As used herein, the number of charges in an siRNA is the number of nucleotides minus two.

[0277] In some embodiments, the bioactive molecule (e.g., anionic payload) comprises a short hairpin RNA (shRNA). In some embodiments, the bioactive molecule comprises a miRNA or a miRNA inhibitor (antimiR). In some embodiments, the bioactive molecule (e.g., anionic payload) can be 10-30 nucleotides in length, e.g., 14-25 nucleotides in length. In some embodiments, the bioactive molecule (e.g., anionic payload) has a length of 16-30 nucleotides, 18-25 nucleotides, particularly 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the bioactive molecule (e.g., anionic payload) comprises a nucleotide sequence having a length of less than 200 nucleotides. In some embodiments, the anionic payload comprises a nucleotide sequence having a length of less than about 150, about 140, about 130, about 120, about 110, about 100, about 90, about 80, about 70, about 60, about 50, about 40, about 30, about 25, about 24, about 23, about 22, about 21, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 12, about 11, or about 10 nucleotides. In some embodiments, the anionic payload comprises a nucleotide sequence having a length of about 30 to about 10, about 25 to about 11, about 30 to about 15, about 25 to about 15, about 24 to about 15, or about 23 to about 15 nucleotides. In some embodiments, the anionic payload comprises a nucleotide sequence having a length of about 30, about 29, about 28, about 27, about 26, about 25, about 24, about 23, about 22, about 21, about 20, about 19, about 18, about 17, about 16, about 15, about 14, or about 13 nucleotides. In some embodiments, the anionic payload comprises a nucleotide sequence having a length of about 22 nucleotides.

[0278] The sequences of miRNAs are publicly available, for example, through the miRBase registry (Griffiths-Jones, et al., Nucleic Acids Res., 36(Database Issue):D154-D158(2008); Griffiths-Jones, et al., Nucleic Acids Res., 36(Database Issue):D140-D144(2008); Griffiths-Jones, et al., Nucleic Acids Res., 36(Database Issue):D109-D111(2008)) and other publicly accessible databases.

[0279] In some embodiments, the miRNA inhibitor is an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or modified forms thereof. In some embodiments, the miRNA antagonist is an antimir. Antimirs are a specific class of miRNA inhibitors, described, for example, in US2007 / 0213292, belonging to Stoffel et al. Antimirs are RNA-like oligonucleotides that contain various modifications for RNase protection and pharmacological properties, such as enhanced tissue and cellular uptake. Antimirs differ from normal RNA in that they have complete 2'-O-methylation of sugars, phosphorothioate backbones, and cholesterol moieties at the 3' end.

[0280] Non-limiting examples of antimirs and other miRNA inhibitors are described in WO2009 / 020771, WO2008 / 091703, WO2008 / 046911, WO2008 / 074328, WO2007 / 090073, WO2007 / 027775, WO2007 / 027894, WO2007 / 021896, WO2006 / 093526, WO2006 / 112872, WO2007 / 112753, WO2007 / 112754, WO2005 / 023986, or WO2005 / 013901, all of which are incorporated herein by reference.

[0281] In some embodiments, the anionic payload comprises mRNA, miRNA, miRNA sponge, tough decoy miRNA, antimir, small RNA, rRNA, siRNA, shRNA, gDNA, cDNA, pDNA, PNA, BNA, antisense oligonucleotide (ASO), aptamer, cyclic dinucleotide, or any combination thereof. In some embodiments, the anionic payload is siRNA. In some embodiments, the anionic payload is mRNA. In some embodiments, the anionic payload is PNA.

[0282] In some embodiments, the nucleic acids are phosphodiester antisense oligonucleotides and any oligonucleotide in which the sugar phosphate "backbone" has been derivatized or replaced with a "backbone analog," such as a phosphorothioate, phosphorodithioate, phosphoramidate, alkyl phosphate triester, or methylphosphonate linkage. In some embodiments, the nucleic acid active agents are antisense oligonucleotides and any oligonucleotide or oligodeoxynucleotide with a non-phosphorus backbone analog, such as a sulfamate, 3'-thioformacetal, methylene(methylimino) (MMI), 3'-N-carbamate, or morpholino carbamate.

[0283] In some embodiments, the bioactive molecule (payload) is an antimir. As used herein, the terms "antimir", "anti-microRNA", "anti-miRNA" and variations thereof refer to molecules (e.g., synthetically produced molecules) used to disable microRNA (miRNA) function in cells for a desired response. miRNAs are sequences (approximately 20-22 bp) complementary to mRNAs involved in RNA cleavage or translational inhibition. By controlling miRNAs that regulate mRNAs in cells, antimirs (also referred to as anti-miRNA oligonucleotides, AMOs, or antagomirs) can be used for further regulation as well as for the treatment of certain cellular disorders. This regulation can occur through a steric block mechanism as well as hybridization with miRNAs.

[0284] These interactions between antimirs and miRNAs in the body can be for the treatment of disorders where over / under expression occurs or abnormalities in miRNAs lead to problems in coding. Some of the miRNA-related disorders encountered by humans include cancer, muscle diseases, autoimmune disorders, and viruses.

[0285] The various components of antimirs can be manipulated to affect the binding affinity and potency of antimirs. The 2'-sugar of antimirs can be modified to be substituted with fluorine and various methyl groups, almost all of which increase the binding affinity. However, some of these modified 2'-sugar antimirs have a negative effect on cell proliferation. Modification of the 5'-3' phosphodiester backbone linkage to a phosphorothioate (PS) backbone linkage is also known to have an effect on target affinity. The use of PS mutations has been shown to decrease the Tm of oligonucleotides, which results in lower target affinity. The final requirement for antimirs is mismatch specificity and length restriction. Due to miRNAs of the same family sharing a "seed" (shared) sequence and differing only by a few additional nucleotides, one antimir can potentially target multiple miRNA sequences. One or more examples of antimir or miRNA sequences are shown in the table below. [Table 1]

[0286] In some embodiments, the payload is a polynucleotide comprising a nucleotide sequence having a length of 5-30 nucleotides. In some embodiments, the polynucleotide has a length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the nucleotide sequence has a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides. In some embodiments, the payload comprises a nucleotide sequence having a length of less than 200 nucleotides. In some embodiments, the payload comprises a nucleotide sequence having a length of less than about 150, about 140, about 130, about 120, about 110, about 100, about 90, about 80, about 70, about 60, about 50, about 40, about 30, about 25, about 24, about 23, about 22, about 21, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 12, about 11, or about 10 nucleotides. In some embodiments, the payload comprises a nucleotide sequence having a length of about 30 to about 10, about 25 to about 11, about 30 to about 15, about 25 to about 15, about 24 to about 15, or about 23 to about 15 nucleotides. In some embodiments, the payload comprises a nucleotide sequence having a length of about 30, about 29, about 28, about 27, about 26, about 25, about 24, about 23, about 22, about 21, about 20, about 19, about 18, about 17, about 16, about 15, about 14, or about 13 nucleotides.

[0287] In some embodiments, the payload (e.g., antimir) is a nucleotide sequence that targets hsa-miR-485, e.g., hsa-miR-485-3p. In some embodiments, hsa-miR-485-3p has the sequence GUCAUACACGGCUCUCCUCUCU (SEQ ID NO: 17). In some embodiments, the payload (e.g., antimir) is a nucleotide sequence that comprises, consists essentially of, or consists of AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18), where U can optionally be T. In some embodiments, the payload (e.g., antimir) is a nucleotide sequence that comprises, consists essentially of, or consists of AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18), where the nucleotide sequence has one mismatch, two mismatches, three mismatches, or four mismatches. In some embodiments, the payload (e.g., antimir) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18), where the nucleotide sequence has one or two mismatches. In other embodiments, the payload (e.g., antimir) is a nucleotide sequence that targets the seed sequence of hsa-miR-485-3p (UCAUACA; SEQ ID NO: 19). In some embodiments, the payload (e.g., antimir) is a nucleotide sequence comprising UCAUACA (SEQ ID NO: 19), where U can optionally be T (complement of the seed), and the nucleotide sequence is about 10 nucleotides to 30 nucleotides (e.g., 10-25, 10-24, 10-23, 10-22, 10-21, 10-20, 10-19, or 10-18) in length.In some aspects, the payload (e.g., an antimir) is a nucleotide sequence comprising UGUAUGA (SEQ ID NO: 20), where U can optionally be T (the complement of the seed), and where the nucleotide sequence comprises 1, 2 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 5' end of the complement of the seed sequence and / or 1, 2 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 3' end of the complement of the seed sequence.

[0288] In some embodiments, the payload is 5'-UGUAUGA-3' (SEQ ID NO:23), 5'-GUGUAUGA-3' (SEQ ID NO:24), 5'-CGUGUAUGA-3' (SEQ ID NO:25), 5'-CCGUGUAUGA-3' (SEQ ID NO:26), 5'-GCCGUGUAUGA-3' (SEQ ID NO:27), 5'-AGCCGUGUAUGA-3' (SEQ ID NO:28), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO:29), 5'-AGAGCCGUGUAUGA-3' (SEQ ID NO:30), 5'-GCCGUGUAUGA-3' (SEQ ID NO:31), 5'-GCCGUGUAUGA-3' (SEQ ID NO:32), 5'-GCCGUGUAUGA-3' (SEQ ID NO:33), 5'-GCCGUGUAUGA-3' (SEQ ID NO:34), 5'-GCCGUGUAUGA-3' (SEQ ID NO:35), 5'-GCCGUGUAUGA-3' (SEQ ID NO:36), 5'-GCCGUGUAUGA-3' (SEQ ID NO:37), 5'-GCCGUGUAUGA-3' (SEQ ID NO:38), 5'-GCCGUGUAUGA-3' (SEQ ID NO:39), 5'-GCCGUGUAUGA-3' (SEQ ID NO:40), 5'-GCCGUGUAUGA-3' (SEQ ID NO:41), 5'-GCCGUGUAUGA-3' (SEQ ID NO:42), 5'-GCCGUGUAUGA-3' (SEQ ID NO:43), 5'-GCCGUGUAUGA-3' (SEQ ID NO:44), 5'-GCCGUGUAUGA-3' (SEQ ID NO:45), SEQ ID NO:30), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO:31), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO:32), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO:33), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO:34), 5'-AGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO:35), 5'-GAGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO:36); 5'-UGUAUGAC -3' (SEQ ID NO: 37), 5'-GUGUAUGAC-3' (SEQ ID NO: 38), 5'-CGUGUAUGAC-3' (SEQ ID NO: 39), 5'-CCGUGUAUGAC-3' (SEQ ID NO: 40), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 41), 5'-AGCCGUGUAUGAC-3' (SEQ ID NO: 42), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 43), 5'-AGAGCCGUGUAUGAC-3' (SEQ ID NO: 44), 5'-GAGAGCCGUG The nucleotide sequence is selected from the group consisting of UAUGAC-3' (SEQ ID NO: 45), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 46), 5'-AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 47), 5'-GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 48), 5'-AGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 49), or 5'-GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 50).

