Hybrid receptors with multiple transcriptional regulators

Abstract

The present disclosure relates generally to the field of immunology, and in particular to hybrid chimeric antigen receptors designed to combine fast timescale intracellular signaling with long timescale transcriptional regulation. The disclosure also provides such receptors, nucleic acids encoding same, compositions and methods useful for making genetically engineered host cells using the same, and methods for modulating cellular activity and / or for treating various conditions or diseases, such as cancer.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 165,428, filed March 24, 2021, which is incorporated by reference in its entirety and for all purposes.

[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention was made with Government support under Grant No. OD025751 awarded by the National Institutes of Health. The Government has certain rights in the invention.

[0003] The present disclosure relates generally to the field of immunology, and in particular to hybrid chimeric antigen receptors designed to combine fast time-scale intracellular signaling with long time-scale transcriptional regulation. The disclosure also provides such receptors, nucleic acids encoding same, compositions and methods useful for making genetically modified host cells using same, and methods for modulating cellular activity and / or for treating various conditions or diseases, such as cancer. [Background technology]

[0004] Notch receptors are transmembrane proteins that mediate contact signaling between cells and play a central role in development and other cell-cell communications. Notch receptors are involved in and required for a variety of cellular functions during development and are important for the function of a vast number of cell types across species.

[0005] Existing first-generation synthetic derivatives of Notch receptors, often referred to as "SynNotch", have been developed in recent years by replacing the extracellular ligand-binding domain, which contains multiple EGF-like repeats, with antibody derivatives, or by replacing the cytoplasmic domain with selected transcriptional activators, but still rely on the Notch NRR (L. Morsut et al., Cell (2016) 164:780-91) and standard two-step proteolysis. However, the NRR spans about 160 amino acids, and this domain alone is about three times larger than some mature proteins such as insulin and epidermal growth factor (EGF). This results in low receptor expression efficiency, which can exceed the capacity of some widely used cloning and transfection vectors.

[0006] Furthermore, these first- and second-generation SynNotch receptors, in contrast to chimeric antigen receptors (CARs), do not trigger membrane-proximal signaling through a kinase cascade. Instead, the receptors translate ligand binding to release receptor-tethered transcription factors that are transported to the nucleus and regulate user-defined transcriptional circuitry.

[0007] In particular, these receptors lack the ability to initiate fast timescale signaling that regulates cellular processes such as metabolic reprogramming, proliferation, growth factor production, or cytotoxicity.

[0008] The present disclosure provides, inter alia, a new class of hybrid SynNotch receptors that incorporate intracellular signaling domains (e.g., stimulatory domains of CARs and costimulatory domains such as those from the cytoplasmic tail of 4-1BB, CD28, and CD3 zeta) that are capable of initiating T cell activation in conjunction with customized transcriptional regulation. Summary of the Invention

[0009] Provided herein, inter alia, are chimeric receptors comprising, from N-terminus to C-terminus, a) an extracellular ligand-binding domain having binding affinity for a selected ligand; b) a linking polypeptide; c) a transmembrane domain (TMD) comprising one or more ligand-inducible proteolytic cleavage sites; and d) an intracellular domain (ICD). In some embodiments, the ICD comprises, in any order, (i) an intracellular signaling domain (SD) comprising at least one co-stimulatory domain and an activation domain from a signaling molecule, and (ii) a transcription regulator. In certain embodiments, binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at the ligand-inducible proteolytic cleavage site located between the ICD and the linking polypeptide. In other embodiments, binding of the selected ligand to the extracellular ligand-binding domain induces a proximal signaling cascade through the intracellular SD. In some embodiments, the chimeric receptor does not comprise the LIN-12-Notch repeats (LNR) and / or heterodimerization domain (HD) of a Notch receptor.

[0010] In some embodiments, the extracellular domain comprises an antigen binding portion capable of binding to a ligand on the surface of the cell. In some embodiments, the cell is a pathogenic cell. In some embodiments, the cell is a human cell. In some embodiments, the human cell is a tumor cell. In some embodiments, the human cell is a terminally differentiated cell.

[0011] In some embodiments, the ligand comprises a protein or a carbohydrate. In certain embodiments, the ligand comprises CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD178, CD181 (CXCR1), CD191 (CXCR2), CD192 (CXCR3), CD193 (CXCR4), CD194 (CXCR4), CD195 (CXCR4), CD196 (CXCR4), CD197 (CXCR4), CD198 (CXCR4), CD19 ... D182 (CXCR2), CD183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, MAGE, alkaline phosphatase, placenta-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), blue fluorescent protein (BFP) enhanced green fluorescent protein (EGFP), and signal regulatory protein alpha (SIRPα).

[0012] In some embodiments, the ligand is selected from a cell surface receptor, an adhesion protein, an integrin, a mucin, a lectin, a tumor-associated antigen, and a tumor-specific antigen. In some embodiments, the ligand is a tumor-associated antigen or a tumor-specific antigen. In some embodiments, the extracellular ligand binding domain comprises a ligand-binding portion of a receptor. In some embodiments, the antigen-binding portion is selected from the group consisting of an antibody, a nanobody, a diabody, a triabody, a minibody, a F(ab')2 fragment, a F(ab)v fragment, a single chain variable fragment (scFv), a single domain antibody (sdAb), and functional fragments thereof. In some preferred embodiments, the antigen-binding portion comprises a scFv.

[0013] In certain embodiments, the antigen binding portion is selected from the group consisting of CD19, B7H3 (CD276), BCMA (CD269), ALPPL2, CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, Ephrin B2, FAP, The tumor-associated antigen specifically binds to a tumor-associated antigen selected from the group consisting of FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Rα, KIT (CD117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SIRPα, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, and Axl. In some preferred embodiments, the tumor-associated antigen is CD19, BCMA, CEA, HER2, MUC1, CD20, ALPPL2, SIRPα, or EGFR.

[0014] In other preferred embodiments, the tumor-associated antigen is CD19, BCMA, HER2, or ALPPL2.

[0015] In some embodiments, the linking polypeptide of the chimeric receptor provided herein comprises a hinge domain, which in some embodiments can promote oligomerization of the chimeric polypeptide through intermolecular disulfide bonds.

[0016] In some embodiments, the hinge domain is derived from a CD8α hinge domain, a CD28 hinge domain, a CD152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an OX40 hinge domain, an IgG1 hinge domain, an IgG2 hinge domain, an IgG3 hinge domain, and an IgG4 hinge domain, or a functional variant of any thereof. In certain preferred embodiments, the linking polypeptide is derived from the group selected from a CD8α hinge domain or a functional variant thereof, a CD28 hinge domain or a functional variant thereof, an OX40 hinge domain or a functional variant thereof, and an IgG4 hinge domain or a functional variant thereof.

[0017] In some embodiments, the linking polypeptide is derived from a CD8 alpha hinge domain or a functional variant thereof. In other embodiments, the linking polypeptide is derived from a CD28 hinge domain or a functional variant thereof. In some specific embodiments, the linking polypeptide comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO:3.

[0018] In some embodiments, the one or more ligand-inducible proteolytic cleavage sites comprise a gamma-secretase cleavage site. In some embodiments, the TMD comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO:4. In certain embodiments, the chimeric receptor of the present disclosure further comprises a stop-transfer-sequence (STS) located between the TMD and the ICD. In some preferred embodiments, the stop-transfer-sequence comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO:5.

[0019] In some embodiments, the signaling molecule comprises a class 1 or class 3 human membrane protein. In certain embodiments, the signaling molecule comprises CD28, ICOS, CTLA4, PD1, PD1H, BTLA, B71, B7H1, CD226, CRTAM, TIGIT, CD96, TIM1, TIM2, TIM3, TIM4, CD2, SLAM, 2B4, Ly108, CD84, Ly9, CRACC, BTN1, BTN2, BTN3, LAIR1, LAG3, CD160, 4-1BB, OX40, CD27, GITR, CD30, TNFR1, TNFR2, HVEM, LT_R, DR3, DCR3, FAS, CD40, RANK, OPG, TRAILR1, TACI, BAFFR, BCMA, TWEAKR, ED AR, XEDAR, RELT, DR6, TROY, NGFR, CD22, Siglec-3, Siglec-5, Siglec-7, KLRG1, NKR-P1A, ILT2, KIR2DL1, KIR3DL1, CD94-NKG2A, CD300b, CD300e, TREM1, TREM2, ILT7, ILT3, ILT4, TLT-1, CD200R, CD300a, CD300f, DC-SIGN, B7-2, Allergin-1, LAT, BLNK, LAYN, SLP76, EMB-LMP1, HIV-NEF, HVS-TIP, HVS-ORF5, and HVS-stpC. In some preferred embodiments, the signaling molecule is selected from the list consisting of OX40, ICOS, 4-1BB, CTLA4, CD28, CD30, CD2, CD27, and CD226.

[0020] In some embodiments, the activation domain comprises one or more immunoreceptor tyrosine-based activation motifs (ITAMs). In some embodiments, the one or more ITAMs are derived from CD3zeta, CD3sigma, CD3 / , and CD3epsilon. In certain embodiments, the one or more ITAMs have at least about 80, 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity to a CD3zeta ITAM.

[0021] In some embodiments, the transcriptional regulator comprises a transcriptional activator or a transcriptional repressor. In some embodiments, the transcriptional regulator further comprises a nuclear localization sequence (NLS) derived from a protein selected from the group consisting of Gal4, tetR, ZFHD1, and HAP1, and the transcriptional regulator comprises a transactivation domain derived from a protein selected from the group consisting of VP64, VP65, KRAB, and VP16.

[0022] In certain embodiments, the chimeric receptor provided herein comprises an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 15-31 and 34-45.

[0023] In certain embodiments, the chimeric receptors provided herein further comprise a signal sequence, a detectable label, a tumor-specific cleavage site, a disease-specific cleavage site, or a combination thereof.

[0024] In other aspects, the present disclosure also includes recombinant nucleic acids comprising a nucleotide sequence encoding a chimeric receptor described herein. In certain embodiments, the nucleotide sequence is incorporated into an expression cassette or expression vector. In certain embodiments, the expression vector is a viral vector. In certain embodiments, the viral vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a retroviral vector.

[0025] Additionally, the present disclosure includes recombinant cells comprising the chimeric receptors and / or recombinant nucleic acids described herein. In some embodiments, the recombinant cells are eukaryotic cells. In some embodiments, the eukaryotic cells are mammalian cells. In some embodiments, the mammalian cells are immune cells, neuronal cells, epithelial cells, and endothelial cells, or stem cells. In some embodiments, the immune cells are B cells, monocytes, natural killer cells, basophils, eosinophils, neutrophils, dendritic cells, macrophages, regulatory T cells, helper T cells, cytotoxic T cells, or other T cells.

[0026] In some embodiments, a recombinant cell of the disclosure comprises a) a first chimeric receptor and a second chimeric receptor described herein; and / or b) a first nucleic acid and a second nucleic acid described herein. In some embodiments, the first chimeric receptor and the second chimeric receptor do not have the same sequence. In other embodiments, the first nucleic acid or the second nucleic acid do not have the same sequence. In some embodiments, the first chimeric receptor modulates the expression and / or activity of the second chimeric receptor.

[0027] In some embodiments, the recombinant cell of the present disclosure further comprises an expression cassette encoding a protein operably linked to a promoter, and expression of the protein is regulated by a transcriptional regulator. In some embodiments, the protein is heterologous to the cell. In some embodiments, the promoter is a yeast GAL4 promoter. In some embodiments, the protein is a cytokine, a cytotoxin, a chemokine, an immunomodulator, a pro-apoptotic factor, an anti-apoptotic factor, a hormone, a differentiation factor, a de-differentiation factor, an immune cell receptor (e.g., TCR or CAR), or a reporter.

[0028] Further provided herein is a method for making a recombinant cell described herein, comprising: a) providing a cell capable of expressing a protein; and b) contacting the provided cell with a recombinant nucleic acid described herein into the provided cell. In some embodiments, the cells are obtained by leukapheresis performed on a sample obtained from a subject, and the cells are contacted ex vivo. In some embodiments, the recombinant nucleic acid is encapsulated in a viral capsid or lipid nanoparticle.

[0029] Another aspect of the present disclosure relates to a pharmaceutical composition comprising a pharma- ceutically acceptable carrier and one or more of the following: a) a recombinant nucleic acid described herein; and b) a recombinant cell described herein. In some embodiments, the composition comprises a recombinant nucleic acid described herein and a pharma- ceutically acceptable carrier. In certain embodiments, the recombinant nucleic acid is encapsulated in a viral capsid or lipid nanoparticle.

[0030] Further provided herein are systems for, inter alia, modulating cellular activity, inhibiting target cancer cells, or treating a condition in an individual in need thereof. In some embodiments, the systems include one or more of the following: a) a chimeric receptor described herein; b) a recombinant nucleic acid described herein; c) a recombinant cell described herein; and d) a pharmaceutical composition described herein.

[0031] In another aspect, the disclosure also provides a method for modulating an activity of a cell, the method comprising: a) providing a recombinant cell as described herein; and b) contacting the recombinant cell with a selected ligand, where binding of the selected ligand to the extracellular ligand-binding domain induces cleavage of the ligand-inducible proteolytic cleavage site, releasing a transcriptional regulator, and the released transcriptional regulator modulates an activity of the recombinant cell.

[0032] In some embodiments, the contacting is performed in vivo, ex vivo, or in vitro.

[0033] In some embodiments, the cellular activity that is modulated is selected from the group consisting of expression of a selected gene, proliferation, apoptosis, non-apoptotic death, differentiation, dedifferentiation, migration, secretion of a molecule, cell adhesion, and cytolytic activity, hi some embodiments, the released transcriptional regulator modulates expression of a cellular gene product.

[0034] In some embodiments, the released transcriptional regulator regulates expression of a heterologous gene product. In some embodiments, the gene product of the cell is selected from the group consisting of a chemokine, a chemokine receptor, a chimeric antigen receptor, a cytokine, a cytokine receptor, a differentiation factor, a growth factor, a growth factor receptor, a hormone, a metabolic enzyme, a pathogen-derived protein, a proliferation inducer, a receptor, an RNA guided nuclease, a site-specific nuclease, a T cell receptor, a toxin, a toxin-derived protein, a transcriptional regulator, a transcriptional activator, a transcriptional repressor, a translational regulator, a translational activator, a translational repressor, an activating immuno-receptor, an antibody, an apoptosis inhibitor, an apoptosis inducer, a modified T cell receptor, an immune activator, an immune inhibitor, and an inhibiting immuno-receptor.

[0035] In some embodiments, the released transcriptional regulator regulates differentiation of a cell, and the cell is an immune cell, a stem cell, a progenitor cell, or a precursor cell.

[0036] Further provided herein are, inter alia, methods for inhibiting target cell activity in an individual, comprising administering to the individual an effective number of a recombinant cell described herein, in some embodiments, the recombinant cell inhibits target cell activity in the individual.

[0037] In some embodiments, the target cell is a pathogenic cell. In some embodiments, the pathogenic cell is a cancer cell. In some embodiments, the target cell is an acute myeloma leukemia cell, an anaplastic lymphoma cell, an astrocytoma cell, a B cell cancer cell, a breast cancer cell, a colon cancer cell, an ependymoma cell, an esophageal cancer cell, a glioblastoma cell, a glioma cell, a leiomyosarcoma cell, a liposarcoma cell, a hepatoma cell, a lung cancer cell, a mantle cell lymphoma cell, a melanoma cell, a neuroblastoma cell, a non-small cell lung cancer cell, an oligodendroglioma cell, an ovarian cancer cell, a pancreatic cancer cell, a peripheral T cell lymphoma cell, a renal cancer cell, a sarcoma cell, a gastric cancer cell, a carcinoma cell, a mesothelioma cell, or a sarcoma cell.

[0038] In other aspects, the disclosure provides a method for treating a condition in an individual in need of treatment, comprising administering to the individual a first therapy comprising an effective number of recombinant cells described herein, wherein the recombinant cells treat the individual's condition.

[0039] In some embodiments, the method for treating a condition in an individual in need of treatment still further comprises administering a second therapy to the individual.

[0040] In some embodiments, the second therapy is selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, hormone therapy, and toxin therapy.

[0041] In some embodiments, the first and second therapies are administered together in the same composition or in separate compositions. In some embodiments, the first and second therapies are administered simultaneously. In other embodiments, the first and second therapies are administered sequentially. In certain embodiments, the first therapy is administered before the second therapy. In other embodiments, the first therapy is administered after the second therapy. In yet other embodiments, the first and second therapies are administered in alternation.

[0042] The present disclosure also provides the use of one or more of the following: a) a chimeric receptor described herein; b) a recombinant nucleic acid described herein; c) a recombinant cell described herein; and d) a composition described herein for the treatment of a medical condition. In some embodiments, the present disclosure relates to the use of any of the foregoing for the manufacture of a medicament for the treatment of a medical condition. In some embodiments, the medical condition is cancer. In certain embodiments, the cancer is a solid tumor, a soft tissue tumor, or a metastasis. [Brief description of the drawings]

