CALR and JAK2 T cell receptors

Abstract

Described herein are T cell receptors (TCRs) that bind to CALR or JAK2 antigens. Also described are T cell receptors (TCRs), polynucleotides, vectors encoding the TCRs and cells comprising the TCRs, and methods of treatment.

Description

[Technical field]

[0001] (Sequence Listing) This application contains a Sequence Listing, which has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy was created on Feb. 24, 2022, is named JBI6418WOPCT1_SL.txt, and is 511,902 bytes in size.

[0002] FIELD OF THEINVENTION T-cell receptors (TCRs) that bind to CALR or JAK2 antigens are provided. TCRs, polynucleotides and vectors encoding the TCRs, cells comprising the TCRs, and methods of treatment are also provided. [Background technology]

[0003] Janus Kinase 2 (JAK2) is a cytoplasmic protein involved in a signaling pathway known to regulate cell growth and proliferation, primarily through cytokine receptors on the cell surface. This pathway is important for the generation and differentiation of blood cells from hematopoietic stem cells in the bone marrow. Lack of JAK2 is embryonic lethal due to lack of erythropoiesis (production of red blood cells). JAK2 mutations are correlated with myeloproliferative neoplasms (MPNs) such as polycythemia vera (PV), essential thromocythemia (ET) and primary myelofibrosis (PM). The most clinically relevant mutation is V617F, in which the valine at amino acid position 617 is replaced by the amino acid phenylalanine. This mutation is an activating mutation that renders cells more sensitive to growth factors, resulting in increased blood cell proliferation in these diseases. There is a high prevalence of this mutation in MPNs. Nearly 100% of patients with PV, 50% of patients with PM, and 60% of patients with ET harbor this mutation. The current standard of care for MPNs is the JAK inhibitor ruxolitinib, but this treatment is not curative. There remains an unmet medical need for treatment of these diseases. Summary of the Invention [Means for solving the problem]

[0004] Described herein are T cell receptors (TCRs) comprising an alpha chain and a beta chain, wherein the alpha chain comprises a complementarity determining region 3 (CDR3) comprising an amino acid sequence provided in Table 4, and the beta chain comprises a CDR3 comprising a corresponding amino acid sequence provided in Table 5 (i.e., the beta chain CDR3 provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain CDR3 (e.g., row 1) provided in Table 4).

[0005] Also described herein are TCRs comprising an alpha chain and a beta chain, wherein the alpha chain comprises a complementarity determining region 1 (CDR1) comprising an amino acid sequence provided in Table 4, a complementarity determining region 2 (CDR2) comprising an amino acid sequence provided in Table 4, and a CDR3 comprising an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a CDR1 comprising an amino acid sequence provided in Table 5, a CDR2 comprising an amino acid sequence provided in Table 5, and a CDR3 comprising an amino acid sequence provided in Table 5 (i.e., the beta chain CDRs provided in Table 5 are in the same row number (e.g., row 1) as the alpha chain CDRs (e.g., row 1) provided in Table 4).

[0006] In certain embodiments, the alpha chain comprises a variable and joining (VJ) region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a variable, diversity and joining (VDJ) region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 5. The alpha chain VJ regions correspond to the beta chain VDJ regions if they appear in the same row in Tables 4 and 5 (i.e., the beta chain VDJ region provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain VJ region provided in Table 4 (e.g., row 1).

[0007] In certain embodiments, the alpha chain comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 4, and the corresponding beta chain comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 5 (i.e., the beta chain provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain provided in Table 4 (e.g., row 1).

[0008] Nucleic acid molecules encoding the disclosed TCRs are also described herein.

[0009] Also described herein are vectors that contain the disclosed nucleic acid molecules.

[0010] Further described and provided are cells transformed to express any of the nucleic acid molecules described herein.

[0011] Further described are cells comprising any of the disclosed vectors. In certain embodiments, the cells are CD8+ T cells.

[0012] Also provided are pharmaceutical compositions comprising any of the disclosed TCRs, any of the disclosed nucleic acid molecules, any of the disclosed vectors, or any of the disclosed cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0013] The disclosed T cell receptors (TCRs), polynucleotides, vectors, compositions, kits, and cells may be more readily understood by reference to the following detailed description, which forms a part of this disclosure: It is to be understood that the disclosed TCRs, polynucleotides, vectors, compositions, kits, and cells are not limited to the isolated TCRs, polynucleotides, vectors, compositions, kits, and cells specifically described and / or illustrated herein, and that the terminology used herein is for the purpose of describing particular embodiments by way of example only, and is not intended to limit the claimed TCRs, polynucleotides, vectors, compositions, kits, and cells.

[0014] Unless specifically specified otherwise, any description of possible mechanisms or modes of action, or reasons for improvement, is intended to be illustrative only, and the disclosed TCRs, polynucleotides, vectors, compositions, kits and cells are not limited by the merits or demerits of any such proposed mechanisms or modes of action, or reasons for improvement.

[0015] When a range of numerical values ​​is recited or established herein, the range includes its endpoints, and all individual integers and rational numbers within the range, and also includes each of the narrower ranges formed by all the various possible combinations of these endpoints and internal integers and rational numbers, forming a subgroup of the larger group of values ​​within the recited range, as if each of the narrower ranges were explicitly recited. When a range of numerical values ​​is recited herein as being greater than the recited value, the range is in any case finite, bounded at its upper end by values ​​that are usable within the context of the invention described herein. When a range of numerical values ​​is recited herein as being less than the recited value, the range is in any case bounded at its lower end by a non-zero value. It is not intended that the scope of the invention be limited to the specific values ​​recited in defining the range. All ranges are inclusive and combinable.

[0016] When values ​​are expressed as approximations, by use of the antecedent "about," it is understood that the particular value forms another embodiment. Reference to a particular numerical value is intended to include at least the particular value unless the context clearly dictates otherwise.

[0017] It is understood that certain features of the invention that are described herein for clarity in the context of separate embodiments may also be provided in combination in a single embodiment. That is, unless expressly incompatible or specifically excluded, each individual embodiment is considered combinable with any other embodiment, and such combination is considered to be another embodiment. Conversely, various features of the invention that are described for brevity in the context of a single embodiment may also be provided separately or in any subcombination. Finally, although an embodiment may be described as part of a series of steps or as part of a more general structure, each step may also be considered to be an independent embodiment in itself that can be combined with the others.

[0018] Various terms relating to the embodiments of the present specification are used throughout the specification and claims. Unless otherwise indicated, such terms are to be given their ordinary meaning in the art. Other specifically defined terms are to be interpreted in a manner consistent with the definitions provided herein.

[0019] The term "comprising" is intended to include examples encompassed by the terms "consisting essentially of" and "consisting of," and similarly, the term "consisting essentially of" is intended to include examples encompassed by the term "consisting of."

[0020] When a value is expressed as an approximation by using the descriptor "about", it is understood that the particular value forms another embodiment. In general, the use of the term "about" indicates an approximation that may vary depending on the desired properties to be obtained by the disclosed subject matter, and should be interpreted in the particular context in which it is used based on its function. Those skilled in the art can interpret this as a matter of routine. In some cases, the number of significant figures used for a particular value can be one non-limiting way to determine the extent of the term "about". In other cases, the gradations used in a series of values ​​can be used to determine the intended range available for the term "about" for each value.

[0021] Unless otherwise specified, the term "about" refers to a ±10% variation of the associated value. Thus, the term "about" is used to encompass a ±10% or less variation, a ±5% or less variation, a ±1% or less variation, a ±0.5% or less variation, or a ±0.1% or less variation from the stated value.

[0022] When lists are presented, it is to be understood that each individual element of that list and every combination of that list is a separate embodiment, unless otherwise specified. For example, a list of embodiments presented as "A, B, or C" should be interpreted as including the embodiments "A," "B," "C," "A or B," "A or C," "B or C," or "A, B, or C."

[0023] As used herein, the singular forms "a," "an," and "the" are intended to include plurals.

[0024] As used herein, the term "at least one" means "one or more."

[0025] The terms "kit" and "article of manufacture" are used synonymously.

[0026] A "9-mer" or "9mer" refers to a polypeptide that is 9 amino acids in length.

[0027] A "subject" includes any human or non-human animal. A "non-human animal" includes any vertebrate, e.g., mammals and non-mammals, such as non-human primates, sheep, dogs, cats, horses, cows, chickens, amphibians, reptiles, etc. The terms "subject" and "patient" may be used interchangeably herein.

[0028] T cell receptor Disclosed herein are TCRs that bind to CALR and the JAK2 epitope. In some embodiments, the TCR binds to a JAK2 epitope comprising the amino acid sequence of VLNYGVCFC (SEQ ID NO: 681). In some embodiments, the TCR binds to a JAK2 epitope comprising the amino acid sequence of FCGDENILV (SEQ ID NO: 682). In some embodiments, the TCR binds to a JAK2 epitope comprising the amino acid sequence of

[0029] [Table 1] wherein the mutant CALR type 1 sequence is underlined, the mutant CALR type II sequence is underlined and bold, and the mutant JAK2 sequence is underlined and italicized. In some embodiments, the TCR binds to a mutJAK2 and mutCALR antigen construct comprising the amino acid sequence of SEQ ID NO: 702.

[0030] The disclosed TCRs can be identified based on T cell binding to CALR and JAK2 epitopes, followed by sequencing of the TCR. The TCRs can be obtained from αβ T cells. The TCRs can be further engineered to improve their affinity, stability, solubility, etc. For example, the TCRs can be cysteine ​​stabilized, expressed as soluble TCRs, as single chain TCRs, as fusions with N- or C-terminal epitope tags, or engineered to improve stability by mutations of the hydrophobic core, such as positions 11, 13, 19, 21, 53, 76, 89, 91 or 94 of the α chain, by domain swapping with α and β chain variable and / or constant domains, as described in U.S. Pat. Nos. 7,329,731, 7,569,664, 9,133,264, 9,624,292, U.S. Patent Application Publication No. 2016 / 0130319 and 9,884,075.

[0031] Described herein are TCRs comprising an alpha chain and a beta chain, where the alpha chain comprises a CDR3 comprising an amino acid sequence provided in Table 4, and the beta chain comprises a CDR3 comprising a corresponding amino acid sequence provided in Table 5. (i.e., the beta chain CDR3 provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain CDR3 (e.g., row 1) provided in Table 4).

[0032] Also described herein are TCRs comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising an amino acid sequence provided in Table 4, a CDR2 comprising an amino acid sequence provided in Table 4, and a CDR3 comprising an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a CDR1 comprising an amino acid sequence provided in Table 5, a CDR2 comprising an amino acid sequence provided in Table 5, and a CDR3 comprising an amino acid sequence provided in Table 5 (i.e., the beta chain CDRs provided in Table 5 are in the same row number (e.g., row 1) as the alpha chain CDRs provided in Table 4 (e.g., row 1).

[0033] In certain embodiments, the alpha chain comprises a variable and joining (VJ) region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a variable, diversity and joining (VDJ) region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 5 (i.e., the beta chain VDJ region provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain VJ region provided in Table 4 (e.g., row 1).

[0034] In certain embodiments, the alpha chain comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 4, and the corresponding beta chain comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 5 (i.e., the beta chain provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain provided in Table 4 (e.g., row 1).

[0035] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 7, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 245. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 3, a CDR2 comprising the amino acid sequence of SEQ ID NO: 5, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 7, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 241, a CDR2 comprising the amino acid sequence of SEQ ID NO: 243, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 245. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 479, and the beta chain comprises a VDJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 581. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 477, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 579.

[0036] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 14, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 252. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 10, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 14, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 248, a CDR2 comprising the amino acid sequence of SEQ ID NO: 250, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 252. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:482, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:584. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:480, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:582.

[0037] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 21, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 259. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a CDR2 comprising the amino acid sequence of SEQ ID NO: 19, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 21, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 255, a CDR2 comprising the amino acid sequence of SEQ ID NO: 257, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 259. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:485, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:587. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:483, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:585.

[0038] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 28, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 266. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 28, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 262, a CDR2 comprising the amino acid sequence of SEQ ID NO: 264, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 266. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:488, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:590. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:486, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:588.

[0039] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 35, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 273. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 31, a CDR2 comprising the amino acid sequence of SEQ ID NO: 33, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 35, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 269, a CDR2 comprising the amino acid sequence of SEQ ID NO: 271, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 273. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:491, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:593. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:489, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:591.

[0040] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 42, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 280. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 38, a CDR2 comprising the amino acid sequence of SEQ ID NO: 40, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 42, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 276, a CDR2 comprising the amino acid sequence of SEQ ID NO: 278, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 280. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:494, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:596. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:492, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:594.

[0041] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 49, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 287. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 45, a CDR2 comprising the amino acid sequence of SEQ ID NO: 47, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 49, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 283, a CDR2 comprising the amino acid sequence of SEQ ID NO: 285, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 287. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 497, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 599. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 495, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 597.

[0042] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 56, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 294. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 52, a CDR2 comprising the amino acid sequence of SEQ ID NO: 54, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 56, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 290, a CDR2 comprising the amino acid sequence of SEQ ID NO: 292, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 294. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:500, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:602. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:498, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:600.

[0043] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 63, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 301. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 59, a CDR2 comprising the amino acid sequence of SEQ ID NO: 61, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 63, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 297, a CDR2 comprising the amino acid sequence of SEQ ID NO: 299, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 301. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:503, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:605. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:501, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:603.

[0044] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 70, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 308. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 66, a CDR2 comprising the amino acid sequence of SEQ ID NO: 68, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 70, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 304, a CDR2 comprising the amino acid sequence of SEQ ID NO: 306, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 308. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:506, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:608. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:504, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:606.

[0045] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 77, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 315. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 73, a CDR2 comprising the amino acid sequence of SEQ ID NO: 75, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 77, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 311, a CDR2 comprising the amino acid sequence of SEQ ID NO: 313, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 315. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:509, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:611. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:507, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:609.

[0046] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 84, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 322. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 80, a CDR2 comprising the amino acid sequence of SEQ ID NO: 82, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 84, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 318, a CDR2 comprising the amino acid sequence of SEQ ID NO: 320, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 322. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:512, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:614. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:510, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:612.

[0047] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 91, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 329. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 87, a CDR2 comprising the amino acid sequence of SEQ ID NO: 89, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 91, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 325, a CDR2 comprising the amino acid sequence of SEQ ID NO: 327, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 329. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:515, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:617. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:513, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:615.

[0048] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 98, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 336. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 94, a CDR2 comprising the amino acid sequence of SEQ ID NO: 96, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 98, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 332, a CDR2 comprising the amino acid sequence of SEQ ID NO: 334, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 336. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:518, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:620. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:516, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:618.

[0049] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 105, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 343. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 101, a CDR2 comprising the amino acid sequence of SEQ ID NO: 103, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 105, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 339, a CDR2 comprising the amino acid sequence of SEQ ID NO: 341, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 343. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:521, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:623. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:519, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:621.

[0050] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 112, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 350. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 108, a CDR2 comprising the amino acid sequence of SEQ ID NO: 110, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 112, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 346, a CDR2 comprising the amino acid sequence of SEQ ID NO: 348, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 350. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:524, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:626. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:522, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:624.

[0051] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 119, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 357. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 115, a CDR2 comprising the amino acid sequence of SEQ ID NO: 117, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 119, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 353, a CDR2 comprising the amino acid sequence of SEQ ID NO: 355, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 357. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:527, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:629. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:525, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:627.

[0052] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 126, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 364. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 122, a CDR2 comprising the amino acid sequence of SEQ ID NO: 124, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 126, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 360, a CDR2 comprising the amino acid sequence of SEQ ID NO: 362, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 364. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:530, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:632. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:528, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:630.

[0053] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 133, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 371. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 129, a CDR2 comprising the amino acid sequence of SEQ ID NO: 131, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 133, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 367, a CDR2 comprising the amino acid sequence of SEQ ID NO: 369, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 371. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:533, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:635. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:531, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:633.

[0054] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 140, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 378. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 136, a CDR2 comprising the amino acid sequence of SEQ ID NO: 138, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 140, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 374, a CDR2 comprising the amino acid sequence of SEQ ID NO: 376, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 378. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:536, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:638. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:534, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:636.

[0055] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 147, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 385. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 143, a CDR2 comprising the amino acid sequence of SEQ ID NO: 145, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 147, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 381, a CDR2 comprising the amino acid sequence of SEQ ID NO: 383, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 385. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:539, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:641. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:537, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:639.

[0056] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 154, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 392. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 150, a CDR2 comprising the amino acid sequence of SEQ ID NO: 152, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 154, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 388, a CDR2 comprising the amino acid sequence of SEQ ID NO: 390, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 392. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:542, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:644. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:540, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:642.

[0057] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 161, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 399. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 157, a CDR2 comprising the amino acid sequence of SEQ ID NO: 159, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 161, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 395, a CDR2 comprising the amino acid sequence of SEQ ID NO: 397, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 399. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:545, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:647. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:543, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:645.

[0058] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 168, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 406. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 164, a CDR2 comprising the amino acid sequence of SEQ ID NO: 166, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 168, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 402, a CDR2 comprising the amino acid sequence of SEQ ID NO: 404, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 406. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:548, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:650. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:546, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:648.

[0059] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 175, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 413. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 171, a CDR2 comprising the amino acid sequence of SEQ ID NO: 173, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 175, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 409, a CDR2 comprising the amino acid sequence of SEQ ID NO: 411, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 413. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:551, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:653. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:549, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:651.

[0060] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 182, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 420. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 178, a CDR2 comprising the amino acid sequence of SEQ ID NO: 180, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 182, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 416, a CDR2 comprising the amino acid sequence of SEQ ID NO: 418, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 420. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:554, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:656. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:552, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:654.

[0061] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 189, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 427. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 185, a CDR2 comprising the amino acid sequence of SEQ ID NO: 187, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 189, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 423, a CDR2 comprising the amino acid sequence of SEQ ID NO: 425, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 427. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:557, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:659. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:555, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:657.

[0062] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 196, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 434. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 192, a CDR2 comprising the amino acid sequence of SEQ ID NO: 194, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 196, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 430, a CDR2 comprising the amino acid sequence of SEQ ID NO: 432, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 434. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:560, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:662. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:558, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:660.

[0063] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 203, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 441. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 199, a CDR2 comprising the amino acid sequence of SEQ ID NO: 201, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 203, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 437, a CDR2 comprising the amino acid sequence of SEQ ID NO: 439, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 441. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:563, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:665. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:561, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:663.

[0064] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 210, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 448. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 206, a CDR2 comprising the amino acid sequence of SEQ ID NO: 208, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 210, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 444, a CDR2 comprising the amino acid sequence of SEQ ID NO: 446, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 448. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:566, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:668. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:564, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:666.

[0065] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 217, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 455. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 213, a CDR2 comprising the amino acid sequence of SEQ ID NO: 215, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 217, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 451, a CDR2 comprising the amino acid sequence of SEQ ID NO: 453, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 455. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:569, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:671. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:567, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:669.

[0066] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 224, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 462. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 220, a CDR2 comprising the amino acid sequence of SEQ ID NO: 222, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 224, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 458, a CDR2 comprising the amino acid sequence of SEQ ID NO: 460, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 462. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:572, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:674. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:570, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:672.

[0067] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 231, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 469. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 227, a CDR2 comprising the amino acid sequence of SEQ ID NO: 229, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 231, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 465, a CDR2 comprising the amino acid sequence of SEQ ID NO: 467, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 469. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:575, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:677. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:573, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:675.

