Negative-strand RNA viral vector and plant genome editing method not requiring transformation

Abstract

The present invention provides a method and a virus vector system for site-specific modification of genetic material of a plant using a minus-strand RNA virus vector. The present invention also provides a method for site-specific editing of a target DNA of a plant genome without requiring stable genetic transformation of the plant to be modified, comprising the steps of: infecting a plant with a Tomato spotted wilt virus vector, instantaneously expressing a sequence-specific nucleic acid modifying enzyme, and the sequence-specific nucleic acid modifying enzyme targets a target site in the infected plant genome, cleaving or modifying the target site, and completing the target-directed modification of the target site by the plant's DNA repair mechanism. By using an RNA virus vector to deliver the sequence-specific nucleic acid modifying enzyme, not only is the editing efficiency of the target site improved, but also a non-genetically modified edited strain is obtained.

Description

[Technical field]

[0001] The present invention is in the field of plant genetic engineering, and relates to a method for editing plant genomes that does not require stable genetic transformation. Specifically, the present invention relates to a method for delivering CRISPR nucleic acid modification enzymes into plants and genetically modifying plant genomes using an engineered plant negative strand RNA viral vector system, and to plants and their progeny whose genetic material has been modified by said method. [Background technology]

[0002] The development of sequence-specific nuclease (SSNs) technology has made targeted genome editing possible. SSNs are composed of a sequence-specific DNA binding domain and a non-specific DNA cleavage domain. After being introduced into cells, they target specific sites in the genome, generate DNA double-strand breaks (DSBs), and activate the cellular non-homologous end joining (NHEJ) mechanism to repair the DSBs. In this process, base insertion or deletion is likely to occur, so mutations are likely to occur in the target sequence. In addition, when a homologous DNA sequence is present in a cell, the body's homologous recombination (HR) mechanism uses the homologous template to repair the DSBs, thereby performing genetic manipulations such as gene modification, allele replacement, or targeted insertion of a foreign gene on the target sequence. Furthermore, by fusing SSN mutants, which are unable to generate DSBs, with effectors such as transcription factors, cytosine deaminase, adenine deaminase, and reverse transcriptase, it is possible to achieve target gene transcription control, base editing, and the insertion or deletion of single or multiple bases.

[0003] Conventional SSNs mainly include zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced short palindromic repeats / CRISPR associated proteins (CRISPR / Cas). CRISPR / Cas technology only requires the introduction of Cas nuclease and target site-specific guide RNA into cells, and has the advantages of simple operation and high efficiency, so it is widely used in genome editing of animals and plants.

[0004] An important part of genome editing technology is the delivery of SSNs reagents, i.e., the methods and means for introducing SSNs into recipient cells. Because direct transfection of SSNs molecules is inhibited by components of the rigid cell wall of plant cells, SSNs are usually delivered to plant cells in the form of genetic modification by methods such as transformation with Agrobacterium or bombardment with a gene gun, i.e., genetic transformation occurs. When this method is used for genetic improvement of crops, the following problems arise: 1) there are many species or varieties of crops with low transformation efficiency; 2) especially for plants with complex ploidy, long breeding cycle, or vegetative propagation, the genetic recombination segregation of SSNs in the progeny of the edited line depends on sexual hybridization, and the process is time-consuming and labor-intensive; 3) stable genetic transformation process may cause unexpected changes and damage to the chromosomal DNA of plants; and 4) in some countries, products related to the genetic transformation process may be subject to regulation as genetically modified plants.

[0005] Viral vectors are natural delivery tools for biological macromolecules and are widely used for the introduction and instantaneous expression of heterologous genes in plants (e.g., Donson et al., Proc Natl Acad Sci USA, 1991, 88: 7204-7208; Wang et al., PLoS Pathog, 2015, 11: e1005223). In particular, RNA viral vectors do not involve the DNA stage in their replication process, so there is no risk of foreign nucleic acids integrating into the host genome. Infection of plant strains with plant viruses is not only more rapid and simpler than stable transformation by genetic recombination, but also results in overexpression of foreign genes through viral replication. Infectious viral vectors can also realize the direct delivery of foreign genes into plants (in planta) without isolating specific recipient cells or tissues. Many plant viruses have now been modified into vectors and are used to deliver nucleic acid molecules or express foreign proteins into plants (Gleba et al., Curr Opin Plant Biol, 2004, 7: 182-188; Cody and Scholthof, Annu Rev Phytopathol, 2019, 57: 211-230).

[0006] In plant genome editing, the molecular weight of CRISPR / Cas nuclease genes is large; for example, the genes of commonly used Cas9 and Cas12a nucleases are approximately 4,000 kilobases (kb), and when cis-regulatory elements are added, the molecular weight becomes 5-7 kb, which poses a major challenge to the packaging capacity of viral vectors. Due to limited packaging capacity, some infectious plant virus vectors use small CRISPR guide RNAs (gRNAs), such as cabbage leaf curl virus, whose genome is single-stranded DNA (Yin et al., Sci Rep, 2015, 5: 14926), and tobacco rattle virus, whose genome is sense RNA (Ali et al., Mol Plant, 2015, 8: 1288-1291; Patent WO 2015189693; Patent WO 2016084084), tobacco mosaic virus (Cody et al., Plant Physiol, 2017, 175: 23-35), pea early-browning virus (PEBV) (Ali et al., Virus Res, 2018, 244: 333-337), and beet necrotic yellow vein virus (Jiang et al., Plant Biotechnol J, 2018, 244: 333-337). 2019, 17: 1302-1315) and Chloris striate mosaic virus (CSMV) (Mei et al., Plant Direct, 2019, 3: 1-16). The cooperation of guide RNA delivered by these viral vectors with transgenic expressed Cas9 allows site-specific editing of the genome. Other specific sense RNA plant viral vectors with strong packaging capacity are used to deliver other nuclease components. For example, the tobacco rattle virus has been used to deliver meganucleases of about 1 kb (Honig et al., Mol plant, 2015, 8: 1292-1294) or zinc finger nucleases of about 2 kb (Marton et al., Plant Physiol, 2010, 154: 1079-1087; patent WO 2009130695), and split CRISPR / Cas nuclease components (U.S. Patent Application US 20190359993).

[0007] Viral replicon systems are vectors that can replicate but cannot infect the whole body, and have a strong ability to accept foreign fragments. Papers (Baltes et al., Plant Cell, 2014, 151-163) and patents (WO 2018081081 and US 20210054388) have disclosed the delivery of CRISPR / Cas nuclease and homologous recombination DNA template by Geminiviridae Bean yellow dwarf virus replicon vector. Papers (Wang et al., Mol Plant, 2017, 10: 1007-1010) and Chinese patent CN 109880846 A have disclosed the delivery of CRISPR / Cas nuclease and homologous recombination DNA template by Geminiviridae Wheat dwarf virus replicon vector system. A paper (Ariga et al., Plant Cell Physiol, 2020, 61: 1946-1953) and a US patent (US 20190359993) disclosed a method for delivering CRISPR / Cas nuclease genes using potato virus X and tomato mosaic virus vectors. A paper (Gao et al., New Phytol, 2019, 223: 2120-2133) and a Chinese patent (CN 110511955 A) disclosed a method for delivering CRISPR / Cas nuclease in single plant cells using barley yellow stripe mosaic virus vectors. The replicon virus vector cannot infect plants systemically, and the virus vector-containing DNA is introduced into cells by methods such as transformation with Agrobacterium or bombardment with a gene gun to express the complete CRISPR / Cas nuclease in the inoculated cells and realize genome editing. Summary of the Invention [Problem to be solved by the invention]

[0008] Plant negative-strand RNA viruses mainly include non-segmented negative-strand RNA viruses of the Rhabdoviridae family and segmented Bunyavirales viruses. At present, there are few reports on these viral vectors. A paper (Ma et al., Nature Plants, 2020, 6: 773-339) disclosed a method for systemic delivery of CRISPR / Cas nuclease and realization of DNA-free genome editing in Nicotiana benthamiana strains by Sowberry yellow rhabdovirus vectors, but due to the limited range of viral hosts, there are currently no reports on the delivery of CRISPR / Cas nuclease in different crops. A paper (Feng et al., Proc Natl Acad Sci USA, 2020, 117: 1181-1190) reported a method for genetic manipulation and virus rescue of Tomato spotted wilt virus of the Bunyavirales order. [Means for solving the problem]

[0009] In order to solve the current technical problems of using a plant virus vector to perform genome site-specific modification in plants without genetic recombination, the present invention uses Tomato spotted wilt virus to deliver a sequence-specific nucleic acid modifying enzyme to plants. The sequence-specific nucleic acid modifying enzyme can target a specific nucleic acid sequence in the plant genome, and cleave or modify the target site, and then the plant's endogenous DNA repair mechanism completes the site-specific modification of the target site. Furthermore, the Tomato spotted wilt virus has the ability to infect the whole body, so that the sequence-specific nucleic acid modifying enzyme can be delivered systemically in the plant, and site-specific edited plant parts that do not contain integration by foreign nucleic acid sequences can be obtained. Furthermore, the site-specific edited plant parts (e.g., plant cells) that do not contain integration by foreign sequences can be regenerated to obtain a non-genetically modified, stably inherited site-specific edited plant. Furthermore, the site-specific edited plant parts (e.g., plant cells) that do not contain integration by foreign sequences can be treated with an antiviral drug in the regeneration process, and then a virus-free, non-genetically modified, stably inherited site-specific edited plant can be obtained.

[0010] First, one aspect of the present invention is a method for modifying genetic material of a plant cell, said method not requiring the incorporation of exogenous genetic material into the genome of the cell to be modified, and comprising the steps of: a) providing at least one plant cell in which genetic material is to be modified; b) providing a Tospovirus vector, said viral vector system comprising at least one polynucleotide sequence encoding a sequence-specific nucleic acid modifying enzyme; c) introducing the viral vector into the plant cell and instantly expressing the nucleic acid modifying enzyme; and d) the sequence-specific nucleic acid modifying enzyme targets and cuts or modifies a specific site in the genome of the plant cell and completes the modification to the genetic material of the plant cell via endogenous DNA repair mechanisms of the plant cell.

[0011] In another aspect, the present invention further provides a method for generating a plant having modified genetic material, said method not requiring the incorporation of exogenous genetic material into the modified cellular genome, and comprising the steps of: a) providing at least one plant cell in which genetic material is to be modified; b) providing a Tospovirus viral vector, said viral vector comprising at least one heterologous polynucleotide sequence encoding a sequence-specific nucleic acid modifying enzyme; c) introducing the viral vector into the plant cell and instantly expressing the nucleic acid modifying enzyme; d) the sequence-specific nucleic acid modifying enzyme targets and cuts or modifies a specific site in the genome of the plant cell, and completes the modification to the genetic material of the plant cell through the endogenous DNA repair mechanisms of the plant cell; and e) obtaining a plant having modified genetic material from said plant cell.

[0012] In some embodiments, the method includes selecting plant cells or plants in which the genetic material has been modified, preferably the selection process does not require the use of a selectable marker.

[0013] In some embodiments, the modification comprises a deletion, insertion or substitution of one or more nucleotides at the target gene site in the plant cell, or a combination of the above modification modes.

[0014] In some embodiments, the heterologous polynucleotide sequence encoding the sequence-specific nucleic acid modifying enzyme is any nuclease, mutant form or derivative thereof capable of achieving genome editing, preferably, the sequence-specific nucleic acid modifying enzyme is selected from CRISPR / Cas nuclease, TALEN nuclease, zinc finger nuclease, meganuclease, more preferably, CRISPR / Cas nuclease, even more preferably, CRISPR / SpCas9 from Streptococcus pyogenes or CRISPR / LbCas12a (LbCpf1) nuclease from Lachnospira.

[0015] In some other embodiments, the heterologous polynucleotide sequence encoding the sequence-specific nucleic acid modifying enzyme is any polynucleotide sequence capable of achieving genome base editing, such as an adenine base editor formed by fusing a Cas polypeptide with an adenine deaminase, or a cytosine base editor formed by fusing a Cas polypeptide with a cytosine deaminase. Preferably, the Cas polypeptide is a SpCas9 nickase variant derived from Streptococcus pyogenes, the adenine deaminase is an artificially evolved Escherichia coli tRNA adenine deaminase A (ecTadA) variant (TadA8e V106W), and the cytosine deaminase is human apolipoprotein B messenger RNA cytosine deaminase catalytic subunit 3A (hAPOBEC3A; hA3A).

[0016] In some embodiments, in the recombinant viral vector system, the viral vector is a Tomato spotted wilt virus vector, and preferably, the Tomato spotted wilt virus three genomic segments S, M, L polynucleotide sequences have at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% identity to SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively.

[0017] The Tomato spotted wilt virus vector provided by the present invention comprises one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) insertion sites for foreign genes. In some embodiments, the recombinant Tomato spotted wilt virus vector S genome carries one reporter gene and the M genome carries another reporter gene, which are operably linked to cis elements for viral mRNA transcription. Preferably, the reporter genes are green fluorescent protein gene (GFP) and red fluorescent protein gene (RFP). When the recombinant nucleic acid construct is introduced into a plant cell, the replication and systemic infection of the recombinant virus are tracked by the expression of the reporter genes.

[0018] In some embodiments, the Tomato spotted wilt virus vector S genome fragment comprises at least one heterologous polynucleotide sequence encoding a sequence-specific nucleic acid modifying enzyme component, wherein the heterologous polynucleotide sequence is operably linked to a cis-element for viral mRNA transcription, and preferably, the specific nucleic acid modifying enzyme component is a chimeric CRISPR guide RNA polynucleotide molecule.

[0019] In a specific embodiment, a portion or all of the polynucleotide sequence encoding the nonstructural protein NSs in the Tomato spotted wilt virus vector S genome is replaced by a heterologous polynucleotide sequence encoding the sequence-specific nucleic acid modifying enzyme component or a sequence obtained by fusing the same with another heterologous sequence, and preferably, the other heterologous sequence is a sequence encoding a fluorescent reporter gene, more preferably a sequence encoding a fluorescent reporter gene.

[0020] In some embodiments, the heterologous polynucleotide sequence encoding the sequence-specific nucleic acid modifying enzyme component is a polynucleotide sequence encoding a guide RNA.

[0021] In some embodiments, the heterologous polynucleotide sequence inserted into the S genome encodes one guide RNA.

[0022] In some embodiments, the heterologous polynucleotide sequence inserted into the S genome encodes two or more guide RNAs.

[0023] In some embodiments, the Tomato spotted wilt virus vector M genome fragment comprises at least one heterologous polynucleotide sequence encoding a sequence-specific nucleic acid modifying enzyme component, the heterologous polynucleotide sequence being operably linked to a cis-element involved in viral mRNA transcription, and preferably the specific nucleic acid modifying enzyme component is a Cas polypeptide, more preferably an LbCas12a polypeptide derived from Lachnospira, SpCas9 derived from Streptococcus pyogenes, or an adenine base editor or a cytosine base editor formed by fusing an SpCas9 variant with a base deaminating enzyme.

[0024] In a preferred embodiment, the sequences encoding the SpCas9, LbCas12a, adenine base editor and cytosine base editor polypeptides are plant codon-optimized sequences, preferably, the codon-optimized sequences are set forth in SEQ ID NOs: 10, 11, 84 and 85, respectively.

[0025] In a specific embodiment, a portion or all of the polynucleotide sequence encoding the viral glycoprotein (GP) in the Tomato spotted wilt virus vector M genome is replaced by a heterologous polynucleotide sequence encoding the sequence-specific nucleic acid modifying enzyme component.

[0026] In some embodiments, the polynucleotide sequence of the Tomato spotted wilt virus vector L genome fragment is a chimeric sequence, and the polynucleotide sequence encoding the viral polymerase (RdRp) is replaced by a codon-optimized RdRp sequence, preferably the codon-optimized RdRp sequence set forth in SEQ ID NO:5.

[0027] In some embodiments, the Tomato spotted wilt virus vector is an attenuated infectious virus vector lacking the NSs gene. In some other embodiments, the Tomato spotted wilt virus vector is an infectious virus vector lacking the GP gene and therefore unable to be transmitted by vector insects.

[0028] The present invention further provides methods for introducing an infectious Tomato spotted wilt virus vector into a plant cell, expressing a nucleic acid modifying enzyme, and modifying genetic material within the infected plant cell. In some embodiments, the nucleic acid modifying enzyme is a CRISPR / LbCas12a nuclease. In some embodiments, the nucleic acid modifying enzyme is a CRISPR / SpCas9 nuclease. In some embodiments, the nucleic acid modifying enzyme is an adenine base editor. In some embodiments, the nucleic acid modifying enzyme is a cytosine base editor.

[0029] In some embodiments, the method of introducing the viral vector into a plant cell comprises introducing a nucleic acid construct comprising a viral vector polynucleotide sequence into the plant cell under conditions that allow for the development of recombinant virus.

[0030] In a preferred embodiment, the recombinant viral vector or nucleic acid construct used in the method is an Agrobacterium binary plasmid, which comprises a promoter and a terminator capable of regulating transcription, and the method of incorporation into the plant cell is the Agrobacterium infection method.

[0031] In some embodiments, the nucleic acid construct introduced into the plant cell further comprises an auxiliary expression vector encoding one or more RNA silencing suppressors (VSRs), preferably the silencing suppressors are selected from one or a combination of the following: Tombusvirus p19, Tobacco etch virus HcPro, Barley stripe mosaic virus γb, and Tomato spotted wilt virus NSs.

[0032] In some embodiments, a nucleic acid construct comprising the viral vector sequence is introduced into a plant cell and then transcribed to generate S, M, or L genomic sense or antisense strand RNA of a Tomato spotted wilt virus chimera, preferably to generate sense strand RNA.

[0033] In a preferred embodiment, the concentration ratio of the nucleic acid constructs comprising the Tomato spotted wilt virus S, M, L chimeric genome fragments is 1-2:2-10:1-2, preferably 1:10:2. Furthermore, the nucleic acid constructs are Agrobacterium binary plasmids, and the concentration ratio is the concentration ratio of the Agrobacterium strains of each binary plasmid contained in the mixture of Agrobacterium bacteria solutions.

[0034] In some embodiments, the method of introducing the viral vector into plant cells is inoculation of the plant with recombinant viral particles, including inoculation by mechanical friction, high pressure spray, or transplantation.

[0035] In a preferred embodiment, the plant to be modified with the genetic material is a natural or experimental host plant capable of systemic or local infection with a Tospovirus virus, and further, the host plant is selected from the group consisting of Nicotiana benthamiana, N. tabacum, Lycopersicon esculentum, Capsicum annuum, C. frutescens, C. chinense, Arachis hypogaea, Solanum tuberosum, Physalis alkekengi, Solanum melongena, Glycine max, Gossypium hirsutum, Lactuca sativa, Spinacia oleracea, Citrullus lanatus, Cucumis sativa, and the like. sativus, broad bean (Vicia faba), black gram (Vigna mungo), mung bean (Vigna radiata) or cowpea (Vigna unguiculata).

[0036] In some embodiments, the plants to be modified with the genetic material include varieties or genotypes of Tospovirus host plants. Preferred embodiments include, but are not limited to, multiple peanut varieties, such as Huayu25, Huayu32, Huayu39, Huayu48, Huayu9616, Fengyou68, Honghua1, Dabaisha, Silihong, and Shuofeng518. In some other preferred embodiments, the plants to be modified with the genetic material include, but are not limited to, multiple paprika varieties, such as Zhoula2, Zhoula3, Zhoula4, Fuxiangxiuli, Bola5, Bola7, Bola15, Xingshu201, Xingshu301, and Xingshuguiyan.

[0037] In some embodiments, the infectious Tomato spotted wilt virus vector incorporated into the plant cell expresses an LbCas12a polypeptide and a single guide RNA, and the nuclease complex formed targets the crFucT target sequence (SEQ ID NO: 86) and the crDCL2 target sequence (SEQ ID NO: 87) in N. benthamiana, or the conserved crPDS1 target sequence (SEQ ID NO: 12) in N. benthamiana and N. tabacum, or the crPDS2 target sequence (SEQ ID NO: 13) in tomato, or the crPDS3 target sequence (SEQ ID NO: 14) and the crPDS6 target sequence (SEQ ID NO: 99) in Capsicum, or the crPDS4 target sequence (SEQ ID NO: 15) in peanut and soybean, or the crPDS5 target sequence (SEQ ID NO: 98) in peanut, or the crER target sequence (SEQ ID NO: 88) in Physalis oryzae.

[0038] In some embodiments, the infectious Tomato spotted wilt virus vector incorporated into the plant cell expresses an LbCas12a polypeptide and multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) tandem guide RNAs such that multiple nuclease complexes are formed targeting multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) target sequences. In a preferred embodiment, two guide RNAs are expressed in tandem to target the crPDS1 and crFucT target sites, respectively, or three guide RNAs are expressed in tandem to target the crPDS1, crFucT and crDCL2 target sites, respectively, in N. benthamiana.

[0039] In some embodiments, the infectious Tomato spotted wilt virus vector that is introduced into the plant cell expresses an SpCas9 polypeptide and a single guide RNA, and the nuclease complex formed targets the gGFP target sequence (SEQ ID NO: 16) of the N. benthamiana GFP transgenic, or the gPDS2 target sequence (SEQ ID NO: 89), gRDR6 target sequence (SEQ ID NO: 90), or gSGS3 target sequence (SEQ ID NO: 91) of an endogenous N. benthamiana gene, or the conserved gPDS1 target sequence (SEQ ID NO: 17) of N. benthamiana and N. tabacum.

[0040] In some embodiments, the infectious Tomato spotted wilt virus vector that is introduced into the plant cell expresses an SpCas9 polypeptide and multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) tandem guide RNAs such that multiple nuclease complexes are formed that target multiple (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) target sequences. In a preferred embodiment, two guide RNAs are expressed in tandem to target the gPDS2 and gRDR6 target sites, respectively, or three guide RNAs are expressed in tandem to target the gPDS2, gRDR6 and gSGS3 target sites, respectively, in N. benthamiana.

[0041] In some embodiments, the infectious Tomato spotted wilt virus vector that is introduced into the plant cell expresses an adenine base editor polypeptide and a guide RNA, and the base-modifying enzyme complex formed targets the N. benthamiana gPDSa target sequence (SEQ ID NO: 92), or the gFucTa1 target sequence (SEQ ID NO: 93), or the gBBLd target sequence (SEQ ID NO: 97).

[0042] In some embodiments, the infectious Tomato spotted wilt virus vector that is introduced into the plant cell expresses a cytosine base editor polypeptide and a guide RNA, and the base-modifying enzyme complex formed targets the gFucTa2 target sequence (SEQ ID NO: 94), or the gRDR6a1 target sequence (SEQ ID NO: 95), or the gRDR6a2 target sequence (SEQ ID NO: 96) of Nicotiana benthamiana.

[0043] Furthermore, the present invention provides methods for obtaining plants from plant cells infected with a viral vector and having modified genetic material, and methods for selecting plants having modified genetic material.

[0044] The plant cells according to the invention may be whole cell lines or isolated plant cells such as callus, suspension cells, protoplasts, etc. In some preferred embodiments of the invention, the cells are whole cell lines.

[0045] In some embodiments of the invention, plant cells or tissues infected by the virus are used as explants for tissue culture and plant regeneration in media that does not contain a selection marker (e.g., antibiotics, herbicides, etc.) to obtain plants with modified genetic material.

[0046] Further, the method includes selecting plants having modified genetic material from the regenerated plants, and the selection process does not require selection with a selection marker (e.g., antibiotics, herbicides, etc.).In some other embodiments of the present invention, the method for selecting plants having modified genetic material does not require selection marker genes, and the identification method employed is one or a combination of restriction enzyme protection analysis, Sanger sequencing analysis, and high-throughput sequencing analysis.

[0047] In some preferred embodiments of the present invention, Nicotiana benthamiana leaf cells infected with a Tomato spotted wilt virus nuclease delivery vector were used for tissue culture to obtain lines with modified genetic material without the insertion of foreign nucleic acid.

[0048] In some preferred embodiments of the present invention, tobacco leaf cells infected with a Tomato spotted wilt virus nuclease delivery vector were used in tissue culture to obtain lines with modified genetic material without the insertion of foreign nucleic acid.

[0049] In some preferred embodiments of the present invention, tomato leaf cells infected with a Tomato spotted wilt virus nuclease delivery vector were used in tissue culture to obtain lines with modified genetic material without the insertion of foreign nucleic acid.

[0050] Furthermore, the present invention compares the effects of infection with Tomato spotted wilt virus vectors containing / not containing the NSs gene on differentiation and regeneration of plant cells, and finds that the inclusion of NSs inhibits plant regeneration. Therefore, in some preferred embodiments of the present invention, plant cells infected with an NSs-deleted Tomato spotted wilt virus vector are used for tissue culture to regenerate plants with modified genetic material.

[0051] In another embodiment of the present invention, there is provided a method for obtaining a virus-free strain from a cell infected with a Tospovirus by tissue culture, the method comprising the steps of: a) providing at least one plant cell infected with a Tospovirus; b) performing tissue culture and plant regeneration on the plant cells in a medium containing an antiviral compound; and c) obtaining and identifying the virus-free regenerant strain.

[0052] In some embodiments, the antiviral compound is ribavirin and 100% of the regenerants are cleared of the virus, compared to only 4.4% of the regenerants in a control without an antiviral drug.

[0053] In some embodiments, the antiviral compound is favipiravir and the viral clearance rate is 66.7%.

[0054] In some embodiments, the antiviral compound is remdesivir and the viral clearance rate is 15.6%.

[0055] Another aspect of the invention is a recombinant viral vector system, the recombinant viral vector system comprising one or more recombinant viral vectors, the recombinant viral vectors comprising: a) a polynucleotide sequence of a Tospovirus vector; b) a heterologous polynucleotide sequence operably linked to a viral transcriptional cis-element and encoding at least one sequence-specific nucleic acid modifying enzyme; The present invention provides a recombinant viral vector system, which is introduced into a plant cell and then replicates and expresses the sequence-specific nucleic acid modifying enzyme, and the sequence-specific nucleic acid modifying enzyme targets and cuts or modifies a specific target site in the plant cell genome.

[0056] The sequence-specific nucleic acid modifying enzyme is any nuclease, mutant form or derivative thereof capable of achieving genome modification, preferably, the sequence-specific nucleic acid modifying enzyme is selected from CRISPR / Cas nucleases, more preferably CRISPR / SpCas9 from Streptococcus pyogenes, CRISPR / LbCas12a (LbCpf1) nuclease from Lachnospira, adenine base editors and cytosine base editors constructed based on CRISPR / SpCas9 nuclease variants.

[0057] In some embodiments, the viral vector is derived from Tomato spotted wilt virus, and preferably, the polynucleotide sequences of the three genomic segments S, M, and L of Tomato spotted wilt virus have at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% identity to SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively.

[0058] In some embodiments, the Tomato spotted wilt virus vector S genome fragment comprises at least one heterologous polynucleotide sequence encoding a sequence-specific nucleic acid modifying enzyme component, wherein the heterologous polynucleotide sequence is operably linked to a cis-element for viral mRNA transcription, and preferably, the specific nucleic acid modifying enzyme component is a chimeric CRISPR guide RNA polynucleotide molecule.

[0059] In some embodiments, part or all of the polynucleotide sequence encoding the nonstructural protein NSs in the Tomato spotted wilt virus vector S genome is replaced by a heterologous polynucleotide sequence encoding the sequence-specific nucleic acid modifying enzyme component or a sequence formed by fusing the same with another heterologous sequence, and preferably the other sequence is a sequence encoding a fluorescent reporter gene.

[0060] In some embodiments, the heterologous polynucleotide sequence inserted into the S genome encodes one guide RNA.

[0061] In some embodiments, the heterologous polynucleotide sequence inserted into the S genome encodes two or more guide RNAs.

[0062] In some embodiments, the Tomato spotted wilt virus vector M genome fragment comprises at least one heterologous polynucleotide sequence encoding a sequence-specific nucleic acid modifying enzyme component, the heterologous polynucleotide sequence being operably linked to a cis-element involved in viral mRNA transcription, and preferably the specific nucleic acid modifying enzyme component is a Cas polypeptide, more preferably SpCas9 from Streptococcus pyogenes, LbCas12a polypeptide from Lachnospira, or an adenine base editor and a cytosine base editor formed by fusing an SpCas9 variant with a base deaminating enzyme.

[0063] In a preferred embodiment, the sequences encoding the SpCas9 or LbCas12a, adenine base editor and cytosine base editor polypeptides are plant codon-optimized sequences, preferably, the codon-optimized sequences are depicted in SEQ ID NOs: 10, 11, 84, 85.

[0064] In a preferred embodiment, a part or all of the polynucleotide sequence encoding the viral glycoprotein (GP) in the Tomato spotted wilt virus vector M genome is replaced by a heterologous polynucleotide sequence encoding the sequence-specific nucleic acid modifying enzyme component.

[0065] In some embodiments, the polynucleotide sequence of the Tomato spotted wilt virus vector L genome fragment is a chimeric sequence, and the polynucleotide sequence encoding the viral polymerase (RdRp) is replaced by a codon-optimized RdRp sequence, preferably the codon-optimized RdRp sequence set forth in SEQ ID NO:5.

[0066] In some embodiments, the viral vector is a nucleic acid construct comprising a viral vector polynucleotide sequence, and the nucleic acid construct can form an infectious recombinant viral vector after being introduced into a plant cell, and preferably, the nucleic acid construct is an Agrobacterium binary plasmid comprising a promoter and a terminator capable of regulating transcription, and the method of introduction into the plant cell is an Agrobacterium infection method.

[0067] In a preferred embodiment, the nucleic acid construct co-introduced into the plant cell further comprises an auxiliary expression vector encoding one or more RNA silencing suppressors (VSRs), preferably selected from one or more of Tombusvirus p19, Tobacco Etch Virus HcPro, Barley Stripe Mosaic Virus γb, and Tomato Spotted Wilt Virus NSs.

[0068] Furthermore, after the nucleic acid construct containing the viral vector sequence is introduced into a plant cell, it is transcribed to generate S, M, L genomic sense or antisense strand RNA of the Tomato spotted wilt virus chimera, preferably to generate sense strand RNA.

[0069] In a preferred embodiment, the concentration ratio of the nucleic acid constructs comprising the Tomato spotted wilt virus S, M, L chimeric genome fragments is 1-2:2-10:1-2, preferably 1:10:2.

[0070] In a preferred embodiment, the nucleic acid construct is an Agrobacterium binary plasmid, and the concentration ratio is the concentration ratio of each binary plasmid of an Agrobacterium strain contained in a mixture of Agrobacterium liquids.

[0071] In some embodiments, the method of introducing the viral vector into plant cells is infection with recombinant viral particles, including inoculation by mechanical friction, high pressure spray, or transplantation.

