Methods and compositions for genetic modification and therapeutic use of immune cells

Abstract

Aspects of the present disclosure relate to methods and compositions for genetic modification of immune cells to generate immune cells that do not secrete TGF-β1. Methods for the use of such genetically modified immune cells are also disclosed, including immunotherapeutic methods for the treatment of cancer. A further aspect of the present disclosure relates to human CD8 cells that contain genetic modifications that prevent the cells from secreting TGF-β1. + It is directed at T cells.

Description

[Technical field]

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 177,053, filed April 20, 2021, the contents of which are incorporated herein by reference.

[0002] Sequence Listing This application contains a Sequence Listing which has been submitted in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on April 19, 2022, is named MDAC_P1296WO_Sequence_Listing.txt and is 558 bytes in size. [Background technology]

[0003] background I. FIELD OF THEINVENTION Aspects of the invention relate to at least the fields of immunology, cancer biology, and medicine.

[0004] II. Background Adoptive T cell therapy (ACT), in which tumor-reactive T lymphocytes are isolated from peripheral blood or tumor tissue, genetically engineered, expanded in vitro, and infused into patients, has been shown to induce clinical responses in patients with leukemia, lymphoma, metastatic melanoma, and other malignancies. The effector functions of cytotoxic T lymphocytes (CTLs) are suppressed by multiple factors, including TGF-β1. In an attempt to overcome the inhibitory role of TGF-β1 on CTL effector functions, T cells have been engineered to express a dominant-negative form of the TGF-β receptor (TGFBRII-DNR) or to knock out the TGF-β receptor to block recognition of TGF-β1. These approaches seek to maintain the antitumor efficacy of CTLs in a high TGF-β1 microenvironment. However, CD8 + T cells are resident memory T cells (T cells) that may be important for the long-term antitumor effect of ACT. RM ) requires recognition of TGF-β1. Current strategies involve the use of CD8+ T cells are T RM This negates the ability to form T and reduces the effectiveness of ACT. RM Therapeutic CD8 with regenerative properties + There remains a need for improved ACT compositions and methods involving T cells with enhanced efficacy. Summary of the Invention

[0005] overview Aspects of the present disclosure include methods for treating immune cells that do not secrete TGF-β1 (e.g., CD8 + A particular need in the art is addressed by providing T cells (e.g., TGFB1 knockout cells) that can be effective in targeting and killing tumor cells and can be used to treat tumors. Such cells as disclosed herein can be effective in targeting and killing tumor cells and can be used to treat tumors. RM ) formation ability. Compositions comprising such cells, methods for the production of such cells, and methods of using such cells for the treatment of cancer are also disclosed.

[0006] Embodiments of the present disclosure include methods for the detection and / or differentiation of immune cells (e.g., CD8 + T cells, CD4 +The present disclosure includes methods for treating subjects with cancer, methods for genetically modifying cells, and methods for generating TGFB1 mutations. The cells (e.g., immune cells, tumor infiltrating lymphocytes, cytotoxic T cells, etc.) of the present disclosure may include at least one, two, three, or more of the following: genetic modification of TGFB1, frameshift mutation of TGFB1, nonsense mutation of TGFB1, deletion of TGFB1, modification of the region of exon 1 of TGFB1, epigenetic modification of TGFB1, and genetic modification of a regulatory region (e.g., promoter, enhancer, etc.) that controls the expression of TGFB1. The method of the present disclosure includes the following steps: obtaining immune cells from a subject, obtaining tumor infiltrating lymphocytes from a subject, obtaining CD8 + Obtaining T cells, expanding the cells obtained from the subject, culturing the cells obtained from the subject, human CD8 + Genetically modifying T cells, modifying immune cells to generate genetically modified immune cells that do not secrete TGF-β1, transfecting human CD8 T cells with Cas nuclease and guide RNA targeting TGFB1, + administering the genetically modified immune cells to the subject; administering to the subject a human CD8 + The composition of the present disclosure can include at least one, two, three, four, five, or more of administering T cells, diagnosing the subject for cancer, administering cancer therapy to the subject, and determining that the subject is resistant to cancer therapy. +The method may include at least one, two, three, four, or more of T cells, tumor infiltrating lymphocytes, genetically modified immune cells, Cas nucleases, guide RNAs, vectors, plasmids, transfection reagents, excipients, and cancer therapeutics. It is specifically contemplated that one or more of the described steps and / or components may be excluded from certain embodiments of the present disclosure.

[0007] In some aspects, a method for treating a subject having cancer includes administering to the subject a human CD8 + Disclosed herein are methods comprising administering human CD8 T cells. + The T cells do not express TGF-β1. In some embodiments, the human CD8 + The T cells express a mutant TGF-β1 protein. In some embodiments, the T cells are human CD8 + T cells are derived from CD8 + In some embodiments, the T cells are derived from human CD8 T cells from a subject. + The T cells are tumor infiltrating lymphocytes. In some embodiments, the T cells are human CD8 + The T cell comprises a mutation in TGFB1. In some embodiments, the mutation is a frameshift mutation. In some embodiments, the mutation is a nonsense mutation. In some embodiments, the mutation comprises an alteration (e.g., a mutation in) a region of exon 1 of TGFB1. In some embodiments, the region of exon 1 comprises the sequence of SEQ ID NO:1. In some embodiments, the cancer is melanoma. In some embodiments, the cancer is a recurrent cancer. In some embodiments, the subject has been pretreated for cancer with a pretreatment. In some embodiments, the subject has been determined to be resistant to the pretreatment. In some embodiments, the method comprises administering to the subject a human CD8 + Human CD8 containing T cells + In some embodiments, the method comprises administering a population of human CD8 T cells. +Each cell of the population of T cells does not secrete TGF-β1. In some embodiments, the method further comprises administering an additional cancer therapy. In some embodiments, the additional cancer therapy is chemotherapy, radiation therapy, or immunotherapy.