[0068] Described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 238, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 476. Also described herein is a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 234, a CDR2 comprising the amino acid sequence of SEQ ID NO: 236, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 238, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 472, a CDR2 comprising the amino acid sequence of SEQ ID NO: 474, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 476. In certain embodiments, the alpha chain comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:578, and the beta chain comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:680. In certain embodiments, the alpha chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:576, and the beta chain comprises an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:678.

[0069] Polynucleotides The present disclosure also provides polynucleotides encoding any of the disclosed TCRs.

[0070] Described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, where the alpha chain comprises a CDR3 comprising an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a CDR3 comprising a corresponding amino acid sequence provided in Table 5. Described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, where the alpha chain comprises a CDR3 encoded by a nucleic acid sequence provided in Table 4, and the corresponding beta chain comprises a CDR3 encoded by a corresponding nucleic acid sequence provided in Table 5 (i.e., the beta chain CDR3 provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain CDR3 provided in Table 4 (e.g., row 1).

[0071] Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising an amino acid sequence provided in Table 4, a CDR2 comprising an amino acid sequence provided in Table 4, and a CDR3 comprising an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a CDR1 comprising an amino acid sequence provided in Table 5, a CDR2 comprising an amino acid sequence provided in Table 5, and a CDR3 comprising an amino acid sequence provided in Table 5. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by a nucleic acid sequence provided in Table 4, a CDR2 encoded by a nucleic acid sequence provided in Table 4, and a CDR3 encoded by a nucleic acid sequence provided in Table 4, and the corresponding beta chain comprises a CDR1 encoded by a nucleic acid sequence provided in Table 5, a CDR2 encoded by a nucleic acid sequence provided in Table 5, and a CDR3 encoded by a nucleic acid sequence provided in Table 5 (i.e., the beta chain CDRs provided in Table 5 are in the same row number (e.g., row 1) as the alpha chain CDRs provided in Table 4 (e.g., row 1).

[0072] Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a VJ region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a VDJ region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 5. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a VJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence provided in Table 4, and the corresponding beta chain comprises a VDJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence provided in Table 5 (i.e., the beta chain VDJ region provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain VJ region provided in Table 4 (e.g., row 1).

[0073] Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 4, and the corresponding beta chain comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 5. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence provided in Table 4, and the corresponding beta chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence provided in Table 5 (i.e., the beta chain provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain provided in Table 4 (e.g., row 1).

[0074] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO:6, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO:244. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO:2, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO:4, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO:6, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO:240, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO:242, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO:244. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:478, and the beta chain comprises a variable, diversity and joining (VDJ) region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:580. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:1, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:239.

[0075] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 13, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 251. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 9, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 11, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 13, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 247, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 249, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 251. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:481, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:583. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:8, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:246.

[0076] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 20, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 258. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 16, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 18, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 20, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 254, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 256, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 258. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 484, and the beta chain comprises a VJD region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 586. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 15, and the beta chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 253.

[0077] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 27, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 265. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 23, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 25, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 27, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 261, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 263, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 265. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:487, and the beta chain comprises a VJD region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:589. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:22, and the beta chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:260.

[0078] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 34, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 272. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 30, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 32, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 34, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 268, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 270, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 272. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 490, and the beta chain comprises a VJD region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 592. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 29, and the beta chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 267.

[0079] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 41, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 279. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 37, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 39, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 41, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 275, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 277, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 279. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 493, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 595. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 36, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 274.

[0080] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 48, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 286. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 44, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 46, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 48, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 282, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 284, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 286. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 496, and the beta chain comprises a VJD region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 598. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 43, and the beta chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO: 281.

[0081] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 55, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 293. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 51, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 53, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 55, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 289, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 291, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 293. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:499, and the beta chain comprises a VJD region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:601. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:50, and the beta chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:288.

[0082] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 62, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 300. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 58, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 60, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 62, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 296, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 298, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 300. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:502, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:604. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:57, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:295.

[0083] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 69, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 307. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 65, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 67, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 69, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 303, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 305, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 307. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:505, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:607. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:64, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:302.

[0084] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 76, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 314. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 72, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 74, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 76, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 310, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 312, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 314. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:508, and the beta chain comprises a VJD region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:610. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:71, and the beta chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:309.

[0085] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 83, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 321. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 79, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 81, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 83, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 317, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 319, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 321. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:511, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:613. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:78, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:316.

[0086] Described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 90, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 328. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 86, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 88, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 90, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 324, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 326, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 328. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:514, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:616. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:85, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:323.

[0087] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 97, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 335. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 93, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 95, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 97, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 331, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 333, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 335. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:517, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:619. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:92, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:330.

[0088] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 104, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 342. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 100, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 102, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 104, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 338, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 340, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 342. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:520, and the beta chain comprises a VJD region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:622. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:99, and the beta chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:337.

[0089] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 111, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 349. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 107, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 109, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 111, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 345, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 347, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 349. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:523, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:625. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:106, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:344.

[0090] Described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 118, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 356. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 114, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 116, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 118, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 352, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 354, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 356. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:526, and the beta chain comprises a VJD region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:628. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:113, and the beta chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:351.

[0091] Described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 125, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 363. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 121, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 123, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 125, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 359, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 361, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 363. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:529, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:631. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:120, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:358.

[0092] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 132, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 370. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 128, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 130, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 132, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 366, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 368, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 370. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:532, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:634. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:127, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:365.

[0093] Described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 139, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 377. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 135, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 137, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 139, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 373, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 375, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 377. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:535, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:637. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:134, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:372.

[0094] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 146, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 384. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 142, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 144, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 146, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 380, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 382, ​​and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 384. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:538, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:640. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:141, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:379.

[0095] Described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 153, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 391. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 149, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 151, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 153, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 387, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 389, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 391. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:541, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:643. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:148, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:386.

[0096] Described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 160, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 398. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 156, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 158, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 160, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 394, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 396, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 398. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:544, and the beta chain comprises a VJD region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:646. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:155, and the beta chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:393.

[0097] Described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 167, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 405. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 163, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 165, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 167, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 401, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 403, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 405. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:547, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:649. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:162, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:400.

[0098] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 174, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 412. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 170, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 172, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 174, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 408, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 410, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 412. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:550, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:652. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:169, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:407.

[0099] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 181, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 419. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 177, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 179, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 181, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 415, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 417, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 419. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:553, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:655. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:176, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:414.

[0100] Described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 188, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 426. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 184, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 186, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 188, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 422, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 424, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 426. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:556, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:658. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:183, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:421.

[0101] Described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 195, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 433. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 191, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 193, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 195, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 429, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 431, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 433. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:559, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:661. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:190, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:428.

[0102] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 202, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 440. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 198, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 200, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 202, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 436, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 438, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 440. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:562, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:664. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:197, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:435.

[0103] Described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 209, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 447. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 205, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 207, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 209, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 443, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 445, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 447. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:565, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:667. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:204, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:442.

[0104] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 216, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 454. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 212, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 214, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 216, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 450, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 452, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 454. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:568, and the beta chain comprises a VJD region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:670. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:211, and the beta chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:449.

[0105] Described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 223, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 461. Also described herein is a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 219, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 221, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 223, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 457, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 459, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 461. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:571, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:673. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:218, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:456.

[0106] Described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 230, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 468. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 226, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 228, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 230, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 464, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 466, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 468. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:574, and the beta chain comprises a VJD region encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:676. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:225, and the beta chain is encoded by a nucleic acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:463.

[0107] Described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 237, and the beta chain comprises a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 475. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 233, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 235, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 237, and the beta chain comprises a CDR1 encoded by the nucleic acid sequence of SEQ ID NO: 471, a CDR2 encoded by the nucleic acid sequence of SEQ ID NO: 473, and a CDR3 encoded by the nucleic acid sequence of SEQ ID NO: 475. In certain embodiments, the alpha chain comprises a VJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:577, and the beta chain comprises a VJD region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:679. In certain embodiments, the alpha chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:232, and the beta chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid sequence of SEQ ID NO:470.

[0108] In some embodiments, the polynucleotide comprises DNA.

[0109] In some embodiments, the polynucleotide comprises RNA.

[0110] In some embodiments, the RNA is mRNA.

[0111] In some embodiments, the polynucleotide comprises a promoter, an enhancer, a polyadenylation site, a Kozak sequence, a stop codon, or any combination thereof.

[0112] Methods for making polynucleotides of the present disclosure are known in the art and include chemical synthesis, enzymatic synthesis (e.g., in vitro transcription), enzymatic or chemical cleavage of longer precursors, chemical synthesis of smaller fragments of polynucleotides followed by fragment ligation, or known PCR methods. The polynucleotide sequence to be synthesized can be designed with the appropriate codons for the desired amino acid sequence. Generally, preferred codons can be selected for the intended host that the sequence will be used for expression.

[0113] vector The present disclosure also provides a vector comprising any of the polynucleotides disclosed herein.The present disclosure also provides a vector comprising a polynucleotide encoding any of the polypeptides disclosed herein.

[0114] Described herein is a vector comprising a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising an amino acid sequence provided in Table 4 and the corresponding beta chain comprises a CDR3 comprising a corresponding amino acid sequence provided in Table 5. Described herein is a vector comprising a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by a nucleic acid sequence provided in Table 4 and the corresponding beta chain comprises a CDR3 encoded by a corresponding nucleic acid sequence provided in Table 5.

[0115] Also described herein is a vector comprising a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising an amino acid sequence provided in Table 4, a CDR2 comprising an amino acid sequence provided in Table 4, and a CDR3 comprising an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a CDR1 comprising an amino acid sequence provided in Table 5, a CDR2 comprising an amino acid sequence provided in Table 5, and a CDR3 comprising an amino acid sequence provided in Table 5.

[0116] Also described herein is a vector comprising a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by a nucleic acid sequence provided in Table 4, a CDR2 encoded by a nucleic acid sequence provided in Table 4, and a CDR3 encoded by a nucleic acid sequence provided in Table 4, and the corresponding beta chain comprises a CDR1 encoded by a nucleic acid sequence provided in Table 5, a CDR2 encoded by a nucleic acid sequence provided in Table 5, and a CDR3 encoded by a nucleic acid sequence provided in Table 5.

[0117] Also described herein is a vector comprising a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a VJ region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a VDJ region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 5.

[0118] Also described herein is a vector comprising a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a VJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence provided in Table 4, and the corresponding beta chain comprises a VDJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence provided in Table 5.

[0119] Also described herein is a vector comprising a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 4, and the corresponding beta chain comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 5.

[0120] Also described herein is a vector comprising a polynucleotide encoding a TCR polypeptide comprising an alpha chain and a beta chain, wherein the alpha chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence provided in Table 4, and the corresponding beta chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence provided in Table 5.

[0121] The vector may be a vector intended for expressing the polynucleotide of the present disclosure in any host, such as bacteria, yeast or mammalian.Suitable expression vectors are typically replicable in the host organism, either as episomes or as an integral part of the host chromosomal DNA.Usually, expression vectors contain a selection marker, such as ampicillin resistance, hygromycin resistance, tetracycline resistance, kanamycin resistance or neomycin resistance, to allow detection of cells transformed or transduced with the desired DNA sequence.Exemplary vectors are plasmids, cosmids, phages, viral vectors or artificial chromosomes.

[0122] Suitable vectors that may be used include, but are not limited to: Bacterial: pBs, phagescript, PsiX174, pBluescript SK, pBs KS, pNH8a, pNH16a, pNH18a, pNH46a (Stratagene, La Jolla, Calif., USA), pTrc99A, pKK223-3, pKK233-3, pDR540 and pRIT5 (Pharmacia, Uppsala, Sweden). Eukaryotic: pWLneo, pSV2cat, pOG44, PXR1, pSG (Stratagene), pSVK3, pBPV, pMSG and pSVL (Pharmacia).

[0123] The present disclosure provides an expression vector comprising a polynucleotide of the present disclosure. The present disclosure also provides an expression vector comprising a polynucleotide encoding a polypeptide of the present disclosure.

[0124] Other viral vectors and recombinant viruses The present disclosure also provides viral vectors comprising any of the polynucleotides of the present disclosure.

[0125] The present disclosure also provides viral vectors comprising a polynucleotide encoding any of the TCR polypeptides of the present disclosure.

[0126] Viral vectors are derived from naturally occurring viral genomes and are typically modified to be replication-deficient, e.g., non-replicating. Non-replicating viruses require proteins to be provided in trans for replication. Typically, these proteins are stably or transiently expressed in virus-producing cell lines, thereby allowing the virus to replicate. Thus, viral vectors are typically infectious and non-replicating. Viral vectors include adenovirus vectors, adeno-associated virus (AAV) vectors (e.g., AAV types 5 and 2), great ape adenovirus vectors (GAd), alphavirus vectors (e.g., Venezuelan equine encephalitis virus (VEEV), Sindbis virus (SIN), Semliki forest virus (SFV), and VEEV-SIN chimeras), herpesvirus vectors (e.g., vectors derived from cytomegaloviruses such as rhesus cytomegalovirus (RhCMV)), arenavirus vectors (e.g., lymphocytic choriomeningitis virus (LCMV) vectors), measles virus vectors, poxvirus vectors (e.g., vaccinia virus, modified vaccinia virus Ankara ... vaccinia virus Ankara, MVA), NYVAC (derived from the Copenhagen strain of vaccinia), and avipox vectors: canarypox (ALVAC) and fowlpox (FPV) vectors), vesicular stomatitis virus vectors, retroviral vectors, lentiviral vectors, virus-like particles, LNPs derived from alphaviruses encapsulating self-replicating RNA, and bacterial spores.

[0127] In some embodiments, the viral vector is derived from an adenovirus, a poxvirus, an alphavirus, an adeno-associated virus, a retrovirus, or a self-replicating RNA molecule.

[0128] In some embodiments, the viral vector is derived from an adenovirus. Suitable adenovirus vectors include, for example, hAd5, hAd7, hAd11, hAd26, hAd34, hAd35, hAd48, hAd49, hAd50, GAd20, Gad19, GAd21, GAd25, GAd26, GAd27, GAd28, GAd29, GAd30, GAd31, ChAd3, ChAd4, ChAd5, ChAd6, ChAd7, ChAd8, ChAd9, These include ChAd10, ChAd11, ChAd16, ChAdI7, ChAd19, ChAd20, ChAd22, ChAd24, ChAd26, ChAd30, ChAd31, ChAd37, ChAd38, ChAd44, ChAd55, ChAd63, ChAd73, ChAd82, ChAd83, ChAd146, ChAd147, PanAd1, PanAd2 and PanAd3.

[0129] Adenoviral vectors can be derived from human adenoviruses (Ad), but also from bovine adenoviruses (e.g., bovine adenovirus 3, BAdV3), canine adenoviruses (e.g., CAdV2), porcine adenoviruses (e.g., PAdV3 or 5), or adenoviruses that infect other species, such as great apes, such as chimpanzees (Pan), gorillas (Gorilla), orangutans (Pongo), bonobos (Pan paniscus), and mongooses (Pan troglodytes). Typically, naturally occurring great ape adenoviruses are isolated from fecal samples of the respective great apes.

[0130] Human adenoviral vectors can be derived from various adenovirus serotypes, for example, human adenovirus serotypes hAd5, hAd7, hAd11, hAd26, hAd34, hAd35, hAd48, hAd49, or hAd50 (serotypes are also referred to as Ad5, Ad7, Ad11, Ad26, Ad34, Ad35, Ad48, Ad49, or Ad50).

[0131] Great ape adenovirus (GAd) vectors can be derived from various adenovirus serotypes, for example, great ape adenovirus serotypes GAd20, GAd19, GAd21, GAd25, GAd26, GAd27, GAd28, GAd29, GAd30, GAd31, ChAd3, ChAd4, ChAd5, ChAd6, ChAd7, ChAd8, ChAd9, ChAd10, ChAd11, ChAd16, ChAdI7, ChAd19, ChAd20, ChAd22, ChAd24, ChAd26, ChAd30, ChAd31, ChAd37, ChAd38, ChAd44, ChAd55, ChAd63, ChAd73, ChAd82, ChAd83, ChAd146, ChAd147, PanAd1, PanAd2, or PanAd3.

[0132] Adenoviral vectors are known in the art. Most sequences of human and non-human adenoviruses are known, and others can be obtained using routine procedures. Exemplary genomic sequences of Ad26 are found in GenBank Accession No. EF153474 and WO 2007 / 104792. Exemplary genomic sequences of Ad35 are found in WO 2000 / 70071. Ad26-based vectors are described, for example, in WO 2007 / 104792. Ad35-based vectors are described, for example, in U.S. Patent No. 7,270,811 and WO 2000 / 70071. Vectors based on ChAd3, ChAd4, ChAd5, ChAd6, ChAd7, ChAd8, ChAd9, ChAd10, ChAd11, ChAd16, ChAd17, ChAd19, ChAd20, ChAd22, ChAd24, ChAd26, ChAd30, ChAd31, ChAd37, ChAd38, ChAd44, ChAd63, and ChAd82 are described in WO 2005 / 071093. Vectors based on PanAd1, PanAd2, PanAd3, ChAd55, ChAd73, ChAd83, ChAd146, and ChAd147 are described in WO 2010 / 086189.

[0133] In some embodiments, the viral vector is a poxvirus, hi some embodiments, the poxvirus vector is selected from a smallpox virus vector, a vaccinia virus vector, a cowpox virus vector, a monkeypox virus vector, a Copenhagen Vaccinia Virus (W) vector, a New York Attenuated Vaccinia Virus (NYVAC) vector, and a Modified Vaccinia Ankara (MVA) vector.

[0134] Poxvirus (Poxviridae) vectors can be derived from Variola virus (variola), Vaccinia virus, Cowpox virus or Monkeypox virus. Exemplary vaccinia viruses are Copenhagen vaccinia virus (W), New York attenuated vaccinia virus (NYVAC), ALVAC, TROVAC, or Modified Vaccinia Ankara (MVA).

[0135] MVA originates from the cutaneous vaccinia strain Ankara (Chorioallantois vaccinia Ankara, CVA virus) which has been maintained for many years at the Vaccination Institute (Ankara, Turkey) and used as the basis for human vaccination.

[0136] In some embodiments, the viral vector is an adeno-associated virus. The viral vector comprising the polynucleotide of the present disclosure may be derived from a human adeno-associated virus, such as AAV-2 (adeno-associated virus type 2). An attractive feature of AAV vectors is that they do not express any viral genes. The only viral DNA sequence contained in AAV vectors is the 145 bp inverted terminal repeat (ITR). Thus, as seen in naked DNA immunization, the only gene expressed is that of the antigen or antigen chimera. In addition, AAV vectors are known to transduce both dividing and non-dividing cells, such as human peripheral blood monocyte-derived dendritic cells, for persistent transgene expression, as well as for oral and intranasal delivery to generate mucosal immunity. Furthermore, the amount of DNA required is likely to be several orders of magnitude less, at 50 μg or about 10 15 As opposed to a dose of naked DNA of 10 copies 10A dose of 1000 particles or copies of DNA produces the maximum response. AAV vectors are packaged by co-transfecting a suitable cell line (e.g., human 293 cells) with DNA contained in the construct encoding the AAV ITR chimeric protein and the AAV helper plasmid ACG2, which contains the AAV coding region (AAV rep and cap genes) without the ITRs. The cells are then infected with adenovirus Ad5. The vectors can be purified from cell lysates using methods known in the art (e.g., cesium chloride density gradient ultracentrifugation, etc.) and verified to be free of detectable replication-competent AAV or adenovirus (e.g., by cytopathic effect bioassay).