[0072] In some embodiments, the viral vector is an NSs gene-deleted, attenuated infectious viral vector.

[0073] In some embodiments, the viral vector is an infectious viral vector that is incapable of transmission by insect vectors due to a deletion of the GP gene.

[0074] In another aspect of the present invention there is provided a bacterial strain or a recombinant viral particle further comprising the recombinant viral vector system described above, preferably wherein said bacterium is E. coli or Agrobacterium.

[0075] In another aspect, the present invention further provides a reagent kit for the recombinant viral vector system, the reagents including the viral vector may be provided alone or in combination, a) a nucleic acid construct composition comprising a Tomato spotted wilt virus S, M, L genomic fragment, the genomic fragment comprising at least one heterologous polynucleotide sequence encoding a sequence-specific nucleic acid modifying enzyme; and b) an auxiliary expression vector encoding one or more RNA silencing suppressors (VSRs), preferably the silencing suppressors are selected from one or more of Tombusvirus p19, Tobacco Etch Virus HcPro, Barley Stripe Mosaic Virus γb, and Tomato Spotted Wilt Virus NSs.

[0076] Furthermore, the reagent kit further includes a manual or instruction manual.

[0077] In another aspect, the present invention further relates to the application of the recombinant viral vector system, bacterial strain or recombinant virus, reagent kit or method described above in plant genome editing.

[0078] In another aspect, the present invention further provides plants and progeny plants having modified genetic material generated by systemic infection with a recombinant viral vector as described above, or by the methods described above. [Brief description of the drawings]

[0079] [Figure 1] This method involves the delivery of CRISPR / Cas nucleases by Tomato spotted wilt virus (TSWV) vectors to perform plant genome editing. The recombinant virus vector Agrobacterium containing the nuclease sequence is inoculated into the lower leaves of Nicotiana benthamiana by infiltration to systemically infect the plant with the virus vector. The sap of the plant containing the recombinant virus particles may be further inoculated into other virus host plants. The virus vector expresses the nuclease in the cells of the infected plant, causing genome editing. The virus-infected plant tissue is used as an explant to obtain regenerated plants by tissue culture. The target sequence is amplified by PCR, and the edited regenerated plants and progeny are selected by restriction enzyme protection test and Sanger sequencing. [Diagram 2] The morphology and genome structure of TSWV virus particles. (2A) shows a spherical TSWV virus particle, with a lipid coat covering the surface, to which the virally encoded Gn and Gc glycoprotein protrusions are attached. The interior of the virus particle contains three single-stranded antisense RNA genomes covered by the nucleocapsid protein (N), and a small amount of RNA-dependent RNA polymerase (RdRp) is bound to the genome. (2B) shows the TSWV genome structure. The three genomes are named according to their molecular weights: RdRp encoded by L and its antisense, movement protein NSm and glycoprotein precursor GP encoded by M and its ambisense, and envelope protein N and NSs protein encoded by the S strand and its ambisense. [Diagram 3]Plasmid vector profile. (3A) shows the pCB301-2μ-HDV plasmid profile, used to construct the viral genome cDNA clone. The top plasmid contains 2×35S (35S promoter) (SEQ ID NO: 9), Hepatitis D virus ribozyme sequence (HDV-Rz), NOS terminator, binary vector T-DNA left arm (LB) and right arm (RB), yeast multiple origin (2μ ori), yeast TRP1 autotrophic marker, bacterial multiple origin (oriV), kanamycin resistance gene (KanR), and replicase gene trfA. The bottom diagram shows that viral cDNA sequences can be inserted into the vector digested with StuI and SmaI to generate viral RNA with faithful terminal sequences by transcription. (3B) shows the pGD Agrobacterium binary vector profile used to construct the instantaneous expression vector. [Figure 4] Schematic diagram of TSWV vector construction that can express two reporter genes simultaneously. (4A) is the L antigenome cDNA cloning vector pL(+) and its RdRp coding sequence (SEQ ID NO: 4) replaced by a codon-optimized sequence (SEQ ID NO: 5), pL(+)opt. (4B) is the M genome cDNA cloning vector pM(-), and its genomic cDNA cloning vector (pM(-)RFP) and antigenome cDNA cloning vector (pM(+)RFP) replaced by the red fluorescent protein (RFP) gene, respectively. (4C) is the S antigenome cDNA cloning vector pS(+) and its derivative vector pS(+)GFP replaced by the green fluorescent protein (GFP) gene, pS(+)GFP. 2x35S: two 35S promoters; Rz: hepatitis D virus ribozyme; NOS: NOS terminator; 5' and 3': 5' and 3' noncoding regions (5'UTR and 3' UTR) of the viral genome; IGR: intergenic. [Diagram 5]This is a TSWV vector that simultaneously expresses two fluorescent reporter genes. (5A) shows the combination of Agrobacterium inoculation mixtures containing each nucleic acid construct. (5B) shows the fluorescence images of GFP and RFP in infiltrated leaves 5 days after infiltration of N. benthamiana leaves with each Agrobacterium composition and in systemically infected leaves 10 days after infiltration. (5C) shows the symptoms and fluorescence images generated by infecting N. benthamiana with the recombinant virus 10 days after inoculation. Mock: negative control without pL(+)opt in the inoculation composition. (5D) shows the expression of TSWV structural protein N, GFP, and RFP protein in systemically infected leaves infected with the virus detected by Western blot. [Figure 6] Rescue effect of each RNA silencing suppressor (VSR) on TSWV vector. (6A) shows the combination of Agrobacterium mixtures containing one or more VSRs and TWSV vector nucleic acid constructs. (6B) is a graph of the rescue efficiency of TSWV vector when expressing single or combination of VSRs. [Figure 7] Image of TSWV-Cas12a-crRNA vector construction. pL(+)opt is the L antigenome strand (sense) cDNA clone containing the codon-optimized RdRp. pM(-)Cas12a and pM(+)Cas12a are the M genome (antisense) and antigenome strand (sense) cDNA clones in which the GP gene is replaced by the Cas12a coding sequence, respectively. pS(+)crRNA:GFP is the S antigenome cDNA clone in which the NSs gene is replaced by the GFP gene and 5' is inserted into the crRNA sequence. 2x35S: two 35S promoters; Rz: Hepatitis D virus ribozyme; NOS: NOS terminator; 5' and 3'UTR: 5' and 3' non-coding regions; IGR: intergenic; m7G: mRNA cap; DR: crRNA direct repeat; guide: crRNA guide sequence. [Figure 8]Rescue system of TSWV-Cas12a-crRNA vector. (8A) shows GFP fluorescence expressed in recombinant TSWV S genome 5 days after infiltration of N. benthamiana leaves with each combination of Agrobacterium infiltration mixture. (8B) shows symptoms induced by TSWV vector obtained from pM(-)Cas12a and pM(+)Cas12a vectors. Mock: negative control without pL(+)opt construct in inoculation composition. (8C) shows Western blot images of viral N protein, GFP, and Cas12a expression in systemically infected tissues. (8D) shows the integrity of Cas12a gene in recombinant viral M genome detected by RT-PCR. The upper figure shows the design of PCR detection primers for NSm and Cas12a genes, and the lower figure shows gel electrophoresis of PCR products. (8E) is a Sanger sequencing peak diagram showing that most of the Cas12a sequence in the TSWV vector M genome rescued by pM(-)Cas12a (group 4) is deleted, with only a small amount of the 5' and 3' coding regions being retained. [Figure 9]TSWV-Cas12a-crRNA vector is infected to N. benthamiana and targeted genome editing is performed. (9A) shows the structure of N. benthamiana PDS gene and the target sequence. PDSa and PDSb represent the two PDS copies of allotetraploid N. benthamiana, and the selected crPDS1 target site is conserved in PDSa and PDSb genes. The red vertical line indicates the position of the target sequence, the underline indicates the restriction enzyme recognition sequence contained in the target sequence, and the bold alphabet indicates the PAM sequence. (9B) shows the symptoms and GFP fluorescence generated by inoculating N. benthamiana with the recombinant virus. (9C) Western blot detection of the expression of TSWV N protein, GFP, and Cas12a protein. (9D) PCR / RE detection of the editing efficiency of the crPDS1 target site. Mock / U: Healthy N. benthamiana PCR product is not digested by the restriction enzyme. Mock / D: Healthy N. benthamiana PCR products digested by restriction enzymes. Indel (%) represents the percentage of PCR products that cannot be digested by HinfI out of the total PCR products. [Figure 10] TSWV-Cas12a-crRNA virus particles are mechanically inoculated to infect multiple plants, and genome editing occurs. (10A) is a schematic diagram of the test flow. Agrobacterium is inoculated into N. benthamiana plants by infiltration to rescue the recombinant virus vector, and N. benthamiana juice containing virus particles is used as a virus source to inoculate other plants by friction or high-pressure spray, and genome editing at the target site is detected after the plants are infected. (10B) shows that the recombinant virus particles are inoculated into N. benthamiana, potato, physalis, lettuce, and cotton plants by friction, and GFP fluorescence is expressed. (10C) The expression of virus N protein, GFP, and Cas12a protein in infected systemically infected leaves of N. benthamiana is detected by Western blot. (10D) Genome editing at the PDS target site in N. benthamiana inoculated by friction is analyzed by PCR / RE. Indel (%) represents the efficiency of targeted genome editing. [Figure 11] TSWV-Cas12a-crRNA particles are infected into tobacco plants and genome editing occurs. (11A) shows the tobacco PDS gene structure diagram and target sequence. PDSa and PDSb represent the two PDS copies in allotetraploid tobacco plants, and the selected crPDS1 is conserved in tobacco PDSa and PDSb. The red vertical line indicates the position of the target sequence, the underline indicates the restriction enzyme recognition sequence contained in the target sequence, and the bold alphabet indicates the PAM sequence. (11B) shows the fluorescent images of the symptoms and systemically infected leaves 5 days after inoculation of tobacco plants with TSWV-Cas12a-crRNA particles by friction. The upper image is a mock control, and the lower image is a plant inoculated with TSWV-Cas12a-crRNA particles. (11C) Western blot analysis of the expression of viral N protein, GFP, and Cas12a protein. (11D) PCR / RE analysis of genome editing of tobacco PDS target site by friction. Indel (%) represents the frequency of targeted genome editing. [Figure 12] Tomato plants are infected with TSWV-Cas12a-crRNA virus particles and genome editing occurs. (12A) shows the tomato PDS gene structure and target sequence. The red vertical line indicates the position of the target sequence, the underline indicates the restriction enzyme recognition sequence contained in the target sequence, and the bold letters indicate the PAM sequence. (12B) shows the fluorescent images of the symptoms and systemically infected leaves generated by inoculating tomato plants with TSWV-Cas12a-crRNA particles by rubbing. Mock: inoculation buffer control. (12C) Western blot analysis of the expression of the viral N protein, GFP, and Cas12a protein. (12D) Genome editing of the tomato PDS target site by rubbing is analyzed by PCR / RE. Indel (%) indicates the frequency of targeted genome editing. [Figure 13]TSWV-Cas12a-crRNA virus particles are infected into peppers, and genome editing occurs. (13A) shows the structure of the pepper PDS gene and the target sequence, and the target site is conserved in Tabasco, paprika, and habanero. The red vertical line indicates the position of the target sequence, the underline indicates the restriction enzyme recognition sequence contained in the target sequence, and the bold alphabet indicates the PAM sequence. (13B) shows the symptoms and fluorescent images of systemically infected leaves generated by inoculating Tabasco (C. frutescens), paprika (C. annuum), and habanero (C. chinense) with virus particles by friction. The upper figure is a healthy control, and the lower figure is a virus-infected strain. (13C) shows the expression of the virus N protein, GFP, and Cas12a protein analyzed by Western blot. (13D) Genome editing of the PDS target site in Tabasco (C. frutescens) tissues infected by the virus is analyzed by PCR / RE. Indel (%) represents the targeted genome editing efficiency. (13E) Target gene mutation efficiency in Tabasco, paprika, and habanero tissues infected by the virus is analyzed by high-throughput sequencing. [Figure 14] TSWV-Cas12a-crRNA was infected into Chinese lantern plant and genome editing was induced. (14A) Fluorescence images of systemically infected leaves and symptoms induced by inoculating Chinese lantern plant with TSWV-Cas12a-crRNA particles by friction. Mock: inoculation buffer control. (14B) Expression of viral N protein, GFP, and Cas12a protein was analyzed by Western blot. (14C) shows the efficiency of systemic infection of Chinese lantern plant with the viral vector and the genome editing efficiency of the ER target site in the systemically infected tissue. [Figure 15]TSWV-Cas12a-crRNA particles are infected into peanut plants, and genome editing occurs. (15A) shows the peanut PDS gene structure and target sequence. PDSa and PDSb represent the two PDS copies in allotetraploid peanut, and crPDS4 is conserved in the two PDS copies in peanut. The red vertical line represents the position of the target sequence, the underline represents the restriction enzyme recognition sequence contained in the target sequence, and (G) is the flanking sequence adjacent to the target site, which constitutes the NdeI digest site adjacent to the target sequence. The bold letters represent the PAM sequence. (15B) shows the symptoms and fluorescence images of systemically infected leaves 5 days after inoculation of tobacco plants with virus particles by friction. The left image is a mock control, and the right image is a plant inoculated with virus particles. (15C) shows the expression of the virus N protein, GFP, and Cas12a protein analyzed by Western blot. (15D) Analysis of genome editing of peanut PDS target site by friction by PCR / RE. Indel (%) represents the efficiency of targeted genome editing. [Figure 16] Soybean is infected with TSWV-Cas12a-crRNA virus particles and genome editing occurs. (16A) shows the soybean PDS gene structure and target sequence. The red vertical line indicates the position of the target sequence, the underline indicates the restriction enzyme recognition sequence contained in the target sequence, and the bold letters indicate the PAM sequence. (16B) shows the fluorescent images 4 and 8 days after the virus particles were injected into soybean cotyledons. (16C) The expression of the viral N protein, GFP, and Cas12a protein is analyzed by Western blot. (16D) Genome editing of the soybean PDS target site by friction is analyzed by PCR / RE. Indel (%) indicates the efficiency of targeted genome editing. [Figure 17] Infection and editing efficiency of the TSWV editing vector for each paprika cultivar. (17A) Western blot analysis of the expression of TSWV N protein, GFP, and Cas12a protein in infected tissues. (17B) Systemic infection efficiency and targeted genome editing efficiency of the TSWV vector for each paprika cultivar. Each cultivar had three biological replicates. [Figure 18] Infection and editing efficiency of the TSWV editing vector for each peanut variety. (18A) shows the symptoms caused by infecting each peanut variety with the TSWV vector. (18B) detects the expression of TSWV N protein, GFP, and Cas12a protein in the infected tissues by Western blot. (18C) shows the systemic infection efficiency and targeted genome editing efficiency of the TSWV vector for each peanut variety. Each variety has three biological replicates. [Figure 19] The TSWV-Cas12a-crRNA multi-target editing vector simultaneously edits multiple target genes. (19A) shows a schematic diagram of the multi-target vector expressing multiple crRNAs. S1, S2, and S3 are Spacer 1, Spacer 2, and Spacer 3 sequences. DR is direct repeat. UTR is viral non-coding region. Red arrows indicate Cas12a cleavage sites, which generate one or more mature crRNAs. (19B) shows the symptoms generated by infecting N. benthamiana with TSWV single-target and multi-target editing vectors. (19C) shows that the editing efficiency generated at each target site of the multi-target editing vector is similar to that of each site of the single-target vector. ns means no significant difference (n = 6 biological replicates, two-tailed Student's t-test). [Figure 20]Schematic diagram of TSWV-Cas9-gRNA expression vector construction. pL(+)opt is an L antigenome strand (sense) cDNA clone containing codon-optimized RdRp (SEQ ID NO: 5). pM(-)Cas9 and pM(+)Cas9 are M genome (antisense) and antigenome (sense) cDNA clones in which the GP gene is replaced by the Cas9 coding sequence, respectively. pS(+)RFP:gRNA is an S antigenome cDNA clone in which the NSs gene is replaced by the RFP gene and the 5' is inserted into the gRNA sequence. When the virus replicates and transcribes, the RFP and gRNA fusion sequences in the S genome are transcribed into mRNA, the Cas9 protein expressed in the M genome binds to the gRNA sequence, and the plant endogenous RNA enzyme processes and removes the extra sequences at both ends. 2x35S: two 35S promoters; Rz: hepatitis D virus ribozyme; NOS: NOS terminator; 5' and 3'UTR: 5' and 3' non-coding regions; IGR: intergenic; m7G: mRNA cap; scaffold: gRNA scaffold sequence (crRNA and tracrRNA); guide: gRNA guide sequence. [Figure 21] Comparison of the efficiency of pM(-)Cas9 and pM(+)Cas9 constructs to rescue recombinant TSWV-CRISPR / Cas9 vectors. [Figure 22] TSWV-Cas9-gRNA vector edits the GFP gene recombination in N. benthamiana. (22A) shows the symptoms and fluorescence images generated by infecting N. benthamiana 16C with the recombinant virus. (22B) shows the expression of TSWV N protein, RFP, GFP, and Cas9 detected by Western blot. (22C) shows the editing efficiency of the GFP gene target site detected by PCR / RE method. Indel (%) represents the target genome editing efficiency. (22D) shows the editing of the target sequence verified by Sanger sequencing. wt: wild type; d#: # base deletion; ×#: # clones. [Figure 23]The TSWV-Cas9-gRNA vector edits the N. benthamiana PDS target site. (23A) is the N. benthamiana PDS gene structure diagram and target sequence. PDSa and PDSb represent the two PDS copies of allotetraploid N. benthamiana, and the selected gPDS1 is conserved in PDSa and PDSb. The red vertical line represents the position of the target sequence, the underline represents the restriction enzyme recognition sequence contained in the target sequence, and the bold alphabet represents the PAM sequence. (23B) is a symptom diagram generated by inoculating N. benthamiana with the recombinant virus. (23C) is the expression of TSWV structural protein N and Cas9 protein detected by Western blot. (23D) is the editing efficiency of the PDS target site detected by PCR / RE method. Mock / U: Healthy N. benthamiana PCR product is not digested by restriction enzyme. Mock / D: Healthy N. benthamiana PCR product is digested by restriction enzyme. [Figure 24] TSWV-Cas9-gRNA virus particles are infected into tobacco plants, and genome editing occurs. (24A) shows the tobacco PDS gene structure and target sequence. The selected gPDS1 is conserved in the two copies of PDSa and PDSb of allotetraploid tobacco. The red vertical line indicates the position of the target sequence, the underline indicates the restriction enzyme recognition sequence contained in the target sequence, and the bold alphabet indicates the PAM sequence. (24B) is a photograph generated by inoculating TSWV-Cas9-gRNA particles into tobacco plants by friction. (24C) The expression of the viral N protein and Cas9 protein is analyzed by Western blot. (24D) The genome editing efficiency of the tobacco PDS target site by friction is analyzed by PCR / RE. Indel (%) indicates the target genome editing efficiency. [Diagram 25]The TSWV-Cas9-gRNA multi-target editing vector simultaneously edits multiple target genes. (25A) shows a schematic diagram of the multi-target editing vector expressing multiple sgRNAs. S1, S2, and S3 are the Spacer1, Spacer2, and Spacer3 sequences. Scaffold is the sgRNA backbone sequence. UTR is the viral non-coding region. It is embedded in the viral mRNA, and processing of the gRNA depends on the binding of the Cas9 protein, while the plant's endogenous RNA enzyme processes and removes the extra sequences at both ends. (25B) shows the symptoms generated by infecting Nicotiana benthamiana with the TSWV-Cas9-gRNA single-target and multi-target editing vectors. The histogram in (25C) shows that the editing efficiency generated at each target site of the multi-target editing vector is similar to that of the single-target vector at each site. ns means no significant difference (n = 3-6 biological replicates, two-tailed Student's t-test). [Figure 26] Schematic diagram of TSWV-ABE-gRNA expression vector construction. pL(+)opt is the L antigenome strand (sense) cDNA clone containing the codon-optimized RdRp (SEQ ID NO: 5). pM(+)ABE is the M antigenome strand (sense) cDNA clone in which the GP gene is replaced by the ABE coding sequence. pS(+)GFP:gRNA is the S antigenome cDNA clone in which the NSs gene is replaced by the GFP gene and 3' is inserted into the gRNA sequence. 2x35S: two 35S promoters; Rz: Hepatitis D virus ribozyme; NOS: NOS terminator. [Figure 27]The TSWV-ABE-gRNA vector edits the endogenous gene target site in N. benthamiana. (27A) is a diagram of the symptoms and GFP fluorescence generated by infecting N. benthamiana with the recombinant virus. (27B) is the expression of TSWV structural protein N, GFP, and base editor detected by Western blot. (27C) is the histogram showing the base editing efficiency of PDSa, FucTa, and BBLd target sites detected by high-throughput sequencing. (27D) is the histogram showing the substitution efficiency of bases A to G (or T to C) in the base editing window of the target site detected by high-throughput sequencing. [Figure 28] Schematic diagram of TSWV-CBE-gRNA expression vector construction. pM(+)CBE is the M antigenomic strand (sense) cDNA clone in which the GP gene is replaced by the CBE coding sequence. 2×35S: two 35S promoters; Rz: Hepatitis D virus ribozyme; NOS: NOS terminator. [Figure 29] The TSWV-CBE-gRNA vector edits the endogenous gene target site in N. benthamiana. (29A) is a diagram of the symptoms and GFP fluorescence generated by inoculating N. benthamiana with the recombinant virus. (29B) is a Western blot showing the expression of TSWV structural protein N, GFP, and base editor. (29C) is a histogram showing the base editing efficiency of the RDR6a and FucTa target sites detected by high-throughput sequencing. (29D) is a histogram showing the substitution efficiency of base C to T (or G to A) in the base editing window of the target site. [Diagram 30]Mutant plants were regenerated by tissue culture from N. benthamiana cells infected with TSWV-Cas12a-crRNA. (30A) The upper leaves of N. benthamiana infected with TSWV-Cas12a-crRNA were selected as explants and tissue cultured, followed by dedifferentiation and rooting to obtain regenerated seedlings. The red circle indicates one albino seedling in which the PDS has lost its function. (30B) and (30C) show the detection of genome editing of the PDS target site in three regenerated plants (M0-1 / -2 / -3) by PCR / RE and Sanger sequencing, respectively. M0-3 is an albino seedling. wt: wild type; d#: # base deletion. [Diagram 31] Mutant plants were regenerated by tissue culture from transgenic N. benthamiana cells infected with TSWV-Cas9-gRNA vector. (31A) shows three regenerated plants and GFP fluorescence image. (31B) shows the genotypes of the gGFP site of three regenerated plants determined by Sanger sequencing. Italic letters indicate base insertion. "-" indicates base deletion. Bold letters indicate PAM sequence. i1: 1 base insertion; d1: 1 base deletion. [Diagram 32] Mutant plants were regenerated by tissue culture from tomato cells infected with TSWV-Cas12a-crRNA. (32A) shows that after 3 weeks of tissue culture, excised leaves induce callus and differentiate to form shoots (red circles). (32B) shows the etiolated callus (upper panel) and regenerated plants that induce rooting (lower panel). (32C) shows the genome editing of the PDS target site of five regenerated plants analyzed by PCR / RE. (32D) shows the genotype of the PDS target site of five regenerated plants (M0-1 / -2 / -3 / -4 / -5) identified by Sanger sequencing. wt: wild type; d#: # base deletion. [Diagram 33] This is an experimental flow chart showing how treatment with an antiviral drug promotes virus eradication in regenerated strains. [Diagram 34]The virus elimination effect of antiviral drugs on regenerated seedlings. (34A) shows the results of virus RT-PCR detection in regenerated plants. The presence of the virus was detected using a specific primer for TSWV N, and the endogenous Actin primer for N. benthamiana was used as the internal reference. The histogram in (34B) shows the virus elimination rate when treated with each drug. [Diagram 35] The effect of antiviral drug treatment on the editing efficiency of regenerated seedlings. (35A) shows the expression of N. benthamiana regenerated seedlings. Some regenerated seedlings show an albino phenotype due to knockout of four alleles of PDS (N. benthamiana is an allotetraploid). (35B) shows the histograms showing the percentage of each mutation type in regenerated seedlings treated with each drug. The mutation type of the target gene was determined by high-throughput sequencing of PCR amplicons of the target site region sequences of PDS-A and PDS-B genes. The genotypes of PDS-A and PDS-B of N. benthamiana are designated according to the following definitions. The editing efficiency (indels%) of 0-10.0% is wild type (Wildtype, WT). The editing efficiency of 10% < indels% ≦ 35.0% is chimeric mutation (Chimeric, Chi). 35.0% < indels% ≦ 80.0% is a heterozygous mutation (He), i.e., one allele has an edit at the target site, but the other allele is wild type. For editing efficiencies between 80.0% and 100.0%, if the same type of edit occurs in the two alleles, it is a homozygous mutation (Ho), and if two types of edit occur in the two alleles, it is a biallelic mutation (Bi). [Diagram 36]Genetic analysis of the segregation of phenotypes of the progeny of regenerants. (36A) shows the segregation ratio of the progeny phenotypes of two regenerants containing PDS gene mutations. The segregation ratio of green seedlings:albino seedlings is 15:1 for RB-#54 (-20 / wt; -10 / wt), and the segregation ratio of RD-#76 (-11 / -12; -11 / -14) is 3:1. (36B) shows the segregation ratio and statistical analysis of the phenotypes of the M1 progeny of the regenerated M0 line. Although the M0 line has two mutations in the PDS-A and PDS-B genes, the line still phenotypes green because of the presence of at least one wild-type allele or non-frameshift mutation (-6, -9, -12; noted in blue letters) in the allele. Albino seedlings were generated by the segregation of the M1 progeny by self-pollination of these M0s. x2 P value was obtained by chi-square test, and P value > 0.5 indicates that the actual value of the segregation ratio is consistent with the theoretical value of the segregation ratio. [Figure 37] Mutant lines were regenerated by tissue culture from tobacco cells infected with TSWV-Cas12a-crRNA. (37A) shows regenerated tobacco seedlings in rooting medium. (37B) shows the ratio of lines containing edits in each group to the total number of lines in each group. Lines were analyzed for edits by including HTS of PCR amplicons of target site region sequences in NtPDS-A and NtPDS-B homologs. Indels<=10% were recognized as wild type, and indels>10% were recognized as edited lines. (37C) shows the ratio of each mutant genotype in M0 lines in each group. [Figure 38]The rescue efficiency of TSWV-Cas9-gRNA vector containing NSs gene is reduced and affects the line regeneration. (38A) shows the construct in which M genome contains gRNA insertion and NSs gene is retained (pS(+)NSs:gPDS1) or replaced by RFP (pS(+)RFP:gPDS1). (38B) shows almost the same symptoms expressed by infecting N. benthamiana with TSWV-Cas9-gRNA with / without NSs gene. (38C) shows the considerable targeted genome editing efficiency generated in the systemically infected tissue. (38D) shows that the rescue efficiency of recombinant virus vector is obviously reduced by the presence of NSs gene. (38E) shows that inoculation of N. benthamiana with recombinant TSWV particles with / without NSs by friction has almost the same infection rate. (38F) shows that N. benthamiana cells infected with TSWV-Cas9-gRNA vector containing NSs gene cannot regenerate. N. benthamiana leaf tissue infected with an editing vector containing NSs undergoes necrosis during tissue culture regeneration, whereas a viral vector lacking NSs has no effect on regeneration. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0080] Before describing at least one embodiment of the present invention in detail, it is to be understood that the invention is not limited in its application to that set forth in the following specification or illustrated by the examples. The invention may have other embodiments or be practiced or completed in various forms. Also, it is to be understood that the words and terminology used herein are for the purpose of description and not of limitation.

[0081] The following definitions and methods are provided to more precisely define the present invention and to guide those skilled in the art to practice the present invention. Unless otherwise specified, scientific and technical nouns used herein have the meanings commonly understood by those skilled in the art. In addition, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and virology related terms and laboratory operation steps used herein are terms and common steps widely used in the corresponding fields. For example, standard recombinant DNA and molecular cloning techniques used in the present invention are familiar to those skilled in the art and are more fully described in the following literature: Michael R. Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual (4th edition); Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 2012. In addition, in order to more precisely understand the present invention, the following provides definitions and interpretations of related terms.

[0082] definition The terms "comprise," "comprise," "contain," "have" and their cognates mean "including, but not limited to." The scope of this term encompasses the scope of the terms "consisting of" and "consisting essentially of."

[0083] The phrase "consisting essentially of" means that the compositions and methods may include other components and / or steps as long as they do not materially alter the basic and novel characteristics of the claimed composition or method.

[0084] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include multiple compounds, including mixtures thereof.

[0085] In the present invention, the term "plant" includes the whole plant, any progeny, plant parts that make up the plant, etc., including, but not limited to, plant cells, plant cell cultures, plant tissues, plant tissue cultures, plant cuttings, plant organs (e.g., pollen, embryos, flowers, fruits, buds, leaves, roots, stems, related explants), plant seeds (e.g., mature seeds, immature seeds, immature embryos without seed coats), etc. Plant cells may be in the form of isolated single cells or cell aggregates (e.g., callus, cells being cultured), protoplasts, cells from which gametes are developed, or cells or cell aggregates that can be regenerated into complete plants. Plant cell cultures or tissue cultures can be regenerated into plants having plant physiological or morphological characteristics derived from the cells or tissues, and can be regenerated into plants having substantially the same genotype as the plants. The regenerable cells in plant cell cultures or tissue cultures may be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, filaments, flowers, acorns, panicles, cobs, husks, stems. Plant parts include harvestable parts and parts of progeny plants available for propagation. Plant parts available for propagation include, but are not limited to, for example, seeds, fruits, cuttings, seedlings, tubers, and rhizomes. Harvestable parts of a plant may be any useful part of the plant, including, but are not limited to, for example, flowers, pollen, seedlings, tubers, leaves, stems, fruits, seeds, and roots.

[0086] The term "plant cell" refers to the structural and physiological unit of a plant. As used herein, plant cell includes protoplasts, protoplasts with partial cell wall. A plant cell may be in the form of an isolated single cell or a cell aggregate (e.g., soft callus, cultured cells), or may be part of a higher tissue unit (e.g., plant tissue, plant organ, plant). Thus, a plant cell may be a protoplast, a cell from which gametes are developed, or a cell or a collection of cells that can regenerate into a complete plant. Thus, in embodiments herein, a seed that contains a plurality of plant cells and can regenerate into a complete plant is considered a "plant part." A plant "progeny" includes any subsequent generation of a plant.

[0087] The terms "variety," "line," "cultivar," "germplasm," and "genotype" are used interchangeably in the present invention and refer to a plant variety of the same classification species, whose genetic combination and phenotype have stable characteristics that can be distinguished from other plant varieties.