[0008] Human CD8 + CD8 containing T cells + Populations of T cells are also disclosed. In some embodiments, CD8 + Each cell in the population of T cells does not secrete TGF-β1. + A portion of the population of T cells does not secrete TGF-β1. In some embodiments, secretion of TGF-β1 is associated with CD8 + In some embodiments, the secretion of TGF-β1 is undetectable in a population of CD8 T cells compared to a population of control cells. + In some embodiments, secretion of TGF-β1 is substantially decreased in a population of CD8 T cells compared to a control cell population. +At least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, up to 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84% %, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or approximately 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70% %, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or any range or value derivable therein. + A portion of the population of T cells does not express TGF-β1. In some embodiments, expression of TGF-β1 is conferred by CD8 +In some embodiments, expression of TGF-β1 is undetectable in a population of CD8 T cells compared to a population of control cells (e.g., wild-type cells, untreated cells, cells treated with a control gene editing reagent, etc.). +In some embodiments, expression of TGF-β1 is substantially reduced in a population of T cells. In some embodiments, expression of TGF-β1 is substantially reduced in a population of T cells. In some embodiments, expression of TGF-β1 is substantially reduced in a population of T cells. 96%, 97%, 98%, 99%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, up to 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, up to 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94 3%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or approximately 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, The expression of TGF-β1 is reduced by 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or any range or value derivable therein. In some embodiments, the expression of TGF-β1 is reduced by at least 80%, 90%, 95%, or 99%. In some embodiments, the expression of TGF-β1 is reduced by at least 90%.

[0009] In some embodiments, a method for the production of human CD8A comprising introducing into a cell a Cas nuclease and a guide RNA targeting TGFB1. + Disclosed herein are methods for genetically modifying T cells. In some embodiments, the guide RNA targets a region of exon 1 of TGFB1. In some embodiments, the region of exon 1 comprises the sequence of SEQ ID NO:1 (or a portion thereof). In some embodiments, the Cas nuclease is Cas9. In some embodiments, the Cas nuclease is Cas12a. In some embodiments, a mutation is generated in TGFB1 in a cell. In some embodiments, the mutation is generated using a Cas nuclease. In some embodiments, the mutation is a frameshift mutation. In some embodiments, the mutation is a nonsense mutation. In some embodiments, the Cas nuclease and the guide RNA are introduced into the cell via transfection. In some embodiments, the Cas nuclease and the guide RNA are introduced into the cell via electroporation. In some embodiments, the method comprises isolating human CD8 from a subject. + In some embodiments, the method further comprises obtaining human CD8 T cells. + T cells are tumor-infiltrating lymphocytes.

[0010] In some embodiments, methods for treating a subject with cancer are also disclosed herein, the methods comprising: (a) modifying immune cells from the subject to generate genetically modified immune cells that do not secrete TGF-β1; and (b) administering the genetically modified immune cells to the subject. In some embodiments, the immune cells do not express TGF-β1. In some embodiments, the immune cells express a mutant TGF-β1 protein. In some embodiments, the immune cells are natural killer T cells. In some embodiments, the immune cells are modified to express a cloned T cell receptor (TCR) or a chimeric antigen receptor (CAR). In some embodiments, the immune cells are engineered CAR-T cells or engineered TCR-T cells. In some embodiments, the immune cells are T cells. In some embodiments, the T cells are CD4 +In some embodiments, the T cells are CD8 + In some embodiments, the immune cell is a T cell. In some embodiments, the immune cell is a tumor infiltrating lymphocyte. In some embodiments, modifying the immune cell comprises generating a mutation in TGFB1 in the immune cell. In some embodiments, the mutation is a frameshift mutation. In some embodiments, the mutation is a nonsense mutation. In some embodiments, the mutation is a mutation in exon 1 of TGFB1. In some embodiments, modifying the immune cell comprises targeting a region of exon 1 of TGFB1 using a Cas nuclease and a guide RNA. In some embodiments, the region of exon 1 comprises the sequence of SEQ ID NO:1. In some embodiments, the subject is a human subject.

[0011] In certain aspects, human immune cells are further disclosed that include a genetic modification that prevents the cell from secreting TGF-β1. In some embodiments, the immune cell is a T cell. In some embodiments, the T cell is a CD8 + In some embodiments, the T cells are CD4 +The human immune cell is a T cell. In some embodiments, the immune cell is a natural killer T cell. In some embodiments, the immune cell expresses a cloned TCR or CAR. In some embodiments, the immune cell is an engineered CAR-T cell or an engineered TCR-T cell. In some embodiments, the genetic modification is a frameshift mutation of TGFB1. In some embodiments, the genetic modification is a nonsense mutation of TGFB1. In some embodiments, the genetic modification is a deletion of TGFB1. In some embodiments, the genetic modification comprises a modification (e.g., a mutation in) a region of exon 1 of TGFB1. In some embodiments, the region of exon 1 comprises the sequence of SEQ ID NO:1. In some embodiments, the human immune cell is a tumor-infiltrating lymphocyte or is derived therefrom. Also disclosed is a pharmaceutical composition comprising the cell of the present disclosure and, optionally, a pharmaceutical acceptable excipient. Also disclosed is a population of human immune cells comprising human immune cells. In some embodiments, the secretion of TGF-β1 is undetectable in the population of human immune cells.In some embodiments, the secretion of TGF-β1 is increased by at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89% relative to a population of control cells (e.g., a population of immune cells that are not genetically modified). 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, up to 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78% %, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or approximately 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or approximately 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, %, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or any range or value derivable therein.

[0012] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for any measuring or quantitating method.

[0013] The use of the words "a" or "an" when used in conjunction with the term "comprising" can mean "one," but is also consistent with the meaning of "one or more," "at least one," and "one or more than one."

[0014] The term "and / or" means "and" or "or." Illustratively, A, B, and / or C includes A only, B only, C only, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B and C. In other words, "and / or" functions as an inclusive or.

[0015] The words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional unrecited elements or method steps.

[0016] The compositions and methods for their use can "comprise," "consist essentially of," or "consist" of any of the components or steps disclosed throughout this specification. Compositions and methods "consist essentially of" any of the disclosed components or steps limit the scope of particular materials or steps that do not materially affect the basic and novel characteristics of the claimed invention. As used in this specification and the claims, the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include"), or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that embodiments described herein with reference to the term "comprising" may also be implemented with reference to the terms "consisting of" or "consisting essentially of."