[0137] Viral vectors comprising the polynucleotides of the present disclosure also include retroviral vectors. Retroviruses are a class of integrative viruses that replicate using a virally encoded reverse transcriptase enzyme to replicate the viral RNA genome into double-stranded DNA that is integrated into the chromosomal DNA of infected cells (e.g., target cells). Such vectors include those derived from murine leukemia viruses, particularly Moloney (Gilboa, et al., 1988, Adv. Exp. Med. Biol 241:29) or Friend FB29 strains (WO 1995 / 01447). In general, retroviral vectors contain deletions of all or part of the viral genes gag, pol, and env, while retaining the 5' and 3' LTRs and encapsidation sequences. These elements can be modified to increase the expression levels or stability of the retroviral vector. Such modifications include the replacement of retroviral encapsidation sequences with retrotransposons such as VL30 (see, e.g., U.S. Pat. No. 5,747,323).

[0138] A polynucleotide encoding a polypeptide of the present disclosure may be inserted downstream of the encapsidation sequence, such as in the opposite orientation to the retroviral genome. Retroviral particles are prepared in the presence of a helper virus or in a suitable complementing (packaging) cell line in which the retroviral genes (e.g., gag / pol and env) that the retroviral vector lacks are integrated into the genome. Such cell lines are described in Miller and Rosman, 1989, BioTechniques 7:980; Danos and Mulligan, 1988, Proc. Natl. Acad. Sci. USA 85:6460; Markowitz, et al., 1988, Virol. 167:400. The product of the env gene is involved in binding of the virus particle to the viral receptor present on the surface of the target cell, thus determining the host range of the retroviral particle. Thus, packaging cell lines such as PA317 cells (ATCC CRL 9078) or 293EI6 (WO 97 / 35996), which contain amphotropic envelope proteins, can be used to allow infection of target cells of humans and other species. Retroviral particles are recovered from the culture supernatant and, optionally, can be further purified according to standard techniques (e.g., chromatography, ultracentrifugation).

[0139] The present disclosure also provides a host cell comprising any of the above vectors.

[0140] Suitable host cells include prokaryotic or eukaryotic host cells. In some embodiments, the host cell is a PER.C6, PER.C6TetO, chicken embryo fibroblast (CEF), CHO, HEK293, HT-1080, HKB-11, CAP, HuH-7, or Age1 cell line.

[0141] self-replicating RNA molecule Provided herein are viral vectors comprising any of the polynucleotides of the present disclosure, where the vectors are derived from self-replicating RNA molecules.

[0142] The self-replicating RNA may be derived from an alphavirus. The alphavirus may belong to the VEEV / EEEV group, or the SF group, or the SIN group. Non-limiting examples of SF group alphaviruses include Semliki Forest virus, O'nyong-nyong virus, Ross River virus, Middleburg virus, Chikungunya virus, Barmah Forest virus, Getah virus, Mayaro virus, Sagiyama virus, Bebaru virus, and Una virus. Non-limiting examples of SIN group alphaviruses include Sindbis virus, Girdwood SA virus, South African arbovirus No. 86, Okerubo virus, Aura virus, Babanki virus, Wataroa virus, and Kijiraga virus. Non-limiting examples of VEEV / EEEV group alphaviruses include Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Pixuna virus (PIXV), Middleburg virus (MIDV), Chikungunya virus (CHIKV), O'Nyong-Nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getah virus (GET), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), and Una virus (UNAV). Examples include UNAV.

[0143] The self-replicating RNA molecules may be derived from an alphavirus genome, meaning that they have or are similar to some of the structural features of an alphavirus genome. The self-replicating RNA molecules may be derived from a modified alphavirus genome.

[0144] Self-replicating RNA molecules include Eastern equine encephalitis virus (EEEV), Venezuelan equine encephalitis virus (VEEV), Everglades virus (EVEV), Mucambo virus (MUCV), Semliki Forest virus (SFV), Pixuna virus (PIXV), Middleburg virus (MIDV), Chikungunya virus (CHIKV), Onyong-nyong virus (ONNV), Ross River virus (RRV), Barmah Forest virus (BF), Getah virus (GET), Sagiyama virus (SAGV), Bebaru virus (BEBV), Mayaro virus (MAYV), Una virus (UNAV), Sindbis virus (SINV), Aura virus (AURAV), Whataroa virus (WHAV), Babanki virus (BABV), Kyzylagach virus (KYV), and Sarcovirus (SAGV). The alphavirus may be derived from KYZV, WEEV, Highland J virus (HJV), Fort Morgan virus (FMV), Ndumu virus (NDUV), and Boggy Creek virus. Both pathogenic and non-pathogenic alphavirus strains are suitable. In some embodiments, the alphavirus RNA replicon is from Sindbis virus (SIN), Semliki Forest virus (SFV), Ross River virus (RRV), Venezuelan equine encephalitis virus (VEEV), or Eastern equine encephalitis virus (EEEV).

[0145] In some embodiments, the self-replicating RNA molecule derived from an alphavirus is Venezuelan Equine Encephalitis Virus (VEEV).

[0146] A self-replicating RNA molecule can contain an RNA sequence from a wild-type New World or Old World alphavirus genome (or the amino acid sequence encoded thereby). Any of the self-replicating RNA molecules disclosed herein can include an RNA sequence "derived from" or "based on" a wild-type alphavirus genome sequence, meaning that it has a sequence that is at least 60%, or at least 65%, or at least 68%, or at least 70%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99%, or 100%, or 80-99%, or 90-100%, or 95-99%, or 95-100%, or 97-99%, or 98-99% identical to an RNA sequence from a wild-type RNA alphavirus genome (which may be a corresponding RNA sequence), which may be a New World or Old World alphavirus genome.

[0147] Self-replicating RNA molecules contain all the genetic information necessary to direct their own amplification or self-replication in permissive cells. To direct their own replication, they contain cis-acting RNA sequences that code for polymerases, replicases, or other proteins that can interact with proteins, nucleic acids, or ribonucleoproteins derived from the virus or host cell to catalyze the RNA amplification process, and are necessary for the replication and transcription of the replicon-encoding RNA. Thus, RNA replication leads to the production of multiple daughter RNAs. These daughter RNAs, and collinear subgenomic transcripts, can be translated to provide in situ expression of the gene of interest, or can be transcribed to provide further transcripts of the same sense as the delivered RNA, which are translated to provide in situ expression of the gene of interest. The overall result of this transcription sequence is that the number of introduced replicon RNAs is greatly amplified, so that the encoded gene of interest becomes the major polypeptide product of the cell.

[0148] There are two open reading frames (ORFs) in the genome of alphaviruses, non-structural (ns) and structural genes. The nsORFs encode proteins (nsP1-nsP4) required for transcription and replication of viral RNA, produced as a polyprotein, and are the viral replication machinery. The structural ORFs encode three structural proteins, the core nucleocapsid protein C, and the envelope proteins P62 and El, which associate as a heterodimer. The viral membrane-anchored surface glycoproteins are responsible for receptor recognition and entry into target cells by membrane fusion. The four ns protein genes are encoded by genes in the 5'2 / 3 of the genome, and the three structural proteins are translated from a collinear subgenomic mRNA in the 3'1 / 3 of the genome.

[0149] Self-replicating RNA molecules can be used as the basis for the introduction of foreign sequences into host cells by replacing viral sequences encoding structural genes or by inserting foreign sequences 5' or 3' of sequences encoding structural genes. They can be engineered to replace viral structural genes (genes of interest, GOI) downstream of a replicase under the control of a subgenomic promoter, e.g., a polynucleotide encoding a polypeptide of the present disclosure. Upon transfection, the immediately translated replicase interacts with the 5' and 3' ends of the genomic RNA and synthesizes complementary genomic RNA copies. These serve as templates for the synthesis of new positive-stranded capped and polyadenylated genomic copies and subgenomic transcripts. Amplification ultimately reaches up to 2 x 10 per cell. 5 This results in a significantly higher RNA copy number of up to 100 copies, resulting in uniform and / or enhanced expression of the GOI (e.g., a polynucleotide encoding a polypeptide of the present disclosure) that may affect therapeutic efficacy or therapeutic impact.

[0150] The present disclosure provides a self-replicating RNA molecule that contains all the genetic information necessary to direct its own amplification or self-replication in a permissive cell.

[0151] The present disclosure also provides self-replicating RNA molecules that can be used as the basis for introducing foreign sequences (e.g., polynucleotides encoding a polypeptide of the present disclosure) into a host cell by replacing viral sequences encoding structural genes.

[0152] Provided herein are viral vectors comprising any of the polynucleotides of the present disclosure, where the vectors are derived from self-replicating RNA molecules.

[0153] Any of the above self-replicating RNA molecules may be one or more nonstructural genes, nsP1, nsP2, nsP3, and nsP4; at least one of a DLP motif, a 5'UTR, a 3'UTR, and a polyA, and may further comprise one or more of the subgenomic promoters.

[0154] In some embodiments, for example, the self-replicating RNA molecule is one or more of the nonstructural genes, nsP1, nsP2, nsP3, and nsP4; at least one of a DLP motif, a 5'UTR, a 3'UTR, and a polyA, and Subgenomic promoters, and an RNA encoding the amino acid sequence of SEQ ID NO:8 or SEQ ID NO:10, operably linked to a subgenomic promoter.

[0155] In some embodiments, the self-replicating RNA molecule comprises an RNA sequence encoding a protein or peptide, 5' and 3' alphavirus untranslated regions, an RNA sequence encoding an amino acid sequence derived from the New World alphavirus VEEV nonstructural proteins nsP1, nsP2, nsP3, and nsP4, a subgenomic promoter operably linked to the RNA sequence encoding the protein and regulating its translation, a 5' cap and a 3' polyA tail, a positive-sense single-stranded RNA, a DLP from Sindbis virus upstream of non-structural protein 1 (nsP1), a 2A ribosomal skipping element, and nsp1 nucleotide repeats downstream of the 5'-UTR and upstream of the DLP.

[0156] In some embodiments, the self-replicating RNA molecule may be at least 1 kb, or at least 2 kb, or at least 3 kb, or at least 4 kb, or at least 5 kb, or at least 6 kb, or at least 7 kb, or at least 8 kb, or at least 10 kb, or at least 12 kb, or at least 15 kb, or at least 17 kb, or at least 19 kb, or at least 20 kb in size, or may be from 100 bp to 8 kb, or from 500 bp to 8 kb, or from 500 bp to 7 kb, or from 1 to 7 kb, or from 1 to 8 kb, or from 2 to 15 kb, or from 2 to 20 kb, or from 5 to 15 kb, or from 5 to 20 kb, or from 7 to 15 kb, or from 7 to 18 kb, or from 7 to 20 kb in size.

[0157] Any of the self-replicating RNA molecules disclosed above can further comprise a coding sequence for an autoprotease peptide (e.g., an autocatalytic self-cleaving peptide), optionally operably linked upstream of the nucleic acid sequence encoding the GOI.

[0158] Generally, any proteolytic cleavage site known in the art can be incorporated into the nucleic acid molecule of the present disclosure, for example, a proteolytic cleavage sequence that is cleaved after production by a protease. Further suitable proteolytic cleavage sites also include proteolytic cleavage sequences that can be cleaved after the addition of an external protease. As used herein, the term "autoprotease" refers to a "self-cleaving" peptide that has autoproteolytic activity and can cleave itself from a larger polypeptide moiety. Several autoproteases, such as the "2A-like" peptide from Equine Rhinitis A Virus (E2A), porcine teschovirus-1 (P2A), and Thosea asigna virus (T2A), which were first identified in foot-and-mouth disease virus (FMDV) and are members of the picornavirus group, have since been identified, and their activity in proteolytic cleavage has been shown in various ex vitro and in vivo eukaryotic systems. Thus, the concept of autoprotease is available to those skilled in the art, since many naturally occurring autoprotease systems have been identified. Well-studied autoprotease systems are, for example, viral proteases, developmental proteins (e.g., HetR, hedgehog proteins), RumA autoprotease domain, UmuD, etc. Non-limiting examples of autoprotease peptides suitable for the compositions and methods of the present disclosure include peptide sequences from Porcine Teschovirus-1 2A (P2A), Foot and Mouth Disease Virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna Virus 2A (T2A), Cytoplasmic Polyhedrosis Virus 2A (BmCPV2A), Flacheria Disease Virus 2A (BmIFV2A), or combinations thereof.

[0159] In some embodiments, the coding sequence for the autoprotease peptide is operably linked downstream of the DLP motif and upstream of the GOI.

[0160] In some embodiments, the autoprotease peptide comprises or consists of a peptide sequence selected from the group consisting of Porcine Teschovirus-1 2A (P2A), Foot and Mouth Disease Virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), Cytoplasmic Polyhedrosis Virus 2A (BmCPV2A), Flacheria Disease Virus 2A (BmIFV2A), and combinations thereof. In some embodiments, the autoprotease peptide comprises the peptide sequence of Porcine Teschovirus-1 2A (P2A).

[0161] In some embodiments, the autoprotease peptide is selected from the group consisting of Porcine Teschovirus-1 2A (P2A), Foot and Mouth Disease Virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), Thosea asigna virus 2A (T2A), Cytoplasmic Polyhedrosis Virus 2A (BmCPV2A), Flacheria Disease Virus 2A (BmIFV2A), and combinations thereof.

[0162] In some embodiments, the autoprotease peptide is porcine teschovirus-1 2A (P2A).

[0163] Incorporation of the P2A peptide in the modified viral RNA replicon allows release of the protein encoded by the GOI (e.g., a polynucleotide encoding a TCR polypeptide of the present disclosure) from the capsid-GOI fusion.

[0164] In some embodiments disclosed herein, the porcine teschovirus-1 2A (P2A) peptide sequence is engineered in frame immediately following the DLP sequence and in frame immediately upstream of all GOIs.

[0165] Any of the self-replicating RNA molecules disclosed above may further comprise a coding sequence downstream Loop (DLP) motif.

[0166] Some viruses have sequences that can form one or more stem-loop structures that regulate, e.g., increase, capsid gene expression. Viral capsid enhancer, as used herein, refers to a regulatory element that includes a sequence that can form such a stem-loop structure. In some instances, the stem-loop structure is formed by a sequence within the coding sequence of a capsid protein, and is referred to as a downstream loop (DLP) sequence. As disclosed herein, these stem-loop structures or variants thereof can be used, for example, to regulate, e.g., increase, the expression level of a gene of interest. For example, these stem-loop structures or variants can be used in a recombinant vector (e.g., in a heterologous virus genome) to enhance the transcription and / or translation of a coding sequence operably linked downstream thereof.

[0167] Alphavirus replication in host cells is known to induce double-stranded RNA-dependent protein kinase (PKR). PKR phosphorylates eukaryotic translation initiation factor 2α (eIF2α). Phosphorylation of eIF2α inhibits translation initiation of mRNAs, thereby preventing the virus from completing a productive replication cycle. Infection of cells with Sindbis virus induces PKR, which leads to phosphorylation of eIF2α, but viral subgenomic mRNAs are efficiently translated and translation of all other cellular mRNAs is restricted. Efficient translation of viral subgenomic mRNAs in Sindbis virus is enabled by the presence of a stable RNA hairpin loop (or DLP motif) downstream of the wild-type AUG start codon of the viral capsid protein (e.g., capsid enhancer). DLP structures can stall the ribosome on the wild-type AUG, which has been reported to support translation of subgenomic mRNAs without the need for functional eIF2α. Thus, the subgenomic mRNAs of Sindbis virus (SINV) and other alphaviruses are efficiently translated even in cells with highly active PKR, leading to full phosphorylation of eIF2α.

[0168] DLP structures were first characterized in Sindbis virus (SINV) 26S mRNA and were also detected in Semliki Forest virus (SFV). Similar DLP structures have been reported to exist in at least 14 other members of the Alphavirus genus, including New World (e.g., MAYV, UNAV, EEEV (NA), EEEV (SA), AURAV) and Old World (SV, SFV, BEBV, RRV, SAG, GETV, MIDV, CHIKV, and ONNV) members. The predicted structures of these alphavirus 26S mRNAs were constructed based on SHAPE (selective 2'-hydroxyl acylation and primer extension) data (Toribio et al., Nucleic Acids Res. May 19; 44(9): 4368-80, 2016), the contents of which are incorporated herein by reference). Stable stem-loop structures were detected in all cases except for CHIKV and ONNV, whereas MAYV and EEEV showed less stable DLPs (Toribio et al., 2016, supra). The highest DLP activity was reported for alphaviruses, which contain the most stable DLP structures.

[0169] As an example, members of the Alphavirus genus can resist activation of the antiviral RNA-activated protein kinase (PKR) by a downstream loop (DLP) present in the viral 26S transcript, allowing eIF2-independent translation initiation of these mRNAs. The DLP is located downstream of the AUG in the SINV26S mRNA and other members of the Alphavirus genus.

[0170] In some embodiments, a nucleic acid molecule of the disclosure may comprise a DLP motif and / or a coding sequence for a GOI operably linked to a coding sequence for a DLP motif.

[0171] In some embodiments, the self-replicating RNA molecules of the present disclosure comprise a downstream loop (DLP).

[0172] In some embodiments, the downstream loop (DLP) comprises at least one RNA-stem loop.

[0173] In some cases, DLP activity depends on the distance between the DLP motif and the start codon AUG (AUGi). The AUG-DLP spacing of alphavirus 26S mRNA is adjusted to the topology of the ES6S region of the ribosomal 18S rRNA in a manner that places AUGi at the P site of the 40S subunit stalled by DLP, allowing the incorporation of Met-tRNA without the involvement of eIF2. In the case of Sindbis virus, the DLP motif is found in the first ~150 nt of the Sindbis subgenomic RNA. A hairpin is located downstream of the Sindbis capsid AUG start codon (AUG at nt 50 of the Sindbis subgenomic RNA), thus pausing the ribosome to begin translation using the correct capsid gene AUG. Previous studies of sequence comparison and structural RNA analysis have revealed evolutionary conservation of the DLP in SINV and predicted the presence of equivalent DLP structures in many members of the Alphavirus genus (see, e.g., Ventoso, J. Virol. 9484-9494, Vol. 86, September 2012).

[0174] Without wishing to be bound by any particular theory, it is believed that placing a DLP motif upstream of the coding sequence of any GOI will result in a fusion protein between the N-terminal capsid amino acids, usually encoded in the hairpin region, and the GOI-encoded protein, because initiation occurs at the capsid AUG and not the GOI AUG.

[0175] In some embodiments, the self-replicating RNA molecule comprises a downstream loop located upstream of nonstructural protein 1 (nsP1).

[0176] In some embodiments, the downstream loop is placed upstream of nonstructural protein 1 (nsP1) and is bound to nsP1 by the porcine teschovirus-1 2A (P2A) ribosomal skipping element.

[0177] The DLP-containing self-replicating RNA of the present disclosure can be useful for conferring resistance to the innate immune system in a subject. Unmodified RNA replicons are sensitive to the initial innate immune system state of the cells into which they are introduced. When a cell / individual is in a highly active innate immune system state, the performance of the RNA replicon (e.g., the replication and expression of GOI) may be adversely affected. By manipulating DLP to control the initiation of protein translation, especially of nonstructural proteins, the effect of the existing activation state of the innate immune system on efficient RNA replicon replication is eliminated or reduced. This results in a more uniform and / or enhanced expression of the GOI, which may affect the efficacy or therapeutic impact of the treatment.