[0043] [Figure 1A] 1A-1C show exemplary hybrid SynNotch CAR designs and predicted functions of hybrid SynNotch CAR circuits according to some embodiments of the present disclosure: Figure 1A is a diagram of all possible intracellular domain configurations. [Figure 1B] FIG. 1B is a detailed diagram of the hybrid SynNotch CAR domain. [Figure 1C] FIG. 1C shows the hypothesis of short-term proximal signaling and long-range transcriptional signaling induced by a hybrid SynNotch CAR. [Figure 2A]Figures 2A-2D provide a schematic summary of the results of experiments performed to demonstrate expression and circuit induction of various exemplary hybrid SynNotch CARs. Primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads (GIBCO) and transduced with two lentiviral constructs expressing either the receptor or the transcriptional reporter construct. Hybrid SynNotch CARs bearing the 41BB costimulatory domain (Figure 2A) or the CD28 costimulatory domain (Figure 2C) were sorted 5 days after the first T cell stimulation, and the receptor and reporter double positive population was purified. To assess circuit induction, T cells expressing the anti-CD19 receptor and BFP reporter with the 41BB costimulatory domain (Figure 2B) or the CD28 costimulatory domain (Figure 2D) were co-cultured with K562 cells (blue) or CD19+K562 cells (red) for 48 hours 14 days after the first T cell stimulation. Transcriptional activation of the inducible BFP reporter gene was then measured using a Fortessa X-50 (BD). [Figure 2B] Figures 2A-2D provide a schematic summary of the results of experiments performed to demonstrate expression and circuit induction of various exemplary hybrid SynNotch CARs. Primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads (GIBCO) and transduced with two lentiviral constructs expressing either the receptor or the transcriptional reporter construct. Hybrid SynNotch CARs bearing the 41BB costimulatory domain (Figure 2A) or the CD28 costimulatory domain (Figure 2C) were sorted 5 days after the first T cell stimulation, and the receptor and reporter double positive population was purified. To assess circuit induction, T cells expressing the anti-CD19 receptor and BFP reporter with the 41BB costimulatory domain (Figure 2B) or the CD28 costimulatory domain (Figure 2D) were co-cultured with K562 cells (blue) or CD19+K562 cells (red) for 48 hours 14 days after the first T cell stimulation. Transcriptional activation of the inducible BFP reporter gene was then measured using a Fortessa X-50 (BD). [Figure 2C]Figures 2A-2D provide a schematic summary of the results of experiments performed to demonstrate expression and circuit induction of various exemplary hybrid SynNotch CARs. Primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads (GIBCO) and transduced with two lentiviral constructs expressing either the receptor or the transcriptional reporter construct. Hybrid SynNotch CARs bearing the 41BB costimulatory domain (Figure 2A) or the CD28 costimulatory domain (Figure 2C) were sorted 5 days after the first T cell stimulation, and the receptor and reporter double positive population was purified. To assess circuit induction, T cells expressing the anti-CD19 receptor and BFP reporter with the 41BB costimulatory domain (Figure 2B) or the CD28 costimulatory domain (Figure 2D) were co-cultured with K562 cells (blue) or CD19+K562 cells (red) for 48 hours 14 days after the first T cell stimulation. Transcriptional activation of the inducible BFP reporter gene was then measured using a Fortessa X-50 (BD). [Figure 2D] Figures 2A-2D provide a schematic summary of the results of experiments performed to demonstrate expression and circuit induction of various exemplary hybrid SynNotch CARs. Primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads (GIBCO) and transduced with two lentiviral constructs expressing either the receptor or the transcriptional reporter construct. Hybrid SynNotch CARs bearing the 41BB costimulatory domain (Figure 2A) or the CD28 costimulatory domain (Figure 2C) were sorted 5 days after the first T cell stimulation, and the receptor and reporter double positive population was purified. To assess circuit induction, T cells expressing the anti-CD19 receptor and BFP reporter with the 41BB costimulatory domain (Figure 2B) or the CD28 costimulatory domain (Figure 2D) were co-cultured with K562 cells (blue) or CD19+K562 cells (red) for 48 hours 14 days after the first T cell stimulation. Transcriptional activation of the inducible BFP reporter gene was then measured using a Fortessa X-50 (BD). [Figure 3A]Figures 3A-3B show the expression of hybrid SynNotch CAR activation markers. T cells expressing anti-CD19 receptor with 41BB costimulatory domain (Figure 3A) or CD28 costimulatory domain (Figure 3B) and BFP reporter were generated as in Figure 2. Transduced cells were co-cultured with K562 cells (grey) or CD19+K562 cells (blue or red) for 48 hours. Expression of activation markers CD25, CD39, CD69 and PD-1 was then measured using a Fortessa X-50 (BD). [Figure 3B] Figures 3A-3B show the expression of hybrid SynNotch CAR activation markers. T cells expressing anti-CD19 receptor with 41BB costimulatory domain (Figure 3A) or CD28 costimulatory domain (Figure 3B) and BFP reporter were generated as in Figure 2. Transduced cells were co-cultured with K562 cells (grey) or CD19+K562 cells (blue or red) for 48 hours. Expression of activation markers CD25, CD39, CD69 and PD-1 was then measured using a Fortessa X-50 (BD). [Figure 4] Figure 4 summarizes the results of an experiment performed to demonstrate the growth of an exemplary hybrid SynNotch CAR. T cells expressing anti-CD19 receptors with 41BB or CD28 costimulatory domains and a BFP reporter were generated as in Figure 2. Transduced cells were stained with Cell Trace Far Red (CTFR) and co-cultured with K562 cells (grey) or CD19+K562 cells (blue or red) for 5 days. The dilution of the CTFR dye was then measured using a Fortessa X-50 (BD). [Figure 5A]Figures 5A-5B provide a schematic summary of the results of experiments performed to demonstrate cytokine secretion of exemplary hybrid SynNotch CARs. T cells expressing anti-CD19 receptors with 41BB costimulatory domains (Figure 5A) or CD28 costimulatory domains (Figure 5B) and BFP reporter were generated as in Figure 2. Transduced cells were co-cultured with K562 cells (grey) or CD19+K562 cells (blue or red). After 48 hours, a second bolus of Brefeldin A, Monensin, and K562 cells (with or without CD19+ expression) was added to the co-culture. The co-culture was incubated for an additional 6 hours, and then the transduced cells were assessed for intracellular expression of the cytokines Granzyme B, IFNy, IL-2, and TNFa using a Fortessa X50 (BD). Note that no data was collected for the hybrid SynNotch CAR with ICD CD28-CD3ζ-Gal4VP64. [Figure 5B] Figures 5A-5B provide a schematic summary of the results of experiments performed to demonstrate cytokine secretion of exemplary hybrid SynNotch CARs. T cells expressing anti-CD19 receptors with 41BB costimulatory domains (Figure 5A) or CD28 costimulatory domains (Figure 5B) and BFP reporter were generated as in Figure 2. Transduced cells were co-cultured with K562 cells (grey) or CD19+K562 cells (blue or red). After 48 hours, a second bolus of Brefeldin A, Monensin, and K562 cells (with or without CD19+ expression) was added to the co-culture. The co-culture was incubated for an additional 6 hours, and then the transduced cells were assessed for intracellular expression of the cytokines Granzyme B, IFNy, IL-2, and TNFa using a Fortessa X50 (BD). Note that no data was collected for the hybrid SynNotch CAR with ICD CD28-CD3ζ-Gal4VP64. [Figure 6A]Figures 6A-6B provide a schematic summary of the results of experiments performed to demonstrate targeted killing by an exemplary hybrid SynNotch CAR. T cells expressing anti-CD19 receptor with 41BB costimulatory domain (Figure 6A) or CD28 costimulatory domain (Figure 6B) and BFP reporter were generated as in Figure 2. A549 cells expressing CD19 ligand and nuclear stain mkate2 were allowed to attach to 96-well flat-bottom plates for 24 hours, and then transduced T cells were added at a 1:1 ratio. Plates were incubated in Incucyte and images and fluorescence of the plates were taken every 2 hours for 5 days. The number of A549 CD19+mkate2+ cells in culture at each time point was calculated using imaging software. For each experimental group, A549 cell counts were normalized to those of the hinge-Notch experimental group. [Figure 6B] Figures 6A-6B provide a schematic summary of the results of experiments performed to demonstrate targeted killing by an exemplary hybrid SynNotch CAR. T cells expressing anti-CD19 receptor with 41BB costimulatory domain (Figure 6A) or CD28 costimulatory domain (Figure 6B) and BFP reporter were generated as in Figure 2. A549 cells expressing CD19 ligand and nuclear stain mkate2 were allowed to attach to 96-well flat-bottom plates for 24 hours, and then transduced T cells were added at a 1:1 ratio. Plates were incubated in Incucyte and images and fluorescence of the plates were taken every 2 hours for 5 days. The number of A549 CD19+mkate2+ cells in culture at each time point was calculated using imaging software. For each experimental group, A549 cell counts were normalized to those of the hinge-Notch experimental group. [Figure 7]Figures 7A-7C show the in vivo efficacy of hybrid SynNotch CARs. Figure 7A is an illustration of the experimental timeline. NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ (NSG) mice were administered 0.5x106 Nalm6-Luc-GFP tumor cells intravenously. Bulk CD3+ T cells were transduced with anti-CD19 hybrid SynNotch CAR with ICD CD3ζ-Gal4VP64-CD28 and BFP reporter as in Figure 2. Four days after tumor injection, animals were administered 0.5x106 transduced CD3+ T cells via retro-orbital injection. Figure 7B shows tumor burden measured via bioluminescence imaging of luciferase-secreting tumor cells using IVIS Spectrum. Figure 7C shows survival curves. [Figure 8A] Figures 8A-8D show that minimized 4-1BB variants improve NF-kB signaling and reduce noise. Figure 8A is an illustration of the 41BB variants, showing the amino acids deleted to create the "no STS" and "trunc" 41BB costimulatory domains. [Figure 8B] FIG. 8B shows that T cells were co-transduced to express an anti-CD19 hybrid SynNotch CAR with the 41BB variant and a BFP reporter as described in FIG. [Figure 8C] FIG. 8C shows that circuit induction was assessed as described in FIG. [Figure 8D] Figure 8D shows a Jurkat cell line transduced to express the mCherry reporter under the common promoter of NfKB. This NfKB reporter cell line was then transduced with an anti-CD19 hybrid SynNotch CAR and co-cultured with K562 cells expressing CD19. After 24, 48, and 72 hours of co-culture, mCherry expression was assessed by flow cytometry as a proxy for NfKB activity. [Figure 9A]Figures 9A-9D show further iterations of the minimized 41BB variant. Figure 9A is an illustration of the 41BB variant showing the amino acids deleted to create the "min" 41BB costimulatory domain, and the region of amino acids deleted to create the "trunc41BBtrunc41BB" costimulatory domain. [Figure 9B] FIG. 9B shows that T cells were co-transduced to express an anti-CD19 hybrid SynNotch CAR with the 41BB variant and a BFP reporter as described in FIG. [Figure 9C] FIG. 9C shows that circuit induction was assessed as described in FIG. [Figure 9D] Figure 9D shows that Jurkat cell lines were transduced to express mCherry reporter under the common promoter of NfKB. This NfKB reporter cell line was then transduced with anti-CD19 hybrid SynNotch CAR and co-cultured with K562 cells expressing CD19. After 24, 48, and 72 hours of co-culture, mCherry expression was assessed by flow cytometry as a proxy for NfKB activity. [Figure 10A] Figures 10A-10B show the in vivo efficacy of Trunc41BB hybrid SynNotch CAR. Figure 10A is an illustration of the experimental timeline. NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ (NSG) mice were subcutaneously injected with 4x106 CD19 ligand expressing M28 tumor cells. Bulk CD3+ T cells were co-transduced with anti-CD19 hybrid SynNotch CAR with ICD shown in 10B and BFP reporter as described in Figure 2. Seven days after tumor injection, animals were administered 6x106 transduced CD3+ T cells via retro-orbital injection. [Figure 10B] FIG. 10B shows tumor volumes assessed weekly by caliper measurements. [Figure 11A]Figures 11A-11C show minimized CD28 variants reduce noise. Figure 11A is an illustration of the CD28 variants showing the amino acids deleted to create the "no STS" and "trunc" CD28 costimulatory domains. [Figure 11B] FIG. 11B shows T cells co-transduced to express an anti-CD19 hybrid SynNotch CAR with a CD28 variant and a BFP reporter as described in FIG. [Figure 11C] FIG. 11C shows the circuit induction evaluated as described in FIG. [Figure 12A] Figures 12A-12C show further iterations of minimized CD28 variants: Figure 12A is an illustration of the CD28 variants, showing the amino acids deleted to create the "CD28ΔTPRRP", "truncCD28ΔTPRRP" and "fully truncCD28" costimulatory domains. [Figure 12B] FIG. 12B shows T cells co-transduced to express an anti-CD19 hybrid SynNotch CAR with a CD28 variant and a BFP reporter as described in FIG. [Figure 12C] FIG. 12C shows the circuit induction evaluated as described in FIG. [Figure 13A] Figures 13A-13C show "third generation" variants. Figure 13A is an illustration of a "third generation" variant that includes one of the CD28 signaling motifs added to the C-terminus of the trunc41BB costimulatory domain. [Figure 13B] FIG. 13B shows T cells co-transduced to express anti-CD19 hybrid SynNotch CAR with third generation variants and a BFP reporter as described in FIG. [Figure 13C] FIG. 13C shows the circuit induction evaluated as described in FIG. [Figure 14A]Figures 14A-14B show the in vivo efficacy of Trunc41BB hybrid SynNotch CAR. Figure 14A is an illustration of the experimental timeline. NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ (NSG) mice were subcutaneously injected with 4x106 CD19 ligand expressing M28 tumor cells. Bulk CD3+ T cells were co-transduced with anti-CD19 hybrid SynNotch CAR with ICD shown in 14B and BFP reporter as described in Figure 2. Seven days after tumor injection, animals were injected with 3x106 transduced CD3+ T cells via retro-orbital injection. [Figure 14B] FIG. 14B shows tumor volumes assessed weekly by caliper measurements. [Figure 15A] Figures 15A-15B show expression and circuit induction of BCMA and ALPPL2 targeted hybrid SynNotch CARs. T cells expressing anti-BCMA and anti-ALPPL2 receptors with 41BB costimulatory domains and a BFP reporter were generated as described in Figure 2 (Figure 15A). Transduced cells were co-cultured with K562 cells (blue) or antigen positive (either BCMA or ALPPL2) K562 cells (red) for 48 hours (Figure 15B). [Figure 15B] Figures 15A-15B show expression and circuit induction of BCMA and ALPPL2 targeted hybrid SynNotch CARs. T cells expressing anti-BCMA and anti-ALPPL2 receptors with 41BB costimulatory domains and a BFP reporter were generated as described in Figure 2 (Figure 15A). Transduced cells were co-cultured with K562 cells (blue) or antigen positive (either BCMA or ALPPL2) K562 cells (red) for 48 hours (Figure 15B). [Figure 16]Figure 16 shows the in vivo efficacy of ALPPL2-targeted hybrid SynNotch CAR. NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ (NSG) mice were subcutaneously administered 4x106 M28 tumor cells as described in Figure 14. Bulk CD3+ T cells were co-transduced with anti-ALPPL2 CAR or anti-ALPPL2 hybrid SynNotch CAR with ICDs as shown in the figure and BFP reporter as described in Figure 2. Seven days after tumor injection, animals were administered 3x106 transduced CD3+ T cells via retro-orbital injection. Tumor volume was assessed weekly by caliper measurement. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0044] The present disclosure generally relates to a new class of chimeric receptors designed to combine fast timescale intracellular signaling and long timescale transcriptional regulation. In particular, some embodiments of the present disclosure provide (i) exemplary chimeric receptors (referred to herein as "hybrid SynNotch CARs") that incorporate CAR costimulatory and stimulatory domains, such as the cytoplasmic tail of the CD3 zeta chain, and transcriptional regulators. The structures of the cytoplasmic tails of these new receptors (costimulatory domain, CD3 zeta, transcription factors) can be configured in a variety of ways. As described in more detail below, the present disclosure also reveals hybrid receptor structures that reliably induce proximal T cell receptor costimulatory signals and gene regulation in target cell types, such as primary human T cells. The new hybrid SynNotch CARs provided herein can simultaneously stimulate (i) fast timescale (e.g., seconds to minutes) proximal signaling, and (ii) long timescale transcriptional regulation that would normally take hours to induce to a level sufficient to observe a change in cellular state.

[0045] As shown in more detail below in this disclosure, certain intracellular configurations of hybrid SynNotch CARs (e.g., with 4-1BB or CD28 costimulatory domains) exhibit antigen-independent induction of inducible transcriptional reporter elements, whereas other configurations do not. Furthermore, this disclosure shows that the configuration of the intracellular domain affects the behavior of the receptor both in the presence and absence of a ligand. Additionally, this disclosure illustrates that upon binding to a target antigen, a hybrid SynNotch CAR functionally induces signaling through its intracellular signaling domains (e.g., 4-1BB or CD28, and CD3 zeta), leading to expression of activation markers. In some preferred embodiments, this disclosure shows that upon binding to a target antigen, a hybrid SynNotch CAR provided herein functionally induces a short-term signaling cascade through its intracellular signaling domains (e.g., 4-1BB or CD28, and CD3 zeta), leading to proliferation of T cells. Additionally, the present disclosure shows that the signaling induced by the costimulatory and activation domains (e.g., CD3 zeta) of the hybrid SynNotch CARs of the present disclosure differs in type or mechanism, strength, intensity, or length of time to the CARs. Meanwhile, the present disclosure shows that the hybrid SynNotch CAR T cells disclosed herein can kill target cells at a similar rate as CAR T cells. Thus, the present disclosure provides that the hybrid SynNotch CAR induces a T cell activation and cytotoxicity program sufficient to cause target cell killing over a longer period of time (e.g., multiple days). Furthermore, the present disclosure shows that the hybrid SynNotch CAR T cells are effective in controlling and eliminating tumor burden in vivo.

[0046] The present disclosure further provides that, inter alia, the hybrid SynNotch CARs described herein can be optimized for antigen-independent activity by modification of the costimulatory domain (e.g., the 4-1BB costimulatory domain), resulting in better designs capable of both antigen-dependent transcriptional circuit induction and T cell signaling.

[0047] Although various features of the present disclosure may be described in the context of a single embodiment, those features may also be provided separately or in any suitable combination. Conversely, although the present disclosure may be described herein in the context of separate embodiments for clarity, the present disclosure may also be implemented in a single embodiment. The published patent applications and other published references, documents, manuscripts, and scientific literature cited herein are hereby incorporated by reference in their entirety for any purpose. Additionally, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[0048] In the following detailed description, reference is made to the accompanying drawings, which form a part hereof. In the drawings, like symbols generally identify like components unless the context indicates otherwise. The illustrative alternatives described in the detailed description, drawings, and claims are not intended to be limiting. Other alternatives may be used, and other changes may be made, without departing from the spirit or scope of the subject matter presented herein. It will be readily understood that the aspects generally described herein and illustrated in the figures can be arranged, substituted, combined, and designed in a wide variety of different configurations, all of which are expressly contemplated and made a part of this application.

[0049] definition The singular forms "a," "an," and "the" include plural references unless the context clearly indicates otherwise. For example, the term "a cell" includes one or more cells, including mixtures thereof. "A and / or B" is used herein to include all of the following options: "A," "B," "A or B," and "A and B."

[0050] As used herein, the terms "administration" and "administering" refer to the delivery of a composition or formulation by a route of administration, including, but not limited to, intravenous, intraarterial, intracerebral, intrathecal, intramuscular, intraperitoneal, subcutaneous, intramuscular, and combinations thereof. This term includes, but is not limited to, administration by a medical professional and self-administration.

[0051] The term "heterologous" refers to a polypeptide sequence or domain that is not native to the flanking sequences, e.g., the heterologous sequence is not found in nature associated with the polypeptide sequence present at one or both termini.

[0052] The term "derived from" as used herein with respect to a protein or polypeptide means origin or source and may include naturally occurring, recombinant, unpurified or purified polypeptides obtained from or derived based on a source or original protein or polypeptide. Thus, a protein or polypeptide derived from an original protein or polypeptide may comprise the original protein or polypeptide in part or in whole, or may be a fragment or variant of the original protein or polypeptide. In some instances, a polypeptide sequence or domain derived from a source or origin may be genetically or chemically modified.

[0053] The terms "host cell" and "recombinant cell" are used interchangeably herein. Such terms, like "cell," "cell culture," and "cell line," are understood to refer not only to the particular subject cell or cell line, but also to the progeny or potential progeny of such a cell or cell line, regardless of the number of transfers. It should be understood that not all progeny are completely identical to the parent cell. This is because certain modifications may occur in progeny, either due to mutations (e.g., deliberate or accidental mutations) or environmental influences, and such progeny may not in fact be identical to the parent cell, but are included within the scope of the terms used herein so long as the progeny retain the same functionality as the original cell or cell line.

[0054] As used herein, the term "operably linked" refers to a physical or functional connection between two or more elements, e.g., polypeptide sequences or polynucleotide sequences, that enables them to function in their intended manner.

[0055] The term "percent identity" as used herein in the context of two or more nucleic acids or proteins means identical or a specified percentage of identical nucleotides or amino acids (e.g., about 60% sequence identity over a particular region, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher identity default) when compared and aligned for maximum correspondence over a comparison window or designated region, as measured using the BLAST or BLAST 2.0 sequence comparison algorithm with default parameters described below, or by manual alignment and visual inspection. "BLAST" refers to two or more sequences or subsequences of the same test parameter. See, for example, the NCBI website at ncbi.nlm.nih.gov / BLAST. Such sequences are said to be "substantially identical." This definition also refers to, and may be applied to, the complement of the test sequence. This definition also includes sequences that have deletions and / or additions, as well as sequences that have substitutions. Sequence identity can be calculated over a region that is at least about 20 amino acids or nucleotides in length, or over a region that is 10-100 amino acids or nucleotides in length, or over the entire length of a given sequence. Sequence identity can be calculated using the GCS program package (Devereux Sequence identity can be calculated using published techniques and widely available computer programs, such as BLASTP, BLASTN, FASTA (Atschul et al., Nucleic Acids Res. 12:387, 1984), BLASTP, BLASTN, FASTA (Atschul et al., J Mol Biol 215:403, 1990), etc. Sequence identity can be measured using sequence analysis software, such as the Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705, using its default parameters.

[0056] As used herein, unless otherwise specified, a "therapeutically effective amount" of an agent is an amount sufficient to provide a therapeutic benefit in the treatment or management of a health condition, such as a disease (e.g., cancer), or an amount sufficient to delay or minimize one or more symptoms associated with cancer. A therapeutically effective amount of a compound means an amount of a therapeutic agent that, alone or in combination with another therapeutic agent, provides a therapeutic benefit in the treatment or management of cancer. The term "therapeutically effective amount" can encompass an amount that improves overall treatment, reduces or avoids the symptoms or causes of cancer, or enhances the therapeutic effectiveness of another therapeutic agent. An example of an "effective amount" is an amount sufficient to contribute to the treatment, prevention, or alleviation of a symptom or symptoms of a disease, which may also be referred to as a "therapeutically effective amount." "Alleviation" of a symptom means a decrease in the severity or frequency of the symptom(s), or the disappearance of the symptom(s). The precise amount of a composition that comprises a "therapeutically effective amount" will depend on the purpose of the treatment, and will be ascertainable by one of ordinary skill in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 2010); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (2016); Pickar, Dosage Calculations (2012); and Remington: The Science and Practice of Pharmacy, 22nd Edition, 2012, Gennaro, Ed., Lippincott, Williams & Wilkins).

[0057] As used herein, a "subject" or "individual" includes animals, such as humans (e.g., human individuals) and non-human animals. In some embodiments, a "subject" or "individual" is an individual under the care of a physician. Thus, a subject can be a human individual or an individual who has, is at risk of, or is suspected of having a disease of interest (e.g., cancer) and / or one or more symptoms of the disease. A subject can also be an individual who has been diagnosed as being at risk for a condition of interest at the time of diagnosis or thereafter. The term "non-human animal" includes all vertebrates, such as mammals, e.g., rodents, e.g., mice, and non-mammals, e.g., non-human primates, e.g., sheep, dogs, cows, chickens, amphibians, reptiles, and the like.

[0058] Where a range of values ​​is provided, unless the context clearly dictates otherwise, it is understood that each intervening value, to the tenth of the unit of the lower limit, between the upper and lower limits of that range, as well as any other stated or intervening value within that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also encompassed in the disclosure.

[0059] All ranges disclosed herein also encompass all possible subranges and combinations of subranges. Any range recited can be recognized as fully descriptive and allowing for division of the same range into at least one half, one third, one quarter, one fifth, one tenth, etc. As a non-limiting example, each range discussed herein can be readily divided into a lower third, a middle third, an upper third, and the like. Also, as one of ordinary skill in the art would understand, the language "up to," "at least," "greater than," "less than," and the like all refer to ranges that are inclusive of the recited numbers and that can then be divided into subranges as discussed above. And, as one of ordinary skill in the art would understand, ranges include individual members. Thus, for example, a group having 1-3 items means a group having 1, 2, or 3 items. Similarly, a group having 1-5 items means a group having 1, 2, 3, 4, or 5 items, and so forth.

[0060] It is understood that certain features of the present disclosure that are described in the context of separate embodiments may also be provided in combination in a single embodiment for clarity. Conversely, various features of the disclosure that are described in the context of a single embodiment may also be provided separately or in any suitable subcombination for brevity. All combinations of the embodiments of the present disclosure are specifically embraced by the present disclosure and are disclosed herein as if each combination were individually and expressly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein as if each such subcombination were individually and expressly disclosed herein.

[0061] One skilled in the art will appreciate that the chimeric receptors disclosed herein provide signals with a variety of properties, low to high ligand-induced transduction and (independently) low to moderate non-induced signaling. This range of activity is a novel feature that can be exploited to enhance and modulate the action of engineered cells. Furthermore, as described in more detail below, many of the receptor variants disclosed herein exhibit better expression compared to existing SynNotch receptors.

