Method for selecting cryopreserved cord blood units for the production of engineered natural killer cells with enhanced efficacy against cancer - Patents.com

Abstract

Methods and compositions are provided relating to optimizing the selection of umbilical cord blood units for producing immune cells, such as NK cells, for adoptive cell therapy. [0003] Embodiments of the present disclosure relate to methods and compositions related to optimizing the selection of cord blood units for producing immune cells, such as NK cells, for adoptive cell therapy. In specific embodiments, certain characteristics of the cord blood unit and / or the cells derived therefrom are analyzed. If one or more characteristic thresholds are met for the characteristics of the cord blood unit and / or the cells derived therefrom, the cord blood unit is utilized as a source for producing immune cells. The specific characteristics measured include viability of the cord blood cells prior to cryopreservation, total nuclear cell recovery, nucleated red blood cell content, and, optionally, cytotoxicity and / or proliferation of the immune cells following cryopreservation.

Description

[Technical field]

[0001] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 164,379, filed March 22, 2021, and U.S. Provisional Patent Application Serial No. 63 / 243,669, filed September 13, 2021, both of which are incorporated by reference in their entireties.

[0002] Embodiments of the present disclosure relate to at least the technical fields of cell biology, molecular biology, immunology, and medicine. [Background technology]

[0003] Cord blood-derived natural killer (NK) cells modified to express CARs are an effective treatment for cancer. Indeed, cord blood-derived NK cells can be modified (either by genetic or non-genetic methods) to treat multiple malignancies and infectious diseases. Cryopreserved cord blood is readily available in biobanks (to be used as a cell source for stem cell transplantation) and can provide sufficient numbers of NK cells to manufacture multiple cell therapy products for clinical use. An alternative to using cord blood units as a source of NK cells is to obtain cells from healthy donors by a process called leukapheresis. This process is complex and involves donor risk. The clinical efficacy of NK cell preparations is highly influenced by the characteristics of the cryopreserved cord units. The present disclosure fulfills a long-standing need in the art to procure cells suitable for cell therapy. Summary of the Invention

[0004] The present disclosure is directed to methods and compositions relating to cell therapy for an individual. The cell therapy may be of any type, but in certain embodiments, the cell therapy includes adoptive cell therapy using immune cells, including at least immune cells that may ultimately be modified prior to administration to an individual in need of the cells. In certain embodiments, the present disclosure relates to the identification of cord blood units that are particularly suitable for producing immune cells effective for adoptive cell therapy for an individual, including being more effective than selection of cord blood in the absence of such identification.

[0005] The present disclosure relates to a multi-part strategy for identifying cord blood units most likely to produce highly effective immune cell therapy products for the treatment of patients, including at least the treatment of any type of disease state, such as cancer, any type of infectious disease, etc. The present disclosure provides a set of selection criteria that includes (i) characterization of the cord blood units prior to cryopreservation, (ii) after thawing and at the start of immune cell manufacturing, such as in a GMP facility, and (iii) characterization of the immune cells during and at the end of manufacturing.

[0006] Certain embodiments include methods of selecting a cord blood composition comprising, prior to cryopreservation or use of the cord blood composition, measuring: (a) cord blood cell viability; (b) optionally, total mononuclear cell (TNC) recovery; (c) nucleated red blood cell (NRBC) content; (d) weight of the infant from whom the cord blood is derived; (e) race of the biological mother and / or biological father of the infant from whom the cord blood is derived; (f) optionally, gestational age of the infant from whom the cord blood is derived; (g) optionally, in utero collection of the cord blood (although ex utero collection or a combination of in utero and ex utero collection may be used in any of the methods disclosed herein). (h) optionally, the biologically male infant from whom the cord blood is derived; (i) optionally, the pretreatment volume (volume of collected cord blood plus anticoagulant (e.g., 35 ml citrate phosphate dextrose (CPD))≦120 mL; (j) optionally, the extracted cord blood cells are >0.4% CD34+; and optionally, after cryopreservation, (k) cytotoxicity of immune cells from the cord blood composition after thawing; and (l) measuring the fold expansion of immune cells (including NK cells) from the cord blood in culture after thawing. In a specific embodiment, the criteria meets a quantitative threshold for at least one of the characteristics.

[0007] In specific embodiments, one or more of the following criteria are met: (a) umbilical cord blood cell viability is 98% or 99% or greater; (b) any total mononuclear cell (TNC) recovery is 76.3% or greater; and (c) nucleated red blood cell (NRBC) content is 7.5×10 7 Or 8.0 x 10 7 or any amount therebetween.

[0008]

[0013] Embodiments of the present disclosure encompass methods of selecting a cord blood composition comprising the steps of: prior to cryopreservation of the cord blood composition, measuring: (a) cord blood cell viability; (b) optionally, total mononuclear cell (TNC) recovery; (c) nucleated red blood cell (NRBC) content; (d) weight of the infant from whom the cord blood is derived; (e) race of the biological mother and / or biological father of the infant from whom the cord blood is derived; (f) optionally, gestational age of the infant from whom the cord blood is derived; (g) optionally, in utero collection of the cord blood (although ex utero collection, or a combination of in utero and ex utero collection, may be used in any of the methods of the present disclosure); (h) optionally, the biological male infant from whom the cord blood is derived; (i) optionally, pretreatment volume (volume of cord blood collected plus anticoagulant (35 ml (j) optionally, the extracted cord blood has a CD34+ CPD)≦120 mL; (d) optionally, after cryopreservation, the extracted cord blood has a CD34+ CPD; and (e) optionally, after thawing, measuring the cytotoxicity of immune cells from the cord blood composition. In a specific embodiment, the immune cells are natural killer (NK) cells. The method may further include expanding the NK cells and / or modifying the NK cells. In some cases, the NK cells are modified to express one or more non-endogenous gene products, such as one or more non-endogenous receptors (such as one or more chimeric receptors comprising one or more chimeric antigen receptors and / or one or more non-natural T cell receptors). In some cases, the non-endogenous gene products consist of one or more non-endogenous receptors, one or more cytokines, one or more chemokines, one or more enzymes, or a combination thereof. The NK cells may be modified such that expression of one or more endogenous genes in the NK cells is disrupted.

[0009] In one embodiment, a method of selecting a cord blood composition is provided, the method comprising identifying a cord blood composition determined prior to cryopreservation to have one or more of the following: (a) a cord blood cell viability of 98% or 99% or greater; (b) optionally a total mononuclear cell (TNC) recovery of 76.3% or greater; (c) a nucleated red blood cell (NRBC) content of 7.5×10 7 or 8.0×10 7or any amount therebetween; (d) the weight of the infant from whom the cord blood was derived is 3650g or greater; (e) the race of the biological mother and / or father of the infant from whom the cord blood was derived is Caucasian; (f) optionally, the gestational age of the infant from whom the cord blood was derived is about 38 weeks or less; (g) optionally, the cord blood is collected in utero (although ex utero collection, or a combination of ex utero and in utero collection, may be used in any of the methods disclosed herein); (h) optionally, the cord blood is collected from a biologically male infant; (i) optionally, the pretreatment volume (volume of collected cord blood + anticoagulant (35ml CPD)) is ≦120mL; (j) optionally, the extracted cord blood cells are >0.4% CD34+; and optionally (k) measuring the cytotoxicity of immune cells from the thawed cord blood composition. In some cases, the pre-cryopreservation cord blood composition is determined to have at least (a) and (b); determined to have (b) and (c); determined to have (a) and (c); or determined to have (a), (b) and (c).

[0010] Specifically, the cord blood cell viability of (a) is 98.1, 98.2, 98.3, 98.4, 98.5, 98.6, 98.7, 98.8, 98.9, 99.0, 99.1, 99.2, 99.3, 99.4, 99.5, 99.6, 99.7, 99.8, or 99.9% or more. Specifically, the TNC recovery of (b) is 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more. Specifically, the NRBC content is 8.0×10 7 , 7.9×10 7 , 7.8×10 7 , 7.7×10 7 , 7.6×10 7 , 7.5×10 7 , 7.0×10 7 , 6.0×10 7 , 5.0×10 7 , 4.0×10 7 , 3.0×10 7 , 2.0×10 7 , 1.0×10 7 ,9.0×10 6,8.0×10 6 ,7.0×10 6 ,6.0×10 6 ,5.0×10 6 ,4.0×10 6 ,3.0×10 6 ,2.0×10 6 ,1.0×10 6 ,9.0×10 5 ,8.0×10 5 ,7.0×10 5 ,6.0×10 5 ,5.0×10 5 ,4.0×10 5 ,3.0×10 5 ,2.0×10 5 ,1.0×10 5 ,9.0×10 4 ,8.0×10 4 ,7.0×10 4 ,6.0×10 4 ,5.0×10 4 ,4.0×10 4 ,3.0×10 4 ,2.0×10 4 ,1.0×10 4 ,9.0×10 3 ,8.0×10 3 ,7.0×10 3 ,6.0×10 3 、5.0×10 3 、4.0×10 3 、3.0×10 3 、2.0×10 3 、1.0×10 3 、9.0×10 2 、8.0×10 2 、7.0×10 2 、6.0×10 2 、5.0×10 2 、4.0×10 2 、3.0×10 2 、2.0×10 2 、1.0×10 2etc. Specifically, the weight of the infant from which the cord blood is derived is 3650 g or more. In a specific embodiment, the race of the biological mother from which the cord blood is derived is Caucasian, and / or the biological father of the infant from which the cord blood is derived is Caucasian. In certain embodiments, the gestational age of the infant from which the cord blood is derived is about 38 weeks or less. In certain embodiments, the cord blood can be obtained by any suitable method, but in certain embodiments, it is obtained in utero, ex utero, or both, but in certain cases, it is obtained only in utero. In certain embodiments, the volume of cord blood extracted in addition to about 35 mL of anticoagulant is ≦120 mL, and the volume of cord blood extracted is about 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, or 30 mL or less.

[0011] Any of the methods encompassed herein may further comprise the step of deriving immune cells from the thawed cord blood composition. The immune cells may be NK cells, invariant NK cells, NK T cells, T cells B cells, monocytes, granulocytes, myeloid neutrophils, eosinophils, basophils, mast cells, monocytes, macrophages, dendritic cells, stem cells, or mixtures thereof. Specifically, the immune cells from the thawed cord blood composition are NK cells, and the cytotoxicity is 66.7% or more. The cytotoxicity may be 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more.

[0012] In some embodiments, the cord blood is from a fetus or infant that is 39 weeks or less than 38 weeks of gestation. The cord blood may be from a fetus or infant that is 39 weeks, 38 weeks, 37 weeks, 36 weeks, 35 weeks, 34 weeks, 33 weeks, 32 weeks, 31 weeks, 30 weeks, 29 weeks, 28 weeks, 27 weeks, 26 weeks, 25 weeks, or 24 weeks or less of gestation. In some cases, the method further comprises determining the viability of cord blood cells after thawing. In a specific embodiment, the viability of cord blood cells after thawing is 86.5% or more, for example 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% or more.

[0013] If the immune cells from the thawed cord blood composition are NK cells, the NK cells can be expanded. Expansion parameters may or may not be determined on a case-by-case basis. Expansion can be quantified after a particular number of days in culture, such as between day 0 and day 15, or any range therebetween. The expansion of the cells can be at least or about 3-fold, 5-fold, 7-fold, 10-fold, 20-fold, 25-fold, 50-fold, 75-fold, 100-fold, 125-fold, 150-fold, 175-fold, 200-fold, 225-fold, 250-fold, 275-fold, 300-fold, 325-fold, 350-fold, 375-fold, 400-fold, 425-fold, 450-fold, 475-fold, 500-fold, or more. In some cases, the expansion of the NK cells between day 0 and day 6 of culture is 7-fold or more. In some cases, the expansion of the NK cells between day 6 and day 15 of culture is 10-fold or more. In specific embodiments, the expansion is between 0-15 days or 6-15 days or 0-6 days (and any range therebetween) and has an expansion of greater than 70. Specifically, the expansion is between 0-15 days (and any range therebetween) and has an expansion of greater than 450.Ranges of days for expansion at any multiple level include: 0-15, 0-14, 0-13, 0-12, 0-11, 0-10, 0-9, 0-8, 0-7, 0-6, 0-5, 0-4, 0-3, 0-2, 0-1, 1-15, 1-14, 1-13, 1-12, 1-11, 1-10, 1-9, 1-8, 1-7, 1-6, 1-5, 1-4, 1-3, 1-2 ,2-15,2-14,2-13,2-12,2-11,2-10,2-9,2-8,2-7,2-6,2-5,2-4,2-3,3-15,3-14,3-13,3-12,3-11,3-10,3-9,3-8,3-7,3-6,3-5,3-4,4-15,4-14,4-13,4-12,4-11,4-10,4-9,4 -8,4-7,4-6,4-5,5-15,5-14,5-13,5-12,5-11,5-10,5-9,5-8,5-7,5-6,6-15,6-14,6-13,6-12,6-11,6-10,6-9,6-8,6-7,7-15,7-14,7-13,7-12,7-11,7-10,7-9,7-8,8-15,8- 14, 8-13, 8-12, 8-11, 8-10, 8-9, 9-15, 9-14, 9-13, 9-12, 9-11, 9-10, 10-15, 10-14, 10-13, 10-12, 10-11, 11-15, 11-14, 11-13, 11-12, 12-15, 12-14, 12-13, 13-15, 13-14, 14-15 etc.

[0014] The NK cells may be modified, such as modified to express one or more non-endogenous gene products, such as a non-endogenous receptor, including a chimeric receptor, such as a chimeric antigen receptor, or the non-endogenous receptor is a non-natural T cell receptor. In some cases, the non-endogenous gene products consist of one or more non-endogenous receptors, one or more cytokines, one or more chemokines, one or more enzymes, or a combination thereof. In certain embodiments, immune cells from a thawed cord blood composition are modified such that expression of one or more endogenous genes in the cells is disrupted.

[0015] In specific embodiments, cord blood cell viability is greater than 98% or 99%, TNC recovery is greater than 76.3%, and NRBC content is greater than 7.5×10 7or 8.0×107 or any range therebetween (7.5×10 7 -8.0×10 7 , 7.5×10 7 -7.9;7.5×10 7 -7.8×10 7 ;7.5×10 7 -7.7×10 7 ;7.5×10 7 -7.6×10 7 ;7.6×10 7 -8.0×10 7 ;7.6×10 7 -7.9×10 7 ;7.6×10 7 -7.8×10 7 ;7.6×10 7 -7.7×10 7 ;7.7×10 7 -8.0×10 7 ;7.7×10 7 -7.9×10 7 ;7.7×10 7 -7.8×10 7 ;7.8×10 7 -8.0×10 7 ;7.8×10 7 -7.9×10 7 ;7.9×10 7 -8.0×10 7 In a specific embodiment, the cord blood is from a fetus or infant of 39 or 38 weeks gestation or less, the viability of the cord blood cells after thawing is 86.5% (this is optional), the NK cell expansion is 3-fold or greater between days 0 and 6 of culture, the NK cell expansion is 100-fold or greater between days 6 and 15 of culture, and the NK cell expansion is 900-fold or greater between days 0 and 15 of culture. In a specific example, the NK cell expansion is 70-fold or greater between days 6 and 15 of culture. In a specific embodiment, the NK cell expansion is 450-fold or greater between days 0 and 15 of culture.

[0016] The present disclosure includes a cord blood composition identified by any one of the methods included herein. The composition can be included in a pharma- ceutically acceptable carrier. The composition can be prepared with one or more cryoprotectants.

[0017] Embodiments of the present disclosure include compositions comprising a population of immune cells from any of the methods encompassed herein.

[0018] In some embodiments, there is a method of predicting efficacy of immune cells for a treatment, comprising measuring one or more unfrozen cord blood compositions for: (a) cord blood cell viability; (b) optionally, total mononuclear cell (TNC) recovery; (c) nucleated red blood cell (NRBC) content; (d) weight of the infant from whom the cord blood is derived; (e) race of the biological mother and / or biological father of the infant from whom the cord blood is derived being Caucasian; (f) optionally, gestational age of the infant from whom the cord blood is derived; wherein the immune cells are therapeutically effective when the cord blood composition comprises one or more of the following characteristics: (a) cord blood cell viability of 98% or more or 99% or more; (b) total mononuclear cell (TNC) recovery of 76.3%; (c) nucleated red blood cell (NRBC) content of 8.0×10 7 (d) the weight of the cord blood derived infant is 3650g or more; (e) the race of the biological mother and / or biological father of the cord blood derived infant is Caucasian; and (f) optionally, the gestational age of the cord blood derived infant is about 38 weeks or less. The method may further include freezing one or more blood compositions. The method may further include, upon thawing, measuring the cytotoxicity of immune cells from the (d) cord blood composition. In some cases, the cytotoxicity is 66.7% or more.

[0019] The foregoing has outlined, rather broadly, the features and technical advantages of the present disclosure in order that the following detailed description may be better understood. Additional features and advantages will now be described which form the subject matter of the claims herein. It should be understood by those skilled in the art that the ideas and specific embodiments disclosed may be readily utilized as a basis for modifying or designing other structures for carrying out the same purposes of the present design. It should also be understood by those skilled in the art that such equivalent constructions do not depart from the spirit and scope as defined by the appended claims. The novel features believed characteristic of the design disclosed herein, both as to organization and method of operation, together with further objects and advantages, will be better understood from the following description when considered in conjunction with the accompanying figures. It is to be expressly understood, however, that each figure is provided for the purpose of illustration and description only, and is not intended as a definition of the limits of the present disclosure.

[0020] For a more complete understanding of this disclosure, reference is now made to the following descriptions taken in conjunction with the accompanying drawings, in which: [Brief description of the drawings]

[0021] [Figure 1] Characteristics of CBUs before freezing predict clinical response related to cell viability.

[0022] [Diagram 2] Pre-freeze CBU characteristics predict clinical response in terms of total mononuclear cell (TNC) recovery.

[0023] [Diagram 3] Pre-freeze CBU characteristics are predictive of clinical response indicating a decrease in nucleated red blood cell (NRBC) content.

[0024] [Figure 4] The three CBU characteristics were independent predictors of response in multivariate models when adjusted for patient clinical characteristics.

[0025] [Diagram 5] Number of advantageous attributes of CBUs in the 30-day response (cross-tabulation).

[0026] [Figure 6] Killing of RAJI tumor cells by non-transformed NK cells (from frozen CB) is an independent predictor of clinical response (measured by 51Cr release assay).

[0027] [Figure 7] Figures 7A-7B. Use of additional parameters to improve prediction of clinical responsiveness using cell viability >98%; TNC recovery >76.3%; and NRBC content (7A) compared with gestational age <39 weeks; cord blood post-thaw viability >86.5%; NK cell expansion ≥3-fold from culture days 0 to 6; NK cell expansion ≥100-fold from culture days 6 to 15; and / or NK cell expansion ≥900-fold from culture days 0 to 15.

[0028] [Figure 8] Figure 8A shows that the cell viability of cord blood units measured by flow cytometry can be used to predict the achievement of a complete response, with 99% identified as the optimal cutoff for predicting response. Figure 8B shows +30 overall response (PR / CR) and complete response (CR) according to the cell viability of cord blood units. Patients receiving CBU-derived cell preparations with a viability of 99% or more showed statistically significantly better clinical responses than patients receiving CBU-derived cell preparations with poor viability.

[0029] [Figure 9] Demonstration of nucleated red blood cell counts in cord blood units predictive of achievement of a clinical response is provided.

[0030] [Figure 10]Figure 10A provides race information associated with selected cord blood units and treatment response. Figure 10B shows response at day 30 according to pre-freezing CBU viability and CBU race. Patients who received CBU-derived cell products with pre-freezing viability > 99% and who were Caucasian race showed a statistically significant CR rate compared to patients who received CBU-derived cell products with pre-freezing viability > 99% but who were not Caucasian race.

[0031] [Figure 11] 1 shows cord blood infant weight in relation to treatment success.

[0032] [Figure 12] 12A-12C show that the choice of CBU based on four specific criteria is the primary factor determining patient response.

[0033] [Figure 13] FIG. 13 provides validation in an independent sample of 19 patients treated with different NK cell products.

[0034] [Figure 14] It is shown that adding additional features improves the predictive power of the model. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0035] I. Definition Examples As used herein, "a" or "an" can mean one or more. As used herein in a claim(s), when used with the word "Comprising", the word "a" or "an" can mean one or more. Some embodiments of the present disclosure can consist of or consist essentially of one or more elements, method steps, and / or methods of the present disclosure. It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein, and different embodiments can be combined.

[0036] The use of the term "or" in the claims is used to mean "and / or" unless expressly indicated to refer to alternatives only or the alternatives are not mutually exclusive, however, the present disclosure supports the definition to refer to alternatives and "and / or" only. For example, "X, Y, and / or Z" can refer to "X" alone, "Y" alone, "Z" alone, "X, Y, and Z", "(X and Y) or Z", "X or (Y and Z)", or "X or Y or Z". It is specifically contemplated that X, Y, or Z may be specifically excluded from the embodiment. As used herein, "another" may mean at least a second or more. The terms "about", "substantially" and "approximately" generally mean the stated value plus or minus 5%.

[0037] Throughout this specification, unless the context requires otherwise, the words "comprise", "contain", and "comprise" are understood to mean the inclusion of a recited step or element or group of steps or elements, but not the exclusion of other steps or elements or group of steps or elements. "Consisting of" means including and limited to what follows the phrase "consisting of". Thus, the phrase "consisting of" indicates that the recited elements are necessary or mandatory, and other elements may not be present. "Consisting essentially of" means including the elements recited after the phrase, and is limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the recited elements. Thus, the phrase "consisting essentially of" indicates that the recited elements are necessary or mandatory, but other elements are optional and may or may not be present depending on whether they affect the activity or action of the recited elements.