[0178] DLP motifs in self-replicating RNAs can confer efficient mRNA translation in cellular environments where cellular mRNA translation is inhibited. When DLPs are coupled to the translation of nonstructural protein genes of replicon vectors, replicase and transcriptase proteins can initiate functional replication in PKR-activated cellular environments. When DLPs are coupled to the translation of subgenomic mRNAs, robust GOI expression is possible even when intracellular mRNAs are restricted by innate immune activation. Thus, engineering self-replicating RNAs that contain DLP structures to help drive the translation of both nonstructural protein genes and subgenomic mRNAs provides a powerful method to overcome innate immune activation.

[0179] Examples of self-replicating RNA vectors containing DLP motifs are described in U.S. Patent Application Publication No. 2018 / 0171340 and WO2018106615, the contents of which are incorporated by reference in their entireties.

[0180] Any of the self-replicating RNA molecules disclosed above may further comprise the non-structural genes nsP1, nsP2, nsP3, and / or nsP4. In some embodiments, the self-replicating RNA molecule does not encode a functional viral structural protein.

[0181] Alphavirus genomes encode the nonstructural proteins nsP1, nsP2, nsP3, and nsP4, which are produced as a single polyprotein precursor, sometimes named P1234 (or nsP1-4 or nsP1234), and are cleaved into mature proteins by proteolytic processing. nsP1 is approximately 60 kDa in size, may have methyltransferase activity, and may be involved in the viral capping reaction. nsP2 is approximately 90 kDa in size, may have helicase and protease activity, and nsP3 is approximately 60 kDa in size and contains three domains: a macrodomain, a central (or alphavirus-specific) domain, and a hypervariable domain (HVD). nsP4 is approximately 70 kDa in size and contains the core RNA-dependent RNA polymerase (RdRp) catalytic domain. After infection, the alphavirus genomic RNA is translated to yield the P1234 polyprotein, which is cleaved into individual proteins.

[0182] The alphavirus genome also encodes three structural proteins: the core nucleocapsid protein C, and the envelope proteins P62 and E1, which associate as heterodimers. The structural proteins are under the control of a subgenomic promoter and can be substituted by GIO.

[0183] In some embodiments, the self-replicating RNA can lack (or not contain) the sequence of at least one (or all) of the structural viral proteins (e.g., nucleocapsid protein C, envelope proteins P62, 6K, and E1). In these embodiments, the sequence encoding one or more structural genes can be replaced with one or more sequences, such as, for example, a coding sequence for at least one protein or peptide (or other gene of interest (GOI)), such as a TCR polypeptide of the present disclosure.

[0184] In some embodiments, the self-replicating RNA lacks sequences encoding alphavirus structural proteins or does not encode alphavirus (or, optionally, any other) structural proteins. In some embodiments, the self-replicating RNA molecule further lacks part or all of the coding regions for one or more viral structural proteins. For example, the alphavirus expression system may lack part or all of the coding sequences for one or more of the viral capsid protein C, E1 glycoprotein, E2 glycoprotein, E3 protein, and 6K protein.

[0185] In some embodiments, the self-replicating RNA molecule does not contain the coding sequence for at least one of the structural viral proteins. In these cases, the sequence encoding the structural gene may be replaced with one or more sequences, such as, for example, the coding sequence for a GOI (e.g., a TCR polypeptide).

[0186] The present disclosure also provides a self-replicating RNA molecule comprising the non-structural genes nsP1, nsP2, nsP3 and nsP4, wherein the self-replicating RNA molecule does not encode a functional viral structural protein.

[0187] In some embodiments, the present disclosure provides a self-replicating RNA molecule that includes coding sequences for at least one, at least two, at least three, or at least four nonstructural viral proteins (e.g., nsP1, nsP2, nsP3, nsP4). The nsP1, nsP2, nsP3, and nsP4 proteins encoded by the replicon are functional or biologically active proteins.

[0188] In some embodiments, the self-replicating RNA molecule comprises a coding sequence of a portion of at least one nonstructural viral protein. For example, the self-replicating RNA molecule may comprise about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100% of the coding sequence of at least one nonstructural viral protein, or a range between any two of these values. In some embodiments, the self-replicating RNA molecule may comprise a coding sequence of a substantial portion of at least one nonstructural viral protein. As used herein, a "substantial portion" of a nucleic acid sequence encoding a nonstructural viral protein includes sufficient nucleic acid sequence encoding a nonstructural viral protein to allow for putative identification of that protein, either by manual evaluation of the sequence by a person skilled in the art, or by computer-based automated sequence comparison and identification using algorithms such as BLAST (see, e.g., "Basic Local Alignment Search Tool"; Altschul SF et al., J. Mol. Biol. 215:403-410, 1993).

[0189] In some embodiments, the self-replicating RNA molecule can include the entire coding sequence of at least one nonstructural protein. In some embodiments, the self-replicating RNA molecule includes substantially all of the coding sequence of a naturally occurring viral nonstructural protein. In certain embodiments, the one or more nonstructural viral proteins are derived from the same virus.

[0190] In some embodiments, the downstream loop DLP of the self-replicating RNA molecule placed upstream of nonstructural protein 1 (nsP1) is derived from Sindbis virus.

[0191] In some embodiments, the self-replicating RNA molecule comprises nsP1, nsP2, nsP3 and nsP4 sequences from Venezuelan Equine Encephalitis Virus (VEEV) and a DLP motif from Sindbis Virus (SIN).

[0192] In some embodiments, the self-replicating RNA molecule also has an RNA subsequence that encodes an amino acid sequence derived from an alphavirus nsP3 macrodomain and an RNA subsequence that encodes an amino acid sequence derived from an alphavirus nsP3 central domain. The self-replicating RNA molecule can also have an RNA subsequence that encodes an amino acid sequence derived entirely from an Old World alphavirus nsP3 hypervariable domain, or it can have an amino acid sequence that has a portion derived from a New World alphavirus nsP3 hypervariable domain and a portion derived from an Old World alphavirus nsP3 hypervariable domain, i.e., the hypervariable domain (HVD) can be a hybrid or chimeric New World / Old World sequence.

[0193] In some embodiments, the self-replicating RNA molecule can have an RNA sequence that encodes an amino acid sequence derived from the wild-type New World alphavirus nsP1, nsP2, nsP3, and nsP4 protein sequences, hi other embodiments, one or more of the nonstructural proteins are derived from a different virus.

[0194] In some embodiments, the self-replicating RNA molecule can have an RNA sequence encoding an nsP3 macrodomain derived from a wild-type alphavirus nsP3 and an nsP3 central domain derived from a wild-type alphavirus nsP3. In various embodiments, the macrodomain and central domain can both be derived from a New World wild-type alphavirus nsP3 or both can be derived from an Old World wild-type alphavirus nsP3 protein. In other embodiments, the macrodomain can be derived from a New World wild-type alphavirus macrodomain and the central domain can be derived from an Old World wild-type alphavirus central domain, or vice versa. The various domains can be of any of the sequences described herein.

[0195] In some embodiments, the self-replicating RNA molecule contains the non-VEEV nonstructural proteins nsP1, nsP2, nsP3, and nsP4.

[0196] Accumulating experimental evidence indicates that the replication / amplification of VEEV and other alphavirus genomes and their defective interfering (DI) RNAs is determined by three promoter elements: (i) a conserved 3'-terminal sequence element (3'CSE) followed by a poly(A) tail, (ii) the 5'UTR, which functions as a key promoter element for both negative- and positive-strand RNA synthesis, and (iii) a 51-nt conserved sequence element (51-ntCSE) present in the nsP1 coding sequence, which functions as an enhancer of alphavirus genome replication (Kim et al., PNAS, 2014, 111:10708-10713, and references therein).

[0197] Any of the self-replicating RNA molecules disclosed above may further comprise an unmodified 5' untranslated region (5'UTR).

[0198] Previous studies have revealed that only a small portion of viral nonstructural proteins (nsPs) colocalize with dsRNA replication intermediates during VEEV and Sindbis virus infection. Thus, the majority of nsPs are not involved in RNA replication (Gorchakov R, et al. (2008) A new role for ns polyprotein cleavage in Sindbis virus replication. J Virol 82 (13): 6218-6231). This provides an opportunity to utilize the underutilized ns proteins for the amplification of subgenomic RNAs encoding proteins of interest that are usually transcribed from subgenomic promoters and not further amplified.

[0199] In some embodiments, a fragment of nsP1 of a self-replicating RNA molecule of the present disclosure is replicated downstream of the 5'-UTR and upstream of the DLP.

[0200] In some embodiments, the first 193 nucleotides of nsP1 are duplicated downstream of the 5'UTR and upstream of the DLP.

[0201] In some embodiments, the self-replicating RNA molecule comprises a modified 5' untranslated region (5'-UTR). For example, the modified 5'-UTR may comprise one or more nucleotide substitutions at position 1, position 2, position 4, or a combination thereof. Preferably, the modified 5'-UTR comprises a nucleotide substitution at position 2, and more preferably, the modified 5'-UTR has a U to G substitution at position 2. Examples of such self-replicating RNA molecules are described in US Patent Application Publication No. 2018 / 0104359 and WO2018075235, the contents of which are incorporated herein by reference in their entireties.

[0202] In some embodiments, the UTR can be a wild-type New World or Old World alphavirus UTR sequence, or a sequence derived from any of them. The 5'UTR can be any suitable length, such as about 60 nt, or 50-70 nt, or 40-80 nt. In some embodiments, the 5'UTR can also have a conserved primary or secondary structure (e.g., one or more stem loops) and can be involved in the replication of the alphavirus or replicon RNA. The 3'UTR can be up to several hundred nucleotides, for example, 50-900, or 100-900, or 50-800, or 100-700, or 200 nt-700 nt. The 3'UTR can also have a secondary structure, such as a step loop, followed by a polyadenylation region or a polyA tail.

[0203] The 5' and 3' untranslated regions may be operably linked to any of the other sequences encoded by the replicon. The UTRs may be operably linked to a promoter and / or sequences encoding a protein or peptide by providing sequences and spacing necessary for recognition and transcription of other coding sequences.

[0204] The GOI (e.g., a polynucleotide encoding a TCR polypeptide of the present disclosure) may be expressed under the control of a subgenomic promoter. In certain embodiments, instead of the native subgenomic promoter, the subgenomic RNA may be placed under the control of an internal ribosome entry site (IRES) derived from encephalomyocarditis virus (EMCV), Bovine Viral Diarrhea Virus (BVDV), poliovirus, Foot-and-mouth disease virus (FMD), Enterovirus 71, or Hepatitis C virus. Subgenomic promoters range from 24 nucleotides (Sindbis virus) to more than 100 nucleotides (Beet Necrotic Yellow Vein Virus) and are usually found upstream of the transcription start.

[0205] The self-replicating RNA molecule can have a 3' poly A tail. It can also contain a poly A polymerase recognition sequence (e.g., AAUAAA) at its 3' end.

[0206] In those cases where a self-replicating RNA molecule is packaged into a recombinant alphavirus particle, it may contain one or more sequences, so-called packaging signals, that serve to initiate interactions with alphavirus structural proteins leading to particle formation. In some embodiments, the alphavirus particle comprises RNA derived from one or more alphaviruses and structural proteins, at least one of which is derived from two or more alphaviruses.

[0207] In some embodiments, the self-replicating RNA molecule comprises a VEEV-derived vector in which the structural viral proteins (e.g., nucleocapsid protein C, and envelope proteins P62, 6K, and E1) have been removed and replaced by coding sequences for the polypeptides of the present disclosure.

[0208] Engineered Cells Expressing the TCRs of the Disclosure Engineered cells expressing TCRs that specifically bind to the CALR and JAK2 epitopes of the present disclosure are within the scope of the present disclosure. The present disclosure provides engineered cells (e.g., T cells) that include any one of the alpha TCR chains and any one of the beta TCR chains disclosed in Tables 4 and 5. These engineered cells can be used to treat a variety of disorders or diseases, such as cancer, myeloproliferative disorders, and cardiovascular diseases.

[0209] Suitable engineered cells include, for example, cells obtained from animals and humans.

[0210] In some embodiments, the cell comprising a TCR of the present disclosure is a T cell capable of differentiating lymphoid cells, a natural killer (NK) cell, a cytotoxic T lymphocyte (CTL), a regulatory T cell (Treg), a human embryonic stem cell, a lymphoid progenitor cell, a T cell progenitor cell, a pluripotent stem cell, or an induced pluripotent stem cell (iPSC). In some embodiments, the isolated cell comprising a TCR of the present disclosure is a T cell. The T cell can be any T cell, such as a cultured T cell, e.g., a primary T cell, or a T cell from a cultured T cell line, e.g., Jurkat, SupT1, or a T cell obtained from a mammal. If obtained from a mammal, the T cell can be obtained from any source, including bone marrow, blood, lymph nodes, thymus, or other tissues or fluids. The T cell can also be enriched or purified. The T cell can be a human T cell. The T cell can be a T cell isolated from a human. The T cells may be any type of T cell and at any stage of development, including CD4+CD8+ double positive T cells, CD8+ T cells (e.g., cytotoxic T cells), CD4+ helper T cells (e.g., Th1 and Th2 cells), peripheral blood mononuclear cells (PBMCs), peripheral blood leukocytes (PBLs), tumor infiltrating cells, memory T cells, naive T cells, etc. The T cells may be CD8+ T cells or CD4+ T cells. The T cells may be αβ T cells or γδ T cells.

[0211] In some embodiments, the isolated cell comprising a TCR of the present disclosure is a NK cell.

[0212] In some embodiments, the isolated cell comprising a TCR of the present disclosure is an αβ T cell.

[0213] In some embodiments, the isolated cell comprising a TCR of the present disclosure is a γδ T cell.

[0214] In some embodiments, the isolated cell comprising a TCR of the present disclosure is a CD8+ cytotoxic T lymphocyte.

[0215] In some embodiments, the isolated cell comprising a TCR of the present disclosure is a human embryonic stem cell.

[0216] In some embodiments, the isolated cell comprising a TCR of the present disclosure is a lymphoid progenitor cell.

[0217] In some embodiments, the isolated cell comprising a TCR of the present disclosure is a pluripotent stem cell.

[0218] In some embodiments, the isolated cell comprising a TCR of the present disclosure is an induced pluripotent stem cell (iPSC).

[0219] In some embodiments, the isolated cell comprising a TCR of the present disclosure is a CD4+ T lymphocyte. In certain embodiments, the CD4+ T lymphocyte is a Th 1 In certain embodiments, the CD4+ T lymphocytes are Th 2 In certain embodiments, the CD4+ T lymphocytes are Th 17 In certain embodiments, the CD4+ T lymphocytes are T reg In certain embodiments, the CD4+ T lymphocytes are T FH It is a cell.

[0220] Methods for producing engineered cells expressing the TCRs of the present disclosure Methods for making engineered cells containing any one of the alpha TCR chains and any one of the beta TCR chains disclosed in Tables 4 and 5 are described herein.

[0221] In some embodiments, to produce engineered cells for use as a cell therapy product, cells, preferably autologous T cells, are obtained from a pheresis sample taken from a subject and modified with the vectors of the present disclosure encoding the desired TCR alpha and beta sequences. Upon encountering the engineered cells, target cells may be killed by the engineered cells, such as engineered T cells, due to their ability to exhibit specific targeted cytotoxicity (i.e., specific cell killing).

[0222] A pheresis sample can be collected from a subject by any of a number of suitable lymphocytapheresis, lymphodepletion, and leukaphoresis procedures currently known or that become available in the art, which provide for the recovery of peripheral blood leukocytes (PBLs) from collected peripheral blood and separate the leukocytes from other plasma components of the sample. Exemplary procedures are illustrated, for example, in U.S. Patent Application Publication No. 2004 / 0173778 and U.S. Patent Application Publication No. 200 / 40147021, as well as U.S. Patent Nos. 4,690,915, 5,126,132, 6,255,073, 5,846,827, 6,251,385, 6,225,044, 6,210,963, 6,194,207, 5,443,983, 6,040,177, 5,766,920, 6,210,662, 6,204,058, and 6,227,368.

[0223] The selected naive cells, preferably naive T cells, can be substantially separated from non-selected pheresis sample components. In certain embodiments, the naive T cells, which may be naive CD4+ T cells, naive CD8+ T cells, or naive CD4+ T cells and naive CD8+ T cells, are substantially separated from other PBLs, e.g., non-T cells. Methods for selecting PBLs include procedures using Ficoll gradients, techniques using immunopurification (e.g., monoclonal antibodies against cell surface markers such as CD molecules, and beads such as Sepharose-, protein A-, and protein G-bound beads to which antibodies can be adsorbed, and magnetic beads to which antibodies can be adsorbed), flow cytometry, and fluorescence-activated cell sorter (FACS) analysis.

[0224] In certain embodiments, the selected naive T cells are substantially purified by cell sorting procedures such as FACS-based methods or magnetic bead purification systems such as those available in the art, such as Miltenyi beads (Myltenyi Biotec) and Dynabead systems (Dynal Biotech), in combination with other suitable cell sorting devices and methodologies.

[0225] The subject from which the pheresis product containing naive cells can be obtained is preferably a mammal in need of treatment, such as a dog, cat, horse, rat, rabbit, mouse, non-human primate or human. More preferably, the subject is a human patient in need of treatment for cancer, myeloproliferative disorder or cardiovascular disease. Alternatively, in appropriate circumstances, immune cells such as naive T cells that are not derived from the subject to be treated, but from another compatible source, such as an immune cell donor, or even an immortalized or transformed immune cell line, can be used to prepare a cell therapy product according to the present invention.

[0226] The naive cells, preferably naive T cells, thus selected are then modified by introducing into the cells, using known methods, a viral vector containing any of the disclosed polynucleotides, such that the cells are capable of replicating in vivo, resulting in long-term persistence that may lead to sustained tumor control.

[0227] In some embodiments, naive cells, preferably naive T cells, are transduced with any of the disclosed TCRs, resulting in constitutive expression of the TCR on the surface of the cell. The cells expressing the TCR may be further engineered to express one or more costimulatory molecules. Exemplary costimulatory molecules are CD28, ICOS, LIGHT, GITR, 4-1BB, and OX40. The cells expressing the TCR may be further engineered to produce one or more cytokines or chemokines or pro-inflammatory mediators, such as TNFα, IFNγ, IL-2, IL-3, IL-6, IL-7, IL-11, IL-12, IL-15, IL-17, or IL-21. The cells may have endogenous TCR loci and / or HLA loci inactivated using known gene editing techniques.

[0228] The engineered cells may optionally be expanded to produce therapeutic compositions and cell therapy products containing the desired phenotype and number of engineered cells. An exemplary T cell expansion procedure involves incubating activated T cells with irradiated non-CD8+ cells in the presence of selected cytokines and anti-CD3 antibody preparations to promote non-specific activated T cell expansion. The choice of expansion protocol to be used is within the interest of the skilled artisan and can be facilitated by guidance in the art.

[0229] composition The present disclosure also provides compositions comprising any of the polynucleotides, any of the polypeptides, or any of the vectors disclosed herein. In some embodiments, the compositions may comprise vectors comprising any of the nucleotides disclosed herein.