[0088] A "gene" is any nucleotide sequence necessary to produce a single polypeptide chain or functional RNA.

[0089] The term "genome", when used in reference to a plant cell, includes not only chromosomal DNA present in the cell nucleus, but also organelle DNA in sub-organellar components present in the cell (e.g., mitochondria, plastids). "Polynucleotide", "nucleic acid sequence", "nucleotide sequence" and "nucleic acid fragment" are used interchangeably and refer to single- or double-stranded RNA or DNA polymers, which may optionally contain synthetic, non-natural or modified nucleotide bases. Nucleotides are designated by single alphabetical letters as follows: "A" stands for adenosine or deoxyadenosine (corresponding to RNA or DNA, respectively); "C" stands for cytidine or deoxycytidine; "G" stands for guanosine or deoxyguanosine; "U" stands for uridine; "T" stands for thymidine; "I" stands for inosine; "R" stands for purine (A or G); "Y" stands for pyrimidine (C or T); "K" stands for G or T; "H" stands for A or C or T; and "N" stands for any nucleotide.

[0090] The term "genetic material" refers to DNA, which transmits genetic information between parent and offspring generations.

[0091] The term "sequence" refers to a sequence of nucleotides of any length, which may be DNA or RNA, which may be linear, circular or branched, and which may be single-stranded or double-stranded.

[0092] The term "expression" refers to the conversion of sequence information into a corresponding expression product, which includes either the direct transcription product (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozymes, structural RNA, or any other type of RNA) or a protein generated by translation of an mRNA. Expression products also include RNA that has been modified, for example, by capping, adenylation, methylation, and proteins that have been modified, for example, by methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation, glycosylation.

[0093] The term "code" refers to a DNA polynucleotide sequence that can be transcribed into RNA (mRNA) that translates a protein, or a DNA polynucleotide sequence that can be transcribed into RNA that does not translate a protein (non-coding RNA such as tRNA, rRNA, etc.), or an RNA polynucleotide sequence that can be translated into a protein.

[0094] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein and refer to a polymer of amino acid residues.

[0095] A "fusion protein" is a polypeptide chain generated by linking and expressing genes encoding two or more polypeptides, and the polypeptide chains may be linked by a specific linker peptide.

[0096] "Codon optimization" refers to the replacement of one or more codons in a coding sequence with synonymous codons to improve the expression level of a target protein in a particular host cell. Since all organisms exhibit some degree of codon usage differences or preferences, infrequently used or rare codons in a target gene are replaced with preferred codons of the target organism without changing the amino acids to improve the expression level of the gene in the target organism. In addition, the targets of codon optimization further include polyadenylation sites suspected to be inactivated, exon-intron splice sites, sequences capable of forming secondary structures, balanced GC content, etc., to improve the expression level of the gene at the transcriptional level. "Codon optimization" is a common gene design tool, and there are existing patents and computer programs disclosed in the field for optimizing gene codons to be expressed in a particular plant species. For example, codon optimization software provided by several nucleic acid synthesis companies, the codon usage database available at www.kazusa.orjp / codon / ("Codon Usage Database"), U.S. Patents 881,224,7 (Method for achieving improved polypeptide expression) and 8224578 (Method and device for optimizing a nucleotide sequence for the purpose of expression of a protein), and references by Murray et al. (Nucleic Acids Res 1989, 17:477-497) and Nakamura et al. (Nucleic Acids Res, 2000, 28: 292) can be mentioned.

[0097] A "homology" or "identity" percentage describes the degree of similarity in sequence (e.g., nucleotide or amino acid) alignment of polynucleotide or polypeptide segments. A sequence alignment can be obtained by manually aligning two sequences, e.g., a reference sequence provided herein and another sequence, to maximize occurrence of matching elements, e.g., individual nucleotides or amino acids, although cuts may be introduced into any sequence. The "homology score" of a sequence aligned with a reference sequence is determined by dividing the number of matching elements by the total length of the reference sequence, not including the cuts introduced into the reference sequence in the alignment process. As used herein, "percentage identity" ("% identity") is determined by multiplying the identity score by 100.

[0098] As used herein, a "recombinant" nucleic acid is a non-naturally occurring nucleic acid, e.g., a combined nucleic acid fragment with a desired function, generated by the artificial joining of two otherwise separate nucleic acid fragments. This artificial combination is usually accomplished by means of chemical synthesis or by the artificial manipulation of separate segments of nucleic acid (e.g., genetic engineering techniques).

[0099] As used herein, the term "chimeric sequence" as applied to a nucleic acid or polypeptide is a combination by artificial means of two or more sequences of different origin into one recombinant sequence, or a regulatory sequence and a nucleotide sequence of interest which are of the same origin but arranged in a manner different from that generally found in nature.

[0100] The terms "heterologous" and "foreign" are used interchangeably herein and refer to a nucleotide or polypeptide sequence that is not present in a naturally occurring nucleic acid or protein. A heterologous nucleic acid sequence may be linked (e.g., by genetic engineering means) to a naturally occurring nucleic acid sequence (or a variant thereof) to generate a chimeric nucleic acid sequence.

[0101] The term "vector" refers to an autonomously replicable nucleic acid molecule, such as a plasmid, phage, virus or cosmid, that transfers foreign nucleic acid fragments to recipient cells in genetic engineering techniques.

[0102] The terms "nucleic acid construct" and "recombinant vector", "recombinant nucleic acid construct" or "recombinant expression vector" are used interchangeably herein and include vectors and at least one inserted DNA molecule, and further include functional RNA molecules generated by transcription of these constructs or RNA equivalents chemically synthesized from the nucleic acid construct sequence. Typically, the nucleic acid construct is a recombinant expression vector generated to express and / or propagate an insert or to construct other recombinant nucleic acid sequences. The inserted DNA molecule is operably or inoperably linked to a promoter sequence and operably or inoperably linked to a DNA regulatory sequence.

[0103] The term "regulatory sequence" refers to specific nucleic acid sequences present within or flanking (5' or 3' end) sequences of a coding sequence to regulate transcription, RNA processing or stability, translation, etc. Regulatory sequences include, but are not limited to, promoters, enhancers, introns, transcriptional regulatory elements, polyadenylation signals, RNA processing signals, translational enhancer elements, etc.

[0104] The term "operably linked" refers to the linkage between regulatory elements (e.g., but not limited to, promoter sequences, transcription termination sequences, etc.) and a nucleic acid sequence (e.g., a coding sequence or an open reading frame) such that the transcription and translation of the nucleotide sequence is controlled and regulated by said regulatory elements.

[0105] A "promoter" as used in the present invention is a DNA regulatory region capable of binding RNA polymerase and initiating transcription of a downstream (3' direction) coding or non-coding sequence, a nucleic acid fragment capable of controlling the transcription of another nucleic acid fragment. In some embodiments of the present invention, the promoter is a promoter capable of controlling the transcription of a downstream gene in a plant cell, whether derived from a plant cell or from a virus. The promoter may be a constitutive promoter, a tissue-specific promoter, a developmentally regulated promoter, or an inducible promoter.

[0106] "Introducing" or "incorporating" into a plant refers to transforming a nucleic acid molecule (e.g., a plasmid, a linear nucleic acid fragment, RNA, etc.) or protein into a plant cell by methods including, but not limited to, Agrobacterium transformation, biolistic bombardment, electroporation, PEG-mediated transformation, etc., thereby allowing the nucleic acid or protein to function in the plant cell.

[0107] "Agroinfiltration" is a method of inducing gene expression in plants in plant biology. In this method, a suspension of Agrobacterium tumefaciens is injected into the leaves of a plant, and the target gene in the binary plasmid transfer DNA (T-DNA) is transferred to the inside of the plant cell by the Agrobacterium present in the intercellular space, and is instantly expressed. The Agrobacterium infiltration method can be applied to various plants, but is particularly effective in Nicotiana benthamiana and Nicotiana tobacco.

[0108] "Agroinfection" or "Agroinoculation" is a method of inoculating plants with an infectious element (e.g., a virus or viroid) by the crown gall pathogen. Viral (or viroid) DNA or cDNA sequences are cloned into the T-DNA region of an Agrobacterium binary plasmid and transferred to plant cells by Agrobacterium infection. The virus (or viroid) replicates intracellularly, usually leading to systemic infection and symptom development.

[0109] The term "instantaneous expression" refers to the introduction of a foreign nucleic acid sequence into a plant cell, tissue, organ or individual by methods such as Agrobacterium infiltration, gene gun bombardment, viral vector infection, PEG-mediated protoplast transformation, etc., where the foreign nucleic acid sequence may or may not be integrated into the plant chromosome, and the foreign nucleic acid fragment can maintain expression at the site of introduction for a certain period of time.

[0110] A "viral infectious clone" is a nucleic acid construct or plasmid containing viral sequences that, when introduced into a suitable host cell, can rescue a viable recombinant virus.

[0111] The term "viral rescue" refers to the process of introducing a viral infectious DNA or cDNA clone into a suitable host cell and generating an infectious virus.

[0112] As used herein, a "recombinant virus" is a virus that has been generated by recombinant DNA technology. Unlike naturally occurring wild-type viruses, the sequence of a recombinant virus can be artificially modified by recombinant DNA technology.

[0113] As used herein, the terms "viral vector", "recombinant viral vector", "recombinant viral expression vector" and "recombinant viral vector system" are used interchangeably herein and refer to viruses that have been genetically modified in a laboratory environment for the purpose of introducing heterologous nucleic acid sequences into a host cell, tissue, organ or individual.

[0114] In some embodiments, the viral vector system may be a composition of one or more recombinant nucleic acid constructs or recombinant viral vectors, which can replicate, transcribe and express heterologous sequences after being introduced into a host cell. In some embodiments, the system may be a combination of bacterial strains each containing different nucleic acid constructs or viral vectors, preferably the bacterial strain is Agrobacterium. In other embodiments, the viral vector system may further be a genetically engineered viral particle.

[0115] The term "virion" refers to the infectious form of a virus structure that includes a genomic nucleic acid core and a capsid, which may or may not include an outer envelope. As used herein, "virion" includes infectious viral nucleocapsid particles that lack an envelope.

[0116] Viral "sense strand" RNA and "antisense strand" RNA refer to the polarity of messenger RNA (mRNA), with the synonymous mRNA being "sense strand" RNA and the complementary being "antisense strand" RNA. For negative-strand RNA viruses, as the name suggests, the genomic RNA coated by the virus particles is the antisense strand RNA, also called virion RNA (vRNA). Conversely, the complementary sense strand RNA is also called complementary RNA (cRNA) or antigenomic RNA (agRNA).

[0117] In the present invention, "genetic modification", "gene modification", "nucleic acid modification" and "genome editing" refer to modifying the genome of an organism by biotechnological means to change the structure or composition of the genome sequence, such as altering the sequence of a gene, including the deletion, substitution or insertion of single or multiple deoxynucleotides, or any combination of the above methods, and generating heritable epigenetic modifications, such as DNA methylation, histone modification, etc.

[0118] A "genetically modified plant" is a plant that has been modified by genetic engineering means to incorporate single or multiple deoxynucleotide insertions, deletions, substitutions, or any combination of the foregoing, into its genome, including those that allow for stable inheritance of the modified gene sequence.

[0119] As used herein, a "nucleic acid modifying enzyme" refers to an enzyme that can specifically target and modify the structure or composition of a cellular nucleic acid sequence, e.g., modifying the sequence of a gene, including single or multiple deoxynucleotide deletions, substitutions, insertions, or any combination of the above, resulting in heritable epigenetic modifications, e.g., DNA methylation, histone modifications, etc.

[0120] The terms "sequence-specific endonuclease," "endonuclease," "nuclease," and "nucleic acid modifying enzyme" are used interchangeably herein and are enzymes that have an activity utilized to degrade or modify nucleic acids.

[0121] The terms "Cas nuclease," "CRISPR nuclease," "CRISPR / Cas protein," "Cas protein," and "Cas effector" are used interchangeably herein and include a Cas protein or fragment thereof (e.g., a protein that includes an active Cas DNA cleavage domain and / or a Cas guide RNA binding domain) and are RNA-guided nucleases. Cas proteins are the protein components of the CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats and Related Systems) genome editing system and can target and cleave DNA target sequences guided by a guide RNA to form double- or single-stranded DNA breaks.

[0122] The terms "guide RNA", "gRNA" and "sgRNA" are used interchangeably herein and refer to an RNA molecule that binds to a nuclease and guides the nuclease to target a specific site in the genome. The guide RNA contains a nucleotide sequence that has sufficient complementarity with a target sequence to hybridize with the target sequence, and a nucleotide sequence that binds to a Cas protein to form a CRISPR / Cas complex. In the CRISPR / Cas9 nuclease system, the guide RNA is usually an RNA binary complex molecule formed by hybridization of a partially complementary CRISPR RNA (crRNA) and a trans-acting CRISPR RNA (tracrRNA), or a single gRNA molecule formed by artificially linking the two RNA molecules. In the CRISPR / Cas12a nuclease system, the guide RNA does not require a tracrRNA molecule and is composed of only the crRNA.

[0123] "Base editing" is a technique for editing specific bases in a cell's nucleic acid molecules, for example by using a sequence-specific nucleic acid modifying enzyme to deaminate single or multiple bases in a target DNA or RNA molecule of a cell, and then converting the deaminated modified bases into other bases by the cell's endogenous DNA replication and repair pathways, for example, converting cytosine to thymine or guanine, or adenine to guanine.

[0124] A "base editor" is a reagent that can specifically target and modify nucleotide (e.g., DNA or RNA) bases (e.g., A, C, G, T, or U) and convert the modified bases. Depending on the base that it modifies, it can be classified as an adenine base editor (ABE), a cytosine base editor (CBE), etc. Typically, a "base editor" is a fusion protein composed of Cas9 nickase (nCas9) or Cas9 without nuclease activity (nuclease dead Cas9, dCas9), a base deamination enzyme, and other effectors, and is guided by a guide RNA to target a specific nucleic acid sequence and catalyze a base deamination reaction, so that the deaminated base is converted to another base by the cell's endogenous DNA replication and repair pathways.

[0125] The term "protospacer adjacent motif sequence (PAM)" refers to a nucleic acid sequence in a DNA target sequence region that is recognized by a corresponding Cas nuclease and plays an important role in cleavage of the target DNA by the Cas nuclease guided by a guide RNA.

[0126] As used herein, a "target DNA" is a DNA polynucleotide that includes a "target site" or a "target sequence." The terms "target site," "target sequence," and "protospacer DNA" are used interchangeably herein and include a nucleic acid sequence in which a target DNA fragment in a genome can bind to a guide RNA in the present invention.

[0127] Plant genome editing system The present invention discloses a method for delivering sequence-specific nucleic acid modifying enzymes using broad-spectrum plant RNA virus vectors for plant genome editing, specifically including but not limited to the method of applying the virus vector system to the delivery of genome editing elements and the modification of plant genetic material. An engineered infectious virus vector is for carrying a sequence-specific nucleic acid modifying enzyme nucleic acid sequence, and the virus vector is infected into a plant, and then the sequence-specific nucleic acid modifying enzyme is expressed in the cell. The nucleic acid modifying enzyme targets a specific site in the plant genome and cuts or modifies it to generate DNA double-strand breaks or base modifications, and the endogenous DNA repair mechanism of the cell completes the modification of the genetic material of the plant cell, generating one or more combinations of mutations due to base deletion, insertion, and substitution.

[0128] Sequence-specific nucleases commonly used in genome editing include meganucleases, zinc finger nucleases, transcriptionally active element-like effector nucleases, and CRISPR / Cas nucleases. Meganucleases, zinc finger nucleases, and transcriptionally active element-like effector nuclease systems specifically target DNA sites using the DNA binding domain of the nuclease protein, whereas the CRISPR / Cas nuclease system uses a single short guide RNA to guide the Cas protein to identify the target sequence, so there is no need to assemble multiple DNA binding units, and cleavage at the target site can be achieved simply by introducing the Cas protein and guide RNA into the cell, making it the most widely applied genome target editing system.

[0129] CRISPR / Cas systems are classified into two types and five types (I to V) according to the number and function of Cas genes. The second type, type II and type V systems, are the easiest to use as engineered genome editing tools, and only require a single Cas effector. Type II CRISPR systems include the CRISPR / Cas9 system, such as the SpCas9 system derived from Streptococcus pyogenes and the SaCas9 system derived from Staphylococcus aureus, which include Cas9 protein, crRNA, and tracrRNA. A part of the complementary sequence of crRNA and tracrRNA hybridizes to form double-stranded RNA, and the structure is cleaved by the cell's endogenous double-stranded RNA enzyme, leading to the processing and maturation of crRNA. At the same time, crRNA and tracrRNA hybridize to form a binary complex, which binds to the Cas9 protein and guides the latter to target the target DNA sequence paired with the crRNA protospacer. The engineered genome editing CRISPR / Cas9 nuclease system links crRNA and tracrRNA to form a single guide RNA (sgRNA or gRNA). The guide RNA contains a sequence structure that binds to Cas9 and a protospacer that pairs with the target DNA. The V-type CRISPR / Cas system includes CRISPR / Cas12a (also called Cpf1), such as AsCas12a, LbCas12a, and FnCas12a from Acidaminococcus, Lachnospiraceae, and Franisella novicida, and these homologous proteins have the activity of RNA-guided DNA endonuclease. The CRISPR / Cas12a nuclease system only requires a single guide RNA, i.e., crRNA, and does not require the involvement of tracrRNA. The crRNA contains a sequence that binds to Cas12a and a protospacer sequence that pairs with the target DNA.In addition, Cas12a has its own cRNA processing activity and cleaves transcription units containing multiple crRNA sequences to generate multiple guide RNAs, making it easier to precisely process crRNA and achieve multi-target editing by simultaneous expression of multiple crRNAs (Fonfara et al., Nature, 2016, 532: 517-521; Zetsche et al., Nat Biotechnol, 2017, 35: 31-34).

[0130] Methods for designing CRISPR / Cas9 or CRISPR / Cas12a nucleases to perform genome editing have been disclosed in the literature (Jinek et al., Science, 337: 816-821; Cong et al., Science, 2013, 339: 819-823; Zetsche et al., Cell, 2015, 63: 759-771), and SpCas9 and LbCas12a amino acid sequences can be obtained by searching the SwissProt database (accession numbers Q99ZW2 and 5ID6_A). In brief, the guide RNA sequence determines the target specificity, so the gene target of the Cas nuclease can be changed simply by changing the target sequence (protospacer) in the gRNA. Typically, one or more specific protein localization signals are fused to one or both ends of the Cas protein, such as the nuclear localization signal NLS, which transports the Cas protein and guide RNA complex to a specific organelle (e.g., the cell nucleus) to function. When the Cas protein and an engineered guide RNA are co-introduced or co-expressed in a cell, the Cas protein and guide RNA form a complex and are guided by the guide RNA to bind to a target site in the genome, and one or two DNA strands of the target sequence are cleaved by the Cas protein. The damage to the cleaved DNA strand is repaired by the non-homologous end joining (NHEJ) repair mechanism in the cell, and the two cleaved ends are joined together, but the repair mechanism is prone to cause deletion, insertion, or substitution of bases at the junction.

[0131] When a recombination template of foreign DNA is provided to a cell in which a double-stranded DNA break has occurred, and the broken DNA ends are repaired by a homologous recombination (HR) mechanism, the designed sequence may be incorporated into the genome by the repair template. The recombination template may be linear or circular single-stranded or double-stranded DNA, and may contain sequences (homology arms) that are homologous to both sides of the target sequence of the genome cleaved by a nuclease, and the length of the homology arms is 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 nucleotides or more. When DNA breaks are generated by cleaving a target gene of the genome with a nuclease, the released DNA ends are mediated by the homology sequence, and DNA synthesis is performed using the foreign DNA as a template, thereby incorporating the pre-designed foreign sequence into the target site.

[0132] In some embodiments, the present invention utilizes CRISPR / LbCas12a nucleases to perform plant genome editing, while in other embodiments, the present invention utilizes CRISPR / SpCas9 nucleases to perform plant genome editing.

[0133] Cas fusion proteins may also contain one or more heterologous effector domains, and in the ideal situation, the two domains are linked by a linker sequence. Protein domains that can be fused to Cas proteins include, but are not limited to, antigen epitope tags (e.g., HA, His, Flag, myc), reporter proteins (green fluorescent protein, β-glucuronidase, luciferase), DNA methylase, transcription activation domain, transcription repression domain, histone modification enzyme, DNA topoisomerase, DNA recombinase, cytosine deaminase, uracil glycosylase suppressor, adenine deaminase, DNA polymerase, reverse transcriptase, etc. Cas protein DNA endonuclease domains are inactivated by mutation, but retain the ability to form a complex with guide RNA and target specific DNA sequences in the genome. For example, when an amino acid mutation is introduced into the RuvC or HNH domain active site of the Cas9 protein, such as a mutation of aspartic acid 10 to alanine (D10A), or histidine 840 to alanine (H840A), or asparaginate 854 to alanine (N854A), or asparaginate 863 to alanine (N863A), a nCas9 mutant protein is generated that can only cleave a single strand, i.e., it becomes a nickase. When the RuvC and HNH domain active sites are mutated simultaneously, the generated dCas9 mutant loses the ability to cleave DNA. The dCas9 or nCas9 protein can be fused to the specific effector domain and, guided by guide RNA, can be used for localization of genomic sequences, DNA modification (cytosine methylation, adenine base editing, cytosine base editing, etc.), transcriptional regulation (activation, repression, histone modification, etc.), DNA recombination, DNA synthesis, etc. (Anzalone et al., Nat Biotechnol, 2020, 38: 824-844).

[0134] Base editors include nuclease-inactivated Cas proteins (e.g., Cas9 and Cpf1), DNA-dependent base deamidates, such as cytosine deaminase and adenine deaminase. Cytosine deamidates are natural or engineered deamidates, such as apolipoprotein B human cytosine deaminase 3A (human APOBEC3A, hA3A). Natural adenine deamidates usually use RNA as a substrate and convert adenosine in single-stranded RNA to inosine (I) by deamination. Recently, by directed evolution, a DNA-dependent adenine deaminase was obtained based on Escherichia coli tRNA adenine deaminase A (ecTadA) that can convert deoxyguanosine in single-stranded DNA to inosine (I) using single-stranded DNA as a substrate (Gaudelli et al., Nature, 2017, 551: 464-471). Cytosine base editor (CBE) and adenine base editor (ABE) proteins can specifically target cellular nucleic acid molecules based on the guide of guide RNA, and deaminate cytosine bases (C) or adenine bases (A) at the target site without forming double-stranded DNA breaks (DSBs), and then replace them with thymine (T) or guanine (G), respectively, through DNA replication and repair, thereby realizing the targeted replacement of C to T (cytosine base editing) or A to G (adenine base editing).

[0135] The design of the base modification method of guide RNA in the ABE and CBE systems has been disclosed in the literature (Komor et al., Nature, 2016, 533: 420-424; Gaudelli et al., Nature, 2017, 551: 464-471). In brief, the guide RNA sequence determines the target specificity, so the gene target of the base editor can be changed simply by changing the target sequence (protospacer) in the gRNA. When the base editor and guide RNA are co-introduced into cells, the base editor protein can generate base conversion within the activity window of the target sequence.

[0136] In some embodiments, the present invention uses CBEs to perform plant genome base editing. In other embodiments, the present invention uses ABEs to perform plant genome base editing.

[0137] Viral vector-based nuclease delivery system As set forth above, the present invention provides viral vector systems and methods for delivering CRISPR / Cas elements to plant cells.

[0138] The viral vector is applied to express one or more CRISPR elements in plant cells. For example, one Cas nuclease nucleic acid sequence, one or more gRNA nucleic acid sequences are inserted into each viral vector and operably linked to the viral transcriptional regulatory sequence. Preferably, two or more CRISPR / Cas elements are inserted into the same viral vector and operably linked to one or more transcriptional regulatory sequences. The Cas nuclease and one or more gRNA nucleic acid sequences may be inserted into the same site in the viral genome, and the expression is controlled by the same regulatory sequence. The Cas nuclease and one or more gRNA nucleic acid sequences may be inserted into different sites in the viral genome, and the expression is controlled by different regulatory sequences.

[0139] Specifically, most plant DNA virus vectors and positive-strand RNA virus vectors can only package foreign fragments of limited length, making it difficult to express large molecular weight CRISPR / Cas nuclease genes (4kb or more). The present invention engineers a single segmented plant negative-strand RNA Tospovirus virus vector system, with Tomato spotted wilt virus (TSWV) vector as a preferred embodiment. In an embodiment of the present invention, the TSWV vector may contain one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) insertion sites, which are upstream and / or downstream of the viral transcriptional regulatory elements. In a preferred embodiment of the present invention, a Cas protein coding sequence in one genome of the recombinant TSWV vector is operably linked to a viral transcriptional regulatory sequence, and one or more gRNA coding sequences in the other genome are operably linked to a viral transcriptional regulatory sequence. In cells infected by TSWV, viral transcriptional regulatory sequences drive the expression of Cas proteins and gRNAs, which guide Cas nucleases to target specific DNA sites in the genome, where the Cas nucleases make single- or double-stranded cuts in the target sequence.

[0140] Tospoviruses, also known as orthotospoviruses, are a type of virus classified as belonging to the Negarnaviricota phylum, Bunyavirales order, and Tospoviridae family. The viruses in this genus include Groundnut bud necrosis virus (GBNV), Groundnut ringspot virus (GRSV), Groundnut yellow spot virus (GYSV), Impatiens necrotic spot virus (INSV), Tomato chlorotic spot virus (TCV), Tomato spotted wilt virus (TSWV), Watermelon silver mottle virus (WSMoV), Zucchini lethal chlorosis virus (ZLCV), Groundnut chlorotic fan-spot virus (GCFSV), Watermelon bud necrosis virus (WBNV), Melon yellow spot virus (Melon yellow These include iris yellow spot virus (MYSV), iris yellow spot virus (IYSV), and chrysanthemum stem necrosis virus (CSNV).

[0141] Tospoviruses share conservative morphological, biological, and molecular biological characteristics. The virus particles are spherical, with a diameter of about 80-110 nanometers (nm), and are covered with a single coat on the surface, with the outer coat layer being composed of glycoprotein protrusions of about 5 nm. The virus particles encase three single-stranded antisense genome RNAs of different lengths, which are the L, M, and S genome fragments, and the total genome length is about 16,600 bases (nt). The 3' end of each genome fragment has nine highly conserved bases and is complementary to the 5' end region, forming a panhandle structure, making each genome fragment pseudocircular, which plays an important role in the viral transcription and replication process (Figure 2). The L genome is an antisense encoding strategy, and its antigenome strand encodes an RNA-dependent RNA polymerase (RdRp) with a size of about 330 kDa, which is essential for viral replication and transcription. The M and S genomes adopt an ambisense encoding strategy, with the sense and antisense strands each containing one open reading frame, separated by an intergenic region, which contains a cis-element that functions in transcription termination. The M genome strand encodes the nonstructural movement protein NSm, which plays an important role in the cell-to-cell and long-distance movement of the virus, while the antigenome strand encodes the glycoprotein precursor protein (GP), which is processed to mature glycoproteins GN and GC, and is a protein protrusion that anchors the glycoprotein to the virion, and is essential for virion maturation and vector transmission. The nonstructural protein NSs encoded by the S genome strand is an RNA silencing suppressor, and the nucleocapsid protein (N) encoded by the antigenome strand is a viral structural protein that covers the nucleocapsid formed by the viral genome. The minimum infectious unit of negative-strand viruses is the nucleocapsid, that is, a ribonucleoprotein complex in which the viral genomic RNA is packaged by the N protein and the RdRp protein.