[0038] As used herein, the term "cord blood composition" or "cord blood unit" refers to a volume of cord blood originally obtained from the placenta and / or from the attached umbilical cord after birth. The cord blood unit or cord blood composition may or may not be stored in a storage facility after collection. In some cases, the cord blood unit or cord blood composition contains blood from a single individual, while in other cases, the cord blood unit or cord blood composition is a mixture from multiple individuals.

[0039] As used herein, the term "cryopreservation" refers to the process of cryopreservation of cells at a temperature below the freezing point. In a specific example, the temperature of cryopreservation is at least as low as -80°C. Cryopreservation may or may not include the addition of one or more cryoprotectants to the cells prior to freezing. Examples of cryoprotectants include dimethyl sulfoxide (DMSO), hetastarch, dextran 40, or combinations thereof. In one specific example, 6% hetastarch in 0.9% sodium chloride in 5 ml of 55% dimethyl sulfoxide / 5% dextran 40 in 0.9% sodium chloride can be utilized.

[0040] As used herein, the "disruption" of a gene refers to the elimination or reduction of expression in a cell of one or more gene products encoded by a gene of interest, compared to the expression level of the gene product in the absence of the disruption. Exemplary gene products include the mRNA and protein products encoded by the gene. In some cases, gene disruption is transient or reversible, while in other cases, it is permanent. The disruption in some cases is the disruption of a functional or full-length protein or mRNA, although a truncated or non-functional product may be produced. In some embodiments herein, gene activity or function is disrupted, as opposed to expression. Gene disruption is generally induced by artificial methods, i.e., by the addition or introduction of a compound, molecule, complex, or composition, and / or by disruption of the nucleic acid of the gene or the nucleic acid associated with the gene, such as at the DNA level. Exemplary methods for gene disruption include gene disruption techniques, such as gene silencing, knockdown, knockout, and / or gene editing. Examples include antisense technologies such as RNAi, siRNA, shRNA, and / or ribozymes, which generally result in a transient reduction in expression, as well as gene editing techniques that result in the inactivation or destruction of targeted genes, for example, by inducing truncation and / or homologous recombination. Examples include insertions, mutations, and deletions. Such gene disruptions typically result in the suppression and / or complete absence of expression of the normal or "wild type" product encoded by the gene. Examples of such gene disruptions include insertions of genes or parts of genes, including deletion of the entire gene, frameshift and missense mutations, deletions, knock-ins and knock-outs. Such disruptions can occur in coding regions, e.g., in one or more exons, resulting in the failure to produce a full-length product, a functional product, or any product, such as by the insertion of a stop codon. Such gene disruptions can also occur by disruption of promoters, enhancers, or other regions that affect transcriptional activation, to prevent transcription of the gene. Gene disruptions include gene targeting, including inactivation of the target gene by homologous recombination.

[0041] The terms "engineered" and "engineering" as used herein refer to entities that are produced by the hand of man (or a process that produces the same), including cells, nucleic acids, polypeptides, vectors, and the like. In at least some cases, engineered entities are synthetic and comprise elements that do not occur or are not constructed in nature in the embodiments utilized in this disclosure. With respect to cells, cells may be engineered because they have reduced expression of one or more endogenous genes and / or express one or more heterologous genes (such as synthetic antigen receptors and / or cytokines), but in this case, all of the engineering is done by the hand of man. With respect to antigen receptors, antigen receptors are considered engineered because they are comprised of multiple components that have been genetically recombined and constructed in a way that does not occur in nature, e.g., in the form of a fusion protein of the components that do not occur in nature so constructed.

[0042] The term "xenogeneic" as used herein refers to a cell type different from the recipient or derived from a different species. Specifically, it refers to a gene or protein that is synthetic and / or not derived from NK cells. This term also refers to a synthetically derived gene or gene construct. This term also refers to a synthetically derived gene or gene construct. For example, a cytokine may be considered xenogeneic with respect to NK cells even if the cytokine is naturally produced by NK cells because it is synthetically derived by genetic recombination, such as by being provided to the NK cells on a vector carrying a nucleic acid sequence that encodes the cytokine.

[0043] The term "immune cells" as used herein refers to cells that are part of the immune system and help the body fight infections and other diseases. Immune cells include natural killer cells, invariant NK cells, NK T cells, any type of T cell (e.g., regulatory T cells, CD4.sup.+ T cells, CD8.sup.+ T cells, or gamma delta T cells), B cells, monocytes, granulocytes, myeloid cells neutrophils, eosinophils, basophils, mast cells, monocytes, macrophages, dendritic cells, and / or stem cells (e.g., mesenchymal stem cells (MSCs) or induced pluripotent stem cells (iPSCs)). Also provided herein are methods for producing and engineering immune cells after selecting an appropriate cord blood unit, as well as methods for using and administering the cells for adoptive cell therapy, where the cells may be autologous or allogeneic with respect to the source of the cord blood and the recipient of the cells.

[0044] Throughout this specification, references to "one embodiment," "one embodiment," "particular embodiment," "related embodiment," "an embodiment," "additional embodiment," or "further embodiment," or combinations thereof, mean that the particular features, structures, or characteristics described in connection with the embodiment are included in at least one embodiment of the invention. Thus, the appearances of such phrases in various places throughout this specification do not necessarily all refer to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0045] "Treating" or treatment of a disease or condition refers to carrying out a protocol that may include administering one or more agents to a patient to alleviate the signs or symptoms of the disease. Desirable effects of treatment include reducing the rate of disease progression, improving or mitigating the disease state, remission, or improving prognosis. Alleviation may occur before or after the signs or symptoms of the disease or condition appear. Thus, "treatment" or "treatment" may include "prophylaxis" or "prevention" of a disease or undesirable condition. Furthermore, "treating" or "treatment" specifically includes protocols that do not require complete alleviation of signs or symptoms, do not require a cure, and have only a minor effect on the patient.

[0046] The term "therapeutic benefit" or "therapeutically effective" as used throughout this application refers to something that promotes or enhances the well-being of a subject with respect to the medical treatment of the condition. This includes, but is not limited to, reducing the frequency or severity of signs or symptoms of the disease. For example, treating cancer can include, for example, reducing tumor size, reducing tumor invasiveness, reducing the rate of cancer growth, or preventing metastasis. Treating cancer can also refer to extending the survival of a subject afflicted with cancer.

[0047] "Subject" and "patient" as well as "individual" are interchangeable and may refer to either a human or a non-human, such as a primate, mammal, vertebrate, etc. In certain embodiments, the subject is a human. The subject may be any organism or animal subject that is the subject of a method or material, including a mammal, such as a human, a laboratory animal (e.g., primate, rat, mouse, rabbit), livestock (e.g., cow, sheep, goat, pig, turkey, chicken), household pet (e.g., dog, cat, rodent), horse, and transgenic non-human animal. The subject may be, for example, a patient having or suspected of having a disease (which may be referred to as a medical condition), such as one or more infectious diseases, one or more genetic disorders, one or more cancers, or any combination thereof. As used herein, a "subject" or "individual" may or may not be housed in a medical facility, or may be treated as an outpatient in a medical facility. An individual may receive one or more medical compositions via the internet. Individuals may include humans or non-human animals of any age, and thus include both adults and juveniles (e.g., children) and infants, including individuals in utero. Subjects may or may not have a need for medical treatment. Individuals may participate in experiments, whether clinical or in support of basic science research, whether voluntary or involuntary.

[0048] The phrase "pharmaceutical or pharmacologically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic, or other adverse reactions when administered to animals, such as humans. The preparation of pharmaceutical compositions containing antibodies or additional active ingredients will be known to those skilled in the art in light of this disclosure. Furthermore, it will be understood that for administration to animals (e.g., humans), preparations should meet the standards of sterility, pyrogenicity, general safety, and purity required by the FDA Office of Biological Standards. The term "optionally" is used herein to refer to an element, step, or parameter that may or may not be utilized in any of the methods of the present disclosure.

[0049] As used herein, "pharmaceutical acceptable carrier" includes any and all aqueous solvents (e.g., water, alcoholic / aqueous solutions, saline, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc.), non-aqueous solvents (e.g., propylene glycol, polyethylene glycol, vegetable oils, and injectable organic esters such as ethyloleate), dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial or antifungal agents, antioxidants, chelating agents, and inert gases), isotonicity agents, absorption retardants, salts, drugs, drug stabilizers, gels, binders, excipients, disintegrants, lubricants, sweeteners, flavoring agents, dyes, fluid and nutrient replenishers, such materials and combinations thereof will be known to those skilled in the art. The pH and exact concentration of the various components in the pharmaceutical composition are adjusted according to well-known parameters.

[0050] As used herein, the term "viability" refers to the ability of a particular cell or cells to remain alive. I. Method Embodiments

[0051] II. Method embodiments The embodiments of the present disclosure include a method for identifying predictors for the response of immune cells (such as NK cells) derived from cord blood cells. In certain embodiments, a cord blood unit is tested for one or a variety of predictors that may produce immune cells suitable for adoptive cell therapy better than a cord blood unit lacking one or more of the predictors. The various parameters tested that may predict improved response of immune cells derived from cord blood cells compared to cells not so tested may include cell production, cell manipulation, and / or cell activity processes. These parameters may evaluate the cord blood unit itself, or they may evaluate any cells derived from the cord blood unit, or cells derived from manipulation or modification thereof. Such parameters include: viability of the cord blood unit; red blood cell content of the cord blood unit; total mononuclear cell recovery from the cord blood unit; expansion of immune cells derived from the thawed cord blood unit (including expansion at one or more ranges of time points); volumes of various materials; the gender, age and / or weight of the infant, the race of the infant's biological parent(s); one or more markers of the cells; manipulation of immune cells derived from the thawed cord blood unit; cytotoxicity of immune cells derived from the thawed cord blood unit; gestational age of the mother from which the cord blood is derived; cytotoxicity of immune cells derived from the thawed cord blood unit (including cytotoxicity against cancer cells or pathogen-infected cells); viability of the cord blood unit after thawing; and others.

[0052] Embodiments of the present disclosure include methods for selecting cryopreserved cord blood units to produce cells for adoptive cell therapy, the cells being cells with a higher potency (e.g., as measured using cytotoxicity assays and percentage of patients responding) for a particular purpose, including clinical use, than cells that have not been so selected. In specific embodiments, the method is for selecting cryopreserved cord blood units to produce engineered immune cells with a higher potency for adoptive cell therapy than cells that have not been so selected, including, for example, for the treatment of cancer. In certain aspects, the method is for selecting cryopreserved cord blood units to produce engineered natural killer cells with a higher potency for adoptive cell therapy than cells that have not been so selected, including, for example, for the treatment of any type of cancer.

[0053] In certain embodiments, methods encompassed herein include methods that reduce the risk of selecting a cord blood unit (which may be referred to as a cord blood composition) that will produce immune cells (such as, for example, NK cells) that are ineffective or poorly suited to be genetically engineered, expanded, and / or clinically utilized, such as for the treatment of cancer. In specific embodiments, the methods reduce the risk of selecting a cord blood unit that will produce immune cells that lack high potency, such as for cancer therapy as an adoptive cell therapy. In specific cases, the methods encompassed herein increase the likelihood of resulting in an adoptive NK cell therapy that is effective against one or more types of cancer.

[0054] In the disclosed methods, selection is made for cells for adoptive cell therapy that are quantitatively and / or qualitatively better in cell therapy than cells that have not been so selected. Qualitatively, the cells may be more cytotoxic, may be expanded to a greater extent, may have a higher persistence, may be more amenable to manipulation, may result in a greater proportion of responding patients, or a combination thereof. Quantitatively, the selected cord blood unit resulting from the present methods may have a cell viability level that is at least at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more compared to a cord blood unit selected without knowledge of one or more of the selection parameters encompassed herein. The selected cord blood units resulting from the methods may have cell viability levels that are at least 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 250-fold, 500-fold, 750-fold, 1000-fold or more than a cord blood unit selected without knowledge of one or more of the selection parameters encompassed herein. The selected cord blood units resulting from the methods may provide a total mononuclear cell recovery that is at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than a cord blood unit selected without knowledge of one or more of the selection parameters encompassed herein. The selected cord blood units resulting from the present methods may provide total mononuclear cell recovery that is at least 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 250-fold, 500-fold, 750-fold, 1000-fold or more, relative to cord blood units selected without knowledge of one or more of the selection parameters encompassed herein.Selected cord blood units resulting from the method have a lower variability than cord blood units selected without knowledge of one or more of the selection parameters encompassed herein, at least 1×10. 3 pieces, 1×10 4 pieces, 1×10 5 pieces, 1×10 6 pieces, 1×10 7 pieces, 5×10 7 A selected cord blood unit resulting from the present methods may have a nucleated red blood cell content that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or less than a cord blood unit selected without knowledge of one or more of the selection parameters contained herein.

[0055] In certain embodiments, the weight of the infant at the time of collection of cord blood tissue, whether in utero or outside utero, may be taken into consideration in the method of the present disclosure.In a specific embodiment, the weight of the infant is greater than 3650 grams, such as greater than 3650 grams, greater than 3700 grams, greater than 3750 grams, greater than 3800 grams, greater than 3850 grams, greater than 3900 grams, greater than 3950 grams, greater than 4000 grams, greater than 4050 grams, greater than 4100 grams, greater than 4150 grams, greater than 4200 grams, greater than 4250 grams, greater than 4500 grams, and the like.In a specific embodiment, this is measured prior to cryopreservation and / or use.

[0056] In specific embodiments, the race of one or more biological parents of the infant is Caucasian. In some cases, both biological parents of the infant are Caucasian, in some cases the biological mother is Caucasian, and in some cases the biological father is Caucasian.

[0057] In a specific embodiment, the timing of collection of cord blood from an infant is a factor in the method. In a specific embodiment, cord blood is obtained from the umbilical cord of an infant in utero. The collection step can be by any suitable method, and the party obtaining the cord blood may or may not be the party that manipulates, stores, and / or analyzes the cord blood for one or more parameters. In a specific embodiment, at the time of collection or shortly thereafter, the cord blood is combined with one or more anticoagulants, and the volume of the anticoagulant may or may not be a standard amount. In a specific case, the pretreatment volume is the volume of the cord blood collected + anticoagulant, and in certain cases, the pretreatment volume is the volume of the cord blood collected + a certain volume of anticoagulant (e.g., 35 mL or about 35 mL, etc.). In certain embodiments, the volume of cord blood drawn is no more than about 85mL, 84mL, 83mL, 82mL, 81mL, 80mL, 79mL, 78mL, 77mL, 76mL, 75mL, 74mL, 73mL, 72mL, 71mL, 70mL, 69mL, 68mL, 67mL, 66mL, 65mL, 64mL, 63mL, 62mL, 61mL, 60mL, 59mL, 58mL, 57mL, 56mL, 55mL, 54mL, 53mL, 52mL, 51mL, 50mL, 49mL, 48mL, 47mL, 46mL, 45mL, 44mL, 43mL, 42mL, 41mL, 40mL, 39mL, 38mL, 37mL, 36mL, 35mL, 34mL, 33mL, 32mL, 31mL, or 30mL or less by volume. In some cases, the volume of the anticoagulant is or is approximately 25mL, 26mL, 27mL, 28mL, 29mL, 30mL, 31mL, 32mL, 33mL, 34mL, 35mL, 36mL, 37mL, 38mL, 39mL, 40mL, 41mL, 42mL, 43mL, 44mL, 45mL, 46mL, 47mL, 48mL, 49mL, or 50mL or more. In specific cases, the volume of the anticoagulant is 35mL or about 35mL.The anticoagulant can be any type of anticoagulant, including at least CPD (the anticoagulant can be CDP-A (CDP + adenosine); citrate-phosphate-soluble dextrose (CP2D); acid citrate dextrose (ACD); heparin, etc.). In certain embodiments, cells in the collected cord blood may express one or more particular markers. In specific cases, cells in the collected cord blood may express CD34. In certain embodiments, a certain percentage of cells express any marker, including CD34. In certain cases, more than 0.4% of cells in the collected blood express CD34. In certain cases, more than 0.4%, more than 0.5%, more than 0.6%, more than 0.7%, more than 0.8%, more than 0.9%, more than 1.0%, more than 1.5%, more than 2%, more than 3%, more than 4%, more than 5%, more than 6%, more than 7%, more than 8%, more than 9%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, or more than 95% of the cells in the collected blood express CD34. In certain cases, at least 0.4% of the cells, at least 0.5% of the cells, at least 0.6% of the cells, at least 0.7% of the cells, at least 0.8% of the cells, at least 0.9% of the cells, at least 1.0% of the cells, at least 1.5% of the cells, at least 2% of the cells, at least 3% of the cells, at least 4% of the cells, at least 5% of the cells, at least 6% of the cells, at least 7% of the cells, at least 8% of the cells, at least 9% of the cells, at least 10% of the cells, at least 15% of the cells, at least 20% of the cells, at least 25% of the cells, at least 30% of the cells, at least 40% of the cells, at least 50% of the cells, at least 60% of the cells, at least 70% of the cells, at least 75% of the cells, at least 80% of the cells, at least 85% of the cells, at least 90% of the cells, or at least 95% of the cells in the collected blood express CD34.In a specific embodiment, this is determined prior to cryopreservation and / or use.

[0058] The selected cord blood cells resulting from the method may produce immune cells having cytotoxicity that is at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more than that of immune cells produced from cord blood cells selected without knowledge of one or more of the selection parameters encompassed herein. In some cases, immune cells produced from selected cord blood cells may have a level of cytotoxicity that is at least 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 250-fold, 500-fold, 750-fold, 1000-fold or more than that of immune cells selected from cord blood cells without knowledge of one or more of the selection parameters encompassed herein.

[0059] In certain aspects of the disclosure, selection is performed for one or more product characteristics of any kind of pre-frozen cord blood unit article, and in some aspects, selection is performed for one or more product characteristics after the frozen cord blood unit article is thawed. Such action(s) allows for the selection of the most suitable cord blood unit article (among the population of cord blood unit articles for which selection is performed) for producing cell products, including cell products for adoptive cell therapy. The characteristics of the post-thawed cord blood unit article may or may not be directly related to the production of cell products. That is, in some cases, the manipulation of cells derived from the cord blood unit article to produce cell therapy is enhanced by selecting the appropriate cord blood unit article, and in further or alternative cases, the activity of the cell therapy after the manipulation of cells derived from the cord blood unit article is enhanced by selecting the appropriate cord blood unit article (e.g., activity such as cytoxicity, in vivo persistence, and others).

[0060] The embodiments of the present disclosure include a method in which one or more parameters are characterized for one or more cord blood units from one or more storage banks of any type of cord blood unit. In a specific case, after the one or more cord blood units are characterized, one or more particular cord blood units may be rejected as being inappropriate for providing an optimal response (e.g., activity upon therapeutic administration). In a further case, one or more particular cord blood units may be determined to be suitable for enhanced activity, such as for enhanced activity upon therapeutic administration. In some circumstances, when two or more cord blood units are determined by the method of the present disclosure to be worthy of selection, they may or may not be combined before or after thawing. Immune cells produced from the selected cord blood units may be combined after induction from the cord blood units.

[0061] In a specific embodiment, the present disclosure provides a novel set of criteria for identifying cord blood units for producing NK cell therapy products with the highest potency for the treatment of cancer. NK cells derived from these highly potent cord blood units are most likely to produce optimal responses in cancer patients. As such, the methods of the present disclosure are used to select cord blood units with the highest potency as a source of material for the production of NK cell therapy products, and to avoid the selection of cord blood units and / or the generation of NK cells that may not induce a clinical response or may induce an ineffective clinical response. In a specific embodiment, the high potency NK cells produced from cord blood units selected by the methods of the present disclosure have the highest probability of inducing remission in cancer patients following adoptive transfer. In a specific case, the high potency NK cells produced from cord blood units selected by the methods of the present disclosure have a greater probability of inducing remission in cancer patients following adoptive transfer than NK cells produced from cord blood units lacking the disclosed beneficial characteristics.

[0062]

[0023] Embodiments of the disclosure include a method of selecting a cord blood composition, comprising: prior to cryopreservation, (a) a cord blood cell viability of 98% or greater or 99% or greater; (b) where appropriate, a total mononuclear cell (TNC) recovery of 76.3% or greater; and (c) a nucleated red blood cell (NRBC) content of 7.5 x 10 7 pieces~8.0×10 7(d) the weight of the infant from whom the cord blood is derived; (e) the race of the biological mother and / or biological father of the infant from whom the cord blood is derived being White; (f) the gestational age of the infant from whom the cord blood is derived, if necessary; (g) in utero collection of the cord blood, if necessary (although ex utero or a combination of in utero and ex utero may be used in any method of this disclosure); (h) the biological (i) optionally, a pretreatment volume (volume of collected cord blood + anticoagulant (35 ml CPD)) of 120 mL or less; (j) optionally, the cells of the extracted cord blood are greater than 0.4% CD34+, optionally (k) measuring cytotoxicity of immune cells derived from said cord blood composition after thawing, and optionally (l) measuring expansion of said cells in culture. In some cases, the cord blood composition before cryopreservation is determined to have at least the characteristics of (a) and (c). In some cases, the cord blood composition before cryopreservation is determined to have at least the characteristics of (b) and (c). In some cases, the cord blood composition before cryopreservation is determined to have at least the characteristics of (a) and (b). In some cases, the pre-cryopreservation cord blood composition is determined to have one, two, three, or all of the characteristics of (a), (c), (d), and (e), and may be in any combination. In some cases, the pre-cryopreservation cord blood composition is determined to have (a), (b), (c), and (d). In some cases, the pre-cryopreservation cord blood composition is determined to have one, two, three, or all of the characteristics of (a), (c), (d), and (e) in addition to one or more of (b), (f), (g), (h), (i), and (j).