[0230] The composition may comprise or be formulated into a pharmaceutical composition comprising the composition and a pharma- ceutically acceptable excipient. "Pharmaceutically acceptable" refers to an excipient, including carriers, buffers, stabilizers, or other materials known to those skilled in the art, that, at the dosages and concentrations employed, do not cause undesirable or harmful effects in the subject to which it is administered. The exact nature of the carrier or other material may depend on the route of administration, e.g., intramuscular, subcutaneous, oral, intravenous, cutaneous, mucosal (e.g., intestinal), intranasal, or intraperitoneal. Liquid carriers such as water, petroleum, animal or vegetable oils, mineral oil, or synthetic oil may be included. Saline, dextrose or other sugar liquids, or glycols such as ethylene glycol, propylene glycol, or polyethylene glycol may be included. An exemplary formulation is the Adenovirus World Standard (Hoganson et al, 2002): 20 mM Tris pH 8, 25 mM NaCl, 2.5% glycerol; or 20 mM Tris, 2 mM MgCl2, 25 mM NaCl, sucrose 10% w / v, polysorbate 80 0.02% w / v; or 10-25 mM citrate buffer pH 5.9-6.2, 4-6% (w / w) hydroxypropyl-beta-cyclodextrin (HBCD), 70-100 mM NaCl, 0.018-0.035% (w / w) polysorbate-80, and optionally 0.3-0.45% (w / w) ethanol. Many other buffers can be used and examples of suitable formulations for storage and pharmaceutical administration of purified pharmaceutical preparations are known.

[0231] Kits / Products Kits and articles of manufacture are also described. Such kits include a package or container that is partitioned to receive one or more doses of the pharmaceutical compositions disclosed herein. Suitable containers include, for example, bottles. In one embodiment, the container is made of various materials, such as glass or plastic.

[0232] The product provided herein includes packaging materials.Packaging materials for use in packaging pharmaceutical products include, for example, those in U.S. Patent Nos. 5,323,907, 5,052,558 and 5,033,252.Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, bags, containers, bottles, and any packaging materials suitable for the selected formulation and intended mode of administration and treatment.

[0233] The kit typically includes a label listing the contents and / or instructions for use, as well as a package insert with instructions for use. A set of instructions for use is also typically included.

[0234] In one embodiment, the label is on or associated with the container. In one embodiment, a label is on a container when letters, numbers, or other characters forming the label are affixed, molded, or inscribed into the container itself, and a label is associated with a container when the label is present within a receptacle or carrier that also holds the container, for example, as a package insert.

[0235] In one embodiment, the label is used to indicate that the contents are to be used for a particular therapeutic application. The label also indicates directions for using the contents, for example, in the methods described herein.

[0236] In certain embodiments, the pharmaceutical compositions are provided in a pack or dispenser device that contains one or more unit dosage forms containing the compounds provided herein. The pack contains a metal or plastic foil, such as a blister pack. In one embodiment, the pack or dispenser device is accompanied by instructions for administration. In one embodiment, the pack or dispenser also contains a notice associated with the container in a form prescribed by a government agency regulating the manufacture, use, or sale of pharmaceuticals, which notice reflects approval by that agency of the drug form for administration to humans or animals. Such notice is, for example, labeling approved by the U.S. Food and Drug Administration for prescription drugs, or an approved product insert. In one embodiment, the compositions provided herein are also prepared and placed in an appropriate container and labeled for the treatment of a specified condition.

[0237] Method of Treatment or Use Methods for treating a subject with any of the disclosed compositions or engineered cells are provided herein. The disclosed compositions and engineered cells can be used to treat, prevent, or reduce the risk of a clinical condition.

[0238] In some embodiments, the clinical condition is cancer, a myeloproliferative disorder, or a cardiovascular disease.

[0239] In some embodiments, the myeloproliferative disorder is selected from primary myelofibrosis (MPN), polycythemia vera (PV), essential thrombocythemia (ET), primary myelofibrosis (PFM), secondary myelofibrosis, acute myeloid leukemia (AML), secondary AML, chronic myelogenous leukemia (CML), clonal hematopoiesis of indeterminate potential (CHIP), and chronic myelomonocytic leukemia (CMML).

[0240] In some embodiments, the cancer is selected from lung cancer, lymphatic cancer, acute lymphocytic leukemia, acute myeloid leukemia, chronic myeloid leukemia, Burkitt's lymphoma, Hodgkin's lymphoma, plasma cell myeloma, biliary tract cancer, bladder cancer, liver cancer, pancreatic cancer, prostate cancer, skin cancer, thyroid cancer, gastric cancer, colorectal cancer, colon cancer, urinary tract cancer, central nervous system cancer, neuroblastoma, kidney cancer, breast cancer, cervical cancer, testicular cancer, and soft tissue cancer.

[0241] In some embodiments, the cardiovascular disease is selected from acute coronary syndrome, ischemic cerebrovascular disease, ischemic heart disease, thrombosis, venous thromboembolism, deep vein thrombosis, pulmonary embolism, refractory intraperitoneal thrombosis, peripheral arterial disease, hypertension, heart failure, atrial fibrillation, coronary heart disease, atherosclerosis, or clonal hematopoiesis.

[0242] In some embodiments, the method comprises administering to a subject in need thereof a composition comprising any of the polynucleotides, any of the polypeptides, or any of the vectors disclosed herein, hi some embodiments, the composition may comprise a vector comprising any of the nucleotides disclosed herein.

[0243] In some embodiments, the method comprises administering to a subject in need thereof a composition comprising any of the polynucleotides disclosed herein, wherein the polynucleotide encodes a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a CDR3 comprising a corresponding amino acid sequence provided in Table 5. In some embodiments, the method disclosed herein comprises administering to a subject in need thereof a composition comprising a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 encoded by a nucleic acid sequence provided in Table 4, and the corresponding beta chain comprises a CDR3 encoded by a corresponding nucleic acid sequence provided in Table 5 (i.e., the beta chain CDR3 provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain CDR3 provided in Table 4 (e.g., row 1). For the sake of brevity, each possible alternative will not be analyzed, but each constitutes a separate embodiment as if fully set forth.

[0244] In some embodiments, the method comprises administering to a subject in need thereof a composition comprising a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising an amino acid sequence provided in Table 4, a CDR2 comprising an amino acid sequence provided in Table 4, and a CDR3 comprising an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a CDR1 comprising an amino acid sequence provided in Table 5, a CDR2 comprising an amino acid sequence provided in Table 5, and a CDR3 comprising an amino acid sequence provided in Table 5. In some embodiments, the method comprises administering to a subject in need thereof a composition comprising a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 encoded by a nucleic acid sequence provided in Table 4, a CDR2 encoded by a nucleic acid sequence provided in Table 4, and a CDR3 encoded by a nucleic acid sequence provided in Table 4, and the corresponding beta chain comprises a CDR1 encoded by a nucleic acid sequence provided in Table 5, a CDR2 encoded by a nucleic acid sequence provided in Table 5, and a CDR3 encoded by a nucleic acid sequence provided in Table 5 (i.e., the beta chain CDRs provided in Table 5 are in the same row number (e.g., row 1) as the alpha chain CDRs provided in Table 4 (e.g., row 1). For the sake of brevity, each possible alternative will not be analyzed, but each constitutes a separate embodiment as if fully set forth.

[0245] In some embodiments, the method comprises administering to a subject in need thereof a composition comprising a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a VJ region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a VDJ region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 5. In some embodiments, the method comprises administering to a subject in need thereof a composition comprising a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a VJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence provided in Table 4, and the corresponding beta chain comprises a VDJ region encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence provided in Table 5 (i.e., the beta chain VDJ region provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain VJ region provided in Table 4 (e.g., row 1). For the sake of brevity, each possible alternative will not be analyzed, but each constitutes a separate embodiment as if fully set forth.

[0246] In some embodiments, the method comprises administering to a subject in need thereof a composition comprising a polynucleotide encoding a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 4, and the corresponding beta chain comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 5. Also described herein are polynucleotides encoding a TCR comprising an alpha chain and a beta chain, where the alpha chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence provided in Table 4, and the corresponding beta chain is encoded by a nucleic acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to a nucleic acid sequence provided in Table 5 (i.e., the beta chain provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain (e.g., row 1) provided in Table 4). For the sake of brevity, each possible alternative will not be analyzed, but each constitutes a separate embodiment as if fully set forth.

[0247] In some embodiments, the method comprises administering to a subject in need thereof a composition comprising a viral vector comprising a polynucleotide encoding any of the TCR polypeptides of the present disclosure. In any of the methods disclosed herein, the composition administered to the subject may comprise a vector selected from an adenovirus vector, an alphavirus vector, a poxvirus vector, an adeno-associated virus vector, a retrovirus vector, a self-replicating RNA molecule, and combinations thereof. In some embodiments, the vector is selected from an Ad26 vector, an MVA vector, a GAd20 vector, a self-replicating RNA molecule, and combinations thereof.

[0248] In some embodiments, the method comprises administering to a subject in need thereof a composition comprising any of the polypeptides disclosed herein, wherein the polypeptide is a TCR. In some embodiments, the method comprises administering to a subject in need thereof a composition comprising a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising an amino acid sequence provided in Table 4, and the beta chain comprises a CDR3 comprising a corresponding amino acid sequence provided in Table 5. (i.e., the beta chain CDR3 provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain CDR3 provided in Table 4 (e.g., row 1). For the sake of brevity, each possible alternative will not be analyzed, but each constitutes a separate embodiment as if fully set forth.

[0249] In some embodiments, the method comprises administering to a subject in need thereof a composition comprising a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising an amino acid sequence provided in Table 4, a CDR2 comprising an amino acid sequence provided in Table 4, and a CDR3 comprising an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a CDR1 comprising an amino acid sequence provided in Table 5, a CDR2 comprising an amino acid sequence provided in Table 5, and a CDR3 comprising an amino acid sequence provided in Table 5 (i.e., the beta chain CDRs provided in Table 5 are in the same row number (e.g., row 1) as the alpha chain CDRs (e.g., row 1) provided in Table 4). For brevity, each possible alternative will not be analyzed, but each constitutes a separate embodiment as if fully set forth.

[0250] In some embodiments, the method comprises administering to a subject in need thereof a composition comprising a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a variable and joining (VJ) region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a variable, diversity and joining (VDJ) region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 5 (i.e., the beta chain VDJ region provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain VJ region provided in Table 4 (e.g., row 1). For the sake of brevity, each possible alternative will not be analyzed, but each constitutes a separate embodiment as if fully set forth.

[0251] In some embodiments, the method comprises administering to a subject in need thereof a composition comprising a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 4, and the corresponding beta chain comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 5 (i.e., the beta chain provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain (e.g., row 1) provided in Table 4). For the sake of brevity, each possible alternative will not be analyzed, but each constitutes a separate embodiment as if fully set forth.

[0252] In some embodiments, the method comprises administering to a subject in need thereof any of the engineered cells disclosed herein. In certain embodiments, the engineered cells comprise any one of the alpha TCR chains and any one of the beta TCR chains disclosed in Tables 4 and 5. For the sake of brevity, each possible alternative will not be analyzed, but each constitutes a separate embodiment as if fully described.

[0253] In some embodiments, the method comprises administering to a subject in need thereof an engineered cell comprising any of the polypeptides disclosed herein, wherein the polypeptide is a TCR. In some embodiments, the method comprises administering to a subject in need thereof an engineered cell comprising a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR3 comprising an amino acid sequence provided in Table 4, and the beta chain comprises a CDR3 comprising a corresponding amino acid sequence provided in Table 5. (i.e., the beta chain CDR3 provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain CDR3 provided in Table 4 (e.g., row 1). For the sake of brevity, each possible alternative will not be analyzed, but each constitutes a separate embodiment as if fully set forth.

[0254] In some embodiments, the method comprises administering to a subject in need thereof an engineered cell comprising a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a CDR1 comprising an amino acid sequence provided in Table 4, a CDR2 comprising an amino acid sequence provided in Table 4, and a CDR3 comprising an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a CDR1 comprising an amino acid sequence provided in Table 5, a CDR2 comprising an amino acid sequence provided in Table 5, and a CDR3 comprising an amino acid sequence provided in Table 5 (i.e., the beta chain CDRs provided in Table 5 are in the same row number (e.g., row 1) as the alpha chain CDRs (e.g., row 1) provided in Table 4). For brevity, each possible alternative will not be analyzed, but each constitutes a separate embodiment as if fully set forth.

[0255] In some embodiments, the method comprises administering to a subject in need thereof an engineered cell comprising a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises a variable and joining (VJ) region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 4, and the corresponding beta chain comprises a variable, diversity and joining (VDJ) region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 5 (i.e., the beta chain VDJ region provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain VJ region provided in Table 4 (e.g., row 1). For the sake of brevity, each possible alternative will not be analyzed, but each constitutes a separate embodiment as if fully set forth.

[0256] In some embodiments, the method comprises administering to a subject in need thereof an engineered cell comprising a TCR comprising an alpha chain and a beta chain, wherein the alpha chain comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 4, and the corresponding beta chain comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to an amino acid sequence provided in Table 5 (i.e., the beta chain provided in Table 5 is in the same row number (e.g., row 1) as the alpha chain (e.g., row 1) provided in Table 4). For the sake of brevity, each possible alternative will not be analyzed, but each constitutes a separate embodiment as if fully set forth.

[0257] In some embodiments, the engineered cells containing a TCR are T cells capable of differentiating lymphoid cells, natural killer (NK) cells, cytotoxic T lymphocytes (CTLs), regulatory T cells (Tregs), human embryonic stem cells, lymphoid progenitor cells, T cell progenitor cells, pluripotent stem cells, or induced pluripotent stem cells (iPSCs).

[0258] In certain embodiments, the engineered cells are derived from naive cells obtained from a subject in need of treatment. In certain embodiments, the engineered cells are not derived from a subject in need of treatment, but instead are derived from an immune cell donor or another compatible source, such as an immortalized or transformed immune cell line.

[0259] In some embodiments, the desired amount of engineered cells is used to prepare a cell therapy product for therapeutic administration. In certain embodiments, the cell therapy product is reinfused, i.e., infused back into the subject from which the pheresis sample used to derive the cell therapy product was obtained. Reinfusion procedures that may be used include, for example, those disclosed in U.S. Patent Nos. 4,844,893 and 4,690,915. In certain embodiments, the cell therapy product is reinfused, i.e., infused back into a subject different from the subject from which the pheresis sample used to derive the cell therapy product was obtained.

[0260] In some embodiments, one or more quality assurance tests are performed on the activated T lymphocytes or cell therapy product, preferably prior to administration. In some embodiments, quality assurance tests include performing one or more tests to confirm HLA match between patient and T lymphocytes, flow cytometry analysis (CD8+, TCR+), sterility (absence of bacterial or fungal growth), Gram stain negativity for bacteria, mycoplasma negativity by PCR / ELISA, absence of residual Drosophila DNA, absence of insect viral cDNA, viability (>72% viable), and cytolytic activity by CTL assay.

[0261] Dose and Route of Administration In some embodiments, a desired amount of the viral vector is used to prepare a composition for therapeutic administration.

[0262] In some embodiments, a composition comprising a viral vector comprises about 1×10 4 IFU (infectious unit) ~ approx. 1 x 10 11It is administered in a dose of IFU. In certain embodiments, the viral vector is an adenovirus vector, an Ad26 vector, a GAd20 vector, a poxvirus vector, or an MVA vector.

[0263] In some embodiments, the composition comprising the self-replicating RNA molecule is administered in a dose of about 1 microgram to about 100 micrograms.

[0264] In some embodiments, the compositions disclosed herein can be administered to a subject by various routes, such as subcutaneous, topical, oral, and intramuscular. Administration of the composition can be accomplished orally or parenterally. Methods of parenteral delivery include topical, intraarterial (directly to tissue), intramuscular, subcutaneous, intramedullary, intrathecal, intracerebroventricular, intravenous, intraperitoneal, or intranasal administration. The present disclosure also has the objective of providing suitable topical, oral, systemic, and parenteral formulations for use in prophylactic and therapeutic methods.

[0265] In some embodiments, intramuscular administration of the composition can be accomplished by using a needle. An alternative is the use of a needleless injection device (e.g., using Biojector™) to administer the composition or a lyophilized powder containing the composition. For intravenous, cutaneous or subcutaneous injection, or injection into an affected area, the composition can be in the form of a parenterally acceptable aqueous solution that is pyrogen-free and has suitable pH, isotonicity, and stability. Those skilled in the art can successfully prepare suitable solutions using isotonic vehicles such as, for example, sodium chloride injection, Ringer's injection, lactated Ringer's injection. Preservatives, stabilizers, buffers, antioxidants, and / or other additives can be included as necessary. Sustained release formulations can also be used.

[0266] The actual amount administered, and the rate and time-course of administration, will depend on the nature and severity of what is being treated. Prescription of treatment, e.g., dosage, etc., is within the responsibility of general practitioners and other physicians, and typically takes into account the disorder being treated, the condition of the individual patient, the site of delivery, the method of administration, and other factors known to the practitioner.

[0267] In some embodiments, a desired amount of the engineered cells is used to prepare a cell therapy product for therapeutic administration.

[0268] To treat a subject, an effective amount of a cell therapy product is administered to a subject suffering from or diagnosed with a disease, injury, or condition. The subject may be a human patient in need of treatment for cancer, a myeloproliferative disorder, or a cardiovascular disease.

[0269] Effective amounts or effective dosages of the cell therapy products of the invention can be ascertained by conventional methods, such as modeling, dose escalation studies, or clinical trials, and by considering conventional factors, such as the mode or route of administration or product delivery, the pharmacokinetics of the cell therapy product, the severity and course of the disease, injury or condition, the subject's previous or current therapies, the subject's health status and response to drugs, and the judgment of the treating physician. Exemplary dosages include cell populations of 1×10 for an adult human. 8 ~1×10 11 Or 1×10 9 ~1×10 10 Approximately 1 x 10 activated T cells 6 ~Approx. 1×10 12 The antibody may comprise activated T cells.

[0270] The cell therapy product can be prepared as a therapeutic composition comprising engineered cells, preferably engineered T cells, and a suitable excipient, such as a pharma- ceutically acceptable diluent or solvent, to maintain the engineered cells until infusion into a subject.

[0271] Any suitable technique for administering the composition containing the cellular components to a subject can be used. For example, administration of the engineered T cells by intravenous infusion can be used. Multiple infusions may be required or indicated, and these infusions may occur over a period of several weeks or longer. Exemplary techniques are described, for example, in U.S. Patent Nos. 4,844,893 and 4,690,915. EXAMPLES

[0272] These examples are presented for illustrative purposes only and are not intended to limit the scope of the claims provided herein.

[0273] Example 1. Analysis of TCR sequences 12-day assay - transduced, endogenous, exogenous - 10x endpoint Single cell TCRα / β and RNA sequencing were performed on CD8+ T cell samples isolated from leukopaks from four healthy human donors. Dendritic cells from each donor were treated with a) DMSO treatment or a single exogenously loaded 9-mer peptide corresponding to one of the two mutJAK2 epitopes ("exogenous treatment"), b) transfection with tandem minigene constructs composed of combined mutJAK2 and mutCALR epitopes (mutCALR type I and mutCALR type II) ("endogenous treatment"), or c) transduction with Ad5 virus containing mutJAK2 and mutCALR antigen constructs ("Ad5 treatment").

[0274] The 9-mer peptide corresponding to the two mutJAK2 epitopes has the following amino acid sequences: VLNYGVCFC (SEQ ID NO: 681) and FCGDENILV (SEQ ID NO: 682). A tandem minigene construct comprised of the combined mutJAK2 and mutCALR epitopes has the amino acid sequence:

[0275] [Table 2] In SEQ ID NO: 683, the mutCALR type 1 sequence is underlined, the mutCALR type II sequence is underlined and in bold, and the two mutJAK2 sequences are underlined and in italics.