[0142] Tospoviruses are transmitted by thrips in nature and can infect several types of food crops, industrial crops, vegetables, and flowering plants, but can also easily infect their natural or experimental host plants in laboratory conditions by inoculation using mechanical friction, transplantation, or other means. While most Tospoviruses have a wide host range, the host range of Tomato spotted wilt virus (TSWV) is particularly broad, and includes more than 1,090 species of monocotyledonous and dicotyledonous plants from over 85 families, including Solanaceae, Cucurbitaceae, Asteraceae, Fabaceae, and Brassicaceae (Parrella et al., J Plant Pathol, 2003, 85: 227-264), such as Abelmoschus esculentus, Ageratum houstonianum, Allium cepa, Amaranthus caudatus, Amaranthus hybridus, Amaranthus retroflexus, Amaranthus inosus, Amaranthus viridis, Amaryllis sp.), pineapple (Ananas comosus), anemone, celery (Apium graveolens var dulce), columbine (Aquilegia vulgaris), Arabidopsis (Arabidopsis thaliana), peanut (Arachis hypogaea), burdock (Arctium lappa), black arum (Arum palaestinum), begonia (Begonia sp.), bean sprout (Belamcanda chinensis), beet (Beta vulgaris), Bidens pilosa, rapeseed (Brassica campestris), cauliflower (Brassica oleracea var botrytis), Chinese cabbage (Brassica pekinensis), bok choy (Brassica rapa ssp. Chinensis), Calceolaria herbeohybrida, Calendula officinalis, Callistephuschinensis, Campanula glomerata, Campanula isophylla, Campanula latiloba, Campanula pyramidalis, Sword bean (Canavalia gladiata), Long-legged sword bean (Canavalia obtusifolia), English sword bean (Canavalia occidentalis), Shepherd's purse (Capsella bursa-pastoris), Paprika (Capsicum annuum), Tabasco (Capsicum frutescens), Habanero (Capsicum Chinense), Capsicum Baccatum, Rocotto pepper (Capsicum Pubescens), Papaya (Carica papaya), Cassia occidentalis, Scarlet laurel (Cassia tora, Catharanthus roseus, Cornflower (Centaurea cyanus), Wallflower (Cheiranthus cheiri), Chenopodium album, Chenopodium ambrosioides, Chenopodium amaranticolor, Chenopodium murale, Chrysanthemun coronarium, Chrysanthemun indicum, Chrysanthemun leucanthemum, Chrysanthemun morifolium, Chickpea (Cicer arietinum), Endive (Cichorium endiva), Chrysanthemum intybus, Cineraria, Watermelon (Citrullus lanatus), Arabica coffee (Coffea arabica), Convolvulus arvensis, Conyza bonariensis, Cordyline fruticose (also known as Cordylineterminalis), Coriandrum sativum, Coreopsis drummondii, Coronopus didymus, Crepis japonica (Youngia japonica), Crotalaria incana, Crotalaria juncea, Crotalaria pallida (Crotalaria mucronata), melon (Cucumis melo), cucumber (Cucumis sativus), pumpkin (Cucurbita maxima), Japanese pumpkin (Cucurbita moschata), golden melon (Cucurbita pepo), cyclamen (Cyclamen indicum) (Cyclamen persicum), artichoke (Cynara scolymus, Dahlia (Dahlia pinnata), Dahlia variabilis, Datura stramonium, Delphinium (Delphinium sp.), Desmodium triflorum, Desmodium unicinatum, Duboisia (Duboisia leichhardtii), Emilia sonchifolia, Fennel (Foeniculum vulgare), Wild strawberry (Fragaria vesca), Galinsoga parviflora, Galinsoga quadriradiata, Gladiolus (Gladiolus sp.), Soybean (Glycine max), Glycine soja, Gomphrena globosa, Gossypium hirsutum), sea cucumber (Gossypium barbadense), sunflower (Helianthus annuus), sea laurel (Hibiscus tiliaceus), amaryllis (Hippeastrum hybridum), and Japanese daffodil (Hippeastrumreginae), Hippeastrum rutilum, Hoya carnosa, Hydrangea macrophylla, Henbane (Hyoscyamus niger), Holsii (Impatiens holsii), Impatiens sultanii, Impatiens wallerana, Sweet potato (Ipomea batatas), Lactuca sativa, Lathyrus odoratus, Leonotis nepetaefolia, Limonium latifolium, Lupinus leucophyllus, Lupinus mutabilis, Lupinus polyphyllus, Lycium procissimum, tomato (Lycopersicon esculentum), wild tomato (Lycopersicon hirsutum), currant tomato (Lycopersicon pimpinellifolium), rabbit mallow (Malva parviflora), stock (Matthiola incana), medicinal plant (Medicago polymorpha), prawn sprout (Melilotus officinalis), oleander (Nerium oleander), Nicoandra physaloides, Nicotiana acuminata, Nicotiana bigelovii, Nicotiana clevelandii, Nicotiana glutinosa, Nicotiana rustica, Nicotiana sylvestris, Nicotiana tabacum, Iceland poppy (Papaver nudicaule), geranium (Pelargonium hortorum), petunia (Petunia hybrida), adzuki bean (Phaseolus angularis), kidney bean (Phaseolusvulgaris, Phlox (Phlox drummondii), Physalis angulata (also known as Physalis minima), Physalis spp, Red pea (Pisum arvense), Pea (Pisum sativum), Plantago major, Black seed plantain (Plantago rugelii), Bindweed (Polygonum convolvulus), Purslane (Portulaca oleracea), Primula (Primula sp.), Primula malacoides, Primula sinensis, Ranunculus (Ranunculus sp.), Red raspberry (Rubus idaeus), Rudbeckia amplexicaulis amplexicaulis, Saintpaulia ionantha, Salpiglossis, Scabiosa, Schizanthus, Sechium edule, Senecio cruentus, Senecio jacobea, Sesamum indicum, Sinningia eciosa, False Jerusalem cherry, Solanum carolinense, Solanum laciniatum, Solanum mammosum, Solanum melongena, Solanum nigrum, Solanum nodiflorum, Solanum capsicastrum seaforthianum, Solanum triflorum, potato (Solanum tuberosum), sowgrass (Sonchus oleraceus), spinach (Spinacia oleracea), Chinese burdock (Stachys arvensis), Stapellia, Chinese laurel (Stellaria media), Streptosolenjamesonii, French marigold (Tagetes patula), Taraxacum, Tephrosia purpurea, Tribulus terrestris, White clover (Trifolium repens), Trifolium subterraneum, Nasturtium (Tropaeolum majus), Vallota, Verbena brasilliensis, Verbena litoralis, Verbesina enceloides, Broad bean (Vicia faba), Black gram (Vigna mungo), Mung bean (Vigna radiata), Cowpea (Vigna unguiculata), Xanthium saccharatum, Calla lily (Zantedeschia aethopica), White spotted calla (Zantedeschia albo-maculata, yellow calla lily (Zantedeschia elliottiana), Zantedeschia melanoleuca, peach calla lily (Zantedeschia rehmannii), and zinnia elegans.

[0143] As described above, one aspect of the present invention provides a Tomato spotted wilt virus expression vector system. As can be understood by those skilled in the art of biotechnology, genetic manipulation of viral genomes and development of viral vectors are premised on the construction of a viral infectious clone, which, upon introduction into a suitable host cell, generates a viral DNA clone of a recombinant virus, i.e., achieves viral rescue, and expresses viral or non-viral sequences contained in the virus in the host cell.

[0144] The construction and application of plant negative strand RNA virus infectious cDNA clones and viral expression vectors have been disclosed in relevant documents or patents, such as the paper on the plant rhabdovirus Sonchus yellow net virus (SYNV) (Wang et al., PLoS Pathog, 2015, 11: e 1005223) and patent CN 105039388 B, the paper on the plant rhabdovirus Barley yellow mosaic virus (BYSMV) (Gao et al., New Phytol, 2019, 223: 2120-2133) and patent CN 110511955 A, and the tomato spotted wilt virus infectious clone system (Feng et al., PNAS, 2020, 117: 1181-1190). The process of rescuing a recombinant negative-strand RNA virus from cloned DNA includes: 1) constructing a nucleic acid construct capable of generating viral genome or antigenome RNA by transcription and a nucleic acid construct expressing viral core protein; 2) jointly introducing the nucleic acid construct into a suitable host cell in the form of a circular plasmid, a linear DNA fragment, a nucleic acid fragment generated by in vitro transcription, etc.; 3) expressing viral RNA and protein in the cell, and forming an infectious unit by packaging to generate a recombinant virus. The introduction method is a method known in the art, for example, by Agrobacterium transformation, gene gun method, nucleic acid (plasmid DNA or in vitro transcribed RNA) friction method, PEG-mediated method, electric shock method, microinjection method, liposome transformation method, nanoparticle-mediated transformation method.

[0145] When the nucleic acid construct is introduced into a suitable plant host cell, the plant RNA silencing response is an important limiting factor that inhibits its highly efficient expression and subsequent recombinant virus generation. As an important mechanism for inhibiting foreign nucleic acid entry, the plant RNA silencing response suppresses the instantaneous expression of the nucleic acid construct (Johansen et al., Plant Physiol 2001, 126: 930-938), while limiting the replication and infection of the nascent recombinant virus (Kasschau et al., Virology 2001, 285: 71-81). To improve the instantaneous expression efficiency and rescue efficiency of recombinant plant negative-strand RNA viruses, a known solution in the field is the viral suppressor of RNA silencing encoded by the co-expressing virus (Wang et al., PLoS Pathog, 2015, 11: e 1005223; Ma & Li, Viruses 2020, 12: 1459). Currently, there are many known viral RNA silencing suppressors, including Tombusvirus p19, Tobacco Etch Virus HcPro, Barley Stripe Mosaic Virus γb, Tomato Spotted Wilt Virus NSs, Turnip Crinkle Virus p38, Flock House Virus B2, Influenza Virus NS1, Ebola Virus VP35, etc. The specific mechanisms of these silencing suppressors are different, and when co-expressed, they have a synergistic effect on promoting recombinant negative strand virus rescue (Ganesan et al., J Virol 2013, 87:10598-10611; Ma & Li, Viruses 2020, 12: 1459).

[0146] The embodiment of the present invention discloses a method for constructing a TSWV virus vector system and technical means for rescuing the recombinant virus. The TSWV genome sequence, i.e., its S genome, M genome and L genome sequences are shown in SEQ ID NO: 1, 2 and 3, respectively. In the art, the viral genome sequence does not need to have 100% identity with the disclosed sequences SEQ ID NO: 1, 2 and 3. The viral genome sequence has at least 70%, at least 80%, at least 90%, at least 95% or at least 99% identity with the entire genome sequence disclosed by the present invention. Alternatively, the RdRp protein amino acid sequence encoded thereby has at least 70%, at least 80%, at least 90%, at least 95% or at least 99% homology with the protein amino acid sequence encoded by the RdRp gene (SEQ ID NO: 4) disclosed by the present invention.

[0147] To construct a nucleic acid construct capable of generating viral genomic RNA by transcription, in an embodiment of the present invention, the TSWV S, M, L genomic nucleic acid sequence is inserted into a plant expression vector and operably linked downstream of a promoter sequence. Many suitable plant expression vectors are known to those skilled in the art and are commercially available, such as pCambia, pGreen, pCASS, PBin19, pGD, pCB301, etc. Suitable promoters include constitutive or inducible promoters derived from endogenous plant genes or plant viruses, such as the actin promoter, the ubiquitin promoter, or the cauliflower mosaic virus (CaMV) 35S promoter. An embodiment of the present invention employs a version of the CaMV 35S promoter (SEQ ID NO: 9), which can generate 5'-end faithful target viral RNA.

[0148] In the nucleic acid construct of the TSWV genome, the 3' end of the viral sequence is operably linked to a self-splicing hepatitis D virus ribozyme sequence, and the viral RNA generated by transcription is spliced ​​by the ribozyme to generate a faithful 3' end viral terminal sequence. The design of the hepatitis D virus ribozyme has been disclosed in papers (Sharmeen et al., 1998, J. Virol. 62, 2674-2679; Feng et al., Proc Natl Acad Sci USA, 2020, 2: 1181-1190) and U.S. Patent 522,533,7 (Ribozyme compositions and methods for use), and is known to those skilled in the art.

[0149] In an embodiment of the invention, the TSWV L genome nucleic acid construct comprises an L antigenomic RNA cDNA sequence operably linked to a 35S promoter for transcription to generate a sense strand of L antigenomic RNA, the M genome nucleic acid construct comprises an M genome or antigenomic cDNA sequence operably linked to a 35S promoter for transcription to generate a M genome (antisense) or antigenomic (sense) RNA, and the S genome nucleic acid construct comprises an S antigenomic cDNA sequence operably linked to a 35S promoter for transcription to generate a sense strand of S antigenomic RNA.

[0150] As shown above, the rescue of negative strand viruses requires the co-expression of viral core proteins and viral RNA in cells to generate viral infectious units by transcription. In the practice of the present invention, the L and S antigenomic RNA transcription units (sense) express the viral nucleocapsid core proteins RdRp (also called L) and N, respectively, as translation templates, and then package with the N and RdRp proteins to form viral nucleocapsids, which serve as templates for viral replication to generate progeny viral genomes.

[0151] It should be understood by those skilled in the art that the L and S nucleic acid constructs may contain L and S genomic cDNA sequences operably linked to the 35S promoter, but in this case, since the L and S genomic RNA transcription units (antisense) cannot express viral core proteins, it is necessary to separately provide RdRp and N auxiliary expression vectors in the cells to generate viral core proteins by translation, package the viral genome, and initiate recombinant viral replication and infection.

[0152] In an embodiment of the present invention, the TSWV L genome nucleic acid construct is further modified to replace the sequence encoding RdRp in the L genome (SEQ ID NO: 4) with a codon-optimized coding sequence. Preferably, the optimized RdRp sequence is shown in SEQ ID NO: 5. It should be noted that gene sequence optimization is a common operation in biotechnology, and the same gene can obtain different optimized sequences through different optimization methods, and the codon-optimized sequence provided by the present invention is merely exemplary. Other appropriately optimized sequences can also improve the highly efficient and stable expression of TSWV RdRp in plant cells, leading to the generation of recombinant viruses.

[0153] In some embodiments of the invention, the TSWV M genomic fragment can be manipulated by recombinant DNA techniques, for example, to insert a heterologous nucleic acid sequence, or to delete or replace part or all of the GP gene sequence (SEQ ID NO: 6). In some preferred embodiments, all or part of the GP gene sequence is replaced by a heterologous reporter gene nucleic acid sequence.

[0154] In some embodiments of the invention, the TSWV S genome fragment can be manipulated by recombinant DNA techniques, for example, by inserting a heterologous nucleic acid sequence upstream or downstream of the NSs gene (SEQ ID NO:7) coding sequence, or by deleting or replacing all or part of the NSs gene. In some preferred embodiments, all or part of the NSs gene sequence is replaced by a heterologous reporter gene nucleic acid sequence.

[0155] In embodiments of the invention, heterologous nucleic acid sequences contained in the TSWV M and S genomes are operably linked to viral transcriptional cis elements, including promoter elements that function to direct mRNA transcription in the non-coding regions of the M and S genomes, and cis elements that function to direct transcription termination between viral genes.

[0156] Further, the nucleic acid constructs of the recombinant TSWV S, M, L genomes are introduced into suitable plant cells under conditions that allow for recombinant virus rescue. In some embodiments of the present invention, the auxiliary nucleic acid constructs co-introduced into the cells further comprise a sequence encoding one or more RNA silencing suppressors operably linked to a promoter to facilitate the generation of recombinant viruses. In some embodiments of this aspect, preferably, the RNA silencing suppressors are a single or multiple combination of Tombusvirus p19, Tobacco Etch Virus Hc-Pro, Barley Stripe Mosaic Virus γb, and Tomato Spotted Wilt Virus NSs, and the promoter is a 35S promoter. Optionally, the nucleic acid constructs co-introduced into the cells may further comprise a TSWV N and RdRp protein auxiliary expression vector.

[0157] In an embodiment of this aspect, the nucleic acid construct composition introduced into a plant cell comprises: a) a nucleic acid construct comprising TSWV S, M, L recombinant genomic sequences; b) an auxiliary expression construct encoding one or more viral silencing suppressors; and, optionally, c) one or more auxiliary expression constructs encoding the TSWV N and L proteins.

[0158] The method of "introducing into plant cells" according to this embodiment is a method commonly used in the art, and includes, for example, Agrobacterium-mediated transformation, gene gun bombardment, pollen-mediated introduction, PEG-mediated fusion, electric shock, microinjection, ultrasound-mediated transformation, liposome-mediated transformation, nanoparticle-mediated transformation, etc., to introduce a circular plasmid containing a viral nucleic acid sequence, a linear DNA fragment, in vitro transcribed RNA, etc. into a suitable eukaryotic cell.

[0159] In some embodiments of the present invention, the method of introducing into the plant cell is Agrobacterium infection, i.e., the one or more nucleic acid constructs are transformed into suitable plant cells by Agrobacterium infiltration. The nucleic acid construct is a plasmid vector suitable for transformation by Agrobacterium, i.e., a binary plasmid vector, which contains a transfer DNA (T-DNA) region that is transferred to the plant cell in the process of infecting the plant with Agrobacterium. The nucleic acid construct may also be introduced into the cell by other methods, such as gene gun bombardment, leaf friction, PEG fusion, etc. In this case, the nucleic acid construct may be introduced into the cell in the form of DNA, RNA, or ribonucleoprotein complex.

[0160] In a preferred embodiment of the present invention, Agrobacterium is used to infiltrate leaf tissue of N. benthamiana to introduce the transfer DNA fragment of Agrobacterium binary plasmid into N. benthamiana cells, and to carry out transcription, expression and recombinant virus rescue. Although N. benthamiana is one of the best plants for transformation by Agrobacterium, several other plant species have different degrees of susceptibility to Agrobacterium transformation.

[0161] In some embodiments of the present invention, the recombinant TSWV with all or part of the GP gene deleted is infectious to plants, but the recombinant virus cannot be acquired by vector insects such as thrips and cannot be transmitted to other plants by vector insects, so the recombinant virus and method provided by the present invention have high biosafety.

[0162] In some embodiments of the present invention, the recombinant TSWV from which all or part of the NSs gene has been deleted has infectivity for plants and is less virulent than the wild-type virus.

[0163] The TSWV vector may contain one or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) insertion sites, which are upstream and / or downstream of the viral transcriptional regulatory elements. In some embodiments, the recombinant TSWV vector M genome carries one reporter gene and the S genome carries another reporter gene, which are operably linked to the viral transcriptional regulatory sequences. Preferably, the reporter genes are green fluorescent protein gene (GFP) and red fluorescent protein gene (RFP). When the recombinant nucleic acid construct is introduced into a plant cell, the replication and systemic infection of the recombinant virus is tracked by the expression of the reporter genes.

[0164] In another aspect, the present invention discloses a TSWV expression vector system for delivering a sequence-specific nucleic acid modifying enzyme to a plant and a method for constructing the same.

[0165] In some embodiments of the invention, the recombinant TSWV vector M genome comprises a coding sequence for one component of a nucleic acid modifying enzyme operably linked to a viral transcriptional regulatory sequence, and the S genome comprises another component of the nucleic acid modifying enzyme operably linked to a viral transcriptional regulatory sequence. In cells infected with TSWV, the viral transcriptional regulatory sequence drives co-expression of the nucleic acid modifying enzyme components, and the complex formed targets and causes modification to a specific DNA site in the genome.

[0166] As described above, the recombinant virus, in which the TSWV vector contains multiple insertion sites and the M and / or S genomes each or simultaneously contain foreign nucleic acid sequences, can systemically infect plants and express one or more foreign sequences. Therefore, an embodiment of the present invention provides a viral expression vector system capable of expressing a sequence-specific nucleic acid modifying enzyme, specifically, at least two polynucleotide sequences encoding CRISPR / Cas nucleic acid modifying enzyme components are inserted into the recombinant TSWV genome and operably linked to the viral transcription cis-element. The recombinant TSWV vector is introduced into a plant cell to express the nucleic acid modifying enzyme.

[0167] In some embodiments of the present invention, the CRISPR / Cas nucleic acid modification enzyme is a CRISPR / LbCas12a system derived from Lachnospira.

[0168] In some embodiments of the present invention, the CRISPR / Cas nucleic acid modifying enzyme is the CRISPR / SpCas9 system from Streptococcus pyogenes.

[0169] In some embodiments of the present invention, the CRISPR / Cas nucleic acid modification enzyme is an ABE based on the CRISPR / SpCas9 system.

[0170] In some other embodiments of the present invention, the CRISPR / Cas nucleic acid modification enzyme is a CBE based on the CRISPR / SpCas9 system.

[0171] To improve the efficiency of expression of Cas effectors in plant cells, some embodiments of the present invention provide a R. necrosis factor-optimized LbCas12a coding sequence (e.g., as shown in SEQ ID NO: 10), a N. benthamiana codon-optimized SpCas9 protein sequence (e.g., as shown in SEQ ID NO: 11), a N. benthamiana codon-optimized adenine editor protein coding sequence (e.g., as shown in SEQ ID NO: 84), or a N. benthamiana codon-optimized cytosine editor protein coding sequence (e.g., as shown in SEQ ID NO: 85). It should be understood by those of skill in the art that methods of performing codon optimization for specific host species are feasible and known.

[0172] As shown in the sequence, the Cas effector of the present invention is a fusion protein, which further comprises a nuclear localization sequence at its N-terminus and / or C-terminus to achieve sufficient accumulation of the CRISPR / Cas complex in the plant cell nucleus. In addition, according to the DNA site to be edited, the Cas fusion protein of the present invention may further comprise other localization sequences, such as a cytoplasmic localization sequence, a chloroplast localization sequence, a mitochondrial localization sequence, etc. In some embodiments of the present invention, the sequence encoding the Cas12a protein replaces the M genome GP coding sequence, and the expression of the Cas12a protein is controlled by the M genome cis-element. A foreign nucleic acid molecule encoding the Cas12a guide RNA (crRNA) is inserted upstream or downstream of the S genome NSs coding frame, and the expression of the guide RNA is controlled by the S genome cis-element. Preferably, the S genome NSs coding frame is simultaneously replaced by a reporter gene frame, and the infection by the recombinant virus is tracked by the reporter gene. In an embodiment of this aspect, the guide RNA transcription unit is spliced ​​to a terminal polynucleotide derived from a virus by the Cas12a nuclease processing mechanism.

[0173] In some other embodiments of the present invention, the M genome GP coding sequence is replaced by a sequence encoding a Cas9 protein, and the expression of the Cas9 protein is controlled by the M genome cis element. A foreign nucleic acid molecule encoding a Cas9 guide RNA is inserted upstream or downstream of the S genome NSs coding frame, and the expression of the guide RNA is controlled by the S genome cis element. Preferably, the NSs coding frame is replaced by a reporter gene. In some embodiments of this aspect, the guide RNA transcription unit is spliced ​​to the terminal polynucleotide derived from the virus by Cas9 nuclease and endogenous RNA processing mechanisms.

[0174] In some embodiments of the present invention, the coding sequence of the ABE protein replaces the M genome GP coding sequence, and its expression is controlled by the M genome cis-element. A foreign nucleic acid molecule encoding a guide RNA is inserted upstream or downstream of the S genome NSs coding frame, and its expression is controlled by the S genome cis-element. Preferably, the NSs coding frame is replaced by a fluorescent reporter gene.

[0175] In some embodiments of the present invention, the coding sequence of the CBE protein replaces the M genome GP coding sequence, and its expression is controlled by the M genome cis-element. A foreign nucleic acid molecule encoding a guide RNA is inserted upstream or downstream of the S genome NSs coding frame, and its expression is controlled by the S genome cis-element. Preferably, the NSs coding frame is replaced by a fluorescent reporter gene.

[0176] In the above embodiment, two nucleic acid sequences encoding a Cas effector and a guide RNA (crRNA or gRNA) element are inserted into the M and S genomes of the recombinant TSWV vector, respectively. According to existing technical means in the field, the nucleic acid sequences encoding the Cas effector and the gRNA (or crRNA) element can be tandemly linked into a single RNA transcription unit for expression (Campa et al., Nat Methods, 2019, 16: 887-893; Tang et al., Plant Biotechnol J, 2019, 17: 1431-1445). Therefore, the two nucleic acid sequences encoding the Cas protein and the gRNA element are linked into a single nucleic acid sequence and expressed by being inserted into one genome of TSWV, for example, the M genome, S genome, and L genome.

[0177] Furthermore, in some embodiments of the present invention, the recombinant TSWV vector is used to express a CRISPR / Cas nucleic acid modification enzyme in a plant cell, and a nucleic acid construct containing the TSWV recombinant genome fragment and an auxiliary expression construct are introduced into a suitable plant cell under conditions that allow for recombinant virus rescue.

[0178] In an embodiment of the present invention, the nucleic acid construct composition introduced into a plant cell comprises: a) a nucleic acid construct comprising recombinant TSWV S, M, and L genomic sequences, wherein the S genome comprises one or more heterologous nucleic acid sequences encoding CRISPR guide RNAs, the M genome comprises one or more heterologous nucleic acid sequences encoding Cas nuclease components, and the L genome comprises a codon-optimized viral RdRp sequence (SEQ ID NO: 5); b) an auxiliary expression construct encoding one or more viral silencing suppressors, and optionally further comprising c) an auxiliary expression construct encoding the TSWV N and L proteins.

[0179] The method of "introducing into plant cells" according to the present invention is a method commonly used in the art, for example, by Agrobacterium-mediated transformation, gene gun bombardment, pollen tube introduction, PEG-mediated fusion, electric shock induction, microinjection, laser transformation, ultrasound transformation, liposome transformation, nanoparticle-mediated transformation, etc., to introduce a circular plasmid containing a viral nucleic acid sequence, a linear DNA fragment, RNA generated by in vitro transcription, etc. into a suitable eukaryotic cell. In some embodiments of the present invention, the method of introducing into plant cells is Agrobacterium infection, i.e., infiltrating leaf tissue of N. benthamiana with Agrobacterium containing the nucleic acid construct (binary plasmid vector), introducing the transfer DNA fragment of the binary plasmid into N. benthamiana cells, and carrying out transcription, expression, and recombinant virus generation.

[0180] TSWV is a segmented negative-strand RNA virus, and when rescuing recombinant virus from cloned DNA, the three recombinant genomes S, M, and L can be simultaneously obtained in the same cell to generate active infectious units through transcription and initiate recombinant virus infection. As can be easily understood, the three genomes S, M, and L have large differences in length, and therefore their expression and assembly efficiency is different. In addition, the insertion of large fragments of non-homologous sequences, such as the 3.9 kb LbCas12a coding sequence, the 4.2 kb SpCas9 coding sequence, the 4.9 kb ABE coding sequence, and the 5.2 kb CBE coding sequence, will further affect the efficiency of rescuing recombinant genome fragments. According to the technical means of the present invention, in order to effectively generate recombinant virus, it is necessary to optimize the polarity (sense or antisense) of the recombinant genome cDNA in the nucleic acid construct and the construction ratio of the three genome nucleic acids.

[0181] In a related embodiment, the recombinant L and S genomic fragments are operably linked downstream of the 35S promoter in the antigenomic cDNA orientation, and the sense-strand viral RNA generated by transcription may serve as a translation template for the N and L proteins and may also serve as a template for genome replication.

[0182] In some embodiments, a recombinant M genome fragment containing an LbCas12a coding sequence is operably linked to a 35S promoter in the antigenome cDNA direction, and transcriptionally generates a sense strand RNA of the recombinant M genome.

[0183] In some other embodiments, the recombinant M genome fragment containing the SpCas9 coding sequence is operably linked to a 35S promoter in the antigenome or genome cDNA orientation, preferably in the genome cDNA orientation, and is transcribed to generate an antisense strand RNA of the recombinant M genome.

[0184] In some other embodiments, a recombinant M genome fragment containing an ABE or CBE heterologous coding sequence is operably linked to a 35S promoter in the antigenome cDNA orientation and transcribed to generate recombinant M genome sense strand RNA.

[0185] When introducing the virus expression vector into the virus expression vector by Agrobacterium infiltration, the concentration of the Agrobacterium solution (OD 600 By adjusting the ratio of each recombinant genome construct introduced into the plant (shown as a value), the coordinated expression and efficient assembly of the three recombinant genomes can be achieved. By adjusting the ratio of the recombinant constructs within a certain range, it is possible to rescue the recombinant virus from the clonal viral cDNA.

[0186] In some embodiments, recombinant virus rescue can be achieved when the Agrobacterium concentration ratio of the recombinant S genome construct containing crRNA, the recombinant M genome construct containing LbCas12a, and the recombinant L genome construct is 2:2:1, 1:2:1, or 1:10:2. Preferably, the recombinant virus rescue efficiency is highest when the concentration of the S recombinant genome construct is the lowest, the concentration of the L genome is the next lowest, and the concentration of the M genome is the highest, for example, when the S:M:L ratio is 1:10:2.

[0187] In some embodiments, when the Agrobacterium concentration ratio of the recombinant S genome construct containing gRNA, the recombinant M genome construct containing SpCas9, and the recombinant L genome construct is 1:10:2, highly efficient rescue of the recombinant virus can be achieved.

[0188] In some embodiments, highly efficient rescue of recombinant virus can be achieved when the Agrobacterium concentration ratio of the recombinant S genome construct containing the gRNA, the recombinant M genome construct containing the base editor, and the recombinant L genome construct is 1:10:2.

[0189] The limited packaging capacity is the biggest challenge for the delivery of specific sequence nucleases by recombinant viral vectors. According to some embodiments of the present invention, the TSWV vector genome has multiple insertion sites and the ability to assemble unusual foreign fragments, and recombinant viruses carrying CRISPR / Cas nuclease fragments of 5 kb or more in length can systemically infect plants and express foreign sequences. In addition, nucleases that can be expressed by TSWV further include other CRISPR / Cas nucleases of homologous or smaller molecular weight, such as SaCas9, STl1Cas9, STl2Cas9, St3Cas9, NmCas9, AsCas12a, FnCas12a, CasX, CasY, CasΦ nuclease system, and mutants or derivatives of some amino acids of CRISPR nucleases, such as high-fidelity Cas nucleases espCas9, HFCas9, Cas9 nickase (nCas9), Cas9 inactivating enzyme (dCas9), guide editors, etc., but are not limited to these, and further include other types of small molecular weight nucleases, such as meganucleases (up to 1 kb), zinc finger nucleases (up to 2 kb), and transcriptionally active element-like effector nucleases (up to 3 kb).

[0190] The viral vector employed in accordance with an embodiment of the present invention is Tomato spotted wilt virus (TSWV), a Tospovirus genus signature species. In addition, the present invention can be implemented based on the teachings of the present invention, and further includes Tospovirus and other segmented plant negative-strand RNA viruses having similar genome structures and biological properties, such as Groundnut bud necrosis virus (GBNV), Groundnut ringspot virus (GRSV), Groundnut yellow spot virus (GYSV), Impatiens necrotic spot virus (INSV), Tomato chlorotic spot virus (TCV), Watermelon silver mottle virus (WSMoV), Zucchini lethal chlorosis virus (ZLCV), Groundnut chlorotic fan-spot virus (GCFSV), Watermelon bud necrosis virus (WSMov), etc. Examples of viruses that may be present include, but are not limited to, WBNV, Melon yellow spot virus (MYSV), Iris yellow spot virus (IYSV), and Chrysanthemum stem necrosis virus (CSNV).

[0191] Plant genome editing based on viral delivery systems In another aspect, the present invention provides a method for modifying plant genetic material, comprising using the TSWV vector of the present invention to deliver a CRISPR / Cas nucleic acid modification enzyme complex to a plant cell, and a Cas effector targets a specific sequence in the plant genome under the guidance of a guide RNA to cause DNA breaks or base modifications, and then completing the modification of the genetic material of the plant cell through endogenous DNA repair mechanisms to generate one or a combination of multiple types of mutations due to base deletion, insertion and substitution.

[0192] In some embodiments of the invention, the nuclease delivered by the TSWV vector is a CRISPR / LbCas12a nuclease, and in some other embodiments, a CRISPR / SpCas9 nuclease.

[0193] In some embodiments of the invention, the base editor delivered by the TSWV vector is an ABE, and in some other embodiments, a CBE.

[0194] Methods for designing and constructing suitable CRISPR guide RNAs based on a given target sequence are known to those skilled in the art, for example, the design of LbCas12a crRNA can be found in Fonfara et al. (Nature, 2016, 532: 517-521). In general, LbCas12a crRNA comprises a protospacer (guide sequence) of about 23 nucleotides that is complementary to the target sequence, and a direct repeat (DR) sequence that binds to LbCas12a protein to form a complex, in which the DR sequence binds to Cas12a to form a complex, while the spacer sequence targets the complementary target DNA. The target sequence has the following structure: 5'-TTTN-NX-3', where N is any one base selected from A, G, C, and T, Nx represents X consecutive nucleotides, and X is an integer of 15≦X≦30, and TTTN is the protospacer adjacent motif (PAM) sequence of LbCas12a. In some specific embodiments of the present invention, X is 23.

[0195] In addition, Cas12a has its own cRNA processing activity and cleaves transcription units containing multiple crRNA sequences to generate multiple guide RNAs, making it easier to precisely process crRNA and achieve multi-target editing by simultaneous expression of multiple crRNAs (Fonfara et al., Nature, 2016, 532: 517-521; Zetsche et al., Nat Biotechnol, 2017, 35: 31-34).

[0196] In some embodiments of the present invention, the guide RNA of Cas12a is a single crRNA, and its structure is "direct repeat (DR)-spacer sequence (Spacer)-direct repeat (DR)". In an embodiment of this aspect, TSWV expresses the early transcription unit of "DR-Spacer-DR" guide RNA, both ends of which contain sequences derived from the virus, and after the Cas12a protein binds to the DR sequence, it can process and splice the terminal polynucleotide derived from the virus through its nuclease activity to form a mature crRNA containing the "DR-Spacer" structure.