[0063] A. Measurement of cell viability Embodiments of the present disclosure include methods in which the viability of cells in a cord blood unit is measured, and the measurement provides information on whether the cord blood unit is suitable, e.g., suitable for selection to derive immune cells for adoptive cell therapy. The cord blood cells being tested for viability may be a mixture of various cells in cord blood, such as, for example, mononuclear cells, stem cells (e.g., hematopoietic or mesenchymal), white blood cells, immune system cells (monocytes, macrophages, neutrophils, basophils, eosinophils, megakaryocytes, dendritic cells, T cells (including T helper cells and cytotoxic cells), B cells, NK cells), and others. The viability of cells in cord blood may be ascertained by one or more physical properties of these cells and / or one or more activities of these cells.

[0064] Although viability may be determined by any suitable method or methods, in specific cases, measurements are made by flow cytometry, tetrazolium reduction assay, resazurin reduction assay, protease viability marker assay, ATP assay, sodium-potassium ratio, lactate dehydrogenase assay, neutral red uptake, propidium iodide, TUNEL assay, formazan-based assay, Evans blue, trypan blue, ethidium homodimer assay, or combinations thereof.

[0065] Cell viability for the cord blood cells may be measured before and / or after cryopreservation. In one embodiment, the cord blood cell viability for the desired cord blood unit is 98.1% or more, 98.2% or more, 98.3% or more, 98.4% or more, 98.5% or more, 98.6% or more, 98.7% or more, 98.8% or more, 98.9% or more, 99.0% or more, 99.1% or more, 99.2% or more, 99.3% or more, 99.4% or more, 99.5% or more, 99.6% or more, 99.7% or more, 99.8% or more, or 99.9% or more.

[0066] In cases where viability is measured in addition to one or more other characteristics, such as total nucleated cell recovery and nucleated red blood cell content, cell viability may or may not precede one or more other measurements. In specific cases, viability is measured prior to TNC recovery and NRBC measurement, or subsequent to TNC recovery and NRBC measurement. In some cases, viability is measured after TNC but before NRBC, or after NRBC but before TNC recovery.

[0067] B. Total Nucleated Cell Recovery Measurement In certain embodiments of the method, total nucleated cell (TNC) recovery is measured in which nucleated cells are measured after cord blood processing. TNC recovery estimates both live and dead nucleated cells. This step may or may not be optional.

[0068] Any suitable assay for measuring TNC may be utilized, however, in specific embodiments, the TNC recovery assay includes flow cytometry; trypan blue; 3% acetic acid with methylene blue; hematology analyzer analysis; or combinations thereof. The TNC recovery assay may or may not be automated in a specific case.

[0069] In one embodiment, the TNC recovery is 76.3% or more, 76.4% or more, 76.5% or more, 76.6% or more, 76.7% or more, 76.8% or more, 76.9% or more, 77% or more, 78% or more, 79% or more, 80% or more, 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more.

[0070] In certain embodiments, the TNC recovery of the cord blood unit is determined prior to cryopreservation.

[0071] In cases where TNC recovery is measured in addition to one or more other characteristics, such as cell viability and NRBC content, TNC recovery may or may not be measured before one or more other measurements. In specific cases, TNC recovery is measured prior to cell viability and NRBC measurement, or subsequent to cell viability and NRBC measurement. In some cases, TNC recovery is measured after cell viability but before NRBC, or after NRBC but before cell viability.

[0072] C. Measurement of nucleated red blood cell count In certain embodiments, cord blood units are selected based on the measurement of nucleated red blood cell (NRBC) content. The measurement may be manual or may be automated. In certain embodiments, cord blood units with lower NRBC content are more effective in generating effective immune cells than cord blood units with higher NRBC content. The level of NRBC in the cord blood unit determines the response rate of individuals treated with immune cells (e.g., NK cells, etc.) derived from a particular cord blood unit. NRBC content may be measured by density centrifugation, such as by density centrifugation in a Sepax® device.

[0073] In a specific embodiment, the NRBC content is greater than 8.0×10, including down to undetectable levels. 7 Less than or equal to 7.9×10 7 Less than or equal to 7.8×10 7 Less than or equal to 7.7×10 7 pcs or less, 7.6×10 7 Less than or equal to 7.5×10 7 Less than or equal to 7.0×10 7 pcs or less, 6.0×10 7 Less than or equal to 5.0×10 7 pcs or less, 4.0×10 7 pcs or less, 3.0×10 7 pcs or less, 2.0×10 7 pcs or less, 1.0×10 7less than, 9.0×10 6 less than, 8.0×10 6 less than, 7.0×10 6 less than, 6.0×10 6 less than, 5.0×10 6 less than, 4.0×10 6 less than, 3.0×10 6 less than, 2.0×10 6 less than, 1.0×10 6 less than, 9.0×10 5 less than, 8.0×10 5 less than, 7.0×10 5 less than, 6.0×10 5 less than, 5.0×10 5 less than, 4.0×10 5 less than, 3.0×10 5 less than, 2.0×10 5 less than, 1.0×10 5 less than, 9.0×10 4 less than, 8.0×10 4 less than, 7.0×10 4 less than, 6.0×10 4 less than, 5.0×10 4 less than, 4.0×10 4 less than, 3.0×10 4 less than, 2.0×10 4 less than, 1.0×10 4 less than, 9.0×10 3 less than, 8.0×10 3 less than, 7.0×10 3 less than, 6.0×10 3 less than, 5.0×10 3 less than, 4.0×10 3 less than, 3.0×10 3 less than, 2.0×10 3 less than, 1.0×10 3 less than, 9.0×10 2 less than, 8.0×10 2 less than, 7.0×10 2 less than, 6.0×10 2 less than, 5.0×10 2 less than, 4.0×10 2 less than, 3.0×10 2 less than, 2.0×102 pcs or less, 1.0×10 2 100 or less, and others.

[0074] In certain embodiments, NRBC are measured prior to cryopreservation.

[0075] In cases where NRBC is measured in addition to one or more other characteristics, such as total nucleated cell recovery and cell viability, NRBC may or may not be measured prior to one or more other measurements. In specific cases, NRBC is measured prior to TNC recovery and cell viability, or subsequent to TNC recovery and cell viability. In some cases, NRBC is measured after TNC but before cell viability, or after cell viability but before TNC recovery.

[0076] D. Infant weight In some embodiments, the weight of the infant from which the cord blood is derived is utilized as a parameter in any method encompassed by the present disclosure. The weight of the infant may be obtained immediately prior to collection of the cord blood, such as within days or hours or minutes. In some cases, the weight of the infant may be determined in utero by using prenatal ultrasound. In some cases, the weight of the infant is determined outside the uterus, such as with a standard weighing scale. The party who measures the weight of the infant may or may not be the party who manipulates, stores, and / or analyzes the cord blood for one or more parameters. This step may occur before and / or after any other steps prior to cryopreservation. In a specific embodiment, the weight of the infant is greater than a certain amount, which may or may not generally correlate with gestational age. In specific cases, the weight of the infant is greater than about 3650 grams, such as greater than 3650 grams, greater than 3700 grams, greater than 3750 grams, greater than 3800 grams, greater than 3850 grams, greater than 3900 grams, greater than 3950 grams, greater than 4000 grams, greater than 4050 grams, greater than 4100 grams, greater than 4150 grams, greater than 4200 grams, greater than 4250 grams, greater than 4500 grams, etc. In specific embodiments, this is determined prior to cryopreservation and / or use.

[0077] E. Race of biological parents In a specific embodiment, one or more races of the biological parents are Caucasian. In some cases, the biological mother is Caucasian and the biological father is Caucasian. In some cases, the biological mother is Caucasian but the biological father is not Caucasian. In some cases, the biological father is Caucasian but the biological mother is not Caucasian.

[0078] F. Collection Parameters for Cord Blood In some embodiments, cord blood is obtained by standard methods in the art, such as through a needle from the umbilical vein after the baby is born. For extrauterine extraction, this is done after the placenta is expelled, and the cord blood may be placed in a sterile collection bag containing an anticoagulant or an anticoagulant may be added. For intrauterine extraction, this is done through the umbilical vein while the placenta is still in the mother's body, and the cord blood may then be placed in a sterile collection bag containing an anticoagulant or an anticoagulant may be added. In some cases, cord blood from the same baby is combined from intrauterine and extrauterine extractions. In a specific embodiment, intrauterine extraction is the preferred method over extrauterine extraction.

[0079] In certain embodiments, the volume of the cord blood drawn is taken into account in the disclosed method. For example, the volume of the combination of both cord blood and anticoagulant as a pretreatment composition is taken into account in the disclosed method. In a specific case, the volume of the combination of cord blood and anticoagulant is 120 mL or less. As an example, when the volume of anticoagulant is about 35 mL, the volume of cord blood is less than about 85 mL, 84 mL, 83 mL, 82 mL, 81 mL, 80 mL, 79 mL, 78 mL, 77 mL, 76 mL, 75 mL, 74 mL, 73 mL, 72 mL, 71 mL, 70 mL, 69 mL, 68 mL, 67 mL, 66 mL, 65 mL, 64 mL, 63 mL, 62 mL, 61 mL, 60 mL or less by volume. less than 59mL, less than 58mL, less than 57mL, less than 56mL, less than 55mL, less than 54mL, less than 53mL, less than 52mL, less than 51mL, less than 50mL, less than 49mL, less than 48mL, less than 47mL, less than 46mL, less than 45mL, less than 44mL, less than 43mL, less than 42mL, less than 41mL, less than 40mL, less than 39mL, less than 38mL, less than 37mL, less than 36mL, less than 35mL, less than 34mL, less than 33mL, less than 32mL, less than 31mL, or less than 30mL.

[0080] G. Cord Blood Cell Markers In a specific embodiment, at least a portion of the cells in cord blood, whatever type of cells, may express one or more specific markers as a population.In a specific embodiment, a certain percentage of cells in cord blood express CD34.Examples of cord blood cell types include stem cells, progenitor cells, red blood cells, white blood cells, B lymphocytes, T lymphocytes, NK cells, monocytes and platelets.In some cases, more than 0.4% of cells in collected cord blood express CD34. In certain cases, more than 0.4%, more than 0.5%, more than 0.6%, more than 0.7%, more than 0.8%, more than 0.9%, more than 1.0%, more than 1.5%, more than 2%, more than 3%, more than 4%, more than 5%, more than 6%, more than 7%, more than 8%, more than 9%, more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 40%, more than 50%, more than 60%, more than 70%, more than 75%, more than 80%, more than 85%, more than 90%, or more than 95% of the cells in the collected blood express CD34. In certain cases, at least 0.4% of cells, at least 0.5% of cells, at least 0.6% of cells, at least 0.7% of cells, at least 0.8% of cells, at least 0.9% of cells, at least 1.0% of cells, at least 1.5% of cells, at least 2% of cells, at least 3% of cells, at least 4% of cells, at least 5% of cells, at least 6% of cells, at least 7% of cells, at least 8% of cells, at least 9% of cells, at least 10% of cells, at least 15% of cells, at least 20% of cells, at least 25% of cells, at least 30% of cells, at least 40% of cells, at least 50% of cells, at least 60% of cells, at least 70% of cells, at least 75% of cells, at least 80% of cells, at least 85% of cells, at least 90% of cells, or at least 95% of cells in the collected blood express CD34. In a specific embodiment, this is measured prior to cryopreservation and / or use.

[0081] H. Measurement of Cytotoxicity The embodiments of the present disclosure include measuring the cytotoxicity of any type of immune cell, including NK cells derived from cord blood units. In a specific embodiment, measuring the cytotoxicity of NK cells derived from cord blood units is performed. In certain cases, cord blood cell units are characterized for viability, NRBC and TNC recovery, and after selection of the cord blood cell units based on this characterization, and after cryopreservation and thawing, if necessary, cells from the cord blood units may be measured for cytotoxicity.

[0082] Cytotoxicity assays often rely on dying cells with a severely compromised cell membrane that allows the release of cytoplasmic contents or the penetration of fluorescent dyes into cellular structures. Cytotoxicity can be measured in a number of different ways, for example, by measuring cell viability using vital dyes (formazan dyes), protease biomarkers, or by measuring ATP content. Formazan dyes are chromogenic products formed by the reduction of tetrazolium salts (INT, MTT, MTS, and XTT) by dehydrogenases (e.g., lactate dehydrogenase (LDH) and other) and reductors that are released upon cell death. Other assays include sulforhodamine B assays and water-soluble tetrazolium salt assays that may be utilized for high-throughput screening. Cytotoxicity can be measured using an Incucyte® instrument.

[0083] In specific embodiments, dyes that selectively permeate dead cells can be utilized (e.g., Trypan Blue, etc.). In other cases, fluorescent DNA-binding dyes that permeate dead cells can be utilized (e.g., Hoechst 33342, YO-PRO-1, or CellTox Green, etc.).

[0084] In specific embodiments, where the cell being tested for cytotoxicity is a T cell or a NK cell, 51A Cr release assay may be used.

[0085] I. Measurement of NK cell expansion In specific embodiments of the disclosed methods, the degree of NK cell expansion following cryopreservation and thawing of cord blood units (including cord blood units selected based on the criteria contained herein) is a predictor of clinical response. That is, after the cord blood is thawed, the thawed blood is treated and cultured under conditions that expand the amount of NK cells in culture. Cord blood units that meet the selection criteria contained herein may or may not be pooled prior to NK cell expansion. The quantitative degree of NK cell expansion, including in some cases at a particular time point, is utilized in some embodiments as a selection criterion for NK cells that will have greater clinical efficacy compared to NK cells derived from randomly selected cord blood units.

[0086] In certain cases, NK cells are expanded and an expansion level is determined. When NK cells are expanded at least to a certain level at a certain time, the NK cells have greater clinical efficacy compared to NK cells that cannot be expanded to such a level. In at least some cases, NK cells that will have clinical efficacy in the range between day 0 and day 6 are 2-fold or more, 3-fold or more, 4-fold or more, 5-fold or more, 6-fold or more, 7-fold or more (including 8-fold or more, 9-fold or more, 10-fold or more, 12-fold or more, 15-fold or more, 20-fold or more, 50-fold or more, 100-fold or more, 150-fold or more, 200-fold or more, 250-fold or more, 500-fold or more, 1000-fold or more, 1500-fold or more, 2000-fold or more, and others). In at least some cases, if the expansion is less than 7-fold (including less than 6-fold, less than 5-fold, less than 4-fold, less than 3-fold, or less than 2-fold) in the range between day 0 and day 6, the NK cells may have insufficient clinical efficacy. In at least some cases, expansion in culture ranged between days 6 and 15, with 10 2 more than 10 times 3 more than 10 times 4 more than 10 times 5More than twice (10 6 more than 10 times 7 more than 10 times 8 more than 10 times 9 more than 10 times 10 more than 10 times 11 more than 10 times 12 more than 10 times 13 NK cells will have clinical efficacy if the expansion in culture is 10 fold or more, and others. In at least some cases, the expansion in culture ranges between days 6 and 15, and the NK cells will have clinical efficacy if the expansion in culture is 10 fold or more, and others. 5 Less than double (10 4 Less than 10 times 3 Less than 10 times 2 1000× or more, 1100× or more, 1200× or more, 1300× or more, 1400× or more, 1500× or more, 1600× or more, 1700× or more, 1800× or more, 1900× or more, 2000× or more, 2500× or more, 3000× or more, 4000× or more, 5000× or more, 10,000× or more, or more. In at least some cases, NK cells that will have clinical efficacy in the range between day 0 and day 15 are 900× or more, 1000× or more, 1100× or more, 1200× or more, 1300× or more, 1400× or more, 1500× or more, 1600× or more, 1700× or more, 1800× or more, 1900× or more, 2000× or more, 2500× or more, 3000× or more, 4000× or more, 5000× or more, 10,000× or more, or more. In at least some cases, if the expansion in culture is less than 900-fold (e.g., less than 800-fold, less than 700-fold, less than 600-fold, less than 500-fold, less than 400-fold, less than 300-fold, less than 200-fold, less than 100-fold, etc.) in the range between days 6 and 15, the NK cells may have insufficient clinical efficacy.

[0087] In some embodiments, NK cell expansion utilizes a specific in vitro method for expanding NK cells. In some cases, preactivation of a population of NK cells is performed in a preactivation culture containing an effective concentration of IL-12, IL-15 and / or IL-18 to obtain preactivated NK cells, and then the preactivated NK cells are expanded in an expansion culture containing artificial antigen presenting cells (aAPCs) expressing CD137 ligand. In certain aspects, the aAPCs further express membrane-bound cytokines. In some aspects, the membrane-bound cytokines are membrane-bound IL-21 (mIL-21) and / or membrane-bound IL-15 (mIL-15). In some aspects, the aAPCs have essentially no endogenous expression of HLA class I molecules, HLA class II molecules or CD1d molecules. In certain aspects, the aAPCs express ICAM-1 (CD54) and LFA-3 (CD58). In some aspects, the aAPC is further defined as a leukemia cell-derived aAPC. In certain aspects, the leukemia cell-derived aAPC is further defined as a K562 cell engineered to express CD137 ligand and / or mIL-21. The K562 cell may be engineered to express CD137 ligand and mIL-21. In certain aspects, engineered is further defined as retroviral transduction. In certain aspects, the aAPC is irradiated. In certain cases, the pre-activation step is for 10-20 hours, such as 14-18 hours (e.g., about 14 hours, 15 hours, 16 hours, 17 hours, or 18 hours), particularly about 16 hours. In certain aspects, the pre-activation culture comprises IL-18 and / or IL-15 at a concentration of 10-100 ng / mL, such as 40-60 ng / mL, particularly about 50 ng / mL. In some aspects, the pre-activation culture comprises IL-12 at a concentration of 0.1-150 ng / mL, such as, for example, 1-20 ng / mL, particularly at a concentration of about 10 ng / mL. In further aspects, the expansion culture further comprises IL-2.In some aspects, IL-2 is present at a concentration of 10-500 U / mL, such as, for example, 100-300 U / mL, particularly at a concentration of about 200 U / mL. In some aspects, the IL-12, IL-18, IL-15 and / or IL-2 is recombinant human IL-2. In some aspects, IL-2 is replenished in the expansion culture every 2-3 days. In some aspects, aAPCs are added to the expansion culture at least a second time. In some aspects, the method is performed in serum-free medium.

[0088] In one embodiment, the expansion step comprises culturing the NK cells in the presence of an effective amount of universal antigen presenting cells (UAPCs) engineered to express (1) CD48 and / or CS1 (CD319), (2) membrane-bound interleukin-21 (mbIL-21), and (3) 41BB ligand (41BBL). In some aspects, the immune cells and UAPCs are cultured at a ratio of 3:1 to 1:3, such as 3:1, 3:2, 1:1, 1:2, or 1:3. In certain aspects, the immune cells and UAPCs are cultured at a ratio of 1:2. In some aspects, the UAPCs have essentially no endogenous expression of HLA class I molecules, HLA class II molecules, or CD1d molecules. In certain aspects, the UAPCs express ICAM-1 (CD54) and LFA-3 (CD58). In certain aspects, the UAPCs are further defined as leukemia cell-derived aAPCs. In some aspects, the leukemia cell-derived UAPCs are further defined as K562 cells. In certain aspects, the UAPCs are added at least a second time.

[0089] In some aspects, the expansion is performed in the presence of IL-2. In specific aspects, IL-2 is present at a concentration of 10-500 U / mL, such as 10-25 U / mL, 25-50 U / mL, 50-75 U / mL, 75-10 U / mL, 100-150 U / mL, 150-200 U / mL, 200-250 U / mL, 250-300 U / mL, 300-350 U / mL, 350-400 U / mL, or 400-500 U / mL. In certain aspects, IL-2 is present at a concentration of 100-300 U / mL. In certain aspects, IL-2 is present at a concentration of 200 U / mL. In some aspects, the IL-2 is recombinant human IL-2. In a specific aspect, IL-2 is replenished every 2-3 days, such as every 2 or 3 days.

[0090] III. Cord blood-derived immune cells Certain embodiments of the present disclosure relate to immune cells derived from a cord blood unit(s) that are selected for processing based on one or more criteria encompassed herein. The immune cells include NK cells, invariant NK cells, NKT cells, T cells (e.g., regulatory T cells, CD4 + T cells, CD8 + The immune cells may be any type of immune cell, including T cells, gamma-delta T cells, monocytes, granulocytes, myeloid cells, macrophages, neutrophils, dendritic cells, mast cells, eosinophils, basophils, stem cells (e.g., mesenchymal stem cells (MSCs) or induced pluripotent stem (iPSC) cells), and others. Methods of producing and manipulating immune cells, as well as methods of using and administering the cells for adoptive cell therapy, are also provided herein, in which case the cells may be autologous or allogeneic with respect to the individual from whom the cord blood was obtained. Thus, immune cells may be used as immunotherapy, such as to target cancer cells.

[0091] Immune cells may be isolated from a cord blood unit from a human subject. Cord blood may be obtained from a subject of interest, such as a subject suspected of having a particular disease or condition, a subject suspected of having a predisposition to a particular disease or condition, or a subject undergoing treatment for a particular disease or condition. Cord blood may be obtained from a subject for the purpose of banking the cord blood (including the immune cells derived therefrom) in case it is needed later during life. The immune cells derived from the cord blood may be used as is, or may be stored for a period of time, such as by freezing. Cord blood may be pooled or unpooled, such as from two or more sources, such as from three, four, five, six, seven, eight, nine, ten or more sources (e.g., donor subjects), or may be unpooled.

[0092] The cord blood from which the immune cells are derived can be obtained from a subject in need of treatment or from a subject suffering from any kind of disease, including diseases associated with reduced immune cell activity. Thus, the cells will be autologous to the subject in need of treatment. Alternatively, the population of immune cells can be obtained from a donor, preferably from a histocompatible donor. The population of immune cells can be taken from peripheral blood, cord blood, bone marrow, spleen, or any other organ / tissue in which the immune cells are present in the subject or donor. The immune cells can be isolated from a pool of subjects and / or donors, such as pooled cord blood.

[0093] When the population of immune cells is obtained from a cord blood unit from a donor separate from the subject, the donor is preferably allogeneic, provided that the obtained cells are subject-compatible in that they can be introduced into the subject. Allogeneic donor cells may or may not be human leukocyte antigen (HLA) compatible. To be subject-compatible, allogeneic cells can be treated to reduce immunogenicity.