[0062] Notch Receptors Notch receptors are large transmembrane proteins that typically transmit signals upon binding to surface-bound ligands expressed on adjacent cells. Notch signaling relies on cell-cell communication, for example between two contacting cells, one of which is a "receiver" cell and the other a "sender" cell. Notch receptors expressed on receiver cells recognize ligands (delta / serrate / lag (DSL) protein family) expressed on sender cells. Binding of Notch and delta on these contacting cells leads to two-step proteolysis of the Notch receptor, ultimately releasing the intracellular part ("ICD") of the receptor from the membrane into the cytoplasm. Notch contains a matrix metalloprotease cleavage site (designated "S2") that is protected from cleavage by the Notch negative regulatory region ("NRR") when the receptor is not activated. The NRR consists of three LIN-12-Notch repeat ("LNR") modules and a heterodimerization domain ("HD"). This proteolysis is thought to be regulated by forces exerted by the sending cell, where DSL ligands attract the Notch receptor, causing a conformational change in the NRR, exposing a metalloprotease site, which is cleaved by constitutively active proteases (e.g., ADAM10), releasing the extracellular binding portion of the receptor and the negative regulatory domain. Release of the ligand-binding portion of the receptor now exposes another cleavage site (designated "S3"), which is cleaved by γ-secretase in the plasma membrane. This cleavage releases the nuclear-homing ICD from the plasma membrane. WR Gordon et al., Dev Cell (2015) 33:729-36. This released domain alters the behavior of the receiver cell by regulating transcription. The evolutionary divergence between vertebrates and invertebrates has been accompanied by at least two gene duplications in the Notch lineage: flies have one Notch gene, nematodes have two (GLP-1 and LIN-12), and mammals have four (NOTCH1-4).Notch signal transduction depends on three key events: (i) ligand recognition; (ii) conformational exposure of the ligand-dependent cleavage site; and (iii) assembly of a nuclear transcriptional activation complex.

[0063] Classical Notch signals are transmitted by a process called regulated intramembrane proteolysis. Notch receptors are normally maintained on the cell surface in a resting conformation that is resistant to proteolysis, but ligand binding initiates a proteolytic cascade that releases the intracellular domain (ICD) of the receptor from the membrane. The key regulated cleavage step occurs by ADAM metalloproteases, at a site called S2, just outside the plasma membrane. This truncated receptor, called NEXT (short for Notch extracellular truncation), remains tethered to the membrane until it is processed at the S3 site by the multiprotein enzyme complex γ-secretase.

[0064] After gamma-secretase cleavage, the ICD eventually enters the nucleus where it becomes the core of an assembly of transcription activation complexes containing DNA-binding transcription factors and transcriptional coactivators of the Mastermind family. This complex then binds one or more additional coactivator proteins, such as p300, to recruit the basal transcription machinery and activate the expression of downstream target genes.

[0065] Notch receptors have a modular domain organization. The ectodomain of Notch receptors consists of a series of N-terminal epidermal growth factor (EGF)-like repeats that are responsible for ligand binding. O-linked glycosylation of these EGF repeats, including modifications by O-fucose, Fringe, and Rumi glycosyltransferases, also regulates the activity of Notch receptors in response to different ligand subtypes in flies and mammals.

[0066] The EGF repeats are followed by three LIN-12 / Notch repeat (LNR) modules, which are unique to Notch receptors and have been widely reported to be involved in preventing premature activation of the receptor. The heterodimerization (HD) domain of Notch1 is split by furin cleavage, so that its N-terminal part is the end of the extracellular subunit and its C-terminal half is the beginning of the transmembrane subunit. Following the extracellular region, the receptor has a transmembrane segment and an intracellular domain (ICD) that contains transcriptional regulators.

[0067] Compositions of the Disclosure The present disclosure provides, among other things, a new class of chimeric receptors designed to combine fast timescale intracellular signaling and long timescale transcriptional regulation. In particular, some embodiments of the present disclosure provide new hybrid SynNotch receptor structures incorporating signaling domains (e.g., costimulatory, CD3 zeta, etc.) capable of initiating T cell activation in conjunction with customized transcriptional regulation. In some embodiments, the new receptors provided herein have linear amino acid signaling motifs that mediate signaling in T cells appended to the cytoplasmic tail of the SynNotch receptor. As shown in the examples and figures, these new receptors can stimulate both fast timescale (e.g., seconds to a minute) proximal signaling as well as long timescale transcriptional regulation that takes hours to induce to levels sufficient to observe changes in cellular state.

[0068] In one aspect, the present disclosure provides chimeric receptors comprising, from N-terminus to C-terminus: a) an extracellular ligand-binding domain having binding affinity for a selected ligand; b) a linking polypeptide; c) a transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and d) in any order: (i) an intracellular signaling domain (SD) comprising (1) at least one costimulatory domain and (2) an activation domain derived from a signaling molecule, and (ii) an intracellular domain comprising a transcription regulator. In some embodiments, binding of a selected ligand to the extracellular ligand-binding domain induces cleavage at the ligand-inducible proteolytic cleavage site located between the intracellular domain and the linking polypeptide. Furthermore, binding of a selected ligand to the extracellular ligand-binding domain can also induce a proximal signaling cascade through the intracellular SD. In some embodiments, a proximal signaling cascade refers to a fast time scale of signaling. For example, the signaling cascade can be induced in seconds to minutes. Alternatively, the signaling cascade can last from seconds to minutes. In some embodiments, such a proximal signaling cascade is induced through a T cell receptor costimulatory signal. Additionally, the chimeric receptors provided herein do not contain the LIN-12-Notch repeats (LNR) and / or heterodimerization domains (HD) of a Notch receptor. In some embodiments, the linking polypeptide can promote oligomerization of the chimeric receptor through intermolecular disulfide bonds.

[0069] Extracellular domains (ECDs) and ligands In some embodiments, the ECD of the chimeric receptors disclosed herein (e.g., hybrid SynNotch CARs) has binding affinity for one or more targeting ligands. The targeting ligands can be expressed on the cell surface or otherwise fixed, immobilized, or restrained so that mechanical forces can be exerted on the chimeric receptor. The cells can be pathogenic cells or human cells. In some embodiments, the human cells can be tumor cells. In some embodiments, the human cells can be terminally differentiated cells. Thus, without being bound to any particular theory, binding of the ECD of the chimeric receptors provided herein to a cell surface ligand does not necessarily remove the targeting ligand from the target cell surface, but instead creates a mechanical pulling force on the chimeric receptor. A normally soluble ligand can also be targeted if it is bound to a molecule on the surface or in the extracellular matrix. In some embodiments, the targeting ligand is a cell surface ligand. Non-limiting examples of suitable ligand classes include cell surface receptors, adhesion proteins, surface-bound carbohydrates, lipids, glycolipids, lipoproteins, lipopolysaccharides, integrins, mucins, and lectins. In some embodiments, the ligand is a protein. In some embodiments, the ligand is a carbohydrate.

[0070] In some embodiments, the ligand is a cluster of differentiation (CD) marker. In some embodiments, the CD markers are CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, CD8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD13 4, CD140 (PDGFR4), CD152, CD154, CD158, CD178, CD181 (CXCR1), CD182 (CXCR2), CD183 (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, and MAGE.

[0071] In some embodiments, the extracellular domain comprises a ligand-binding portion of a receptor. In some embodiments, the extracellular domain comprises an antigen-binding portion that binds one or more target antigens. In some embodiments, the antigen-binding portion comprises one or more antigen-binding determinants of an antibody or functional antigen-binding fragment thereof. Upon reading this disclosure, one of skill in the art will readily understand that the term "functional fragment thereof" or "functional variant thereof" refers to a molecule that has quantitative and / or qualitative biological activity in common with the wild-type molecule from which the fragment or variant is derived. For example, a functional fragment or functional variant of an antibody is one that retains essentially the same ability to bind to the same epitope as the antibody from which the functional fragment or functional variant is derived. For example, an antibody capable of binding to an epitope of a cell surface receptor can be truncated at the N-terminus and / or C-terminus and assessed for retention of epitope binding activity using assays known to those of skill in the art. In some embodiments, the antigen-binding portion is selected from the group consisting of an antibody, a nanobody, a diabody, a triabody, or a minibody, a F(ab')2 fragment, a F(ab) fragment, a single chain variable fragment (scFv), and a single domain antibody (sdAb), and / or a functional fragment thereof. In some embodiments, the antigen-binding portion comprises an scFv.

[0072] An antigen-binding portion can comprise a naturally occurring amino acid sequence or can be engineered, designed, or modified to provide desired and / or improved properties, such as binding affinity. In general, the binding affinity of an antigen-binding portion, such as an antibody, to a target antigen (e.g., CD19 antigen) can be calculated by the Scatchard method as described in Frankel et al., Mol. Immunol, 16:101-06, 1979. In some embodiments, the binding affinity is measured by antigen / antibody dissociation rate. In some embodiments, the binding affinity is measured by competitive radioimmunoassay. In some embodiments, the binding affinity is measured by ELISA. In some embodiments, the antibody affinity is measured by flow cytometry. An antibody that "selectively binds" to an antigen (such as CD19) is an antigen-binding portion that binds to the antigen with high affinity, e.g., with an equilibrium constant (KD) of 100 nM or less, such as 60 nM or less, such as 30 nM or less, such as 15 nM or less, or 10 nM or less, or 5 nM or less, or 1 nM or less, or 500 pM or less, or 400 pM or less, or 300 pM or less, or 200 pM or less, or 100 pM or less, but does not significantly bind to other antigens.

[0073] One skilled in the art can select an ECD based on the desired localization or function of the cells genetically engineered to express the chimeric receptor or hybrid SynNotch CAR of the present disclosure. For example, a chimeric receptor or hybrid SynNotch CAR with an ECD that includes an antibody specific for the HER2 antigen can target cells to HER2-expressing breast cancer cells. In some embodiments, the ECD of the hybrid SynNotch CAR of the present disclosure can bind to a tumor-associated antigen (TAA) or tumor-specific antigen (TSA). One skilled in the art will understand that a TAA includes a molecule, such as, for example, a protein, that is present in tumor cells and in normal cells or many normal cells at much lower concentrations than in tumor cells. In contrast, a TSA generally includes a molecule, such as, for example, a protein, that is present in tumor cells but not in normal cells.

[0074] In some cases, the antigen-binding portion is specific for an epitope present in an antigen expressed by a tumor cell, i.e., a tumor-associated antigen. The tumor-associated antigen may be, for example, an antigen associated with breast cancer cells, B-cell lymphoma, pancreatic cancer, Hodgkin's lymphoma cells, ovarian cancer cells, prostate cancer cells, mesothelioma, lung cancer cells, non-Hodgkin's B-cell lymphoma (B-NHL) cells, ovarian cancer cells, prostate cancer cells, mesothelioma cells, melanoma cells, chronic lymphocytic leukemia cells, acute lymphocytic leukemia cells, myeloid leukemia cells, neuroblastoma cells, gliomas, glioblastomas, colorectal cancer cells, and the like. It will also be understood that tumor-associated antigens may also be expressed by non-cancerous cells. In some embodiments, the antigen-binding domain is specific for an epitope present in a tissue-specific antigen. In some embodiments, the antigen-binding domain is specific for an epitope present in a disease-associated antigen.

[0075] Non-limiting examples of suitable target antigens include CD19, B7H3 (CD276), BCMA (CD269), alkaline phosphatase, placenta-like 2 (ALPPL2), green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), signal regulatory protein alpha (SIRPα), CD123, CD171, CD179α, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1 , CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, ephrin B2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Rα, KIT (CD117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, and Axl.

[0076] In some embodiments, the target antigen is CD19, B7H3 (CD276), BCMA (CD269), ALPPL2, CD123, CD171, CD179α, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD33, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, EphrinB2, FAP, FLT3, GD2, GD3, GM3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Ra, KIT (CD117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, Axl, GPC2, human epidermal growth factor receptor 2 (Her2 / neu), CD276 (B7H3), IL-13Rα1, IL-13Rα2, α-fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen-125 (CA-125), CA19-9, calretinin, MUC-1, epithelial membrane protein (EMA), epithelial tumor antigen (ETA), tyrosinase, melanoma-associated antigen (MAGE), CD34, CD45, CD123, CD93, CD99, CD117, chromogranin, cytokeratin, desmin, glial fibrillary acidic protein (GFAP), gross cystic disease fluid protein (gross cystic disease fluid protein)(GCDFP-15), ALK, DLK1, FAP, NY-ESO, WT1, HMB-45 antigen, protein melan-A (melanoma antigen recognized by T lymphocytes;MART-1), myo-D1, muscle-specific actin (MSA), neurofilament, neuron-specific enolase (NSE), placental alkaline phosphatase, synaptophysin, thyroglobulin, thyroid transcription factor-1, AOC3 (VAP-1), CAM-3001, CCL11 (eotaxin-1), CD125, CD147 (basigin), CD154 (CD40L), CD2, CD20, CD23 (IgE receptor), CD25 (subunit of the heterodimeric IL-2 receptor), CD3, CD4, CD5, IFN-α, IFN-γ, IgE, IgE Fc region, IL-1, IL-12, IL-23, IL-13, IL-17, IL-17A, IL-22, IL-4, IL-5, IL-5, IL-6, IL-6 receptor, integrin α4, integrin α4β7, LFA-1 (CD11α), myostatin, OX-40, sclerostin, SOST, TGFβ1, TNF-α, VEGF-A, pyruvate kinase isoenzyme M2 (tumor M2-PK), CD20, CD5, CD7, CD3, TRBC1, TRBC2, BCMA, CD 38, CD123, CD93, CD34, CD1α, SLAMF7 / CS1, FLT3, CD33, CD123, TALLA-1, CSPG4, DLL3, kappa light chain, lambda light chain, CD16 / FcγRIII, CD64, FITC, CD22, CD27, CD30, CD70, GD2 (ganglioside G2), GD3, EGFRvIII (epidermal growth factor variant III), EGFR and its isovarients, TEM-8, sperm protein 17 (Sp17), and mesothelin;

[0077] Further non-limiting examples of suitable antigens include PAP (prostatic acid phosphatase), prostate stem cell antigen (PSCA), prostein, NKG2D, TARP (T cell receptor gamma alternate reading frame protein), Trp-p8, STEAP1 (six transmembrane epithelial antigen 1 of the prostate), aberrant ras protein, aberrant p53 protein, integrin β3 (CD61), galactin, K-Ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene), Ral-B, GPC2, CD276 (B7H3), or IL-13Rα. In some embodiments, the antigen is Her2. In some embodiments, the antigen is ALPPL2. In some embodiments, the antigen is BCMA. In some embodiments, the antigen binding portion of the ECD is specific for a reporter protein such as BFP, GFP, or eGFP. Non-limiting examples of such antigen binding portions include the LaG17 anti-GFP nanobody. In some embodiments, the antigen binding portion of the ECD comprises an anti-BCMA fully humanized VH domain (FHVH). In some embodiments, the antigen is signal regulatory protein alpha (SIRPα).

[0078] Additional antigens suitable for targeting by the chimeric receptors disclosed herein include, but are not limited to, GPC2, human epidermal growth factor receptor 2 (Her2 / neu), CD276 (B7H3), IL-13Rα1, IL-13Rα2, alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen-125 (CA-125), CA19-9, calretinin, MUC-1, epithelial membrane protein (EMA), epithelial tumor antigen (ETA). Other suitable target antigens include, but are not limited to, tyrosinase, melanoma associated antigen (MAGE), CD34, CD45, CD123, CD93, CD99, CD117, chromogranin, cytokeratin, desmin, glial fibrillary acidic protein (GFAP), gross cystic disease fluid protein (GCDFP-15), ALK, DLK1, FAP, NY-ESO, WT1, HMB-45 antigen, protein melan-A (melanoma antigen recognized by T lymphocytes; MART-1), myo-D1, muscle specific actin (MSA), neurofilament, neuron specific enolase (NSE), placental alkaline phosphatase, synaptophysin, thyroglobulin, and thyroid transcription factor-1.

[0079] Additional antigens suitable for targeting by the chimeric receptors disclosed herein include AOC3 (VAP-1), CAM-3001, CCL11 (eotaxin-1), CD125, CD147 (basigin), CD154 (CD40L), CD2, CD20, CD23 (IgE receptor), CD25 (subunit of the heteromeric IL-2 receptor), CD3, CD4, CD5, IFN-α, IFN-γ, IgE, IgE These include, but are not limited to, those associated with inflammatory diseases such as the Fc region, IL-1, IL-12, IL-23, IL-13, IL-17, IL-17A, IL-22, IL-4, IL-5, IL-5, IL-6, IL-6 receptor, integrin α4, integrin α4β7, LFA-1 (CD11α), myostatin, OX-40, sclerostin, SOST, TGFβ1, TNF-α, and VEGF-A.

[0080] Additional antigens suitable for targeting by the chimeric receptors and hybrid SynNotch CARs disclosed herein include, but are not limited to, pyruvate kinase isoenzyme type M2 (tumor M2-PK), CD20, CD5, CD7, CD3, TRBC1, TRBC2, BCMA, CD38, CD123, CD93, CD34, CD1α, SLAMF7 / CS1, FLT3, CD33, CD123, TALLA-1, CSPG4, DLL3, kappa light chain, lambda light chain, CD16 / FcγRIII, CD64, FITC, CD22, CD27, CD30, CD70, GD2 (ganglioside G2), GD3, EGFRvIII (epidermal growth factor variant III), EGFR and its isovariants, TEM-8, sperm protein 17 (Sp17), and mesothelin. Further non-limiting examples of suitable antigens include PAP (prostatic acid phosphatase), prostate stem cell antigen (PSCA), prostein, NKG2D, TARP (T cell receptor gamma alternative reading frame protein), Trp-p8, STEAP1 (six transmembrane epithelial antigen 1 of the prostate), abnormal ras protein, abnormal p53 protein, integrin β3 (CD61), galactin, K-Ras (V-Ki-ras2 Kirsten rat sarcoma viral oncogene), and Ral-B. In some embodiments, the antigen is GPC2, CD19, Her2 / neu, CD276 (B7H3), IL-13Rα1, or IL-13Rα2. In some embodiments, the antigen is Her2. In some embodiments, the antigen is ALPPL2. In some embodiments, the antigen is BCMA. In some embodiments, the antigen-binding portion of the ECD is specific for a reporter protein, such as GFP or eGFP. Non-limiting examples of such antigen-binding moieties include the LaG17 anti-GFP nanobody. In some embodiments, the antigen-binding portion of the ECD comprises an anti-BCMA fully humanized VH domain (FHVH).

[0081] In some embodiments, antigens suitable for targeting by the chimeric receptors and hybrid SynNotch CARs disclosed herein include ligands derived from pathogens. For example, the antigen can be HER2, which is produced by HER2-positive breast cancer cells. In some embodiments, the antigen can be CD19, which is expressed in B-cell leukemia. In some embodiments, the antigen can be EGFR, which is expressed in glioblastoma multiforme (GBM), but is less expressed in healthy CNS tissues. In some embodiments, the antigen can be CEA, which is associated with adult cancers, such as colon cancer.

[0082] In some embodiments, the antigen binding portion of the ECD is specific for a cell surface target, non-limiting examples of which include CD19, CD30, Her2, CD22, ENPP3, EGFR, CD20, CD52, CD11α, and α-integrin. In some embodiments, the chimeric receptors and hybrid SynNotch CARs disclosed herein comprise an extracellular domain having an antigen binding portion that binds to CD19, CEA, HER2, MUC1, CD20, ALPPL2, BCMA, or EGFR. In some embodiments, the chimeric receptors provided herein (e.g., hybrid SynNotch CARs) comprise an extracellular domain that comprises an antigen binding portion that binds to CD19. In some embodiments, the chimeric receptors provided herein (e.g., hybrid SynNotch CARs) comprise an extracellular domain that comprises an antigen binding portion that binds to ALPPL2. In some embodiments, the chimeric receptors provided herein (e.g., hybrid SynNotch CARs) comprise an extracellular domain that comprises an antigen binding portion that binds to BCMA. In some embodiments, the chimeric receptors provided herein (e.g., hybrid SynNotch CARs) comprise an extracellular domain that comprises an antigen-binding moiety that binds to Her2. In some embodiments, the chimeric receptors and hybrid SynNotch CARs disclosed herein comprise an extracellular domain that comprises an antigen-binding moiety that binds to CD19, ALPPL2, BCMA, or Her2.

[0083] In some embodiments, the extracellular domain comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the sequences set forth in SEQ ID NOs: 1, 2, 46, and 47. In some embodiments, the extracellular domain comprises an amino acid sequence having at least 90% sequence identity to the sequences set forth in SEQ ID NOs: 1, 2, 46, and 47. In some embodiments, the extracellular domain comprises an amino acid sequence having at least 95% sequence identity to the sequences set forth in SEQ ID NOs: 1, 2, 46, and 47. In some embodiments, the extracellular domain comprises an amino acid sequence having 100% sequence identity to the sequences set forth in SEQ ID NOs: 1, 2, 46, and 47. In some embodiments, the extracellular domain comprises the amino acid sequence set forth in SEQ ID NOs:1, 2, 46, and 47, wherein one, two, three, four, or five of the amino acid residues in any one of SEQ ID NOs:1, 2, 46, and 47 are replaced with a different amino acid residue.

[0084] Linked Polypeptides As described above, the chimeric receptor of the present disclosure comprises a linking polypeptide sequence disposed between the extracellular binding domain (ECD) and the transmembrane domain (TMD). Existing "SynNotch" receptors comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with the Notch receptor JMD, including the NRR, a TMD, and an ICD. In contrast, the chimeric receptor and hybrid SynNotch CAR comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with the Notch receptor JMD, but lacking the NRR (LIN-12-Notch repeat (LNR) module, and heterodimerization domain), a TMD, and an ICD. In other words, in the hybrid SynNotch CAR, the linking polypeptide replaces the negative regulatory region (NRR) and heterodimerization (HD) domain of native Notch. A polypeptide linker can be used that is 3 to 50 amino acid residues long (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. amino acid residues). In some embodiments, the length and amino acid composition of the linker polypeptide sequence can be optimized to alter the orientation and / or proximity of the ECD and TMD relative to one another to achieve the desired activity of the chimeric receptor of the present disclosure. All of these sequences can be used as the linking polypeptide of the chimeric receptor of the present disclosure.