[0197] In some other embodiments of the present invention, the guide RNA of Cas12a is a plurality of crRNAs linked in tandem, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more crRNA sequences. Specifically, the expression manner of the tandem crRNA is "DR-Spacer 1-DR- Spacer 2-DR...". In an embodiment of this aspect, TSWV expresses an early transcription unit containing tandem crRNAs, both ends of which contain sequences derived from the virus, and after the Cas12a protein binds to the DR sequence, it can process and release two or more mature crRNA molecules through its nuclease activity. The editing efficiency of the target gene generated thereby is similar to that of the corresponding TSWV vector delivering a single crRNA.

[0198] In some embodiments of the present invention, the target site of the LbCas12a and crRNA complex delivered by the TSWV vector is selected from the conserved crPDS1 target sequence 5'-TTTCTGCCGTTAATTTGAGAGTCCAAG-3' (SEQ ID NO: 12) (bold letters are PAM sequences, as described below) in Nicotiana benthamiana and tobacco phytoene desaturase (PDS) genes, in some other embodiments, the target site is selected from the conserved crPDS2 target sequence 5'-TTTCTGCTGTTAACTTGAGAGTCCAAG-3' (SEQ ID NO: 13) in the tomato PDS gene, in some other embodiments, the target sequence 5'-TTTCTGCTGTCAACTTGAGAGTCCAAG-3' (SEQ ID NO: 14) in the pepper PDS gene, and in some other embodiments, the target site is selected from the conserved crPDS4 target sequence 5'-TTTCTGCTGTCAACTTGAGAGTCCAAG-3' (SEQ ID NO: 15) in the peanut and soybean PDS genes. TTTGACAGAAAACTGAAGAACACATAT-3' (SEQ ID NO: 15).

[0199] In some embodiments of the present invention, the target site of the LbCas12a and crRNA complex delivered by the TSWV vector is selected from the conserved target sequence 5'- TTTGGAACAGATTCCAATAAGAAGCCT-3' (crFucT, SEQ ID NO: 86) in the Nicotiana benthamiana FucT gene, or the DCL2 target sequence 5'- TTTGAGAAGCTATGCTTATCTTCTTCG-3' (crDCL2, SEQ ID NO: 87), in some other embodiments, the target sequence 5'- TTTAATGTTAAACCTTTAGTGTCCTTT-3' (crER, SEQ ID NO: 88) in the Physalis orbicularis ER gene, or in some embodiments, the conserved target sequence 5'- AATGCAATGTATATTGATTGCCTTAAA-3' (crPDS5, SEQ ID NO: 98), and in some embodiments, the conserved target sequence of the pepper PDS gene is selected from 5'-TTTCTGCTGTCAACTTGAGAGTCCAAG-3' (crPDS6, SEQ ID NO: 99).

[0200] In some other embodiments of the present invention, the LbCas12a delivered by the TSWV vector can form multiple LbCas12a / crRNA complexes with multiple crRNAs linked in tandem to simultaneously target multiple genes for multiple editing, for example, two crRNAs (crPDS1&crFucT; SEQ ID NO: 135) are expressed in tandem to target the N. benthamiana crPDS1 and crFucT sites, respectively, or three crRNAs (crPDS1&crFucT&crDCL2; SEQ ID NO: 136) are expressed in tandem to target the N. benthamiana crPDS, crFucT and crDCL2 sites, respectively, and the editing efficiency generated by the multi-targeting vector is similar to that of the corresponding TSWV vector delivering a single gRNA.

[0201] The design of SpCas9 gRNA can be found in Ran et al. (Nat Protoc, 2013, 11: 2281-2308). SpCas9 gRNA comprises a protospacer of about 20 nucleotides complementary to the target sequence, and a sequence that binds to SpCas9 protein to form a complex, and the 3' end comprises a protospacer adjacent motif NGG adjacent to it. The target sequence has the following structure, i.e., 5'-NX-NGG-3', where N is any one base selected from A, G, C, and T, Nx represents X consecutive nucleotides, X is an integer of 14≦X≦30, and NGG is the protospacer adjacent motif (PAM) sequence of SpCas9. In some specific embodiments of the present invention, X is 20.

[0202] When gRNA is expressed using an RNA virus vector, both ends of the gRNA initial transcription unit usually contain sequences derived from the virus. When co-expressed with Cas9 protein, the gRNA sequence is bound to the Cas9 protein, and the unbound virus-derived sequences are spliced ​​by endogenous RNA processing enzymes to release one or more mature gRNA molecules (Mikami et al., Plant Cell Physiol, 2017, 58: 1857-1867; Ellison et al., Nat Plants, 2020, 6: 620-624).

[0203] In some embodiments of the present invention, the target site for the SpCa9 and gRNA complex delivered by the TSWV vector is selected from the recombinant gGFP target sequence 5'-GATACCCAGATCATATGAAGCGG-3' (SEQ ID NO: 16) of the N. benthamiana GFP gene, and in some other embodiments, is selected from the conserved gPDS1 target sequence 5'-GGACTCTTGCCAGCAATGCTTGG-3' (SEQ ID NO: 17) in the N. benthamiana and N. tabacum PDS genes.

[0204] In some embodiments of the present invention, the target site for the SpCas12a and gRNA complex delivered by the TSWV vector is selected from the conserved target sequence 5'-TTGGTAGTAGCGACTCCATGGGG-3' (gPDS2, SEQ ID NO: 89) in the N. benthamiana PDS gene, or the RDR6 target sequence 5'-CCCCTCCTGACTCTTACCCAACT-3' (gRDR6, SEQ ID NO: 90), or the SGS3 target sequence 5'-ACAAGAGTGGAAGCAGTGCTGGG-3' (gSGS3, SEQ ID NO: 91).

[0205] In some other embodiments of the present invention, the SpCas9 delivered by the TSWV vector forms multiple SpCas9 / gRNA complexes with multiple gRNAs linked in tandem to simultaneously target multiple genes for multiple editing, for example, expressing two gRNAs (gPDS2&gRDR6; SEQ ID NO: 137) in tandem to target the gPDS2 and gRDR6 sites, respectively, or expressing three gRNAs (gPDS2&gRDR6&gSGS3; SEQ ID NO: 138) in tandem to target the gPDS2, gRDR6 and gSGS3 sites, respectively, and the editing efficiency of the target genes generated by the multi-targeting vector is similar to that of the corresponding TSWV vector delivering a single gRNA.

[0206] The gRNA design of base editors (such as ABE and CBE) is basically similar to the SpCas9 nuclease design. In some embodiments of the present invention, the target site of the ABE and gRNA complex delivered by the TSWV vector is selected from the target sequence 5'-TGCAAATTGAGTTGGGAGTGAGG-3' (gPDSa, SEQ ID NO: 92) of the N. benthamiana PDSa gene, in some embodiments, the target sequence 5'-CCTCTTGAGAATGTTGCTATTGG-3' (gFucTa1, SEQ ID NO: 93) of the N. benthamiana FucTa gene, or the target sequence 5'-GAAATCAGAGTAAGGTGCGGAGG-3' (gBBLd, SEQ ID NO: 97) of the N. benthamiana berberine bridge enzyme-like nucleic acid (BBL) d gene.

[0207] In some embodiments of the present invention, the target site of the CBE and gRNA complex delivered by the TSWV vector is selected from the target sequence 5'-CACACCTTCCTCCAGGAGATAGG-3' (gFucTa2, SEQ ID NO: 94) of the Nicotiana benthamiana alpha-1,3-fucosyltransferase a gene (FucTa), the target site 1 sequence 5'-CCAATATCTAGGCGTGAGGGATT-3' (gRDR6a1, SEQ ID NO: 95) and the target site 2 sequence 5'-CCCGACTTCATGGGGAAGGAGGA-3' (gRDR6a2, SEQ ID NO: 96) of the RNA-dependent RNA polymerase 6a gene (RDR6a).

[0208] The guide RNA can target a single gene or multiple genes, for example, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more. In some embodiments of the present invention, the guide RNA targets a single gene, for example, Cas12a crRNA targets tomato PDS gene, pepper PDS gene, soybean PDS gene, and Cas9 gRNA targets GFP gene recombination. In other embodiments, the guide RNA targets two genes, for example, Cas12a crRNA targets N. benthamiana and N. tabacum PDSa and PDSb genes, peanut PDSa and PDSb genes, and Cas9 gRNA targets N. benthamiana and N. tabacum PDSa and PDSb genes.

[0209] To achieve modification of genetic material in plant cells, the TSWV viral vectors containing the Cas effector and targeting guide RNAs at different target sites are introduced into plant cells, tissues or organs by any method known in the art. For example, the recombinant viral vector nucleic acid sequence-containing circular plasmid, linear DNA fragment, in vitro transcribed RNA, etc. are introduced into suitable plant cells by Agrobacterium infection, gene gun bombardment, pollen tube introduction, PEG-mediated fusion, electric shock, microinjection, ultrasound transformation, liposome transformation, nanoparticle-mediated transformation, etc. In some embodiments of the present invention, the method of introduction into plant cells is Agrobacterium infection, i.e., infiltrating leaf tissue of Nicotiana benthamiana with Agrobacterium containing the nucleic acid construct (binary plasmid vector). Viral nucleic acid sequences introduced into N. benthamiana cells guide the generation of recombinant viruses and express CRISPR nuclease complexes in inoculated and systemically infected leaves of the plant, the latter of which target and cleave or modify target sequences, inducing modification of the genetic material.

[0210] The TSWV viral vector may be introduced into plant cells by a method of infecting plants with viral particles. For example, the plant may be infected with plant sap containing infectious recombinant viral particles by mechanical friction, high pressure spray, needle puncture, syringe injection, vacuum infiltration, bombardment with a gene gun, etc., or the virus may be inoculated by homografting or heterografting the infected plant with the plant to be infected. In some embodiments of the present invention, the infection method is inoculation of N. benthamiana sap containing recombinant viral particles into N. benthamiana, tobacco, tomato, paprika, Tabasco, habanero, potato, physalis, safflower, peanut, soybean, and cotton by friction inoculation and high pressure spray. The recombinant viral particles introduced into the plant cells initiate viral replication and infection, and express the CRISPR nuclease complex in the inoculated and / or systemically infected leaves, which cleaves or modifies the target sequence, inducing modification of the genetic material.

[0211] When plants are infected with a viral vector, any method known in the art can be applied to identify modifications to the target sequence, including functional assays such as inactivation or activation of reporter gene expression, or amplification of DNA sequences by polymerase chain reaction using Surveyor and T7EI nuclease assays, restriction enzyme protection assays, Sanger sequencing assays, and high-throughput sequencing assays.

[0212] In some embodiments of the present invention, the identification methods used are restriction enzyme protection analysis and Sanger sequencing analysis. Depending on the target sequence, the editing efficiency of the target gene by the nuclease expressed by the viral vector in the present invention is 45%-98%.

[0213] In some other embodiments of the present invention, the identification method used is high-throughput sequencing analysis.High-throughput sequencing uses plant total DNA as template, amplifies a sequence containing a target with a specific primer with a linker, then further amplifies the amplicon of the sequence, adds a barcode, and then performs high-throughput sequencing.Then, the sequencing result is compared and analyzed with the wild-type sequence, and the ratio of the number of reads in which the expected mutation occurs at the target site to the total reads is calculated.This ratio is the editing efficiency of the target gene.

[0214] The method of the present invention does not require stable transformation of the nuclease-encoding gene into a plant, but can simply introduce an infectious recombinant TSWV viral vector to instantly express the CRISPR nucleic acid modification enzyme locally or systemically in plant tissues, thereby achieving modification of the target sequence in the plant cell genome, thereby avoiding the integration of foreign nucleotide sequences in the plant genome.

[0215] In the present invention, the target sequence to be modified may be located at any site in the genome, for example, in a functional gene such as an exon or intron of a protein-coding gene, or in a gene expression regulatory region such as a promoter region or enhancer region, thereby realizing functional modification of the gene or modification of gene expression. In some embodiments of the present invention, the target sequence modification includes one or a combination of multiple types of mutations by deletion, insertion, and substitution of one or more bases, leading to frameshift and premature termination of the open reading frame of the target gene, substitution or deletion of amino acids.

[0216] In addition, when a recombinant template for foreign DNA is provided in plant cells infected with a recombinant TSWV viral vector, it can be used to guide homologous recombination of DNA. When DNA breaks are generated by cleaving a genomic target gene with a nuclease expressed by the viral vector, the released DNA ends are mediated by homologous sequences, and DNA synthesis is performed using the foreign DNA as a template, thereby incorporating a pre-designated foreign sequence into the target gene site.

[0217] Plants in which genetic material may be modified by the methods provided by the present invention include natural or experimental hosts infected with a viral vector, such as, for example, Abelmoschus esculentus, Ageratum houstonianum, Allium cepa, Amaranthus caudatus, Amaranthus hybridus, Amaranthus retroflexus, Amaranthus inosus, Amaranthus viridis, Amaryllis sp., Ananas comosus, Anemone, Apium graveolens var dulce, Aquilegia vulgaris, Arabidopsis thaliana, Arachis spp., and the like. hypogaea, burdock (Arctium lappa), black arum (Arum palaestinum), begonia (Begonia sp.), bean sprout (Belamcanda chinensis), beet (Beta vulgaris), Bidens pilosa, rapeseed (Brassica campestris), cauliflower (Brassica oleracea var botrytis), Chinese cabbage (Brassica pekinensis), bok choy (Brassica rapa ssp. Chinensis), Calceolaria herbeohybrida, calendula (Calendula officinalis), daisy (Callistephus chinensis), campanula glomerata, campanula isophylla, campanula latiloba, campanula pyramidalis, sword bean (Canavalia gladiata), long-legged sword bean (Canavalia obtusifolia), European sword bean (Canavalia occidentalis), shepherd's purse (Capsellabursa-pastoris, peppers (Capsicum annuum), tabasco (Capsicum frutescens), habanero (Capsicum Chinense), Capsicum Baccatum, rocotto pepper (Capsicum Pubescens), papaya (Carica papaya), box-flower (Cassia occidentalis), cowpea (Catharanthus roseus), cornflower (Centaurea cyanus), wallflower (Cheiranthus cheiri), Chinese ragweed (Chenopodium album), American ragweed (Chenopodium ambrosioides), Japanese redweed (Chenopodium amaranticolor), Japanese redweed (Chenopodium murale), Chinese chrysanthemum (Chrysanthemun coronarium, Chrysanthemun indicum, Oxeye daisy (Chrysanthemun leucanthemum), Chrysanthemum (Chrysanthemun morifolium), Chickpea (Cicer arietinum), Endive (Cichorium endiva), Chrysanthemum bittersweet (Cichorium intybus), Cineraria, Watermelon (Citrullus lanatus), Arabica coffee (Coffea arabica), Field weed (Convolvulus arvensis), Rough daisy (Conyza bonariensis), Cordyline fruticose (Cordyline terminalis), Coriandrum sativum, Coreopsis drummondii, Sheeps purse (Coronopus didymus), Crepis Youngia japonica, Crotalaria incana, Crotalaria juncea, Crotalariapallida) (also known as Crotalaria mucronata), melon (Cucumis melo), cucumber (Cucumis sativus), pumpkin (Cucurbita maxima), Japanese pumpkin (Cucurbita moschata), golden melon (Cucurbita pepo), cyclamen (Cyclamen indicum) (also known as Cyclamen persicum), artichoke (Cynara scolymus), dahlia (Dahlia pinnata), Dahlia variabilis, morning glory (Datura stramonium), delphinium (Delphinium sp.), bush clover (Desmodium triflorum), Desmodium unicinatum, Duboisia (Duboisia leichhardtii), Emilia sonchifolia, fennel (Foeniculum vulgare, wild strawberry (Fragaria vesca), barberry (Galinsoga parviflora), daisy (Galinsoga quadriradiata), gladiolus (Gladiolus sp.), soybean (Glycine max), mountain soybean (Glycine soja), globe amaranth (Gomphrena globosa), cotton plant (Gossypium hirsutum), sea cucumber (Gossypium barbadense), sunflower (Helianthus annuus), sea laurel (Hibiscus tiliaceus), amaryllis (Hippeastrum hybridum), daffodil (Hippeastrum reginae), Hippeastrum rutilum, cherry orchid (Hoya carnosa), hydrangea (Hydrangea macrophylla), henbane (Hyoscyamus niger), Holsii (Impatiens holsii), Sultanii (Impatiens sultanii), Wallerana (Impatiens wallerana), Sweet potato (Ipomea batatas), Lactucasativa, sweet pea (Lathyrus odoratus), leucanthemum (Leonotis nepetaefolia), garden lupin (Limonium latifolium), white lupin (Lupinus leucophyllus), spotted lupin (Lupinus mutabilis), Japanese lupin (Lupinus polyphyllus), wolfberry (Lycium procissimum), tomato (Lycopersicon esculentum), wild tomato (Lycopersicon hirsutum), currant tomato (Lycopersicon pimpinellifolium), rabbit mallow (Malva parviflora), stock (Matthiola incana), medicinal plant (Medicago polymorpha), oenothera biennis (Melilotus officinalis), oleander (Nerium oleander, Nicandra physaloides, Nicotiana acuminata, Nicotiana bigelovii, Nicotiana clevelandii, Nicotiana glutinosa, Nicotiana rustica, Nicotiana sylvestris, Nicotiana tabacum, Iceland poppy, Pelargonium hortorum, Petunia hybrida, Phaseolus angularis, Phaseolus vulgaris, Phlox drummondii, Physalis angulata (also known as Physalis minima), Physalis spp, Pisum sativum arvense), pea (Pisum sativum), plantain (Plantago major), black seed plantain (Plantago rugelii), bindweed (Polygonumconvolvulus, Portulaca oleracea, Primula (Primula sp.), Primula malacoides, Primula sinensis, Ranunculus sp., Red raspberry (Rubus idaeus), Rudbeckia amplexicaulis, Saintpaulia ionantha, Salpiglossis, Scabiosa, Schizanthus, Sechium edule, Senecio cruentus, Senecio jacobea, Sesamum indicum, Sinningia eciosa, False Jerusalem cherry (Solanum capsicastrum, horsenettle (Solanum carolinense), solanum laciniatum, horned eggplant (Solanum mammosum), eggplant (Solanum melongena), nightshade (Solanum nigrum), nightshade (Solanum nodiflorum), blue nightshade (Solanum seaforthianum), Solanum triflorum, potato (Solanum tuberosum), sowberry (Sonchus oleraceus), spinach (Spinacia oleracea), wild burdock (Stachys arvensis), Stapellia, Chinese laurel (Stellaria media), Streptosolen jamesonii, French marigold (Tagetes patula), Taraxacum, Tephrosia purpurea, Tribulus terrestris terrestris), white clover (Trifolium repens), Trifolium subterraneum, nasturtium (Tropaeolum majus), Vallota, Verbena brasilliensis, Verbenalitoralis, Verbesina enceloides, broad bean (Vicia faba), black gram (Vigna mungo), mung bean (Vigna radiata), cowpea (Vigna unguiculata), Xanthium saccharatum, calla lily (Zantedeschia aethopica), white spotted calla lily (Zantedeschia albo-maculata), yellow calla lily (Zantedeschia elliottiana), Zantedeschia melanoleuca, peach calla lily (Zantedeschia rehmannii), and zinnia elegans.

[0218] In some embodiments of the present invention, preferred plants include Nicotiana benthamiana, tobacco, tomato, paprika, Tabasco, habanero, ground cherries, potato, camellia, peanut, soybean, and cotton.

[0219] As is well known, plants, especially cultivated crops, include different varieties, also called lines, cultivars, germplasms, genotypes, etc. According to the present invention, the TSWV nuclease delivery vector can effectively infect different varieties of the same species while expressing nucleic acid modifying enzymes to generate similar targeted modification efficiencies of target genes.

[0220] In some preferred embodiments of the present invention, the TSWV nuclease delivery vector was infected into 10 peanut varieties to generate similar targeted modification efficiencies of target genes, including Huayu25, Huayu32, Huayu39, Huayu48, Huayu9616, Fengyou68, Honghua1, Dabaisha, Silihong, and Shuofeng518 varieties.

[0221] In some other preferred embodiments of the present invention, the TSWV nuclease delivery vector was infected into 10 paprika varieties to generate similar targeted gene targeted modification efficiencies, including Zhoula2, Zhoula3, Zhoula4, Fuxiangxiuli, Bola5, Bola7, Bola15, Xingshu201, Xingshu301, and Xingshuguiyan varieties.

[0222] Generally speaking, viral infection of host plants is not dependent on the plant genotype, and the TSWV nuclease delivery vector can effectively infect and modify the genetic material of different varieties, lines, cultivars, germplasms, and genotypes of other host plants.

[0223] Methods for generating genetically modified plants Furthermore, the present invention discloses a method for obtaining plants from the plant cells whose genetic material has been modified, and a method for selecting plants whose genetic material has been modified.

[0224] The plant cells according to the invention may be intact cells infected with a virus or isolated plant cells such as callus, suspension cells, protoplasts, etc.

[0225] Methods for obtaining plant organs or whole plants from plant cells include seed propagation, for example by inducing plant cells to develop into adult embryonic stem cells, which then develop into reproductive cells to produce seeds by sexual reproduction, either naturally or artificially, or by micropropagation, i.e. vegetative propagation of plant cells under isolated conditions using plant tissue culture techniques.

[0226] In some embodiments of the present invention, the method for obtaining a plant with modified genetic material is micropropagation. The method includes tissue culture and plant regeneration using a plant cell or tissue infected by a virus as an explant in a medium that does not contain a selection marker, i.e., no selection agent (e.g., antibiotic, herbicide, etc.) is used in the tissue culture process. Furthermore, the method includes selecting a plant with modified genetic material from the regenerated plant, and the selection process does not require selection by a selection marker, but selects a target gene sequence by restriction enzyme analysis or DNA sequencing analysis.

[0227] Furthermore, the present invention compares the effects of infection with TSWV viral vectors containing / not containing the NSs gene on differentiation and regeneration of plant cells, and finds that the inclusion of NSs inhibits plant regeneration. Therefore, in some preferred embodiments of the present invention, plant cells infected with NSs-deleted TSWV vectors are used for tissue culture to regenerate plants with modified genetic material.

[0228] Methods of plant line culture and regeneration are known to those skilled in the art, and different plant cells have different requirements for medium components and hormone concentrations and ratios.

[0229] In some preferred embodiments of the present invention, Nicotiana benthamiana leaf cells infected with a TSWV nuclease delivery vector are used in tissue culture to obtain lines in which the genetic material has been modified without the insertion of foreign nucleic acid.

[0230] In some preferred embodiments of the present invention, tobacco leaf cells infected with a TSWV nuclease delivery vector are used in tissue culture to obtain lines in which the genetic material has been modified without the insertion of a foreign nucleic acid.

[0231] In some preferred embodiments of the present invention, tomato leaf cells infected with a TSWV nuclease delivery vector were used in tissue culture to obtain lines with modified genetic material without the insertion of foreign nucleic acid.

[0232] When somatic tissue infected with a virus is used for tissue culture, the virus usually remains in the regenerated plant. Infection with a viral vector continues to express nucleic acid modification enzymes in the regenerated plant, modifying target genes in somatic cells to generate non-heritable edits, or modifying non-target genes to generate off-target modifications. In addition, persistent virus infection interferes with plant physiology and phenotype, adversely affecting flowering and fruit set rates. Therefore, the adverse effects can be avoided by removing the viral vector during plant regeneration.

[0233] Certain compounds can effectively inhibit the replication of human or animal RNA viruses in vivo and in vitro, such as certain nucleotides or nucleotide analogues, such as ribavirin, favipiravir, remdesivir, 6-azauridine, oxypurinol, gemcitabine, galidesivir (BCV4430), mizoribine, molnupiravir, sofosbuvir, tenofovir, and the like (Geraghty et al., Viruses, 2021, 13: 667; Borbone et al., Molecules, 2021, 26: 986). These nucleotides or nucleotide analogs target the viral RNA-dependent RNA polymerase (RdRP) and are erroneously incorporated into the nascent viral RNA chain by the RdRp during viral replication, resulting in termination of viral RNA replication or the accumulation of a large number of harmful mutations in the viral genome tissue. The affinity of each compound with each animal RNA virus RdRP is obviously different, so the antiviral effect is also different. The present inventor unexpectedly discovered that when somatic tissue infected with TSWV is used for tissue culture, the virus eradication efficiency of the regenerated strain is significantly improved by adding a specific nucleotide or nucleotide analog to the culture medium, and the proportion of genetic modifications contained in the regenerated strain is obviously increased.

[0234] In some examples of the present invention, when leaf tissue infected with a TSWV CRISPR / Cas12a delivery vector was regenerated in medium containing 40 mg / L ribavirin, 100% of the regenerants were virus-free and the efficiency of generating tetra-allelic mutations at the crPDS1 target site was 28.9%, whereas in the control without antiviral drug, 4.4% of the regenerants were virus-free and 15.6% of the regenerants contained biallelic mutations.

[0235] In some examples of the present invention, when leaf tissue infected with a TSWV CRISPR / Cas12a delivery vector was regenerated in medium containing 40 mg / L favipiravir, 66.7% of the regenerants were virus-free.

[0236] In some examples of the present invention, when leaf tissue infected with a TSWV CRISPR / Cas12a delivery vector was regenerated in medium containing 1.2 mg / L remdesivir, 15.6% of regenerants were virus-free.

[0237] In another aspect, the present invention further provides the recombinant TSWV particle, wherein the viral chimeric genome enveloped by the viral particle contains a coding sequence for a heterologous sequence-specific nucleic acid modifying enzyme. The recombinant TSWV viral particle is inoculated into isolated plant cells or into specific organs or tissues of intact plants, such as leaves, veins, and roots, by a method commonly used in the art, such as inoculation by sap friction, high pressure spray, etc. The viral particle infects the plant cell, and then expresses the nucleic acid modifying enzyme, which induces the plant cell to cleave or modify the target sequence in the plant genome and modify the genetic material.

[0238] In another aspect, the present invention further provides a reagent kit comprising the viral vector elements mentioned by the method and composition. The reagent kit may include a viral vector system and a manual thereof, and includes a) a nucleic acid construct comprising a recombinant TSWV S, M, L chimeric genome sequence, where the S genome comprises one or more heterologous nucleic acid sequences encoding CRISPR guide RNA components, the M genome comprises one or more heterologous nucleic acid sequences encoding Cas nucleic acid modification enzyme components, and the L genome comprises a codon-optimized viral RdRp sequence (SEQ ID NO: 5); and b) an auxiliary expression construct encoding one or more viral silencing suppressors. The viral vector is introduced into a cell, and then generates a recombinant virus, which instantly expresses CRISPR / Cas nucleic acid modification enzymes and modifies the genetic material of the cell genome. The viral vector reagents may be provided alone or in combination, and may be placed in a suitable container, such as a tube, bottle, or vial.

[0239] The editing technology based on the viral vector delivery system disclosed in the present invention has the following advantages over existing technologies:

[0240] (1) The viral vector has good foreign fragment packaging capacity and excellent genetic stability, making it applicable to the delivery of large molecular weight Cas nuclease genes, but the plant cells to be modified do not need to contain the nuclease components expressed by genetic modification.

[0241] (2) The viral vector has a fully infectious virus in plants and is therefore capable of delivering and expressing nucleases in multiple organs and tissues in planta.

[0242] (3) The viroid has a broad host range and can be applied to several important crops because the recombinant virus particles inoculate and infect host plants by abrasion.

[0243] (4) The viral vector is a non-enveloped deletion mutant and cannot be transmitted by insects, possessing excellent biosafety.

[0244] (5) Replication of the viral vector can express large amounts of sequence-specific nucleases, leading to high genome editing efficiency.

[0245] (6) The RNA virus replication process does not involve the DNA stage, so there is no risk of foreign DNA integration, and the obtained edited strains do not contain foreign genetic material.

[0246] (7) In general, viral vector-mediated instantaneous expression is independent of the genotype of the host plant and can be applied to a wide variety of crop varieties, whereas traditional Agrobacterium-mediated stable transformation is usually limited to a few species or specific varieties.

[0247] (8) During strain regeneration, the viral vector can be efficiently removed by antiviral drugs, making it possible to obtain virus-free mutant strains. EXAMPLES

[0248] The present invention will be described in more detail below with reference to the following examples. The examples are used to explain the present invention and do not limit the scope of the present invention. Any modifications or improvements made without departing from the spirit of the present invention are within the scope of the present invention.

[0249] Unless otherwise stated, the experimental methods used in the following examples are conventional methods, and unless otherwise stated, the reagents and materials used are commercially available.

[0250] In the following examples, the recombinant Tomato Spotted Wilt Virus (TSWV) vector is described using the TSWV-XY nomenclature (or abbreviated as VXY), where X refers to the heterologous nucleic acid sequence contained in the M genome and Y refers to the foreign nucleic acid sequence inserted into the S genome. When the genome contains two heterologous nucleic acid elements linked in tandem, they are linked by a semicolon, e.g., TSWV-XY:Z. For example, TSWV-Cas12a-crPDS1:GFP is a recombinant TSWV vector in which the M genome contains a heterologous Cas12a sequence and the S genome contains a heterologous crRNA and GFP sequence. When describing a plasmid construct containing TSWV S, M, and L genome cDNA sequences, the nomenclature pS / M / L is used. (- / +)X In the format, (-) indicates that the construct is inserted downstream of the promoter in the genomic cDNA direction and transcribed to generate viral antisense strand RNA after being introduced into a cell, (+) indicates that the construct is inserted downstream of the promoter in the antigenome cDNA direction and transcribed to generate viral sense strand RNA after being introduced into a cell, and X indicates a heterologous nucleic acid sequence contained in the genome. For example, pM (+)cas12a is a TSWV M antigenomic cDNA vector containing a heterologous Cas12a sequence.

[0251] The Agrobacterium binary vector pCB301-2μ-HDV (FIG. 3A) is disclosed in the literature "Sun K, Zhao D, Liu Y, Huang C, Zhang W, Li Z. Rapid construction of complex plant RNA virus infectious cDNA clones for agroinfection using a yeast-E. coli-Agrobacterium shuttle vector. Viruses. 2017, 9(11). pii: E332."

[0252] The Agrobacterium binary vector pGD (FIG. 3B), and the pGD-GFP and pGD-RFP vectors are disclosed in the literature "Goodin MM, Dietzgen RG, Schichnes D, et al., pGD vectors: versatile tools for the expression of green and red fluorescent protein fusions in agroinfiltrated plant leaves. Plant J, 2002, 31: 375-83."