[0017] An "individual," "subject," and "patient" are used interchangeably and can refer to a human or a non-human.

[0018] Any method related to a therapeutic, diagnostic, or physiological purpose or effect may also be described using "use" claim language, such as the "use of" any compound, composition, or agent described herein to achieve or carry out the described therapeutic, diagnostic, or physiological purpose or effect.

[0019] It is specifically contemplated that any limitation stated with respect to one embodiment of the present invention can be applied to any other embodiment of the present invention. Furthermore, any composition of the present invention can be used in any method of the present invention, and any method of the present invention can be used to produce or utilize any composition of the present invention. Any step in the method described herein can be applied to any other method. Moreover, any method described herein can have the exclusion of any step or combination of steps. It is understood that the embodiments in the Examples section are embodiments applicable to all aspects of the technology described herein.

[0020] The use of one or more sequences or compositions may be employed according to any of the methods described herein. Other aspects are described throughout this application. Any aspect described with respect to one aspect of this disclosure also applies to other aspects of this disclosure, and vice versa.

[0021] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while indicating particular embodiments of the present invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. [Brief description of the drawings]

[0022] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0023] [Figure 1A]Figures 1A-1D show data demonstrating that CRISPR / Cas9 RNP efficiently depletes the TGFB1 gene in CD8+ T cells. Figure 1A shows the sequence (SEQ ID NO:1) of the TGFB1 gRNA, the location, indel rate and knockout score. Figure 1B shows the results of Sanger sequencing of the TGFB1 gene fragment adjacent to the target sequence of the gRNA in non-targeted (NT) control and TGFB1 knockout CD8+ T cells. Figure 1C shows representative plots of membrane TGF-β1 (LAP) and CD8 levels of Fluorescence Minus One (FMO) control, NT control and TGFB1 knockout CD8+ T cells at day 2 after stimulation with α-CD3 / α-CD28 beads. Figure 1D shows the levels of total secreted TGF-β1 of NT control and TGFB1 knockout CD8+ T cells at day 2 after stimulation with α-CD3 / α-CD28 beads. [Figure 1B] See legend to Figure 1A. [Figure 1C] See legend to Figure 1A. [Figure 1D] See legend to Figure 1A. [Figure 2A] Figures 2A-2D show data demonstrating that TGFB1 knockout in polyclonally activated CD8+ T cells enhances cytokine production and does not affect TRM formation. Figure 2A shows representative plots of intracellular TNF-α, IFN-γ, granzyme B and IL-2 levels of control and TGFB1-depleted CD8+ T cells after restimulation. Figure 2B shows the percentage of IFN-γ+, TNF-α+, IFN-γ+ TNF-α+ and IL-2+ CD8+ T cells after restimulation. Figure 2C shows the mean fluorescence intensity (MFI) levels of intracellular granzyme B after restimulation. Results were compared between experimental groups using Student's t-test. n=3. Statistical significance is displayed as NS, p≧0.05, *p<0.05, **p<0.01. Figure 2D shows representative plots of CD103 and CD69 levels of control and TGFB1-depleted CD8+ T cells after culture with exogenous TGF-β1 under hypoxic conditions. Error bars represent the standard error of the mean (SEM). [Figure 2B] See legend to Figure 2A. [Figure 2C] See legend to Figure 2A. [Figure 2D] See legend to Figure 2A. [Diagram 3] Flow cytometry data of NT control and TGFB1-depleted TCR T cells following rapid expansion protocol (REP) are shown. [Figure 4A] Figures 4A-4C show data demonstrating that knockout of TGFB1 enhances cytokine production in TCR-T cells. Figure 4A shows representative plots of intracellular TNF-α, IFN-γ, granzyme B and IL-2 levels in control and TGFB1 knockout TCR-T cells after 16 h coculture (E:T ratio = 5:1) with Mel526 cells. Figure 4B shows the percentages of IFN-γ+, TNF-α+, IFN-γ+ TNF-α+ and IL-2+ TCR-T cells. Figure 4C shows the mean fluorescence intensity (MFI) levels of intracellular granzyme B. Results were compared between experimental groups using Student's t-test. n=3. Statistical significance is displayed as NS, p≧0.05, * p<0.05, ** p<0.01. Error bars represent SEM. [Figure 4B] See legend to Figure 4A. [Figure 4C] See legend to Figure 4A. [Figure 5A]Figures 5A-5C show data demonstrating that knockout of TGFB1 enhances the cytotoxic activity of TCR-T cells. Figure 5A shows the cytotoxicity of NT control and TGFB1 knockout TCR-T cells co-cultured with Mel526 cells at various E:T ratios and measured by chromium release assay. Figure 5B shows the cytotoxicity of NT control and TGFB1 knockout TCR-T cells co-cultured with Mel526 cells at various E:T ratios. TCR-T cells were treated with 10 ng / mL TGF-β1 for 4 days prior to the chromium release assay. Figure 5C shows a combination of the data shown in Figures 5A and 5B. Results were compared between experimental groups using Student's t-test. n=4. Statistical significance is displayed as NS, p≧0.05, *p<0.05, **p<0.01. Error bars represent SEM. [Figure 5B] See legend to Figure 5A. [Figure 5C] See legend to Figure 5A. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0024] Detailed Description of the Invention The present disclosure provides, at least in part, a method for the treatment of immune cells (e.g., CD8 + In addition, such modified cells have enhanced anti-tumor efficacy and are useful in the generation of resident memory T cells (T RM A particular aspect of the present disclosure is the discovery that genetically modified immune cells (e.g., human CD8 + The present invention is directed to methods for the genetic modification of TGFB1 in immune cells using gene editing techniques, including CRISPR / Cas-based gene editing, and to methods of using such cells for the treatment of cancer.