[0276] The mutJAK2 and mutCALR antigen construct contained within the Ad5 virus (also known as LS_CALR_JAK2-2x9mer (HEME002)) has the following amino acid sequence: MACPGFLWALVISTCLEFSMAMKDKQDEEQRTRRMMRTKMRMRRMRRTRRKMRRKMSPARPRTSCREACLQGWTEAAYEEAEDNCRRMMRTKAAYVLNYGVCFCAAYFCGDENILV (SEQ ID NO: 702).

[0277] Autologous pan-T cells were then added to the co-culture to initiate TCR stimulation.

[0278] In all cases, TCR was stimulated for 11 days followed by overnight restimulation with individual peptides. Cells were harvested and CD8+ T cells were isolated using negative selection magnetic bead capture technology. These isolated CD8+ T cells were analyzed using the 10x Genomics single cell sequencing platform.

[0279] means 2 days prior (for Ad5 treatment) or 1 day prior (for exogenous and endogenous treatment): Donor dendritic cells (DCs) from the four healthy human donors mentioned above were thawed in IMDM5 (IMDM5 medium supplemented with 5% human antibody serum Sigma, H3667: Gibco, 12440) with 1x anti-aggregant (CTL, CTL-AA-001). Cells were washed by centrifugation at 1300 rpm for 5 min and resuspended in IMDM5 containing 50 ng / mL GM-CSF and IL-4. Cells were seeded in 6-well plates at approximately 1-1.5e6 cells / well in 2 mL IMDM5 and incubated overnight at 37°C / 5% CO2.

[0280] (For Ad5 treatment) 1 day prior: DCs were removed from plates and wells of the same donor were combined. Cells were washed, counted and resuspended in IMDM5 at a density of 6e5 cells / mL. 50 μL of cells were seeded into the appropriate wells of a clear round-bottom 96-well plate according to the plate layout (density of 3e4 cells / well). At least one row / column was left empty around the outer edge of the plate and filled with 100 μL of DPBS. In a BSL2+ environment, Ad5 constructs were diluted in IMDM5 medium with 2× (final concentration: 5 μg / mL) polybrene (Millipore, Cat# TR-1003-G) to a concentration of 5,000 Multiplicity of Infection (MOI) per 50 μL. 50 μL of each construct was added to the appropriate wells of DCs according to the plate layout. Plates were returned to the 37°C / 5% CO2 incubator overnight.

[0281] (For endogenous treatment) Day 0: DCs were removed from plates and wells of the same donor were combined. Cells were washed, counted and resuspended in IMDM5 at a density of 5e5 cells / mL. 500 μL of cells were seeded into the appropriate wells of a 24-well plate according to the plate layout (density of 2.5e5 cells / well). Opti-MEM was combined with the core transfection agent and transfection booster according to the NanoJuice kit protocol (Millipore Sigma, 71902) and incubated at room temperature (RT) for 5 minutes. DNA was added to the appropriate tube and mixed by gentle pipetting. Cells were incubated at RT for 15 minutes. 20 μL of each preparation was dropped into the appropriate wells indicated on the plate layout. Plates were gently rocked to mix and incubated at 37°C / 5% CO 2The wells were transferred from the endogenous transfection plate to microcentrifuge tubes. The tubes were centrifuged at 1500×g for 5 min. The cells were resuspended in 500 μL of DPBS. The wash was repeated for a total of 2 washes. After the final wash, the cells were resuspended in 500 μL of IMDM5. The cells were mixed by pipetting and 65 μL was transferred to the appropriate wells indicated on the plate layout. The corresponding donor pan-T cells (i.e., pan-T cells from the same donor as the dendritic cells) were thawed in IMDM5 with 1× anti-aggregant and washed by centrifugation at 1300 rpm for 5 min. The cells were resuspended at 3e6 cells / mL in IMDM5. 100 μL of prepared pan-T donor cells were added to the corresponding donor DC wells according to the plate layout (density of 3e5 pan-T cells / well. Final ratio of DC:pan-T 1:10). 200 μL of DPBS was added to the outer wells of the plate. The plate was incubated at 37° C. / 5% CO 2 The mice were then returned to the incubator.

[0282] (For exogenous treatment) Day 0: DCs were removed from plates and wells of the same donor were combined. Cells were washed, counted, and resuspended in IMDM5 at a density of 3e5 cells / mL. 100 μL of cells were seeded into appropriate wells in a clear 96-well round bottom plate as indicated on the plate layout (density of 3e4 cells / well). Peptides were diluted to 20× final concentration in IMDM5 and 5 μL of diluted peptide was added to appropriate exogenous wells according to the plate layout. 200 μL of DPBS was added to outer wells and incubated at 37° C. / 5% CO 2The plates were incubated at 4°C for 1.5-2 hours. After incubation, the plates were placed in a room temperature irradiator for the time calculated to achieve the desired dose of 50 Gray radiation. The corresponding donor pan-T cells were thawed in IMDM5 with 1x anti-agglutinant and washed by centrifugation at 1300 rpm for 5 minutes. The cells were resuspended at 3e6 cells / mL in IMDM5. 100μL of prepared pan-T donor cells were added to the corresponding donor DC wells according to the plate layout (density of 3e5 pan-T cells / well. Final ratio of DC:pan-T 1:10). The plates were incubated at 37°C / 5% CO 2 The mice were then returned to the incubator.

[0283] (For Ad5 treatment) Day 0: Plates were incubated with Ad5 for approximately 20 hours before removing them from the incubator. Plates were washed by centrifugation at 300×g for 5 minutes and the pellet was resuspended in DPBS (Gibco, 14140). Washing was repeated for a total of 3 washes. After the final wash, cells were resuspended in 100 μL of IMDM5. Corresponding donor pan-T cells were thawed in IMDM5 with 1× anti-agglutinant. Cells were washed by centrifugation at 1300 rpm for 5 minutes and then resuspended at 3e6 cells / mL in IMDM5. 100 μL of prepared pan-T donor cells were added to the corresponding donor DC wells according to the plate layout (density of 3e5 pan-T cells / well. Final ratio of DC:pan-T 1:10). 200 μL of DPBS was added to the outer wells of the plate. Plates were incubated at 37° C. / 5% CO 2 The mice were then returned to the incubator.

[0284] Day 3 and after day 3 (for all treatments): IMDM5 medium was prepared with 2x final concentration of IL-2, IL-7 and IL-15. (Final concentrations: IL-2: 50 IU / mL, IL-7: 25 ng / mL and IL-15: 25 ng / mL). 100 μL of medium was removed from each well and replaced with prepared IMDM5 cytokine medium. Plates were gently rocked to mix and incubated at 37°C / 5% CO 2The protocol was repeated every 2-3 days up to day 12, except that the concentration of IL-2 was increased to 100 IU / mL.

[0285] Day 11: (If the restimulation day overlapped with a day when the medium needed to be refreshed, the refresh was done first). For pan-T cell restimulation, peptides corresponding to exogenous, endogenous or Ad5 constructs were prepared in IMDM5. For single peptide restimulation, a final concentration of 5 μg / mL was used. For CALR peptide pools, each peptide was used at a final concentration of 1 μg / mL (peptides were pooled at 500× final concentration before adding to the plate). DMSO controls were prepared in IMDM5 to match the highest concentration of peptide used (5 μg / mL). 5 μL of each preparation was added to the appropriate wells. The plate was gently rocked to mix. The plate was returned to the incubator and incubated at 37° C. / 5% CO. 2 The mixture was incubated overnight (approximately 18 hours).

[0286] The sequences of the CALR peptide pool are provided in Table 1.

[0287] [Table 3]

[0288] Day 12 (for all treatments): A vial of pan-T cells was thawed from each donor (used as baseline) in IMDM5 with 1x anti-aggregant, washed by centrifugation at 1300 rpm for 5 minutes, and resuspended in IMDM5. Duplicates of each sample were combined in tubes on ice and centrifuged at 1500 rpm for 5 minutes at 4°C. The supernatant was removed and 300 μL running buffer was added to wash. The tubes were centrifuged again and the supernatant was removed. The antibody cocktail provided in the CD8 T cell negative selection bead kit was prepared and appropriately scaled (40 μL buffer and 10 μL antibody per sample). The antibody cocktail contained biotin-conjugated monoclonal anti-human antibodies against CD4, CD15, CD16, CD19, CD34, CD36, CD56, CD123, TCRγ / δ and CD235a (glycophorin A), monoclonal anti-CD14 antibody (isotype: mouse IgG2a), anti-CD61 antibody (isotype: mouse IgG1) and microbeads coupled to anti-biotin antibody (isotype: mouse IgG1).

[0289] 50 μL of prepared antibody cocktail was added to each sample and incubated on ice for 5 min. Bead cocktail was prepared and appropriately scaled (30 μL buffer and 20 μL beads per sample). 50 μL was added to each sample and incubated on ice for 10 min. 400 μL buffer was added to bring the sample volume to 500 μL. 400 μL buffer was added to the baseline sample to bring the volume to 500 μL. Manual CD8+ isolation protocol (MACS Miltenyi Biotec, 130-096-495) was followed. Columns and tubes (15 mL) were prepared, rinsed with 3 mL buffer and pre-wetted. 500 μL cells were added and the flow-through was collected. Cells were washed with 3 mL buffer and collected. Cells were counted and washed by centrifugation at 1500 rpm for 5 min. Cells were resuspended at 1e4 cells / mL in PBS.

[0290] 10x single cell V(D)J genomics protocol Immune repertoire information and gene expression from the same cells were measured using the 10x genomics protocol of single cell V(D)J (variable, diverse and linked) (Chromium™ Single Cell V(D)J Reagent Kits User Guide-CG000086). Cells obtained from the 12-day assay were washed and resuspended in 1x phosphate-buffered saline (PBS) containing 0.04% bovine serum albumin (BSA) to achieve the target cell concentration (approximately 20,000 cells / sample). Gel Bead-in-Emulsion (GEM) was created by combining barcoded single cell VDJ 5' gel beads, master mix with cells and distribution oil on a 10x Chromium Controller Single Cell A chip. After GEM creation, the gel beads were dissolved and any co-distributed cells were dissolved. Oligonucleotides containing sequencing primers, 10x cell barcodes, 10x unique molecular identifier (UMI) barcodes and template switch oligo (TSO) were released and mixed with a master mix containing cell lysate and reverse transcription (RT) reagents. Incubation with GEM-RT produced barcoded full-length cDNA from mRNA. The 10x barcoded full-length cDNA from GEM-RT was purified and amplified by polymerase chain reaction (PCR) (14 cycles), and primers to the 5' and 3' ends were added in GEM-RT. Full-length VDJ segments were enriched from cDNA amplified using primers specific for the TCR region. Enzymatic fragmentation and size selection were used to optimize cDNA amplicon size prior to 5' gene expression (GEX) library construction.P5 (AATGATACGGCGACCACCGA) (SEQ ID NO: 703), P7 (CAAGCAGAAGACGGCATACGAGAT) (SEQ ID NO: 704), sample index (NNNNNNNN) (SEQ ID NO: 705), and Illumina R2 (AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) (SEQ ID NO: 706) sequences were added by end repair, A-tailing, adapter ligation, and sample index PCR. The final library contained the P5 and P7 priming sites used in Illumina sequencing. The pooled / normalized libraries were sequenced at the recommended depth / run parameters. The libraries sequenced on NovaSeq produced high quality data with the expected Q30 (Sequencing Analysis Viewer) score. The multiplexed sequences were demultiplexed and analyzed using The Chromium Single Cell Immune Profiling Software Suite.

[0291] Example 2. Identification of TCRs enriched by stimulation Identification of expanded TCR To identify TCRs enriched by antigen stimulation, T cell receptor alpha / beta (TCRα / β) sequences from T cell populations treated with either endogenous minigene or Ad5 transduction were compared against corresponding sequences from T cell populations obtained by stimulation with an empty minigene (i.e., no antigen) or Ad5 null construct (i.e., Ad5 transfection without antigen cassette). For TCRα / β sequences obtained from stimulation with exogenously loaded dendritic cells (DCs), the corresponding DMSO-treated control (i.e., DMSO + no antigen stimulation) was used. TCRα / β sequences present in the enriched cell population with a false discovery rate (FDR) of less than 0.0003 and a minimum of a two-fold increase in TCR ratio compared to the control were selected for further analysis. TCRα / β sequences that were highly abundant (approximately 1.0% or greater) and significantly enriched in both control and treatment conditions were also selected for further testing.

[0292] Identification of expanded TCR sequences from activated T cells. To further classify and experimentally validate the number of TCRs, single cell RNA (scRNA) sequencing data was obtained from the same cells. The T cell activation markers considered for mRNA-based gating of T cells were TNF, GZMB, CD69 and PRF1 (perforin). These markers and their cutoffs are listed in Table 2 below. TCRs present in cells that were clonally expanded and had higher mRNA expression than the cutoff in all four genes were given the highest priority. In addition, TCRs that shared sequence identity with known self- or viral antigens were excluded from further consideration. The IEDB (www.iedb.org) public repository database was used to identify self / viral antigen-responsive TCR sequences.

[0293] [Table 4]

[0294] scRNA analysis The scRNA sequencing analysis was performed using the Seurat R package. Samples were first quality controlled using high mitochondrial content (>5%), excessively low (<300) count and library size criteria. Cells that did not pass the quality control (QC) thresholds were removed. After QC sorting, raw RNA read counts were normalized and transformed using the SCTransform algorithm. Samples before and after 12 days of expansion were combined using the sample integration method implemented in Seurat. Principal component analysis (PCA) was performed, followed by uniform manifold approximation and projection (UMAP) clustering on the first 30 principal components. The normalized mRNA data was then used to test the expression profiles of various T cell activation markers to establish cutoff criteria. The activation profiles generally showed a bimodal distribution, and the cutoff was selected at the valley point between two adjacent peaks of the bimodal distribution. See Table 1 for cutoff values.

[0295] Table 3 provides the donor numbers, treatment conditions, V(D)J genes and constant genes of the 34 sequenced T cell receptors.

[0296] [Table 5]

[0297] Table 4 provides the full length alpha chain sequences and nucleotide (NT) and amino acid (AA) sequences of the alpha chain CDR1, CDR2 and CDR3 as defined by IMGT for each of the 34 T cell receptors listed in Table 3. Table 5 provides the full length beta chain sequences and nucleotide and amino acid sequences of the beta chain CDR1, CDR2 and CDR3 as defined by IMGT for each of the 34 T cell receptors listed in Table 3. For both Tables 4 and 5, the TCR alpha or beta (full length) amino acid sequences derived from the scRNA analysis had incomplete constant gene sequences. To complete this, the incomplete constant region sequences were aligned against the canonical TCRB1 and TCRB2 sequences and additional missing portions were added. In two cases, the alignment had incomplete query coverage and in these cases the overhanging portions in the incomplete genes were deleted and the correct TCRB sequence was added. In the case of the TCR alpha gene, the missing portions of the TCR alpha gene sequence were added. The full length constant genes are identified by name in Table 3. The VJ / VDJ portions of the TCR alpha or beta (full length) amino acid sequences are underlined, the constant regions are underlined and in bold, and the unmarked sequences are leader sequences. For the corresponding nucleotide sequences in Tables 4 and 5, the leader sequences are underlined, the constant regions are underlined and in bold, and the VJ / VDJ portions of the full length TCR nucleotide sequences are unmarked.

[0298] [Table 6-1]

[0299] [Table 6-2]

[0300] [Table 6-3]

[0301]

Table 6-4

[0302]

Table 6-5

[0303]

Table 6-6

[0304]

Table 6-7

[0305]

Table 6-8

[0306]

Table 6-9

[0307]

Table 6-10

[0308]

Table 6-11

[0309]

Table 6-12

[0310]

Table 6-13

[0311]

Table 6-14

[0312]

Table 6-15

[0313]

Table 6-16

[0314]

Table 6-17

[0315]

Table 6-18

[0316]

Table 6-19

[0317]

Table 6-20

[0318]

Table 6-21

[0319]

Table 6-22

[0320]

Table 6-23

[0321]

Table 6-24

[0322]

Table 6-25

[0323]

Table 6-26

[0324]

Table 6-27

[0325]

Table 6-28

[0326]

Table 6-29

[0327]

Table 6-30

[0328]

Table 6-31

[0329]

Table 6-32

[0330]

Table 6-33

[0331]

Table 6-34

[0332]

Table 6-35

[0333]

Table 6-36

[0334]

Table 6-37

[0335]

Table 6-38

[0336]

Table 6-39

[0337]

Table 6-40

[0338]

Table 6-41

[0339]

Table 6-42

[0340]

Table 6-43

[0341]

Table 6-44

[0342]

Table 6-45

[0343]

Table 6-46

[0344]

Table 6-47

[0345]

Table 6-48

[0346]

Table 6-49

[0347]

Table 6-50

[0348]

Table 6-51

[0349]

Table 6-52

[0350]

Table 6-53

[0351]

Table 6-54

[0352]

Table 6-55

[0353]

Table 7-1

[0354]

Table 7-2

[0355]

Table 7-3

[0356]

Table 7-4

[0357]

Table 7-5

[0358]

Table 7-6

[0359]

Table 7-7

[0360]

Table 7-8

[0361]

Table 7-9

[0362]

Table 7-10

[0363]

Table 7-11

[0364]

Table 7-12

[0365]

Table 7-13

[0366]

Table 7-14

[0367]

Table 7-15

[0368]

Table 7-16

[0369]

Table 7-17

[0370]

Table 7-18

[0371]

Table 7-19

[0372]

Table 7-20

[0373]

Table 7-21

[0374]

Table 7-22

[0375]

Table 7-23

[0376]

Table 7-24

[0377]

Table 7-25

[0378]

Table 7-26

[0379]

Table 7-27

[0380]

Table 7-28

[0381]

Table 7-29

[0382]

Table 7-30

[0383]

Table 7-31

[0384]

Table 7-32

[0385]

Table 7-33

[0386]

Table 7-34

[0387]

Table 7-35

[0388]

Table 7-36

[0389]

Table 7-37

[0390]

Table 7-38

[0391]

Table 7-39

[0392]

Table 7-40

[0393]

Table 7-41

[0394]

Table 7-42

[0395]

Table 7-43

[0396]

Table 7-44

[0397]

Table 7-45

[0398]

Table 7-46

[0399]

Table 7-47

[0400]

Table 7-48

[0401]

Table 7-49

[0402]

Table 7-50

[0403]

Table 7-51

[0404]

Table 7-52

[0405]

Table 7-53

[0406]

Table 7-54

[0407]

Table 7-55

[0408]

Table 7-56

[0409]

Table 7-57

[0410]

Table 7-58

[0411]

Table 7-59

[0412]

Table 7-60

[0413] [Table 7-61]

[0414] [Table 7-62]

[0415] Example 3. Lentiviral design and transduction Vector Design Unique complementarity determining regions (CDRs) from selected TCR alpha / beta pairs are combined with the relevant constant regions to form full-length TCR DNA sequences. The sequences have a TCR alpha with the stop codon removed, followed by a furin F2A cleavage site, followed by a TCR beta containing a stop codon. A native leader sequence is used for each TCR sequence. DNA is synthesized and cloned into an EF1a promoter vector with puromycin resistance to produce lentiviral constructs (VectorBuilder).