[0253] The RNA silencing suppressor (VSR) protein expression vectors pGD-HcPro, pGD-p19, and pGD-γb are disclosed in the literature "Ganesan U, Bragg JN, Deng M, et al., Construction of a sonchus yellow net virus minireplicon: a step toward reverse genetic analysis of plant negative-strand RNA viruses. J Virol. 2013, 87: 10598-10611."

[0254] The N. benthamiana codon-optimized SpCas9 sequence is disclosed in the publication "Yin K, Han T, Liu G, et al., Geminivirus-based guide RNA delivery system for CRISPR / Cas9 mediated plant genome editing. Scientific Reports, 2015, 5: 14926."

[0255] The plasmid pYQ230 containing the rice-ecodon-optimized LbCas12a sequence is disclosed in the literature "Tang, X., Lowder, LG, Zhang, T., et al. A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Nature Plants, 2017, 3:17018."

[0256] Nicotiana benthamiana LAB varieties and the 16C transgenic line are disclosed in the publication "Ruiz MT, Voinnet O, Baulcombe DC. Initiation and maintenance of virus-induced gene silencing. Plant Cell, 1998, 10:937-46." Tobacco (N. tabacum cv. K326), tomato (Solanum lycopersicum cv. Hongbaoshi), potato (S. tuberosum), pepper (Capsicum annuum), Tabasco (C. frutescens), habanero (C. Chinense), ground cherries (Physalis grisea), cotton plants (Lactuca sativa), upland cotton (Gossypium hirsutum cv. Junmian No. 1), peanuts (Arachis hypogaea), and soybeans (Glycine max cv. William 82) are common plant experimental materials that are available to the public from the Institute of Biological Technology, Zhejiang University.

[0257] The target gene sequences of Solanaceae plants (Nicotiana benthamiana, Nicotiana tabacum, Tomato, Potato, and Capsicum) can be obtained by searching from the Solanaceae Genome Database (https: / / solgenomics.net / ), while the target gene sequences of Legume plants (Arachis hypogaea, Glycine max) can be obtained by searching from the Legume Genome Information System LIS Database (https: / / legumeinfo.org / ). The Cas12a target site is selected based on the CRISPR RGEN Tools (http: / / www.rgenome.net / ) online software design, and the target sites of Cas9 and Cas9-induced base editors are selected based on the CRISPR-P site (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR) online software design.

[0258] Example 1: Construction of TSWV double reporter gene expression vector Extraction of total RNA from plant samples infected by TSWV: 0.1 g of TSWV virus source stored in this laboratory was immediately ground into powder with liquid nitrogen. Total RNA of the sample was extracted using TRIzol reagent (Invitrogen), and after precipitation with isopropanol, it was dissolved in 50 μL of DEPC-treated pure water and used directly in subsequent experiments or aliquoted and stored in a -80°C refrigerator.

[0259] Obtaining viral genome cDNA by reverse transcription The procedure was carried out while referring to the instruction manual for TaKaRa AMV reverse transcriptase, and the specific steps are as follows:

[0260] 1) The following systems are mixed and reacted:

[0261] [Table 1]

[0262] 2) React in a PCR machine under the following conditions: 42°C for 1 hour, 50°C for 30 minutes, 95°C for 5 minutes, and 4°C for 10 minutes. The harvested product can be directly diluted and used as a PCR template, or stored at -20°C for further use.

[0263] Construction of recombinant TSWV vectors and viral protein instantaneous expression vectors The TSWV genome contains three fragments, S, M and L genome (Figure 2), in descending order, and the sequences are shown in SEQ ID NO: 1, 2 and 3. The three viral genome cDNAs are respectively constructed into the binary vector pCB301-2μ-HDV. As shown in Figure 3A, a blunt-end linearized vector is obtained by pCB301-2μ-HDV digested by StuI / SmaI, and after the foreign viral sequence is inserted, the 35S promoter (SEQ ID NO: 9) initiates transcription from the first base at the 5'-end of the inserted sequence, and the Hepatitis D ribozyme sequence (HDV-RZ) can ensure that the viral RNA transcription unit contains a faithful 3'-end sequence. The viral protein instantaneous expression vector is cloned into the binary vector pGD (Figure 3B). The primer sequences for the vector construction of the present invention are listed in Table 1. The primers and gene fragments are synthesized by GenScript Co., Ltd. (Nanjing).

[0264] 1) PL (+) and pL (+)opt Vector construction pL (+)is the TSWV L antigenome cDNA vector (Figure 4A). The L cDNA obtained by the reverse transcription is used as a template to amplify the L full-length antigenome cDNA (SEQ ID NO: 3) with specific primers L(+) / F and L(+) / R (Table 1). The pCB301-2μ-HDV yeast-Agrobacterium-E. coli shuttle vector is digested with restriction enzymes StuI and SmaI to obtain a linearized plasmid DNA fragment, which is then transformed with the L cDNA fragment. A circular plasmid is obtained by yeast homologous recombination cloning method according to Sun et al. (Viruses. 2017, 9. pii: E332.). Yeast colonies are selected on a tryptophan-deficient yeast plate to extract the plasmid, which is then transformed into E. coli, and the plasmid is extracted and digested for verification. The positive yeast plasmid clones that passed the test are then verified by Sanger sequencing to obtain pL (+) Get the.

[0265] pL (+)opt pL (+) pL is derived from the RdRp coding sequence (SEQ ID NO: 4) and replaced by a codon-optimized sequence (SEQ ID NO: 5) (Figure 4A). The RdRp codons were optimized according to N. benthamiana codon preferences, and potential intron-exon splicing sites were predicted for the wild-type RdRp sequence by the software Alternative Splice Site Predictor (ASSP) (http: / / wangcomputing.com / assp / ), and the predicted splice sites were removed to obtain the codon-optimized RdRp sequence (SEQ ID NO: 5). (+) The plasmid was used as a template to amplify the vector fragment from which the RdRp coding sequence was deleted with primers Lopt 5' UTR / F and Lopt 3' UTR / R, and the vector fragment was transformed into yeast cells together with the chemically synthesized codon-optimized RdRp fragment to obtain the recombinant clone pL (+)opt Assemble the parts.

[0266] 2) pM (-) , pM (-)RFP and pM (+)RFP Vector construction pM (-) is the TSWV M genome cDNA vector (FIG. 4B). The M cDNA obtained by the reverse transcription was used as a template to amplify with primers M 5'UTR / F and M 3'UTR / R to obtain the M full-length genome cDNA (SEQ ID NO: 2). Both sides of the primer pair contain 15 bp sequences that are homologous to both sides of the linearized pCB301-2μ-HDV vector of StuI and SmaI. The M full-length genome cDNA fragment was inserted into the linearized pCB301-2μ-HDV vector using In-Fusion clone reagent (Invitrogen) to obtain pM (-) Obtain the plasmid.

[0267] pM (-)RFP pM (-) This is a vector in which the GP gene in the plasmid is replaced by the RFP gene (Figure 4B). The primer pairs M IGR / ScaI / F and M IGR / R, and RFP / M 3'UTR / F and pCB-PmeI / R are used to amplify pM(-) as a template to obtain the ScaI-IGR fragment containing the complete M intergenic (IGR) sequence, and the 3'UTR-PmeI fragment containing the 3'UTR of M to the PmeI digest site of the pCB301 vector. In addition, the RFP fragment is amplified from the pGD-RFP plasmid using primers RFP / F and RFP / R, and the pM(-) vector is digested with restriction enzymes ScaI and PmeI, and the vector fragment is recovered. The four fragments are ligated using In-Fusion clone reagent to obtain pM (-)RFP Get the.

[0268] pM (+)RFP and pM (-)RFP The primers 35S / M 3'UTR / F and HDV / M 5'UTR / R were used to generate pM (-)RFPUsing this as a template, the viral M genome cDNA containing RFP was amplified and ligated with pCB301-2μ-HDV digested with SmaI / StuI by In-Fusion cloning.

[0269] 3) pS (+) and pS (+)GFP Vector construction p.S. (+) is the TSWV S antigenome cDNA vector (FIG. 4C). The S cDNA obtained by the reverse transcription was used as a template to amplify the S antigenome full-length cDNA fragment (SEQ ID NO: 1) with primers 35S / S 3'UTR / F and HDV / S 5'UTR / R, and the S antigenome full-length cDNA fragment was ligated with the StuI / SmaI double-digested pCB301-2μ-HDV vector fragment by In-Fusion clone.

[0270] p.S. (+)GFP pS (+) The NSs gene in the plasmid is replaced by the GFP gene (Figure 4C). (+) Using the vector as a template, the DNA fragment with the NSs sequence removed is amplified with primers S 5'UTR / F and S IGR / R. Using the pGD-GFP plasmid as a template, the GFP fragment is amplified with primers GFP / 5'UTR / F and GFP / IGR / R. The two fragments are seamlessly ligated by In-Fusion to obtain pS (+)GFP Get the.

[0271] 4) Construction of pGD-NSs and pGD-NSm expression vectors Using the S and M cDNA obtained by reverse transcription as templates, primer pairs BamHI / NSs / F and SalI / NSs / R, BamHI / NSm / F and SalI / NSm / are used to amplify cDNA fragments coding for NSs (SEQ ID NO: 7) and NSm (SEQ ID NO: 8), respectively. The PCR products digested with BamHI and SalI are ligated with pGD vector to obtain instantaneous expression vectors pGD-NSs and pGD-NSm, respectively.

[0272] Example 2: Simultaneous expression of two fluorescent reporter proteins by TSWV vectors Inoculation of Agrobacterium into Nicotiana benthamiana by infiltration The pL (+)opt , pM (-)RFP , pM (+)RFP , pS (+)GFP , pS (+) The viral genome cDNA binary plasmid is transformed into Agrobacterium bacterial strain EHA105 by electric shock, and at the same time, the TSWV movement protein NSm expression vector pGD-NSm, the TSWV silencing suppressor protein NSs expression vector pGD-NSs, and heterologous viral RNA silencing suppressor (VSR) expression vectors, such as pGD-p19 (tombusvirus p19 protein), pGD-HcPro (tobacco etch virus HcPro protein), and pGD-γb (barley stripe mosaic virus γb protein), are transformed into Agrobacterium bacterial strain EHA105 by electric shock, respectively. A single colony of Agrobacterium was selected and inoculated into 4 mL of YEP liquid medium (beef extract 10 g / L, yeast extract 10 g / L, NaCl 5 g / L, pH 7.0) containing 50 μg / mL kanamycin and 25 μg / mL rifampicin, and the OD 600 The bacteria were cultured overnight at 28°C and 220 rpm so that the OD was 0.8-1.2, and then centrifuged at 5,500 rpm for 10 minutes to collect the bacterial precipitate. The bacteria were then resuspended in infiltration buffer (10 mM MgCl2, 10 mM MES, 200 mM acetosyringone) and the OD was adjusted to 0.8-1.2. 600 Adjust the pH so that it is approximately 1.0 and leave it to stand for 2-3 hours.

[0273] To rescue recombinant viruses carrying two reporter genes and to measure the effects of M genome polarity (sense or antisense) and co-expression of NSm protein on the efficiency of recombinant virus rescue, Agrobacterium mixtures were prepared in the following three combinations and infiltrated into Nicotiana benthamiana leaves to rescue the recombinant viruses.

[0274] Experimental group 1: pL (+)opt , pM (-)RFP , pS (+)GFP , pGD-p19, pGD-HcPro, pGD-γb, pGD-NSs Experimental group 2: pL (+)opt , pM (+)RFP , pS (+)GFP , pGD-p19, pGD-HcPro, pGD-γb, pGD-NSs Experimental group 3: pL (+)opt , pM (+)RFP , pS (+)GFP , pGD-NSm, pGD-p19, pGD-HcPro, pGD-γb, pGD-NSs The final concentrations of the mixture containing the S, M, and L genome plasmids were OD 600 = 0.1, and the bacterial solutions containing each RNA suppressor plasmid were mixed in equal proportions to a final concentration of OD 600 = 0.05, and the final concentration of the bacterial solution containing the pGD-NSm expression vector was adjusted to OD 600 = 0.1. Using the method shown in FIG. 5A, three lower leaves of Nicotiana benthamiana plants at the 5-7 leaf stage were infiltrated in each of the three experimental groups, and the inoculated plants were cultured in an insect-proof greenhouse at 25°C.

[0275] Reporter gene expression analysis Five days after infiltration, N. benthamiana leaves infiltrated with all three combinations expressed GFP and RFP, and GFP-expressing leaf tissue was more localized compared to RFP-expressing tissue, especially in experimental group 3 (Figure 5B).

[0276] Seven days after infiltration, all the upper noninfiltrated leaves in experimental groups 1 and 2 showed green and red fluorescence, and after 10 days, the systemically infected leaves showed a broad spread of fluorescence. In contrast, the fluorescence of the systemically infected leaves of N. benthamiana infiltrated in experimental group 1 appeared slightly later, and after 10 days, it showed scattered red and green fluorescent spots (Fig. 5B).

[0277] Six to eight days after infiltration, all inoculated plants in experimental groups 1 and 2 showed a succession of virus infection symptoms, such as curling, shrinking, and chlorosis of young leaves, while in experimental group 3, systemic infection of the plants was delayed by 2 to 3 days. All systemically infected plants expressed fluorescent proteins under UV and other conditions (Figure 5C). Total protein from the upper leaves was extracted and Western blot analysis was performed using TSWV N polyclonal antibody, GFP polyclonal antibody, and mCherry polyclonal antibody, respectively. The total protein from the leaves of all three experimental groups showed stripes of the virus N protein, GFP protein, and RFP protein, while the control group without the L genome plasmid did not show the corresponding stripes (Figure 5D).

[0278] The above results indicate that i) the L and S antigenome cDNA vectors generate viral RNA by transcription, which in turn generates sufficient RdRp and N proteins for packaging the viral genome by translation to form a nucleocapsid infectious unit; ii) the M genome leads to the generation of recombinant viruses despite the use of the genome cDNA vector (experimental group 1) and the antigenome cDNA vector (experimental groups 2 and 3); iii) the provision of a separate viral movement protein instantaneous expression vector does not promote the rescue of recombinant viruses, but rather delays the rescue of viruses (compared to experimental groups 2 and 3); iv) the recombination of the NSs and GP gene deletions systemically infects N. benthamiana and simultaneously expresses the reporter genes GFP and RFP.

[0279] Example 3: Effect of RNA silencing suppressor combinations on recombinant virus rescue The Agrobacterium infiltration mixture of Example 2 contains four RNA silencing suppressor (VSR) expression vectors, namely, pGD-p19, pGD-HcPro, pGD-γb, and pGD-NSs. This example further measured the effect of expression of single or multiple viral silencing suppressor combinations on recombinant TSWV rescue. For the Agrobacterium mixture, pL (+)opt , pM (-)RFP , pS (+)GFP The final concentration of each plasmid-containing bacterial solution was OD 600 The final concentration of each VSR plasmid was adjusted to OD = 0.1. 600 = 0.05.

[0280] Experimental group 1: pGD-p19, pGD-HcPro, pGD-γb, pGD-NSs (pGD-VSRs) Experimental group 2: pGD-p19 Experimental group 3: pGD-HcPro Experimental group 4: pGD-γb Experimental group 5: pGD-NSs Experimental group 6: pGD-p19, pGD-HcPro Experimental group 7: pGD (blank control) Eight days after inoculation, 16-18 of the 20 invaded strains in experimental groups 1 (VSRs), 2 (p19), and 6 (p19+HcPro) showed systemic infection symptoms, i.e., the rescue efficiency was 80-90%. In experimental groups 3 (HcPro), 4 (γb), and 5 (NSs), 7, 12, and 2 strains showed systemic infection, respectively. According to the time and ratio of systemic infection, the efficiency was highest in experimental groups 2, 1, 6, 4, 3, and 5. Even after 20 days after inoculation, no systemic infection was observed in the 20 invaded strains in experimental group 7 (Figure 6). The above results show that the co-expression of silencing suppressors has different degrees of promoting effect on the rescue of recombinant TSWV vector, especially p19 has the most significant effect, and NSs protein has a low efficiency.

[0281] Example 4: Design and construction of TSWV-Cas12a-crRNA editing vector The CRISPR / Cas12a nuclease system includes Cas12a protein and a guide RNA (crRNA) that binds to a target. As shown in Figure 7, the construction strategy of the TSWV-Cas12a-crRNA vector is as follows: i) The GP sequence in the TSWV M genome is replaced with a sequence encoding Cas12a to construct the genomic cDNA vector pM (-)Cas12a and antigenome cDNA vector pM (+)Cas12a ii) constructing the crRNA sequence into pS (+)GFP Insert the GFP coding frame adjacent to the start codon 5' into the vector pS (+)crRNA:GFP The vector is constructed. The structure of the inserted crRNA sequence is "Direct Repeat-Guide Sequence-Direct Repeat", and the design of the two direct repeats is to process the crRNA initial transcription unit generated in the S genome by the Cas12a protein expressed in the M genome, splice the virus-derived sequence on the side chain, and release the correct crRNA sequence. The specific construction method is described in detail below.

[0282] 1) pM (-)Cas12a and pM (+)Cas12a Vector construction A plasmid (derived from pYQ230) containing the Rhinekodon-optimized Cas12a sequence and flanked by a nuclear localization signal and a 3xFlag antigen epitope sequence (SEQ ID NO: 10) is used as a template to amplify with primers M UTR / Cas12a / F and Cas12a / R (Table 1) to obtain a 3xFlag-NLS-Cas12a-NLS fragment. Amplified from pM(-) plasmid with primers M 3'UTR / F and Cas12a / M IGR / R to obtain an M vector fragment lacking the GP sequence. The above two fragments are ligated using In-Fusion cloning reagent to obtain pM (-)Cas12a Generate a vector.

[0283] pM (-)Cas12aUsing the above as a template, the recombinant M genome cDNA fragment was obtained by amplifying it with primers 35S / M 3'UTR / F and HDV / M 5'UTR / R, and then ligated to the pCB301-2μ-HDV vector fragment digested with restriction enzymes StuI and SmaI by the In-Fusion cloning method, and inserted into the vector in the antigenome cDNA direction to obtain pM (+)Cas12a Generate a vector.

[0284] 2) pS (+)crRNA:GFP Constructing a series vector To facilitate the insertion of crRNA, (+)GFP Insert one SpeI digest site 5' into the plasmid GFP start codon. (+)GFP Using the PacI single digest site in the IGR sequence and the PvuI single digest site in the NOS sequence of the vector, the primer pairs SpeI / GFP / F and IGR PacI / R, and NOS PvuI / F and S 5'UTR / R were used to construct pS (+)GFP The PacI-IGR-GFP-SpeI and SpeI-5'UTR-HDV-NOS fragments are obtained by amplifying them from the vector. The fragments are then aliquoted into pS (+)GFP Inserted into the vector pS (+)SpeI:GFP Get the intermediate vector.

[0285] Based on the CRISPR RGEN Tools (http: / / www.rgenome.net / ) online design software, the target site crPDS1 (5'-TTTCTGCCGTTAATTTGAGAGTCCAAG-3') (SEQ ID NO: 12) of Nicotiana benthamiana and tobacco phytoene desaturase gene (PDS) (bold letters are PAM sequences, as below), the target site crPDS2 (5'-TTTCTGCTGTTAACTTGAGAGTCCAAG-3') (SEQ ID NO: 13) of tomato PDS, the target site crPDS3 (5'-TTTCTGCTGTCAACTTGAGAGTCCAAG-3') (SEQ ID NO: 14) of pepper PDS, and the target site crPDS4 (5'-TTTGACAGAAAACTGAAGAACACATAT-3') (SEQ ID NO: 15) of peanut and soybean PDS were selected. The crRNA sequences targeting the target sites (represented in SEQ ID NOs: 18-21, respectively) have the structure "direct repeat-guide sequence-direct repeat" and contain SpeI digest sites on both sides. (+)SpeI:GFP Insert into the SpeI site of the vector pS (+)crPDS1:GFP , pS (+)crPDS2:GFP , pS (+)crPDS3:GFP , pS (+)crPDS4:GFP Generate a vector.

[0286] Example 5: Construction of recombinant TSWV-Cas12a-crRNA rescue system In Example 2, rescue conditions for the TSWV-RFP-GFP vector were established, and it was found that the M genome and antigenome cDNA vectors could be applied to rescue recombinant viruses. According to the initial preliminary experiments in this example, the insertion of a Cas12a gene of just under 4 kb into the M genome had a clear effect on the generation of the TSWV-Cas12a-crRNA vector. Therefore, this example comprehensively investigated the experimental conditions for generating the TSWV-Cas12a-crRNA vector, including the polarity (sense or antisense) of the M genome and the relative ratio of each genome component. As shown below, eight combinations were used at different concentrations (OD600 ) were prepared, and each combination contained the L, M, S cDNA vectors and four VSR vectors, namely, pGD-p19+ pGD-HcPro+ pGD-γb+ pGD-NSs. Groups 1-4 contained the M genome cDNA vector pM (-)Cas12a Groups 5-8 include the M antigenome cDNA vector pM (+)Cas12a and groups 5-7 contain the pGD-NSm expression vector.

[0287] [Table 2]

[0288] The Agrobacterium composition was used to infiltrate Nicotiana benthamiana leaves to carry out recombinant virus rescue. As shown in FIG. 8A, after 5 days, each combination was observed to have GFP fluorescence widely distributed in the infiltrated leaves. After 9 days of infiltration, some combinations showed systemic infection symptoms in the infiltrated strains, while all strains in groups 1, 2, and 3 were consistently free of recombinant virus infection, and only 2 strains (4%) out of 50 inoculated strains in group 4 eventually showed recombinant virus infection. As shown in the above table, the infection rates of groups 5-8 expressing M antigenome RNA were 10%, 28%, 60%, and 83%, respectively, which were obviously higher than those of groups 1-4 expressing M genome RNA. The ratios of Agrobacterium carrying M plasmid and S plasmid in groups 5-8 were 1:1, 2:1, 10:1, and 10:1, respectively, indicating that highly efficient recombinant virus rescue requires a relatively high concentration of M antigenome cDNA plasmid.

[0289] The combination showed typical TSWV symptoms in systemically infected strains (Figure 8B). Total protein samples from the upper leaves of two systemically infected strains in Group 4 and two randomly infected strains in Group 8 were extracted and subjected to Western blot analysis using TSWV N polyclonal antibody, GFP polyclonal antibody, and Flag monoclonal antibody (detecting Cas12a protein), respectively. These samples showed the expression of viral N protein and GFP protein, but only two samples in Group 8 showed striped patterns of Cas12a protein, and two samples in Group 4 showed no detected expression of Cas12 (Figure 8C). In addition, to investigate why the expression of Cas12a was not detected in the strains of group 4, total RNA samples were extracted from the systemically infected leaves of the four strains, and reverse transcription PCR (RT-PCR) was performed to detect the NSm gene and Cas12a insert fragment of the recombinant virus M genome in the four samples using specific primers NSm / F (5'-ATGTTGACTTTTTTTGGTAATAAGGG-3') (SEQ ID NO: 24) and NSm / R (5'-CTATATTTCATCAAAAGATAACTGAGC-3') (SEQ ID NO: 25) to amplify NSm, and the primer pair IGR / F (5'-TACTTTTAATACCACTTATTTAAGCTT-3') (SEQ ID NO: 26) and M UTR / R (5'-AGAGCAATCAGTGCAAACAAAAAC-3') (SEQ ID NO: 27) for the Cas12a flanking chain. As shown in Figure 8D, four samples were detected to have the expected size of NSm gene, two samples in group 8 were detected to have the target Cas12a stripe pattern of ~4.3 kb in size, while two samples in group 4 were detected to have only a small fragment of about 0.5-0.7 kb. The deleted fragments were cloned and subjected to Sanger sequencing analysis, and it was found that most of the Cas12 insertion fragment in the recombinant virus of group 4 was deleted, and only a part of the 5' and 3' sequences of the Cas12a gene remained (Figure 8E).

[0290] According to the above results, unlike the TSWV-RFP-GFP vector rescue system, the M genome cDNA vector pM (-)Cas12aThe Agrobacterium mixture containing pM was not applicable to rescue TSWV-Cas12a-crRNA or the rescued recombinant virus lost most of the Cas12a insertion sequence, but the M antigenome cDNA vector pM (+)Cas12a can be applied to generate complete TSWV-Cas12a-crRNA vectors. When the Agrobacterium ratio with L genome vector, M genome vector, and S genome vector is 2:10:1, the rescue of recombinant virus is most efficient (group 8), but the instantaneous expression of NSm protein has no promoting effect on the rescue of recombinant virus vector (compare groups 7 and 8). Therefore, in the following related examples, the Agrobacterium combination and concentration of group 8 are used to rescue recombinant virus.

[0291] Example 6: Editing of N. benthamiana PDS gene with TSWV-Cas12a-crRNA vector The N. benthamiana strain is an allotetraploid, and the target site crPDS1 sequence of the PDS gene (5'-TTTCTGCCGTTAATTTGA GAGTC CAAG-3'; SEQ ID NO: 12) (bold alphabets are PAM, underlined bases are HinfI digest sites) is conserved in the PDSa and PDSb gene species derived from the two ancestral parent genomes (Figure 9A). (+)crPDS1:GFP The vector contains a crRNA sequence capable of targeting the crPDS1 site. Based on the Agrobacterium infiltration component (experimental group) with a mixture of each vector of the test system of group 8 in Example 5, pS (+)crPDS1:GFP pS without crRNA instead of vector (+)GFP The vector was used as a negative control, as follows:

[0292] Experimental group: pL (+)opt , pM (+)Cas12a , pS (+)crPDS1:GFP , pGD-p19+ pGD-HcPro+ pGD-γb+ pGD-NSs Control group: pL (+)opt , pM (+)Cas12a , pS (+)GFP, pGD-p19+ pGD-HcPro+ pGD-γb+ pGD-NSs The two Agrobacterium mixtures were infiltrated into Nicotiana benthamiana leaves, and about 10 days after inoculation, TSWV symptoms such as leaf curling and shrinking and chlorotic spots were observed, and GFP protein was expressed in the systemically infected leaves (Figure 9B). The tissues of the systemically infected leaves were collected and total proteins were extracted, and TSWV N, GFP, and Cas12a proteins were detected using specific antibodies (Figure 9C).

[0293] To verify whether the cells infected with the viral vector have edited the target gene site, the polymerase chain reaction / restriction enzyme digestion (PCR / RE) is used to detect genome editing at the target site. If editing has occurred at the target site, the restriction enzyme site partially overlapping with the Cas12a digest site will be destroyed, and the target DNA PCR fragment cannot be digested by the corresponding endonuclease. The specific method is as follows:

[0294] 1) PureLink (登録商標) Genomic DNA is extracted from upper leaf tissue of plants using the Quick Gel Extraction Kit (Invitrogen).

[0295] 2) Perform PCR amplification on a genomic DNA fragment containing the target crPDS1 using specific primers on either side of the target sequence in Table 2.

[0296] 3) Digest the PCR product with restriction enzymes. A typical digest system is as follows:

[0297] [Table 3]

[0298] PCR / RE analysis showed that the mutation efficiency of the PDS target site in the strain infected with TSWV-Cas12a-crPDS1:GFP was about 50%, while the tissue infected with the control V-Cas12a-GFP had no editing of the target site (Figure 9D).The above results indicate that the TSWV vector can systemically deliver the Cas12a / crRNA complex in N. benthamiana and generate site-specific editing at the target site with high efficiency.

[0299] Example 7: Mechanical propagation and stability analysis of TSWV-Cas12a-crRNA viral particles In Example 6, the infection of N. benthamiana plants with the TSWV-Cas12a-crPDS1:GFP vector was initiated by Agrobacterium infiltration inoculation, but many plants are significantly less susceptible to Agrobacterium transformation than the model plant N. benthamiana. To verify the feasibility of inoculation with other viruses, this example explored the feasibility of mechanical inoculation of recombinant virus particles into other plants, and the test flow is as follows (Figure 10A):

[0300] 1) Infiltrate Nicotiana benthamiana with Agrobacterium to generate TSWV-Cas12a-crPDS1:GFP recombinant virus.

[0301] 2) The upper leaves of systemically infected Nicotiana benthamiana plants are collected and polished with inoculation buffer (0.01 mM sodium sulfite, 0.01 mM potassium phosphate, pH 7.0) to obtain viral sap.

[0302] 3) First, sprinkle 600 mesh emery evenly on the leaves to be inoculated.

[0303] 4) Apply the virus sap to the finger pad and gently rub the leaf to inoculate. Alternatively, centrifuge the virus sap at 12,000 rpm for 10 minutes in a tabletop centrifuge. Remove the supernatant of the virus sap and add surfactant silwet70 to a final concentration of 0.1% (v / v). Load the virus sap into a high-pressure spray gun and adjust the air pump of the spray gun until the air pressure stabilizes at 40 PSI. Then, point the nozzle of the spray gun at the emery-sprayed leaves and spray the virus sap at a distance of 3-5 cm.

[0304] 5) After inoculation is complete, spray sterile water to wash away any emery remaining on the leaves.

[0305] 6) Detect infection with the recombinant virus by symptom observation, fluorescent imaging, Western blot, RT-PCR, etc. Detect genome editing at the target site by PCR / RE and / or Sanger sequencing.

[0306] The TSWV-Cas12a-crPDS1:GFP sap was inoculated into healthy seedlings of N. benthamiana, potato, Chinese lantern plant, cotton, and Japanese laurel by the mechanical inoculation method. After 8-16 days of inoculation, the plants of N. benthamiana, potato, Chinese lantern plant, and Japanese laurel plant inoculated by friction and high-pressure spraying showed virus infection symptoms, and green fluorescent signals were detected in the infected plant tissues by fluorescence microscopy (Figure 10B). Taking the systemically infected N. benthamiana plant as an example, Western blot analysis showed that TSWV N protein, Cas12a, and GFP protein could be detected in the tissues of the systemically infected N. benthamiana plant (Figure 10C). The editing efficiency of the target sequence of the N. benthamiana PDS gene was detected by the PCR / RE method of Example 6. For two randomly selected strains inoculated by friction and two strains inoculated by high-pressure spray, the mutation efficiency of the PDS target site was 47-71% (Figure 10D), which is comparable to the editing efficiency of the strains inoculated by Agrobacterium (43-55%, Example 6).

[0307] Because the crPDS1 target site is conserved in N. benthamiana and the two copies of the tobacco PDS gene (Figure 11A), the recombinant virus sap was used as a virus source to inoculate tobacco plants by friction. About 8 days after inoculation, green fluorescence was observed in the systemically infected leaves, and symptoms such as chlorotic spots, yellowing of the vein, and leaf shrinkage appeared (Figure 11B). Furthermore, the expression of TSWV N, Cas12a, and GFP proteins was detected (Figure 11C). Genomic DNA was amplified with tobacco target site-specific primers (Table 2), and PCR / RE analysis showed that the mutation efficiency of the PDS target site in tissues infected by the recombinant virus could reach 56% (Figure 11D).