[0025] I. Gene editing systems Certain aspects of the present disclosure relate to methods and compositions for gene editing (also referred to as "genetic engineering") useful for generating one or more genetic modifications in cells. As used herein, "genetic modification" refers to a region of a cell genome that is altered from its native (i.e., endogenous) sequence. A genetic modification can be created through the artificial editing of a gene or other genetic material. In some embodiments, the genetic modification is a mutation of a gene. Various types of genetic mutations are recognized in the art and contemplated herein. In some embodiments, the mutation is an insertion, deletion, point mutation, frameshift mutation, or nonsense mutation. One or more of these mutations can be excluded from the embodiments of the present disclosure. In some embodiments, the mutation prevents expression of the gene (i.e., is a knockout mutation). In some embodiments, the mutation causes the production of a mutant protein. In some embodiments, the genetic modification of the present disclosure is a mutation of TGFB1. In some embodiments, the mutation of TGFB1 is a mutation in the region of exon 1, 2, 3, 4, 5, 6, or 7 of TGFB1. In some embodiments, the mutation is TGFB1 In some embodiments, the genetic modification of the present disclosure is a mutation in TGFB2. In some embodiments, the TGFB2 mutation is a mutation in the region of exon 1, 2, 3, 4, 5, 6, or 7 of TGFB2. In some embodiments, the mutation is TGFB2 In some embodiments, the genetic modification of the present disclosure is a mutation in TGFB3. In some embodiments, the TGFB3 mutation is a mutation in the region of exon 1, 2, 3, 4, 5, 6, or 7 of TGFB3. In some embodiments, the mutation is TGFB3 This is a mutation within the exon 1 region of the .

[0026] Certain aspects of the present disclosure are directed to the use of gene editing technology to generate knockout mutations in genes in cell populations.The disclosed technology can eliminate the expression of genes in some or all of the cells in the population.In some aspects, the expression of genes is undetectable from the cell population (e.g., measured by mRNA and / or protein expression).In some aspects, the expression of genes is substantially reduced in the cell population compared to cells that do not have knockout mutations.In some embodiments, expression of a gene (e.g., as measured by mRNA and / or protein expression) is at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90% ,91%,92%,93%,94%,95%,96%,97%,98%,99%,99%,99%,99.1%,99.2%,99.3%,99.4%,99.5%,99.6%,99.7%,99.8%,99.9%,Up to 50%,51%,52%,53%,54%,55%,56%,57%,58%,59%,60%,61%,62%,63%,64%,65%,66%,67%,68%,69%,70%,71%,72%,73%,74%,75%,76%,77%,78%,79% ,80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or approximately 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or approximately 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 7 The expression of the gene is decreased by 8%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or any range or value derivable therein. In some embodiments, the expression of the gene is decreased by at least 80%, 90%, 95%, or 99%. In some embodiments, the expression of the gene is decreased by at least 90%.

[0027] Various methods and systems for gene editing are known in the art, including, for example, zinc finger nuclease (ZFN)-based gene editing, transcription activator-like effector nuclease (TALEN)-based gene editing, and CRISPR / Cas-based gene editing. In some embodiments, the method of the present disclosure includes CRISPR / Cas-based gene editing, including the use of components of the CRISPR system, such as guide RNA (gRNA) and Cas nuclease.

[0028] In general, a "CRISPR system" refers collectively to the transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated ("Cas") genes, including sequences encoding Cas genes, tracr (trans-activating CRISPR) sequences (e.g., tracrRNA or active partial tracrRNA), tracr-mate sequences (including "direct repeats" and tracrRNA-processed partial direct repeats in the context of endogenous CRISPR systems), guide sequences (also referred to as "spacers" in the context of endogenous CRISPR systems), and / or other sequences and transcripts from the CRISPR locus.

[0029] A CRISPR / Cas nuclease or CRISPR / Cas nuclease system can include a non-coding RNA molecule (guide) RNA that binds to DNA in a sequence-specific manner, and a Cas protein (e.g., Cas9) that has nuclease functionality (e.g., two nuclease domains). One or more elements of the CRISPR system can be derived from a particular organism that contains an endogenous CRISPR system, such as a Type I, Type II, or Type III CRISPR system, e.g., Streptococcus pyogenes.

[0030] In some aspects, the Cas nuclease and gRNA (comprising a fusion of the target sequence-specific crRNA and the immobilized tracrRNA) are introduced into the cell. The Cas nuclease and gRNA can be introduced into the cell indirectly through the introduction of one or more nucleic acids (e.g., vectors) encoding the Cas nuclease and / or gRNA. The Cas nuclease and gRNA can be introduced into the cell directly by the introduction of the Cas nuclease protein and the gRNA molecule. In general, the target site at the 5' end of the gRNA uses complementary base pairing to target the Cas nuclease to the target site, e.g., to a gene. The target site can be selected based on its location directly 5' to its protospacer adjacent motif (PAM) sequence, e.g., typically NGG or NAG. In this regard, the gRNA can be targeted to a desired sequence by modifying the first 20, 19, 18, 17, 16, 15, 14, 14, 12, 11, or 10 nucleotides of the guide RNA to correspond to the target DNA sequence. Generally, CRISPR system is characterized by the element that promotes the formation of CRISPR complex at the site of target sequence.Typically, "target sequence" generally refers to the sequence for which guide sequence is designed, so that the hybridization between target sequence and guide sequence has the complementarity that promotes the formation of CRISPR complex.Complete complementarity is not necessary, provided that there is sufficient complementarity to cause hybridization and promote the formation of CRISPR complex.

[0031] The CRISPR system can induce a double-strand break (DSB) at the target site followed by a disruption as described herein. In other embodiments, a Cas9 variant considered a "nickase" is used to create a single-strand nick at the target site. Paired nickases can be used to improve specificity, for example, each of which is directed by a pair of different gRNA targeting sequences such that a 5' overhang is introduced simultaneously with the introduction of a nick. In other embodiments, catalytically inactive Cas9 is fused to a heterologous effector domain, such as a transcriptional repressor or activator, to trigger gene expression.