[0416] Lentiviral transduction of TCR KO Jurkat cell lines Day 1: TCR KO Jurkat cells are removed from flasks and counted. Cells are washed by centrifugation at 1500 rpm for 5 min and resuspended in R10 (R10 medium: Gibco, 61870 supplemented with 10% FBS Gibco, 16140 and 1x sodium pyruvate Gibco, 11360) at a density of 1.5e6 cells / mL. 500 μL of cells are seeded into appropriate wells of a 12-well plate according to the plate layout (density of 7.5e5 cells / well). In a BSL2+ environment, lentiviral constructs are diluted in R10 medium with 2x (final concentration: 4 μg / mL) polybrene (Millipore, Catalog Number: TR-1003-G) to a concentration of 20 multiplicity of infection (MOI) per 500 μL. 500 μL of each construct is added to the appropriate wells according to the plate layout. The plates are centrifuged at 2000 rpm for 2 hours at 30° C. After centrifugation, 1 mL of R10 is added to each well. The plates are then incubated at 37° C. / 5% CO 2 The mixture was incubated overnight at 4°C.

[0417] Day 2: Cells are transferred to individual 15 mL tubes and washed by centrifugation at 300×g for 5 min. Pellets are resuspended in DPBS (Gibco, 14140). Washing is repeated for a total of 3 washes. After the final wash, cells are resuspended in 1 mL of R10. Cells are transferred to a 6-well plate and 1 mL of prepared R10 medium containing 2× (final concentration 1.25 μg / mL) puromycin (Gibco, A11138-03) is added. Cells are incubated at 37° C. / 5% CO 2 Return the cells to the incubator.

[0418] Day 5: Count cells and scale density to 2e5 cells / mL for volume in appropriately sized plates / flasks. For healthy cells, puromycin concentration may be increased to 1.25 µg / mL - 2.5 µg / mL. Culture cells at 37 °C / 5% CO 2 Return the cells to the incubator.

[0419] Day 8 (and every 3-4 days thereafter): Count cells and scale to maintain a density of 2e5 cells / mL. Gradually increase puromycin to a final concentration of 5 µg / mL.

[0420] Example 4. TCR engagement assay TCR engagement assays are performed to determine whether TCRα / β pairs can bind defined peptide-MHC (pMHC) complexes and induce T cell responses. Antigen presenting cells (APCs) are harvested and seeded at 3e5 cells / well in 40 μL in RPMI1640+10% FBS in white clear bottom 96 well plates. Peptides are prepared by adding dimethylsulfoxide (DMSO) or water to the lyophilized powder to achieve a 10 mg / mL concentration. Peptides are exogenously loaded onto APCs by diluting in media to 10× final concentration and adding 10 μL to the well. The same concentrations of DMSO or water and / or wild type (wt) peptides are used as controls. Cells are incubated at 37°C, 5% CO 2 Place in incubator for 2 hours. Meanwhile, harvest reporter T cells expressing a single TCR a / b pair from Table 3 and dilute to 3e6 cells / mL. After 2 hours of incubation, add 50 μL of T cells to each well to give an APC:T cell ratio of 2:1. Place cells back in incubator for 5-6 hours. After incubation, add 100 μL of BioGlo Luciferase Reagent (Promega, Cat# G7940) to each well. Place plate on a rotating plate shaker at medium speed for 2 minutes. Read plate on Envision (Perkin Elmer) plate reader using 0.5 second luminescence detection. Crosstalk corrected values ​​are analyzed using GraphPad Prism graphing software.

[0421] Those skilled in the art will appreciate that changes could be made to the embodiments described above without departing from the broad inventive concept. It is understood therefore that the invention is not limited to the particular embodiments disclosed, but is intended to cover modifications within the spirit and scope of the invention as defined herein.

[0422] The following list of embodiments is intended to complement, not replace or supplant, the preceding description.

[0423] Embodiment 1. A T cell receptor (TCR) comprising an alpha chain and a beta chain, (a) the alpha chain comprises a complementarity determining region 3 (CDR3) comprising the amino acid sequence of SEQ ID NO: 7 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 245; or (b) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 14 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 252; or (c) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 21 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 259; or (d) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:28 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:266; or (e) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 35 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 273; or (f) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 42 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 280; or (g) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 49 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 287; or (h) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 56 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 294; or (i) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 63 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 301; or (j) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 70 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 308; or (k) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 77 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 315; or (l) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 84 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 322; or (m) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 91 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 329; or (n) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 98 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 336; or (o) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 105 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 343; or (p) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 112 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 350; or (q) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 119 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 357; or (r) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 126 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 364; or (s) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 133 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 371; or (t) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 140 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 378; or (u) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 147 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 385; or (v) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 154 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 392; or (w) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 161 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 399; or (x) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 168 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 406; or (y) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 175 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 413; or (z) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 182 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 420; or (aa) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 189 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 427; or (bb) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 196 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 434; or (cc) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 203 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 441; or (dd) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 210 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 448; or (ee) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 217 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 455; or (ff) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 224 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 462; or (gg) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 231 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 469; or (hh) A TCR, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 238 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 476.

[0424] Embodiment 2. A T cell receptor (TCR) comprising an alpha chain and a beta chain, (a) the alpha chain comprises a complementarity determining region 1 (CDR1) comprising the amino acid sequence of SEQ ID NO:3, a complementarity determining region 2 (CDR2) comprising the amino acid sequence of SEQ ID NO:5, and a complementarity determining region 3 (CDR3) comprising the amino acid sequence of SEQ ID NO:7, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:241, a CDR2 comprising the amino acid sequence of SEQ ID NO:243, and a CDR3 comprising the amino acid sequence of SEQ ID NO:245; or (b) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 10, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 14, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 248, a CDR2 comprising the amino acid sequence of SEQ ID NO: 250, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 252; or (c) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a CDR2 comprising the amino acid sequence of SEQ ID NO: 19, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 21, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 255, a CDR2 comprising the amino acid sequence of SEQ ID NO: 257, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 259; or (d) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 24, a CDR2 comprising the amino acid sequence of SEQ ID NO: 26, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 28, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 262, a CDR2 comprising the amino acid sequence of SEQ ID NO: 264, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 266; or (e) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 31, a CDR2 comprising the amino acid sequence of SEQ ID NO: 33, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 35, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 269, a CDR2 comprising the amino acid sequence of SEQ ID NO: 271, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 273; or (f) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 38, a CDR2 comprising the amino acid sequence of SEQ ID NO: 40, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 42, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 276, a CDR2 comprising the amino acid sequence of SEQ ID NO: 278, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 280; or (g) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 45, a CDR2 comprising the amino acid sequence of SEQ ID NO: 47, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 49, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 283, a CDR2 comprising the amino acid sequence of SEQ ID NO: 285, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 287; or (h) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 52, a CDR2 comprising the amino acid sequence of SEQ ID NO: 54, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 56, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 290, a CDR2 comprising the amino acid sequence of SEQ ID NO: 292, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 294; or (i) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:59, a CDR2 comprising the amino acid sequence of SEQ ID NO:61, and a CDR3 comprising the amino acid sequence of SEQ ID NO:63, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:297, a CDR2 comprising the amino acid sequence of SEQ ID NO:299, and a CDR3 comprising the amino acid sequence of SEQ ID NO:301; or (j) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 66, a CDR2 comprising the amino acid sequence of SEQ ID NO: 68, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 70, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 304, a CDR2 comprising the amino acid sequence of SEQ ID NO: 306, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 308; or (k) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 73, a CDR2 comprising the amino acid sequence of SEQ ID NO: 75, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 77, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 311, a CDR2 comprising the amino acid sequence of SEQ ID NO: 313, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 315; or (l) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 80, a CDR2 comprising the amino acid sequence of SEQ ID NO: 82, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 84, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 318, a CDR2 comprising the amino acid sequence of SEQ ID NO: 320, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 322; or (m) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 87, a CDR2 comprising the amino acid sequence of SEQ ID NO: 89, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 91, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 325, a CDR2 comprising the amino acid sequence of SEQ ID NO: 327, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 329; or (n) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 94, a CDR2 comprising the amino acid sequence of SEQ ID NO: 96, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 98, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 332, a CDR2 comprising the amino acid sequence of SEQ ID NO: 334, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 336; or (o) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 101, a CDR2 comprising the amino acid sequence of SEQ ID NO: 103, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 105, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 339, a CDR2 comprising the amino acid sequence of SEQ ID NO: 341, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 343; or (p) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 108, a CDR2 comprising the amino acid sequence of SEQ ID NO: 110, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 112, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 346, a CDR2 comprising the amino acid sequence of SEQ ID NO: 348, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 350; or (q) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 115, a CDR2 comprising the amino acid sequence of SEQ ID NO: 117, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 119, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 353, a CDR2 comprising the amino acid sequence of SEQ ID NO: 355, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 357; or (r) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 122, a CDR2 comprising the amino acid sequence of SEQ ID NO: 124, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 126, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 360, a CDR2 comprising the amino acid sequence of SEQ ID NO: 362, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 364; or (s) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 129, a CDR2 comprising the amino acid sequence of SEQ ID NO: 131, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 133, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 367, a CDR2 comprising the amino acid sequence of SEQ ID NO: 369, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 371; or (t) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 136, a CDR2 comprising the amino acid sequence of SEQ ID NO: 138, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 140, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 374, a CDR2 comprising the amino acid sequence of SEQ ID NO: 376, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 378; or (u) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 143, a CDR2 comprising the amino acid sequence of SEQ ID NO: 145, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 147, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 381, a CDR2 comprising the amino acid sequence of SEQ ID NO: 383, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 385; or (v) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 150, a CDR2 comprising the amino acid sequence of SEQ ID NO: 152, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 154, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 388, a CDR2 comprising the amino acid sequence of SEQ ID NO: 390, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 392; or (w) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 157, a CDR2 comprising the amino acid sequence of SEQ ID NO: 159, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 161, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 395, a CDR2 comprising the amino acid sequence of SEQ ID NO: 397, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 399; or (x) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 164, a CDR2 comprising the amino acid sequence of SEQ ID NO: 166, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 168, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 402, a CDR2 comprising the amino acid sequence of SEQ ID NO: 404, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 406; or (y) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 171, a CDR2 comprising the amino acid sequence of SEQ ID NO: 173, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 175, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 409, a CDR2 comprising the amino acid sequence of SEQ ID NO: 411, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 413; or (z) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 178, a CDR2 comprising the amino acid sequence of SEQ ID NO: 180, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 182, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 416, a CDR2 comprising the amino acid sequence of SEQ ID NO: 418, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 420; or (aa) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 185, a CDR2 comprising the amino acid sequence of SEQ ID NO: 187, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 189, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 423, a CDR2 comprising the amino acid sequence of SEQ ID NO: 425, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 427; or (bb) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 192, a CDR2 comprising the amino acid sequence of SEQ ID NO: 194, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 196, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 430, a CDR2 comprising the amino acid sequence of SEQ ID NO: 432, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 434; or (cc) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 199, a CDR2 comprising the amino acid sequence of SEQ ID NO: 201, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 203, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 437, a CDR2 comprising the amino acid sequence of SEQ ID NO: 439, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 441; or (dd) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 206, a CDR2 comprising the amino acid sequence of SEQ ID NO: 208, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 210, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 444, a CDR2 comprising the amino acid sequence of SEQ ID NO: 446, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 448; or (ee) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 213, a CDR2 comprising the amino acid sequence of SEQ ID NO: 215, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 217, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 451, a CDR2 comprising the amino acid sequence of SEQ ID NO: 453, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 455; or (ff) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 220, a CDR2 comprising the amino acid sequence of SEQ ID NO: 222, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 224, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 458, a CDR2 comprising the amino acid sequence of SEQ ID NO: 460, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 462; or (gg) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 227, a CDR2 comprising the amino acid sequence of SEQ ID NO: 229, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 231, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 465, a CDR2 comprising the amino acid sequence of SEQ ID NO: 467, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 469, or (hh) A TCR, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 234, a CDR2 comprising the amino acid sequence of SEQ ID NO: 236, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 238, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 472, a CDR2 comprising the amino acid sequence of SEQ ID NO: 474, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 476.

[0425] Embodiment 3. (a) the alpha chain according to embodiment 2(a) comprises a variable and joining (VJ) region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 479, and the beta chain according to embodiment 2(a) comprises a variable, diversity and joining (VDJ) region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 581, or (b) the alpha chain of embodiment 2(b) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 482, and the beta chain of embodiment 2(b) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 584; or (c) the alpha chain of embodiment 2(c) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 485, and the beta chain of embodiment 2(c) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 587; or (d) the alpha chain of embodiment 2(d) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 488, and the beta chain of embodiment 2(d) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 590; or (e) the alpha chain of embodiment 2(e) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 491, and the beta chain of embodiment 2(e) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 593; or (f) the alpha chain according to embodiment 2(f) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 494, and the beta chain according to embodiment 2(f) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 596; or (g) the alpha chain according to embodiment 2(g) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 497, and the beta chain according to embodiment 2(g) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 599; or (h) the alpha chain according to embodiment 2(h) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 500, and the beta chain according to embodiment 2(h) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 602; or (i) the alpha chain according to embodiment 2(i) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 503, and the beta chain according to embodiment 2(i) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 605, or (j) the alpha chain according to embodiment 2(j) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 506, and the beta chain according to embodiment 2(j) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 608; or (k) the alpha chain according to embodiment 2(k) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 509, and the beta chain according to embodiment 2(k) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 611; or (l) the alpha chain according to embodiment 2(l) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 512, and the beta chain according to embodiment 2(l) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 614, or (m) the alpha chain according to embodiment 2(m) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 515, and the beta chain according to embodiment 2(m) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 617; or (n) the alpha chain according to embodiment 2(n) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 518, and the beta chain according to embodiment 2(n) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 620; or (o) the alpha chain according to embodiment 2(o) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 521, and the beta chain according to embodiment 2(o) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 623; or (p) the alpha chain according to embodiment 2(p) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 524, and the beta chain according to embodiment 2(p) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 626, or (q) the alpha chain according to embodiment 2(q) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 527, and the beta chain according to embodiment 2(q) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 629; or (r) the alpha chain according to embodiment 2(r) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 530, and the beta chain according to embodiment 2(r) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 632, or (s) the alpha chain according to embodiment 2(s) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 533, and the beta chain according to embodiment 2(s) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 635, or (t) the alpha chain according to embodiment 2(t) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 536, and the beta chain according to embodiment 2(t) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 638; or (u) the alpha chain according to embodiment 2(u) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 539, and the beta chain according to embodiment 2(u) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 641; or (v) the alpha chain according to embodiment 2(v) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 542, and the beta chain according to embodiment 2(v) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 644, or (w) the alpha chain according to embodiment 2(w) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 545, and the beta chain according to embodiment 2(w) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 647, or (x) the alpha chain according to embodiment 2(x) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 548, and the beta chain according to embodiment 2(x) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 650; or (y) the alpha chain according to embodiment 2(y) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 551, and the beta chain according to embodiment 2(y) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 653; or (z) the alpha chain according to embodiment 2(z) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 554, and the beta chain according to embodiment 2(z) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 656; or (aa) the alpha chain according to embodiment 2(aa) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 557, and the beta chain according to embodiment 2(aa) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 659, or (bb) the alpha chain according to embodiment 2(bb) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 560, and the beta chain according to embodiment 2(bb) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 662, or (cc) the alpha chain according to embodiment 2 (cc) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 563, and the beta chain according to embodiment 2 (cc) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 665, or (dd) the alpha chain according to embodiment 2(dd) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 566, and the beta chain according to embodiment 2(dd) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 668, or (ee) the alpha chain according to embodiment 2(ee) comprises a VJ region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 569, and the beta chain according to embodiment 2(ee) comprises a VJD region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 671, or (ff) the alpha chain according to embodiment 2(ff) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 572, and the beta chain according to embodiment 2(ff) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 674, or (gg) the alpha chain according to embodiment 2 (gg) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 575 and the beta chain according to embodiment 2 (gg) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 677, or (hh) A TCR described in embodiment 1 or 2, wherein the alpha chain described in embodiment 2 (hh) comprises a VJ region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 578, and the beta chain described in embodiment 2 (hh) comprises a VJD region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 680.

[0426] Embodiment 4. (a) the alpha chain according to embodiment 2(a) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 477, and the beta chain according to embodiment 2(a) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 579, or (b) the alpha chain according to embodiment 2(b) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 480, and the beta chain according to embodiment 2(b) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 582; or (c) the alpha chain according to embodiment 2(c) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 483, and the beta chain according to embodiment 2(c) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 585; or (d) the alpha chain according to embodiment 2(d) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 486, and the beta chain according to embodiment 2(d) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 588; or (e) the alpha chain according to embodiment 2(e) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 489, and the beta chain according to embodiment 2(e) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 591; or (f) the alpha chain according to embodiment 2(f) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 492, and the beta chain according to embodiment 2(f) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 594; or (g) the alpha chain according to embodiment 2(g) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 495, and the beta chain according to embodiment 2(g) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 597; or (h) the alpha chain according to embodiment 2(h) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 498, and the beta chain according to embodiment 2(h) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 600; or (i) the alpha chain according to embodiment 2(i) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 501 and the beta chain according to embodiment 2(i) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 603; or (j) the alpha chain according to embodiment 2(j) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 504 and the beta chain according to embodiment 2(j) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 606; or (k) the alpha chain according to embodiment 2(k) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 507, and the beta chain according to embodiment 2(k) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 609; or (l) the alpha chain according to embodiment 2(l) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 510, and the beta chain according to embodiment 2(l) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 612; or (m) the alpha chain according to embodiment 2(m) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 513, and the beta chain according to embodiment 2(m) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 615; or (n) the alpha chain according to embodiment 2(n) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 516, and the beta chain according to embodiment 2(n) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 618; or (o) the alpha chain according to embodiment 2(o) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 519, and the beta chain according to embodiment 2(o) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 621; or (p) the alpha chain according to embodiment 2(p) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 522 and the beta chain according to embodiment 2(p) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 624; or (q) the alpha chain according to embodiment 2(q) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 525, and the beta chain according to embodiment 2(q) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 627; or (r) the alpha chain according to embodiment 2(r) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 528, and the beta chain according to embodiment 2(r) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 630, or (s) the alpha chain according to embodiment 2(s) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 531 and the beta chain according to embodiment 2(s) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 633; ​​or (t) the alpha chain according to embodiment 2(t) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 534, and the beta chain according to embodiment 2(t) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 636; or (u) the alpha chain according to embodiment 2(u) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 537, and the beta chain according to embodiment 2(u) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 639, or (v) the alpha chain according to embodiment 2(v) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 540, and the beta chain according to embodiment 2(v) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 642, or (w) the alpha chain according to embodiment 2(w) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 543, and the beta chain according to embodiment 2(w) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 645, or (x) the alpha chain according to embodiment 2(x) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 546, and the beta chain according to embodiment 2(x) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 648; or (y) the alpha chain according to embodiment 2(y) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 549, and the beta chain according to embodiment 2(y) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 651; or (z) the alpha chain according to embodiment 2(z) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 552, and the beta chain according to embodiment 2(z) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 654; or (aa) the alpha chain according to embodiment 2(aa) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 555, and the beta chain according to embodiment 2(aa) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 657, or (bb) the alpha chain according to embodiment 2(bb) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 558 and the beta chain according to embodiment 2(bb) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 660; or (cc) the alpha chain according to embodiment 2 (cc) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 561 and the beta chain according to embodiment 2 (cc) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 663; or (dd) the alpha chain according to embodiment 2(dd) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 564 and the beta chain according to embodiment 2(dd) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 666; or (ee) the alpha chain according to embodiment 2(ee) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 567, and the beta chain according to embodiment 2(ee) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 669, or (ff) the alpha chain according to embodiment 2(ff) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 570, and the beta chain according to embodiment 2(ff) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 672, or (gg) the alpha chain according to embodiment 2 (gg) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 573 and the beta chain according to embodiment 2 (gg) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 675, or (hh) A TCR according to embodiment 1 or 2, wherein the alpha chain according to embodiment 2 (hh) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 576 and the beta chain according to embodiment 2 (hh) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 678.