[0085] In some embodiments, the linking polypeptide encompassed by the present disclosure can include a polypeptide, such as a hinge linker, that can promote oligomerization of chimeric receptors through intermolecular disulfide bonds. In some embodiments, the hinge linker of the present disclosure includes an oligomerization domain (e.g., a hinge domain) that contains one or more polypeptide motifs that promote oligomerization of chimeric receptors through intermolecular disulfide bonds. In these examples, within the chimeric receptors disclosed herein, the hinge domain generally includes a flexible polypeptide connector region located between the ECD and the TMD. Thus, the hinge domain provides flexibility between the ECD and the TMD, and further provides a site for intermolecular disulfide bonds between two or more chimeric receptor monomers to form an oligomeric complex. In some embodiments, the hinge domain includes a motif that promotes dimerization of the chimeric receptors disclosed herein. In some embodiments, the hinge domain includes a motif that promotes trimerization of the chimeric receptors disclosed herein (e.g., a hinge domain derived from OX40). Hinge polypeptide sequences suitable for the compositions and methods of the present disclosure can be naturally occurring hinge polypeptide sequences (e.g., from naturally occurring immunoglobulins) or can be engineered, designed, or modified to provide desired and / or better properties, such as transcriptional regulation properties. Suitable hinge polypeptide sequences include, but are not limited to, those derived from IgA, IgD, and IgG1 hinge domains, IgG subclasses such as IgG2 hinge domains, IgG3 hinge domains, IgG4 hinge domains, or functional variants thereof. In some embodiments, the hinge polypeptide sequence contains one or more CXXC motifs. In some embodiments, the hinge polypeptide sequence contains one or more CPPC motifs.Additional information in this regard can be found, for example, in a recent review by G. Vidarsson et al., Frontiers Immunol (2014) 5:520 (doi: 10.3389 / fimmu.2014.00520), which is incorporated by reference in its entirety.

[0086] The hinge polypeptide sequence can also be derived from a CD8α hinge domain, a CD28 hinge domain, a CD152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an OX40 hinge domain, and functional variants thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from a CD8a hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from a CD28 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from an OX40 hinge domain or a functional variant thereof. In some embodiments, the hinge domain comprises a hinge polypeptide sequence derived from an IgG4 hinge domain or a functional variant thereof.

[0087] The hinge linker can comprise about 5 to about 60 amino acids derived from or overlapping with a selected hinge domain, e.g., at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 12, at least about 15, at least about 17, at least about 20, at least about 22, at least about 24, at least about 26, at least about 28, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, or at least about 60 amino acids. In embodiments of the invention, the hinge linker has no more than about 60 amino acids, less than about 55, less than about 50, less than about 45, less than about 40, less than about 35, less than about 32, less than about 30, less than about 29, less than about 28, less than about 27, less than about 26, less than about 25, less than about 24, less than about 23, less than about 22, less than about 21, less than about 20, less than about 18, less than about 16, less than about 14, less than about 12, or less than about 10 amino acids.

[0088] In some embodiments, the linking polypeptide sequence comprises a sequence having at least 80% sequence identity, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity, to the sequence set forth in SEQ ID NO:3. In some embodiments, the linking polypeptide sequence comprises an amino acid sequence having at least 90% sequence identity to the sequence set forth in SEQ ID NO:3. In some embodiments, the linking polypeptide sequence comprises an amino acid sequence having at least 95% sequence identity to the sequence set forth in SEQ ID NO:3. In some embodiments, the linking polypeptide sequence comprises an amino acid sequence having at least 99% sequence identity to the sequence set forth in SEQ ID NO:3. In some embodiments, the linking polypeptide sequence comprises an amino acid sequence identical to the sequence set forth in SEQ ID NO:3. In some embodiments, the linking polypeptide sequence comprises an amino acid sequence set forth in SEQ ID NO:3, wherein one, two, three, four, or five of the amino acid residues of any one of SEQ ID NO:3 are replaced with a different amino acid residue.

[0089] Transmembrane domain (TMD) As described above, the chimeric receptors of the present disclosure comprise a TMD that contains one or more ligand-inducible proteolytic cleavage sites.

[0090] Examples of proteolytic cleavage sites of Notch receptors (e.g., S2 or S3) are described above. Additional proteolytic cleavage sites suitable for the compositions and methods disclosed herein include, but are not limited to, metalloproteinase cleavage sites of MMPs selected from collagenase-1, -2, and -3 (MMP-1, -8, and -13), gelatinase A and B (MMP-2 and -9), stromelysin 1, 2, and 3 (MMP-3, -10, and -11), matrilysin (MMP-7), and membrane metalloproteinases (MT1-MMP and MT2-MMP). For example, the cleavage sequence of MMP-9 is Pro-XX-Hy (wherein X is any residue; Hy represents a hydrophobic residue such as Leu, Ile, Val, Phe, Trp, Tyr, Val, Met, Pro), e.g., Pro-XX-Hy-(Ser / Thr), e.g., Pro-Leu / Gln-Gly-Met-Thr-Ser or Pro-Leu / Gln-Gly-Met-Thr. Another example of a suitable protease cleavage site is a plasminogen activator cleavage site, e.g., a urokinase plasminogen activator (uPA) or tissue plasminogen activator (tPA) cleavage site. Another example of a suitable protease cleavage site is a prolactin cleavage site. Specific examples of cleavage sequences of uPA and tPA include sequences containing Val-Gly-Arg. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a tobacco etch virus (TEV) protease cleavage site, e.g., Glu-Asn-Leu-Tyr-Thr-Gln-Ser, where the protease cleaves between glutamine and serine. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is an enterokinase cleavage site, e.g., Asp-Asp-Asp-Asp-Lys, where the cleavage occurs after the lysine residue. Another example of a protease cleavage site that can be included in a proteolytically cleavable linker is a thrombin cleavage site, e.g., Leu-Val-Pro-Arg.Further suitable linkers that include a protease cleavage site include sequences cleavable by the following proteases: PreScission™ protease (a fusion protein comprising human rhinovirus 3C protease and glutathione-S-transferase), thrombin, cathepsin B, Epstein-Barr virus protease, MMP-3 (stromelysin), MMP-7 (matrilysin), MMP-9; thermolysin-like MMPs, matrix metalloproteinase 2 (MMP-2), cathepsin L; cathepsin D, matrix metalloproteinase l (MMP-l), urokinase-type plasminogen activator, membrane type 1 1) Matrix metalloproteinases (MT-MMPs), stromelysin 3 (or MMP-11), thermolysin, fibroblast collagenase and stromelysin-1, matrix metalloproteinase 13 (collagenase-3), tissue-type plasminogen activator (tPA), human prostate-specific antigen, kallikrein (hK3), neutrophil elastase, and calpain (calcium-activated neutral protease). Proteases that are not native to the host cell in which the receptor is expressed (e.g., TEV) can be used as an additional regulatory mechanism, where receptor activation is reduced until a protease is expressed or otherwise provided. In addition, proteases may function as an independent regulatory mechanism in tumor- or disease-associated (expressed to a significantly higher extent than in normal tissues). For example, some matrix metalloproteinases are highly expressed in certain cancer types.

[0091] In general, a suitable TMD for the chimeric receptors disclosed herein can be any transmembrane domain of a type I transmembrane receptor that contains at least one γ-secretase cleavage site. A detailed description of the structure and function of the γ-secretase complex and its substrate proteins, including amyloid precursor protein (APP) and Notch, can be found, for example, in a recent review by Zhang et al., Frontiers Cell Neurosci (2014). Non-limiting suitable TMDs derived from type I transmembrane receptors include those derived from CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A, and IFNAR2, where the TMD contains at least one γ-secretase cleavage site. Additional TMDs suitable for the compositions and methods described herein include, but are not limited to, transmembrane domains from type I transmembrane receptors IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKHD1, NECTIN1, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM. In some embodiments, the TMD of the chimeric receptor of the present disclosure is a TMD derived from the TMD of a member of the calsyntenin family, such as alcadein alpha and alcadein gamma. In some embodiments, the TMD of the chimeric receptor of the present disclosure is a TMD known in a Notch receptor. In some embodiments, the TMD of the chimeric receptor of the present disclosure is a TMD from a different Notch receptor.For example, in Mini Notch, which is based on human Notch1, the Notch1 TMD can be replaced with the h2 TMD, the Notch3 TMD, the Notch4 TMD, or a Notch TMD from a non-human animal, such as zebrafish (Danio rerio), fruit fly (Drosophila melanogaster), African clawed frog (Xenopus laevis), or red jungle fowl (Gallus gallus).

[0092] In some embodiments, the amino acid substitution(s) in the TMD comprises one or more substitutions in the "GV" motif of the TMD. In some embodiments, at least one of such substitution(s) comprises a substitution to alanine. For example, one, two, three, four, five, or more amino acid residues of FMYVAAAAFVLLFFVGCGVLL (SEQ ID NO: 4) may be replaced with a different amino acid residue. In some embodiments, the amino acid residues at positions 18 and / or 19 of the "GV" motif in SEQ ID NO: 4 are replaced with a different amino acid residue. In some embodiments, the glycine residue at position 18 of SEQ ID NO: 4 is replaced with a different amino acid residue. In some embodiments, the valine residue at position 19 of SEQ ID NO: 4 is replaced with a different amino acid residue. In some embodiments, the transmembrane domain comprises an amino acid sequence having a sequence corresponding to SEQ ID NO: 4 with a mutation at a position corresponding to position 18 of SEQ ID NO: 4, such as a G18A mutation. In some embodiments, the transmembrane domain comprises an amino acid sequence having a sequence corresponding to SEQ ID NO: 4 with a mutation at a position corresponding to position 19 of SEQ ID NO: 4, such as a V19A mutation. The TMD can be derived from SEQ ID NO: 4, but can be longer or shorter. For example, the TMD can be 1, 2, 3, 4, or more amino acids longer or shorter than SEQ ID NO: 4. In some embodiments, the TMD comprises a sequence having at least 80% sequence identity to SEQ ID NO: 4, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity.

[0093] Stop Transfer Sequence (STS) The chimeric receptors of the present disclosure include an STS that includes a charged hydrophilic domain located between the TMD and ICD. Without being bound to any particular theory, this domain located between the TMD and ICD prevents the ICD from entering the cell membrane. In some embodiments, a single peptide containing about 1 to about 40 amino acid residues (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more amino acid residues) with most residues having a charged side chain under physiological conditions can be used as an STS. In short STS embodiments (e.g., less than about 6 amino acids), about 5 or 6 of the amino acids will have a charged side chain. In some embodiments, the STS comprises about 1-15, about 5-20, about 8-25, about 10-30, about 12-35, about 14-40, about 5-40, about 10-35, about 15-30, about 20-25, about 20-40, about 10-30, about 4-20, or about 5-25 amino acid residues. In some embodiments, the STS comprises about 4-10, about 5-12, about 6-14, about 7-18, about 8-20, about 9-22, about 10-24, or about 11-26 amino acid residues. In some embodiments, the STS comprises about 4-10 residues, such as 4, 5, 6, 7, 8, 9, or 10 amino acid residues.

[0094] In some embodiments, the STS comprises a sequence having at least about 80% sequence identity, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity, to the STS domain of a type 1 receptor. In some embodiments, the STS comprises an amino acid sequence having at least 90% sequence identity to the STS domain of a type 1 receptor. In some embodiments, the STS comprises a sequence having at least 70% sequence identity, such as at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity, to an STS sequence from Notch1, Notch2, Notch3, Notch4, CSF1R, CXCL16, DAG1, GHR, PTPRF, AGER, KL, NRG1, LRP1B, Jag2, EPCAM, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA3, IL1R2, or PTPRM. In some embodiments, the STS comprises a sequence that contains only Lys (K) or Arg (R) in the first four residues. In some embodiments, the STS comprises 1, 2, 3, 4, 5, or more basic residues. In some embodiments, the STS contains 5, 4, 3, 2, 1, or 0 aromatic residues or residues with hydrophobic and / or bulky side chains.

[0095] In some embodiments, the STS comprises a sequence having at least 80% sequence identity, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity, to SKRKRKH (SEQ ID NO:5). In some embodiments, the STS comprises an amino acid sequence having at least 90% sequence identity to SEQ ID NO:5. The STS can be derived from SEQ ID NO:5, but can be longer or shorter. For example, the STS can be 1, 2, 3, 4, or more amino acids longer or shorter than SEQ ID NO:5. In some embodiments, the STS comprises a sequence having at least 80% sequence identity, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity, to SEQ ID NO:5. In some embodiments, the STS comprises an amino acid sequence having at least 95% sequence identity to SEQ ID NO:5. In some embodiments, an STS comprises an amino acid sequence having at least 100% sequence identity to SEQ ID NO: 5. In some embodiments, an STS comprises the amino acid sequence of SEQ ID NO: 5, wherein one, two, three, four, or five of the amino acid residues of SEQ ID NO: 5 are replaced with a different amino acid residue.

[0096] Intracellular domain (ICD) The chimeric receptor of the present disclosure comprises an intracellular domain (ICD) that includes, in any order: (i) an intracellular signaling domain (SD) that includes at least one costimulatory domain and an activation domain from a signaling molecule, and (ii) an intracellular domain that includes a transcriptional regulator. In other words, the ICD of the chimeric receptor of the present disclosure can have at least three different domains, as shown in Figures 1A-1B. The three different domains can be arranged in a specific order and operably linked to each other via one or more linkers. In some embodiments, the three different domains are linked via a (GS)n linker, as shown in Figure 1B. n can be any number selected from 1-100. For example, n can be 2, 3, 4, 5, 6, 7, 8, 9, or 10. In other embodiments, n can be 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. An exemplary GS linker can have three GS repeats and a sequence of GSGSGSGS (SEQ ID NO: 6). One of skill in the art would know how to modify the linker to suit a particular application.

[0097] In some embodiments, the intracellular domain of a chimeric receptor of the present disclosure further comprises an intracellular signaling domain, which can have at least two distinct domains, i.e., at least one costimulatory domain and an activation domain.

[0098] In some embodiments, the costimulatory domain comprises a sequence derived from a signaling molecule. The signaling molecule can be a protein selected from class 1 and / or class 3 human membrane proteins. In some embodiments, the signaling molecule is selected from CD28, ICOS, CTLA4, PD1, PD1H, BTLA, B71, B7H1, CD226, CRTAM, TIGIT, CD96, TIM1, TIM2, TIM3, TIM4, CD2, SLAM, 2B4, Ly108, CD84, Ly9, CRACC, BTN1, BTN2, BTN3, LAIR1, LAG3, CD160, 4-1BB, OX40, CD27, GITR, CD30, TNFR1, TNFR2, HVEM, LT_R, DR3, DCR3, FAS, CD40, RANK, OPG, TRAILR1, TACI, BAFFR, BCMA, TWEAKR, EDAR, XEDAR , RELT, DR6, TROY, NGFR, CD22, Siglec-3, Siglec-5, Siglec-7, KLRG1, NKR-P1A, ILT2, KIR2DL1, KIR3DL1, CD94-NKG2A, CD300b, CD300e, TREM1, TREM2, ILT7, ILT3, ILT4, TLT-1, CD200R, CD300a, CD300f, DC-SIGN, B7-2, Aladdin-1, LAT, BLNK, LAYN, SLP76, EMB-LMP1, HIV-NEF, HVS-TIP, HVS-ORF5, and HVS-stpC, and derivatives, mutants, variants, fragments, and combinations thereof. In other embodiments, the signaling molecule is selected from the list consisting of OX40, ICOS, 4-1BB, CTLA4, CD28, CD30, CD2, CD27, and CD226, as well as derivatives, mutants, variants, fragments, and combinations thereof.In some embodiments, the signaling molecule is selected from the group consisting of 4-1BB, BAFF-R, BCMA, BTLA, CD2, CD200R, CD244, CD28, CD300a, CD300f, CD40, CD7, CD72, CD96, CRACC, CRTAM, CTLA4, CXADR, DC-SIGN, GITR, HAVCR2, ICOS, ILT2, ILT3, ILT4, KIR2DL1, KIR3DL1, KLRG1, LAG3, LAIR1, NKG2D, NKR-P1A, NTB-A, PD1, Siglec-3, TACI, TIGIT, TLT-1, and TNR8 (CD30), as well as derivatives, mutants, variants, fragments, and combinations thereof. In other embodiments, the signaling molecule is CD28 or 4-1BB. In one preferred embodiment, the costimulatory domain comprises a sequence derived from CD28. In another preferred embodiment, the costimulatory domain comprises a sequence derived from 4-1BB, hi another embodiment, the costimulatory domain comprises one of the CD28 signaling motifs added to the C-terminus of the trunc41BB costimulatory domain.

[0099] In some embodiments, the activation domain comprises one or more conserved amino acid motifs that function as substrates for phosphorylation, such as, for example, immunoreceptor tyrosine-based activation motifs (ITAMs). In some embodiments, the activation domain comprises at least one, at least two, at least three, at least four, or at least five specific tyrosine-based motifs selected from ITAM motifs, ITIM motifs, and / or related intracellular motifs that function as substrates for phosphorylation. In some embodiments of the present disclosure, the activation domain of the intracellular signaling domain comprises at least one, at least two, at least three, at least four, or at least five ITAMs. In general, any activation domain that comprises an ITAM can be suitably used in constructing the chimeric receptors described herein. ITAMs generally comprise a conserved protein motif that is often present in the tail portion of signaling molecules expressed in many immune cells. The motif can comprise two repeats of the amino acid sequence YxxL / I separated by 6-8 amino acids, where each x is independently any amino acid, making the conserved motif YxxL / Ix(6-8)YxxL / I. ITAMs in signaling molecules are important for intracellular signal transduction, mediated at least in part by phosphorylation of tyrosine residues within the ITAM following activation of the signaling molecule. ITAMs can also serve as docking sites for other proteins involved in signaling pathways.

[0100] In some embodiments, the activation domain is derived from CD3zeta, CD3sigma, CD3 / , and CD3epsilon. For example, in some embodiments, the ITAM is derived from CD3zeta, CD3sigma, CD3 / , and CD3epsilon. In one preferred embodiment, the ITAM is derived from CD3zeta. In certain embodiments, the ITAM comprises a sequence that is at least about 80, 85, 90, 95, 96, 97, 98, 99, or 100% identical to a CD3zeta ITAM. In some embodiments, the activation domain comprises at least one, at least two, at least three, at least four, or at least five ITAMs independently selected from ITAMs derived from CD3zeta, FcRgamma, and combinations thereof. In some embodiments, the activation domain comprises a CD3zeta ITAM.

[0101] In some embodiments, the intracellular domain of the chimeric receptor of the present disclosure further comprises a transcription regulator. A transcription regulator is a biochemical element that acts to activate or repress transcription of a DNA sequence driven by a promoter. Transcription regulators suitable for the compositions and methods of the present disclosure can be naturally occurring transcription regulators or can be engineered, designed, or modified to provide desired and / or better properties, such as regulating transcription. In some embodiments, the transcription regulator directly regulates the expression of one or more genes involved in cell differentiation. In some embodiments, the transcription regulator indirectly regulates the expression of one or more genes involved in cell differentiation by regulating the expression of a second transcription factor, which in turn regulates the expression of one or more genes involved in cell differentiation. It will be understood by those skilled in the art that the transcription regulator can be a transcription activator or a transcription repressor. In some embodiments, the transcription regulator is a transcription repressor. In some embodiments, the transcription regulator is a transcription activator. In some embodiments, the transcription regulator can further comprise a nuclear localization signal. In some embodiments, the transcription regulator comprises a nuclear localization sequence derived from Gal4, tetR, ZFHD1, or HAP1. In other embodiments, the transcription regulator comprises a transcription regulator sequence derived from VP64, VP65, KRAB, or VP16. In certain embodiments, the transcription regulator is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-VP64, Gal4-KRAB, and HAP1-VP16. In some embodiments, the transcription regulator is Gal4-VP64.

[0102] In some embodiments, the ICD comprises a sequence having at least 80% sequence identity, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or 99% sequence identity, to one or more of SEQ ID NOs: 7-14, 33, 49-53, and 59-62. In some embodiments, the ICD comprises an amino acid sequence having at least 90% sequence identity to one or more of SEQ ID NOs: 7-14, 33, 49-53, and 59-62. In some embodiments, the ICD comprises an amino acid sequence having at least 95% sequence identity to one or more of SEQ ID NOs: 7-14, 33, 49-53, and 59-62. In some embodiments, the ICD comprises an amino acid sequence having at least 100% sequence identity to one or more of SEQ ID NOs: 7-14, 33, 49-53, and 59-62. In some embodiments, the ICD comprises one or more amino acid sequences of SEQ ID NOs: 7-14, 33, 49-53, and 59-62, wherein one, two, three, four, or five of the amino acid residues in one or more of SEQ ID NOs: 7-14, 33, 49-53, and 59-62 are substituted with a different amino acid residue.

[0103] Additional Domains In some embodiments, the chimeric receptors provided herein can further comprise additional regions or domains. For example, in some embodiments, the extracellular domain located N-terminal to the TMD can comprise a membrane localization signal, such as a CD8A signal. In other embodiments, the chimeric receptors can comprise a detectable label, such as a myc tag or a His tag, and the like. In further embodiments, the chimeric receptors provided herein can also comprise a tumor-specific or disease-specific cleavage site. In further embodiments, the chimeric receptors provided herein can comprise a combination of these additional regions.

[0104] In some embodiments, a chimeric receptor of the present disclosure comprises: (a) a linking polypeptide comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO:3; (b) a transmembrane domain comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO:4; and (c) a stop-transfer sequence domain comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO:5.