[0094] A.NK cells In some embodiments, the immune cells derived from the selected cord blood unit(s) are NK cells. NK cells are a subpopulation of lymphocytes that have spontaneous cytotoxicity against various tumor cells, virus-infected cells, and some normal cells in bone marrow and thymus. NK cells are very important effectors of early innate immune responses against transformed and virus-infected cells. NK cells constitute about 10% of lymphocytes in human peripheral blood. When lymphocytes are cultured in the presence of IL-2, strong cytotoxic reactivity appears. NK cells are effector cells known as large granular lymphocytes due to their larger size and the presence of characteristic azurophilic granules in their cytoplasm. NK cells differentiate and mature in bone marrow, lymph nodes, spleen, tonsils and thymus. NK cells can be detected by specific surface markers, such as CD16, CD56 and CD8 in humans. NK cells do not express the T cell antigen receptor, the pan-T marker CD3, or the surface immunoglobulin B cell receptor.

[0095] Stimulation of NK cells is achieved through crosstalk of signals originating from activating and inhibitory receptors on the cell surface. The activation state of NK cells is regulated by the balance of intracellular signals received from a germline-encoded set of activating and inhibitory receptors (Campbell, 2006). When NK cells encounter abnormal cells (e.g., tumor cells or virus-infected cells) and activating signals become dominant, NK cells can rapidly induce apoptosis of the target cell through directed secretion of cytolytic granules containing perforin and granzymes or engagement of death domain-containing receptors. Activated NK cells can also secrete type I cytokines (e.g., interferon-gamma, tumor necrosis factor-alpha, and granulocyte-macrophage colony-stimulating factor (GM-CSF)), which activate both innate and adaptive immune cells, as well as other cytokines and chemokines (Wu et al., 2003). The production of these soluble factors by NK cells in early innate immune responses has a profound effect on the recruitment and function of other hematopoietic cells. Also, through physical contact and production of cytokines, NK cells are central players in a regulatory cross-talk network with dendritic cells and neutrophils to promote or suppress immune responses.

[0096] In one particular aspect, NK cells are isolated and expanded by previously described methods of ex vivo expansion of NK cells (Shah et al., 2013). In this method, CB mononuclear cells are isolated by Ficoll density gradient centrifugation and cultured in a bioreactor with IL-2 and artificial antigen presenting cells (aAPCs). After 7 days, the cell culture is depleted of any cells expressing CD3 and re-cultured for an additional 7 days. Cells are again CD3 depleted and CD56 + / CD3 - In another method, umbilical cord CB is characterized to determine the percentage of CD34 cells or NK cells. + Isolation of cells and differentiation of CD56+ / -cells by culture in medium containing SCF, IL-7, IL-15, and IL-2+ / CD3 - It is used to direct NK cells through differentiation into NK cells.

[0097] BT cells In some embodiments, the immune cells derived from the selected cord blood unit(s) are T cells. Several basic approaches have been described in the past 20 years for the induction, activation and expansion of functional anti-tumor effector cells. These include: autologous cells (such as tumor infiltrating lymphocytes (TILs)); T cells activated ex vivo using autologous DCs, lymphocytes, artificial antigen presenting cells (APCs), or beads coated with T cell ligands and activating antibodies, or cells isolated by capturing target cell membranes; allogeneic cells that naturally express anti-host tumor TCRs; and tumor non-specific autologous or allogeneic cells that are genetically reprogrammed or "reordered" to express tumor-reactive or chimeric TCR molecules that exhibit antibody-like tumor recognition capabilities, known as "T-bodies". These approaches have led to numerous protocols for the preparation of T cells and immunization with T cells that can be used in the methods described herein.

[0098] In some embodiments, one or more subsets of T cells are derived from selected cord blood: e.g., CD4 + cells, CD8 + Cells, and subpopulations thereof (e.g., subpopulations defined by function, activation state, maturity, differentiation, expansion, recirculation, localization and / or persistence potential, antigen specificity, type of antigen receptor, presence in specific organs or compartments, marker or cytokine secretion profile, and / or degree of differentiation, etc. For the subject to be treated, T cells may be obtained from allogeneic or autologous umbilical cord blood, or mixtures thereof.

[0099] Certain types of T cells may be derived from selected cord blood. T cells (e.g., CD4+ and / or CD8 + Among the various subtypes and subpopulations of T cells, there are naive T (T N ) cells, effector T cells (T EFF ), memory T cells and their subtypes (e.g., stem cell memory T cells (TSCs) M ), central memory T cells (TC M ), effector memory T cells (T EM ), tumor infiltrating lymphocytes (TILs), immature T cells, mature T cells, helper T cells, cytotoxic T cells, mucosal-associated invariant T (MAIT) cells, naturally occurring adaptive regulatory T (Treg) cells, helper T cells (e.g., TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells, follicular helper T cells, alpha / beta T cells, and delta / gamma T cells).

[0100] In some embodiments, one or more of the cord blood derived T cell populations are enriched or depleted for cells that are positive for one or more specific markers (such as, for example, surface markers) or negative for one or more specific markers. In some cases, such markers are absent or expressed at relatively low levels in certain populations of T cells (such as, for example, non-memory cells), but present or expressed at relatively higher levels in certain other populations of T cells (such as, for example, memory cells).

[0101] In some embodiments, T cells are separated from the cord blood sample by negative selection of markers expressed on non-T cells (e.g., B cells, monocytes or other leukocytes, etc.), such as, for example, CD14. + or CD8 + The selection process for CD4 + Helper cells and CD8 + It is used to separate cytotoxic T cells. Such CD4+ Populations and CD8 + The population can be further sorted into subpopulations by positive or negative selection for markers expressed, or expressed to a relatively greater extent, in one or more naive, memory and / or effector T cell subpopulations.

[0102] In some embodiments, CD8 + T cells can be further enriched or depleted for naive cells, central memory cells, effector memory cells and / or central memory stem cells, for example, by positive or negative selection based on surface antigens associated with each subpopulation.

[0103] In some embodiments, T cells are cultured in interleukin-2 (IL-2), and in any case, T cells may be pooled prior to expansion. Expansion can be accomplished by any of a number of methods as known in the art. For example, T cells can be rapidly expanded using non-specific T cell receptor stimulation in the presence of feeder lymphocytes and either interleukin-2 (IL-2) or interleukin-15 (IL-15). Non-specific T cell receptor stimulation can include around 30 ng / ml OKT3 (mouse monoclonal anti-CD3 antibody, available from Ortho-McNeil.RTM. (Raritan, NJ)). Alternatively, T cells can be rapidly expanded by in vitro stimulation of peripheral blood mononuclear cells (PBMCs) in the presence of a T cell growth factor, such as 300 IU / ml IL-2 or IL-15, with one or more antigens of the cancer (including antigenic portions (e.g., epitopes) thereof, or cells, which may be expressed from a vector, if necessary, such as human leukocyte antigen A2 (HLA-A2) binding peptides. In vitro derived T cells are rapidly expanded by restimulation with the same antigen(s) of the cancer pulsed against antigen presenting cells expressing HLA-A2. Alternatively, T cells can be restimulated, for example, with irradiated autologous lymphocytes or with irradiated HLA-A2+ allogeneic lymphocytes and IL-2.

[0104] C. Stem cells In some embodiments, the immune cells derived from the selected cord blood unit(s) may be stem cells, such as induced pluripotent stem cells (PSCs), mesenchymal stem cells (MSCs), or hematopoietic stem cells (HSCs), or mixtures thereof.

[0105] The pluripotent stem cells encompassed herein may be induced pluripotent stem (iPS) cells, commonly abbreviated as iPS cells or iPSCs. Induction of pluripotency was originally achieved in 2006 using mouse cells (Yamanaka et al., 2006) and in 2007 using human cells (Yu et al., 2007; Takahashi et al., 2007) by reprogramming somatic cells through the introduction of transcription factors associated with pluripotency. The use of iPSCs avoids most of the ethical and practical issues associated with the large-scale clinical use of ES cells, and patients with iPSC-derived autologous grafts may not require lifelong immunosuppressive treatment to prevent graft rejection.

[0106] Somatic cells, such as the somatic cells in umbilical cord blood unit, can be initialized to produce iPS cells using various methods known to those skilled in the art.Those skilled in the art can easily produce iPS cells: for example, see published US Patent Application No. 2009 / 0246875, published US Patent Application No. 2010 / 0210014; published US Patent Application No. 2012 / 0276636; U.S. Patent No. 8,058,065; U.S. Patent No. 8,129,187; PCT Publication No. WO2007 / 069666(A1); U.S. Patent No. 8,268,620; U.S. Patent No. 8,546,140; U.S. Patent No. 9,175,268; U.S. Patent No. 8,741,648; U.S. Patent Application No. 2011 / 0104125 and U.S. Patent No. 8,691,574 (which are incorporated herein by reference). In general, nuclear reprogramming factors are used to generate pluripotent stem cells from somatic cells.In some embodiments, at least three of Klf4, c-Myc, Oct3 / 4, Sox2, Nanog and Lin28 are utilized, or at least four of them are utilized.In other embodiments, Oct3 / 4, Sox2, c-Myc and Klf4 are utilized, or Oct3 / 4, Sox2, Nanog and Lin28 are utilized.

[0107] The mouse cDNA sequence and human cDNA sequence of these nuclear reprogramming substances are available by referring to the NCBI accession numbers described in International Publication WO2007 / 069666 and US Patent No. 8,183,038 (which are incorporated herein by reference). Various methods for introducing one or more reprogramming substances or the nucleic acid encoding these reprogramming substances are known in the art, and are disclosed in, for example, US Patent Nos. 8,268,620, 8,691,574, 8,741,648, 8,546,140, ​​published US Patent Nos. 8,900,871 and 8,071,369 (which are both incorporated herein by reference).

[0108] Once induced, iPSCs can be cultured in a medium that is sufficient to maintain pluripotency. iPSCs may be used with various media and techniques developed to culture pluripotent stem cells (more specifically embryonic stem cells), as described in U.S. Patent No. 7,442,548 and U.S. Patent Application Publication No. 2003 / 0211603. In the case of mouse cells, culture is carried out by adding leukemia inhibitory factor (LIF) as a differentiation inhibitor to normal culture medium. In the case of human cells, it is preferable to add basic fibroblast growth factor (bFGF) instead of LIF. Other methods for culturing and maintaining iPSCs, as would be known to those skilled in the art, may be used with the methods disclosed herein.

[0109] In certain embodiments, undefined conditions may be used, for example, pluripotent cells may be cultured on fibroblast feeder cells or in a medium exposed to fibroblast feeder cells to maintain stem cells in an undifferentiated state. In some embodiments, cells are cultured in the presence of mouse embryonic fibroblasts as feeder cells, which are treated with radiation or antibiotics to terminate cell division. Alternatively, pluripotent cells may be cultured and maintained in an essentially undifferentiated state using a defined feeder-independent culture system (such as TESR™ medium or E8™ / Essential8™ medium).

[0110] Various plasmids have been designed with several objectives in mind, including achieving a controlled high copy number and avoiding potential sources of plasmid instability in bacteria, as well as providing a means for plasmid selection that is compatible for use in mammalian cells, including human cells. The dual requirements of plasmids for use in human cells have been particularly noted. First, such plasmids are suitable for maintenance and fermentation in E. coli, so that large amounts of DNA can be produced and purified. Second, such plasmids are safe and suitable for use in human patients and animals. The first requirement calls for a high copy number plasmid that can be relatively easily selected and stably maintained during bacterial fermentation. The second requirement calls for consideration of various factors, such as selection markers and other coding sequences. In some embodiments, the various plasmids encoding markers are composed of the following: (1) a high copy number origin of replication, (2) a selectable marker, such as, but not limited to, the neo gene for antibiotic selection with kanamycin, (3) a transcription termination sequence including a tyrosinase enhancer, and (4) a multiple cloning site for incorporating various nucleic acid cassettes, and (5) a nucleic acid sequence encoding a marker operably linked to the tyrosinase promoter. In certain aspects, the plasmid does not contain a tyrosinase enhancer or a tyrosinase promoter. There are many plasmid vectors known in the art for inducing nucleic acids encoding proteins. These include, but are not limited to, the vectors disclosed in U.S. Patent Nos. 6,103,470, 7,598,364, 7,989,425, and 6,416,998, and U.S. Patent Application No. 12 / 478,154, which are incorporated herein by reference.

[0111] Episomal gene delivery systems can include plasmids, Epstein-Barr Virus (EBV)-based episomal vectors, yeast-based vectors, adenovirus-based vectors, Simian Virus 40 (SV40)-based episomal vectors, Bovine Papilloma Virus (BPV)-based vectors, or lentiviral vectors. Viral gene delivery systems can include RNA-based or DNA-based viral vectors.

[0112] IV. Cell manipulation In some embodiments, immune cells derived from selected cord blood unit(s) are manipulated by humans to be utilized for various purposes. The manipulation may be for clinical or research use. The manipulated immune cells may in some cases be stored or used, such as administered to an individual in need thereof. The manipulation may or may not be performed by the same person who generated the immune cells from the selected cord blood unit(s).

[0113] In a specific embodiment, the immune cells are engineered to express one or more non-natural receptors, such as, for example, antigen receptors. The antigen can be of any type, and engineering the immune cells to express the antigen can, at least in some cases, facilitate the use of the cells for clinical applications. The antigen can be a cancer antigen (including a tumor antigen or a hematopoietic cell antigen), or the antigen can be for any type of pathogen, including bacterial, viral, fungal, parasitic, and others.

[0114] Immune cells (e.g., autologous or allogeneic T cells (e.g., regulatory T cells, CD4 + T cells, CD8 +T cells, or gamma-delta T cells), NK cells, invariant NK cells, NKT cells, stem cells (e.g., MSCs or iPS cells) can be genetically engineered to express antigen receptors (e.g., engineered TCRs and / or CARs, etc.). For example, immune cells may be modified to express a TCR with antigen specificity for a cancer antigen. In certain embodiments, NK cells are engineered to express a TCR. NK cells may alternatively or additionally be engineered to express a CAR. Multiple CARs and / or TCRs, such as against different antigens, may be added to a single cell type, such as a T cell or NK cell.

[0115] A variety of suitable cell modification methods and recombinant reagents are known in the art. See, for example, Sambrook and Ausubel (supra). For example, cells can be transduced to express TCRs with antigen specificity for cancer antigens using the transduction techniques described in Heemskerk et al. (2008) and Johnson et al. (2009).

[0116] In some embodiments, the cells contain one or more engineered nucleic acids encoding one or more antigen receptors, and engineered products of such nucleic acids. In some embodiments, the nucleic acids are heterologous, i.e., not normally present in the cell or sample obtained from the cell, e.g., obtained from another organism or cell, e.g., not normally found in the cell being manipulated and / or the organism from which such cell is derived. In some embodiments, the nucleic acids are not naturally occurring, e.g., nucleic acids not found in nature (e.g., chimeras).

[0117] In some embodiments, CAR contains an extracellular antigen recognition domain that specifically binds to antigen.In some embodiments, antigen is a protein expressed on the surface of a cell.In some embodiments, CAR is a TCR-like CAR, and antigen is a processed peptide antigen, such as an intracellular protein peptide antigen, that is recognized on the cell surface in the context of major histocompatibility complex (MHC) molecules, just like TCR.

[0118] Various exemplary antigen receptors, including CARs and recombinant TCRs, as well as various methods for engineering and introducing receptors into cells, are described, for example, in International Patent Application Publication Nos. WO2000 / 14257, WO2013 / 126726, WO2012 / 129514, WO2014 / 031687, WO2013 / 166321, WO2013 / 071154, WO2013 / 123061, U.S. Patent Application Publication Nos. 2002131960, 2013287748, and 20130149337; U.S. Patent Nos. 6,451,995, 7,446,190, 8,252, and 8,311, and in US Pat. Nos. 2,592, 8,339,645, 8,398,282, 7,446,179, 6,410,319, 7,070,995, 7,265,209, 7,354,762, 7,446,191, 8,324,353 and 8,479,118, and European Patent Application No. EP 2537416, and / or the antigen receptors and methods described by Sadelain et al. (2013), Davila et al. (2013), Turtle et al. (2012), Wu et al. (2012). In some aspects, engineered antigen receptors include CARs such as those described in U.S. Pat. No. 7,446,190 and those described in International Patent Application Publication No. WO / 2014055668(A1).

[0119] In embodiments where TCRs are utilized, electroporation of RNA coding for the alpha and beta (or gamma and delta) chains of the full-length TCR can be used as an alternative to overcome the long-term problem of autoreactivity caused by pairing of the retrovirally transduced TCR chains with the endogenous TCR chains. Even if such an alternative pairing occurs in a transient transfection strategy, any autoreactive T cells that may arise will lose this autoreactivity over time, since the introduced TCR alpha and beta chains are only expressed transiently. When the expression of the introduced TCR alpha and beta chains decreases, only normal autologous T cells remain. This is not the case when the full-length TCR chains are introduced by stable retroviral transduction, which never loses the introduced TCR chains, thus causing ever-present autoreactivity in the patient.

[0120] After genetic modification, the immune cells may be delivered immediately (e.g., injected, etc.) or may be stored. In certain aspects, after genetic modification, the cells may be expanded ex vivo for days, weeks, or months as a bulk population within about 1, 2, 3, 4, 5, or more days after gene transfer into the cells. In further aspects, the transfectants are cloned, and clones that demonstrate the presence of a single integrated or episomally maintained expression cassette or plasmid, and the expression of a chimeric receptor (as an example), are expanded ex vivo. Clones selected for expansion demonstrate the ability to specifically recognize and lyse target cells expressing the antigen. The recombinant immune cells may be expanded by stimulation, such as with IL-2, or other cytokines that bind to the common gamma chain (e.g., IL-7, IL-12, IL-15, and IL-21, etc.). The recombinant immune cells may be expanded by stimulation with artificial antigen-presenting cells. In a further aspect, the genetically modified cells may be cryopreserved. 1. Chimeric antigen receptor

[0121] A. Chimeric Antigen Receptor In some embodiments, immune cells are engineered to express a CAR, where the CAR comprises a) one or more intracellular signaling domains, b) a transmembrane domain, and c) specifically binds to a desired antigen.

[0122] In some embodiments, engineered antigen receptors include CARs, including activating or stimulatory CARs, costimulatory CARs (see WO 2014 / 055668), and / or inhibitory CARs (iCARs, see Fedorov et al., 2013). CARs generally comprise an extracellular antigen (or ligand) binding domain linked to one or more intracellular signaling components, in some aspects via a linker and / or one or more transmembrane domains. Such molecules generally mimic or approximate signals through natural antigen receptors, signals through such receptors in combination with costimulatory receptors, and / or signals through costimulatory receptors alone.

[0123] Certain embodiments of the present disclosure relate to the use of nucleic acids, including nucleic acids encoding antigen-specific CAR polypeptides, including humanized CARs (hCARs) to reduce immunogenicity, that include an intracellular signaling domain, a transmembrane domain, and an extracellular domain that includes one or more signaling motifs. In certain embodiments, the CAR may recognize an epitope that includes a space shared between one or more antigens. In certain embodiments, the binding region may include a complementarity determining region of a monoclonal antibody, a variable region of a monoclonal antibody, and / or an antigen-binding fragment thereof. In another embodiment, the specificity is derived from a peptide (e.g., a cytokine) that binds to a receptor.

[0124] It is envisioned that the human CAR nucleic acid can be a human gene used to enhance cellular immunotherapy in human patients. In a specific embodiment, the present invention includes a cDNA or coding region of a full-length CAR. The antigen-binding region or domain can include a fragment of the VH and VL chains of a single-chain variable fragment (scFv) derived from a particular human monoclonal antibody, such as those described in U.S. Pat. No. 7,190,304, which is incorporated herein by reference. The fragment can also be any number of different antigen-binding domains of a human antigen-specific antibody. In a more specific embodiment, the fragment is an antigen-specific scFv encoded by a sequence optimized for human codon usage for expression in human cells.

[0125] The arrangement can be a multimer, such as a bispecific antibody or a multimer. The multimer is most likely to form a diabody by cross-pairing of the variable portions of the light and heavy chains. The hinge portion of the structure can have multiple options, from being completely deleted, to maintaining the first cysteine, to substituting proline instead of serine, to being truncated up to the first cysteine. The Fc portion can be deleted. A protein that is stable and / or dimerizes can serve this purpose. Only one of the Fc domains can be used, for example, either the CH2 or CH3 domain of a human immunoglobulin. The hinge, CH2 and CH3 regions of a human immunoglobulin modified to improve dimerization can also be used. Only the hinge portion of the immunoglobulin can be used. A portion of CD8α can also be used.

[0126] In some embodiments, the CAR nucleic acid comprises a sequence encoding other costimulatory receptors, such as a transmembrane domain and a modified CD28 intracellular signaling domain. Other costimulatory receptors include, but are not limited to, one or more of CD28, CD27, OX-40 (CD134), DAP10, DAP12, and 4-1BB (CD137). In addition to the primary signal initiated by CD3ζ, the additional signal provided by the human costimulatory receptor inserted into the human CAR is important for the full activation of NK cells and can help improve the in vivo persistence and therapeutic success of adoptive immunotherapy.

[0127] In some embodiments, CARs are constructed with specificity for a particular antigen (or marker or ligand), such as an antigen that is intended to induce an attenuated response, such as an antigen expressed on a particular cell type targeted by adoptive therapy, such as a cancer marker, and / or an antigen expressed on a normal or non-disease cell type. Thus, a CAR generally comprises one or more antigen-binding molecules, such as one or more antigen-binding fragments, domains, or portions, or one or more antibody variable domains, and / or antibody molecules, in its extracellular portion. In some embodiments, a CAR comprises one or more antigen-binding portions of an antibody molecule, such as a single-chain antibody fragment (scFv) derived from the variable heavy (VH) and variable light (VL) chains of a monoclonal antibody (mAb).