[0032] The target sequence may comprise any polynucleotide, such as DNA or RNA polynucleotide. The target sequence may be located in the nucleus or cytoplasm of a cell, for example, in an organelle of a cell. In general, the sequence or template that can be used for recombination into a targeting locus, including the target sequence, is referred to as "editing template" or "editing polynucleotide" or "editing sequence". In some aspects, the exogenous template polynucleotide may be referred to as editing template. In some aspects, the recombination is homologous recombination.

[0033] Typically, in the context of an endogenous CRISPR system, the formation of a CRISPR complex (including a guide sequence that hybridizes to a target sequence and forms a complex with one or more Cas proteins) results in the cleavage of one or both strands in or near the target sequence (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from the target sequence). A tracr sequence that includes or consists of all or a portion of a wild-type tracr sequence (e.g., about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of the wild-type tracr sequence, or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of the wild-type tracr sequence) can also form part of a CRISPR complex, such as by hybridization with all or a portion of a tracr mate sequence that is operably linked to the guide sequence along at least a portion of the tracr sequence. The tracr sequence has sufficient complementarity with the tracr mate sequence to hybridize and participate in the formation of a CRISPR complex, e.g., at least 50%, 60%, 70%, 80%, 90%, 95% or 99% sequence complementarity along the length of the tracr mate sequence when optimally aligned.

[0034] One or more vectors driving the expression of one or more elements of the CRISPR system can be introduced into a cell such that the expression of the elements of the CRISPR system directs the formation of a CRISPR complex at one or more target sites. The components can also be delivered to the cell as proteins and / or RNA. For example, the Cas enzyme, the guide sequence linked to the tracr-mate sequence, and the tracr sequence can each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements can be combined in a single vector with one or more additional vectors providing any components of the CRISPR system not included in the first vector. The vector can include one or more insertion sites (also referred to as "cloning sites"), such as restriction endonuclease recognition sequences. In some embodiments, the one or more insertion sites are located upstream and / or downstream of one or more sequence elements of the one or more vectors. When multiple different guide sequences are used, a single expression construct can be used to target CRISPR activity to multiple different corresponding target sequences in a cell.

[0035] The vector may include a regulatory element operably linked to an enzyme coding sequence encoding a Cas protein (also referred to as a "Cas nuclease"). Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Cas12a (Cpf1), Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm, Css1, Css2 ... 2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csfl, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof. These enzymes are known; for example, the amino acid sequence of the S. pyogenes Cas9 protein can be found in the SwissProt database under accession number Q99ZW2.

[0036] The Cas nuclease can be Cas9 (e.g., Streptococcus pyogenes or S. pneumoniae). The Cas nuclease can be Cas12a. The Cas nuclease can direct one or both strand cleavage at the location of the target sequence, e.g., within the target sequence and / or within the complement of the target sequence. The vector can encode a Cas nuclease that is mutated relative to the corresponding wild-type enzyme such that the mutant Cas nuclease lacks the ability to cleave one or both strands of a target polynucleotide containing the target sequence. For example, an aspartic acid to alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 from Streptococcus pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (that cleaves a single strand). In some embodiments, the Cas9 nickase can be used in combination with a guide sequence, e.g., two guide sequences, that target the sense and antisense strands of a DNA target, respectively. This combination creates a nick on both strands, allowing it to be used to induce NHEJ or HDR.

[0037] In some embodiments, the enzyme coding sequence encoding the CRISPR enzyme is codon-optimized for expression in a particular cell, such as a eukaryotic cell. The eukaryotic cell can be or be derived from a particular organism, such as a mammal, including but not limited to a human, mouse, rat, rabbit, dog, or non-human primate. In general, codon optimization refers to the process of modifying a nucleic acid sequence for enhanced expression in a host cell of interest by replacing at least one codon of the native sequence with a codon that is more or most frequently used in the host cell's genes, while maintaining the native amino acid sequence. Different species show a particular bias for a particular codon of a particular amino acid. Codon bias (the difference in codon usage between organisms) often correlates with the translation efficiency of messenger RNA (mRNA), which in turn is believed to depend, among other things, on the nature of the codon being translated and the availability of a particular transfer RNA (tRNA) molecule. The dominance of a selected tRNA in a cell is generally a reflection of the codon that is most frequently used in peptide synthesis. Thus, genes can be tailored for optimal gene expression in a given organism based on codon optimization.

[0038] In general, a guide sequence is any polynucleotide sequence that has sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of CRISPR complex to the target sequence.In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence is 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99% or more, or is greater than 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99% or more, when optimally aligned using a suitable alignment algorithm.

[0039] Optimal alignment may be determined by use of any algorithm suitable for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler transformation (e.g., Burrows Wheeler Aligner), Clustal W, Clustal X, BLAT, Novoalign (Novocraft Technologies, ELAND (Illumina, San Diego, Calif.), SOAP (available from soap.genomics.org.cn), and Maq (available from maq.sourceforge.net).

[0040] Cas nuclease can be part of a fusion protein that contains one or more heterologous protein domains. Cas nuclease fusion protein can contain any additional protein sequence and optionally a linker sequence between any two domains. Examples of protein domains that can be fused with Cas nuclease include, but are not limited to, epitope tags, reporter gene sequences, and protein domains that have one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity, and nucleic acid binding activity. Non-limiting examples of epitope tags include histidine (His) tag, V5 tag, FLAG tag, influenza hemagglutinin (HA) tag, Myc tag, VSV-G tag, and thioredoxin (Trx) tag. Examples of reporter genes include, but are not limited to, glutathione-5-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), autofluorescent proteins including HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and blue fluorescent protein (BFP). Cas nucleases can be fused to genetic sequences encoding proteins or fragments of proteins that bind to DNA molecules or to other cellular molecules including, but not limited to, maltose binding protein (MBP), S-tags, Lex A DNA binding domain (DBD) fusions, GAL4A DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. Additional domains that may form part of fusion proteins containing Cas nucleases are described in US 20110059502, which is incorporated herein by reference.

[0041] II. Treatment Aspects of the present disclosure are directed to compositions and methods for therapeutic use.The compositions of the present disclosure can be used for in vivo, in vitro or ex vivo administration.The administration route of the composition can be, for example, intratumoral, intravenous, intramuscular, intraperitoneal, subcutaneous, intraarticular, intrasynovial, intrathecal, oral, topical, by inhalation, or by a combination of two or more administration routes.