[0289] In some embodiments, the payload is 5'-TGTATGA-3' (SEQ ID NO:51), 5'-GTGTATGA-3' (SEQ ID NO:52), 5'-CGTGTATGA-3' (SEQ ID NO:53), 5'-CCGTGTATGA-3' (SEQ ID NO:54), 5'-GCCGTGTATGA-3' (SEQ ID NO:55), 5'-AGCCGTGTATGA-3' (SEQ ID NO:56), 5'-GAGCCGTGTATGA-3' (SEQ ID NO:57), 5'-AGAGCCGTGTATGA-3' (SEQ ID NO:58), 5'-AGAGCCGTGTATGA-3' (SEQ ID NO:59), 5'-GCCGTGTATGA-3' (SEQ ID NO:510), 5'-GCCGTGTATGA-3' (SEQ ID NO:511), 5'-GCCGTGTATGA-3' (SEQ ID NO:512), 5'-GCCGTGTATGA-3' (SEQ ID NO:513), 5'-GCCGTGTATGA-3' (SEQ ID NO:514), 5'-GCCGTGTATGA-3' (SEQ ID NO:515), 5'-GCCGTGTATGA-3' (SEQ ID NO:516), 5'-GCCGTGTATGA-3' (SEQ ID NO:517), 5'-GCCGTGTATGA-3' (SEQ ID NO:518), 5'-GCCGTGTATGA-3' (SEQ ID NO:519), 5'-GCCGTGTATGA-3' (SEQ ID NO:520), 5'-GCCGTGTATGA-3' (SEQ ID NO:521), 5'-GCCGTGTATGA-3' (SEQ ID NO:522), 5'-GCCGTGTAT '(SEQ ID NO:58), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO:59), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO:60), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO:61), 5'-GAGGAGAGCCGTGTATGA-3' (SEQ ID NO:62), 5'-AGAGGAGAGCCGTGTATGA-3' (SEQ ID NO:63), 5'-GAGAGGAGAGCCGTGTATGA-3' (SEQ ID NO:64); 5'-TGTA TGAC-3' (SEQ ID NO: 65), 5'-GTGTATGAC-3' (SEQ ID NO: 66), 5'-CGTGTATGAC-3' (SEQ ID NO: 67), 5'-CCGTGTATGAC-3' (SEQ ID NO: 68), 5'-GCCGTGTATGAC-3' (SEQ ID NO: 69), 5'-AGCCGTGTATGAC-3' (SEQ ID NO: 70), 5'-GAGCCGTGTATGAC-3' (SEQ ID NO: 71), 5'-AGAGCCGTGTATGAC-3' (SEQ ID NO: 72), 5'-GAG A nucleotide sequence comprising: AGCCGTGTATGAC-3' (SEQ ID NO: 73), 5'-GGAGAGCCGTGTATGAC-3' (SEQ ID NO: 74), 5'-AGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 75), 5'-GAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 76), 5'-AGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 77), or 5'-GAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 78).

[0290] In some embodiments, the payload (e.g., antimir) is a nucleotide sequence that targets hsa-miR-204, e.g., hsa-miR-204-5p. hsa-miR-204-5p is shown in Table 1 as UUCCCUUUGUCAUCCUAUGCCU (SEQ ID NO: 13). In some embodiments, the payload (e.g., antimir) is a nucleotide sequence that comprises, consists essentially of, or consists of AGGCAUAGGAUGACAAAGGGAA (SEQ ID NO: 15), where U can optionally be T. In some embodiments, the payload (e.g., antimir) is a nucleotide sequence that comprises, consists essentially of, or consists of AGGCAUAGGAUGACAAAGGGAA (SEQ ID NO: 15), where U can optionally be T, and the nucleotide sequence has one mismatch, two mismatches, three mismatches, or four mismatches. In some embodiments, the payload (e.g., antimir) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGGCAUAGGAUGACAAAGGGAA (SEQ ID NO: 15), where U can optionally be T, and the nucleotide sequence has one or two mismatches. In other embodiments, the payload (e.g., antimir) is a nucleotide sequence that targets the seed sequence of hsa-miR-204-5p (UCCCUUU; SEQ ID NO: 21). In some embodiments, the payload (e.g., antimir) is a nucleotide sequence comprising AAAGGGA (SEQ ID NO: 22) (the complement of the seed), where U can optionally be T, and the nucleotide sequence is about 10 nucleotides to 30 nucleotides (e.g., 10-25, 10-24, 10-23, 10-22, 10-21, 10-20, 10-19, or 10-18) in length.In some embodiments, the payload (e.g., an antimir) is a nucleotide sequence comprising AAAGGGA (SEQ ID NO: 22) (complement of the seed), where the nucleotide sequence comprises 1, 2 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 5' end of the complement of the seed sequence and / or 1, 2 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 3' end of the complement of the seed sequence.

[0291] i. Chemically modified polynucleotides In some aspects, a polynucleotide of the disclosure (e.g., an antimir, e.g., a miR485 antimir) comprises at least one chemically modified nucleoside and / or nucleotide. When a polynucleotide of the disclosure is chemically modified, the polynucleotide may be referred to as a "modified polynucleotide."

[0292] "Nucleoside" refers to a compound containing a sugar molecule (e.g., pentose or ribose) or derivative thereof, along with an organic base (e.g., purine or pyrimidine) or derivative thereof (also referred to herein as a "nucleobase").

[0293] "Nucleotide" refers to a nucleoside that includes a phosphate group. Modified nucleotides can be synthesized by any useful method, for example, chemically, enzymatically, or recombinantly, to include one or more modified non-natural nucleosides.

[0294] A polynucleotide may comprise a region or regions of linked nucleosides. Such regions may have variable backbone linkages. The linkages may be standard phosphodiester bonds, in which case the polynucleotide comprises a region of nucleotides.

[0295] Modified polynucleotides disclosed herein may contain a variety of different modifications.In some embodiments, modified polynucleotides contain one, two or more (optionally different) nucleoside or nucleotide modifications.In some embodiments, modified polynucleotides may exhibit one or more desirable properties, such as improved thermal or chemical stability, reduced immunogenicity, reduced degradation, increased binding to target microRNA, reduced non-specific binding to other microRNA or other molecules, compared to unmodified polynucleotides.

[0296] In some aspects, the polynucleotide of the present disclosure is chemically modified.As used herein, with respect to polynucleotide, the term "chemical modification" or, as appropriate, "chemically modified" refers to the modification of one or more of adenosine (A), guanosine (G), uridine (U), thymidine (T), or cytidine (C) ribonucleosides or deoxyribonucleosides, including, but not limited to, their nucleobase, sugar, backbone, or any combination thereof, in their position, pattern, percentage, or population.

[0297] In some embodiments, the polynucleotides (e.g., antimirs) of the present disclosure may have uniform chemical modifications of all or any of the same nucleoside types, or groups of modifications generated by downward titration of the same starting modifications on all or any of the same nucleoside types, or a measured percentage of all or any of the same nucleoside types except with random incorporation. In another embodiment, the polynucleotides (e.g., antimirs) of the present disclosure may have uniform chemical modifications of two, three, or four of the same nucleoside types throughout the polynucleotide (e.g., all uridines and all cytosines are modified in the same way, etc.).

[0298] Modified nucleotide base pairing encompasses not only standard adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and / or modified nucleotides containing non-standard or modified bases, where the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonding between the non-standard and standard bases, or between two complementary non-standard base structures. One example of such non-standard base pairing is base pairing between the modified nucleobase inosine and adenine, cytosine, or uracil. Any combination of bases / sugars or linkers can be incorporated into the polynucleotides of the present disclosure.

[0299] Those skilled in the art will understand that, unless otherwise noted, the polynucleotide sequences described in this application recite "T" in representative DNA sequences, but when the sequence represents RNA, "T" is replaced with "U." For example, the TDs of the present disclosure can be administered as RNA, as DNA, or as hybrid molecules containing both RNA and DNA units.

[0300] In some embodiments, a polynucleotide (e.g., an antimir, e.g., a miR485 antimir) comprises at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20 or more) modified nucleobase combinations.

[0301] In some embodiments, the nucleobases, sugars, backbone linkages, or any combination thereof in a polynucleotide (e.g., an antimir, e.g., miR485 antimir) are at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% modified.

[0302] 1. Base modification In certain embodiments, chemical modifications are present in nucleobases in polynucleotides (e.g., antimirs, e.g., miR485 antimirs) of the present disclosure. In some embodiments, at least one chemically modified nucleoside is a modified uridine (e.g., pseudouridine (ψ), 2-thiouridine (s2U), 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), or 5-methoxy-uridine (mo5U)), a modified cytosine (e.g., 5-methylcytidine (m5C)), a modified adenosine (e.g., 1-methyl-adenosine (m1A), N6-methyl-adenosine (m6A), or 2-methyladenine (m2A)), a modified guanosine (e.g., 7-methylguanosine (m7G) or 1-methylguanosine (m1G)), or a combination thereof.