[0128] In certain embodiments of the chimeric antigen receptor, the antigen-specific portion of the receptor (which may be co-referenced as the extracellular domain constituting the antigen-binding region) comprises a tumor-associated antigen or a pathogen-specific antigen-binding domain. Antigens include carbohydrate antigens recognized by pattern recognition receptors such as Dectin-1. The tumor-associated antigen may be any antigen, so long as it is expressed on the cell surface of the tumor cell. Exemplary embodiments of tumor-associated antigens include CD19, CD20, carcinoembryonic antigen, alpha fetoprotein, CA-125, MUC-1, CD56, EGFR, c-Met, AKT, Her2, Her3, epithelial tumor antigen, melanoma-associated antigen, mutated p53, mutated ras, and the like. In certain embodiments, the CAR can be co-expressed with a cytokine to improve persistence when the amount of tumor-associated antigen is low. For example, the CAR can be co-expressed with IL-15.

[0129] The sequence of the open reading frame encoding the chimeric receptor can be obtained from genomic DNA sources, cDNA sources, or can be synthesized (e.g., via PCR), or combinations thereof. Depending on the size of the genomic DNA and the number of introns, it may be desirable to use cDNA or a combination thereof, since introns have been shown to stabilize mRNA. It may also be further advantageous to stabilize the mRNA using endogenous or exogenous non-coding regions.

[0130] It is assumed that chimeric construct can be introduced into immune cells as naked DNA or in a suitable vector.Methods for stably transfecting cells by electroporation using naked DNA are known in the art.See, for example, U.S. Patent No. 6,410,319.Naked DNA generally refers to the DNA encoding chimeric receptor that is contained in a plasmid expression vector in a suitable direction for expression.

[0131] Alternatively, the chimeric construct can be introduced into immune cells using a viral vector (e.g., retroviral vector, adenoviral vector, adeno-associated viral vector, or lentiviral vector).The vector suitable for use according to the method of the present disclosure is a suitable vector that is non-replicative in immune cells.Many virus-based vectors are known, in which the copy number of the virus that is maintained in cells is low enough to maintain cell viability, such as HIV, SV40, EBV, HSV, or BPV-based vectors.

[0132] In some aspects, the antigen-specific binding or recognition component is linked to one or more transmembrane and intracellular signaling domains.In some embodiments, the CAR comprises a transmembrane domain fused with the extracellular domain of the CAR.In one embodiment, the transmembrane domain that is naturally associated with one of the domains in the CAR is used.In some examples, the transmembrane domain is selected or modified by amino acid substitution that avoids the binding of such domain with the transmembrane domain of the same or different surface membrane protein to minimize interaction with other members of the receptor complex.

[0133] The transmembrane domain of some embodiments is derived from either natural or synthetic sources. When the source is natural, the domain of some aspects is derived from a membrane-bound or transmembrane protein. Transmembrane regions include those derived from (i.e., at least one or more transmembrane regions of) the alpha, beta, or zeta chain of the T-cell receptor, CD28, CD3 zeta, CD3 epsilon, CD3 gamma, CD3 delta, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, ICOS / CD278, GITR / CD357, NKG2D, and DAP molecules. Alternatively, the transmembrane domain of some embodiments is synthetic. In some aspects, synthetic transmembrane domains mainly include hydrophobic residues, such as leucine and valine. In some aspects, a triplet of phenylalanine, tryptophan and valine is found at each end of the synthetic transmembrane domain.

[0134] In certain embodiments, the platform technology disclosed herein for genetically modifying immune cells such as NK cells includes (i) non-viral gene transfer using an electroporation device (e.g., nucleofector), (ii) CARs that signal via an endodomain (e.g., CD28 / CD3-ζ, CD137 / CD3-ζ, or other combinations), (iii) CARs with variable length extracellular domains connecting the antigen recognition domain with the cell surface, and, in some examples, (iv) K562-derived artificial antigen presenting cells (aAPCs) that can robustly and numerically expand CARsup+ immune cells (Singh et al., 2008; Singh et al., 2011).

[0135] BT cell receptor (TCR) In some embodiments, engineered antigen receptors include recombinant TCRs and / or TCRs cloned from naturally occurring T cells. "T cell receptor" or "TCR" refers to a molecule that contains variable a and β chains (known as TCRα and TCRβ, respectively) or variable γ and δ chains (also known as TCRγ and TCRδ, respectively) and can specifically bind to an antigenic peptide bound to an MHC receptor. In some embodiments, the TCR is of the αβ type.

[0136] Generally, TCRs, which exist in αβ and γδ types, are generally structurally similar, although the T cells expressing them may have different anatomical locations or functions. TCRs can be found on the surface of cells or in soluble form. Generally, TCRs are found on the surface of T cells (or T lymphocytes), where they are generally responsible for the recognition of antigens bound to major histocompatibility complex (MHC) molecules. In some embodiments, TCRs may also include a constant domain, a transmembrane domain, and / or a short cytoplasmic tail (see, e.g., Janeway et al., 1997). For example, in some aspects, each chain of a TCR may have one N-terminal immunoglobulin variable domain, one immunoglobulin constant domain, a transmembrane region, and a short cytoplasmic tail at the C-terminus. In some embodiments, TCRs are associated with invariant proteins of the CD3 complex, which are involved in mediating signal transduction. Unless otherwise specified, the term "TCR" should be understood to encompass functional TCR fragments thereof. The term also encompasses intact or full-length TCRs, including TCRs of the αβ or γδ types.

[0137] Thus, in this specification, reference to a TCR includes any TCR or functional fragment, such as an antigen-binding portion of a TCR that binds to a specific antigenic peptide bound to an MHC molecule, i.e., an MHC-peptide complex. An "antigen-binding portion" or "antigen-binding fragment" of a TCR, which may be used interchangeably, refers to a molecule that includes a portion of the structural domain of a TCR but binds to the antigen that the complete TCR binds (e.g., an MHC-peptide complex). In some cases, the antigen-binding portion includes sufficient variable domains of the TCR, such as the variable a chain and variable β chain of the TCR, to form a binding site for binding to a specific MHC-peptide complex, such as each chain typically including three complementarity determining regions.

[0138] In some embodiments, the variable domains of the TCR chains combine to form immunoglobulin-like loops or complementarity determining regions (CDRs) that form the binding site of the TCR molecule and thus confer antigen recognition and determine peptide specificity. Generally, like immunoglobulins, the CDRs are separated by framework regions (FRs) (see, for example, Jores et al., 1990; Chothia et al., 1988; Lefranc et al., 2003). In some embodiments, CDR3 is the main CDR responsible for recognition of processed antigens, but CDR1 of the alpha chain has also been shown to interact with the N-terminal portion of antigenic peptides, while CDR1 of the beta chain interacts with the C-terminal portion of peptides. CDR2 is believed to recognize MHC molecules. In some embodiments, the variable region of the beta chain can include an additional hypervariable (HV4) region.

[0139] In some embodiments, the TCR chains include constant domains. For example, like immunoglobulins, the extracellular portion of a TCR chain (e.g., a chain, β chain) can include two immunoglobulin domains, an N-terminal variable domain (e.g., Va or Vp; generally, amino acids 1-116 according to Kabat numbering; Kabat et al., "Sequences of Proteins of Immunological Interest," US Dept. Health and Human Services, Public Health Service National Institutes of Health, 1991, 5th ed.) and one constant domain adjacent to the cell membrane (e.g., a chain constant domain or Ca, generally amino acids 117-259 according to Kabat; β chain constant domain or CP, generally amino acids 117-295 according to Kabat). For example, in some instances, the extracellular portion of the TCR formed by the two chains includes two membrane-proximal constant domains and two membrane-distal variable domains that include the CDRs. The constant domain of the TCR domain contains a short connector sequence in which cysteine ​​residues form disulfide bonds linking the two chains, in some embodiments the TCR may have an additional cysteine ​​residue in each of the α and β chains such that the TCR contains two disulfide bonds in the constant domain.

[0140] In some embodiments, the TCR chain can include a transmembrane domain. In some embodiments, the transmembrane domain is positively charged. In some cases, the TCR chain includes a cytoplasmic tail. In some cases, this structure allows the TCR to associate with other molecules, such as CD3. For example, a TCR that includes a constant domain with a transmembrane region can anchor the protein to the cell membrane and associate with the invariant subunit of the CD3 signaling apparatus or complex.

[0141] Generally, CD3 is a multiprotein complex that can have three different chains (γ, δ, and ε) and a ζ chain in mammals. For example, in mammals, the complex can contain a homodimer of CD3γ, CD3δ, two CD3ε chains, and a CD3ζ chain. CD3γ, CD3δ, and CD3ε chains are highly related cell surface proteins of the immunoglobulin superfamily that contain a single immunoglobulin domain. The transmembrane regions of CD3γ, CD3δ, and CD3ε chains are negatively charged. This is a property that allows these chains to associate with the positively charged T cell receptor chains. The intracellular tails of CD3γ, CD3δ, and CD3ε chains each contain one conserved motif known as an immunoreceptor tyrosine-based activation motif or ITAM, while each CD3ζ chain has three. Generally, ITAMs are involved in the signaling capacity of the TCR complex. These accessory molecules have negatively charged transmembrane regions and play a role in propagating signals from the TCR to the cell.

[0142] In some embodiments, the TCR may be a heterodimer of two chains, α and β (or optionally γ and δ), or it may be a single chain TCR construct. In some embodiments, the TCR is a heterodimer, for example, comprising two separate chains (α and β chains or γ and δ chains) linked by one or more disulfide bonds. In some embodiments, the TCR for a target antigen (e.g., a cancer antigen) is identified and introduced into a cell. In some embodiments, a nucleic acid encoding the TCR can be obtained from a variety of sources, such as by polymerase chain reaction (PCR) amplification of a published DNA sequence of a TCR. In some embodiments, the TCR is obtained from a biological source, such as a cell, such as a T cell (e.g., a cytotoxic T cell), a T cell hybridoma, or other published source. In some embodiments, the T cell can be obtained from an in vivo isolated cell. In some embodiments, a high affinity T cell clone can be isolated from a patient and the TCR isolated. In some embodiments, the T cell can be a cultured T cell hybridoma or clone. In some embodiments, the TCR clone for the target antigen is one generated in a transgenic mouse engineered with human immune system genes (e.g., human leukocyte antigen system, or HLA). See, for example, tumor antigens (see, e.g., Parkhurst et al., 2009 and Cohen et al., 2005). In some embodiments, phage display is used to isolate a TCR for the target antigen (see, e.g., Varela-Rohena et al., 2008 and Li, 2005). In some embodiments, the TCR or antigen-binding portion thereof can be synthetically generated from knowledge of the sequence of the TCR.

[0143] C. Antigen In a specific case, immune cells derived from the selected cord blood unit(s) are engineered to express antigen-targeting proteins, such as, for example, antigen-targeting receptors. In a specific case, the receptors are engineered to include chimeric components from different sources. Among the antigens targeted by the engineered antigen receptors are those expressed in association with the disease, condition, or cell type to be targeted via adoptive cell therapy. Among such diseases and conditions are proliferative, neoplastic, and malignant diseases and disorders, including various cancers and tumors, including hematological cancers, cancers of the immune system (e.g., lymphomas, leukemias, and / or myelomas, such as, for example, B, T, and myeloid leukemias, lymphomas, and multiple myelomas). In some embodiments, the antigen is selectively expressed or overexpressed on the surface of disease or condition cells, e.g., on the surface of tumor or pathogenic cells, when compared to normal or non-targeted cells or tissues. In other embodiments, the antigen is expressed on the surface of normal cells and / or on the surface of engineered cells.

[0144] Any suitable antigen may find use in the methods of the present invention. Exemplary antigens include, but are not limited to, antigenic molecules from infectious pathogens, self / autogenous antigens, tumor / cancer-associated antigens, and neo-antigens of tumors (Linnemann et al., 2015). In certain aspects, antigens include NY-ESO, EGFRvIII, Muc-1, Her2, CA-125, WT-1, Mage-A3, Mage-A4, Mage-A10, TRAIL / DR4, and CEA. In certain aspects, antigens for two or more antigen receptors include, but are not limited to, CD19, EBNA, WT1, CD123, NY-ESO, EGFRvIII, MUC1, HER2, CA-125, WT1, Mage-A3, Mage-A4, Mage-A10, TRAIL / DR4, and / or CEA. Sequences for these antigens are known in the art: e.g., CD19 (Accession No. NG_007275.1), EBNA (Accession No. NG_002392.2), WT1 (Accession No. NG_009272.1), CD123 (Accession No. NC_000023.11), NY-ESO (Accession No. NC_000023.11), EGFRvIII (Accession No. NG_007726.3), MUC1 (Accession No. NG_029383.1), HER2 (accession number NG_007503.1), CA-125 (accession number NG_055257.1), WT1 (accession number NG_009272.1), Mage-A3 (accession number NG_013244.1), Mage-A4 (accession number NG_013245.1), Mage-A10 (accession number NC_000023.11), TRAIL / DR4 (accession number NC_000003.12) and / or CEA (accession number NC_000019.10).

[0145] Tumor-associated antigens may be derived from various cancers, such as prostate, breast, colorectal, lung, pancreatic, renal, mesothelioma, ovarian or melanoma. Exemplary tumor-associated antigens or tumor cell-derived antigens include MAGE1, 3 and MAGE4 (or other MAGE antigens, such as the MAGE antigens disclosed in International Patent Application Publication No. WO99 / 40188); PRAME; BAGE; RAGE, Lage (also known as NY ESO 1); SAGE; and HAGE or GAGE. These non-limiting examples of tumor antigens are expressed in a wide variety of tumor types, such as melanoma, lung cancer, sarcoma and bladder cancer. See, for example, U.S. Patent No. 6,544,518. Tumor-associated antigens of prostate cancer include, for example, prostate-specific membrane antigen (PSMA), prostate-specific antigen (PSA), prostatic acid phosphatase, NKX3.1, and six-transmembrane epithelial antigen of the prostate (STEAP).

[0146] Other tumor-associated antigens include Plu-1, HASH-1, HasH-2, Cripto and Criptin. In addition, tumor antigens may be their own peptide hormones, such as full-length gonadotropin hormone releasing hormone (GnRH), a short 10 amino acid long peptide, which are useful in the treatment of many cancers.

[0147] Tumor antigens include tumor antigens derived from cancers characterized by expression of tumor-associated antigens (e.g., HER-2 / neu expression, etc.). Tumor-associated antigens of interest include lineage-specific tumor antigens, such as melanocyte-melanoma lineage antigens MART-1 / Melan-A, gp100, gp75, mda-7, tyrosinase and tyrosinase-related proteins, etc. Exemplary tumor-associated antigens include, but are not limited to, tumor antigens derived from or including any one or more of the following: p53, Ras, c-Myc, cytoplasmic serine / threonine kinases (e.g., A-Raf, B-Raf and C-Raf, cyclin-dependent kinases), MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A20, MAGE-A22, MAGE-A24, MAGE-A26, MAGE-A28, MAGE-A29, MAGE-A30, MAGE-A31, MAGE-A32, MAGE-A33, MAGE-A34, MAGE-A35, MAGE-A36, MAGE-A37, MAGE-A38, MAGE-A3 ...9, MAGE-A39, MAGE-A39, MAGE-A39, MAGE-A39, MAGE-A39, MAGE-A39, MAGE-A39, MAGE-A39, MAGE-A39, MAGE-A39, MAGE-A39, MAGE-A AGE-A12, MART-1, BAGE, DAM-6, DAM-10, GAGE-1, GAGE-2, GAGE-8, GAGE-3, GAGE-4, GAGE-5, GAGE-6, GAGE-7B, NA88-A, MART-1, MC1R, Gp100, PSA, PSM, tyrosinase, TRP-1, TRP-2, ART-4, CAMEL, CEA, Cyp-B, hTERT, hTRT, iCE, MUC1, MUC2, phosphoinositide 3-kinase (PI3 K), TRK receptor, PRAME, P15, RU1, RU2, SART-1, SART-3, Wilms tumor antigen (WT1), AFP, -catenin / m, caspase-8 / m, CEA, CDK-4 / m, ELF2M, GnT-V, G250, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin II, CDC27 / m, TPI / mbcr-abl, BCR-ABL, interferon regulatory factor 4 (IRF4), ETV6 / AML, LDLR / FUT, Pml / RAR, tumor-associated calcium signaling factor 1 (TACSTD1) TACSTD2, receptor tyrosine kinases (e.g., epidermal growth factor receptor (EGFR) (especially EGFRvIII), platelet-derived growth factor receptor (PDGFR), vascular endothelial growth factor receptor (VEGFR)), cytoplasmic tyrosine kinases (e.g., src family,syk-ZAP70 family), integrin-linked kinase (ILK), signal transducer and activator of transcription STAT3, STATS, and STATE, hypoxia-inducible factors (e.g., HIF-1 and HIF-2), nuclear factor-kappa B (NF-B), Notch receptors (e.g., Notch1-4), c-Met, mammalian target of rapamycin (mTOR), WNT, extracellular signal-regulated kinase (ERK) and its regulatory subunits, PMSA, PR-3, MDM2, mesothelin, renal cell carcinoma-5T4, SM22-alpha, carbonic anhydrase I (CAI) and IX (CAIX) (also known as G250), STEAD, TEL / AML1, GD2, proteinase 3, hTERT, sarcoma metastasis breakpoint, EphA2, ML-IAP, EpCA M, ERG (fusion gene between TMPRSS2 and ETS), NA17, PAX3, ALK, androgen receptor, cyclin B1, polysialic acid, MYCN, RhoC, GD3, fucosyl GM1, mesothelial, PSCA, sLe, PLAC1, GM3, BORIS, Tn, GLoboH, NY-BR-1, RGsS, SART3, STn, PAX5, OY-TES1, sperm protein 1 7, LCK, HMWMAA, AKAP-4, SSX2, XAGE1, B7H3, legumain, TIE2, Page4, MAD-CT-1, FAP, MAD-CT-2, fos-related antigen 1, CBX2, CLDN6, SPANX, TPTE, ACTL8, ANKRD30A, CDKN2A, MAD2L1, CTAGiB, SUNC1, LRRN1 and idiotype.

[0148] Antigens include epitope regions or epitope peptides derived from genes that are mutated or differentially transcribed in tumor cells compared to normal cells, such as telomerase enzyme, survivin, mesothelin, mutated ras, bcr / abl rearrangements, Her 2 / neu, mutated or wild-type p53, cytochrome P450 1B1, and aberrantly expressed intronic sequences (such as N-acetylglucosaminyltransferase V); clonal rearrangements of immunoglobulin genes that generate unique idiotypes in myelomas and B-cell lymphomas; tumor antigens that contain epitope regions or epitope peptides derived from oncoviral processes, such as human papillomavirus proteins E6 and E7; Epstein-Barr virus protein LMP2; and non-mutated oncofetal proteins with tumor-selective expression, such as carcinoembryonic antigen and alpha-fetoprotein.

[0149] In other embodiments, antigens are obtained or derived from pathogenic or opportunistic pathogenic microorganisms (also referred to herein as infectious disease microorganisms), such as viruses, fungi, parasites, and bacteria, etc. In certain embodiments, antigens derived from such microorganisms include full-length proteins.

[0150] Exemplary pathogenic organisms whose antigens are contemplated for use in the methods described herein include coronaviruses of all types, including SARS-CoV and SARS-CoV2, human immunodeficiency virus (HIV), herpes simplex virus (HSV), respiratory syncytial virus (RSV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), influenza types A, B and C, vesicular stomatitis virus (VSV), polyomaviruses (e.g., BK virus and JC virus), adenovirus, Staphylococcus spp., including methicillin-resistant Staphylococcus aureus (MRSA), and Streptococcus spp., including Streptococcus pneumoniae. As will be understood by one of skill in the art, proteins from these and other pathogenic microorganisms for use as antigens as described herein, as well as the nucleotide sequences encoding such proteins, may be identified in publications and in public databases, such as, for example, GENBANK®, SWISS-PROT®, and TREMBL®.

[0151] Antigens derived from Human Immunodeficiency Virus (HIV) include HIV virion structural proteins (e.g., gp120, gp41, p17, p24), protease, reverse transcriptase, or any of the HIV proteins encoded by tat, rev, nef, vif, vpr, and vpu.

[0152] Antigens derived from herpes simplex viruses (e.g., HSV1 and HSV2) include, but are not limited to, proteins expressed from HSV late genes. The late gene group primarily codes for proteins that form virion particles. Such proteins include the five proteins (UL) that form the viral capsid (UL6, UL18, UL35, UL38 and the major capsid protein UL19), UL45, and UL27, each of which may be used as an antigen as described herein. Other exemplary HSV proteins contemplated for use as antigens herein include the ICP27 (H1, H2), glycoprotein B (gB) and glycoprotein D (gD) proteins. The HSV genome contains at least 74 genes, each of which codes for a protein that may potentially be used as an antigen.

[0153] Antigens derived from cytomegalovirus (CMV) include CMV structural proteins, viral antigens expressed during the immediate early and early stages of viral replication, glycoprotein I and glycoprotein III, capsid proteins, coat proteins, lower matrix proteins pp65 (ppUL83), p52 (ppUL44), IE1 and IE2 (UL123 and UL122), protein products from the gene cluster from UL128-UL150 (Rykman et al., 2006), envelope glycoproteins B (gB), gH, gN, and pp150. As will be appreciated by those of skill in the art, CMV proteins for use as antigens as described herein may be identified in public databases, such as, for example, GENBANK®, SWISS-PROT®, and TREMBL® (see, for example, Bennekov et al. (2004), Loewendorf et al. (2010), Marschall et al. (2009)).

[0154] Antigens derived from Epstein-Ban virus (EBV) contemplated for use in certain embodiments include EBV lytic proteins gp350 and gp110, EBV proteins produced during latent cycle infection including EBV nuclear antigen (EBNA)-1, EBNA-2, EBNA-3A, EBNA-3B, EBNA-3C, EBNA leader protein (EBNA-LP), and latent membrane protein (LMP)-1, LMP-2A, and LMP-2B (see, e.g., Lockey et al., 2008).