[0105] In some embodiments, a chimeric receptor of the present disclosure comprises: (a) an extracellular ligand-binding domain having at least 80% sequence identity to any one of SEQ ID NOs:1, 2, 45, and 46; (b) a linking polypeptide comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO:3; (c) a transmembrane domain comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO:4; (d) a stop transfer sequence domain comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO:5; and (e) an intracellular domain comprising one or more amino acid sequences having at least 80% sequence identity to one or more of SEQ ID NOs:7-14, 33, 49-53, and 59-62.

[0106] In some embodiments, a chimeric receptor of the present disclosure comprises: (a) an extracellular ligand-binding domain having at least 80% sequence identity to any one of SEQ ID NOs:1, 2, 45, and 46; (b) a linking polypeptide comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO:3; (c) a transmembrane domain comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO:4; (d) a stop transfer sequence domain comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO:5; and (e) an intracellular domain comprising three amino acid sequences, each having at least 80% sequence identity to any one of SEQ ID NOs:7-14, 33, 49-53, and 59-62, linked by a GS linker.

[0107] In some preferred embodiments, a chimeric receptor of the present disclosure comprises: (a) an extracellular ligand-binding domain having the sequences set forth in SEQ ID NOs:1, 2, 45, and 46; (b) a linking polypeptide comprising an amino acid sequence having the sequence set forth in SEQ ID NO:3; (c) a transmembrane domain comprising an amino acid sequence having the sequence set forth in SEQ ID NO:4; (d) a stop transfer sequence domain comprising an amino acid sequence having the sequence set forth in SEQ ID NO:5; and (e) an intracellular domain comprising three amino acid sequences having the sequences set forth in SEQ ID NOs:7-14, 33, 49-53, and 59-62, respectively, linked by a GS linker.

[0108] In some embodiments, a chimeric receptor of the present disclosure comprises: (a) an extracellular ligand-binding domain having at least 80% sequence identity to any one of SEQ ID NOs:1, 2, 45, and 46; (b) a linking polypeptide comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO:3; (c) a transmembrane domain comprising an amino acid sequence having at least 80% sequence identity to SEQ ID NO:4; and (d) an intracellular domain comprising one or more amino acid sequences having at least 80% sequence identity to one or more of SEQ ID NOs:7-14, 33, 49-53, and 59-62.

[0109] In some embodiments, a chimeric receptor of the present disclosure comprises an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to a chimeric receptor disclosed herein. In some embodiments, provided herein is a chimeric receptor comprising an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 15-31, 32-44, 47-48, 54-58, and 63-68.

[0110] nucleic acid molecule In another aspect, provided herein are various nucleic acid molecules that comprise nucleotide sequences encoding the chimeric and hybrid SynNotch receptors of the present disclosure, including expression cassettes and expression vectors that contain these nucleic acid molecules operably linked to heterologous nucleic acid sequences, such as, for example, regulatory sequences that facilitate in vivo expression of the receptor in a host cell.

[0111] Nucleic acid molecules of the present disclosure can be of any length, including, for example, about 1.5 Kb to about 50 Kb, about 5 Kb to about 40 Kb, about 5 Kb to about 30 Kb, about 5 Kb to about 20 Kb, or about 10 Kb to about 50 Kb, e.g., about 15 Kb to 30 Kb, about 20 Kb to about 50 Kb, about 20 Kb to about 40 Kb, about 5 Kb to about 25 Kb, or about 30 Kb to about 50 Kb.

[0112] In some embodiments, provided herein is a nucleic acid molecule comprising a nucleotide sequence encoding a chimeric or hybrid SynNotch receptor comprising, from N-terminus to C-terminus: (a) an extracellular ligand-binding domain having binding affinity for a selected ligand; (b) a linking sequence; (c) a transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and (d) an intracellular signaling domain (SD) comprising (i) at least one costimulatory domain and an activation domain derived from a signaling molecule, and (ii) an intracellular domain comprising a transcriptional regulator, wherein binding of the selected ligand to the extracellular ligand-binding domain is induced at the ligand-inducible proteolytic cleavage site disposed between the transcriptional regulator and the hinge domain.

[0113] In some embodiments, the nucleotide sequence is incorporated into an expression cassette or expression vector. It will be understood that an expression cassette generally comprises a construct of genetic material containing a coding sequence and regulatory information sufficient to direct proper transcription and / or translation of the coding sequence in a recipient cell in vivo and / or in vitro. In general, the expression cassette can be inserted into a vector to target a desired host cell and / or individual. Thus, in some embodiments, an expression cassette of the present disclosure comprises a coding sequence of a chimeric receptor disclosed herein, which coding sequence is operably linked to any one or combination of expression control elements, such as a promoter, and optionally other nucleic acid sequences that affect transcription or translation of the coding sequence.

[0114] In some embodiments, the nucleotide sequence is incorporated into an expression vector. The term "vector" generally refers to a recombinant polynucleotide construct designed for transfer between host cells, and will be understood by those skilled in the art to be used for the purpose of transformation, e.g., the introduction of heterologous DNA into a host cell. Thus, in some embodiments, a vector can be a replicon, such as a plasmid, phage, or cosmid, into which another DNA segment can be inserted to cause replication of the inserted segment. In some embodiments, an expression vector can be an integrating vector.

[0115] In some embodiments, the expression vector can be a viral vector. As will be appreciated by those skilled in the art, the term "viral vector" is used broadly to mean either a nucleic acid molecule (e.g., a transfer plasmid) that contains nucleic acid elements derived from a virus that facilitate the transfer or integration of the nucleic acid molecule into the genome of a cell, or a viral particle that mediates nucleic acid transfer. A viral particle will generally contain various viral and sometimes host cell components in addition to the nucleic acid(s). The term viral vector can refer to a virus or viral particle that can transfer a nucleic acid into a cell, or the transferred nucleic acid itself. Viral vectors and transfer plasmids contain structural and / or functional genetic elements that are primarily derived from a virus. The term "retroviral vector" refers to a viral vector or plasmid that contains structural and functional genetic elements, or portions thereof, that are primarily derived from a retrovirus. The term "lentiviral vector" refers to a viral vector or plasmid that contains structural and functional genetic elements, or portions thereof, that include LTRs that are primarily derived from the retrovirus genus, lentivirus.

[0116] In some embodiments, provided herein are nucleic acid molecules that encode a polypeptide having an amino acid sequence that has at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to a chimeric receptor disclosed herein. In some embodiments, provided herein are nucleic acid molecules that encode a polypeptide having an amino acid sequence that has at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-68. In some embodiments, the nucleic acid molecule encodes a polypeptide having an amino acid sequence that has at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 15-32, 34-44, 47-48, 54-58, and 63-68. In some embodiments, provided herein is a nucleic acid molecule that encodes a polypeptide having an amino acid sequence that has at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1 and 2. In some embodiments, provided herein is a nucleic acid molecule that encodes a polypeptide having an amino acid sequence that has at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to SEQ ID NO: 3. In some embodiments, provided herein is a nucleic acid molecule that encodes a polypeptide having an amino acid sequence that has at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to SEQ ID NO: 4. In some embodiments, provided herein is a nucleic acid molecule that encodes a polypeptide having an amino acid sequence that has at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to SEQ ID NO: 5. In some embodiments, provided herein is a nucleic acid molecule encoding a polypeptide having an amino acid sequence having at least about 80%, 90%, 95%, 96%, 97, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 7-14, 33, 49-53, and 59-62.

[0117] The nucleic acid sequence encoding the chimeric receptor can be optimized for expression in a host cell of interest. For example, the GC content of the sequence can be adjusted to an average level for a given cellular host, calculated with reference to known genes expressed in the host cell. Methods for optimizing codon usage are known in the art. The codon usage in the coding sequence of the chimeric receptor disclosed herein can be optimized to enhance expression in a host cell, such that about 1%, about 5%, about 10%, about 25%, about 50%, about 75%, or up to 100% of the codons in the coding sequence are optimized for expression in a particular host cell.

[0118] Some embodiments disclosed herein relate to vectors or expression cassettes comprising recombinant nucleic acid molecules encoding the chimeric receptors disclosed herein. Expression cassettes generally contain coding sequences and sufficient regulatory information to direct proper transcription and / or translation of the coding sequences in recipient cells in vivo and / or in vitro. Expression cassettes can be inserted into vectors to target desired host cells and / or individuals. Expression cassettes can be inserted into plasmids, cosmids, viruses, autonomously replicating polynucleotide molecules, phages as linear or circular single- or double-stranded DNA or RNA polynucleotide molecules capable of genomic integration or autonomous replication from any source that includes one or more nucleic acid sequences functionally operably linked, i.e., operably linked nucleic acid molecules.

[0119] Also provided herein are vectors, plasmids, or viruses containing one or more nucleic acid molecules encoding any of the chimeric or hybrid SynNotch receptors disclosed herein. The nucleic acid molecules can be included within a vector, for example, capable of directing expression in a cell transformed / transduced with the vector. Vectors suitable for use in eukaryotic and prokaryotic cells are known in the art and are commercially available or readily prepared by one of ordinary skill in the art. See, e.g., Sambrook, J., & Russell, DW (2012). Molecular Cloning: A Laboratory Manual (4th ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory and Sambrook, J., & Russell, DW (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory (collectively referred to as "Sambrook" herein); Ausubel, FM (1987). Current Protocols in Molecular Biology. New York, NY: Wiley (including supplements up to 2014); Bollag, DM et al. (1996). Protein Methods. New York, NY: Wiley-Liss; Huang, L. et al. (2005). Nonviral Vectors for Gene Therapy. San Diego: Academic Press; Kaplitt, MG et al. (1995). Viral Vectors: Gene Therapy and Neuroscience Applications. San Diego, CA: Academic Press; Lefkovits, I. (1997).See The Immunology Methods Manual: The Comprehensive Sourcebook of Techniques. San Diego, CA: Academic Press; Doyle, A. et al. (1998). Cell and Tissue Culture: Laboratory Procedures in Biotechnology. New York, NY: Wiley; Mullis, KB, Ferre, F. & Gibbs, R. (1994). PCR: The Polymerase Chain Reaction. Boston: Birkhauser Publisher; Greenfield, EA (2014). Antibodies: A Laboratory Manual (2nd ed.). New York, NY: Cold Spring Harbor Laboratory Press; Beaucage, SL et al. (2000). Current Protocols in Nucleic Acid Chemistry. New York, NY: Wiley, (including supplements through 2014) and Makrides, SC (2003). Gene Transfer and Expression in Mammalian Cells. Amsterdam, NL: Elsevier Sciences BV, the disclosures of which are incorporated herein by reference. .

[0120] DNA vectors can be introduced into eukaryotic cells by conventional transformation or transfection techniques. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (2012, supra) and other standard molecular biology laboratory manuals, such as calcium phosphate transfection, DEAE-dextran mediated transfection, transfection, microinjection, cationic lipid mediated transfection, electroporation, transduction, scrape loading, ballistic introduction, nucleoporation, hydrodynamic shock, and infection.

[0121] Viral vectors that can be used in the present disclosure include, for example, retroviral vectors, adenoviral vectors, adeno-associated viral vectors, lentiviral vectors, herpes viruses, simian virus 40 (SV40), and bovine papilloma virus vectors. (See, for example, Gluzman (Ed.), Eukaryotic Viral Vectors, CSH Laboratory Press, Cold Spring Harbor, NY). For example, the chimeric receptors disclosed herein can be produced in eukaryotic hosts, such as mammalian cells (e.g., COS cells, NIH3T3 cells, or HeLa cells). These cells are available from many sources, including the American Type Culture Collection (Manassas, VA). When selecting an expression system, care should be taken to ensure that the components are compatible with each other. Those skilled in the art are able to make such judgments. Furthermore, those skilled in the art can consult P. Jones, "Vectors: Cloning Applications", John Wiley and Sons, New York, NY, 2009, for guidance in selecting an expression system.

[0122] The nucleic acid molecules provided can contain naturally occurring sequences or sequences that differ from those naturally occurring but that encode the same polypeptide, e.g., an antibody, due to the degeneracy of the genetic code. These nucleic acid molecules can be composed of RNA or DNA (e.g., genomic DNA, cDNA, or synthetic DNA, such as those made by phosphoramidite-based synthesis), or combinations or modifications of nucleotides within these types of nucleic acids. Furthermore, the nucleic acid molecules can be double-stranded or single-stranded (e.g., either the sense or antisense strand).

[0123] A nucleic acid molecule is not limited to a sequence encoding a polypeptide (e.g., an antibody), but can also include some or all of the non-coding sequences upstream or downstream of the coding sequence (e.g., the coding sequence of a chimeric receptor). Those skilled in the art of molecular biology are familiar with routine procedures for isolating nucleic acid molecules. For example, they can be produced by treating genomic DNA with restriction endonucleases or by performing a polymerase chain reaction (PCR). If the nucleic acid molecule is a ribonucleic acid (RNA), the molecule can be produced, for example, by in vitro transcription.

[0124] Recombinant cells and cell culture The nucleic acids of the disclosure can be introduced into a host cell, such as a human T lymphocyte, to generate a recombinant or modified cell containing the nucleic acid molecule. Accordingly, some embodiments of the disclosure relate to a method for making a recombinant or modified cell comprising: (a) providing a cell capable of protein expression; and (b) contacting the provided cell with a recombinant nucleic acid of the disclosure.

[0125] Introduction of the nucleic acid molecules of the present disclosure into cells can be accomplished by methods known to those of skill in the art, such as, for example, viral infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethylenimine (PEI)-mediated transfection, DEAE-dextran-mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct microinjection, nanoparticle-mediated nucleic acid delivery, and the like.

[0126] Thus, in some embodiments, the nucleic acid molecule can be delivered by viral or non-viral delivery vehicles known in the art. For example, the nucleic acid molecule can be stably integrated into the host genome, or can be episomally replicated, or can be present in the recombinant host cell as a mini-circle expression vector for transient expression. Thus, in some embodiments, the nucleic acid molecule is maintained and replicated in the recombinant host cell as an episomal unit. In some embodiments, the nucleic acid molecule is stably integrated into the genome of the recombinant cell. Stable integration can be achieved using classical random genome recombination techniques, or more sophisticated techniques such as guide RNA-directed CRISPR / Cas9 genome editing, DNA-guided endonuclease genome editing using NgAgo (Natronobacterium gregoryi argonaute), TALEN genome editing (transcription activator-like effector nuclease). In some embodiments, the nucleic acid molecule is present in the recombinant host cell as a minicircle expression vector for transient expression.

[0127] Nucleic acid molecules can be encapsulated in viral capsids or lipid nanoparticles, or can be delivered by viral or non-viral delivery means and methods known in the art, such as electroporation. For example, introduction of nucleic acid into cells can be achieved by viral transduction. In a non-limiting example, adeno-associated virus (AAV) is modified to deliver nucleic acid to target cells by viral transduction. Several AAV serotypes have been reported, and all known serotypes can infect cells of multiple and diverse tissue types. AAV can transduce various species and tissues in vivo without toxicity, and induces relatively mild innate and adaptive immune responses.

[0128] Lentivirus-derived vector systems are also useful for nucleic acid delivery and gene therapy by viral transduction. As gene transfer vectors, lentivirus vectors have several attractive properties, including: (i) sustained gene delivery through stable integration of the vector into the host genome; (ii) ability to infect dividing and non-dividing cells; (iii) broad tissue tropism, including important gene therapy and cell therapy target cell types; (iv) lack of viral protein expression after vector transduction; (v) ability to deliver complex genetic elements such as polycistronic and intron-containing sequences; (vi) potentially safer integration site profile; and (vii) a relatively easy system for vector engineering and engineering.

[0129] In some embodiments, a host cell can be genetically engineered (e.g., transduced or transformed or transfected) with, for example, a vector construct of the present application, which can be, for example, a viral vector or a vector containing a nucleic acid sequence homologous to a portion of the genome of the host cell, or can be an expression vector for expression of a polypeptide of interest. A host cell can be either an untransformed cell or a cell that has already been transfected with at least one nucleic acid molecule.

[0130] In some embodiments, the recombinant cell is a prokaryotic or eukaryotic cell. In some embodiments, the cell is in vivo. In some embodiments, the cell is ex vivo. In some embodiments, the cell is in vitro. In some embodiments, the recombinant cell is a eukaryotic cell. In some embodiments, the recombinant cell is an animal cell. In some embodiments, the animal cell is a mammalian cell. In some embodiments, the animal cell is a human cell. In some embodiments, the cell is a non-human primate cell. In some embodiments, the mammalian cell is an immune cell, a neuronal cell, an epithelial cell, and an endothelial cell, or a stem cell. In some embodiments, the recombinant cell is an immune system cell, for example, a lymphocyte (e.g., a T cell or an NK cell), or a dendritic cell. In some embodiments, the immune cell is a B cell, a monocyte, a natural killer (NK) cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell (TH), a cytotoxic T cell (TCTL), or other T cell. In some embodiments, the immune system cell is a T lymphocyte.

[0131] In some embodiments, the cells are stem cells. In some embodiments, the cells are hematopoietic stem cells. In some embodiments of the cells, the cells are lymphocytes. In some embodiments, the cells are precursor T cells or regulatory T (Treg) cells. In some embodiments, the cells are CD34+, CD8+, or CD4+ cells. In some embodiments, the cells are CD8+ T cytotoxic lymphocyte cells selected from the group consisting of naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, and bulk CD8+ T cells. In some embodiments of the cells, the cells are CD4+ T helper lymphocyte cells selected from the group consisting of naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, and bulk CD4+ T cells. In some embodiments, the cells can be obtained by leukapheresis performed on a sample obtained from a subject. In some embodiments, the subject is a human patient.

[0132] In some embodiments, the recombinant cell further comprises a first and a second nucleic acid molecule disclosed herein, wherein the first and second nucleic acid molecules do not have the same sequence. In some embodiments, the recombinant cell further comprises a first and a second chimeric or hybrid SynNotch receptor disclosed herein, wherein the first chimeric or hybrid SynNotch receptor and the second chimeric or hybrid SynNotch receptor do not have the same sequence. In some embodiments, the first chimeric or hybrid SynNotch receptor modulates the expression and / or activity of the second chimeric or hybrid SynNotch receptor.

[0133] In some embodiments, the recombinant cell further comprises an expression cassette encoding a protein of interest operably linked to a promoter, the expression of the protein of interest being regulated by the chimeric receptor transcriptional regulator. Any suitable promoter can be used in the context of the present disclosure. In some embodiments, the promoter comprises a yeast GAL4 promoter. In some embodiments, the protein of interest is heterologous to the recombinant cell. A heterologous protein is a protein that is not normally found in the cell, e.g., is not normally made by the cell. In principle, there are no particular limitations regarding suitable proteins whose expression can be regulated by the chimeric receptor transcriptional regulator. Exemplary types of proteins suitable for use with the compositions and methods disclosed herein include cytokines, cytotoxins, chemokines, immunomodulators, pro-apoptotic factors, anti-apoptotic factors, hormones, differentiation factors, de-differentiation factors, immune cell receptors, or reporters. In some embodiments, the immune cell receptor is a T cell receptor (TCR). In some embodiments, the immune cell receptor is a chimeric antigen receptor (CAR). In some embodiments, the expression cassette encoding the protein of interest is incorporated into the same nucleic acid molecule that encodes the chimeric receptor of the present disclosure. In some embodiments, an expression cassette encoding a protein of interest is incorporated into a second expression vector separate from the nucleic acid molecule encoding a chimeric receptor of the present disclosure.

[0134] In another aspect, provided herein is a cell culture comprising at least one recombinant cell disclosed herein and a culture medium. In general, the culture medium can be any suitable culture medium for culturing the cells described herein. Techniques for transforming a wide variety of the above host cells and species are known in the art and described in the technical and scientific literature. Thus, cell cultures comprising at least one recombinant cell disclosed herein are also within the scope of this application. Suitable methods and systems for generating and maintaining cell cultures are known in the art.

[0135] Pharmaceutical Compositions In some embodiments, the nucleic acids and recombinant cells of the present disclosure can be incorporated into compositions, including pharmaceutical compositions. Such compositions generally include the nucleic acid and / or recombinant cells and a pharma- ceutically acceptable excipient, such as a carrier.

[0136] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate buffered saline (PBS). In all cases, the composition should be sterile and fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants, such as sodium dodecyl sulfate. Prevention of microbial action can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.In many cases, it will be common to include isotonic agents, such as sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition.Prolonged absorption of the injectable composition can be achieved by including agents that delay absorption, such as aluminum monostearate and gelatin, in the composition.

[0137] Sterile injectable solutions can be prepared by incorporating the active compound in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.

[0138] In some embodiments, the chimeric receptors and Notch receptors of the present disclosure can also be administered by transfection or infection using methods known in the art, including, but not limited to, those described in McCaffrey et al. (Nature 418:6893, 2002), Xia et al. (Nature Biotechnol. 20:1006-10, 2002) or Putnam (Am. J. Health Syst. Pharm. 53:151-60, 1996, erratum at Am. J. Health Syst. Pharm. 53:325, 1996).

[0139] Methods of the Disclosure Administration of any one of the therapeutic compositions described herein, e.g., nucleic acids, recombinant cells, and pharmaceutical compositions, can be used to treat patients against associated health conditions or diseases, such as cancer and chronic infections. In some embodiments, the nucleic acids, recombinant cells, and pharmaceutical compositions described herein can be incorporated into therapeutic agents for use in methods of treating individuals who have, are suspected of having, or may be at risk for developing one or more autoimmune disorders and diseases associated with checkpoint inhibition. Exemplary autoimmune disorders and diseases include, but are not limited to, celiac disease, type 1 diabetes, Graves' disease, inflammatory bowel disease, multiple sclerosis, psoriasis, rheumatoid arthritis, and systemic lupus erythematosus.