[0427] Embodiment 5. A nucleic acid molecule encoding a TCR according to any one of embodiments 1 to 4.

[0428] Embodiment 6. A vector comprising the nucleic acid molecule of embodiment 5.

[0429] Embodiment 7. A cell transformed to express the nucleic acid molecule of embodiment 5.

[0430] Embodiment 8. A cell comprising the vector of embodiment 6.

[0431] Embodiment 9. The cell of embodiment 7 or 8, wherein the cell is a CD8+ T cell.

[0432] Embodiment 10. A pharmaceutical composition comprising a TCR according to any one of embodiments 1 to 4, a nucleic acid molecule according to embodiment 5, a vector according to embodiment 6, or a cell according to any one of embodiments 7 to 9.

Claims

1. A T cell receptor (TCR) comprising an alpha chain and a beta chain, (a) the alpha chain comprises a complementarity determining region 3 (CDR3) comprising the amino acid sequence of SEQ ID NO:7, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:245; or (b) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 14 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 252; or (c) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:21 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:259; or (d) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:28 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:266; or (e) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 35 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 273; or (f) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 42 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 280; or (g) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:49 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:287; or (h) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:56 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:294; or (i) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 63 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 301; or (j) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 70 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 308; or (k) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:77 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:315; or (l) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 84 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 322; or (m) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:91 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:329; or (n) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 98 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 336; or (o) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 105 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 343; or (p) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 112 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 350; or (q) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 119, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 357; or (r) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 126 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 364; or (s) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 133 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 371; or (t) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 140 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 378; or (u) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 147 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 385; or (v) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 154 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 392; or (w) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 161 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 399; or (x) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 168 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 406; or (y) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 175 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 413; or (z) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 182 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 420; or (aa) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 189 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 427; or (bb) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 196 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 434; or (cc) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 203 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 441; or (dd) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 210 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 448; or (ee) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 217 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 455; or (ff) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 224 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 462; or (gg) the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 231 and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 469; or (hh) A TCR, wherein the alpha chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO: 238, and the beta chain comprises a CDR3 comprising the amino acid sequence of SEQ ID NO:

476.

2. (a) the alpha chain comprises a complementarity determining region 1 (CDR1) comprising the amino acid sequence of SEQ ID NO:3, a complementarity determining region 2 (CDR2) comprising the amino acid sequence of SEQ ID NO:5, and a complementarity determining region 3 (CDR3) comprising the amino acid sequence of SEQ ID NO:7, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:241, a CDR2 comprising the amino acid sequence of SEQ ID NO:243, and a CDR3 comprising the amino acid sequence of SEQ ID NO:245; or (b) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 10, a CDR2 comprising the amino acid sequence of SEQ ID NO: 12, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 14, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 248, a CDR2 comprising the amino acid sequence of SEQ ID NO: 250, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 252; or (c) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 17, a CDR2 comprising the amino acid sequence of SEQ ID NO: 19, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 21, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 255, a CDR2 comprising the amino acid sequence of SEQ ID NO: 257, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 259; or (d) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:24, a CDR2 comprising the amino acid sequence of SEQ ID NO:26, and a CDR3 comprising the amino acid sequence of SEQ ID NO:28, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:262, a CDR2 comprising the amino acid sequence of SEQ ID NO:264, and a CDR3 comprising the amino acid sequence of SEQ ID NO:266; or (e) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 31, a CDR2 comprising the amino acid sequence of SEQ ID NO: 33, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 35, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 269, a CDR2 comprising the amino acid sequence of SEQ ID NO: 271, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 273; or (f) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:38, a CDR2 comprising the amino acid sequence of SEQ ID NO:40, and a CDR3 comprising the amino acid sequence of SEQ ID NO:42, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:276, a CDR2 comprising the amino acid sequence of SEQ ID NO:278, and a CDR3 comprising the amino acid sequence of SEQ ID NO:280; or (g) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:45, a CDR2 comprising the amino acid sequence of SEQ ID NO:47, and a CDR3 comprising the amino acid sequence of SEQ ID NO:49, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:283, a CDR2 comprising the amino acid sequence of SEQ ID NO:285, and a CDR3 comprising the amino acid sequence of SEQ ID NO:287; or (h) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:52, a CDR2 comprising the amino acid sequence of SEQ ID NO:54, and a CDR3 comprising the amino acid sequence of SEQ ID NO:56, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:290, a CDR2 comprising the amino acid sequence of SEQ ID NO:292, and a CDR3 comprising the amino acid sequence of SEQ ID NO:294; or (i) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:59, a CDR2 comprising the amino acid sequence of SEQ ID NO:61, and a CDR3 comprising the amino acid sequence of SEQ ID NO:63, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:297, a CDR2 comprising the amino acid sequence of SEQ ID NO:299, and a CDR3 comprising the amino acid sequence of SEQ ID NO:301; or (j) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:66, a CDR2 comprising the amino acid sequence of SEQ ID NO:68, and a CDR3 comprising the amino acid sequence of SEQ ID NO:70, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:304, a CDR2 comprising the amino acid sequence of SEQ ID NO:306, and a CDR3 comprising the amino acid sequence of SEQ ID NO:308; or (k) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:73, a CDR2 comprising the amino acid sequence of SEQ ID NO:75, and a CDR3 comprising the amino acid sequence of SEQ ID NO:77, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:311, a CDR2 comprising the amino acid sequence of SEQ ID NO:313, and a CDR3 comprising the amino acid sequence of SEQ ID NO:315; or (l) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 80, a CDR2 comprising the amino acid sequence of SEQ ID NO: 82, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 84, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 318, a CDR2 comprising the amino acid sequence of SEQ ID NO: 320, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 322; or (m) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:87, a CDR2 comprising the amino acid sequence of SEQ ID NO:89, and a CDR3 comprising the amino acid sequence of SEQ ID NO:91, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:325, a CDR2 comprising the amino acid sequence of SEQ ID NO:327, and a CDR3 comprising the amino acid sequence of SEQ ID NO:329; or (n) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:94, a CDR2 comprising the amino acid sequence of SEQ ID NO:96, and a CDR3 comprising the amino acid sequence of SEQ ID NO:98, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:332, a CDR2 comprising the amino acid sequence of SEQ ID NO:334, and a CDR3 comprising the amino acid sequence of SEQ ID NO:336; or (o) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 101, a CDR2 comprising the amino acid sequence of SEQ ID NO: 103, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 105, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 339, a CDR2 comprising the amino acid sequence of SEQ ID NO: 341, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 343; or (p) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 108, a CDR2 comprising the amino acid sequence of SEQ ID NO: 110, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 112, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 346, a CDR2 comprising the amino acid sequence of SEQ ID NO: 348, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 350; or (q) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 115, a CDR2 comprising the amino acid sequence of SEQ ID NO: 117, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 119, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 353, a CDR2 comprising the amino acid sequence of SEQ ID NO: 355, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 357; or (r) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 122, a CDR2 comprising the amino acid sequence of SEQ ID NO: 124, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 126, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 360, a CDR2 comprising the amino acid sequence of SEQ ID NO: 362, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 364; or (s) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 129, a CDR2 comprising the amino acid sequence of SEQ ID NO: 131, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 133, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 367, a CDR2 comprising the amino acid sequence of SEQ ID NO: 369, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 371; or (t) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 136, a CDR2 comprising the amino acid sequence of SEQ ID NO: 138, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 140, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 374, a CDR2 comprising the amino acid sequence of SEQ ID NO: 376, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 378; or (u) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 143, a CDR2 comprising the amino acid sequence of SEQ ID NO: 145, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 147, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 381, a CDR2 comprising the amino acid sequence of SEQ ID NO: 383, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 385; or (v) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 150, a CDR2 comprising the amino acid sequence of SEQ ID NO: 152, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 154, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 388, a CDR2 comprising the amino acid sequence of SEQ ID NO: 390, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 392; or (w) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 157, a CDR2 comprising the amino acid sequence of SEQ ID NO: 159, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 161, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 395, a CDR2 comprising the amino acid sequence of SEQ ID NO: 397, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 399; or (x) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 164, a CDR2 comprising the amino acid sequence of SEQ ID NO: 166, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 168, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 402, a CDR2 comprising the amino acid sequence of SEQ ID NO: 404, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 406; or (y) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 171, a CDR2 comprising the amino acid sequence of SEQ ID NO: 173, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 175, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 409, a CDR2 comprising the amino acid sequence of SEQ ID NO: 411, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 413; or (z) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 178, a CDR2 comprising the amino acid sequence of SEQ ID NO: 180, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 182, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 416, a CDR2 comprising the amino acid sequence of SEQ ID NO: 418, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 420; or (aa) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 185, a CDR2 comprising the amino acid sequence of SEQ ID NO: 187, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 189, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 423, a CDR2 comprising the amino acid sequence of SEQ ID NO: 425, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 427; or (bb) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 192, a CDR2 comprising the amino acid sequence of SEQ ID NO: 194, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 196, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 430, a CDR2 comprising the amino acid sequence of SEQ ID NO: 432, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 434; or (cc) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 199, a CDR2 comprising the amino acid sequence of SEQ ID NO: 201, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 203, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 437, a CDR2 comprising the amino acid sequence of SEQ ID NO: 439, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 441; or (dd) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:206, a CDR2 comprising the amino acid sequence of SEQ ID NO:208, and a CDR3 comprising the amino acid sequence of SEQ ID NO:210, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:444, a CDR2 comprising the amino acid sequence of SEQ ID NO:446, and a CDR3 comprising the amino acid sequence of SEQ ID NO:448; or (ee) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:213, a CDR2 comprising the amino acid sequence of SEQ ID NO:215, and a CDR3 comprising the amino acid sequence of SEQ ID NO:217, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:451, a CDR2 comprising the amino acid sequence of SEQ ID NO:453, and a CDR3 comprising the amino acid sequence of SEQ ID NO:455; or (ff) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 220, a CDR2 comprising the amino acid sequence of SEQ ID NO: 222, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 224, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 458, a CDR2 comprising the amino acid sequence of SEQ ID NO: 460, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 462; or (gg) the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:227, a CDR2 comprising the amino acid sequence of SEQ ID NO:229, and a CDR3 comprising the amino acid sequence of SEQ ID NO:231, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO:465, a CDR2 comprising the amino acid sequence of SEQ ID NO:467, and a CDR3 comprising the amino acid sequence of SEQ ID NO:469, or (hh) The TCR of claim 1, wherein the alpha chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 234, a CDR2 comprising the amino acid sequence of SEQ ID NO: 236, and a CDR3 comprising the amino acid sequence of SEQ ID NO: 238, and the beta chain comprises a CDR1 comprising the amino acid sequence of SEQ ID NO: 472, a CDR2 comprising the amino acid sequence of SEQ ID NO: 474, and a CDR3 comprising the amino acid sequence of SEQ ID NO:

476.

3. (a) the alpha chain of claim 2(a) comprises a variable and joining (VJ) region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 479, and the beta chain of claim 2(a) comprises a variable, diversity and joining (VDJ) region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 581; or (b) The alpha chain according to claim 2(b) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 482, and the beta chain according to claim 2(b) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 584, or (c) The alpha chain of claim 2(c) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 485, and the beta chain of claim 2(c) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 587, or (d) The alpha chain of claim 2(d) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 488, and the beta chain of claim 2(d) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 590, or (e) The alpha chain of claim 2(e) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 491, and the beta chain of claim 2(e) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 593, or (f) the alpha chain of claim 2(f) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 494, and the beta chain of claim 2(f) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 596; or (g) The alpha chain of claim 2(g) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 497, and the beta chain of claim 2(g) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 599, or (h) The alpha chain of claim 2(h) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 500, and the beta chain of claim 2(h) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 602, or (i) The alpha chain according to claim 2(i) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 503, and the beta chain according to claim 2(i) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 605, or (j) The alpha chain of claim 2(j) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 506, and the beta chain of claim 2(j) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 608, or (k) The alpha chain of claim 2(k) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 509, and the beta chain of claim 2(k) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 611, or (l) The alpha chain according to claim 2(l) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:512, and the beta chain according to claim 2(l) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:614, or (m) The alpha chain of claim 2(m) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:515, and the beta chain of claim 2(m) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:617, or (n) the alpha chain of claim 2(n) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 518, and the beta chain of claim 2(n) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 620; or (o) The alpha chain of claim 2(o) comprises a VJ region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 521, and the beta chain of claim 2(o) comprises a VJD region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 623, or (p) The alpha chain according to claim 2(p) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 524, and the beta chain according to claim 2(p) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 626, or (q) The alpha chain of claim 2(q) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:527, and the beta chain of claim 2(q) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:629, or (r) The alpha chain according to claim 2(r) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 530, and the beta chain according to claim 2(r) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 632, or (s) The alpha chain according to claim 2(s) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 533, and the beta chain according to claim 2(s) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 635, or (t) The alpha chain according to claim 2(t) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 536, and the beta chain according to claim 2(t) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 638, or (u) The alpha chain of claim 2(u) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 539, and the beta chain of claim 2(u) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 641, or (v) the alpha chain of claim 2(v) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 542, and the beta chain of claim 2(v) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 644; or (lol) The alpha chain of claim 2(w) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 545, and the beta chain of claim 2(w) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 647, or (x) The alpha chain according to claim 2(x) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 548, and the beta chain according to claim 2(x) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 650, or (y) The alpha chain of claim 2(y) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:551, and the beta chain of claim 2(y) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:653, or (z) The alpha chain of claim 2(z) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 554, and the beta chain of claim 2(z) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 656, or (aa) The alpha chain according to claim 2(aa) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 557, and the beta chain according to claim 2(aa) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 659, or (bb) The alpha chain according to claim 2(bb) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 560, and the beta chain according to claim 2(bb) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 662, or (cc) The alpha chain according to claim 2(cc) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 563, and the beta chain according to claim 2(cc) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 665, or (dd) the alpha chain of claim 2(dd) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 566, and the beta chain of claim 2(dd) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 668; or (ee) the alpha chain of claim 2(ee) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 569, and the beta chain of claim 2(ee) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 671; or (ff) the alpha chain according to claim 2(ff) comprises a VJ region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 572, and the beta chain according to claim 2(ff) comprises a VJD region comprising an amino acid sequence at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 674; or (gg) The alpha chain according to claim 2(gg) comprises a VJ region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 575, and the beta chain according to claim 2(gg) comprises a VJD region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 677, or (hh) The TCR of claim 2, wherein the alpha chain of claim 2(hh) comprises a VJ region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:578, and the beta chain of claim 2(hh) comprises a VJD region comprising an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

680.

4. (a) the alpha chain of claim 2(a) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 477, and the beta chain of claim 2(a) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 579; or (b) The alpha chain of claim 2(b) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 480, and the beta chain of claim 2(b) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 582, or (c) The alpha chain of claim 2(c) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 483, and the beta chain of claim 2(c) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 585, or (d) The alpha chain of claim 2(d) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 486, and the beta chain of claim 2(d) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 588, or (e) The alpha chain of claim 2(e) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 489, and the beta chain of claim 2(e) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 591, or (f) The alpha chain of claim 2(f) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 492, and the beta chain of claim 2(f) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 594, or (g) The alpha chain of claim 2(g) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 495, and the beta chain of claim 2(g) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 597, or (h) The alpha chain of claim 2(h) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 498, and the beta chain of claim 2(h) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 600, or (i) The alpha chain according to claim 2(i) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 501, and the beta chain according to claim 2(i) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 603, or (j) The alpha chain of claim 2(j) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:504, and the beta chain of claim 2(j) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:606, or (k) The alpha chain of claim 2(k) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:507, and the beta chain of claim 2(k) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:609, or (l) The alpha chain according to claim 2(l) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:510, and the beta chain according to claim 2(l) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:612, or (m) The alpha chain of claim 2(m) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:513, and the beta chain of claim 2(m) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:615, or (n) The alpha chain of claim 2(n) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:516, and the beta chain of claim 2(n) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:618, or (o) The alpha chain of claim 2(o) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 519, and the beta chain of claim 2(o) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 621, or (p) The alpha chain according to claim 2(p) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 522, and the beta chain according to claim 2(p) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 624, or (q) The alpha chain of claim 2(q) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 525, and the beta chain of claim 2(q) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 627, or (r) The alpha chain according to claim 2(r) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 528, and the beta chain according to claim 2(r) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 630, or (s) The alpha chain according to claim 2(s) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 531, and the beta chain according to claim 2(s) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 633, or (t) The alpha chain according to claim 2(t) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 534, and the beta chain according to claim 2(t) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 636, or (u) The alpha chain of claim 2(u) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:537, and the beta chain of claim 2(u) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:639, or (v) the alpha chain of claim 2(v) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 540, and the beta chain of claim 2(v) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 642; or (lol) The alpha chain of claim 2(w) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:543, and the beta chain of claim 2(w) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:645, or (x) The alpha chain according to claim 2(x) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 546, and the beta chain according to claim 2(x) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 648, or (y) The alpha chain of claim 2(y) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:549, and the beta chain of claim 2(y) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:651, or (z) The alpha chain of claim 2(z) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 552, and the beta chain of claim 2(z) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 654, or (aa) The alpha chain according to claim 2(aa) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 555, and the beta chain according to claim 2(aa) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 657, or (bb) The alpha chain according to claim 2(bb) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 558, and the beta chain according to claim 2(bb) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 660, or (cc) The alpha chain according to claim 2(cc) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 561, and the beta chain according to claim 2(cc) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 663, or (dd) the alpha chain of claim 2(dd) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 564, and the beta chain of claim 2(dd) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 666; or (ee) The alpha chain of claim 2(ee) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 567, and the beta chain of claim 2(ee) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 669, or (ff) the alpha chain according to claim 2(ff) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 570, and the beta chain according to claim 2(ff) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 672, or (gg) The alpha chain according to claim 2(gg) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 573, and the beta chain according to claim 2(gg) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 675, or (hh) The TCR of claim 2, wherein the alpha chain of claim 2(hh) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:576, and the beta chain of claim 2(hh) comprises an amino acid sequence that is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:

678.

5. A nucleic acid molecule encoding the TCR according to any one of claims 1 to 4.

6. A vector comprising the nucleic acid molecule of claim 5.

7. A cell transformed to express the nucleic acid molecule of claim 5.

8. A cell comprising the vector described in claim 6.

9. The cell of claim 7 , wherein the cell is a CD8+ T cell.

10. The cell described in claim 8, wherein the cell is a CD8+ T cell.

11. A pharmaceutical composition comprising the TCR of any one of claims 1 to 4.

12. A pharmaceutical composition comprising the nucleic acid molecule described in claim 5.

13. A pharmaceutical composition comprising the vector described in claim 6.

14. A pharmaceutical composition comprising the cells described in claim 7.

15. A pharmaceutical composition comprising the cells described in claim 8.

16. A pharmaceutical composition comprising the cells described in claim 9.

17. A pharmaceutical composition comprising the cells described in claim 10.