[0155] Antigens from respiratory syncytial virus (RSV) contemplated for use herein include any of 11 proteins, or antigenic fragments thereof, encoded by the RSV genome: NS1, NS2, N (nucleocapsid protein), M (matrix protein) SH, G and F (viral coat proteins), M2 (second matrix protein), M2-1 (elongation factor), M2-2 (transcriptional regulation), RNA polymerase, and phosphoprotein P.

[0156] Antigens derived from vesicular stomatitis virus (VSV) contemplated for use include any one of the five major proteins encoded by the VSV genome, and antigenic fragments thereof: the large protein (L), glycoprotein (G), nucleoprotein (N), phosphoprotein (P) and matrix protein (M) (see, e.g., Rieder et al., 1999).

[0157] Antigens derived from influenza virus contemplated for use in certain embodiments include hemagglutinin (HA), neuraminidase (NA), nucleoprotein (NP), matrix proteins M1 and M2, NS1, NS2 (NEP), PA, PB1, PB1-F2, and PB2.

[0158] Exemplary viral antigens also include adenovirus polypeptides, alphavirus polypeptides, calicivirus polypeptides (e.g., calicivirus capsid antigen), coronavirus polypeptides, distemper virus polypeptides, Ebola virus polypeptides, enterovirus polypeptides, flavivirus polypeptides, hepatitis virus (AE) polypeptides (including hepatitis B core or surface antigen, hepatitis C virus E1 or E2 glycoproteins, core or nonstructural proteins), herpesvirus polypeptides (including herpes simplex or varicella zoster virus glycoproteins), infectious peritonitis virus polypeptides, leukemia virus polypeptides, These include, but are not limited to, Marburg virus polypeptides, orthomyxovirus polypeptides, papillomavirus polypeptides, parainfluenza virus polypeptides (e.g., hemagglutinin and neuraminidase polypeptides), paramyxovirus polypeptides, parvovirus polypeptides, pestivirus polypeptides, picornavirus polypeptides (e.g., poliovirus capsid polypeptides), poxvirus polypeptides (e.g., vaccinia virus polypeptides), rabies virus polypeptides (e.g., rabies virus glycoprotein G), reovirus polypeptides, retrovirus polypeptides, and rotavirus polypeptides.

[0159] In certain embodiments, the antigen may be a bacterial antigen. In certain embodiments, the bacterial antigen of interest may be a secreted polypeptide. In other certain embodiments, the bacterial antigen includes an antigen in which a portion (or portions) of the polypeptide is exposed on the outer cell surface of the bacteria.

[0160] Antigens from Staphylococcus species, including methicillin-resistant Staphylococcus aureus (MRSA), contemplated for use include various virulence regulators, such as the Agr system, Sar and Sae, the Arl system, Sar homologs (Rot, MgrA, SarS, SarR, SarT, SarU, SarV, SarX, SarZ and TcaR), the Srr system and TRAP. Other Staphylococcus proteins that may serve as antigens include Clp proteins, HtrA, MsrR, aconitase, CcpA, SvrA, Msa, CfvA and CfvB (see, e.g., Staphylococcus: Molecular Genetics (2008, Caister Academic Press, editor: Jodi Lindsay)). The genomes for two species of Staphylococcus aureus (N315 and Mu50) have been sequenced and are publicly available, for example, in PATRIC (PATRIC: The VBI PathoSystems Resource Integration Center, Snyder et al., 2007). As will be appreciated by those skilled in the art, staphylococcal proteins for use as antigens may also be identified in other public databases, such as, for example, GenBank®, Swiss-Prot® and TrEMBL®.

[0161] Antigens from Streptococcus pneumoniae contemplated for use in certain embodiments described herein include pneumolysin, PspA, choline-binding protein A (CbpA), NanA, NanB, SpnHL, PavA, LytA, Pht, and pilin proteins (RrgA; RrgB; RrgC). Antigenic proteins of Streptococcus pneumoniae are also known in the art and may be used as antigens in some embodiments (see, e.g., Zysk et al. (2000)). The complete genome sequence of a virulent strain of Streptococcus pneumoniae has been sequenced, and as will be appreciated by those of skill in the art, S. pneumoniae proteins for use herein may also be identified in other public databases, such as, for example, GENBANK®, SWISS-PROT®, and TREMBL®. Proteins of particular interest for antigens according to the present disclosure include virulence factors and proteins predicted to be exposed on the surface of streptococci (see, for example, Frolet et al. (2010)).

[0162] Examples of bacterial antigens that can be used as antigens include Actinomyces polypeptides, Bacillus polypeptides, Bacteroides polypeptides, Bordetella polypeptides, Bartonella polypeptides, Borrelia polypeptides (e.g., OspA of B. burgdorferi), Brucella polypeptides, Campylobacter polypeptides, Capnocytophaga polypeptides, Chlamydia polypeptides, Corynebacterium polypeptides, Coxiella polypeptides, Dermatophilus polypeptides, Enterococcus polypeptides, Ehrlichia polypeptides, Escherichia polypeptides, Francisella polypeptides, Fuso polypeptides, and the like. Fusobacterium polypeptides, Haemobartonella polypeptides, Haemophilus polypeptides (e.g., outer membrane proteins of type b H. influenzae), Helicobacter polypeptides, Klebsiella polypeptides, L-type bacteria polypeptides, Leptospira polypeptides, Listeria polypeptides, Mycobacteria polypeptides, Mycoplasma polypeptides, Neisseria polypeptides, Neorickettsia polypeptides, Nocardia polypeptides, Pasteurella polypeptides, Peptococcus polypeptides, Peptostreptococcus polypeptides, Pneumococcus polypeptides (i.e., S.pneumoniae polypeptides) (see description herein), Proteus polypeptides, Pseudomonas polypeptides, Rickettsia polypeptides, Rochalimaea polypeptides, Salmonella polypeptides, Shigella polypeptides, Staphylococcus polypeptides, Group A Streptococcus polypeptides (e.g., the M protein of S. pyogenes), Group B Streptococcus (S. agalactiae) polypeptides, Treponema polypeptides, and Yersinia polypeptides (e.g., the F1 and V antigens of Y pestis).

[0163] Examples of fungal antigens include Absidia polypeptides, Acremonium polypeptides, Alternaria polypeptides, Aspergillus polypeptides, Basidiobolus polypeptides, Bipolaris polypeptides, Blastomyces polypeptides, Candida polypeptides, Coccidioides polypeptides, Conidiobolus polypeptides, Cryptococcus polypeptides, Curvalaria polypeptides, Epidermophyton polypeptides, Exophiala polypeptides, Geotrichum polypeptides, Histoplasma polypeptides, Madurella polypeptides, Malassezia polypeptides, Microsporum polypeptides, ) polypeptides, Moniliella polypeptides, Mortierella polypeptides, Mucor polypeptides, Paecilomyces polypeptides, Penicillium polypeptides, Phialemonium polypeptides, Phialophora polypeptides, Prototheca polypeptides, Pseudallescheria polypeptides, Pseudomicrodochium polypeptides, Pythium polypeptides, Rhinosporidium polypeptides, Rhizopus polypeptides, Scolecobasidium polypeptides, Sporothrix polypeptides, Stemphylium polypeptides, Trichophyton polypeptides, Trichosporon polypeptides,and Xylohypha polypeptides, but are not limited to.

[0164] Examples of protozoan parasite antigens include, but are not limited to, Babesia polypeptides, Balantidium polypeptides, Besnoitia polypeptides, Cryptosporidium polypeptides, Eimeria polypeptides, Encephalitozoon polypeptides, Entamoeba polypeptides, Giardia polypeptides, Hammondia polypeptides, Hepatozoon polypeptides, Isospora polypeptides, Leishmania polypeptides, Microsporidia polypeptides, Neospora polypeptides, Nosema polypeptides, Pentatrichomonas polypeptides, Plasmodium polypeptides. Examples of helminth parasite antigens include Acanthocheilonema polypeptides, Aelurostrongylus polypeptides, Ancylostoma polypeptides, Angiostrongylus polypeptides, Ascaris polypeptides, Brugia polypeptides, Bunostomum polypeptides, Capillaria polypeptides, Chabertia polypeptides, Cooperia polypeptides, Ptides, Crenosoma polypeptides, Dictyocaulus polypeptides, Dioctophyme polypeptides, Dipetalonema polypeptides, Diphyllobothrium polypeptides, Diplydium polypeptides, Dirofilaria polypeptides, Dracunculus polypeptides, Enterobius polypeptides, Filaroides polypeptides,Haemonchus Polypeptide, Lagochilascaris Polypeptide, Loa Polypeptide, Mansonella Polypeptide, Muellerius Polypeptide, Nanophyetus Polypeptide, Necator Polypeptide, Nematodirus Polypeptide, Oesophagostomum Polypeptide, Onchocerca Polypeptide, Opisthorchis Polypeptide, Ostertagia Polypeptide, Parafilaria Polypeptide, Paragonimus Polypeptide, Paraascaris Polypeptide, Physaloptera Polypeptide, Protostrongyl us polypeptides, Setaria polypeptides, Spirocerca polypeptides, Spirometra polypeptides, Stephanofilaria polypeptides, Strongyloides polypeptides, Strongylus polypeptides, Thelazia polypeptides, Toxascaris polypeptides, Toxocara polypeptides, Trichinella polypeptides, Trichostrongylus polypeptides, Trichuris polypeptides, Uncinaria polypeptides, and Wuchereria polypeptides, (e.g., circumsporozoite (PfCSP) of P. falciparum), sporozoite surface protein 2 (PfSSP2), carboxyl terminus of liver status antigen 1 (PfLSA1 c-term), and export protein 1 (PfExp-1), Pneumocystis polypeptide, Sarcocystis polypeptide, Schistosoma polypeptide,These include, but are not limited to, Theileria polypeptides, Toxoplasma polypeptides, and Trypanosoma polypeptides.

[0165] Examples of ectoparasite antigens include, but are not limited to, polypeptides (including antigens, as well as allergens) from fleas; ticks (including hard mites and ulcerative mites); flies (such as midges), mosquitoes, sand flies, black flies, bot flies, horn flies, deer flies, tsetse flies, stable flies, myiasis flies, and biting gnats; ants, spiders, lice; mites; and hemipteran insects (such as bedbugs and assassin bugs).

[0166] D. Cytokines In some cases, immune cells derived from the selected cord blood unit(s) are engineered to express one or more cytokines, including one or more heterologous cytokines. The cytokines may be of any type, but in specific embodiments, the heterologous cytokine(s) is / are selected from the group consisting of IL-4, IL-10, IL-7, IL-2, IL-15, IL-12, IL-18, IL-21, and combinations thereof.

[0167] In a specific embodiment, the cytokine is IL-15. IL-15 is tissue-restricted and is found in serum or systemically at any level only under pathological conditions. IL-15 has several desirable attributes for adoptive therapy. IL-15 is a homeostatic cytokine that induces natural killer cell development and cell proliferation, promotes the eradication of established tumors by relieving the functional suppression of tumor-resident cells, and inhibits AICD.

[0168] In one embodiment, the present disclosure relates to co-modifying CAR-expressing immune cells and / or TCR immune cells with one or more cytokines, including IL-15. In addition to IL-15, other cytokines are envisioned. These include, but are not limited to, cytokines, chemokines and other molecules that contribute to the activation and proliferation of cells used for human applications. NK cells or T cells that express IL-15 can perform uninterrupted supportive cytokine signaling, which is crucial for their survival after infusion.

[0169] E. Suicide gene The immune cells of the present disclosure derived from the umbilical cord blood unit(s) may contain one or more suicide genes. The term "suicide gene" as used herein is defined as a gene that causes the transfer of its gene product to a compound that kills its host cell when a prodrug is administered. Examples of suicide gene / prodrug combinations that can be used include herpes simplex virus-thymidine kinase (HSV-tk) and ganciclovir, acyclovir or FIAU; oxidoreductase and cycloheximide; cytosine deaminase and 5-fluorocytosine; thymidine kinase thymidylate kinase (Tdk::Tmk) and AZT; and deoxycytidine kinase and cytosine arabinoside.

[0170] Purine nucleoside phosphorylase from E. coli, a so-called suicide gene that converts the prodrug 6-methylpurine deoxyriboside into the toxic purine 6-methylpurine. Other examples of suicide genes used with prodrug therapy include the cytosine deaminase gene from E. coli and the thymidine kinase gene from HSV.

[0171] Exemplary suicide genes include CD20, CD52, EGFRv3, or inducible caspase 9. In one embodiment, a truncated form of EGFR variant III (EGFRv3) may be used as a suicide antigen that can be removed by cetuximab. Additional suicide genes known in the art that can be used in the present disclosure include purine nucleoside phosphorylase (PNP), cytochrome p450 enzymes (CYP), carboxypeptidase (CP), carboxylesterase (CE), nitroreductase (NTR), guanine ribosyltransferase (XGRTP), glycosidase enzymes, methionine-alpha, gamma-lyase (MET), and thymidine phosphorylase (TP).

[0172] F. Gene Disruption In some embodiments, immune cells are engineered to have the disruption of the expression of one or more endogenous genes.Disruption can be knockout or knockdown in specific cases.Disruption can be caused in cells by any suitable method, including CRISPR, antisense technology (such as RNAi, siRNA, shRNA, and / or ribozyme, which generally cause a transient reduction in expression), as well as gene editing technology that causes the inactivation or destruction of targeted genes, for example, by inducing cleavage and / or homologous recombination.

[0173] In certain cases, one or more endogenous genes of immune cells are modified, for example, disrupted in expression, in this case expression is partially or completely reduced.In specific cases, one or more genes are knocked down or knocked out.In specific cases, multiple genes are knocked down or knocked out in the same step or multiple steps.The gene that is edited in immune cells can be of any kind.In specific cases, the gene that is edited in immune cells allows immune cells to work more effectively in tumor microenvironment. In a specific case, the gene is one or more of NKG2A, SIGLEC-7, LAG3, TIM3, CISH, FOXO1, TGFBR2, TIGIT, CD96, ADORA2, NR3C1, PD1, PDL-1, PDL-2, CD47, SIRPA, SHIP1, ADAM17, RPS6, 4EBP1, CD25, CD40, IL21R, ICAM1, CD95, CD80, CD86, IL10R, TDAG8, CD5, CD7, SLAMF7, CD38, LAG3, TCR, beta2-microglubulin, HLA, CD73 and CD39.In a specific embodiment, the endogenous gene that is disrupted by CRISPR is TIGIT, and in a specific case, the gRNA that is utilized for this is GACAGGCACAATAGAAACAA (SEQ ID NO: 1). In some embodiments, the endogenous gene edited by CRISPR is CD38, and in specific cases, the gRNA utilized for this purpose is TGAGTTCCCAACTTCATTAG (SEQ ID NO: 2) and / or GCGGGACATGTTCACCCTGG (SEQ ID NO: 3).

[0174] V. How to use Once the cord blood unit(s) are selected, the immune cells derived therefrom may or may not be engineered and may or may not be stored. In any case, with or without immune cell manipulation, therapeutically effective immune cells may be delivered to an individual in need thereof. The immune cells are particularly effective because they are derived from cord blood unit(s) selected for the express reason that they meet one or more selection criteria, as described herein.

[0175] In some embodiments, the present disclosure provides a method for immunotherapy, comprising administering an effective amount of immune cells produced by the method of the present disclosure. In one embodiment, a medical disease or disorder is treated by the transfer of immune cell populations that induce an immune response. In certain embodiments of the present disclosure, cancer or infectious disease is treated by the transfer of the generated immune cell populations that induce an immune response. Provided herein is a method for treating cancer in an individual or for slowing the progression of cancer in an individual, comprising administering an effective amount of antigen-specific cell therapy to the individual. The method may be applied to treat immune disorders, solid cancers, hematological cancers, and viral infections.

[0176] The tumors for which the present treatment method is useful include any malignant cell type, such as those found in solid tumors or hematological malignancies.Exemplary solid tumors may include, but are not limited to, tumors of organs selected from the group consisting of pancreas, colon, appendix, stomach, brain, head, neck, ovary, kidney, larynx, sarcoma, lung, bladder, melanoma, prostate and breast.Exemplary hematological tumors include bone marrow tumors, T-cell or B-cell malignancies, leukemia, lymphoma, blastoma, myeloma, and the like. Further examples of cancers that can be treated using the methods provided herein include, but are not limited to, lung cancer (including small cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, and squamous cell carcinoma of the lung), cancer of the peritoneum, gastric or stomach cancer (including gastrointestinal and gastrointestinal stromal cancer), pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial or uterine cancer, salivary gland cancer, kidney or renal cancer, prostate cancer, vulvar cancer, thyroid cancer, various types of head and neck cancer, and melanoma.

[0177] The cancer may be of the following histological types, specifically, but not limited to: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant cell and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma. carcinoma);transitional cell carcinoma;papillary transitional cell carcinoma;adenocarcinoma;gastrinoma, malignant;bile duct carcinoma;hepatocellular carcinoma;mixed hepatocellular and bile duct carcinoma;trabecular adenocarcinoma;adenoid cystic carcinoma;adenocarcinoma in adenomatous polyps;adenocarcinoma, familial polyposis coli;solid cancer;carcinoid tumor, malignant;branchio-alveolar adenocarcinoma;papillary adenocarcinoma;chromophobe carcinoma;acidophil carcinoma;oxyphilic adenocarcinoma;basophilic carcinoma;clear cell adenocarcinoma;granular cell carcinoma;follicular adenocarcinoma;papillary follicular adenocarcinoma;nonencapsulated sclerosing carcinoma;adrenal cortical carcinoma;endometrioid carcinoma carcinoma);skin adnexal cancer;apocrine gland carcinoma;sebaceous gland carcinoma;earwax gland carcinoma;mucoepidermoid carcinoma;cyst gland carcinoma;papillary cyst gland carcinoma;papillary serous cyst gland carcinoma;mucinous cyst gland carcinoma;mucinous adenocarcinoma;signet ring cell carcinoma;invasive ductal carcinoma;medullary carcinoma;lobular carcinoma;inflammatory carcinoma;Paget's disease, breast;acinic cell carcinoma;adenosquamous carcinoma;adenocarcinoma with squamous metaplasia;thymoma, malignant;ovarian stromal tumor, malignant;theca cell tumor, malignant;granulosa cell tumor, malignant;androblastoma, malignant;Sertoli cell carcinoma;Leydig cell tumor, malignant;lipid cell tumor, malignant;paraganglioma, malignant;extramammary paraganglioma, malignant;pheochromocytoma;glomus angiosarcoma;malignant melanoma Ranoma;Amelanotic melanoma;Superficial spreading melanoma;Lentigo maligna melanoma;Acral lentigo melanoma;Nodular melanoma;Malignant melanoma in giant pigmented nevus;Epithelioid cell melanoma;Blue nevus, malignant;Sarcoma;Fibrosarcoma;Fibrous histiocytoma, malignant;Myxosarcoma;Liposarcoma;Leiomyosarcoma;Rhabdomyosarcoma;Embryonal rhabdomyosarcoma;Alveolar rhabdomyosarcoma;Stromatous sarcoma;Mixed tumor, malignant;Mullerian mixed tumor;Nephroblastoma;Hepatoblastoma;Carcinosarcoma;Mesenchymoma, malignant;Brenner tumor, malignant;Phyllodes tumor, malignant;Synovial sarcoma;Mesothelioma, malignant;Dysgerminoma;Embryonal carcinoma;Teratoma, malignant;Ovarian goiter, malignant;Choriocarcinoma;Mesonephroma, malignant;Hemangiosarcoma;Hemangioendothelioma, malignant;Kaposi's sarcoma;Hemangiopericytoma, malignant;Lymphangiosarcoma;Osteosarcoma;Parocytic osteosarcoma;Chondrosarcoma;Chondrosarcoma, malignant;Mesenchymal chondrosarcoma;Giant cell tumor of bone;Ewing's sarcoma;Odontogenic tumor, malignant;Ameloblastoma, malignant;Ameloblastoma, malignant;Ameloblastoma fibrosarcoma;Pinealoma, malignant;Chordoma;Glioma, malignant;Ependymoma;Astrocytoma;Protoplasmic astrocytoma;Fibrillary astrocytoma;Astroblastoma;Glioblastoma; Oligodendroglioma;Oligodendroglioma;Anaplastic neuroectodermal;Cerebellar sarcoma;Ganglioneuroblastoma;Neuroblastoma;Retinoblastoma;Olfactory neurogenic tumor;Meningioma, malignant;Neurofibrosarcoma;Neurilemoma, malignant;Granular cell tumor, malignant;Malignant lymphoma;Hodgkin's disease;Hodgkin's;Side granuloma;Malignant lymphoma, small lymphocytic;Malignant lymphoma, large cell, diffuse;Malignant lymphoma, follicular;Mycosis fungoides;Other specified non-Hodgkin's lymphoma; B-cell lymphoma;Low-grade / follicular non-Hodgkin's lymphoma (NHL);Small lymphocytic (SL) NHL;Intermediate-grade / follicular NHL;Intermediate-grade diffuse NHL;High-grade immunoblastic NHL;High-grade lymphoblastic NHL;High-grade small noncleaved cell NHL;Giant mass disease NHL;Mantle cell lymphoma;AIDS-related lymphoma;Waldenstrom's macroglobulinemia;Malignant histiocytoma;Multifocal myeloma tumours;mast cell sarcoma;immunoproliferative small intestinal disease;leukemia;lymphocytic leukemia;plasma cell leukemia;erythroleukemia;lymphoblastic cell leukemia;myeloid leukemia:basophilic leukemia;eosinophilic leukemia;monocytic leukemia;mast cell leukemia;megakaryoblastic leukemia;myeloid sarcoma;hairy cell leukemia;chronic lymphocytic leukemia (CLL);acute lymphoblastic leukemia (ALL);acute myeloid leukemia (AML);and chronic myeloblastic leukemia. ;

[0178] Certain embodiments relate to methods of treating leukemia. Leukemia is a cancer of the blood or bone marrow, characterized by abnormal proliferation (abnormal production by doubling) of blood cells, usually white blood cells (leukocytes). Leukemia is part of a broad group of diseases called hematological neoplasms. Leukemia is a broad term that includes a wide range of diseases. Leukemia is clinically and pathologically divided into its acute and chronic forms.