[0042] A. Cancer Therapy In some embodiments, the disclosed method includes administering a cancer therapy to the subject or patient. The cancer therapy can be selected based on the measurement of expression level alone or in combination with the clinical risk score calculated for the subject. In some embodiments, the cancer therapy includes a local cancer therapy. In some embodiments, the cancer therapy excludes a systemic cancer therapy. In some embodiments, the cancer therapy excludes a local therapy. In some embodiments, the cancer therapy includes a local cancer therapy without administering a systemic cancer therapy. In some embodiments, the cancer therapy includes an immunotherapy, which can be a checkpoint inhibitor therapy or an adoptive cell therapy. In some embodiments, the cancer therapy is an adoptive T cell therapy (ACT). Any of these cancer therapies can also be excluded. A combination of these therapies can also be administered.

[0043] The term "cancer" as used herein may be used to describe a solid tumor, a metastatic cancer, or a non-metastatic cancer. In certain aspects, the cancer may be of bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, duodenum, small intestine, large intestine, colon, rectum, anus, gums, head, kidney, liver, lung, nasopharynx, cervix, ovary, pancreas, prostate, skin, stomach, testis, tongue, or uterus origin.

[0044] The cancer may specifically be of the following histological types, but is not limited to: malignant neoplasm; carcinoma; undifferentiated carcinoma; giant cell and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; malignant gastrinoma; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma);trabecular adenocarcinoma;adenoid cystic carcinoma;adenomatous polypoid adenocarcinoma;familial polyposis coli adenocarcinoma;solid tumors;malignant carcinoid tumors;bronchioloalveolar carcinoma;papillary adenocarcinoma;chromophobe carcinoma;eosinophilic carcinoma;eosinophilic adenocarcinoma;basophilic carcinoma;clear cell adenocarcinoma;granular cell carcinoma;follicular adenocarcinoma;papillary follicular adenocarcinoma;nonencapsulated sclerosing carcinoma;adrenal cortical carcinoma;endometrioid carcinoma;skin adnexal carcinoma;apocrine adenocarcinoma;sebaceous gland carcinoma;ceruminous gland carcinoma Breast cancer;Mucoepidermoid carcinoma;Cystadenocarcinoma;Papillary cystadenocarcinoma;Papillary serous cystadenocarcinoma;Mucinous cystadenocarcinoma;Mucinous adenocarcinoma;Signet ring cell carcinoma;Invasive ductal carcinoma;Medullary carcinoma;Lobular carcinoma;Inflammatory carcinoma;Paget's disease of the breast;Acinic cell carcinoma;Adenosquamous carcinoma;Adenocarcinoma with squamous metaplasia;Malignant thymoma;Malignant ovarian stromal tumor;Malignant theca cell tumor;Malignant granulosa cell tumor;Malignant androblastoma;Sertoli cell carcinoma;Malignant Leydig cell tumor;Malignant lipid cell tumor;Malignant parametrial carcinoma Ganglionoma;Extramammary malignant paraganglioma;Pheochromocytoma;Glomus angiosarcoma;Malignant melanoma;Amelanotic melanoma;Superficial spreading melanoma;Malignant melanoma in giant pigmented nevus;Epithelioid cell melanoma;Malignant blue nevus;Sarcoma;Fibrosarcoma;Malignant fibrous histiocytoma;Myxosarcoma;Liposarcoma;Leiomyosarcoma;Rhabdomyosarcoma;Embryonic rhabdomyosarcoma;Alveolar rhabdomyosarcoma;Stroma sarcoma;Malignant mixed tumor;Mullerian mixed tumor;Nephroblastoma;Hepatoblastoma;Carcinosarcoma;Malignant mesenchymoma;Malignant Brenner tumor;Malignant phyllodes tumor;Synovium Membrane sarcoma;Malignant mesothelioma;Dysgerminoma;Embryonal carcinoma;Malignant teratoma;Malignant ovarian goiter;Choriocarcinoma;Malignant mesonephroma;Angiosarcoma;Malignant hemangioendothelioma;Kaposi's sarcoma;Malignant hemangiopericytoma;Lymphangiosarcoma;Osteosarcoma;Parocytic osteosarcoma;Chondrosarcoma;Malignant chondroblastoma;Mesenchymal chondrosarcoma;Giant cell tumor of bone;Ewing's sarcoma;Malignant odontogenic tumor;Ameloblastoma;Malignant ameloblastoma;Ameloblastoma fibrosarcoma;Malignant pinealoma;Chordoma;Malignant glioma;Ependymoma;Astrocytoma;Protoplasmic astrocytoma;Fibrillary astrocytoma;Astroblastoma;Glioblastoma;Oligodendroglioma;Oligodendroglioma;Primitive neuroectodermal tumor;Cerebellar sarcoma;Ganglioneuroblastoma;Neuroblastoma;Retinoblastoma;Olfactory neurogenic tumor;Malignant meningioma;Neurofibrosarcoma;Malignant neurilemmoma;Malignant granular cell tumor;Malignant lymphoma;Hodgkin's disease;Hodgkin's lateral granuloma;Malignant small lymphocytic lymphoma;Malignant diffuse large cell lymphoma;Malignant In some embodiments, the cancer is melanoma.;

[0045] In some embodiments, the cancer is a recurrent cancer. In some embodiments, the cancer is a stage I cancer. In some embodiments, the cancer is a stage II cancer. In some embodiments, the cancer is a stage III cancer. In some embodiments, the cancer is a stage IV cancer.

[0046] It is contemplated that the cancer treatment may exclude any of the cancer treatments described herein.Furthermore, the embodiments of the present disclosure include patients who have been previously treated with the therapeutic methods described herein, and patients who are currently being treated with the therapeutic methods described herein, or patients who have never been treated with the therapeutic methods described herein.In some embodiments, the patient is a patient who is determined to be resistant to the therapeutic methods described herein.In some embodiments, the patient is a patient who is determined to be sensitive to the therapeutic methods described herein.