[0303] In some aspects, the polynucleotides (e.g., antimirs, e.g., miR485 antimirs) of the present disclosure are uniformly modified (e.g., completely modified, modified throughout the entire sequence) for a particular modification. For example, the polynucleotides can be uniformly modified with the same type of base modification, e.g., 5-methylcytidine (m5C), meaning that all cytosine residues in the polynucleotide sequence are replaced with 5-methylcytidine (m5C). Similarly, the polynucleotides can be uniformly modified with any type of nucleoside residue present in the sequence by substitution with a modified nucleoside, e.g., any of those described above.

[0304] In some embodiments, a polynucleotide (e.g., an antimir, e.g., miR485 antimir) of the disclosure comprises a combination of at least two (e.g., two, three, four, or more) modified nucleobases. In some embodiments, at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% of one type of nucleobase in a polynucleotide (e.g., an antimir, e.g., miR485 antimir) of the disclosure are modified nucleobases.

[0305] 2. Backbone modification In some aspects, the payload can include a "polynucleotide of the disclosure" (e.g., including an antimir, e.g., miR485 antimir), where the polynucleotide includes any useful modification in the internucleoside linkage. Such linkages, including backbone modifications, useful in the compositions of the disclosure include, but are not limited to, 3'-alkylene phosphonates, 3'-amino phosphoramidates, alkene-containing backbones, aminoalkyl phosphoramidates, aminoalkyl phosphotriesters, boranophosphates, -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, -CH2-NH-CH2-, chiral phosphonates, chiral phosphorothioates, formacetyl and thioformacetyl backbones, methylene(methylimino), methyleneformacetate, methyl ... thioformacetyl and thioformacetyl backbones, methyleneimino and methylenehydrazino backbones, morpholino linkages, -N(CH3)-CH2-CH2-, oligonucleosides with heteroatom internucleoside linkages, phosphinates, phosphoramidates, phosphorodithioates, phosphorothioate internucleoside linkages, phosphorothioate, phosphotriesters, PNAs, siloxane backbones, sulfamate backbones, sulfide, sulfoxide, and sulfone backbones, sulfonate and sulfonamide backbones, thionoalkylphosphonates, thionoalkylphosphotriesters, and thionophosphoramidates. [ka]

[0306] In some embodiments, the presence of the backbone linkages disclosed above increases the stability (e.g., thermal stability) and / or resistance to degradation (e.g., enzymatic degradation) of a polynucleotide of the disclosure (e.g., an antimir, e.g., miR485 antimir). In some embodiments, the stability and / or resistance to degradation of a modified polynucleotide is increased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to a corresponding unmodified polynucleotide (reference or control polynucleotide).

[0307] In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% of the backbone linkages in a polynucleotide of the disclosure (e.g., an antimir, e.g., a miR485 antimir) are modified (e.g., all of them are phosphorothioate).

[0308] In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 backbone linkages in a polynucleotide of the disclosure (e.g., an antimir, e.g., miR485 antimir) are modified (e.g., phosphorothioate).

[0309] In some embodiments, the backbone comprises linkages selected from the group consisting of phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, phosphorothioate linkages, and combinations thereof.

[0310] 3. Sugar modification Modified nucleosides and nucleotides that can be incorporated into polynucleotides (e.g., antimirs, e.g., miR485 antimirs) of the present disclosure can be modified on the sugar of the nucleic acid. Thus, in some aspects, the payload comprises a nucleic acid, where the nucleic acid comprises at least one nucleoside analog (e.g., a nucleoside having a sugar modification).

[0311] In some embodiments, sugar modifications increase the affinity of the binding of a polynucleotide to its target miRNA. Incorporating affinity-enhancing nucleotide analogs, such as LNA or 2'-substituted sugars, into a polynucleotide can allow the length of the polynucleotide to be reduced, and can also relax the upper limit of the polynucleotide size above which non-specific or aberrant binding does not occur.

[0312] In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% of the nucleotides in a polynucleotide of the disclosure (e.g., an antimir, e.g., a miR485 antimir) contain a sugar modification (e.g., LNA).

[0313] In some aspects, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotide units in a polynucleotide of the disclosure (e.g., an antimir, e.g., a miR485 antimir) are sugar modified (e.g., LNA).

[0314] Generally, RNA comprises the sugar group ribose, which is a five-membered ring with oxygen. Non-limiting exemplary modified nucleotides include substitution of oxygen in ribose (e.g., with S, Se, or alkylene, e.g., methylene or ethylene); addition of a double bond (e.g., replacement of ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., formation of a four-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., formation of a six- or seven-membered ring with an additional carbon or heteroatom, e.g., anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and phospho. morpholino, which also has a roamidate backbone; polycyclic forms (e.g., tricyclo); and "unlocked" forms, such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where the ribose is replaced with a glycol unit linked to a phosphodiester bond), threose nucleic acid (TNA, where the ribose is replaced with α-L-threofuranosyl-(3'→2')), and peptide nucleic acid (PNA, where a 2-amino-ethyl-glycine bond replaces the ribose and phosphodiester backbone). The sugar group may also contain one or more carbons that have the opposite stereochemical configuration to the corresponding carbon in ribose. Thus, a polynucleotide molecule may contain nucleotides that contain, for example, arabinose as the sugar.

[0315] The 2' hydroxyl group (OH) of ribose can be modified or replaced with a number of different substituents. Exemplary substitutions at the 2'-position include, but are not limited to, H, halo, optionally substituted C 1~6 Alkyl; optionally substituted C 1~6 Alkoxy; optionally substituted C 6~10Aryloxy; optionally substituted C 3~8 Cycloalkyl; optionally substituted C 3~8 Cycloalkoxy; optionally substituted C 6~10 Aryloxy; optionally substituted C 6~10 Aryl-C 1~6 Alkoxy, optionally substituted C 1~12 (heterocyclyl)oxy; sugar (e.g., ribose, pentose, or any described herein); polyethylene glycol (PEG), -O(CH2CH2O) n CH2CH2OR, where R is H or an optionally substituted alkyl and n is an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20); "locked" nucleic acids (LNAs) (wherein the 2'-hydroxy is 1~6 Alkylene or C 1~6 They are linked to the 4'-carbon of the same ribose sugar by a heteroalkylene bridge, where exemplary bridges include methylene, propylene, ether, amino bridge, aminoalkyl, aminoalkoxy, amino, and amino acid.

[0316] In some embodiments, the nucleoside analogs present in the polynucleotides (e.g., antimirs, e.g., miR485 antimirs) of the present disclosure include, for example, 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-O-alkyl-SNA, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, arabinonucleic acid (ANA) units, 2'-fluoro-ANA units, HNA units, INA (intercalating nucleic acid) units, 2'MOE units, or any combination thereof. In some embodiments, the LNA is, for example, oxyLNA (e.g., β-D-oxy-LNA or α-L-oxy-LNA), aminoLNA (e.g., β-D-amino-LNA or α-L-amino-LNA), thioLNA (e.g., β-D-thio0-LNA or α-L-thio-LNA), ENA (e.g., β-D-ENA or α-L-ENA), or any combination thereof.

[0317] In some aspects, nucleoside analogs present in the polynucleotides of the disclosure include locked nucleic acids (LNA); 2'-0-alkyl RNA; 2'-amino DNA; 2'-fluoro DNA; arabino nucleic acid (ANA); 2'-fluoro ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleosides (cEt), 2'-0-methyl nucleic acid (2'-OMe), 2'-0-methoxyethyl nucleic acid (2'-MOE), or any combination thereof.

[0318] In some aspects, polynucleotides of the disclosure (e.g., antimirs, e.g., miR485 antimirs) can include both modified RNA nucleotide analogs (e.g., LNA) and DNA units. In some aspects, polynucleotides of the disclosure are gapmers. See, e.g., U.S. Patent Nos. 8,404,649, 8,580,756, 8,163,708, and 9,034,837, all of which are incorporated herein by reference in their entirety. In some aspects, polynucleotides of the disclosure are micromirs. See, U.S. Patent Publication No. US20180201928, which is incorporated herein by reference in its entirety.

[0319] IV. Micelles The present disclosure also provides micelles comprising the cationic carrier units of the present disclosure. The micelles of the present disclosure comprise the cationic carrier units of the present disclosure and a negatively charged payload, where the negatively charged payload and the cationic carrier units are bound to each other. In some embodiments, the binding comprises a covalent bond. In other embodiments, the binding does not comprise a covalent bond. In other embodiments, the binding is by ionic bonds, i.e., electrostatic interactions. In some embodiments, the negatively charged payload (e.g., DNA and / or RNA) is not bound to the cationic carrier units by covalent bonds, and / or the negatively charged payload interacts with the cationic carrier moiety of the cationic carrier units only by ionic interactions.

[0320] In some embodiments, the cationic carrier units and micelles of the present disclosure protect payloads (e.g., DNA and / or RNA) from degradation (e.g., by DNases and / or RNases). First, the cationic carrier units can protect the payload through electrostatic interactions. Second, the micelles sequester the payload in the core of the micelle, i.e., outside the reach of DNases and / or RNases. In some embodiments, protection of the payload from circulating enzymes (e.g., nucleases) can increase the half-life of the negatively charged payload (e.g., DNA and / or RNA) compared to the free payload. In some embodiments, encapsulation of a payload into a micelle of the present disclosure may increase the plasma half-life of the payload by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold as compared to the free payload.

[0321] In some embodiments, the positive charge of the cationic carrier unit, particularly the charge of the cationic carrier moiety, is sufficient to form micelles when mixed with a negatively charged payload (e.g., nucleic acid) in solution, and the overall ionic ratio of the cationic carrier unit, particularly the cationic carrier moiety, to the negatively charged payload (e.g., nucleic acid) is about 1:1. In some embodiments, the positive charge of the cationic carrier unit, particularly the charge of the cationic carrier moiety, is sufficient to form micelles when mixed with a negatively charged payload (e.g., nucleic acid) in solution, and the overall ionic ratio of the cationic carrier unit, particularly the cationic carrier moiety, to the negatively charged payload (e.g., nucleic acid) is about 2:1. In some embodiments, the overall ionic ratio of the cationic carrier unit, particularly the cationic carrier moiety, to the negatively charged payload (e.g., nucleic acid) is higher than 1:1 (i.e., an excess of cationic carrier unit is used). In some embodiments, the overall ionic ratio of the cationic carrier units, particularly the cationic carrier moieties thereof, to the negatively charged payload (e.g., nucleic acid) is less than 1:1 (i.e., an excess of the negatively charged payload is used).