[0179] In certain embodiments of the present disclosure, immune cells are delivered to an individual in need thereof, such as an individual with cancer or infectious disease. The cells then boost the individual's immune system to attack the respective cancer or pathogenic cells. In some cases, an individual is given one or more doses of immune cells. If an individual is given more than one dose of immune cells, the period between doses must be sufficient to allow time for propagation in the individual, and in specific embodiments, the period between doses is 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days or more.

[0180] Certain embodiments of the present disclosure provide a method for treating or preventing immune-mediated disorders. In one embodiment, the subject has an autoimmune disease. Non-limiting examples of autoimmune diseases include alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune disease of the adrenal gland, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune oophoritis and orchitis, autoimmune thrombocytopenia, Behcet's disease, bullous pemphigoid, cardiomyopathy, celiac spate, and the like. spate-dermatitis, chronic fatigue immune dysfunction syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, cicatricial pemphigoid, CREST syndrome, cold agglutinin disease, Crohn's disease, discoid lupus, essential mixed cryoglobulinemia, fibromyalgia-fibromyositis, glomerulonephritis, Graves' disease, Guillain-Barré, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA neuropathy, juvenile arthritis, lichen planus, lupus erythematosus erthematosus), Meniere's disease, mixed connective tissue disease, multiple sclerosis, type 1 or immune-mediated diabetes mellitus, myasthenia gravis, nephrotic syndrome (e.g. minimal change disease, focal glomerulosclerosis or membranous nephropathy), pemphigus vulgaris, pernicious anemia, polyarteritis nodosa, polychondritis, polyglandular syndrome, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary hepatitis, Autoimmune diseases include cirrhosis, psoriasis, psoriatic arthritis, Raynaud's phenomenon, Reiter's syndrome, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, stiff man syndrome, systemic lupus erythematosus, lupus erythematosus, ulcerative colitis, uveitis, vasculitis (such as polyarteritis nodosa, Takayasu's arteritis, temporal arteritis / giant cell arteritis, or dermatitis herpetiformis vasculitis), vitiligo, and Wegener's granulomatosis.Thus, some examples of autoimmune diseases that can be treated using the methods disclosed herein include, but are not limited to, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, type I diabetes, Crohn's disease; ulcerative colitis, myasthenia gravis, glomerulonephritis, ankylosing spondylitis, vasculitis or psoriasis.Subjects may also have allergic disorders, such as asthma.

[0181] In yet another embodiment, the subject is a recipient of a transplanted organ or stem cells, and immune cells are used to prevent and / or treat rejection. In certain embodiments, the subject has or is at risk of developing graft-versus-host disease. GVHD is a possible complication of any transplant that uses or contains stem cells derived from either related or unrelated donors. There are two types of GVHD: acute and chronic. Acute GVHD appears within the first three months after transplantation. Symptoms of acute GVHD include a reddish skin rash on the hands and feet, with peeling or blistering of the skin, which can spread and become more severe. Acute GVHD can also affect the stomach and intestines, where cramps, nausea, and diarrhea are present. Yellowing of the skin and eyes (jaundice) indicates that the liver is affected by acute GVHD. Chronic GVHD is graded based on its severity: stage / grade 1 is mild and stage / grade 4 is severe. Chronic GVHD develops after 3 months of transplantation. Symptoms of chronic GVHD are similar to those of acute GVHD, but in addition, chronic GVHD may also affect mucous glands in the eye, salivary glands in the mouth, and glands that lubricate the stomach lining and intestines. Any of the populations of immune cells disclosed herein can be utilized. Examples of transplanted organs include solid organ grafts, such as kidney, liver, skin, pancreas, lung and / or heart, or cellular grafts, such as pancreatic islets, hepatocytes, myoblasts, bone marrow, or hematopoietic or other stem cells. The graft can be a composite graft, such as facial tissue. Immune cells can be administered before, at the same time, or after transplantation. In some embodiments, the immune cells are administered prior to the transplant, such as at least 1 hour, at least 12 hours, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, or at least 1 month prior to the transplant.In one specific, non-limiting example, administration of a therapeutically effective amount of immune cells occurs 3-5 days prior to transplantation.

[0182] In some embodiments, the subject may be administered non-myeloablative lymphodepleting chemotherapy prior to immune cell therapy. Non-myeloablative lymphodepleting chemotherapy may be any suitable such therapy that may be administered by any suitable route. Non-myeloablative lymphodepleting chemotherapy may include, for example, administration of cyclophosphamide and fludarabine, especially if the cancer is melanoma (which may be metastatic). An exemplary route for administering cyclophosphamide and fludarabine is intravenously. Similarly, any suitable dose of cyclophosphamide and fludarabine may be administered. In certain aspects, around 60 mg / kg of cyclophosphamide is administered for two days, followed by 25 mg / m 2 Pre- and post-fludarabine is administered over a 5-day period.

[0183] In certain embodiments, a growth factor that promotes the growth and activation of immune cells is administered to the subject either simultaneously with the immune cells or subsequently.The immune cell growth factor can be any suitable growth factor that promotes the growth and activation of immune cells.Examples of suitable immune cell growth factors include IL-2, IL-7, IL-15 and IL-12, which can be used alone or in various combinations, such as IL-2 and IL-7, IL-2 and IL-15, IL-7 and IL-15, IL-2, IL-7 and IL-15, IL-12 and IL-7, IL-12 and IL-15, or IL-12 and IL2.

[0184] Therapeutically effective amounts of immune cells can be administered by a number of routes, including parenteral administration, for example, intravenous, intraperitoneal, intramuscular, intrasternal or intraarticular injection, or by infusion.

[0185] The therapeutically effective amount of immune cells for use in adoptive cell therapy is that amount that achieves the desired effect in the subject being treated.For example, it can be the amount of immune cells that is required to suppress the progression of or cause the regression of an autoimmune disease or an alloimmune disease, or the amount of immune cells that can reduce symptoms caused by an autoimmune disease, such as pain and inflammation.It can be the amount that is required to reduce symptoms associated with inflammation, such as pain, edema, and elevated body temperature.It can also be the amount that is required to reduce or prevent rejection of transplanted organs.

[0186] The immune cell population can be administered in a treatment regimen consistent with the disease, for example, in one or several doses over a period of one to several days to improve the disease state, or in regular doses over a long period of time to suppress disease progression and prevent disease recurrence. The exact dose to be used in the formulation will also depend on the route of administration and the severity of the disease or disorder, and must be determined according to the judgment of the physician and each patient's circumstances. The therapeutically effective amount of immune cells will depend on the subject being treated, the severity and type of affliction, and the mode of administration. In some embodiments, the dose that may be used in the treatment of a human subject is about 1 ml. 2 At least 3.8 × 10 immune cells per 4 Pieces, at least 3.8 x 10 5 Pieces, at least 3.8 x 10 6 Pieces, at least 3.8 x 10 7 Pieces, at least 3.8 x 10 8 Pieces, at least 3.8 x 10 9 pieces, or at least 3.8 × 10 10 In certain embodiments, the dose used in treating a human subject ranges from 1 ml to 100 ml. 2 Approximately 3.8 × 10 immune cells per 9 From 3.8 x 10 10 In a further embodiment, the therapeutically effective amount of immune cells ranges from about 5×106 Approximately 7.5 × 10 cells / kg body weight 8 The number of cells / kg body weight can vary, for example, up to about 2 x 10 cells / kg body weight. 7 Approximately 5 × 10 cells 8 up to 10 cells or approximately 5 x 10 cells per kg of body weight 7 Approximately 2 x 10 cells 8 The amount of immune cells can vary from up to 100 cells. The exact amount of immune cells can be easily determined by those skilled in the art based on the age, weight, sex and physiological condition of the subject. Effective doses can be extrapolated from dose-response curves derived from in vitro or animal model test systems.

[0187] The immune cells may be administered in combination with one or more other therapeutic agents for treating an immune-mediated disorder. The combination therapy may include, but is not limited to, one or more antibacterial agents (e.g., antibiotics, antiviral agents, and antifungal agents), antitumor agents (e.g., fluorouracil, methotrexate, paclitaxel, fludarabine, etoposide, doxorubicin, or vincristine), immunodepleting agents (e.g., fludarabine, etoposide, doxorubicin, or vincristine), immunosuppressants (e.g., azathioprine, or glucocorticoids such as dexamethasone or prednisone), anti-inflammatory agents (e.g., glucocorticoids such as hydrocortisone, dexamethasone, or prednisone, or nonsteroidal anti-inflammatory agents such as acetylsalicylic acid, ibuprofen, or naproxen sodium), cytokines (e.g., interleukin-10 or transforming growth factor beta), hormones (e.g., estrogen), or vaccines. In addition, various immunosuppressive or tolerogenic agents can be administered, including, but not limited to, calcineurin inhibitors (e.g., cyclosporine and tacrolimus), mTOR inhibitors (e.g., rapamycin), mycophenolate mofetil, antibodies (e.g., antibodies that recognize CD3, CD4, CD40, CD154, CD45, IVIG, or B cells), chemotherapeutic agents (e.g., methotrexate, treosulfan, busulfan), irradiation, or chemokines, interleukins, or their inhibitors (e.g., BAFF, IL-2, anti-IL-2R, IL-4, JAK kinase inhibitors). Such additional pharmaceutical agents can be administered before, during, or after administration of immune cells, depending on the desired effect. This administration of cells and agents can be by the same route or by different routes, and can be either at the same site or at different sites.

[0188] In certain embodiments, the compositions and methods of the present embodiment are accompanied by the immune cell population in combination with at least one additional therapy.The additional therapy can be radiation therapy, surgery (e.g., lumpectomy and mastectomy), chemotherapy, gene therapy, DNA therapy, viral therapy, RNA therapy, immunotherapy, bone marrow transplantation, nanotherapy, monoclonal antibody therapy, or the combination of the above.The additional therapy can be in the form of adjuvant therapy or neoadjuvant therapy.

[0189] In some embodiments, the additional therapy is administration of a small molecule enzyme inhibitor or a metastasis inhibitor. In some embodiments, the additional therapy is administration of a side effect limiting agent (e.g., an agent intended to reduce the occurrence and / or severity of side effects of treatment, such as an antiemetic agent). In some embodiments, the additional therapy is radiation therapy. In some embodiments, the additional therapy is surgery. In some embodiments, the additional therapy is a combination of radiation therapy and surgery. In some embodiments, the additional therapy is gamma irradiation. In some embodiments, the additional therapy is a therapy targeting the PBK / AKT / mTOR pathway, an HSP90 inhibitor, a tubulin inhibitor, an apoptosis inhibitor, and / or a chemopreventive agent. The additional therapy may be one or more chemotherapeutic agents known in the art.

[0190] Immune cell therapy may be administered before, during, after, or in various combinations with additional cancer therapy (such as immune checkpoint therapy). Administration may be at intervals ranging from simultaneous, to minutes, to days, to weeks. In embodiments in which immune cell therapy is administered to a patient separately from an additional therapeutic agent, it will generally be ensured that a meaningful period does not end after each delivery time, so that the two compounds will still be able to exert a beneficial combined effect on the patient. In such cases, it is contemplated that the patient may be administered antibody therapy and anti-cancer therapy within about 12 hours to 24 hours or 72 hours of each other, more specifically within about 6 hours to 12 hours of each other. In some circumstances, it may be desirable to significantly extend the period for treatment, in which cases days (2, 3, 4, 5, 6, or 7) to weeks (1, 2, 3, 4, 5, 6, 7, or 8) pass between each administration.

[0191] Administration of any of the compounds or cell therapies of the present embodiments to a patient will follow general protocols for administration of such compounds, taking into account the toxicity, if any, of the agent. Thus, in some embodiments, there is a step of monitoring for toxicity that may result from the combination therapy.

[0192] A wide variety of chemotherapeutic agents can be used with the prepared immune cells. The term "chemotherapy" refers to the use of drugs to treat cancer. "Chemotherapeutic agent" is used to imply a compound or composition administered in the treatment of cancer. These agents or drugs are classified according to their mode of activity within the cell, for example, whether and at what stage they affect the cell cycle. Alternatively, agents can be characterized based on their ability to directly crosslink DNA, to intercalate into DNA, or to induce abnormalities in chromosome division and mitosis by affecting nucleic acid synthesis.

[0193] Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclosphosphamide; alkyl sulfonates such as busulfan, improsulfan, and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylmelamines, including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide, and trimethylolomelamine; acetogenins (particularly bullatacin and bullatacinone); camptothecins (including the synthetic analog topotecan); bryostatin; kallistatin; CC-1065 (including its adozelesin, carzelesin, and bizelesin synthetic analogs); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dora statins; duocarmycins (including synthetic analogs, KW-2189 and CB1-TM1); eleutherobin; pancratistatin; sarcodictin; spongiostatins; nitrogen mustards such as chlorambucil, chlornaphazine, chlorophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, nobembitine, phenesterine, prednimustine, trophosfamide, and uracil mustard; nitrosureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as enediyne antibiotics (e.g., calicheamicins, especially calicheamicin gamma II and calicheamicin omega I1); dynemicins, including dynemicin A; bisphosphonates such as clodronate; esperamicin;and neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores, aclacinomysins, actinomycins, authrarnycin, azaserine, bleomycins, cactinomycins, carabicins, carminomycins, carzinophilins, chromomycinis, dactinomycins, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalarnycin, olivomycins. , peplomycin, potfiromycin, puromycin, queramycin, lodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, and zorubicin; antimetabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogs such as denopterin, pteropterin, and trimetrexate; fludarabine, 6-mercaptopurine, thiamprinium, and thiamprinium. purine analogues such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, and floxuridine; androgens such as calsterone, dromostanolone propionate, epithiostanol, mepitiostane, and testolactone; antiadrenal agents such as mitotane and trilostane; folic acid supplements such as frolinic acid; aceglatone; aldophosphamide glycosides; aminolevulinic acid; eniluracil; amsacrine; bestravcil; bisantrene; edatraxate; defofamine; demecolcine; diazicon; elformithine; elliptinium acetate; epothilone; etoglucide; gallium nitrate; hydroxyurea;Lentinan; lonidainine; maytansinoids such as maytansine and ansamitocin; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllic acid; 2-ethylhydrazide; procarbazine; PSK polysaccharide complex; razoxane; rhizoxin; schizophyllan; spirogermanium; tenuazonic acid; triazicon; 2,2',2''-trichlorotriethylamine; trichothecenes (especially T-2 toxin, verracurin A) A), Roridin A and Anguidine); urethane; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; taxoids, such as paclitaxel and docetaxel gemcitabine; 6-thioguanine; mercaptopurine; platinum complexes such as cisplatin, oxaliplatin, and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide edatrexate; daunomycin; aminopterin; xeloda; ibandronic acid; irinotecan (e.g., CPT-11); the topoisomerase inhibitor RFS2000; difluorometlhylornithine (DMFO); retinoids such as retinoic acid; capecitabine; carboplatin, procarbazine, plicamycin, gemcitabien, navelbine, farnesyl-protein transferase inhibitors, transplatinum, and pharma- ceutical acceptable salts, acids, or derivatives of any of the above;

[0194] In some embodiments, radiation therapy is provided to the individual in addition to the immune cells produced herein. Radiation therapy generally involves gamma radiation, X-rays, and / or directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging agents are also contemplated, such as microwaves, proton beam irradiation (U.S. Patent Nos. 5,760,395 and 4,870,287), and UV irradiation. All of these agents most likely affect widespread damage to DNA, DNA precursors, DNA replication and repair, and chromosome assembly and maintenance. X-ray doses range from daily doses of 50-200 roentgens for prolonged periods (3-4 weeks) to single doses of 2000-6000 roentgens. Dose ranges for radioisotopes vary widely and depend on the half-life of the isotope, the strength and type of radiation emitted, and uptake by tumor cells.

[0195] Those skilled in the art will understand that additional immunotherapies may be used in combination with or with the immune cells produced by the methods included herein. In the context of cancer therapy, immunotherapy generally relies on the use of immune effector cells and molecules to target and destroy cancer cells. Rituximab is one such example. The immune effector may be, for example, an antibody specific for some marker on the surface of tumor cells. The antibody may function alone as an effector of therapy or may recruit other cells to actually affect cell killing. The antibody may also be conjugated with a drug or toxin (such as a chemotherapeutic agent, a radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) to act as a targeting agent. Alternatively, the effector may be a lymphocyte with a surface molecule that interacts directly or indirectly with the tumor cell target. Various effector cells include cytotoxic T cells and NK cells.

[0196] Antibody-drug conjugates have emerged as a revolutionary approach to the development of cancer therapeutics. Cancer is one of the leading causes of death worldwide. Antibody-drug conjugates (ADCs) contain a monoclonal antibody (MAb) covalently linked to a cell-killing drug. This approach combines the high specificity of the MAb for its antigen target with a highly potent cytotoxic drug, resulting in an "armed" MAb that delivers the payload (drug) to tumor cells that bear concentrated levels of the antigen. Targeted delivery of the drug also minimizes its exposure in normal tissues, thus reducing toxicity and improving therapeutic index. The FDA approval of two ADC drugs, ADCETRIS® (brentuximab vedotin) in 2011 and KADCYLA® (trastuzumab emtansine or T-DM1) in 2013, has enabled this approach. Currently, there are more than 30 ADC drug candidates in various stages of clinical trials for cancer treatment (Leal et al., 2014). As antibody engineering and linker-payload optimization become increasingly mature, the discovery and development of new ADCs increasingly relies on the identification and validation of new targets suitable for this approach and the generation of targeted MAbs. Two criteria for ADC targets are increased / high levels of expression in tumor cells and robust internalization.

[0197] In one aspect of immunotherapy, tumor cells must have a marker suitable for targeting, i.e., not present on the majority of other cells. Many tumor markers exist, any of which may be suitable for targeting in the context of embodiments of the present invention. Common tumor markers include CD20, carcinoembryonic antigen, tyrosinase (p97), gp68, TAG-72, HMFG, sialyl Lewis antigen, MucA, MucB, PLAP, laminin receptor, erb B, and p155. Another aspect of immunotherapy is to combine anti-cancer effects with immune stimulating effects. There are also immune stimulating molecules, including cytokines such as IL-2, IL-4, IL-12, GM-CSF, γ-IFN, chemokines such as MIP-1, MCP-1, IL-8, and growth factors such as FLT3 ligand.

[0198] Examples of immunotherapies currently under investigation or in use include immune adjuvants, e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene, and aromatic compounds (U.S. Patents. 5,801,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al., 1998); cytokine therapy, e.g., interferon α, β, and γ, IL-1, GM-CSF, and TNF (Bukowski et al., 1998; Davidson et al., 1998; Hellstrand et al., 1998); gene therapy, e.g., TNF, IL-1, IL-2, and p53 (Qin et al., 1998; Austin-Ward and and monoclonal antibodies, such as anti-CD20, anti-ganglioside GM2, and anti-p185 (Hollander, 2012; Hanibuchi et al., 1998; U.S. Patent No. 5,824,311). It is contemplated that one or more anti-cancer therapies may be used in conjunction with the antibody therapies described herein.

[0199] In some embodiments, the immunotherapy can be an immune checkpoint inhibitor. Immune checkpoints either raise a signal (e.g., a costimulatory molecule) or lower a signal. Inhibitory immune checkpoints that can be targeted by immune checkpoint blockade include adenosine A2A receptor (A2AR), B7-H3 (also known as CD276), B and T lymphocyte attenuator (BTLA), cytotoxic T lymphocyte-associated protein 4 (CTLA-4, also known as CD152), indoleamine 2,3-dioxygenase (IDO), killer cell immunoglobulin (KIR), lymphocyte activation gene-3 (LAG3), programmed cell death 1 (PD-1), T cell immunoglobulin domain and mucin domain 3 (TIM-3) and V-domain Ig suppressor of T cell activation (VISTA). In particular, immune checkpoint inhibitors target the PD-1 axis and / or CTLA-4.

[0200] Immune checkpoint inhibitors may be drugs, such as small molecules, recombinant ligands or receptors, or may be antibodies, such as human antibodies, among others (see, e.g., International Publication WO2015016718; Pardoll, Nat Rev Cancer, 12(4):252-64, 2012; both incorporated herein by reference). Known inhibitors of immune checkpoint proteins or analogs thereof may be used, and in particular chimeric, humanized, or human antibodies may be used. As will be appreciated by those skilled in the art, alternative and / or equivalent names may be used for certain antibodies referred to in this disclosure. Such alternative and / or equivalent names are interchangeable in the context of this disclosure. For example, it is known that lambrolizumab is also known by the alternative and equivalent names MK-3475 and pembrolizumab.

[0201] In some cases, surgery is performed for individuals who will receive or have received the immune cells of the present disclosure. Approximately about 60% of people with cancer will undergo some type of surgery, including preventive, diagnostic or staging, curative and palliative surgery. Curative surgery includes resection, where all or part of the cancerous tissue is physically removed, excised and / or destroyed, and may be used in combination with other therapies, such as the treatment of the present embodiment, chemotherapy, radiation therapy, hormone therapy, gene therapy, immunotherapy and / or alternative therapy. Tumor resection refers to the physical removal of at least a portion of the tumor. In addition to tumor resection, surgical treatments include laser surgery, cryosurgery, electrosurgery and microsurgery (Mohs surgery). Removal of part or all of the cancerous cells, tissue or tumor may form a cavity in the body. Treatment may be accomplished by perfusion, direct injection or local application to the area with additional anti-cancer therapy. Such treatments may be repeated, for example, every 1, 2, 3, 4, 5, 6 or 7 days, or every 1, 2, 3, 4 and 5 weeks, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months. These treatments may also be of various dosages.