[0047] B. Cancer Immunotherapy In some embodiments, the method includes administering cancer immunotherapy. Cancer immunotherapy (sometimes called immuno-oncology, abbreviated as IO) is the use of the immune system to treat cancer. Immunotherapies can be classified as active, passive or hybrid (active and passive). These approaches take advantage of the fact that cancer cells often have molecules on their surface that can be detected by the immune system, known as tumor-associated antigens (TAA); these molecules are often proteins or other macromolecules (e.g., carbohydrates). Active immunotherapy instructs the immune system to attack tumor cells by targeting TAA. Passive immunotherapy strengthens existing anti-tumor responses and includes the use of monoclonal antibodies, lymphocytes and cytokines. Various immunotherapies are known in the art, and examples are described below.

[0048] 1. Checkpoint Inhibitors and Combination Treatments Aspects of the present disclosure may include administration of immune checkpoint inhibitors, examples of which are further described below. As disclosed herein, "checkpoint inhibitor therapy" (also referred to as "immune checkpoint blockade therapy", "immune checkpoint therapy", "ICT", "checkpoint blockade immunotherapy", or "CBI") refers to cancer therapy that includes providing one or more immune checkpoint inhibitors to a subject suffering from or suspected of having cancer.

[0049] a. PD-1, PDL1, and PDL2 inhibitors PD-1 can act in the tumor microenvironment where T cells encounter infection or tumors. Activated T cells upregulate PD-1 and continue to express it in peripheral tissues. Cytokines such as IFN-gamma induce the expression of PDL1 on epithelial and tumor cells. PDL2 is expressed on macrophages and dendritic cells. The main role of PD-1 is to limit the activity of effector T cells in the periphery and prevent excessive damage to tissues during immune responses. The inhibitors of the present disclosure can block one or more functions of PD-1 and / or PDL1 activity.

[0050] Alternative names for "PD-1" include CD279 and SLEB2. Alternative names for "PDL1" include B7-H1, B7-4, CD274, and B7-H. Alternative names for "PDL2" include B7-DC, Btdc, and CD273. In some embodiments, PD-1, PDL1, and PDL2 are human PD-1, PDL1, and PDL2.

[0051] In some embodiments, the PD-1 inhibitor is a molecule that inhibits the binding of PD-1 to its ligand binding partner. In certain aspects, the PD-1 ligand binding partner is PDL1 and / or PDL2. In another embodiment, the PDL1 inhibitor is a molecule that inhibits the binding of PDL1 to its binding partner. In certain aspects, the PDL1 binding partner is PD-1 and / or B7-1. In another embodiment, the PDL2 inhibitor is a molecule that inhibits the binding of PDL2 to its binding partner. In certain aspects, the PDL2 binding partner is PD-1. The inhibitor can be an antibody, an antigen-binding fragment thereof, an immunoadhesin, a fusion protein, or an oligopeptide. Exemplary antibodies are described in U.S. Patent Nos. 8,735,553, 8,354,509, and 8,008,449, all of which are incorporated herein by reference. Other PD-1 inhibitors for use in the methods and compositions provided herein are known in the art, such as those described in U.S. Patent Application Publication Nos. 2014 / 0294898, 2014 / 022021, and 2011 / 0008369, all of which are incorporated herein by reference.

[0052] In some embodiments, the PD-1 inhibitor is an anti-PD-1 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody). In some embodiments, the anti-PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, and pidilizumab. In some embodiments, the PD-1 inhibitor is an immunoadhesin (e.g., an immunoadhesin comprising an extracellular or PD-1 binding portion of PDL1 or PDL2 fused to a constant region (e.g., an Fc region of an immunoglobulin sequence). In some embodiments, the PDL1 inhibitor comprises AMP-224. Nivolumab, also known as MDX-1106-04, MDX-1106, ONO-4538, BMS-936558, and OPDIVO®, is an anti-PD-1 antibody described in WO 2006 / 121168. MK-3475, Merck Pembrolizumab, also known as 3475, lambrolizumab, KEYTRUDA®, and SCH-900475, is an anti-PD-1 antibody described in WO2009 / 114335. Pidilizumab, also known as CT-011, hBAT, or hBAT-1, is an anti-PD-1 antibody described in WO2009 / 101611. AMP-224, also known as B7-DCIg, is a PDL2-Fc fusion soluble receptor described in WO2010 / 027827 and WO2011 / 066342. Additional PD-1 inhibitors include MEDI0680, also known as AMP-514 and REGN2810.

[0053] In some embodiments, the immune checkpoint inhibitor is a PDL1 inhibitor, such as durvalumab, also known as MEDI4736, atezolizumab, also known as MPDL3280A, avelumab, also known as MSB00010118C, MDX-1105, BMS-936559, or a combination thereof. In certain aspects, the immune checkpoint inhibitor is a PDL2 inhibitor, such as rHIgM12B7.

[0054] In some embodiments, the inhibitor comprises the heavy and light chain CDRs or VRs of nivolumab, pembrolizumab, or pidilizumab. Thus, in one embodiment, the inhibitor comprises the CDR1, CDR2, and CDR3 domains of the VH region of nivolumab, pembrolizumab, or pidilizumab, and the CDR1, CDR2, and CDR3 domains of the VL region of nivolumab, pembrolizumab, or pidilizumab. In another embodiment, the antibody competes for binding to and / or binds to the same epitope on PD-1, PDL1, or PDL2 as the above-mentioned antibody. In another embodiment, the antibody has at least about 70, 75, 80, 85, 90, 95, 97, or 99% (or any range derivable therein) of variable region amino acid sequence identity with the above-mentioned antibody.