[0322] In some embodiments, when combined with a suitable buffer (e.g., PBS), the complexes formed between the cationic carrier units of the present disclosure and a payload (e.g., an antisense oligonucleotide such as an antimir) self-assemble into micelles.

[0323] Micelles are water-soluble or colloidal structures or aggregates composed of one or more amphiphilic molecules. Amphiphilic molecules are molecules that contain at least one hydrophilic (polar) portion and at least one hydrophobic (non-polar) portion. A "typical micelle" has a single, central, and predominantly hydrophobic compartment or "core" surrounded by a hydrophilic layer or "shell". In aqueous solution, micelles form aggregates in which the hydrophilic "head" region of the amphiphilic molecule is in contact with the surrounding solvent, isolating the hydrophobic single tail region of the amphiphilic molecule in the micellar core. The shape of the micelle is approximately spherical. Other shapes are also possible, such as ellipsoids, cylinders, rod-shaped structures, or polymersomes. The shape and size of the disclosed micelles, and therefore the loading capacity, can be modified by changing the ratio between the water-soluble biopolymer (e.g., PEG) and the cationic carrier (e.g., polylysine). Depending on the ratio, the carrier units may organize as small particles, small micelles, micelles, rod-shaped structures, or polymersomes. Thus, the term "micelles of the present disclosure" encompasses not only typical micelles, but also small particles, small micelles, micelles, rod-shaped structures, or polymersomes.

[0324] Micelles of the present disclosure may be composed of either a single unimolecular polymer containing hydrophobic and hydrophilic moieties, or a mixture of assemblies containing multiple amphiphilic (i.e., surfactant) molecules formed above the critical micelle concentration (CMC) in polar solutions (i.e., aqueous solutions). Micelles are self-assembled from one or more amphiphilic molecules, where the moieties are oriented to result in a predominantly hydrophobic inner core and a predominantly hydrophilic exterior.

[0325] Micelles of the present disclosure may range in size from 5 to about 2000 nanometers. In some embodiments, the diameter of the micelles is from about 10 nm to about 200 nm. In some embodiments, the diameter of the micelles is from about 1 nm to about 100 nm, from about 10 nm to about 100 nm, from about 10 nm to about 90 nm, from about 10 nm to about 80 nm, from about 10 nm to about 70 nm, from about 20 nm to about 100 nm, from about 20 nm to about 90 nm, from about 20 nm to about 80 nm, from about 20 nm to about 70 nm, from about 30 nm to about 100 nm, from about 30 nm to about 90 nm, from about 30 nm to about 80 nm, from about 30 nm to about 70 nm, from about 40 nm to about 100 nm, from about 40 nm to about 90 nm, from about 40 nm to about 80 nm, or from about 40 nm to about 70 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 30 nm to about 60 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 15 nm to about 90 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 15 nm to about 80 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 15 nm to about 70 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 15 nm to about 60 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 15 nm to about 50 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 20 nm to about 60 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 20 nm to about 50 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 20 nm to about 40 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 25 nm to about 35 nm. In some embodiments, the micelles of the present disclosure have a diameter of about 32 nm.

[0326] In some embodiments, a micelle may contain a single type of antimir (e.g., miR485 antimir). In other embodiments, a micelle may contain two or more types of antimir, for example, (i) antimirs with different structures that target the same miRNA, (ii) antimirs with different structures that target different miRNAs, (iii) antimirs with the same structure that target the same miRNA, or (iv) a combination thereof.

[0327] In some embodiments, the micelles of the present disclosure include a single type of cationic carrier unit. In other embodiments, the micelles of the present disclosure include two or more types of cationic carrier units (e.g., targeting different receptors on the target cell surface). In some embodiments, the micelles of the present disclosure can include cationic carrier units with different targeting moieties, different cationic carrier moieties (e.g., to accommodate different payloads), and / or different hydrophobic and / or bridging units.

[0328] Different types of cationic or anionic carrier units can be combined together to form micelles with a payload. For example, to target the blood-brain barrier, micelles of the present disclosure can include cationic (or anionic) carrier units linked to a targeting moiety and cationic (or anionic) carrier units not linked to a targeting moiety. In some embodiments, micelles include about 50 to about 200 cationic or anionic carrier units. In other embodiments, micelles include about 50 to about 150, about 50 to about 140, about 50 to about 130, about 50 to about 120, about 50 to about 110, or about 50 to about 100 cationic or anionic carrier units. In some embodiments, micelles include about 60 to about 200 cationic or anionic carrier units. In other embodiments, the micelles contain about 60 to about 150, about 60 to about 140, about 60 to about 130, about 60 to about 120, about 60 to about 110, about 60 to about 100, about 60 to about 90, about 60 to about 80, or about 60 to about 70 cationic or anionic carrier units. In some embodiments, the micelles contain about 70 to about 200 cationic or anionic carrier units. In other embodiments, the micelles contain about 70 to about 150, about 70 to about 140, about 70 to about 130, about 70 to about 120, about 70 to about 110, about 70 to about 100, about 70 to about 90, or about 70 to about 80 cationic or anionic carrier units. In some embodiments, the micelles contain about 80 to about 200 cationic or anionic carrier units. In other embodiments, the micelles contain about 80 to about 150, about 80 to about 140, about 80 to about 130, about 80 to about 120, about 80 to about 110, about 80 to about 100, or about 80 to about 90 cationic or anionic carrier units. In some embodiments, the micelles contain about 90 to about 200 cationic or anionic carrier units. In other embodiments, the micelles contain about 90 to about 150, about 90 to about 140, about 90 to about 130, about 90 to about 120, about 90 to about 110, or about 90 to about 100 cationic or anionic carrier units. In some embodiments, the micelles contain about 100 to about 200 cationic or anionic carrier units.In other embodiments, the micelles contain from about 100 to about 150, from about 100 to about 140, from about 100 to about 130, from about 100 to about 120, from about 100 to about 110, or from about 100 to about 100 cationic or anionic carrier units.

[0329] The present disclosure also includes micelles comprising (i) a nucleotide sequence (e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) a cationic carrier unit as described herein. In some embodiments, the present disclosure relates to micelles comprising (i) a nucleotide sequence, e.g., an miRNA or an miRNA inhibitor (e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) about 80 to about 120 (e.g., about 85 to about 115, about 90 to about 110, about 95 to about 105) cationic carrier units as described herein, e.g., Schemes I-VI, I'-VI', or combinations thereof (see Figures 2A-2I).

[0330] In some embodiments, the micelle comprises (i) a nucleotide sequence, e.g., an miRNA or miRNA inhibitor (e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) about 80 to about 120 (e.g., about 80, about 85, about 90, about 95, about 100, about 105, or about 110) cationic carrier units described herein, e.g., optionally, [CC]-L1-[CM]-L2-[HM] (see FIG. 2). In some embodiments, the micelle comprises (i) a nucleotide sequence, e.g., an miRNA or an miRNA inhibitor (e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) about 90 to about 110, e.g., about 100, cationic carrier units, wherein (a) about 45 to about 90, e.g., about 80, of the cationic carrier units comprise [CC]-L1-[CM]-L2-[HM], and (b) about 45 to about 55, e.g., about 50, of the cationic carrier units comprise WP-CC-CM, where TM is phenylalanine and WP is (PEG). 5000 and CC is about 40 to about 50 lysines, e.g., about 45, about 46, about 47, about 48, about 49, or about 50 lysines, and about 5 to about 15, about 10 of the lysines are fused to vitamin B3 (nicotinamide).

[0331] In some embodiments, the disclosure comprises (i) a nucleotide sequence, such as an siRNA (e.g., a 21-mer), and (ii) about 35 to about 60 (e.g., about 35, about 40, about 45, about 50, about 55, or about 60) cationic carrier units disclosed herein, wherein the charge ratio between the cationic carrier and the siRNA is about 2.0 (see Figures 15A-15E and 17A-17E).

[0332] In some embodiments, the present disclosure comprises (i) a nucleotide sequence, such as a cholesterol-conjugated siRNA (e.g., a 21-mer), and (ii) about 35 to about 60 (e.g., about 35, about 40, about 45, about 50, about 55, or about 60) cationic carrier units as disclosed herein, wherein the charge ratio between the cationic carrier and the siRNA is about 1.0 (see Figures 8A-8D and 9A-9D).

[0333] In some embodiments, a micelle of the present disclosure comprises (i) a nucleotide sequence, e.g., a miR485-3p inhibitor, e.g., 5'-AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 18), and (ii) about 100 cationic carrier units, wherein (a) about 50 cationic carrier units comprise TM-WP-CC-AM and (b) about 50 cationic carrier units comprise WP-CC-CM, wherein TM is phenylalanine and WP is (PEG) 5000 and CC is about 47 lysines, with about 10 lysines each fused to vitamin B3 (nicotinamide).

[0334] In some embodiments, a micelle can contain a single payload (e.g., a single oligonucleotide, e.g., an antimir). In other embodiments, a micelle can contain more than one payload (e.g., multiple oligonucleotides, e.g., multiple antimirs).

[0335] V. Manufacturing method The present disclosure also provides methods of making the cationic carrier units and micelles of the present disclosure. In general, the present disclosure provides methods of preparing the cationic carrier units of the present disclosure, including, for example, synthesizing the cationic carrier units as described in the Examples section. As used herein, the term "synthesize" refers to assembling the cationic carrier units using methods well known in the art. For example, protein components (e.g., antibody targeting moieties) can be prepared recombinantly and then coupled to other components of the cationic carrier units. In some aspects, each of the components of the cationic carrier units can be prepared using methods known in the art, such as recombinant protein production, solid phase peptide or nucleic acid synthesis, chemical synthesis, enzymatic synthesis, or any combination thereof, and the resulting components can be coupled using chemical and / or enzymatic methods known in the art.