[0202] It is contemplated that other agents may be used in combination with certain aspects of the present embodiment to improve the therapeutic efficacy of the treatment. These additional agents include agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, agents that increase the sensitivity of hyperproliferative cells to apoptosis inducers, or other biological agents. An increase in intercellular signaling by increasing the number of GAP junctions will increase the anti-hyperproliferative effect on neighboring hyperproliferative cell populations. In other embodiments, cytostatic or differentiation agents may be used in combination with certain aspects of the present embodiment to improve the anti-hyperproliferative efficacy of the treatment. Inhibitors of cell adhesion are contemplated to improve the efficacy of the present embodiment. Examples of cell adhesion inhibitors include focal adhesion kinase (FAK) inhibitors and lovastatin. It is further contemplated that other agents that increase the sensitivity of hyperproliferative cells to apoptosis (such as antibody c225) may be used in combination with certain aspects of the present embodiment to improve the efficacy of the treatment.

[0203] VI. Manufactured Articles or Kits Also provided herein is an article of manufacture or kit that includes immune cells produced from selected cord blood unit(s). The article of manufacture or kit may further include a package insert with instructions for using the immune cells to treat or slow the progression of cancer in an individual, or to enhance the immune function of an individual with cancer. Any of the antigen-specific immune cells described herein may be included in the article of manufacture or kit. Suitable containers include, for example, bottles, vials, bags, and syringes. The containers may be formed from a variety of materials, such as glass, plastic (e.g., polyvinyl chloride or polyolefin, etc.), or metal alloys (e.g., stainless steel or Hastelloy, etc.). In some embodiments, the container contains a formulation, and a label on or associated with the container may indicate instructions for use. The article of manufacture or kit may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use. In some embodiments, the article of manufacture further includes one or more additional agents (e.g., chemotherapeutic agents and anti-tumor agents). Suitable containers for such agent(s) include, for example, bottles, vials, bags, and syringes.

[0204] In a specific embodiment, the article of manufacture comprises cryopreserved immune cells produced by the methods described herein. The cryopreserved cells may be frozen with a specific cryoprotectant suitable to prevent the cells from damage during freezing or thawing. EXAMPLES

[0205] The following examples are included to clarify certain embodiments of the present disclosure. It should be understood by those skilled in the art that the techniques disclosed in the following examples represent techniques that the inventors have found to work well in implementing the embodiments of the present disclosure, and therefore can be considered to constitute specific aspects for its implementation. However, those skilled in the art should understand in light of this disclosure that many changes can be made in the specific embodiments disclosed, and that many changes can still produce the same or similar results without departing from the spirit and scope of the present disclosure.

[0206] Example 1 Pre-freezing CBU characteristics predict clinical response The studies in this example characterize whether characteristics of pre-frozen cord blood units (CBUs) can be used to identify those CBUs that are more likely to yield a clinically useful cell product.

[0207] The inventors utilized operator receiver characteristic (ROC) curves to characterize the predictive value of the CBU features of interest and to identify suitable cut-off values ​​that allow classifying each individual CBU as likely ("good") or unlikely ("bad") to induce a clinical response in patients. For example, in FIG. 1, CBU cell viability was examined. The arrow on the ROC curve indicates the value at CBU cell viability that can be used to classify the CBU as "good or bad" with the best sensitivity and specificity (as determined by the point closest to 100% sensitivity and 100% sensitivity [1-specificity=0]). In this case, the value is 98%. The response that patients had to CAR-NK cells was then examined. Patients receiving CAR-NK cells produced from CBUs with a viability of more than 98% showed a response of 81.8%, but patients receiving CAR-NK cells produced from multiple CBUs with a viability of less than 98% had only a 20% response. This result is statistically significant (Fisher's exact test, p=0.004). Logistic regression models were then used to confirm that this outcome was independent of patients' clinical characteristics (e.g., remission status).

[0208] The methodology described above was applied to investigate other variables, such as total mononuclear cell (TNC) recovery. The optimal cutoff for predicting response is 76.3% (Figure 2). In this case, the difference in response between patients receiving CAR-NK cells manufactured from multiple CBUs with a TNC > 73.6 and those receiving CAR-NK cells manufactured from multiple CBUs with a TNC < 73.6 (58.8% vs. 22.2%) is not statistically significant (p = 0.11). However, multivariate logistic regression models show that the impact of TNC on outcome is statistically significant when the impact of confounding clinical variables (e.g., remission status) is taken into account.

[0209] This methodology was also used as described above for other CBU characteristics. In one example, the nucleated red blood cell (NRBC) content of the CBU was characterized. Patients treated with CAR-NK produced from CBUs with low cell content (NRBC less than 7.5×10e7) had a higher response rate than patients treated with CAR-NK cells produced from CBUs with higher NRBC content (62.5% vs. 20%, p=0.05). Again, multivariate logistic models revealed that this effect was independent of clinical variables.

[0210] Example 2 Pre-freeze CBU characteristics can be combined to identify "super CBUs" The three CBU features described in Example 1 are independent predictors of response in a logistic multivariate model adjusted for clinical features. For this reason, these three can be combined to define criteria for an "optimal CBU". Figure 4 shows the multivariate statistical significance for the three CBU features referenced in Example 1. Then, a ROC curve (right panel) was utilized to estimate the predictive value of the CBU criteria for response to the infused CAR-NK cell product. The area under the curve (AUC) of 0.932 indicates that meeting these three criteria (>98% viability, >76.3% TNC recovery, and <7.5x10e7 NRBC content) is a good predictor of response. Figure 5 shows the response of patients treated with CAR-NK cells when the CAR-NK cells are manufactured from CBU units that meet three criteria (100%), two criteria (62.5%), and less than two criteria (8.3%) as referenced in this Example and Example 1. These differences are statistically significant (p=0.00009). The number of favorable cord characteristics is the only independent predictor of response in a multivariate model including various clinical characteristics.

[0211] We characterized the predictive value of other CBU-related variables that would not be known at the time of cord selection, but could be elucidated during the manufacturing period of the cell product. In a specific embodiment, such variables would be determined after thawing. This was utilized to disregard the cell product after manufacturing if it did not meet the appropriate criteria. In FIG. 6, we investigated whether the cytotoxicity of NK cells obtained from frozen CBUs could predict clinical response to CAR-NK cells. Using the methodology attributed above, patients treated with CAR-NK cells produced from multiple CBUs, with NK cell cytotoxicity >18.2 against the Raji cell line at a ratio of 20:1, were shown to have a higher response rate than patients treated with CAR-NK cells derived from multiple CBUs, with less cytotoxic CAR-NK cells (66.7% vs. 12.5%, p=0.03). Again, a multivariate logistic model was used to reveal that this effect was independent of other variables.

[0212] In certain embodiments, other variables may be considered to improve prediction of clinical response. Examples include: (1) gestational age of the fetus or neonate from whom the cord blood was obtained is less than 39 weeks; (2) post-thaw survival of cord blood cells is greater than 86.5%; (3) NK cell expansion of 7-fold or greater between days 0 and 6 in culture; and / or (4) NK cell expansion of 10-fold or greater between days 6 and 15 in culture. 5 7A-7B show a set of three criteria (>98% survival, >76.3% TNC recovery, and 7.5×10 7 The predictive value of the NRBC content (less than 100 ng / mL) is shown in Figure 7A, which can be increased to 99.6% by adding the four variables immediately described (Figure 7B).

[0213] Example 3 Methods for selecting cryopreserved cord blood units to produce engineered natural killer cells with maximum potency against cancer - Patents.com This example relates to identifying predictors of response for treatment considering criteria related to the selection of a suitable cord blood unit (CBU). The inventors investigated whether characteristics of the CBU before freezing could be used to identify such CBUs that are more likely to result in a clinically effective cell product. Product characteristics may include characteristics of the CBU before freezing (to select the best CBU for manufacturing the cell product) and / or may include product characteristics after thawing and at production, which may be used in specific cases to reject products that are not likely to result in an optimal response. This example relates to an analysis based on 37 patients treated in the CD19-CAR-NK trial with outcomes of complete response (CR) and partial response (PR) / CR at 30 days.

[0214] Receiver operating characteristic (ROC) curves were utilized to characterize the predictive value of the CBU features of interest and to identify suitable cut-off values ​​that would allow classifying each individual CBU as likely ("good") or unlikely ("bad") to induce a clinical response in patients. For example, in FIG. 8, CBU cell viability was examined. The arrow on the ROC curve indicates the value at CBU cell viability that can be used to classify the CBU as "good or bad" with the best sensitivity and specificity (this is determined by the point closest to 100% sensitivity and 100% sensitivity [1-specificity=0]). In this case, the value is 99%. The response that the patients had to CAR-NK cells was then considered. Patients receiving CAR-NK cells produced from CBUs with viability of 99% or more had a CR rate of 40.9% and a CR / PR rate of 68.2%. On the other hand, patients receiving CAR-NK cells produced from multiple CBUs with a survival rate of less than 99% only had a CR rate of 6.7% and a CR / PR rate of 20%. These results were statistically significant (Fisher's exact test, p=0.028 and p=0.007, respectively). Logistic regression models were then used to confirm that this outcome was independent of the patients' clinical characteristics (e.g., remission status, etc.).

[0215] The same methodology in Figure 8 was applied with respect to other CBU characteristics in Figure 9. In this case, the nucleated red blood cell (NRBC) content of the CBU was examined. Patients treated with CAR-NK produced from CBUs with low cell content (NRBC less than 8.0 10e7) had higher response rates than patients treated with CAR-NK cells produced from CBUs with higher NRBC content (35.7% vs. 0%, p=0.079, CR rate; and 60.7% vs. 11.1%, p=0.019, PR / CR rate). Again, using multivariate logistic models, it was revealed that this effect was independent of clinical variables.

[0216] Patients treated with CAR-NKs made from multiple CBUs of Caucasian race had a higher response rate than patients treated with CAR-NKs made from CBUs from other ethnicities (Figure 10A). CBU ethnicity can be combined with other CBU characteristics to improve the selection of CBUs more likely to result in clinical responses. Figure 10B shows the results of combining CBU race with CBU survival. The combination of both factors increases the CR rate from 40.9% for survival alone to 61.5% when both criteria are combined (p=0.031).

[0217] Patients treated with CAR-NKs made from multiple CBUs derived from infants weighing over 3650 grams have a higher response rate than patients treated with CAR-NKs made from CBUs derived from lower weight infants (left panel of FIG. 11). As in FIG. 10, infant weight can be combined with other CBU characteristics to better select CBUs more likely to result in a clinical response. The right panel of FIG. 11 shows the results of combining infant weight with CBU survival. Combining both factors increases the CR rate from 40.9% for survival alone to 72.7% when both criteria are combined (p=0.008).

[0218] The four CBU features described above in this example are independent predictors of response in a logistic multivariate model adjusted for clinical features. For this reason, in some embodiments, these four can be combined to define criteria for "optimal CBU" (Figure 12A). We then examined the predictive value of meeting optimal CBU criteria for response to CAR-NK cell products using a ROC curve (Figure 12A). The area under the curve (AUC) of 0.893 indicates that meeting these four criteria (survival rate ≥ 99%, NRBC content < 8.0, infant weight > 3650 grams, and white ethnicity) is a good predictor of response.

[0219] FIG. 12C shows response rates (CR (upper panel) and CR / PR (lower panel)) according to the number of "optimal" CBU features possessed by the NK cell product the patient received. For example, CR rates ranged from 0% for patients who received a product derived from multiple CBUs that only met one criterion to a 100% response rate for patients who received a cell product derived from multiple CBUs that met four of these criteria (p<0.001). Similarly, PR / CR rates were 12.5%, 30.%, 58.3% and 100% for patients who received a cell product derived from multiple CBUs that had one, two, three or four of the desired features (p=0.003). FIG. 12A shows survival probability according to the number of CBU features. The 12-month survival probabilities for patients receiving cell products derived from multiple CBUs with one, two, three or four characteristics were 37.5%, 57.1%, 79.5% and 100%, respectively (p=0.02).

[0220] These results were validated in an independent sample of 19 patients treated with different NK cell products with very similar results, where CR rates at day +30 were 0%, 33.3%, and 75% for patients receiving cell products derived from multiple CBUs with 2 or less, 3 or 4 characteristics, respectively (p=0.029) (Figure 13).

[0221] In some embodiments, there are additional parameters to improve prediction of clinical response: for example, gestational age ≤ 38 weeks; intrauterine collection method; male infants; pretreatment volume ≤ 120 ml; CD34% > 0.4%; NK cell expansion ≥ 450 fold between days 0 and 15 in culture; and NK cell expansion ≥ 70 fold between days 6 and 15 in culture.

[0222] As shown above, the predictive value of the set of four criteria for clinical response (survival rate ≥ 99%, NRBC content < 8, white ethnicity, and infant weight > 3650 grams) is 89.3%. This can be increased to 97.0% by adding the variables described above (Figure 14).

[0223] Although the present disclosure and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made therein without departing from the spirit and scope of the design as defined by the appended claims. Moreover, the scope of the present application is not intended to be limited to the particular embodiments of the processes, apparatus, manufacture, compositions, means, methods and steps described herein. As one skilled in the art would readily appreciate from this disclosure, any process, apparatus, manufacture, composition, means, method or step, whether currently existing or later developed, that performs substantially the same function or achieves substantially the same result as the corresponding embodiments described herein may be utilized in accordance with the present disclosure. Thus, the appended claims are intended to include such processes, apparatus, manufacture, compositions, means, methods or steps within their scope.

Claims

1. 1. A method for selecting an umbilical cord blood composition, comprising: the below described (a) cord blood cell viability; and (b) Nucleated red blood cell (NRBC) content; And at least one of the following: (c) total mononuclear cell (TNC) recovery; (d) the weight of the infant from which the umbilical cord blood is derived; and / or (e) the race of the biological mother and / or biological father of the infant from whom the umbilical cord blood is derived; measuring or considering prior to cryopreservation of the cord blood composition; and After cryopreservation, measuring the cytotoxicity of immune cells derived from the thawed cord blood composition. The method includes:

2. The method of claim 1 , wherein the immune cells are natural killer (NK) cells.

3. The method of claim 2, further comprising expanding the NK cells.

4. 10. The method of claim 1, comprising, prior to cryopreservation, measuring or examining one or more of the following: (f) the gestational age of the newborn from whom the cord blood is derived; (g) in utero collection of umbilical cord blood; (h) The sex of the child from whom the cord blood is derived; (i) the amount of cord blood collected; and / or (j) Number of CD34+ cells in extracted cord blood.

5. 5. The method of claim 4, wherein the NK cells are modified to express one or more non-endogenous gene products, and wherein the non-endogenous gene products comprise one or more non-endogenous receptors, one or more cytokines, one or more chemokines, one or more enzymes, or a combination thereof.

6. 1. A method for selecting an umbilical cord blood composition, comprising: Before cryopreservation, (a) cord blood cell viability of about 98% or greater; (b) Nucleated red blood cell (NRBC) content is approximately 8.0 x 10 ７ 1 or less; and At least one of the following: (c) total mononuclear cell (TNC) recovery of 76.3% or more; (d) the weight of the infant from which the umbilical cord blood is derived is greater than about 3,650 grams; and / or (e) the race of the biological mother and / or biological father of the infant from whom the umbilical cord blood is derived is Caucasian; The method comprises the step of identifying

7. 7. The method of claim 6, wherein the cord blood composition prior to cryopreservation is determined to have (a), (b), (d) and (e).

8. (a) the cord blood cell viability is 99.0% or more; (b) NRBC content is 8.0 × 10 ７ The method according to claim 6, wherein (c) the TNC recovery rate is 77% or more, and (d) the weight of the umbilical cord blood-derived baby is more than about 3,650 g.

9. 7. The method of claim 6, wherein the volume of collected cord blood plus anticoagulant is about 120 mL or less, or wherein at least 0.4% of the cells in the extracted cord blood are CD34+.

10. The method of claim 6, further comprising deriving immune cells from the thawed cord blood composition.

11. 11. The method of claim 10, wherein the immune cells derived from the thawed cord blood composition are NK cells and the cytotoxicity is 66.7% or greater.

12. 7. The method of claim 6, further comprising, prior to cell preservation, measuring or considering one or more of the following: (f) the gestational age of the newborn from whom the cord blood is derived; (g) in utero collection of umbilical cord blood; (h) The sex of the child from whom the cord blood is derived; (i) the amount of cord blood collected; and / or (j) Number of CD34+ cells in extracted cord blood.

13. 7. The method of claim 6, further comprising determining the viability of the cord blood cells after thawing, and wherein the viability of the cord blood cells after thawing is 86.5%.

14. 11. The method of claim 10, wherein the immune cells are NK cells, the NK cells are expanded, and the expansion of the NK cells between days 0 and 6 in culture is 3-fold or greater.

15. 11. The method of claim 10, wherein the immune cell is a NK cell, the NK cell being modified to express one or more non-endogenous gene products, and the non-endogenous gene products comprise one or more non-endogenous receptors, one or more cytokines, one or more chemokines, one or more enzymes, or a combination thereof, and / or the NK cell is modified such that expression of one or more endogenous genes in the cell is disrupted.

16. The cord blood cell viability is greater than 99%, the TNC recovery is greater than or equal to 76.3%, and the NRBC content is greater than or equal to 7.5×10 ７ The method of claim 6 , wherein the number of

17. The cord blood is derived from a fetus or a newborn with a gestational age of 39 weeks or less, the survival rate of the cord blood cells after thawing is 86.5% or more, the expansion of the NK cells between days 0 and 6 in culture is 7-fold or more, and the expansion of the NK cells between days 6 and 15 in culture is 10-fold or more. ５ The method of claim 6, wherein the concentration is 20-30% or more.

18. A composition comprising a cord blood composition identified by the method of selecting a cord blood composition comprising: The method comprises the steps of: (a) umbilical cord blood cell viability of 98% or more; and (b) Nucleated red blood cells (NRBC) content: 8.0×10 ７ above; And at least one of the following: (c) total mononuclear cell (TNC) recovery rate ≥ 76.3%; (d) the weight of the infant from which the umbilical cord blood is derived is greater than 3650 g; and / or (e) the race of the biological mother and / or biological father of the infant from whom the umbilical cord blood is derived is Caucasian; measuring or considering prior to cryopreservation of the umbilical cord blood composition.

19. A composition comprising an immune cell population derived from an umbilical cord blood composition produced using a method for selecting a cord blood composition comprising: The method comprises the steps of: (a) umbilical cord blood cell viability of 98% or more; and (b) Nucleated red blood cells (NRBC) content 8.0×10 ７ above; And at least one of the following: (c) total mononuclear cell (TNC) recovery rate ≥ 76.3%; (d) the weight of the infant from which the umbilical cord blood is derived is greater than 3650 g; and / or (e) the race of the biological mother and / or biological father of the infant from whom the umbilical cord blood is derived is Caucasian; measuring or considering prior to cryopreservation of the umbilical cord blood composition.

20. 1. A method for predicting efficacy of an immune cell for treatment, comprising: The following (a) cord blood cell viability; and (b) Nucleated red blood cell (NRBC) content; And at least one of the following: (c) total mononuclear cell (TNC) recovery; (d) the weight of the infant from which the umbilical cord blood is derived; and / or (e) the race of the biological mother and / or biological father of the infant from whom the umbilical cord blood is derived; measuring or considering prior to cryopreservation of the cord blood composition; The method of claim 1, wherein the immune cells are effective for treatment when the cord blood composition comprises one or more of the following characteristics: (a) cord blood cell viability of 98% or greater; (b) Nucleated red blood cell (NRBC) content is 8.0 x 10 ７ Not more than one; (c) total mononuclear cell (TNC) recovery of 76.3% or greater; (d) the weight of the infant from which the umbilical cord blood is derived is greater than about 3,650 grams; and / or (e) The biological mother and / or biological father of the infant from whom the umbilical cord blood is derived are of Caucasian race.

21. 21. The method of claim 20, further comprising freezing the one or more blood compositions.

22. 22. The method of claim 21, further comprising measuring the cytotoxicity of immune cells derived from the umbilical cord blood composition upon thawing, and wherein the cytotoxicity is 66.7% or greater.

23. A method for producing engineered immune cells, comprising the steps of:

1. A process for engineering an immune cell population to express one or more non-endogenous gene products, wherein the immune cells are derived from a cord blood cell population, and wherein the cord blood cell population prior to cryopreservation has the following characteristics: (a) 98% or greater cord blood cell viability; (b) 8.0×10 ７ The following nucleated red blood cells (NRBC) content; and at least one of the following: (c) total mononuclear cell (TNC) recovery of 76.3% or more; (d) the weight of the infant from whom the cord blood was derived is greater than 3650 g; and / or (e) The biological mother and / or biological father of the cord blood-derived baby are of Caucasian race.

24. A method for producing a raw material for producing a composition comprising immune cells, the method comprising a step of cryopreserving a cell population comprising immune cells derived from a cord blood cell population, the cord blood cell population before cryopreservation having the following characteristics: (a) 98% or greater cord blood cell viability; (b) Nucleated red blood cell (NRBC) content of 8.0 x 107 or less; and at least one of the following: (c) total mononuclear cell (TNC) recovery of 76.3% or more; (d) the weight of the infant from whom the cord blood was derived is 3650 g or greater; and / or (e) The biological mother and / or biological father of the cord blood-derived baby are of Caucasian race.

25. 1. A composition comprising an isolated population of cord blood derived immune cells, the immune cells having (a) a cord blood cell viability of 98% or greater, (b) a total mononuclear cell (TNC) count of 76.3% or greater, and (c) a total mononuclear cell (TNC) count of 8.0×10 ７ A composition derived from one or more cord blood units having the following nucleated red blood cell (NRBC) content:

Images