[0308] The above results demonstrated that sap containing recombinant virus particles could effectively infect many plants by mechanical inoculation, and the progeny viruses stably expressed heterologous nucleases and reporter proteins to induce targeted editing.

[0309] Example 8: Application of TSWV-Cas12a-crRNA vector in tomato and pepper genome editing The target site of the tomato PDS gene, crPDS2 (5'-TTTCTGCTGTTAACTTGA GAGTC CAAG-3' (SEQ ID NO: 13) (bold letters are PAM, underlined bases are HinfI digest site). As shown in FIG. 12A, pS (+)crPDS2:GFP The vector contains a crRNA sequence capable of targeting the site. (+)opt , pM (+)Cas12a , pS (+)crPDS2:GFPAgrobacterium carrying each vector, pGD-p19, pGD-HcPro, pGD-γb, and pGD-NSs, were mixed in an appropriate ratio and inoculated into N. benthamiana leaves by infiltration to rescue the recombinant virus. Three days after the inoculated plants showed systemic infection symptoms, the top young leaves were used as the virus source to inoculate tomato plants at the 4-6 true leaf stage by rubbing, and healthy N. benthamiana juice was rubbed onto the tomato plants as a negative control. The tomato plants rubbed with TSWV-Cas12a-crRNA virus juice showed symptoms such as chlorosis, ring mottling, and shrinkage about 12 days after inoculation, and GFP expression was observed in the systemically infected leaves by fluorescence microscopy (Figure 12B). 15 days after inoculation, total protein was extracted from the systemically infected leaves and Western blot analysis was performed to detect the expression of TSWV N, Cas12a, and GFP proteins (Figure 12C). Genomic DNA was amplified from six randomly selected infected tomato leaves using tomato target site-specific primers (Table 2), and PCR / RE analysis showed that the mutation efficiency of the PDS target site in tissues infected by the recombinant virus was 53-89% (Figure S12D).

[0310] The plant commonly known as chili pepper includes several species of the genus Capsicum, including paprika (C. annuum), tabasco (C. frutescens), and habanero (C. chinense). Furthermore, the target site of the PDS gene, crPDS3 (5'-TTTCTGCTGTCAACTTGA GAGTC CAAG-3' (SEQ ID NO: 14) (bold letters are PAM, underlined bases are HinfI digest site) was selected (Figure 13A). Using the method of Example 6, pS (+)crPDS3:GFP Vectors and pL (+)opt , pM (+)Cas12aThe pGD-p19, pGD-HcPro, pGD-γb, and pGD-NSs vectors were introduced into Nicotiana benthamiana leaves by Agrobacterium infiltration, and the obtained recombinant viruses were inoculated into pepper seedlings at the 4-6 leaf stage by rubbing. After about 12 days, the systemically infected leaves of these pepper plants showed slight chlorosis and yellowing, as well as GFP expression (Figure 13B). Western blot analysis showed that the symptoms were due to the infection of pepper with the recombinant viruses (Figure 13C), and PCR / RE analysis (primers are shown in Table 2) showed that the mutation efficiency of the PDS target site in the pepper tissues infected by the recombinant viruses was 87-94% (Figure 13D). PCR amplification (primers are shown in Table 2 ) was performed on the target site sequences of these pepper strains, followed by high-throughput sequencing, revealing that the mutation efficiencies of the PDS gene target site in Tabasco, paprika, and habanero are 51.5%, 64.0%, and 49.3%, respectively.

[0311] According to the above experimental results, the recombinant TSWV-Cas12a-crRNA vector was inoculated into multiple Solanaceae crops by friction to infect them and induce targeted genome editing.

[0312] Example 9: Application of TSWV-Cas-crRNA vector in Physalis genome editing Physalis alkekengi L. is a plant of the genus Physalis in the Solanaceae family, and is phylogenetically close to tomato. Research has shown that mutated ER genes shorten internodes in tomato and Physalis alkekengi (Kwon et al., Rapid customization of Solanaceae fruit crops for urban agriculture. Nat Biotechnol, 2020, 38: 182-188). The target site of the Physalis alkekengi ER gene, crER: 5'-TTTAATGTTAAACCTTTAGTGTCCTTT-3' (bold letters are PAM, SEQ ID NO: 88), was selected and transformed into pS (+)crER:GFPUsing the method described in Example 6, a pS capable of targeting the site is constructed. (+)crER:GFP Vectors and pL (+)opt , pM (+)Cas12a The pGD-p19, pGD-HcPro, pGD-γb, and pGD-NSs vectors were introduced into Nicotiana benthamiana leaves by Agrobacterium infiltration, and the obtained recombinant viruses were inoculated into Chinese lantern plant seedlings at the two-leaf stage by rubbing. After 10 days, the systemically infected leaves showed chlorosis and slight curling, and GFP expression was observed (Figure 14A). Western blot analysis showed that the viral N protein, GFP protein, and Cas12a protein were detected in Chinese lantern plant tissues infected with the recombinant viruses (Figure 14B). High-throughput detection of the amplicons of the target and nearby sequences showed that the mutation efficiency of the PDS target site in the tissues infected with the recombinant viruses was about 52.9% (Figure 14C).

[0313] According to the above experimental results, the recombinant TSWV-Cas12a-crRNA vector was inoculated into Physalis orbiculatus by friction to infect it and induce targeted genome editing.

[0314] Example 10: Application of TSWV-Cas12a-crRNA vector in peanut and soybean genome editing Peanut (Arachis hypogaea) is an allotetraploid whose genome is derived from two wild species, Arachis duranensis and Arachis ipaensis. The designed target sequence crPDS4 (5'-TTTGACAGAAAACTGAAGAACA CATAT(G)-3' (SEQ ID NO: 15) (bold letters are PAM, and the underlined target base sequence and the target side chain (G) base constitute an NdeI digest site) is conserved in the two endogenous PDS gene copies of peanut (Figure 15A). Using the method according to the above embodiment, first, Agrobacterium infiltrates a N. benthamiana plant to obtain a recombinant virus carrying a Cas12a nuclease sequence for the target site, and then inoculates the N. benthamiana sap containing the virus into four-leaf stage peanut seedlings by friction. Since peanut leaves have a thick wax layer, 0.01 M β-mercaptoethanol is added to the inoculation buffer to improve the penetration of the inoculation solution. Ten days after inoculation by friction, green fluorescence was observed in the systemically infected leaf tissues of some peanut plants, along with symptoms such as chlorosis, yellowing, and dwarfing (Figure 15B), and the expression of TSWV N, Cas12a, and GFP proteins was detected in the systemic tissues (Figure 15C). The PCR / RE method was used to detect PDS target site editing, and the target editing efficiency was 48-59% in the systemically infected leaf tissues of three randomly selected infected peanut plants (Figure 15D).

[0315] The crPDS4 target site is also conserved in soybean PDS genes (Figure 16A), and the recombinant virus has also been used for mechanical inoculation of soybean strains. Systemically infected leaves of N. benthamiana infected with the recombinant virus were homogenized in inoculation buffer, centrifuged at 12,000 rpm for 1 min in a tabletop centrifuge, and the supernatant was then taken and injected into soybean cotyledons 4 days after germination using a 1-mL syringe with a needle. Four days after inoculation, clear green fluorescence was observed near the puncture wound in the cotyledons, and 8 days after inoculation, the fluorescence spread to the surrounding tissues, but there was only red background fluorescence in soybean cotyledons injected with healthy plant sap (Figure 16B). Expression of TSWV N, Cas12a, and GFP proteins was detected in the total protein samples of the inoculated cotyledon tissue (16C). At the same time, the primers in Table 2 were used to amplify sequences containing the target site in the total DNA samples. PCR / RE protection tests showed that the mutation efficiency of the target gene was 27-46% in the cotyledon samples of the three strains (Figure 16D).

[0316] The above experimental results demonstrate that the recombinant TSWV editing vector can infect plant hosts of multiple families or genera by mechanical inoculation and can cause targeted DNA editing with high efficiency.

[0317] Example 11: Editing of the paprika genome by the TSWV genome editing vector is not variety-specific The target crPDS6 (5'-TTTCTGCTGTCAACTTGAGAGTCCAAG-3') (the bold text is the PAM sequence, SEQ ID NO: 99) which is conserved in the PDS genes of 10 paprika (C. annuum) varieties was selected and transformed into pS (+)crPDS6:GFP The vector was constructed and inoculated into 10 pepper varieties by the method described in Example 8. About 7 days after inoculation, symptoms such as spots and shrinkage were observed in the upper non-inoculated leaves. Total protein was extracted from the systemically infected leaf tissue, and Western blot analysis was used to detect the viral N protein and expressed Cas12a and GFP (Figure 17A). Each variety was effectively systemically infected by the viral vector, but there was a certain difference in infection efficiency (Figure 17B). Young systemically infected leaf tissue was taken, total DNA was extracted, and the DNA sequence of the target site region was amplified and deep sequencing was performed. The sequencing results showed that the editing efficiency of each variety was within the range of 50.7-64.4%, with no obvious difference (Figure 17B). The above results showed that the recombinant TSWV genome editing vector effectively infected each pepper variety and caused targeted genome editing, without any variety genotype dependency.

[0318] Example 12: Editing of the peanut genome with the TSWV genome editing vector is not variety-restricted The target crPDS5 (5'-AATGCAATGTATATTGATTGCCTTAAA-3') (the bold text is the PAM sequence, SEQ ID NO: 98), which is conserved among the endogenous PDS gene copies of the 10 peanut varieties, was selected and transformed into pS (+)crPDS5:GFPThe vector was constructed and inoculated into 10 peanut varieties by the method described in Example 10. About 7 days after inoculation, symptoms such as spots and yellowing were observed in non-inoculated leaves (Figure 18A), and the expression of viral N protein, Cas12a and GFP was detected in systemically infected leaf tissue (Figure 18B). Each peanut variety was effectively systemically infected by the viral vector, but there was a certain difference in infection efficiency (Figure 18C). Total DNA from young leaves was extracted, and the DNA sequence of the target site region was amplified and subjected to high-throughput sequencing. The editing efficiency of each variety was 59.4-73.1%, with no obvious difference (Figure 18C). According to these results, the recombinant TSWV genome editing vector effectively infected each peanut variety and caused targeted genome editing, without any variety genotype dependency.

[0319] Example 13: Simultaneous editing of multiple endogenous genes in Nicotiana benthamiana by TSWV-Cas12a-crRNA multi-editing vector According to the above Examples 6-12, TSWV-Cas12a-crRNA can deliver Cas12a and a single crRNA. This Example provides a method for delivering Cas12a and multiple crRNAs by the vector to perform multiple genome editing. The N. benthamiana crPDS1 target site according to Example 6 and new target sites crFucT (5'-TTTGGAACAGATTCCAATAAGAAGCCT-3'; SEQ ID NO: 86) and crDCL2 (5'-TTTGAGAAGCTATGCTTATCTTCTTCG-3'; SEQ ID NO: 87) (Table 3) were selected and prepared into plasmid pS, each containing a single target site in the TSWV S genome, by the method described in Example 4. (+)crPDS1:GFP , pS (+)crFucT:GFP , pS (+)crDCL2:GFPIn addition, a sequence (SEQ ID NO: 135) in which two crRNAs are linked in series and can simultaneously target the crPDS1 and crFucT target sites was chemically synthesized, with the structure "DR-Spacer 1-DR-Spacer 2-DR", and a sequence (SEQ ID NO: 136) in which three crRNAs are linked in series and can simultaneously target the crPDS1, crFucT, and crDCL2 target sites was chemically synthesized, with the structure "DR-Spacer 1-DR-Spacer 2-DR-Spacer 3-DR" (Figure 19A). The synthesized sequences were used as pS (+)GFP The plasmid was cloned into the SpeI digest site of pS (+)crPDS1& FucT:GFP and pS (+)crPDS1& FucT&DCL2:GFP During viral replication, the crRNA transcription unit precursor generated by transcription of the S genome contains the crRNA sequence, and the Cas12a protein expressed by the M genome cleaves the precursor RNA to release one or more mature crRNA molecules (Figure 19A).

[0320] Agrobacterium bacterial strain EHA105 is transformed with the above plasmids in combination with pL(+)opt, pM(+)Cas12a, and VSRs, respectively, and inoculated into Nicotiana benthamiana by infiltration according to Example 6. Seven days after inoculation, the strains are successively systemically infected, and symptoms such as leaf curling and shrinking, chlorotic spotting and the like appear (Figure 19B). The total DNA of the systemically infected leaves of the infected strains is randomly extracted, the DNA sequence of the target sequence genome is amplified, and the editing efficiency of the target gene in the virus-infected tissue is measured by high-throughput sequencing. The results show that the editing efficiency of the multiple editing vector for each target is similar to that of the corresponding single target editing vector (Figure 19C). The above results show that the tandem expression can effectively express multiple crRNAs to form multiple CRISPR / Cas12a complexes to edit multiple targets in the plant genome.

[0321] Example 14: Design and construction of TSWV-Cas9-gRNA genome editing vector The CRISPR / Cas9 nuclease system includes the Cas9 protein and a guide RNA (gRNA) that binds to a target. As shown in Figure 20, the construction strategy of the TSWV-Cas9-gRNA vector is as follows: i) the GP sequence in the TSWV M genome is replaced with a sequence encoding SpCas9 to construct the genomic cDNA vector pM (-)Cas9 and antigenome cDNA vector pM (+)Ca9 ii) constructing a sequence containing the RFP coding frame and gRNA into pS (+) Insert it into the vector, replacing the NSs coding frame, to create pS (+)RFP:crRNA The first step is to construct a vector. In this design, the 3' non-coding region of the RFP mRNA sequence generated by transcription of the S genome contains a gRNA sequence. According to previous studies, the gRNA sequence is bound to a homologous Cas9 protein and the terminal bases are spliced ​​by an endogenous RNA processing enzyme to release a mature gRNA molecule (Mikami et al., Plant Cell Physiol, 2017, 58: 1857-1867; Ma et al., Nat Plants, 2020, 6: 773-779). The specific construction method is described in detail below.

[0322] 1) pM (-)Cas9 and pM (+)Cas9 Vector construction A plasmid containing the codon-optimized Cas9 sequence of N. benthamiana (Yin et al., Scientific Reports, 2015, 5: 14926) is used as a template, and the Cas9 sequence is further flanked by a nuclear localization signal and a 3xFlag antigen epitope sequence (SEQ ID NO: 11), which is amplified with primers Cas9 / F and Cas9 / R to obtain a 3xFlag-NLS-Cas9-NLS fragment. A pM(-) vector is used as a template, and amplified with primers M 3'UTR / F and Cas9 / M IGR / R to obtain a fragment from which the GP sequence has been removed. The above two fragments have 15 bp of homology at their ends, and are ligated with In-Fusion reagent to obtain pMR (-)Cas9 Generate a vector.

[0323] pMR (-)Cas9 Using the above as a template, the primers 35S / M 3'UTR / F and HDV / M 5'UTR / R were used to amplify the recombinant M genome cDNA fragment, which was then ligated to the pCB301-2μ-HDV vector fragment digested with the restriction enzymes StuI and SmaI by the In-Fusion clone method, and inserted into the vector in the direction of the genome strand cDNA to obtain pMR (+)Cas9 Generate a vector.

[0324] 2) pS (+)RFP:gRNA Constructing a series vector First, the S antigenome cDNA vector pS (+)RFP:gGFP The vector was constructed to express a gRNA molecule targeting the Nicotiana benthamiana mGFP5 gene recombination target site gGFP (5'-GATACCCAGATCATATGAAGCGG-3') (SEQ ID NO: 16) (the bold sequence is the PAM). (+)GFP Using the plasmid as a template, the fragment with the GFP gene removed is amplified with primers S 5'UTR / F and S IGR / R. Using the pGD-RFP vector as a template, the RFP fragment is amplified with primers S 5'UTR / RFP / F and RFP / R. The gRNA sequence (SEQ ID NO: 22) for the gGFP target site is chemically synthesized, and further contains SpeI and BamHI digest sites on both sides of the gRNA sequence, as well as 15 nt homology sequences used for In-Fusion cloning. The three DNA fragments are ligated with In-Fusion cloning reagent to obtain pS (+)RFP:gGFP The vector contains SpeI and BamHI digest sites on either side of the gRNA sequence to facilitate replacement of the gRNA sequence.

[0325] Based on the online software of CRISPR-P site (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR), a target site gPDS1 (5'-GGACTCTTGCCAGCAATGCTTGG-3') (SEQ ID NO: 17) that is conserved in the PDS genes of multiple species of Solanaceae plants was selected, and a gRNA (SEQ ID NO: 23) for the target site was synthesized and cloned into pS (+)RFP:gGFP Insert the vector into pS (+)RFP:gPDS1 Get the.

[0326] Example 15: Editing of Nicotiana benthamiana mGFP5 gene recombination with TSWV-Cas9-gRNA vector According to the results of Example 4, the insertion of a large Cas coding sequence affected the packaging of the M genome, so a relatively high concentration of the M antigenome cDNA plasmid was required for efficient rescue of the recombinant virus. (+)opt Vector, pM (-)Cas9 or pM (+)Cas9 Vector, pS (+)RFP:gGFP Set the ratio of vector-carrying Agrobacterium EHA105 bacterial strain to 2:10:1, and another volume of Agrobacterium harboring the VSR expression vector (pGD-p19+ pGD-HcPro+ pGD-γb+ pGD-NSs) to be used below to prepare the Agrobacterium inoculation mixture.

[0327] [Table 4]

[0328] About 10 days after inoculation, the infiltrated plants of Groups 1 and 2 showed systemic virus infection and showed TSWV symptoms such as leaf spotting, chlorosis, and curling. After 20 consecutive days of statistical analysis of the infiltrated plants, the disease incidence rate of Group 1 was slightly higher than that of Group 2 (Figure 21).

[0329] Fluorescence microscopy revealed the expression of red fluorescence in the systemically infected leaves of N. benthamiana 16c strains infected by the recombinant viruses, but no red fluorescence in the healthy control plants. Correspondingly, the expression of recombinant GFP was obviously ablated in the leaf tissues expressing RFP (Figure 22A). Western blot analysis showed that the virus-infected tissues in Group 1 and Group 2 contained high levels of N, Cas9, and RFP expression, but the accumulation level of GFP protein was obviously lower than that of the control plants (Figure 22B), suggesting that the Cas9 / gRNA complex expressed by the recombinant viruses interfered with the expression of the target gene.

[0330] To verify genome editing of the target site of mGFP5, the gGFP target site (5'-GATACCCAGAT CATATG PCR amplification was performed on both sides of the genomic DNA fragments of AAGCGG-3' (SEQ ID NO: 16, underlined NdeI digest site), and PCR / RE was used to detect the genome editing efficiency of the target site. PCR / RE analysis showed that the mutation efficiency of the PDS target site in the strain infected with TSWV-Cas9-RFP:gGFP was about 56-60%, while the healthy control strain tissue had no editing of the target site (Figure 22C). Sanger sequencing analysis of the PCR amplification products showed that the majority of the editing types generated were deletions of 1-12 bases (Figure 22D).

[0331] According to the above results, the expression of M genome and antigenome RNA leads to recombinant virus rescue and expression of Cas9 protein, and the RFP:gRNA fusion sequence inserted into the S genome not only expresses a fluorescent reporter gene to track viral infection, but also causes functional processing and maturation of the fusion-expressed RNA, which acts on the target sequence in cooperation with the Cas9 protein to cause genome editing.

[0332] Example 16: Editing of endogenous PDS genes in N. benthamiana and N. tabacum with TSWV-Cas9-gRNA vectors As shown in FIG. 23A, the gPDS1 target sequence (5′-GGACTCTTGCCA GCAATG CTTGG-3' (SEQ ID NO: 17), (bold letters are PAMs, underlines are BsrDI digest sites) is conserved in N. benthamiana PDSa and PDSb copies. Using the method of Example 15, pL (+)opt , pM (-)Cas9 , pS (+)RFP:gPDS1 Then, the VSRs (pGD-p19+pGD-Hc-Pro+pGD-γb+pGD-NSs) vector is introduced to rescue the recombinant virus. About 10 days after infiltration, symptoms such as leaf curling, chlorosis, and yellowing appear in the upper young leaves of N. benthamiana (Figure 23B), and the expression of the viral N protein and Cas9 protein is detected (Figure 23C). The target site sequence is amplified by the primers in Table 2, and the primer pair simultaneously amplifies the PDSa and PDSb sequences. According to the PCR BsrDI digest protection test, the editing efficiency of the PDS target site in the tissues of the four strains is high, ranging from 74% to 98% (Figure 23D).

[0333] The gPDS1 target site is conserved in two copies of tobacco PDSa and PDSb (Figure 24A). The recombinant virus generated in N. benthamiana was inoculated into tobacco by sap friction, and after about 8 days, systemic infection occurred, and symptoms such as chlorotic spots, yellowing of the vein, and leaf shrinkage appeared in the systemically infected leaves (Figure 24B). Western blot analysis showed that the infected strain expressed N and Cas9 proteins (Figure 24C). PCR amplification and BsrDI digest analysis were performed using tobacco gPDS target site primers (Table 2), and the target editing efficiency of three randomly selected strains was 84-94% (Figure 24D), which is comparable to the efficiency of N. benthamiana. The above experimental results show that the TSWV-Cas9-gRNA vector can infect different hosts by Agrobacterium infiltration or mechanical friction, and can cause highly efficient target genome editing.

[0334] Example 17: Simultaneous editing of multiple endogenous genes in Nicotiana benthamiana using a TSWV-Cas9-gRNA multi-editing vector According to the above Examples 14-16, TSWV-Cas9-gRNA can deliver Cas9 and a single gRNA. This Example provides a method for delivering Cas9 protein and multiple gRNAs by the vector to perform multiple genome editing. The N. benthamiana gPDS2 target site (5'-TTGGTAGTAGCGACTCCATGGGG-3'; SEQ ID NO: 89), gRDR6 target site (5'-CCCCTCCTGACTCTTACCCAACT-3'; SEQ ID NO: 90) and gSGS3 target site (5'-ACAAGAGTGGAAGCAGTGCTGGG-3'; SEQ ID NO: 91) (Table 3) were selected and prepared into plasmid pS GAG, which contains a single target site of TSWV S genome, respectively, by the method described in Example 14. (+)gPDS2:GFP , pS (+)gRDR6:GFP , pS (+)gSGS3:GFP In addition, a sequence (SEQ ID NO: 137) in which two gRNAs are linked in series that can simultaneously target the gPDS2 and gRDR6 target sites is chemically synthesized, and a sequence (SEQ ID NO: 138) in which three gRNAs are linked in series that can simultaneously target the gPDS2, gRDR6, and gSGS3 target sites is chemically synthesized (Figure 25A). The synthesized sequences are designated as pS (+)GFP The plasmid was cloned into the SpeI digest site of pS (+)gNbPDS2&RDR6:GFP and pS (+)gNbPDS2&RDR6&SGS3-1:GFP When the virus replicates, the gRNA transcription unit precursor generated by transcription of the S genome contains a gRNA sequence, and the Cas9 protein expressed by the M genome is bound to the gRNA sequence, and the sequences at both ends are removed by cleavage processing by endogenous nucleases of the plant to release one or more mature gRNA molecules (Figure 25A).

[0335] The above plasmids are transformed with pL(+)opt, pM(+)Cas9, VSRs and Agrobacterium bacteria strain EHA105 respectively, and inoculated into Nicotiana benthamiana by infiltration according to Example 14. Seven days after inoculation, the strains were successively systemically infected, and symptoms such as leaf curling and shrinking, chlorotic spotting and the like appeared (Figure 25B). The total DNA of the systemically infected leaves of the infected strains was randomly extracted, the DNA sequence of the target sequence genome was amplified, and the editing efficiency of the target gene in the virus-infected tissue was measured by high-throughput sequencing. The results showed that the editing efficiency of the multiple editing vector for each target was similar to that of the corresponding single-target editing vector (Figure 25C). These results showed that the tandem expression can effectively express multiple gRNAs and form multiple CRISPR / Cas9 complexes by transcription to perform multi-target editing on the plant genome.

[0336] Example 18: Design and construction of TSWV-ABE-gRNA base editing vector The adenine base editing system includes an adenine base editor (ABE) fusion protein and a guide RNA (gRNA) that binds to a target. As shown in FIG. 26, the construction strategy of the viral vector TSWV-ABE-gRNA for delivering ABE is as follows: i) the GP sequence in the TSWV M genome is replaced with a sequence encoding ABE to construct an antigenome cDNA vector pM (+)ABE ii) constructing a fusion sequence containing a GFP coding sequence and a gRNA into pS (+) Insert it into the vector, replacing the NSs coding frame, to create pS (+)gRNA:GFPThe first step is to construct a vector. In this design, the GFP mRNA sequence 3' non-coding region generated by transcription of the S genome contains a gRNA sequence. According to previous studies, the gRNA sequence is bound to a homologous Cas9 protein and the terminal bases are spliced ​​by an endogenous RNA processing enzyme to release a mature gRNA molecule (Mikami et al., Plant Cell Physiol, 2017, 58: 1857-1867; Ma et al., Nat Plants, 2020, 6: 773-779). The specific construction method is described in detail below (Figure 26).

[0337] 1) pM (+)ABE Vector construction The ABE nucleotide sequence (SEQ ID NO: 84) formed by fusing the codon-optimized TadA8e (V106W) sequence of N. benthamiana with nCas9 was chemically synthesized, and the fusion sequence further contained NLS and 3xFlag antigen epitope sequences at the N-terminus and further contained 3xSV40 NLS sequences at the C-terminus. The NLS-3xFlag-TadA8e (V106W)-nCas9-3xNLS fragment was obtained by amplification with primers SpeI / Flag / F (SEQ ID NO: 124) and ABE / R (SEQ ID NO: 125), and then transformed into pMR (+)Cas9 Using the vector as a template, a fragment from which the Cas9 sequence has been removed is obtained by amplifying the vector with primers M 3'UTR / F (SEQ ID NO: 65) and Cas9 / M IGR / R (SEQ ID NO: 66). The two fragments have 15 bp of homology at their ends, and are ligated using In-Fusion reagent to obtain pMR (+)ABE Generate a vector.

[0338] 2) pS (+)GFP:gRNA Constructing a series vector Based on the online software of CRISPR-P site (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR), the target sequence of Nicotiana benthamiana PDSa gene 5'-TGCAAATTGAGTTGGGAGTGAGG-3' (gPDSa; SEQ ID NO: 92), the target sequence of α-1,3-fucosyltransferase a (FucTa) gene 5'-CCTCTTGAGAATGTTGCTATTGG-3' (gFucTa1, SEQ ID NO: 93), and the target sequence of berberine bridge enzyme-like nucleic acid d (BBLd) gene 5'-GAAATCAGAGTAAGGTGCGGAGG-3' (gBBLd, SEQ ID NO: 97) were selected. The gRNA sequence fragments were then respectively transformed into pS (+)SpeI:GFP Insert into the SpeI site of the vector pS (+)gPDSa:GFP , pS (+)gFucTa1:GFP , pS (+)gBBLd:GFP Generate a vector.

[0339] Example 19: Target site editing of multiple endogenous genes in Nicotiana benthamiana using TSWV-ABE-gRNA vectors pS as described in Example 18 (+)gPDSa:GFP , pS (+)gFucTa1:GFP , pS (+)gBBLd:GFP The vector contains sgRNA sequences that can target three sites, gPDSa, gFucTa1, and gBBLd, respectively. The selected gPDSa only targets the PDSa copy of N. benthamiana. N. benthamiana contains four FucT genes, and the selected gFucTa1 only targets FucTa. N. benthamiana contains five BBL genes, and the selected gBBLd is conservative in the five genes. The present invention only analyzed the base editing efficiency of the target site of the BBLd gene. Referring to the method of Example 15, the Agrobacterium bacterial strain containing the three plasmids was transformed into pL (+)opt , pM (+)ABEThe vectors were mixed with Agrobacterium harboring pGD-p19, pGD-HcPro, pGD-γb, and pGD-NSs in appropriate ratios and inoculated into N. benthamiana leaves by infiltration to rescue the recombinant virus. Approximately 10 days after infiltration, symptoms such as leaf curling, chlorosis, and yellowing appeared in the upper young leaves of N. benthamiana (Figure 27A), and the expression of the viral N protein, GFP, and base-edited fusion protein was detected (Figure 27B). The target site sequences were amplified using the primers in Table 2 (SEQ ID NO: 112 and 115, SEQ ID NO: 122 and 123), respectively. High-throughput sequencing and Sanger sequencing analysis showed that the base editing efficiency of the TSWV-ABE-gRNA vector at the three target sites gPDSa, gFucTa1, and gBBLd was about 28%-39% (Figure 27C), and targeted base conversion from A to G (or T to C) occurred in the base editing activity window (from the 4th base to the 9th base) of the target sequence (Figure 27D). The above experimental results show that the TSWV vector can deliver adenine base editors to plants and can highly efficiently cause base editing of target genes in the tissues of infected plants.

[0340] Example 20: Design and construction of TSWV-CBE-gRNA base editing vector The cytosine base editing system includes a cytosine base editor (CBE) fusion protein and a guide RNA (gRNA) that binds to a target. As shown in Figure 28, the construction strategy of the viral vector TSWV-CBE-gRNA for delivering the CBE is as follows: i) the GP sequence in the TSWV M genome is replaced with a sequence encoding the CBE to construct the antigenomic cDNA vector pM (+)CBE ii) constructing a fusion sequence containing a GFP coding sequence and a gRNA into pS (+) Insert it into the vector, replacing the NSs coding frame, to create pS (+)gRNA:GFP The vector is constructed as follows. The specific construction method is described in detail below.

[0341] 1) pM (+)CBE Vector construction A CBE nucleotide sequence (SEQ ID NO: 85) formed by linking a codon-optimized hA3A sequence with a nCas9 sequence and a UGI sequence was chemically synthesized, and the N-terminus of the hA3A sequence further contained an NLS and a 3xFlag antigen epitope sequence, and the C-terminus of the UGI sequence further contained an NLS. The NLS-3xFlag-hA3A-nCas9-UGI-NLS fragment was obtained by amplifying the fragment with primers SpeI / Flag / F (SEQ ID NO: 124) and CBE / R (SEQ ID NO: 126), and then transformed into pMR (+)Cas9 Using the vector as a template, the vector is amplified with primers M 3'UTR / F and Cas9 / M IGR / R to obtain a fragment from which the Cas9 sequence has been removed. The two fragments have 15 bp of homology at their ends, and are ligated using In-Fusion reagent to obtain pMR (+)CBE Generate a vector.