[0336] The cationic carrier unit of the present disclosure can be purified to remove contaminants. In some aspects, the cationic carrier unit comprises a homogenous population of cationic carrier units. However, in other aspects, the cationic carrier unit can comprise multiple types (e.g., some of them contain targeting moieties, and some contain other moieties but do not have targeting moieties). In some aspects, the preparation of the cationic carrier unit of the present disclosure comprises lyophilization or any other type of dry storage suitable for reconstitution. In some aspects, the preparation of the cationic carrier unit in dry form is performed after the cationic carrier unit is combined with a payload (e.g., nucleic acid).

[0337] In some embodiments, the method of preparing micelles of the present disclosure comprises mixing a cationic carrier unit with a negatively charged payload (e.g., a nucleic acid such as an antisense oligonucleotide, e.g., an antimir) in a 1:1 ionic ratio. In some embodiments, the cationic carrier unit and the negatively charged payload are combined in solution. In some embodiments, after combining the cationic carrier and the negatively charged payload in solution, the resulting solution is lyophilized or dried. In some embodiments, the combination of the cationic carrier and the negatively charged payload is performed in a dry form.

[0338] The ratio of the number n of monomer units in the water-soluble polymer (A, e.g., PEG) to the number m of monomer units (e.g., lysine) in the cationic carrier moiety (B, e.g., polylysine) (in either case, the number of units n or m can be up to 1,000 units) affects the size and shape of the resulting micelles. At a mB / (nA+mB) ratio of 0.5, the resulting micelles are classical micelles. When mB / (nA+mB) is greater than 0.5, the resulting micelles are rod-shaped micelles or polymersomes. When mB / (nA+mB) is less than 0.5, the resulting micelles are small micelles or small particles.

[0339] The micelles of the present disclosure can be produced using any of the techniques known in the art, such as vortexing, extrusion, or sonication. The formation of micelles depends on the application of conditions that exceed the critical micelle concentration (CMC) of the solution containing the cationic carrier units of the present disclosure. After they reach a certain value of concentration, the surfactants begin to associate and self-assemble into more complex units, such as micelles. The CMC of the solution containing the cationic carriers of the present disclosure can be determined by any physical property (e.g., surface tension) that shows a clear transition around the CMC.

[0340] The well-known Smith-Ewart theory predicts that the number of nucleated particles that lead to the formation of micelles at concentrations above the CMC is proportional to the 0.6 power of the surfactant (in this disclosure, cationic carrier units complexed or associated with an anionic payload) concentration, since for a given surfactant, the number of micelles formed generally increases with increasing surfactant concentration.

[0341] In some aspects, micelles of the present disclosure can be purified, e.g., to remove contaminants and / or to produce a homogenous population of micelles (e.g., micelles having the same size, or micelles having the same payload or the same targeting moiety).

[0342] VI. Pharmaceutical Compositions The present disclosure also provides pharmaceutical compositions comprising the cationic carrier units and / or micelles of the present disclosure (i.e., micelles comprising the cationic carrier units of the present disclosure) suitable for administration to a subject. As noted above, the micelles of the present disclosure can be uniform (i.e., all micelles comprise the same type of cationic carrier units, with the same targeting moiety and the same payload). However, in other aspects, the micelles can comprise multiple targeting moieties, multiple payloads, and the like.

[0343] Pharmaceutical compositions generally comprise the cationic carrier units and / or micelles of the present disclosure and a pharma- ceutically acceptable excipient or carrier in a form suitable for administration to a subject, which is determined in part by the particular composition being administered and the particular method used to administer the composition.

[0344] There are a wide variety of suitable formulations of pharmaceutical compositions comprising the micelles of the present disclosure (see, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 18th ed. (1990)). Pharmaceutical compositions are generally formulated under sterile conditions and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration. In some embodiments, the pharmaceutical composition comprises one or more micelles described herein.

[0345] In certain embodiments, the micelles described herein are co-administered with one or more additional therapeutic agents in a pharma- ceutically acceptable carrier. In some embodiments, the pharmaceutical composition comprising the micelles described herein is administered prior to administration of the additional therapeutic agent(s). In other embodiments, the pharmaceutical composition comprising the micelles described herein is administered after administration of the additional therapeutic agent(s). In further embodiments, the pharmaceutical composition comprising the micelles described herein is administered simultaneously with the additional therapeutic agent(s).

[0346] In some embodiments, the pharmaceutical carrier is added after micelle formation, while in other embodiments, the pharmaceutical carrier is added before micelle formation.

[0347] Acceptable carriers, excipients, or stabilizers are nontoxic to recipients (e.g., animals or humans) at the dosages and concentrations employed, and include buffers, such as phosphate, citric acid, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (e.g., octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl, or benzyl alcohol; alkyl parabens, such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; tannins, such as tetrahydrofuran, ... proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or non-ionic active agents such as TWEEN™, PLURONICS™, or polyethylene glycol (PEG).

[0348] Examples of carriers or diluents include, but are not limited to, water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. The use of such media and compounds for pharmacoactive substances is well known in the art. Insofar as any conventional media or compound is incompatible with the cationic carrier unit or micelle disclosed herein, its use in the composition is contemplated.

[0349] Supplementary therapeutic agents may also be incorporated into the compositions of the present disclosure. In general, pharmaceutical compositions are formulated to be compatible with their intended route of administration. The micelles described herein may be administered parenterally, topically, intravenously, orally, subcutaneously, intraarterially, intradermally, transdermally, rectally, intracranially, intraperitoneally, intranasally, intratumorally, intramuscularly, or as an inhalant. In certain aspects, the micelles of the pharmaceutical compositions described herein are administered intravenously, for example, by injection. The micelles described herein may optionally be administered in combination with other therapeutic agents that are at least partially effective in treating the disease, disorder, or condition for which the micelles described herein are intended.

[0350] The solution or suspension may contain the following components: a sterile diluent, such as water, saline, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; an antibacterial compound, such as benzyl alcohol or methylparaben; an antioxidant, such as ascorbic acid or sodium bisulfite; a chelating compound, such as ethylenediaminetetraacetic acid (EDTA); a buffer, such as acetate, citrate, or phosphate, and a compound for adjusting tonicity, such as sodium chloride or dextrose. The pH can be adjusted with an acid or base, such as hydrochloric acid or sodium hydroxide. The formulation can be enclosed in ampoules, disposable syringes, or multiple dose vials made of glass or plastic.

[0351] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (if water soluble) or dispersions and sterile powders. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). The composition is generally sterile and has sufficient fluidity to be easily used in a syringe. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial activity can be achieved by various antibacterial and antifungal compounds, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. If necessary, isotonic compounds, for example, sugars, polyalcohols, for example, mannitol, sorbitol, and sodium chloride, can be added to the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition a compound that delays absorption, such as aluminum monostearate or gelatin.

[0352] The pharmaceutical compositions of the present disclosure can be sterilized by conventional, well-known sterilization techniques. Aqueous solutions can be packaged for use or filtered under sterile conditions and lyophilized, the lyophilized preparation being combined with a sterile aqueous solution prior to administration.

[0353] Sterile injectables can be prepared by incorporating the micelles described herein in an effective amount and in a suitable solvent, together with one or a combination of the components listed herein, if desired.Generally, dispersions are prepared by incorporating the micelles described herein into a sterile vehicle that contains a basic dispersion medium and any other desired components.In the case of sterile powders for preparing sterile injectables, the preparation method is vacuum drying and freeze-drying, which obtains a powder of active ingredient and any additional desired ingredients from the solution that has previously been sterile-filtered.The micelles described herein can be administered in the form of depot injections or implant preparations, which can be formulated in such a way as to allow sustained or pulsed release of the micelles described herein.

[0354] Systemic administration of compositions comprising micelles as described herein may be by transmucosal means. For transmucosal administration, a penetrant appropriate to the barrier to be permeated is used in the formulation. Such penetrants are well known in the art and include, for example, in the case of transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be achieved, for example, by using nasal sprays.

[0355] In certain embodiments, pharmaceutical compositions comprising micelles as described herein are administered intravenously to a subject who will benefit from the pharmaceutical composition. In certain embodiments, the compositions are administered to the lymphatic system, for example, by intralymphatic or intranodal injection (see, for example, Senti et al., PNAS 105(46):17908 (2008)), or by intramuscular injection, subcutaneous administration, intratumoral injection, or by direct injection into the thymus or liver.

[0356] In certain embodiments, pharmaceutical compositions comprising the micelles described herein are administered as a suspension. In certain embodiments, the pharmaceutical compositions are administered as a formulation capable of forming a depot after administration. In certain preferred embodiments, the depot slowly releases the micelles described herein into the circulation or remains in a depot form.

[0357] Typically, a pharma- ceutically acceptable composition is highly purified to be free of contaminants, biocompatible, non-toxic, and suitable for administration to a subject. When water is a component of the carrier, the water is highly purified and treated to be free of contaminants (e.g., endotoxins).

[0358] The pharma- ceutically acceptable carrier may be, but is not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and / or mineral oil.The pharmaceutical composition may further comprise a lubricant, a wetting agent, a sweetener, a flavor enhancer, an emulsifier, a suspending agent, and / or a preservative.

[0359] The pharmaceutical compositions described herein comprise the micelles described herein and, optionally, a pharma- ceutical active or therapeutic agent. The therapeutic agent can be a biologic agent, a small molecule agent, or a nucleic acid agent.

[0360] Dosage forms are provided that include the micelles described herein. In some embodiments, the dosage forms are formulated as suspensions for intravenous injection.

[0361] The micelles or pharmaceutical compositions comprising the micelles disclosed herein can be used simultaneously with other drugs. Specifically, the micelles or pharmaceutical compositions of the present disclosure can be used together with drugs, such as hormonal therapeutic drugs, chemotherapeutic drugs, immunotherapeutic drugs, drugs that inhibit the action of cell growth factors or cell growth factor receptors, and the like.