[0140] Thus, in one aspect, some embodiments of the present disclosure relate to a method for inhibiting target cell activity in an individual, the method comprising administering to the individual a first therapy comprising one or more of the nucleic acids, recombinant cells, and pharmaceutical compositions disclosed herein, the first therapy inhibiting the target cells. For example, a target cell may be inhibited if its proliferation is reduced, if its pathologic or pathogenic behavior is reduced, if it is destroyed or killed, etc. Inhibition includes a reduction in measured pathologic or pathogenic behavior of at least about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. In some embodiments, the method includes administering to an individual an effective number of recombinant cells disclosed herein, which recombinant cells inhibit the activity of a target cell in the individual. In general, the target cell of the disclosed method can be any cell type in the individual, for example, acute myeloma leukemia cells, anaplastic lymphoma cells, astrocytoma cells, B cell cancer cells, breast cancer cells, colon cancer cells, ependymoma cells, esophageal cancer cells, glioblastoma cells, glioma cells, leiomyosarcoma cells, liposarcoma cells, hepatoma cells, lung cancer cells, mantle cell lymphoma cells, melanoma cells, neuroblastoma cells, non-small cell lung cancer cells, oligodendroglioma cells, ovarian cancer cells, pancreatic cancer cells, peripheral T cell lymphoma cells, renal cancer cells, sarcoma cells, gastric cancer cells, carcinoma cells, mesothelioma cells, or sarcoma cells. In some embodiments, the target cell is a pathogenic cell.

[0141] In another aspect, some embodiments of the present disclosure relate to a method for treating a condition (e.g., a disease) in an individual in need of treatment, the method comprising administering to the individual a first therapy comprising one or more of the recombinant cells comprising a chimeric receptor disclosed herein and / or a pharmaceutical composition disclosed herein, where the first therapy treats the condition of the individual. In some embodiments, the method comprises administering to the individual a first therapy comprising an effective number of the recombinant cells disclosed herein, where the recombinant cells treat the condition.

[0142] In another aspect, some embodiments of the present disclosure relate to a method for aiding in the treatment of a health condition (e.g., a disease) of an individual in need of treatment, the method comprising administering to the individual a first therapy comprising one or more of the chimeric receptors, hinge-Notch receptors, nucleic acids, recombinant cells, and pharmaceutical compositions disclosed herein, and a second therapy, wherein the first and second therapies together treat the disease in the individual. In some embodiments, the method comprises administering to the individual a first therapy comprising an effective number of recombinant cells disclosed herein, the recombinant cells treating the health condition.

[0143] Administration of engineered cells to an individual In some embodiments, the methods of the present disclosure involve administering an effective amount of recombinant cells of the present disclosure to an individual in need thereof. This administering step can be accomplished using any method of implantation delivery known in the art. For example, recombinant cells of the present disclosure can be injected directly into the individual's bloodstream or otherwise administered to the individual.

[0144] In some embodiments, the methods disclosed herein include administering recombinant cells to an individual (this term is used interchangeably with the terms "introducing," "implanting," and "transplanting") by a method or route that results in at least partial localization of the introduced cells to a desired site such that a desired effect is exerted. The recombinant cells or their differentiated progeny can be administered by any suitable route that results in delivery to a desired location in an individual where at least a portion of the administered cells or their components are viable. The survival period of the cells after administration to an individual can be as short as a few hours, e.g., 24 hours, to as long as days, years, or even the lifetime of the individual, i.e., long-term engraftment.

[0145] When provided prophylactically, the recombinant cells described herein can be administered to an individual prior to the manifestation of any symptoms of the disease or condition to be treated. Thus, in some embodiments, prophylactic administration of the recombinant cell population prevents the onset of symptoms of the disease or condition.

[0146] When provided therapeutically, in some embodiments, the recombinant cells are provided at (or after) the manifestation of a symptom or sign of a disease or condition, e.g., at the time of onset of the disease or condition.

[0147] For use in the various embodiments described herein, an effective amount of the recombinant cells disclosed herein is at least 10 2 cells, at least 5 x 10 2 cells, at least 10 3 cells, at least 5 x 10 3 cells, at least 10 4 cells, at least 5 x 10 4 cells, at least 10 5 cells, at least 2 x 10 5 cells, at least 3 x 10 5 cells, at least 4 x 10 5 cells, at least 5 x 10 5 cells, at least 6 x 10 5 cells, at least 7 x 10 5 cells, at least 8 x 10 5 cells, at least 9 x 10 5 cells, at least 1 x 10 6 cells, at least 2 x 10 6 cells, at least 3 x 10 6 cells, at least 4 x 10 6 cells, at least 5 x 10 6 cells, at least 6 x 10 6 cells, at least 7 x 10 6 cells, at least 8 x 10 6 cells, at least 9 x 10 6The recombinant cells may be one or more cells, or multiples thereof. The recombinant cells may be derived from one or more donors, or may be obtained from an autologous source. In some embodiments, the recombinant cells are expanded in culture prior to administration to an individual in need thereof.

[0148] In some embodiments, delivery of a recombinant cell composition (e.g., a composition comprising a plurality of recombinant cells, any of the cells described herein) to an individual by a method or route results in at least partial localization of the cell composition at a desired site. The recombinant cell-containing composition can be administered by any suitable route that results in an effective treatment for the individual, e.g., administration can be by administering at least a portion of the delivered composition, e.g., at least 1×10 4 The cells are delivered to the desired site for a period of time, resulting in delivery to the desired site of the individual. Methods of administration include injection, infusion, and instillation. "Injection" includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrasternal injection and infusion. In some embodiments, the route is intravenous. For cell delivery, delivery by injection or infusion is the preferred method of administration.

[0149] In some embodiments, the recombinant cells are administered systemically, e.g., by infusion or injection, e.g., a population of recombinant cells is administered such that it enters the circulatory system of an individual and is therefore subject to metabolic and other similar biological processes, in addition to being administered directly to a target site, tissue, or organ.

[0150] The efficacy of a treatment, including any of the compositions provided herein for the treatment of a disease or condition, can be determined by a skilled clinician. However, one of skill in the art will understand that a treatment is considered effective if any one or all of the signs or symptoms or markers of the disease are improved or ameliorated. Efficacy can also be assessed by a reduction in the need for hospitalization or medical intervention, and measured by an individual not getting worse (e.g., progression of the disease is stopped or at least slowed). Methods for measuring these indicators are known to those of skill in the art and / or described herein. Treatment includes any treatment of a disease in an individual or animal (including, in some non-limiting examples, a human or mammal), including: (1) inhibiting the disease, e.g., stopping or slowing the progression of the condition; or (2) relieving the disease, e.g., causing the regression of the condition; and (3) preventing the onset of the condition or reducing the likelihood of onset.

[0151] As discussed above, a therapeutically effective amount includes a sufficient amount of a therapeutic composition to promote a particular beneficial effect when administered to an individual having, suspected of having, or at risk for a disease, etc. In some embodiments, an effective amount includes an amount sufficient to prevent or delay the onset of a disease symptom, alter the course of a disease symptom (e.g., but not limited to, slow the progression of a disease symptom), or reverse a disease symptom. It will be understood that the appropriate effective amount in any given case can be determined by one of ordinary skill in the art using routine experimentation in any given situation.

[0152] In some embodiments of the disclosed methods, the individual is a mammal. In some embodiments, the mammal is a human. In some embodiments, the individual has or is suspected of having a disease associated with inhibition of cell signaling via a cell surface ligand or antigen. Diseases suitable for treatment by the disclosed compositions and methods include, but are not limited to, cancer, autoimmune diseases, inflammatory diseases, and infectious diseases. In some embodiments, the disease is cancer or a chronic infectious disease.

[0153] Methods for designing, delivering and expressing CARs in T cells and producing clinical grade CAR-T cell populations are known in the art. See, for example, Lee et al., Clin Cancer Res (2012) 18(10):2780-90, which is incorporated herein by reference in its entirety. For example, modified CARs can be introduced into T cells using retroviruses that efficiently and stably integrate a nucleic acid sequence encoding a chimeric antigen receptor into the target cell genome. Exemplary methods are described in Example 2 below.

[0154] Other methods known in the art include lentiviral transduction, transposon-based systems, direct RNA transfection, and CRISPR / Cas systems (e.g., Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Cas10, Cas10d, Cas12a (Cpf1), Cas13a (C2c2), Cas13b, Cas13d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 ( In some embodiments, the system may be a Type I, Type II, or Type III system using a suitable Cas protein, such as, but not limited to, CasX, CasY, Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966.

[0155] In some embodiments, recombinant adeno-associated virus (AAV) vectors can be used for delivery. Techniques for generating rAAV particles in which a cell is provided with the packaged AAV genome, including the polynucleotide to be delivered, the rep and cap genes, and helper virus functions, are standard in the art. rAAV production requires the following components to be present in a single cell (herein referred to as a packaging cell): the rAAV genome, AAV rep and cap genes separate from the rAAV genome (e.g., not in the rAAV genome), and helper virus functions. The AAV rep and cap genes can be from any AAV serotype capable of inducing recombinant virus, and can be from an AAV serotype different from the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, and AAV rh.74. The production of pseudotyped rAAV is disclosed, for example, in WO 01 / 83692.

[0156] CAR-T cells can be expanded ex vivo, for example in response to an autoimmune disease antigen, and then re-infused into the subject in therapeutically effective amounts.

[0157] The exact amount of CAR T cells to be administered can be determined by a physician, taking into account individual differences in the subject's age, weight, disease, and severity of the condition.

[0158] Dosing of T cell therapy can be determined by total cells per infusion or, particularly for pediatric subjects (e.g., patients), cells per kg of body weight. Because T cells replicate and expand after transfer, the amount of cells administered may not resemble the final steady-state cell count. In some embodiments, pharmaceutical compositions comprising CAR T cells of the present disclosure can be administered at a dose of 104-1010 total cells. In another embodiment, pharmaceutical compositions comprising CAR T cells of the present disclosure can be administered at a dose of 103-108 cells / kg body weight, including all integer values ​​within these ranges.

[0159] Compositions comprising the CAR T cells of the present disclosure can also be administered multiple times at these dosages. The cells can be administered using injection techniques known in the art (see, for example, Rosenberg et al., New Engl J Med, (1988) 319:1676). The optimal dosage and treatment regimen for a particular subject can be determined by one of skill in the art by monitoring the subject for symptoms of disease and adjusting the treatment accordingly.

[0160] In some embodiments, administration of any of the compositions embodied herein, e.g., for the treatment of an autoimmune or inflammatory disease, can be combined with other cell-based therapies, such as, for example, stem cells, antigen-presenting cells, pancreatic islets, etc.

[0161] The compositions of the present disclosure can be prepared in a manner known in the art and suitable for parenteral administration to a mammal, particularly a human, and contain a therapeutically effective amount of the composition alone, together with one or more pharma- ceutically acceptable carriers or diluents.

[0162] As used herein, the term "pharmaceutically acceptable carrier" refers to any suitable carrier, diluent or excipient. These include all aqueous and non-aqueous isotonic sterile injection solutions which may contain antioxidants, buffers and solutes which render the composition isotonic with the blood of the intended recipient; aqueous and non-aqueous sterile suspensions including suspending agents and thickening agents, dispersion media, antifungal and antibacterial agents, isotonic and absorption agents and the like. It will be understood that the compositions of the present disclosure may also include other supplementary biologically active agents.

[0163] The carrier must be pharma- ceutically "acceptable" in the sense that it is compatible with other components of the composition and is not harmful to the subject. The compositions include those suitable for parenteral administration, including subcutaneous, intramuscular, intravenous and intradermal administration. The compositions can be conveniently provided in unit dosage form and can be prepared by any method known in the art of pharmacy. Such methods include preparing a carrier for binding with CAR-T cells. In general, the compositions are prepared by uniformly and thoroughly mixing any active ingredient with a liquid carrier.

[0164] In some embodiments, the composition is suitable for parenteral administration, hi other embodiments, the composition is suitable for intravenous administration.

[0165] Compositions suitable for parenteral administration include aqueous and non-aqueous isotonic sterile injection solutions which may contain antioxidants, buffers, bactericides and solutes which render the composition isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents.

[0166] Additional Therapy As mentioned above, any one of the compositions disclosed herein, e.g., the chimeric receptors, recombinant nucleic acids, recombinant cells, cell cultures, and pharmaceutical compositions disclosed herein, can be administered to a subject in need thereof as a single therapy (e.g., monotherapy). Additionally or alternatively, in some embodiments of the present disclosure, the chimeric receptors, recombinant nucleic acids, recombinant cells, cell cultures, and pharmaceutical compositions described herein can be administered to a subject in combination with one or more additional therapies, e.g., at least one, two, three, four, or five additional therapies. Suitable therapies administered in combination with the compositions of the present disclosure include, but are not limited to, chemotherapy, radiation therapy, immunotherapy, hormone therapy, toxin therapy, targeted therapy, and surgery. Other suitable therapies include therapeutic agents such as chemotherapeutic agents, anti-cancer agents, and anti-cancer therapies.

[0167] Administration "in combination with" one or more additional therapies includes simultaneous (concurrent) administration and sequential administration in any order. In some embodiments, the one or more additional therapies are selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, hormone therapy, toxin therapy, and surgery. As used herein, the term chemotherapy encompasses anti-cancer drugs. Anti-cancer drugs from various classes can be used in the methods disclosed herein as appropriate. Non-limiting examples of anti-cancer drugs include alkylating agents, antimetabolites, anthracyclines, plant alkaloids, topoisomerase inhibitors, podophyllotoxins, antibodies (e.g., monoclonal or polyclonal), tyrosine kinase inhibitors (e.g., imatinib mesylate (Gleevec® or Gleevec®)), hormone therapy, soluble receptors, and other anti-cancer drugs.

[0168] The present disclosure also contemplates the use of the compositions of the present disclosure in combination with other drugs and / or in addition to other treatment regimens or modalities, such as surgery. When the compositions of the present disclosure are used in combination with known therapeutic agents, the combination can be administered sequentially (either consecutively or separated by periods of no treatment), or concurrently, or as a mixture. For example, in the case of an autoimmune disease, the treatment includes administering to the subject a composition embodied herein, e.g., autologous T cells transduced with or contacted with a CAR embodied herein, and one or more anti-inflammatory and / or therapeutic agents. Anti-inflammatory agents include one or more antibodies that specifically bind to pro-inflammatory cytokines, such as IL-1, TNF, IL-6, GM-CSF, IFN-γ, etc. In some embodiments, the antibody is anti-TNFα, anti-IL-6, or a combination thereof. In some embodiments, one or more agents that reduce pro-inflammatory cytokines other than an antibody can be administered, such as a nonsteroidal anti-inflammatory drug (NSAID). Any combination of an antibody and one or more agents that reduce pro-inflammatory cytokines can be administered.

[0169] Combination treatment is also intended to include treatment with the compositions of the present disclosure followed by a known treatment, or treatment with a known agent followed by treatment with the compositions of the present disclosure, for example, as a maintenance therapy. For example, in the treatment of autoimmune diseases, excessive and prolonged activation of immune cells such as T lymphocytes and B lymphocytes, and overexpression of tumor necrosis factor alpha (TNF), a major proinflammatory cytokine, along with other mediators such as interleukin-6 (IL-6), interleukin-1 (IL-1), and interferon gamma gamma (IFN-γ), play a central role in the pathogenesis of autoimmune inflammatory responses in rheumatoid arthritis (RA), inflammatory bowel disease (IBD), Crohn's disease (CD), and ankylosing spondylitis (AS).

[0170] Nonsteroidal anti-inflammatory drugs (NSAIDs), glucocorticoids, and disease-modifying antirheumatic drugs (DMARDs) have traditionally been used to treat autoimmune inflammatory diseases. NSAIDs and glucocorticoids are effective in relieving pain and suppressing inflammation, while DMARDs have the ability to reduce tissue and organ damage caused by the inflammatory response. More recently, the treatment of RA and other autoimmune diseases has been revolutionized by the discovery that TNF is critically important in the pathogenesis of the disease. Anti-TNF biologics (such as infliximab, adalimumab, etanercept, golimumab, and certolizumab pegol) have significantly improved the outcomes of managing autoimmune inflammatory diseases.

[0171] Nonsteroidal anti-inflammatory drugs have analgesic, antipyretic, and anti-inflammatory properties and are often used to treat conditions such as arthritis and headaches. NSAIDs relieve pain through blocking the cyclooxygenase (COX) enzyme. COX promotes the production of prostaglandins, which are mediators that cause inflammation and pain. NSAIDs have various chemical structures, but all of them have similar therapeutic effects, such as suppressing autoimmune inflammatory responses. In general, NSAIDs are divided into two categories: conventional nonselective NSAIDs and selective cyclooxygenase-2 (COX-2) inhibitors (for a review, see P. Li et al., Front Pharmacol (2017) 8:460).

[0172] In addition to anti-TNF drugs, biologics targeting other inflammatory cytokines or immune competent molecules are also being widely studied and actively developed. For example, abatacept, a fully humanized fusion protein with the extracellular domain of CTLA-4 and the Fc fraction of IgG1, has been approved for RA patients with inadequate response to anti-TNF therapy. The main immunological mechanism of abatacept is selective inhibition of costimulatory pathways (CD80 and CD86) and activation of T cells. Tocilizumab, a humanized anti-IL-6 receptor monoclonal antibody, has been approved for RA patients intolerant to DMARDs and / or anti-TNF biologics. This therapeutic mAb blocks the transmembrane signaling of IL-6 through binding to the soluble and membrane forms of the IL-6 receptor. Biologic agents targeting IL-1 (anakinra), Th1 immune responses (IL-12 / IL-23, ustekinumab), Th17 immune responses (IL-17, secukinumab) and CD20 (rituximab) have also been approved for the treatment of autoimmune diseases (for review, see P. Li et al., Front Pharmacol (2017) 8:460).

[0173] Thus, in some embodiments, the method of the disclosure comprises separately administering a composition disclosed herein to a subject as a single therapy (e.g., monotherapy). In some embodiments, the composition of the disclosure is administered to a subject as a first therapy in combination with a second therapy. In some embodiments, the second therapy is selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, hormone therapy, toxin therapy, and surgery. In some embodiments, the first therapy and the second therapy are administered concomitantly. In some embodiments, the first therapy is administered at the same time as the second therapy. In some embodiments, the first therapy and the second therapy are administered sequentially. In some embodiments, the first therapy is administered before the second therapy. In some embodiments, the first therapy is administered after the second therapy. In some embodiments, the first therapy is administered before and / or after the second therapy. In some embodiments, the first therapy and the second therapy are administered in alternation. In some embodiments, the first therapy and the second therapy are administered together in a single formulation.

[0174] Methods for modulating cellular activity In another aspect, provided herein are various methods for modulating the activity of a cell, the methods comprising: (a) providing an effective amount of any of the recombinant cells provided herein; and (b) contacting it with a selected ligand, where binding of the selected ligand to the extracellular ligand-binding domain induces cleavage of the ligand-inducible proteolytic cleavage site, releasing an intracellular domain comprising an intracellular signaling domain and a transcriptional regulator, and the released intracellular signaling domain and transcriptional regulator modulate the activity of the recombinant cell. One of skill in the art, upon reading this disclosure, will understand that the disclosed methods can be performed in vivo, ex vivo, or in vitro.

[0175] Non-limiting exemplary cellular activities that can be modulated using the methods provided herein include, but are not limited to, gene expression, proliferation, apoptosis, non-apoptotic death, differentiation, dedifferentiation, migration, secretion of gene products, cell adhesion, and cytolytic activity.

[0176] In some embodiments, the released transcriptional regulator regulates the expression of a gene product in the cell. In some embodiments, the released transcriptional regulator regulates the expression of a heterologous gene product in the cell. A heterologous gene product is one that is not normally found in a native cell, e.g., one that is not normally produced by the cell. For example, the cell can be genetically modified with a nucleic acid that includes a nucleotide sequence that encodes a heterologous gene product.

[0177] In some embodiments, the heterologous gene product is a secreted gene product. In some embodiments, the heterologous gene product is a cell surface gene product. In some cases, the heterologous gene product is an intracellular gene product. In some embodiments, the released transcriptional regulator simultaneously regulates two or more heterologous gene products in a cell.

[0178] In some embodiments, the heterologous gene product in the cell is selected from the group consisting of a chemokine, a chemokine receptor, a chimeric antigen receptor, a cytokine, a cytokine receptor, a differentiation factor, a growth factor, a growth factor receptor, a hormone, a metabolic enzyme, a pathogen-derived protein, a proliferation inducer, a receptor, an RNA-guided nuclease, a site-specific nuclease, a T cell receptor (TCR), a chimeric antigen receptor (CAR), a toxin, a toxin-derived protein, a transcription regulator, a transcription activator, a transcription repressor, a translation regulator, a translation activator, a translation repressor, an activating immunoreceptor, an antibody, an apoptosis inhibitor, an apoptosis inducer, a modified T cell receptor, an immune activator, an immune inhibitor, and an inhibitory immune receptor.

[0179] In some embodiments, the released transcriptional regulator regulates differentiation of a cell, and the cell is an immune cell, a stem cell, a progenitor cell, or a precursor cell.

[0180] The chimeric receptors of the present disclosure provide higher expression than standard SynNotch receptors when using the same binding domain and ICD. Depending on the ligand / binding domain pair and their affinity, the chimeric or hinge Notch receptors of the present disclosure can provide about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50% increased expression over the corresponding SynNotch receptor.

[0181] Additionally, the chimeric receptors of the present disclosure can provide transcriptional regulation that is responsive to the degree of T cell activation, independent of ligand binding. For example, when expressed in a T cell, some of the receptors of the present disclosure provide a stronger ligand-induced signal when the T cell is activated compared to the ligand-induced signal when the T cell is not activated. This allows for further flexibility when it is desired to enhance or suppress T cell responses, for example, upon activation despite the absence of the chimeric receptor ligand.