[0342] 2) pS (+)GFP:gRNA Constructing a series vector Based on the online software of CRISPR-P site (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR), the target site 1 sequence 5'-CCAATATCTAGGCGTGAGGGATT-3' (gRDR6a1; SEQ ID NO: 95) and the target site 2 sequence 5'-CCCGACTTCATGGGGAAGGAGGA-3' (gRDR6a2; SEQ ID NO: 96) of the RNA-dependent RNA polymerase 6 (RDR6a) gene, and the target sequence 5'-CACACCTTCCTCCAGGAGATAGG-3' (gFucTa2; SEQ ID NO: 94) of the α-1,3-fucosyltransferase a gene (FucTa) were selected. The sgRNA sequence fragments were then respectively inserted into pS (+)SpeI:GFP Insert into the SpeI site of the vector pS (+)gRDR6a1:GFP , pS (+)gRDR6a2:GFP , pS (+)gFucTa2:GFP Generate a vector.

[0343] Example 21: Target site editing of multiple endogenous genes in Nicotiana benthamiana using TSWV-CBE-gRNA vector pS as described in Example 20 (+)gRDR6a1:GFP , pS (+)gRDR6a2:GFP and pS (+)gFucTa2:GFP Each vector contains a gRNA sequence that can target one target site. The selected gRDR6a1 and gRDR6a2 only target the RDR6a gene of N. benthamiana. N. benthamiana contains four FucT genes, and the selected gFucTa2 only targets FucTa. Referring to the method of Example 15, the Agrobacterium bacterial strain containing the three plasmids was transformed into pL (+)opt , pM (+)CBE The vectors were mixed with Agrobacterium harboring pGD-p19, pGD-HcPro, pGD-γb, and pGD-NSs in appropriate ratios and inoculated into N. benthamiana leaves by infiltration to rescue the recombinant virus. Approximately 10 days after infiltration, symptoms such as leaf curling, chlorosis, and yellowing appeared in the upper young leaves of N. benthamiana (Figure 29A), and the expression of the viral N protein, GFP, and base-edited fusion protein was detected (Figure 29B). The primers in Table 2 (SEQ ID NO: 116-121) were used to amplify the target site sequences, respectively. High-throughput sequencing and Sanger sequencing analysis showed that the base editing efficiency of the TSWV-CBE-gRNA vector at the three target sites gRDR6a1, gRDR6a2, and gFucTa2 was as high as 55%-82% (FIG. 29C), and the base conversion from C to T (or G to A) occurred in the base editing activity window (from the second base to the thirteenth base) of the target sequence (FIG. 29D). The above experimental results showed that the TSWV-CBE-gRNA vector delivered a cytosine base editor to plants and efficiently caused base editing of the target genome in the tissues of the infected plants.

[0344] Example 22: Regeneration of mutant strains from Nicotiana benthamiana leaf tissue infected with TSWV genome editing vectors In order to verify whether mutant strains could be regenerated and obtained from tissues infected with the TSWV-Cas12a-crRNA viral vector, systemically infected leaves of Nicotiana benthamiana infected with the recombinant TSWV-Cas12a-crPDS1:GFP vector in Example 6 were collected and regenerated by tissue culture. The specific experimental flow is as follows:

[0345] 1) Rinse the leaves with sterile water, disinfect the surface with 70% ethanol for 15 seconds, disinfect the surface with 0.1% mercuric chloride (v / v) for 8 minutes, and rinse with sterile water at least three times.

[0346] 2) 1cm 2 Leaf explants cut to size were placed on antibiotic-free MS differentiation medium (4.4 g / L MS [Duchefa Biochemie], 30 g / L sucrose, 1 mg / L cytokinin 6-BA, 4 g / L agar, pH 5.8) and cultured in a 25°C incubation room under 12 h light / 12 h dark conditions for approximately 2–3 weeks.

[0347] 3) After the differentiated shoots had grown to an appropriate size, they were transferred to MS rooting medium (4.4 g / L MS, 3 g / L sucrose, 7 g / L glucose, 4 g / L agar, pH 5.8) and continued to be cultured for approximately 3 weeks.

[0348] 4) After the seedlings have taken deep roots, place them in a culture bottle with DDW water (ddH2O), acclimate them for 4-5 days, and then transplant them into soil.

[0349] After the virus-infected leaves were cultured on differentiation medium for 10 days, some explants showed callus differentiation, and leaves and shoots were differentiated over time. The regenerated plants had two phenotypes, albino and green, and the green plants were rooted normally and transplanted into soil, while the albino plants could not root (Figure 30A). Two green plants (M0-1 / -2) and one albino plant (M0-3) were selected, and genomic DNA was extracted for PCR / RE analysis. Corresponding to the phenotype, the PCR products of the target sequences of the albino plants were not digested by HinfI, indicating that all the HinfI digest sites of the four PDS alleles were destroyed. The PCR products amplified from the two green plants were incompletely digested by HinfI, indicating that some mutant PDS alleles were present (Figure 30B). Genotyping analysis of the PCR products by Sanger sequencing showed that the four PDS alleles in the albino seedlings (M0-3) showed frameshifts in the PDS coding frame due to base deletions, while the green seedlings M0-1 and M0-2 had one and two mutant PDS alleles, respectively (Figure 30C). According to these results, the mutant lines were obtained by regeneration through tissue culture of N. benthamiana somatic cells infected with TSWV-Cas12a-crRNA.

[0350] Similarly, to verify whether mutant strains can be regenerated and obtained from cells infected with the TSWV-Cas9-gRNA vector, the systemically infected leaf pieces of N. benthamiana infected with the recombinant TSWV-Cas9-RFP:gGFP in Example 15 are collected and the strains are regenerated by the above-mentioned tissue culture method. Fluorescence imaging shows that the three selected regenerated strains have no expression of mGFP5 gene recombination (Figure 31A). Sanger sequencing analysis is performed on the target sequence of the amplified regenerated strains, and the mGFP5 target site genotypes of M0-1 and M0-2 are homozygous with one base insertion, and M0-3 is homozygous with one base deletion (Figure 31B).

[0351] Example 23: Regeneration of mutant strains by tomato leaf tissue infected with TSWV genome editing vector Systemically infected leaves of tomatoes infected by inoculation with the recombinant virus V-Cas12a-crPDS2:GFP in Example 8 were collected, rinsed with sterile water, and then surface disinfected with 70% ethanol for 15 s, transferred to 0.1% mercury trioxide (v / v) solution for 8 min, and rinsed with sterile water 3-5 times. The disinfected leaves were taken, blotted with sterile filter paper, and clear midribs and leaf margins were cut off, and the leaves were cut into 0.5 cm pieces. 2 The cut leaves were placed on antibiotic-free MS differentiation medium and incubated at 25°C for 7 days in the dark, then transferred to a 12-hour light / 12-hour dark culture, and the concentrations of the four combinations of plant hormones shown below were measured.

[0352] [Table 5]

[0353] After about 22 days of culture, the explants on the medium for experimental group 1 and experimental group 2 showed differentiation of shoots and leaves, while the explants on the medium for experimental group 3 and experimental group 4 showed extensive callus on the leaf margins, but no differentiation of shoots or leaves (Figure 32A), and some callus showed albino phenotype, indicating that the PDS gene was inactivated after editing (Figure 32B, upper panel). The differentiated shoots were transferred to MS rooting medium (containing 0.1 mg / L IAA) and continued to be cultured, and strong roots were differentiated after 2-3 weeks (Figure 32B, lower panel).

[0354] Five regenerated tomato seedlings were randomly selected, and genomic DNA was extracted to detect the editing of the PDS target site by PCR / RE. The PCR products of M0-1 and M0-4 strains had partial protection against HinfI digest, indicating the presence of the PDS gene that caused the editing, the PCR products of M0-2 strain had complete protection against HinfI digest, indicating that a pair of PDS alleles had been edited, and the PCR products of M0-3 and M0-5 strains were sensitive to HinfI digest, indicating that no editing had occurred in the target gene (Figure 32C).

[0355] Example 24: Improvement of the efficiency of obtaining virus-free mutant strains by antiviral drug treatment Tissues infected with a virus editing vector are used as explants for tissue culture, and the regenerated strains obtained usually cannot effectively eliminate the virus. In this example, the TSWV-Cas12a-crRNA vector is used as an example, and the vector crRNA targets the N. benthamiana crPDS1 target site, and the effect of antiviral drug treatment in the strain regeneration process on the virus eradication efficiency and mutant strain acquisition is examined. As shown in Figure 33, the leaves of N. benthamiana strains systemically infected with the virus vector are used as explants, and are placed in a medium containing 40 mg / L ribavirin, 40 mg / L favipiravir, or 1.2 mg / L remdesivir, or a medium without antiviral drugs (Mock), using the method described in Example 22, to induce and culture the regenerated seedlings. After 35 days of induction culture, the explants and induced calli of each group are all transferred to an induction medium without antiviral drugs, and induction culture is continued for 55 days, and the regenerated seedlings are transferred to a rooting medium. Three independent biological replicates were set up for each group, and 30 strains were randomly selected from each biological replicate for each group for further analysis. Total RNA of M0 regenerated seedlings from each group was extracted, and the virus status of each regenerated seedling was detected by RT-PCR using TSWV N specific primers N / F (CTATGGATTACCTCTTGATGATGC; SEQ ID NO: 131) and N / R (TTAAGCAAGTTCTGCAAGTTTTG; SEQ ID NO: 132), and Nb / actin / F (CAATCCAGACACCTGTACTTTCTCTC; SEQ ID NO: 133) and Nb / actin / R (AAGCTGCAGGTATCCATGAGACTA; SEQ ID NO: 134) as the internal reference. The results showed that no TSWV recombinant virus was detected in any regenerated seedlings treated with Ribavirin, that is, the virus eradication efficiency was 100%. In contrast, only 4.4% of the mock-treated groups had virus-free regenerants, whereas 15.6% and 28.9% of the regenerants in the remdesivir and favipiravir-treated groups, respectively, had virus-free regenerants (Figures 34A and B).

[0356] In the tissue culture process, different numbers of N. benthamiana lines with albino phenotypes were observed in each group (Figure 35A), indicating that the four alleles of the PDS gene (N. benthamiana is an allotetraploid) were edited and inactivated in these lines. To determine the effect of drug treatment on the target genome editing of the obtained regenerant lines, PCR amplification was performed on the sequence containing the target site (amplification primers are SEQ ID NO: 70 and 71), and the amplicons were subjected to high-throughput sequencing to analyze the mutation type of each line and statistically evaluate the editing efficiency of each group. The genotypes of the two subgenomes of N. benthamiana are designated according to the following definitions: Those with an editing efficiency (indels%) of 0-10.0% are wild-type (WT), those with 10% < indels% ≦ 35.0% are chimeric (Chi), and those with 35.0% < indels% ≦ 80.0% are heterozygous (He), that is, one allele has been edited at the target site, but the other allele is wild type. For those with an editing efficiency of 80.0%-100.0%, if the same type of editing is generated in the two alleles, it is a homozygous (Ho) mutation, and if two types of editing are generated in the two alleles, it is a biallelic (Bi) mutation. Statistical analysis of the genotypes of the M0 strain PDSa and PDSb mutations in each group showed that the proportion of strains with mutations at the target site was the highest in the Ribavirin-treated group, the Remdesivir-treated group had a slight advantage over the Mock group, and the Favipiravir group had the lowest mutation efficiency.Further analysis showed that the Ribavirin group had a higher Ho / Bi type ratio in two copies and a lower Chi type ratio compared to the Mock group.The Remdesivir group had a comparable total editing efficiency compared to the Mock group, but the Ho / Bi type ratio was slightly higher at the target site of the PDSb gene and the Chi type ratio was lower in two copies.Compared to the Mock group, the Favipiravir group had a lower total editing efficiency, but the Ho / Bi type ratio was clearly higher than that of the Mock group for all mutant genotypes (Figure 35B).

[0357] Furthermore, the genetic characteristics of each mutant genotype in the M0 generation strain when it was transmitted to the M1 generation were analyzed, and 19 M0 strains containing the above four genotypes were selected, and seeds generated by self-pollination were obtained. 14-16 M1 seedlings were randomly selected from each M0 strain line, and the mutant genotypes of the target sites of the PDSa and PDSb genes were analyzed by high-throughput sequencing. As shown in Table 4, for M0 strains with genotypes of WT and Chi (0 < indels% ≦ 35.0%), the M1 progeny strains are wild type, and when the genotype of the M0 strain is heterozygous (He), the ratio of the mutant and wild type contained in the progeny is 3:1, which is in accordance with Mendel's law. When the genotype of the M0 strain is Bi / Ho, the M1 progeny strains contain the same mutation type. According to these results, the He and Ho / Bi mutation types in the M0 strain are stably inherited by progeny, but the Chi mutation cannot be inherited.

[0358] In addition, 10 strains of M0 strains in which PDSa and PDSa are He genotype or Ho / Bi genotype were selected to take seeds, sow the seeds, germinate, and then statistically analyze the phenotypes of the progeny. Some strains M1 have a green seedling:white seedling ratio of about 3:1, such as RB-#54. Some strains have a green seedling:white seedling ratio of about 15:1, such as RD-#76 (Figure 36A). The chi-square test shows that the phenotypes of each group conform to Mendel's law (Figure 36B). According to the above, the addition of antiviral drugs in the tissue culture process obviously improves the efficiency of obtaining virus-free regenerated strains with mutations.

[0359] Example 25: Regeneration of mutant strains by tobacco leaf tissue infected with TSWV genome editing vector This example further explored the effect of antiviral drug treatment on virus eradication efficiency and mutant strain acquisition when tobacco tissue infected with TSWV vector is applied to regeneration by tissue culture. Taking the recombinant TSWV-Cas12a-crRNA vector in Example 24 as an example, the vector can simultaneously target the crPDS1 target site of tobacco PDS gene. The systemically infected leaves infected with the virus vector were used as explants for tissue culture and plant regeneration, and the specific experimental flow is described in Example 24. After culturing the virus-infected leaves in differentiation medium for 10 days, some explants showed callus differentiation, and over time, leaves and shoots were differentiated. The regenerated plants had two phenotypes, white seedlings and green seedlings, and the green seedlings were rooted normally and transplanted into soil, while the white seedlings could not be rooted (Figure 37A). The proportion of regenerated strains containing target editing in each drug treatment group was analyzed by high-throughput sequencing. The results are shown in Figure 37B. Compared with the control treatment group and other drug treatment groups, the proportion of regenerated strains containing target editing in the Ribavirin treatment group is obviously higher. Furthermore, the distribution of mutant genotypes in the regenerated strains in each drug treatment group was analyzed, and the proportion of each mutation type was improved by ribavirin (Figure 37C). Viruses were detected in the regenerated strains, and similar to the results of N. benthamiana, 100% of the regenerated strains were virus-free after Ribavirin treatment. These results show that mutant strains were obtained by regeneration through tissue culture of tobacco somatic cells infected with TSWV-Cas12a-crRNA, and ribavirin treatment promoted the elimination of the virus, improving the efficiency of obtaining regenerated strains with mutations.

[0360] Example 26: Recombinant virus rescue of TSWV vectors containing the NSs gene and their adverse effects on infected cell regeneration The TSWV Nss gene encodes an RNA silencing suppressor (Takeda et al., FEBS Lett, 2002, 532: 75-79). In the above example, the NSs gene of the recombinant TSWV vector is replaced by a reporter gene. To investigate the effect of the NSs gene on the efficiency of recombinant virus rescue, toxicity, and genome editing ability, this example measured the recombinant virus vector TSWV-Cas9-NSs:gPDS1 containing the NSs gene. This vector is similar to TSWV-Cas9-RFP:gPDS1, but the viral NSs gene is left upstream of the crPDS1 gRNA sequence instead of the RFP reporter gene (Figure 38A).

[0361] Therefore, the S antigenome vector pS(+) NSs:gPDS1 The specific construction method was to perform PCR amplification of the pS(+) plasmid with primers gPDS1 / NSs / F and SIGR / R to obtain a linearized plasmid fragment, amplify a fragment containing the gPDS1 gRNA sequence (SEQ ID NO: 23) with primers gPDS1 / F and IGR / scaffold / R, and ligate the two fragments using In-Fusion reagent to obtain pS (+)NSs:gPDS1 and obtaining a vector.

[0362] Using the Agrobacterium infiltration method described in Example 11, Nicotiana benthamiana plants are infiltrated with the following Agrobacterium mixture:

[0363] TSWV-Cas9-RFP:gPDS1 rescue mixture:pL (+)opt , pM (-)Cas9 , pS (+)RFP:gPDS1 , pGD-p19 + pGD-HcPro + pGD-γb + pGD-NSs TSWV-Cas9-NSs:gPDS1 rescue mixture:pL (+)opt , pM (-)Cas9 , pS (+)NSs:gPDS1 , pGD-p19 + pGD-HcPro + pGD-γb Because the TSWV-Cas9-NSs:gPDS1 virus S strand can express NSs, the VSR combination does not include the unexpected pGD-NSs instantaneous expression vector during infiltration. After 8 days of infiltration, the recombinant TSWV-Cas9-RFP:gPDS1 showed systemic infection, but after 10 days, the TSWV-Cas9-NSs:gPDS1 showed systemic infection. There was no obvious difference between the symptoms of the two (Figure 38B). After 20 days of infiltration, all infiltrated strains were infected by TSWV-Cas9-RFP:gPDS1, but only 50% of the strains were rescued by the recombinant TSWV-Cas9-NSs:gPDS1 (Figure 38D). Leaves of the diseased strains were used as a virus source to rub healthy N. benthamiana, and the time of systemic infection and infection efficiency of the two recombinant viruses were not obviously different (Figure 38E). PCR / RE analysis showed that the targeted genome editing efficiency in leaves of the infected lines of the two recombinant viruses was substantial (Figure 38C).

[0364] The tissues infected with the TSWV-Cas9-NSs:gPDS1 and TSWV-Cas9-RFP:gPDS1 vectors were collected and tissue cultured according to the method of Example 13. After 7 days of culture, the leaf explants infected with TSWV-Cas9-NSs:gPDS1 showed severe necrosis, and after 10 days, they were completely necrotic. Conversely, the leaves infected with TSWV-Cas9-RFP:gPDS1 did not show severe necrosis, and after 10 days, they showed early differentiation of callus (Figure 38F).

[0365] The above results showed that the rescue efficiency of the TSWV genome editing vector with the NSs virulence factor gene remaining was low, and severe necrosis occurred in infected cells during the tissue culture process, inhibiting plant regeneration.

[0366] Example 27: GP gene-deleted recombinant virus vector cannot be transmitted by thrips The TSWV glycoprotein (GP) is essential for the formation of coated particles and for vector-borne transmission (Sin et al., Proc Natl Acad Sci USA, 2005, 102: 5168-5173). In the present embodiment, the GP gene was replaced by a heterologous sequence. To verify that the recombinant virus vector cannot be transmitted by the insect vector, the recombinant TSWV-Cas9-NSs:gPDS1 and wild-type TSWV (TSWV-WT) viruses obtained in Example 15 are inoculated into peppers by friction. Thrips nymphs are placed on the systemically infected pepper plants to acquire the virus. After feeding for 24 hours, a group of five thrips are placed on one healthy pepper plant and allowed to feed for 20 days. Total RNA of thrips and pepper strains was extracted, and NSm / F and NSm / R primers (Table 1) were used to detect the virus prevalence in thrips (number of thrips carrying the virus / total number of thrips) and the virus infection rate in thrips (number of infected pepper strains / total number of pepper strains inoculated by feeding). As shown below, the wild-type virus infected pepper strains had a virus prevalence of 53% and a virus infection rate of 65% in thrips, but the recombinant TSWV-Cas9-NSs:gPDS1 was unable to carry and transmit the virus by thrips.

[0367] [Table 6]

[0368] [Table 7-1]

[0369] [Table 7-2]

[0370] [Table 8-1]

[0371]

Table 8-2

[0372]

Table 9-1

[0373]

Table 9-2

[0374]

Table 10-1

[0375]

Table 10-2

Claims

1. A recombinant viral vector system comprising: a) a tospovirus polynucleotide sequence; b) at least one polynucleotide sequence operably linked to a viral transcriptional cis-element and encoding a sequence-specific nucleic acid modifying enzyme; The viral vector system is introduced into a plant cell, and then expresses the sequence-specific nucleic acid modifying enzyme, which targets and cuts or modifies a specific genomic sequence in the plant cell; Optionally, the viral vector system further comprises one or more auxiliary expression vectors encoding one or more RNA silencing suppressors.

2. The sequence-specific nucleic acid modifying enzyme is a CRISPR / Cas nuclease, and / or The tospovirus vector is derived from Tomato spotted wilt virus (TSWV), and / or the RNA silencing suppressor is selected from the group consisting of Tombusvirus p19, Tobacco Etch Virus P1 / Hc-Pro, Barley Stripe Mosaic Virus γb, or TSWV NSs; Preferably, the sequence-specific nucleic acid modifying enzyme is a CRISPR / SpCas9 nuclease from Streptococcus pyogenes, or a CRISPR / LbCas12a (LbCpf1) nuclease from Lachnospira, or an adenine or cytosine base editor comprising a Cas9 variant fused to a base deaminating enzyme, and / or 2. The recombinant viral vector system of claim 1, wherein the S, M, and L genomic fragments of TSWV have at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to the nucleic acid sequences set forth in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively.

3. The TSWV S genome fragment comprises at least one heterologous polynucleotide sequence operably linked to a viral mRNA transcription cis-element and encoding a component of a sequence-specific nucleic acid modifying enzyme; and / or the M genome fragment of TSWV comprises at least one heterologous polynucleotide sequence operably linked to a viral mRNA transcription cis-element and encoding a portion of a sequence-specific nucleic acid modifying enzyme; and / or The L genome fragment of TSWV comprises a chimeric sequence, in which a polynucleotide sequence encoding a viral RdRp is replaced by a plant codon-optimized RdRp coding sequence; Preferably, all or part of the sequence encoding the nonstructural proteins (NSs) in the S genome fragment of TSWV is replaced by a heterologous chimeric polynucleotide sequence encoding the nucleic acid modifying enzyme component and a second heterologous polypeptide; and / or All or part of the sequence encoding the glycoprotein precursor (GP) in the M genome fragment of TSWV is replaced by a heterologous polynucleotide sequence encoding the nucleic acid modifying enzyme component; and / or The plant codon-optimized RdRp coding sequence in the L genome fragment of TSWV is shown in SEQ ID NO:5, More preferably, the nucleic acid modifying enzyme component in the S genome fragment of TSWV is a CRISPR guide RNA polynucleotide sequence encoding one or more guide RNAs, and the second heterologous polypeptide is a fluorescent reporter gene; and / or 3. The recombinant viral vector system of claim 2, wherein the nucleic acid modifying enzyme component in the M genome fragment of TSWV is a Cas polypeptide selected from the group consisting of SpCas9 from Streptococcus pyogenes, or Cas12a (LbCpf1) from Lachnospira, or an adenine or cytosine base editor comprising a Cas9 variant fused to a base deaminase.

4. The tospovirus vector is an NSs-deleted attenuated infectious virus, or 2. The recombinant viral vector system of claim 1, wherein the tospovirus vector is an infectious virus that cannot be transmitted by vector insects due to a GP deletion.

5. A tospovirus vector is a nucleic acid construct comprising a viral polynucleotide sequence, The nucleic acid construct, after being introduced into a plant cell, transcribes positive or negative strand RNA of the S, M, and L genomic fragments of the chimeric TSWV; or the nucleic acid construct forms an infectious viral vector after introduction into a plant cell; or the nucleic acid construct is a plasmid; Preferably, the molar ratio of the L, M, and S fragments of TSWV contained in the nucleic acid construct is 1-2(L):2-10(M):1-2(S), or 1(L):10(M):2(S), or 2. The recombinant viral vector system of claim 1, wherein the plasmid is an Agrobacterium binary vector and the binary vector is carried by an Agrobacterium strain at a concentration ratio of 1-2 (L):2-10 (M):1-2 (S), or 1 (L):10 (M):2 (S).

6. A bacterial strain or a recombinant viral particle comprising a recombinant viral vector system described in any one of claims 1 to 5.

7. A method for modifying genetic material of a plant cell, said method not requiring incorporation of exogenous genetic material into the plant cell genome, said method comprising: a) providing at least one plant cell to be modified; and b) providing a Tospovirus vector, the Tospovirus vector comprising at least one polynucleotide sequence encoding a sequence-specific nucleic acid modifying enzyme, the method further comprising: c) introducing the Tospovirus vector into the plant cell to instantaneously express the nucleic acid modifying enzyme; d) the sequence-specific nucleic acid modifying enzyme targets and cuts or modifies specific genomic sequences in the plant cell, and completes the modification to the genetic material of the plant cell through cellular DNA repair mechanisms; e) optionally, obtaining from the plant cell a plant having modified genetic material. [0021] Claim 8: The method further comprises the step of selecting said plant cells or plants in which genetic material has been modified, said selection not using a selection marker, said modification comprising a deletion, insertion or substitution of one or more nucleotides in a target DNA sequence, or a combination thereof, and / or The method includes a step of obtaining a virus-free plant from a cell infected with a tospovirus by tissue culture, the step of obtaining comprising: a) providing at least one plant cell infected with a Tospovirus; b) culturing the plant cells in a medium to regenerate a plant; and c) obtaining and identifying the regenerated virus-free plants; 8. The method of claim 7, wherein the medium comprises an antiviral compound, the antiviral compound being ribavirin, favipiravir, or remdesivir.

9. The sequence-specific nucleic acid modifying enzyme is a CRISPR / Cas nuclease, and / or The tospovirus vector is derived from Tomato spotted wilt virus (TSWV), Preferably, the sequence-specific nucleic acid modifying enzyme is an adenine or cytosine base editor comprising the CRISPR / SpCas9 nuclease from Streptococcus pyogenes, or the CRISPR / LbCas12a (LbCpf1) nuclease from Lachnospira, or a Cas9 variant fused to a base deaminating enzyme; and / or 8. The method of claim 7, wherein the S, M, and L genomic fragments of TSWV have at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% sequence identity to the nucleic acid sequences set forth in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively.

10. The TSWV vector is an attenuated infectious virus lacking an NSs or an infectious virus lacking a GP and therefore unable to be transmitted by an insect vector; and / or the S genome fragment of TSWV comprises at least one heterologous polynucleotide sequence operably linked to a viral mRNA transcription cis-element and encoding a portion of a sequence-specific nucleic acid modifying enzyme; and / or the M genome fragment of TSWV comprises at least one heterologous polynucleotide sequence operably linked to a viral mRNA transcription cis-element and encoding a portion of a sequence-specific nucleic acid modifying enzyme; and / or 10. The method of claim 9, wherein the L genome fragment of TSWV comprises a chimeric sequence, in which a polynucleotide sequence encoding a viral RdRp is replaced by a plant codon-optimized RdRp coding sequence. and / or wherein all or part of the sequence encoding the nonstructural proteins (NSs) in the S genome fragment of TSWV is replaced by a heterologous chimeric polynucleotide sequence encoding a nucleic acid modifying enzyme component and a second heterologous polypeptide; and / or the whole or part of the sequence encoding the glycoprotein precursor (GP) in the M genome fragment of TSWV is replaced by a heterologous polynucleotide sequence encoding the nucleic acid modifying enzyme component; The plant codon-optimized RdRp coding sequence in the L genome fragment of TSWV is shown in SEQ ID NO:5, Preferably, the nucleic acid modifying enzyme component in the S genome fragment of TSWV is a CRISPR guide RNA polynucleotide sequence encoding one or more guide RNAs, and the second heterologous polypeptide is a fluorescent reporter gene; and / or 11. The method of claim 10, wherein the nucleic acid modifying enzyme component in the M genome fragment of TSWV is a Cas polypeptide selected from the group consisting of SpCas9 from Streptococcus pyogenes, or Cas12a (LbCpf1) from Lachnospira, or an adenine or cytosine base editor comprising a Cas9 variant fused to a base deaminase.

12. A method of introducing the Tospovirus vector into a plant cell is carried out by delivering a nucleic acid construct comprising a viral vector nucleic acid sequence into the plant cell under conditions sufficient to initiate a recombinant viral infection, or by infecting the plant cell with recombinant viral particles by any of the following means: mechanical inoculation, high pressure spray inoculation, or inoculation by transplantation; Preferably, said nucleic acid construct further comprises one or more auxiliary expression vectors encoding one or more RNA silencing suppressors selected from the group consisting of Tombusvirus p19, Tobacco Etch Virus P1 / Hc-Pro, Barley Stripe Mosaic Virus γb, or TSWV NSs; and / or The molar ratio of the L, M, and S fragments of TSWV contained in the nucleic acid construct is 1-2(L):2-10(M):1-2(S), or 1(L):10(M):2(S), or 8. The method of claim 7, wherein the nucleic acid construct is a plasmid or wherein the nucleic acid construct is an Agrobacterium binary vector and the binary vector is carried by the Agrobacterium strain at a concentration ratio of 1-2 (L):2-10 (M):1-2 (S), or 1 (L):10 (M):2 (S).

13. The plant to be modified is selected from natural or experimental host plant species or varieties capable of supporting local or systemic infection with a Tospovirus, or is selected from a host plant species or variety selected from the group consisting of Nicotiana benthamiana, tobacco (N. tabacum), tomato (Solanum lycopersicum), pepper (Capsicum annuum), Tabasco (C. frutescens), habanero (C. chinense), peanut (Arachis hypogaea), potato (Solanum tuberosum), ground cherries (Physalis alkekengi), soybean (Glycine max), cotton (Gossypium hirsutum), lettuce (Lactuca sativa), spinach (Spinacia oleracea), watermelon (Citrullus lanatus), cucumber (Cucumis sativus), faba bean (Vicia faba), black gram (Vigna 10. The method of claim 7, wherein the plant is selected from the group consisting of Vigna mungo, Vigna radiata, or Vigna unguiculata.

14. A kit comprising the recombinant viral vector system according to any one of claims 1 to 5, comprising: a) a polynucleotide construct composition comprising nucleic acid sequences of the S, M, and L genomic fragments of TSWV, the nucleic acid sequences comprising at least one heterologous polynucleotide sequence encoding a sequence-specific nucleic acid modifying enzyme; b) one or more auxiliary expression vectors encoding one or more viral suppressors of RNA silencing, optionally selected from the group consisting of Tombusvirus p19, Tobacco Etch Virus P1 / Hc-Pro, Barley Stripe Mosaic Virus γb, or TSWV NSs; 3) the kit optionally includes a user manual or instructions; The reagents in the kit may be provided singly or in combination.

15. A genetically modified plant and its progeny, produced from a cell infected with a recombinant viral vector system described in any one of claims 1 to 5, or produced according to the method described in any one of claims 7 to 13.

Images