[0362] VII. Methods of Treatment and Use The present disclosure also provides a method of treating a disease or condition in a subject in need thereof, the method comprising administering a micelle of the present disclosure or a combination thereof to the subject, e.g., a mammal, such as a human subject. In some aspects, the present disclosure also provides a method of treating a neurodegenerative disorder or cancer in a subject in need thereof, the method comprising administering a therapeutically effective amount of a micelle of the present disclosure or a pharmaceutical composition of the present disclosure to the subject.

[0363] In some aspects, the micelles of the present disclosure may be administered by intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.

[0364] In some aspects, the micelles of the present disclosure can be used in conjunction with other agents or treatments suitable for treating the diseases and conditions disclosed herein.

[0365] The present disclosure also provides a method of encapsulating a payload for delivery, the method comprising incorporating a payload, for example an anionic payload such as a nucleic acid (eg, an antimir), into a micelle of the present disclosure.

[0366] The present disclosure also provides a method for increasing resistance of a payload to degradation (e.g., nuclease-mediated degradation), the method comprising incorporating a payload, e.g., an anionic payload such as a nucleic acid (e.g., an antimir), into a micelle of the present disclosure.

[0367] In some embodiments, the present disclosure provides a method of crossing the blood-brain barrier (BBB), the method comprising administering a micelle disclosed herein, e.g., a micelle comprising tryptophan and / or tyrosine as a targeting moiety. The micelle of the present disclosure loaded with anti-miRNA can be targeted to a receptor of the BBB, e.g., LAT1, as disclosed above. Once the micelle is transported through the BBB by receptor-mediated transcytosis and undergoes intracellular uptake by brain cells (e.g., neurons, astrocytes, or microglia), the payload (e.g., antimir) is released and interacts with a target within the cell (e.g., antimir can bind to target microRNA and cause RNase H-mediated degradation).

[0368] In some embodiments, encapsulation of a payload in a micelle of the present disclosure may increase the resistance of the payload to degradation by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% as compared to the free payload (i.e., the payload not within a micelle, e.g., free in solution).

[0369] In some embodiments, encapsulation of a payload in a micelle of the present disclosure may increase the resistance of the payload to degradation by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold as compared to the free payload.

[0370] The present disclosure also provides a method for increasing the stability of a payload during administration (e.g., while in the bloodstream of a subject), the method comprising incorporating a payload, e.g., an anionic payload such as a nucleic acid (e.g., an antimir), into a micelle of the present disclosure.

[0371] In some embodiments, encapsulation of a payload in a micelle of the present disclosure may increase the stability of the payload (e.g., increase resistance to nucleases) by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to the free payload.

[0372] In some embodiments, encapsulation of a payload in a micelle of the present disclosure may increase the stability of the payload (e.g., increase resistance to nucleases) by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold as compared to the free payload.

[0373] The present disclosure also provides a method of increasing the plasma half-life of a payload, the method comprising incorporating a payload, for example an anionic payload such as a nucleic acid (eg, an antimir), into a micelle of the present disclosure.

[0374] In some embodiments, encapsulation of a payload in a micelle of the present disclosure increases the plasma half-life of the payload by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% relative to the free payload. The increase may be at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, at least about 1000%, at least about 1100%, at least about 1200%, at least about 1300%, at least about 1400%, at least about 1500%, at least about 1600%, at least about 1700%, at least about 1800%, at least about 1900%, or at least about 2000%.

[0375] In some embodiments, encapsulation of a payload into a micelle of the present disclosure may increase the plasma half-life of the payload by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold as compared to the free payload.

[0376] In some embodiments, the encapsulated payload is an antimir disclosed herein, such as an antisense oligonucleotide of SEQ ID NO: 18 or a variant or derivative thereof (e.g., an oligonucleotide having at least about 70% identity to the antisense oligonucleotide of SEQ ID NO: 18), where encapsulation of the antimir in a micelle of the present disclosure increases the plasma half-life of the antimir by at least about 10-fold, at least about 12-fold, at least about 14-fold, at least about 16-fold, at least about 18-fold, or at least about 20-fold compared to the plasma half-life of the free antimir. In a particular embodiment, the encapsulated payload is an antimir disclosed herein, such as an antisense oligonucleotide of SEQ ID NO: 18 or a variant or derivative thereof (e.g., an oligonucleotide having at least about 70% identity to the antisense oligonucleotide of SEQ ID NO: 18), where encapsulation of the antimir in a micelle of the present disclosure increases the plasma half-life of the antimir by at least about 20-fold compared to the plasma half-life of the free antimir. In some embodiments, the plasma half-life of an antimir encapsulated in a micelle of the present disclosure is at least about 30 minutes, at least about 40 minutes, at least about 50 minutes, at least about 60 minutes, at least about 70 minutes, at least about 80 minutes, at least about 90 minutes, at least about 100 minutes, or at least about 120 minutes. In one particular embodiment, the plasma half-life of an antimir encapsulated in a micelle of the present disclosure (e.g., an antisense oligonucleotide of SEQ ID NO: 18) is at least about 90 minutes.

[0377] The present disclosure also provides a method for increasing the penetration, delivery, translocation, or transport of a payload through a physiological barrier, e.g., the BBB or a plasma membrane, comprising incorporating a payload, e.g., an anionic payload such as a nucleic acid (e.g., an antimir), into a micelle of the present disclosure.

[0378] In some embodiments, encapsulation of a payload in a micelle of the present disclosure may increase the penetration, delivery, translocation, or transport of the payload across a physiological barrier, e.g., the BBB or plasma membrane, by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to the free payload.

[0379] In some embodiments, encapsulation of a payload in a micelle of the present disclosure may increase the penetration, delivery, translocation, or transport of the payload across a physiological barrier, e.g., the BBB or plasma membrane, by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold as compared to the free payload.

[0380] In some embodiments, the micelles of the present disclosure can be used to target stem cells, for example, to deliver therapeutic molecules (e.g., therapeutic polynucleotides) or gene therapy components. In other embodiments, the micelles of the present disclosure can be used to treat cancer. For example, the micelles of the present disclosure can target markers specific to certain types of cancer, such as glioma, breast cancer, pancreatic cancer, liver cancer, skin cancer, or cervical cancer, and can carry therapeutic molecules (e.g., therapeutic polynucleotides, peptides, or small molecules) as payloads.

[0381] In certain embodiments, the micelles of the present disclosure can be used to treat pancreatic cancer. In some embodiments, the targeting moiety that guides the micelles of the present disclosure to pancreatic tissue is a cyclic RGD peptide. In other embodiments, the targeting moiety that guides the micelles of the present disclosure to pancreatic tissue is a biomarker that is expressed primarily or exclusively on the surface of normal or cancerous pancreatic cells. In some embodiments, the payload of the micelles of the present disclosure is an oligonucleotide that targets K-Ras, where the delivery of the payload to pancreatic tissue effectively reduces the expression of K-Ras.

[0382] In some embodiments, the micelles of the present disclosure can be used to treat or ameliorate symptoms of neurodegenerative diseases, such as Alzheimer's disease. In some embodiments, the micelles of the present disclosure contain a payload (e.g., an antimir) that targets a molecule that is overexpressed in Alzheimer's disease neuronal tissue, such as miRNA-485-3p. In some embodiments, administration of the micelles of the present disclosure (e.g., a micelle that contains a LAT1 targeting moiety to effectively transport the micelle and the antimir payload that targets miRNA-485-3p through the BBB) to an Alzheimer's disease patient can thus prevent or ameliorate symptoms of Alzheimer's disease, such as apoptosis, loss of mitochondrial function, or inflammation.

[0383] In some embodiments, the present disclosure provides a method of reducing inflammation (e.g., neuroinflammation) in a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease), the method comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, the micelle comprising a therapeutic agent capable of effectively reducing inflammation (e.g., neuroinflammation) in the subject. In some embodiments, the neuroinflammation is cortical inflammation. In some embodiments, the neuroinflammation is hippocampal inflammation. In some embodiments, the therapeutic agent is an antimir targeting miRNA-485-3p (e.g., an antimir of SEQ ID NO: 18 or a fragment or variant thereof), wherein the antimir is capable of reducing the level of miRNA-485-3p in the subject.

[0384] In some embodiments, administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease) may reduce the level of neuroinflammation by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%, compared to the level of neuroinflammation observed in a subject or population of subjects not treated with a micelle of the present disclosure.

[0385] In some embodiments, the present disclosure provides a method of reducing amyloid plaque burden in a subject suffering from Alzheimer's disease, the method comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, the micelle comprising a therapeutic agent capable of effectively reducing amyloid plaque burden in the subject. In some embodiments, the therapeutic agent is an antimir targeting miRNA-485-3p (e.g., an antimir of SEQ ID NO: 18 or a fragment or variant thereof), wherein the antimir is capable of reducing the level of miRNA-485-3p in the subject.

[0386] In some embodiments, administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease) may reduce amyloid plaque burden in the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the amyloid plaque burden observed in a subject or population of subjects not treated with a micelle of the present disclosure.

[0387] In some embodiments, the present disclosure provides a method of restoring and / or inducing neurogenesis in a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease), the method comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, the micelle comprising a therapeutic agent capable of effectively restoring and / or inducing neurogenesis in the subject. In some embodiments, the therapeutic agent is an antimir targeting miRNA-485-3p (e.g., an antimir of SEQ ID NO: 18 or a fragment or variant thereof), wherein the antimir is capable of reducing the level of miRNA-485-3p in the subject.

[0388] In some embodiments, administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease) may restore and / or induce neurogenesis in the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the level of neurogenesis observed in a subject or population of subjects not treated with a micelle of the present disclosure.

[0389] In some embodiments, the present disclosure provides a method for improving cognitive function in a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease), the method comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, the micelle comprising a therapeutic agent capable of effectively improving the cognitive function of the subject. In some embodiments, the therapeutic agent is an antimir targeting miRNA-485-3p (e.g., an antimir of SEQ ID NO: 18 or a fragment or variant thereof), wherein the antimir can reduce the level of miRNA-485-3p in the subject.