[0182] Systems and Kits Also provided herein are systems and kits that include the chimeric receptors, hinge Notch receptors, recombinant nucleic acids, recombinant cells, or pharmaceutical compositions provided and described herein, as well as written instructions for making and using the same. For example, provided herein are, in some embodiments, systems and / or kits that include one or more of the chimeric receptors described herein, hinge Notch receptors described herein, recombinant nucleic acids described herein, recombinant cells described herein, and pharmaceutical compositions described herein. In some embodiments, the systems and / or kits of the present disclosure further include one or more syringes (including pre-filled syringes) and / or catheters (including pre-filled syringes) that are used to administer any of the chimeric receptors, hinge Notch receptors, recombinant nucleic acids, recombinant cells, or pharmaceutical compositions provided to an individual. In some embodiments, the kits can have one or more additional therapeutic agents that can be administered simultaneously or sequentially with other kit components for a desired purpose, such as to modulate the activity of cells, inhibit target cancer cells, or treat a health condition (e.g., a disease) of an individual in need of treatment.

[0183] Any of the above systems and kits may further comprise one or more additional reagents, which may be selected from a dilution buffer; a reconstitution solution, a wash buffer, a control reagent, a control expression vector, a negative control polypeptide, a positive control polypeptide, and a reagent for generating a chimeric receptor polypeptide in vitro.

[0184] In some embodiments, the components of the system or kit can be packaged in separate containers. In some other embodiments, the components of the system or kit can be packaged together in a single container.

[0185] In some embodiments, the system or kit may further include instructions for using the components of the kit to carry out the method of the invention. The instructions for carrying out the method of the invention are generally recorded on a suitable recording medium. For example, the instructions may be printed on a substrate such as paper or plastic. The instructions may be provided as a package insert with the kit, on the label of the container of the kit or its components (i.e., associated with the packaging or subpackaging), or the like. The instructions may be present as an electronic storage data file present on a suitable computer-readable storage medium, such as a CD-ROM, diskette, flash drive, or the like. In some cases, the actual instructions are not present in the kit, but a means for obtaining the instructions from a remote source (e.g., via the Internet) may be provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or downloaded. As with the instructions, the means for obtaining the instructions may be recorded on a suitable substrate.

[0186] All publications and patent applications mentioned in this disclosure are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0187] No admission is made that any document cited herein is prior art. The discussion of a reference states what its author asserts, and the inventors of the present invention reserve the right to challenge the accuracy and pertinence of the cited documents. Although a number of sources of information are referenced herein, including scientific journal articles, patent documents, and textbooks, it will be clearly understood that this reference is not an admission that any of those documents form part of the general knowledge in the art.

[0188] The general method descriptions provided herein are for illustrative purposes only: other alternative methods and substitutes will be apparent to those of skill in the art upon review of this disclosure, and are intended to be within the spirit and scope of this application.

[0189] Throughout this specification, various patents, patent applications, and other types of publications are referenced, such as journal articles, electronic database entries, etc. The disclosures of all patents, patent applications, and other publications cited herein are hereby incorporated by reference in their entireties for all purposes.

[0190] No admission is made that any document cited herein is prior art. The discussion of a reference states what its author asserts, and the inventors of the present invention reserve the right to challenge the accuracy and pertinence of the cited documents. Although a number of sources of information are referenced herein, including scientific journal articles, patent documents, and textbooks, it will be clearly understood that this reference is not an admission that any of those documents form part of the general knowledge in the art. EXAMPLES

[0191] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, cell biology, biochemistry, nucleic acid chemistry, and immunology that are well known to those of skill in the art, and such techniques are fully described in the references cited above.

[0192] Further embodiments are disclosed in further detail in the following examples, which are provided by way of illustration and are not intended to limit the scope of the disclosure or the claims in any way.

[0193] Example 1: Hybrid SYNNOTCH CAR circuit design This example demonstrates the design and construction of an exemplary hybrid SynNotch CAR provided herein.

[0194] The appropriate co-stimulatory domain, CD3 zeta domain, intracellular domain containing Gal4-VP64 and GS linker were synthesized as gene fragments from Twist. Receptors were constructed by fusing scFvs targeting CD19, BCMA or ALPPL2 to the corresponding receptor scaffold and intracellular tail. All receptors contain an n-terminal CD8α signal peptide (MALPVTALLLPLALLLHAARP, SEQ ID NO: 69) for membrane targeting and a flag tag (DYKDDDDK, SEQ ID NO: 70) for easy determination of surface expression using α-flag PE (Biolegend 637310). For all primary T cell experiments, receptors were cloned into a modified pHR'SIN:CSW vector containing the PGK promoter.

[0195] The pHR'SIN:CSW vector was also modified to generate response element plasmids. Five copies of the Gal4 DNA binding domain target sequence (GGAGCACTGTCCTCCGAACG, SEQ ID NO:71) were cloned 5' of the minimal pybTATA promoter. The response element plasmid also contained a PGK promoter constitutively driving mCitrine expression for easy identification of transduced T cells. For all inducible BFP vectors, BFP was cloned via the BamHI site of the multiple cloning site 3' of the Gal4 response element. All constructs were cloned by in-fusion cloning (Clontech #ST0345).

[0196] Figure 1A shows a diagram of all possible intracellular domain configurations. A detailed diagram of the hybrid SynNotch CAR domain is shown in Figure 1B. Furthermore, without being bound by theory, the principle of short-term proximal signaling and long-term transcriptional signaling induced by the hybrid SynNotch CAR is shown in Figure 1C.

[0197] The components of the hybrid SynNotch CARs containing the 4-1BB costimulatory domain are described below in Table 1. The N-JMD of the hybrid SynNotch CARs tested herein contained a truncated form of the CD8a hinge composed of an N-terminal fragment of the canonical CD8a hinge domain. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]

[0198] Additionally, the reference sequences from which each component listed in Table 1 is derived are provided in Table 2 below. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5]

[0199] Additionally, exemplary hybrid SynNotch CARs containing a CD28 costimulatory domain are listed in Table 3 below. [Table 3-1] [Table 3-2] [Table 3-3] [Table 4]

[0200] Additionally, sequence references for the receptor components of the CD28 Hybrid SynNotch CAR are provided in Table 4 below. [Table 5-1] [Table 5-2] [Table 5-3] [Table 6-1] [Table 6-2] [Table 6-3]

[0201] Further, exemplary hybrid SynNotch CARs comprising 41BB and CD28 costimulatory domains are listed in Table 5 below. [Table 7-1] [Table 7-2]

[0202] Additionally, sequence references for the receptor components of the 41BB / CD28 hybrid SynNotch CAR are provided in Table 6 below. [Table 8] [Table 9]

[0203] Example 2: Methods This example illustrates a further methodology used in the present disclosure.

[0204] Isolation and culture of primary human T cells Primary CD4+ and CD8+ T cells were isolated by negative selection from anonymous donor blood after apheresis (STEMCELL Technologies #15062 and 15063). Blood was obtained from Blood Centers of the Pacific (San Francisco, CA) with approval by the University Institutional Review Board. T cells were cryopreserved in RPMI-1640 (UCSF cell culture core) containing 20% ​​human AB serum (Valley Biomedical Inc., #HP1022) and 10% DMSO. After thawing, T cells were cultured in human T cell medium consisting of X-VIVO15 (Lonza #04-418Q), 5% human AB serum, and 10 mM neutralized N-acetyl-L-cysteine ​​(Sigma-Aldrich #A9165) supplemented with 30 units / mL IL-2 (NCI BRB Preclinical Repository). In vivo experiments were completed using bulk CD3+ cells isolated in a similar manner.

[0205] Lentiviral transduction of human T cells Pantropic VSV-G pseudotyped lentivirus was generated by transfecting pHR'SIN:CSW transgene expression vector and viral packaging plasmids pCMVdR8.91 and pMD2.G into Lenti-X 293T cells (Clontech #11131D) using Mirus TransIT-Lenti (Mirus #MIR6606). Primary T cells were thawed on the same day and stimulated with human T-Activator CD3 / CD28 Dynabeads (Life Technologies #11131D) at a cell:bead ratio of 1:3 after 24 hours in culture. Viral supernatants were collected after 48 hours and primary T cells were exposed to virus for 24 hours. Five days after T cell stimulation, Dynabeads were removed, T cells were sorted, and T cells were expanded until days 10-14 when cells became quiescent and could be used in vitro or in vivo. T cells were sorted for the assay using a Becton Dickinson (BD) FACs ARIA II.

[0206] Cancer cell lines The cancer cell lines used were K562 myeloid leukemia cells (ATCC #CCL-243), A549 lung epithelial carcinoma cells (ATCC #CCL-18) and M28 human epithelial mesothelioma cells. K562, A549 and M28 were lentivirally transduced to stably express human CD19. CD19 levels were determined by staining cells with α-CD19 APC (Biolegend #302212) or BV421 (Biolegend #302234). A549 was additionally transduced to express nuclear chromosomal mkate2. All cell lines were screened for expression of the transgene.

[0207] Circuit induction assay To assess circuit induction, primary human T cells were co-transduced with a hybrid SynNotch CAR and a response element containing UAS promoted BFP gene and then co-cultured with K562 (with or without CD19) at a 1:1 ratio for 24-72 hours. Co-cultured cells were then centrifuged, washed twice with flow buffer (PBS + 2% FBS) and resuspended in flow buffer containing diluted DRAQ7 to assess viability. Washed cells were immediately analyzed by flow cytometer to assess BFP expression.

[0208] In vitro activation assay Expression of surface activation markers was used as a measure of short-term activation by either CAR or hybrid SynNotch CAR signaling. To determine activation, transduced cells were co-cultured with K562 (with or without CD19 expression) at a 1:1 ratio for 24-72 hours. Co-cultured cells were then centrifuged, washed twice with flow buffer (PBS + 2% FBS) and stained with 50uL of a master mix of antibodies targeting the surface activation markers CD69, PD-1, CD25 and CD39. After staining, cells were washed twice with flow buffer and resuspended in flow buffer diluted with DRAQ7 to assess viability. Stained cells were immediately analyzed by flow cytometer to assess expression of activation markers.

[0209] In vitro cytokine secretion assay To assess cytokine secretion, transduced primary human T cells were co-cultured with K562 (with or without CD19 expression) at a 1:1 ratio for 18-24 hours (overnight), 48 hours (short-term) or 96 hours (long-term). In overnight co-cultures, Brefeldin A (eBioscience #00-4506-51) and Monensin (VWR #420701-BL) were included to stop cytokine secretion. In both short-term and long-term co-cultures, a second bolus of Brefeldin A and Monensin as well as K562 was added to the co-culture and incubated for an additional 6 hours before staining began. Co-cultured cells were washed twice with PBS and stained with 50uL Fixable NEAR IR (Invitrogen #L34975) for 20 minutes at room temperature in the dark. Then, 50uL of a master mix containing fluorescently tagged anti-CD4 or anti-CD8 antibodies was added to the cells and incubated for 20 minutes at room temperature in the dark. The stained cells were then washed twice with flow buffer (PBS+2%FBS). The stained cells were then resuspended in 100uL of IC Fix Buffer (eBioscience #00-8222-49) and incubated for 45 minutes at 4°C in the dark. The fixed cells were then washed twice with 1x Permeabilization Buffer (eBioscience #00-8333-56). An intracellular cytokine staining master mix was made with fluorescently tagged antibodies targeting the intracellular cytokines TNFa, IL-2, IFNy and Granzyme B diluted in 1x permeabilization buffer. The washed cells were stained with 50uL of this master mix for 30 minutes at 4°C in the dark. The stained cells were washed twice with 1x permeabilization buffer and resuspended in 100uL of flow buffer. The stained cells were immediately analyzed by flow cytometer.

[0210] In vitro Incucyte target killing assay CD19+ A549 cells expressing mkate2 were seeded in flat-bottom 96-well plates and cultured overnight to allow attachment. Transduced primary human T cells were centrifuged and resuspended in Jurkat medium + 30U / mL IL-2, as RPMI is less fluorescent than X-VIVO-15-based medium (Jurkat medium (RPMI-1640 medium + 10% FBS + 1% PenStrep + 1x Glutamax). Media was removed from the adherent A549 cells and transduced human T cells were added to the cultures at a 1:1 ratio. Over the course of the experiment, images were taken every 2 hours using Incucyte software (see related figures for imaging total assay times that differ between conditions).

[0211] In vitro proliferation assay Transduced human T cells were removed from culture and washed with PBS diluted with CellTrace Far Red (CTFR) (Invitrogen #C34564). Cells were stained for 20 min at 37°C in the dark, then 5x the amount of staining protein in culture medium was added, and cells were further cultured for 5 min at 37°C in the dark. Stained cells were centrifuged and washed with human T cell medium. K562 cells (with or without CD19 expression) were washed with human T cell medium and added to the CTFR stained T cells at a 1:1 ratio. Co-cultures were incubated for 5 days, with a medium change occurring midway through the incubation. Co-cultures were then centrifuged, washed twice with flow buffer (PBS+2% FBS), and stained with 50 μL of a master mix containing fluorescently labeled tagged anti-CD8 antibodies. After staining, cells were washed twice with flow buffer (PBS+2% FBS) and resuspended in flow buffer diluted with DRAQ7 to assess viability. The stained cells were immediately analyzed by flow cytometer to assess the dilution of the CTFR dye.

[0212] In vivo Nalm6 studies NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ (NSG) (UCSF LARC Breeding Core) mice were administered 0.5 × 106 luciferase-expressing Nalm6 cells via tail vein injection. Four days after tumor injection, hybrid SynNotch CAR or CAR-transduced T cells were administered to tumor-bearing animals via retro-orbital injection (see figure details for number of T cells administered per experiment). Bioluminescence imaging was performed at fixed time points to assess tumor burden using an IVIS Spectrum In Vivo Imaging system. Animals were administered 200 μL of 15 mg / mL luciferin via IP injection and allowed to ambulate for 12–20 min before prone and supine image capture. Image capture times were adjusted based on bioluminescence intensity and mean radiance [p / s / cm 2 / sr] was used as a measure of tumor burden. Throughout the experiment, animals' drinking water was supplemented with clavamox (Zoetis #55-101) to prevent bacterial infection.

[0213] In vivo M28 studies NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ (NSG) mice were administered 4 × 106 M28 cells expressing CD19 ligand via subcutaneous injection. Seven days after tumor injection, 3–6 × 106 Hybrid SynNotch CAR or CAR-transduced T cells were administered to tumor-bearing animals via retro-orbital injection. Tumors were measured twice weekly with calipers and tumor volume was calculated using the formula: (length × width2) / 2. Throughout the experiment, animals' drinking water was supplemented with clavamox to prevent bacterial infection.

[0214] Example 3: Expression and circuit induction of hybrid SYNNOTCH CAR This example demonstrates that the exemplary hybrid SynNotch CARs provided herein can induce expression of a transcriptional circuit and activate human T cells.

[0215] Briefly, primary human T cells were activated with anti-CD3 / anti-CD28 Dynabeads (GIBCO) and transduced with two lentiviral constructs expressing the receptor or transcriptional reporter constructs. Hybrid SynNotch CARs bearing the 4-1BB costimulatory domain (Figure 2A) or CD28 costimulatory domain (Figure 2C) were sorted 5 days after the first T cell stimulation, and the receptor and reporter double positive population was purified. To evaluate circuit induction, 14 days after the first T cell stimulation, T cells expressing the anti-CD19 receptor and BFP reporter bearing the 4-1BB costimulatory domain (Figure 2B) or CD28 costimulatory domain (Figure 2D) were co-cultured with K562 cells (top) or CD19+K562 cells (bottom) for 48 hours. Transcriptional activation of the inducible BFP reporter gene was then measured using a Fortessa X-50 (BD).

[0216] As shown in the figures, some intracellular conformations of hybrid SynNotch CARs with 4-1BB or CD28 costimulatory domains show antigen-independent induction of the inducible transcriptional BFP reporter element (e.g., conformations 1 and 4 for 4-1BB, and conformations 1, 2, 4, 5, and 6 for CD28). However, other intracellular conformations of hybrid SynNotch CARs show antigen-specific induction of the BFP reporter element and express BFP only in the presence of ligand (e.g., conformations 2, 3, 5, and 6 for 4-1BB, and conformation 3 for CD28). This dataset demonstrates the ability of specific conformations of hybrid SynNotch CAR circuits incorporating either 4-1BB or CD28 costimulatory domains to induce transcription in an antigen-specific manner. Furthermore, this dataset demonstrates that the spatial conformation of the intracellular domain influences the behavior of the receptor in both the presence and absence of ligand.

[0217] Example 4: Expression of Hybrid SYNNOTCH CAR Activation Markers This example shows the expression of activation markers in T cells transduced with an exemplary hybrid SynNotch CAR.

[0218] T cells expressing anti-CD19 receptor with 4-1BB costimulatory domain (Figure 3A) or CD28 costimulatory domain (Figure 3B) and BFP reporter were generated as described above. Transduced cells were co-cultured with K562 cells (gray) or CD19+K562 cells (light gray) for 48 hours. Expression of activation markers CD25, CD39, CD69 and PD-1 was then measured using a Fortessa X-50 (BD). As shown in the figures, the hybrid SynNotch CAR T cells express activation markers with similar mean fluorescence intensity and overall percentage compared to CAR control with the same costimulatory domain. Furthermore, the hybrid SynNotch CAR T cells express activation markers only in the presence of ligand. Taken together, this dataset demonstrates that upon antigen binding, the hybrid SynNotch CAR functionally induces signaling through its intracellular signaling domains (4-1BB or CD28, and CD3 zeta), leading to the expression of activation markers.

[0219] Example 5: Growth of hybrid SYNNOTCH CARs This example shows the expansion of T cells transduced with an exemplary hybrid SynNotch CAR.

[0220] T cells expressing anti-CD19 receptors with 4-1BB or CD28 costimulatory domains and BFP reporter were generated as described above. Transduced cells were stained with Cell Trace Far Red (CTFR) and then co-cultured with K562 cells (gray) or CD19+K562 cells (blue or red) for 5 days. The dilution of the CTFR dye was then measured using a Fortessa X-50 (BD).

[0221] As shown in Figure 4, the hybrid SynNotch CAR, upon binding to the ligand, induces T cell proliferation at a rate similar to the CAR alone. Furthermore, when antigen is present, the hybrid SynNotch CAR T cells proliferate extensively and specifically, indicating that the proliferative response of the hybrid SynNotch CAR T cells is antigen-specific. Collectively, this data set shows that the hybrid SynNotch CAR, upon binding to antigen, functionally induces short-term signaling through its intracellular signaling domains (4-1BB or CD28, and CD3 zeta), leading to T cell proliferation.

[0222] Example 6: Hybrid SYNNOTCH CAR Cytokine Secretion This example demonstrates cytokine secretion by T cells transduced with an exemplary hybrid SynNotch CAR.

[0223] T cells expressing anti-CD19 receptor with 4-1BB costimulatory domain (Figure 5A) or CD28 costimulatory domain (Figure 5B) and BFP reporter were generated as described above. Transduced cells were co-cultured with K562 cells (grey) or CD19+K562 cells (blue or red). After 48 hours, a second bolus of Brefeldin A, Monensin and K562 cells (with or without CD19+ expression) was added to the co-culture. Co-cultures were incubated for an additional 6 hours, and then transduced cells were assessed for intracellular expression of the cytokines Granzyme B, IFNy, IL-2, TNFα using a Fortessa X50 (BD). As shown in the figures, the hybrid SynNotch CAR induces lower expression of cytokines (except Granzyme B) compared to CAR alone. This dataset suggests that signaling induced by the costimulatory domain and CD3 zeta domain of hybrid SynNotch CARs differs in type or mechanism, strength, intensity, or duration to the CARs.

[0224] Example 7: Target killing with hybrid SYNNOTCH CAR This example demonstrates the cell killing activity of an exemplary hybrid SynNotch CAR.

[0225] T cells expressing anti-CD19 receptor with 4-1BB costimulatory domain (Figure 6A) or CD28 costimulatory domain (Figure 6B) and BFP reporter were generated as described above. A549 cells expressing CD19 ligand and nuclear stain mkate2 were allowed to attach to 96-well flat-bottom plates for 24 hours, and then transduced T cells were added at a 1:1 ratio. Plates were incubated in Incucyte and images and fluorescence of the plates were taken every 2 hours for 5 days. The imaging software was used to calculate the number of A549 CD19+mkate2+ cells in the cultures at each time point. For each experimental group, A549 cell counts were normalized to those of the hinge-Notch experimental group. As shown in the figures, the hybrid SynNotch CAR T cells kill target cells at a similar rate as the CAR T cells. This indicates that in an in vitro setting, the hybrid SynNotch CAR induces a T cell activation and cytotoxicity program sufficient to kill target cells over a period of several days.

[0226] Example 8: In vivo efficacy of hybrid SYNNOTCH CAR This example demonstrates the in vivo efficacy of the exemplary hybrid SynNotch CARs provided herein.