[0390] In some embodiments, administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease) may increase cognitive function in the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%, as compared to cognitive function observed in a subject or population of subjects not treated with a micelle of the present disclosure.

[0391] VIII. Kit The present disclosure also provides a kit or article of manufacture comprising the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure, and optionally instructions for use. In some embodiments, the kit or article of manufacture comprises the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure in one or more containers. In some embodiments, the kit or article of manufacture comprises the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure, and a pamphlet. In some embodiments, the kit or article of manufacture comprises the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure, and instructions for use. Those skilled in the art will readily understand that the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure, or a combination thereof, can be easily incorporated into one of the established kit formats well known in the art.

[0392] In some aspects, the kit or article of manufacture includes the cationic carrier units of the present disclosure in a dry form in a container (e.g., a glass vial), and optionally a vial with a suitable solvent for hydrating the dried cationic carrier units, and optionally instructions for hydrating the cationic carrier units and forming micelles. In some aspects, the kit or article of manufacture further includes at least one additional container (e.g., a glass vial) with an anionic payload of the micelles (e.g., an antisense oligonucleotide). In some aspects, the kit or article of manufacture includes the cationic carrier units of the present disclosure in a dry form and the anionic payload of the micelles, also in a dry form, in the same container or in different containers. In some aspects, the kit or article of manufacture includes the cationic carrier units of the present disclosure in a solution and the anionic payload of the micelles, also in a solution, in the same container or in different containers. In some aspects, the kit or article of manufacture includes the micelles of the present disclosure in a solution and instructions for use. In some aspects, the kit or article of manufacture comprises a micelle of the present disclosure in dry form and instructions for use (e.g., instructions for reconstitution and administration).

[0393] *** The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of one in the art. Such techniques are fully explained in the literature, see, e.g., Sambrook et al., ed. (1989) Molecular Cloning A Laboratory Manual (2nd ed.; Cold Spring Harbor Laboratory Press); Sambrook et al., ed. (1992) Molecular Cloning: A Laboratory Manual, (Cold Springs Harbor Laboratory, NY); DN Glover ed., (1985) DNA Cloning, Volumes I and II; Gait, ed. (1984) Oligonucleotide Synthesis; Mullis et al. U.S. Pat. No. 4,683,195; Hames and Higgins, eds. (1984) Nucleic Acid Hybridization; Hames and Higgins, eds. (1984) Transcription And Translation; Freshney (1987) Culture Of Animal Cells (Alan R. Liss, Inc.); Immobilized Cells And Enzymes (IRL Press)(1986);Perbal(1984)A Practical Guide To Molecular Cloning;the treatise,Methods In Enzymology(Academic Press,Inc.,NY);Miller and Calos eds.(1987)Gene Transfer Vectors For Mammalian Cells,(Cold Spring Harbor Laboratory);Wu et al.,eds.,Methods In Enzymology,Vols.154 and 155;Mayer and Walker, eds.(1987) Immunochemical Methods In Cell And Molecular Biology (Academic Press, London); Weir and Blackwell, eds., (1986) Handbook Of Experimental Immunology, Volumes I-IV; Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, (1986);); Crooke, Antisense drug Technology: Principles, Strategies and Applications, 2nd Ed. CRC Press (2007) and in Ausubel et al. (1989) Current Protocols in Molecular Biology (John Wiley and Sons, Baltimore, Md.). .

[0394] All of the references cited above, and all references cited herein, are hereby incorporated by reference in their entirety.

[0395] The following examples are offered by way of illustration and not by way of limitation. EXAMPLES

[0396] Example 1 Synthesis of cationic carriers (a) Synthesis of alkyne-modified tyrosine: A mixture of N-(tert-butoxycarbonyl)-L-tyrosine methyl ester (Boc-Tyr-OMe) (0.5 g, 1.69 mmol) and K2CO3 (1.5 equiv, 2.54 mmol) in acetonitrile (4.0 ml) was added dropwise to propargyl bromide (1.2 equiv, 2.03 mmol). The reaction mixture was heated at 60° C. for 16 h. After the reaction, the reaction mixture was extracted using water and ethyl acetate (EA). The organic layer was then washed with brine solution.

[0397] The crude was purified by flash column (10% EA in hexane). The resulting product was then dissolved in tetrahydrofuran (7.0 ml) and 6.0 M HCl (7.0 ml) and heated at 65° C. for 16 h. Dioxane was removed and extracted with EA. Aqueous NaOH (1.0 M) solution was then added to the mixture until the pH was 7. The reaction mass was concentrated in an evaporator and centrifuged at 12,000 rpm at 0° C. The precipitate was washed with deionized water and lyophilized prior to use.

[0398] (b) Synthesis of (methoxy or) azido-poly(ethylene glycol)-b-poly(L-lysine) (PEG-PLL) (Compound A): Poly(ethylene glycol)-b-poly(L-lysine) was synthesized by ring-opening polymerization of Lys(TFA)-NCA with azido-PEG (N3-PEG) as a macroinitiator. Briefly, N3-PEG (600 mg, 0.12 mmol) and Lys(TFA)-NCA (1447 mg, 5.4 mmol) were dissolved in DMF containing 1 M thiourea and DMF, respectively. The Lys(TFA)-NCA solution was added dropwise to the N3-PEG solution by a microsyringe needle, and the reaction mixture was stirred at 37 °C for 3 days. The reaction bottle was purged with Ar and vacuum. All reactions were carried out under Ar atmosphere.

[0399] After the reaction, the mixture was precipitated in excess diethyl ether. The mixture was filtered and the product was obtained as a white powder after drying under reduced pressure. To deprotect the TFA group of PEG-PLL(TFA), N3-PEG-PLL (500 mg) was dissolved in methanol (60 mL) and 1N NaOH (6 mL) and added dropwise to the polymer solution under stirring. The mixture was kept at 37°C with stirring for 1 day. The reaction mixture was dialyzed against 10 mM HEPES and distilled water four times. A white powder of N3-PEG-PLL(NH2) was obtained after lyophilization. PEG 5K -PLL(NH3 + / Cl - ) 46 , PEG 5K -PLL(NH3 + / Cl - ) 58, and PEG 5K -PLL(NH3 + / Cl - ) 80 PEG was also polymerized by this synthesis method by controlling the amount of reagent supplied. 5K -PLL(NH3 + / Cl - ) 58 A schematic diagram of is shown in FIG. 2A (Compound A).

[0400] (c) Synthesis of (methoxy or) azido-poly(ethylene glycol)-b-poly(L-lysine / nicotinamide) (PEG5K-PLL46(Nic15)) (compound B): To enhance the stability of micelles, nicotinamide and thiol end groups were introduced into the polymer backbone as adjuvant moieties. First, (methoxy or) azido-poly(ethylene glycol)-b-poly(L-lysine / nicotinamide) ((MeO- or) N3PEG 5K -PLL 46 (Nic 15 )) in the presence of EDC / NHS, PEG 5K -PLL 46 It was synthesized by chemical modification of -NH2 and nicotinic acid.

[0401] PEG 5K -PLL 46 -NH2, 151.6 mg) and nicotinic acid (107.8 mg, 1.4 equivalents relative to NH2 of PEG-PLL) were dissolved separately in a mixture of deionized water and methanol (1:1). EDC (251.8 mg, 2.0 equivalents relative to NH2 of PEG-PLL) was added to the nicotinic acid solution, and NHS (151.2 mg, 2.0 equivalents relative to NH2 of PEG-PLL) was added stepwise to the mixture.

[0402] After post-incubation at room temperature for 30 min, the reaction mixture was added to the N3-PEG-PLL(NH2) solution. The reaction mixture was kept at 37°C for 16 h under stirring. The crude product was dialyzed against deionized water for 24 h. The solution was filtered through a syringe filter (0.45 μm) and lyophilized for 2 days. PEG 5K -PLL 46 (Nic15 ) is shown in Figure 2B.

[0403] (d) (Methoxy or) Azidopoly(ethylene glycol)-b-poly(L-lysine / nicotinamide) (PEG 5K -PLL 58 (Nic 30 Synthesis of (MeO- or)N3-PEG (Compound C): To enhance the stability of micelles, nicotinamide and thiol end groups were introduced into the polymer backbone as adjuvant moieties. First, (methoxy or) azido-poly(ethylene glycol)-b-poly(L-lysine / nicotinamide) (MeO- or)N3-PEG) was synthesized. 5K -PLL 56 (Nic 30 )) in the presence of EDC / NHS, PEG 5K -PLL 56 It was synthesized by chemical modification of -NH2 and nicotinic acid.

[0404] PEG 5K -PLL 56 -NH2, 300 mg) and nicotinic acid (234.3 mg, 2.0 equivalents relative to NH2 of PEG-PLL) were dissolved separately in a mixture of deionized water and methanol (1:1). EDC (729.7 mg, 3.0 equivalents relative to NH2 of PEG-PLL) was added to the nicotinic acid solution, and NHS (438.1 mg, 3.0 equivalents relative to NH2 of PEG-PLL) was added stepwise to the mixture.

[0405] After post-incubation at room temperature for 30 min, the reaction mixture was added to the N3-PEG-PLL(NH2) solution. The reaction mixture was kept at 37°C for 16 h under stirring. The crude product was dialyzed against deionized water for 24 h. The solution was filtered through a syringe filter (0.45 μm) and lyophilized for 2 days. PEG 5K -PLL 58 (Nic 30 ) is shown in Figure 2C.

[0406] (e) (Methoxy or) Azidopoly(ethylene glycol)-b-poly(L-lysine / nicotinamide / mercaptopropanamide (PEG5K -PLL 58 (Nic 23 Synthesis of (MeO- or)N3-PEG-SH8) (Compound D): To enhance the stability of micelles, nicotinamide and thiol end groups were introduced into the polymer backbone as adjuvant moieties. First, (methoxy or) azido-poly(ethylene glycol)-b-poly(L-lysine / nicotinamide / mercaptopropanamide) (MeO- or)N3-PEG-SH8) (Compound D) was synthesized. 5K -PLL 58 (Nic 23 / SH8)) in the presence of EDC / NHS, PEG 5K -PLL 56 It was synthesized by chemical modification of -NH2 and nicotinic acid.

[0407] PEG 5K -PLL 56 -NH2, 150 mg) and nicotinic acid (57.5 mg, 0.8 equivalents relative to NH2 of PEG-PLL) were dissolved separately in a mixture of deionized water and methanol (1:1). EDC (134.0 mg, 1.2 equivalents relative to NH2 of PEG-PLL) was added to the nicotinic acid solution, and NHS (80.4 mg, 1.2 equivalents relative to NH2 of PEG-PLL) was added stepwise to the mixture.

[0408] After post-incubation at room temperature for 30 min, the reaction mixture was added to the N3-PEG-PLL(NH2) solution. The reaction mixture was maintained at 37 °C for 16 h with stirring. Next, 3,3'-dithiodipropionic acid (25.4 mg, 0.2 equivalents relative to NH2 of PEG-PLL), EDC (34.7 mg, 0.3 equivalents relative to NH2 of PEG-PLL), and NHS (20.8 mg, 0.3 equivalents relative to NH2 of PEG-PLL) were dissolved in MeOH and added directly to the reaction mixture. After stirring the mixture at 37 °C for 4 h, the reaction was dialyzed against MeOH for 2 h (MWCO = 7,000-8,000) and 1,4-dithiotritol (DTT, 13.0 mg, 0.14 equivalents relative to NH2 of PEG-PLL) was added directly to the membrane to cleave the disulfide bonds in the polymer side chains. The membrane was incubated for 30 min, dialyzed against 50% MeOH for 2 h and against deionized water for 24 h. The solution was filtered through a syringe filter (0.45 μm) and lyophilized for 2 days. PEG 5K -PLL 58 (Nic 23 A schematic diagram of the .SEQ ID NO:1 / SH8) is shown in Figure 2D.

[0409] (f) (methoxy or) azidopoly(ethylene glycol)-b-poly(L-lysine / nicotinamide / mercaptopropanamide) (PEG 5K -PLL 80 (Nic 14 Synthesis of (MeO- or)N3-PEG-2-(N-PEG / SH6) (Compound E): To enhance the stability of micelles, nicotinamide and thiol end groups were introduced into the polymer backbone as adjuvant moieties. First, (methoxy or) azido-poly(ethylene glycol)-b-poly(L-lysine / nicotinamide / mercaptopropanamide) (MeO- or)N3-PEG-2-(N-PEG / SH6) (Compound E) 5K -PLL 80 (Nic 14 / SH6)) was synthesized from nicotinic acid and 3,3'-dithiodipropionic acid in the presence of EDC / NHS. 5K -PLL 80 It was synthesized by chemical modification of -NH2.

[0410] PEG 5K -PLL80 -NH2 (200.0 mg), nicotinic acid (Nic, 22.1 mg, 17 equiv.), 3,3'-dithiodipropionic acid (DTDPA, 10.2 mg, 4.5 equiv.), N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide hydrochloride (EDC, 52.5 mg, 25 equiv.), N-hydroxysuccinimide (NHS, 31.5 mg, 25 equiv.), and triethylamine (TEA, 30.0 μL, 20 equiv.) were dissolved separately in 20 mL of dimethyl sulfoxide.

[0411] The reaction mixture was kept at 37 °C for 16 h with stirring. After the reaction was completed, the crude product was dialyzed against deionized water for 2 h (MWCO = 7,000-8,000), and 1,4-dithiothritol (DTT, 22.5 mg, 13 equiv.) was added directly to the membrane to cleave the disulfide bonds in the polymer side chains. The membrane was incubated for 30 min, dialyzed against deionized water for 2 h, and dialyzed against deionized water for 24 h. The solution was filtered through a syringe filter (0.45 μm) and lyophilized for 2 days. PEG 5K -PEG 5K -PLL 80 (Nic 14 A schematic diagram of / SH6) is shown in Figure 2E.

[0412] (g) (methoxy or) azidopoly(ethylene glycol)-b-poly(L-lysine / nicotinamide / mercaptopropanamide) (PEG 5K -PLL 80 (Nic 23 Synthesis of (MeO- or)N3-PEG-SH6) (Compound F): To enhance the stability of micelles, nicotinamide and thiol end groups were introduced into the polymer backbone as adjuvant moieties. First, (methoxy or) azido-poly(ethylene glycol)-b-poly(L-lysine / nicotinamide / mercaptopropanamide) (MeO- or)N3-PEG-SH6) (Compound F) was synthesized. 5K -PLL 80 (Nic 23 / SH6)) was synthesized from nicotinic acid (NA) and 3,3'-dithiodipropionic acid (DTDPA) in the presence of EDC / NHS. 5K -PLL 80It was synthesized by chemical modification of -NH2.

[0413] PEG 5K -PLL 80 -NH2 (200 mg), NA (36.8 mg, 27.5 equiv), DTDPA (8.7 mg, 4 equiv), EDC (78.3 mg, 37.5 equiv), NHS (47.0 mg, 37.5 equiv), and triethylamine (TEA, 50.1 μL, 33 equiv) were dissolved separately in 20 mL of dimethyl sulfoxide. The reaction mixture was kept at 37 °C for 16 h with stirring. After the reaction was completed, the crude product was dialyzed against deionized water for 2 h (MWCO = 7,000-8,000). 1,4-dithiothritol (DTT, 19.0 mg, 11 equiv) was added directly to the membrane to cleave the disulfide bonds in the polymer side chains. The membrane was incubated for 30 min, dialyzed against deionized water for 2 h, and dialyzed against deionized water for 24 h. The solution was filtered through a syringe filter (0.45 μm) and lyophilized for 2 days. 5K -PLL 80 (Nic 23 A schematic diagram of the .SEQ ID NO:6 is shown in Figure 2F.

[0414] (h) (Methoxy or) Azidopoly(ethylene glycol)-b-poly(L-lysine / nicotinamide / mercaptopropanamide) (PEG 5K -PLL 80 (Nic 28 Synthesis of (MeO- or) N3-PEG-2-(N-PEG / SH8) (Compound G): To enhance the stability of micelles, nicotinamide and thiol end groups were introduced into the polymer backbone as adjuvant moietie...

Claims

1. The following diagram: [CC]-L1-[CM]-L2-[HM] (Scheme I), [CC]-L1-[HM]-L2-[CM] (Scheme II), [HM]-L1-[CM]-L2-[CC] (Scheme III), [HM]-L1-[CC]-L2-[CM] (Scheme IV), [CM]-L1-[CC]-L2-[HM] (Scheme V), or [CM]-L1-[HM]-L2-[CC] (Scheme VI), (In the formula, CC is a cationic carrier moiety; CM is a bridging moiety; HM is a hydrophobic moiety; L1 and L2 are independently an optional linker; The cationic carrier unit, wherein the number of HM is less than about 50% relative to [CC] and [CM].

2. The cationic carrier unit of claim 1, wherein the cationic carrier unit interacts with an anionic payload, and the anionic payload comprises a nucleotide sequence having a length of less than 200 nucleotides.

3. The cationic carrier unit of claim 1 further comprising a water soluble polymer (WP).

4. [WP]-L3-[CC]-L1-[CM]-L2-[HM] (scheme I'), [WP]-L3-[CC]-L1-[HM]-L2-[CM] (Scheme II'), [WP]-L3-[HM]-L1-[CM]-L2-[CC] (Scheme III'), [WP]-L3-[HM]-L1-[CC]-L2-[CM] (scheme IV'), [WP]-L3-[CM]-L1-[CC]-L2-[HM] (Scheme V'), or 4. The cationic carrier unit of claim 3, comprising: [WP]-L3-[CM]-L1-[HM]-L2-[CC] (Scheme VI').

5. 4. The cationic carrier unit of claim 3, wherein the water soluble polymer comprises polyethylene glycol ("PEG"), polyglycerol, or poly(propylene glycol) ("PPG").

6. The cationic carrier unit of claim 1 , wherein the cationic carrier moiety comprises one or more basic amino acids.

7. The cationic carrier unit of claim 1 , wherein the cross-linking moiety comprises one or more amino acids linked to a cross-linking agent.

8. The cationic carrier unit of claim 1, wherein the hydrophobic moiety is one or more amino acids bound to a vitamin, the vitamin comprising vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, or any combination thereof.

9. 2. The cationic carrier unit of claim 1, wherein said cationic carrier moiety comprises from about 20 to about 40 lysines, said bridging moiety comprises from about 5 to about 20 lysine-thiols, and said hydrophobic moiety comprises from about 20 to about 40 lysine-vitamin B3.

10. 10. The cationic carrier unit of claim 1, further comprising a targeting moiety (TM).

11. A micelle comprising the cationic carrier unit of claim 1 and an anionic payload, wherein the cationic carrier moiety of the cationic carrier unit and the anionic payload are bound to each other.

12. 12. The micelle of claim 11, wherein the anionic payload comprises a nucleic acid, the nucleic acid comprising at least one nucleoside analog comprising locked nucleic acid (LNA); 2'-O-alkyl RNA; 2'-amino DNA; 2'-fluoro DNA; arabino nucleic acid (ANA); 2'-fluoro ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleoside (cEt), 2'-O-methyl nucleic acid (2'-OMe), 2'-O-methoxyethyl nucleic acid (2'-MOE), or any combination thereof.

13. The micelle of claim 12, wherein the nucleic acid comprises a nucleotide sequence set forth in SEQ ID NO: 18 (miR-485 3p inhibitor).

14. A pharmaceutical composition comprising a cationic carrier unit according to any one of claims 1 to 10 or a micelle according to any one of claims 11 to 13, and a pharma- ceutically acceptable carrier.

15. A pharmaceutical composition comprising a micelle according to any one of claims 11 to 13 for use in treating a neurodegenerative disease or condition in a subject in need of such treatment.

Images