[0227] A description of the experimental timeline is shown in Figure 7A. NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ (NSG) mice were administered 0.5x106 Nalm6-Luc-GFP tumor cells intravenously. Bulk CD3+ T cells were co-transduced with anti-CD19 hybrid SynNotch CAR with CD3ζ-Gal4VP64-CD28 intracellular domain and BFP reporter as described above. Briefly, animals were administered 0.5x106 transduced CD3+ T cells via retro-orbital injection 4 days after tumor injection. Tumor burden measured via bioluminescence imaging of luciferase-secreting tumor cells using IVIS Spectrum is shown in Figure 7B, and survival curves of experimental mice are shown in Figure 7C. The data show that in vivo hybrid SynNotch CAR T cells are as effective at eliminating Nalm6 tumors as CAR T cells with CD28 costimulatory domain. Although Nalm6 tumor burden initially increased in both the hybrid SynNotch CAR and CAR T cell treated groups as shown through bioluminescence, the tumor burden decreased and eventually disappeared in both treatment groups approximately 10 days after tumor injection. As shown by the survival curves, animals in the hybrid SynNotch CAR and CAR groups survived to the end of the study, while animals receiving non-transduced T cells succumbed to their disease between 18 and 28 days after tumor injection. These data indicate that hybrid SynNotch CAR T cells are effective in controlling and eliminating tumor burden in vivo.

[0228] Similarly, a description of the experimental timeline is shown in Figure 10A. NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ (NSG) mice were subcutaneously administered 4x106 CD19 ligand-expressing M28 tumor cells. Bulk CD3+ T cells were co-transduced with anti-CD19 hybrid SynNotch CAR with ICD shown in 10B and BFP reporter as described above. Briefly, animals were administered 6x106 transduced CD3+ T cells via retro-orbital injection 7 days after tumor injection. Tumor volumes assessed weekly by caliper measurements are shown in Figure 10B. These data indicate that hybrid SynNotch CAR T cells targeting CD19, particularly those with the trunc41BB domain, can induce tumor depletion compared to PBS negative controls.

[0229] Further, a description of the experimental timeline is provided in Figure 14A. NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ (NSG) mice were subcutaneously injected with 4x106 CD19-expressing M28 tumor cells. Bulk CD3+ T cells were co-transduced with an anti-CD19 hybrid SynNotch CAR with the ICD shown in 14B and the BFP reporter described above. Briefly, 7 days after tumor injection, 3x10 6 Animals were administered transduced CD3+ T cells via retro-orbital injection. Tumor volumes assessed weekly by caliper measurements are shown in Figure 14B. These data indicate that third generation CD19-targeted hybrid SynNotch CAR T cells can induce tumor elimination similar to second generation CD19-targeted CARs.

[0230] And the in vivo efficacy of ALPPL2-targeted hybrid SynNotch CAR is shown in Figure 16. NOD.Cg-PrkdcscidIl2rgtm1Wjl / SzJ (NSG) mice were subcutaneously administered 4x106 M28 tumor cells as described in Figure 14. Bulk CD3+ T cells were co-transduced with anti-ALPPL2 CAR or anti-ALPPL2 hybrid SynNotch CAR with ICD as shown and BFP reporter as described in Figure 2. Animals were administered 3x106 transduced CD3+ T cells by retro-orbital injection 7 days after tumor injection. Tumor volume was assessed weekly by caliper measurement. These data indicate that third generation ALPPL2-targeted hybrid SynNotch CAR T cells can induce tumor elimination similar to second generation ALPPL2-targeted CAR.

[0231] Example 9: Minimized 4-1BB or CD28 variants improve NF-KB signaling and reduce noise This example shows the improved NF-kB signaling and reduced noise provided by 4-1BB and CD28 variants.

[0232] Figure 8A shows an alignment of wild type 4-1BB and 4-1BB variants, indicating the amino acids deleted to create the "no STS" and "trunc" 4-1BB costimulatory domains. Figure 9A shows an alignment of wild type 4-1BB and 4-1BB variants, indicating the amino acids deleted to create the "trunc41BB", "min41BB", and "trunc41BBtrunc41BB" costimulatory domains. Figures 11A and 12A show an alignment of wild type CD28 and CD28 variants, indicating the amino acids deleted to create the "no STS", "trunc", "CD28ΔTPRRP", "truncCD28ΔTPRRP", and "fully truncCD28" CD28 costimulatory domains.

[0233] T cells were co-transduced as above with anti-CD19 hybrid SynNotch CARs to express 4-1BB variants or CD28 variants and a BFP reporter. Circuit induction was assessed as above. Figures 8B, 9B, 11B, and 12B show that hybrid SynNotch CARs with 4-1BB variants or CD28 variants are expressed on the surface of T cells after induction at a similar kinetics as hybrid SynNotch CARs with wild type 4-1BB. Figures 8C, 9C, 11C, and 12C show that hybrid SynNotch CARs with "no STS" 4-1BB, "trunc" 4-1BB, "min41BB", "trunc41bbtrunc41bb", "no STS" CD28, "trunc" CD28, and "CD28ΔTPRRP", "truncCD28ΔTPRRP", and "full truncCD28" maintain antigen-dependent induction of the inducible transcriptional circuitry, while there is less antigen-independent induction of the transcriptional circuitry. This dataset indicates that antigen-independent transcriptional regulation of these receptors can be alleviated through modification of the 4-1BB or CD28 costimulatory domains without reducing the antigen-dependent activity of the receptors.

[0234] Jurkat cell lines were transduced to express an mCherry reporter under the NF-κB common promoter. The NF-κB reporter cell lines were transduced with anti-CD19 hybrid SynNotch CAR and co-cultured with K562 cells expressing CD19. Expression of mCherry as a proxy for NF-κB activity was assessed by flow cytometry after 24, 48, and 72 hours of co-culture. Figures 8D and 9D show that the strength of NF-κB signaling induced by the 4-1BB costimulatory domain is not affected when the 4-1BB domain is modified to remove the STS ("no STS"), to remove the first 17 amino acids of the domain ("trunc"), or to remove the first 17 amino acids of the domain and the last 13 amino acids of the domain ("min41BB"). These data, combined with the circuit induction data, indicate that modifications to the 4-1BB costimulatory domain can optimize hybrid SynNotch CARs with antigen-independent activity, resulting in better designs capable of both antigen-dependent transcriptional circuit induction and T cell signaling.

[0235] A summary of the expression and T cell activation activity of the above hybrid SynNotch CARs is shown in Table 8 below. [Table 10-1] [Table 10-2] [Table 10-3] [Table 10-4] [Table 10-5] [Table 10-6] [Table 10-7]

[0236] Example 10: "Third generation" variants This example demonstrates the reduction in noise provided by a variant containing one of the CD28 signaling motifs added to the C-terminus of the trunc41BB costimulatory domain.

[0237] FIG. 13A shows an alignment of wild-type 4-1BB and CD28 and variants, indicating the amino acids deleted and / or added to create the "trunc41BB PYAP", "trunc41BB_YMFM", "trunc41BB YMFMTPRRP", and "trunc41BB AAYRS" costimulatory domains.

[0238] T cells were co-transduced as above to express anti-CD19 hybrid SynNotch CARs with the "third generation" variants and a BFP reporter. Circuit induction was assessed as above. Figure 13B shows that hybrid SynNotch CARs with one of the CD28 signaling motifs added to the C-terminus of the trunc41BB costimulatory domain are expressed on the surface of T cells after induction at a similar level as hybrid SynNotch CARs with wild-type 4-1BB. Figure 13C shows that hybrid SynNotch CARs with "trunc41BB PYAP", "trunc41BB_YMFM", "trunc41BB YMFMTPRRP", and "trunc41BB AAYRS" maintain antigen-dependent induction of the inducible transcriptional circuit and have low antigen-independent induction of the transcriptional circuit. These data indicate that antigen-independent and antigen-dependent transcriptional regulation of these receptors is not affected by the addition of the signaling motif from the CD28 costimulatory domain.

[0239] A summary of the expression and cell activation activity of the above hybrid SynNotch CARs is shown in Table 9 below. [Table 11]

[0240] Example 10: BCMA and ALPPL2 targeting variants T cells were co-transduced as above to express anti-BCMA or anti-ALPPL2 hybrid SynNotch CARs with 41BB costimulatory domain variants and BFP reporter. Circuit induction was assessed as above. Figure 15A shows that anti-BCMA and anti-ALPPLS hybrid SynNotch CARs are expressed on the surface of T cells after induction. Figure 15B shows that anti-BCMA and anti-ALPPLS hybrid SynNotch CARs with "trunc41BB" and "trunc41BB PYAP" maintain antigen-dependent induction of inducible transcriptional circuits, while there is less antigen-independent induction of transcriptional circuits. This data set shows that the hybrid SynNotch CAR scaffold can be fused to other antigen targeting scFvs and maintain antigen-dependent transcriptional regulation of circuits and T cell activation.

[0241] A summary of the expression and cell activation activity of the above hybrid SynNotch CARs is shown in Table 10 below. [Table 12] SEQUENCE TABLE [Table 13-1] [Table 13-2] [Table 13-3] [Table 13-4] [Table 13-5] [Table 13-6]

Table 13-7

Table 13-8

Table 13-9

Table 13-10

Table 13-11

Table 13-12

Table 13-13

Table 13-14

Table 13-15

Table 13-16

Table 13-17

Table 13-18

Table 13-19

Table 13-20

Table 13-21

Table 13-22

Table 13-23

Claims

1. A chimeric receptor comprising, from the N-terminus to the C-terminus: a) an extracellular ligand-binding domain having binding affinity for a selected ligand; b) a linking polypeptide; c) a transmembrane domain (TMD) containing one or more ligand-inducible proteolytic cleavage sites; and d) An intracellular domain (ICD), in any order: (i) an intracellular signaling domain (SD) comprising an activation domain and at least one costimulatory domain derived from a signaling molecule; and (ii) a transcription factor, A chimeric receptor comprising: binding of the selected ligand to the extracellular ligand-binding domain induces cleavage at a ligand-inducible proteolytic cleavage site located between the ICD and the linking polypeptide; binding of the selected ligand to the extracellular ligand-binding domain induces one or more proximal signaling cascades through the intracellular SD; Does not contain the LIN-12-Notch repeats (LNR) and / or heterodimerization domain (HD) of the Notch receptor Chimeric receptors.

2. The chimeric receptor of claim 1 , wherein the extracellular ligand-binding domain comprises an antigen-binding portion capable of binding to a ligand on the surface of a cell.

3. The chimeric receptor of claim 2 , wherein the cell is a pathogenic cell, and optionally the cell is a human cell.

4. The chimeric receptor of claim 3 , wherein the human cell is a tumor cell, and optionally the human cell is a terminally differentiated cell.

5. The chimeric receptor of any one of claims 1 to 4, wherein the ligand comprises a protein or a carbohydrate.

6. A chimeric receptor described in any one of claims 1 to 5, wherein the ligand is selected from a cell surface receptor, an adhesion protein, an integrin, a mucin, a lectin, a tumor-associated antigen, and a tumor-specific antigen.

7. The ligand is CD1, CD1a, CD1b, CD1c, CD1d, CD1e, CD2, CD3d, CD3e, CD3g, CD4, CD5, CD7, CD8a, C D8b, CD19, CD20, CD21, CD22, CD23, CD25, CD27, CD28, CD33, CD34, CD40, CD45, CD48, CD52, CD59, CD66, CD70, CD71, CD72, CD73, CD79A, CD79B, CD80 (B7.1), CD86 (B7.2), CD94, CD95, CD134, CD140 (PDGFR4), CD152, CD154, CD158, CD178, CD181 (CXCR1), CD182 (CXCR2), CD183 7. The chimeric receptor of any one of claims 1 to 6, wherein the chimeric receptor is selected from the group consisting of: (CXCR3), CD210, CD246, CD252, CD253, CD261, CD262, CD273 (PD-L2), CD274 (PD-L1), CD276 (B7H3), CD279, CD295, CD339 (JAG1), CD340 (HER2), EGFR, FGFR2, CEA, AFP, CA125, MUC-1, MAGE, alkaline phosphatase, placenta-like 2 (ALPPL2), B-cell maturation antigen (BCMA), green fluorescent protein (GFP), blue fluorescent protein (BFP) enhanced green fluorescent protein (EGFP), and signal regulatory protein alpha (SIRPα).

8. The chimeric receptor of any one of claims 1 to 7, wherein the extracellular ligand-binding domain comprises a ligand-binding portion of a receptor.

9. 9. The chimeric receptor of any one of claims 2 to 8, wherein the antigen-binding portion is selected from the group consisting of an antibody, a nanobody, a diabody, a triabody, a minibody, a F(ab')2 fragment, a F(ab)v fragment, a single chain variable fragment (scFv), a single domain antibody (sdAb), and functional fragments thereof.

10. The antigen-binding portion is CD19, B7H3 (CD276), BCMA (CD269), ALPPL2, CD123, CD171, CD179a, CD20, CD213A2, CD22, CD24, CD246, CD272, CD30, CD3 3, CD38, CD44v6, CD46, CD71, CD97, CEA, CLDN6, CLECL1, CS-1, EGFR, EGFRvIII, ELF2M, EpCAM, EphA2, EphrinB2, FAP, FLT3, GD2, GD3, GM 10. The chimeric receptor of any one of claims 2 to 9, which binds to a tumor associated antigen selected from the group consisting of: 3, GPRC5D, HER2 (ERBB2 / neu), IGLL1, IL-11Rα, KIT (CD117), MUC1, NCAM, PAP, PDGFR-β, PRSS21, PSCA, PSMA, ROR1, SIRPα, SSEA-4, TAG72, TEM1 / CD248, TEM7R, TSHR, VEGFR2, ALPI, citrullinated vimentin, cMet, and Axl.

11. The chimeric receptor of any one of claims 1 to 10, wherein the linking polypeptide comprises a hinge domain.

12. The chimeric receptor of claim 11 , wherein the hinge domain is capable of promoting oligomerization of the chimeric polypeptide through intermolecular disulfide bonds.

13. 13. The chimeric receptor of claim 11 or 12, wherein the hinge domain is derived from a CD8α hinge domain, a CD28 hinge domain, a CD152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an OX40 hinge domain, an IgG1 hinge domain, an IgG2 hinge domain, an IgG3 hinge domain, and an IgG4 hinge domain, or any functional variant thereof.

14. The chimeric receptor of any one of claims 1 to 13, wherein the linking polypeptide comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO:

3.

15. The chimeric receptor of any one of claims 1 to 14, wherein the one or more ligand-inducible proteolytic cleavage sites comprises a gamma-secretase cleavage site.

16. The chimeric receptor of any one of claims 1 to 15, wherein the TMD comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO:

4.

17. The chimeric receptor of any one of claims 1 to 16, further comprising a stop transfer sequence (STS) located between the TMD and the ICD.

18. The chimeric receptor of claim 17 , wherein the stop transfer sequence comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO:

5.

19. The chimeric receptor of any one of claims 1 to 18, wherein the signaling molecule comprises a class 1 or class 3 human membrane protein.

20. The signaling molecule is CD28, ICOS, CTLA4, PD1, PD1H, BTLA, B71, B7H1, CD226, CRTAM, TIGIT, CD96, TIM1, TIM2, TIM3, TIM4, CD2, SLAM, 2B4, Ly108, CD84, Ly9, CRACC, BTN1, BTN2, BT N3, LAIR1, LAG3, CD160, 4-1BB, OX40, CD27, GITR, CD30, TNFR1, TNFR2, HVEM, LT_R, DR 3, DCR3, FAS, CD40, RANK, OPG, TRAILR1, TACI, BAFFR, BCMA, TWEAKR, EDAR, XEDAR, REL 20. The chimeric receptor of any one of claims 1 to 19, which is selected from the group consisting of T, DR6, TROY, NGFR, CD22, Siglec-3, Siglec-5, Siglec-7, KLRG1, NKR-P1A, ILT2, KIR2DL1, KIR3DL1, CD94-NKG2A, CD300b, CD300e, TREM1, TREM2, ILT7, ILT3, ILT4, TLT-1, CD200R, CD300a, CD300f, DC-SIGN, B7-2, Aladdin-1, LAT, BLNK, LAYN, SLP76, EMB-LMP1, HIV-NEF, HVS-TIP, HVS-ORF5, and HVS-stpC.

21. 21. The chimeric receptor of any one of claims 1 to 20, wherein the activation domain comprises one or more immunoreceptor tyrosine-based activation motifs (ITAMs), optionally wherein the one or more ITAMs are derived from CD3zeta, CD3sigma, CD3 / , and CD3epsilon.

22. The chimeric receptor of any one of claims 1 to 21, wherein the transcriptional regulatory factor comprises a transcriptional activator or a transcriptional repressor.

23. 23. The chimeric receptor of any one of claims 1 to 22, wherein the transcriptional regulator further comprises a nuclear localization sequence (NLS) derived from a protein selected from the group consisting of Gal4, tetR, ZFHD1, and HAP1, and the transcriptional regulator comprises a transactivation domain derived from a protein selected from the group consisting of VP64, VP65, KRAB, and VP16.

24. The chimeric receptor of any one of claims 1 to 23, comprising an amino acid sequence having at least 80% sequence identity to any one of SEQ ID NOs: 15-32, 34-44, 47-48, 54-58, and 63-68.

25. The chimeric receptor of any one of claims 1 to 24, further comprising a signal sequence, a detectable label, a tumor-specific cleavage site, a disease-specific cleavage site, or a combination thereof.

26. A recombinant nucleic acid comprising a nucleotide sequence encoding the chimeric receptor of any one of claims 1 to 25.

27. A recombinant cell comprising the chimeric receptor of any one of claims 1 to 25 and / or a recombinant nucleic acid of claim 26.

28. 28. The recombinant cell of claim 27, wherein the recombinant cell is a eukaryotic cell, optionally wherein the eukaryotic cell is a mammalian cell.

29. 29. The recombinant cell of claim 28, wherein the mammalian cell is an immune cell, a neuronal cell, an epithelial cell, or an endothelial cell, or a stem cell.

30. 30. The recombinant cell of claim 29, wherein the immune cell is a B cell, monocyte, natural killer cell, basophil, eosinophil, neutrophil, dendritic cell, macrophage, regulatory T cell, helper T cell, cytotoxic T cell, or other T cell.

31. The recombinant cell according to any one of claims 27 to 30, a) a first chimeric receptor and a second chimeric receptor according to any one of claims 1 to 25; and / or b) a first nucleic acid and a second nucleic acid according to claim 26; Including, The first chimeric receptor and the second chimeric receptor do not have the same sequence, and / or the first nucleic acid or the second nucleic acid do not have the same sequence. Recombinant cells.

32. 32. The recombinant cell of claim 31 , wherein the first chimeric receptor modulates the expression and / or activity of a second chimeric receptor.

33. 33. The recombinant cell of any one of claims 27 to 32, further comprising an expression cassette encoding a protein operably linked to a promoter, wherein expression of the protein is regulated by a transcriptional regulator.

34. 34. The recombinant cell of claim 33, wherein the protein is heterologous to the cell.

35. 35. The recombinant cell of claim 33 or 34, wherein the promoter is a yeast GAL4 promoter.

36. 36. The recombinant cell of any one of claims 33 to 35, wherein the protein is a cytokine, a cytotoxin, a chemokine, an immunomodulator, a pro-apoptotic factor, an anti-apoptotic factor, a hormone, a differentiation factor, a de-differentiation factor, an immune cell receptor (e.g., TCR or CAR), or a reporter.

37. A method for producing the recombinant cell of any one of claims 27 to 36, comprising the steps of: a) providing a cell capable of expressing a protein; b) contacting the provided cell with the recombinant nucleic acid of claim 26. The method includes:

38. A pharma- ceutically acceptable carrier, as well as: a) the recombinant nucleic acid of claim 26; and b) The recombinant cell according to any one of claims 27 to 36.

2. A pharmaceutical composition comprising one or more of the following:

39. 1. A method for modulating a cellular activity, comprising: a) providing a recombinant cell according to any one of claims 27 to 36; and b) contacting said recombinant cells with a selected ligand; wherein binding of the selected ligand to the extracellular ligand-binding domain induces cleavage of a ligand-inducible proteolytic cleavage site to release the transcriptional regulator, and the released transcriptional regulator regulates an activity of the recombinant cell. method.

40. 1. Use of a composition comprising recombinant cells in the manufacture of a medicament for inhibiting activity of a target cell in an individual, comprising: The composition comprises the recombinant cell of any one of claims 27 to 36 and is administered to an individual, the recombinant cell inhibits the activity of the target cell in the individual; The above uses.

41. A composition comprising recombinant cells for use in a method for inhibiting the activity of a target cell in an individual, the composition comprising the recombinant cells described in any one of claims 27 to 36 and administered to an individual.

42. 42. The use of claim 40 or the composition of claim 41, wherein the target cell is an acute myeloma leukemia cell, an anaplastic lymphoma cell, an astrocytoma cell, a B cell cancer cell, a breast cancer cell, a colon cancer cell, an ependymoma cell, an esophageal cancer cell, a glioblastoma cell, a glioma cell, a leiomyosarcoma cell, a liposarcoma cell, a hepatic cancer cell, a lung cancer cell, a mantle cell lymphoma cell, a melanoma cell, a neuroblastoma cell, a non-small cell lung cancer cell, an oligodendroglioma cell, an ovarian cancer cell, a pancreatic cancer cell, a peripheral T cell lymphoma cell, a renal cancer cell, a sarcoma cell, a gastric cancer cell, a carcinoma cell, a mesothelioma cell, or a sarcoma cell.

43. 27. Use of a composition comprising recombinant cells in the manufacture of a medicament for treating a condition in an individual in need of treatment, wherein the composition is administered to the individual and the recombinant cells comprise a chimeric receptor described in any one of claims 1 to 25 and / or a recombinant nucleic acid described in claim 26.

44. A composition comprising recombinant cells for use in a method for treating a health condition of an individual in need of treatment, wherein the composition is administered to the individual, and the recombinant cells comprise a chimeric receptor described in any one of claims 1 to 25 and / or a recombinant nucleic acid described in claim 26.

45. 45. The use of claim 43 or the composition of claim 44, wherein the condition is cancer.

46. 46. ​​The use of claim 43 or 45, or the composition of claim 44 or 45, wherein the cancer is a solid tumor, a soft tissue tumor, or a metastasis.

Images