[0055] b. CTLA-4, B7-1, and B7-2 Another immune checkpoint that can be targeted in the methods provided herein is cytotoxic T lymphocyte-associated protein 4 (CTLA-4), also known as CD152. The complete cDNA sequence of human CTLA-4 has GenBank accession number L15006. CTLA-4 is found on the surface of T cells and acts as an "off" switch when bound to B7-1 (CD80) or B7-2 (CD86) on the surface of antigen-presenting cells. CTLA4 is a member of the immunoglobulin superfamily expressed on the surface of helper T cells and transmits inhibitory signals to T cells. CTLA4 is similar to the T cell costimulatory protein, CD28, and both molecules bind to B7-1 and B7-2 on antigen-presenting cells. CTLA-4 transmits inhibitory signals to T cells, while CD28 transmits stimulatory signals. Intracellular CTLA-4 is also found in regulatory T cells and may be important for their function. T cell activation via T cell receptor and CD28 leads to increased expression of CTLA-4, an inhibitory receptor for B7 molecules. The inhibitor of the present disclosure can block one or more functions of CTLA-4, B7-1, and / or B7-2 activity. In some embodiments, the inhibitor blocks the interaction between CTLA-4 and B7-1. In some embodiments, the inhibitor blocks the interaction between CTLA-4 and B7-2.

[0056] In some embodiments, the immune checkpoint inhibitor is an anti-CTLA-4 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigen-binding fragment thereof, an immunoadhesin, a fusion protein, or an oligopeptide.

[0057] Anti-human CTLA-4 antibodies (or VH and / or VL domains derived therefrom) suitable for use in the present method can be generated using methods well known in the art. Alternatively, art-recognized anti-CTLA-4 antibodies can be used. For example, the anti-CTLA-4 antibodies disclosed in U.S. Patent No. 8,119,129, WO2001 / 014424, WO98 / 42752; WO20000 / 37504 (CP675,206, also known as tremelimumab; formerly ticilimumab), U.S. Patent No. 6,207,156; Hurwitz et al., 1998 can be used in the methods disclosed herein. The teachings of each of the aforementioned publications are incorporated herein by reference. Antibodies that compete with any of these art-recognized antibodies for binding to CTLA-4 can also be used. For example, humanized CTLA-4 antibodies are described in International Patent Application Nos. WO2001 / 014424, WO2000 / 037504, and US Pat. No. 8,017,114; all of which are incorporated herein by reference.

[0058] An additional anti-CTLA-4 useful as a checkpoint inhibitor in the methods and compositions of the disclosure is ipilimumab (also known as 10D1, MDX-010, MDX-101, and Yervoy®) or antigen-binding fragments and variants thereof (see, e.g., WO2001 / 014424).

[0059] In some embodiments, the inhibitor comprises the heavy and light chain CDRs or VRs of tremelimumab or ipilimumab. Thus, in one embodiment, the inhibitor comprises the CDR1, CDR2, and CDR3 domains of the VH region of tremelimumab or ipilimumab, and the CDR1, CDR2, and CDR3 domains of the VL region of tremelimumab or ipilimumab. In another embodiment, the antibody competes for binding to and / or binds to the same epitope on PD-1, B7-1, or B7-2 as the above-mentioned antibody. In another embodiment, the antibody has at least about 70, 75, 80, 85, 90, 95, 97, or 99% (or any range derivable therein) of variable region amino acid sequence identity with the above-mentioned antibody.

[0060] c. LAG3 Another immune checkpoint that can be targeted in the methods provided herein is lymphocyte activation gene 3 (LAG3), also known as CD223 and lymphocyte activation 3. The complete mRNA sequence of human LAG3 has GenBank accession number NM_002286. LAG3 is a member of the immunoglobulin superfamily found on the surface of activated T cells, natural killer cells, B cells, and plasmacytoid dendritic cells. The primary ligand for LAG3 is MHC class II, which has been reported to negatively regulate T cell proliferation, activation, and homeostasis in a manner similar to CTLA-4 and PD-1, and to play a role in the suppressive function of Tregs. LAG3 also inhibits CD8 + LAG3 helps maintain T cells in a tolerogenic state and works with PD-1 to maintain CD8 exhaustion during chronic viral infection. It is also known that LAG3 is involved in dendritic cell maturation and activation. The inhibitors of the present disclosure can block one or more functions of LAG3 activity.

[0061] In some embodiments, the immune checkpoint inhibitor is an anti-LAG3 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigen-binding fragment thereof, an immunoadhesin, a fusion protein, or an oligopeptide.

[0062] Anti-human-LAG3 antibody (or VH and / or VL domain derived therefrom) suitable for use in the present method can be generated using methods well known in the art.Alternatively, anti-LAG3 antibody approved in the art can be used.For example, anti-LAG3 antibody can include GSK2837781, IMP321, FS-118, Sym022, TSR-033, MGD013, BI754111, AVA-017, or GSK2831781. No. 9,505,839 (BMS-986016, also known as relatlimab); U.S. Patent No. 10,711,060 (IMP-701, also known as LAG525); U.S. Patent No. 9,244,059 (IMP731, also known as H5L7BW); U.S. Patent No. US10,344,089 (25F7, also known as LAG3.1); WO2016 / 028672 (MK-4280, also known as 28G-10); WO2017 / 019894 (BAP050); Burova E., et al., J. ImmunoTherapy Cancer, 2016; 4(Supp. 1):P195(REGN3767); Yu, X., et al., mAbs, 2019;11:6 (LBL-007) can be used in the methods disclosed herein.These and other anti-LAG-3 antibodies useful in the claimed invention are described in, for example, WO2016 / 028672, WO2017 / 106129, WO2017062888, WO2009 / 044273, WO2018 / 069500, WO2016 / 126858, WO2014 / 179664, WO2016 / 200782, WO2015 / 200119, WO2017 / 019846, WO2017 / 198741, WO2017 / 220555, WO20 The antibody can be found in US2017 / 0260271, WO2017 / 086367, WO2017 / 086419, WO2018 / 034227 and WO2014 / 140180.The teachings of each of the above publications are incorporated herein by reference.Antibodies that compete with any of these antibodies that are recognized in the art for binding to LAG3 can also be used.

[0063] In some embodiments, the inhibitor comprises the CDRs or VRs of the heavy and light chains of an anti-LAG3 antibody. Thus, in one embodiment, the inhibitor comprises the CDR1, CDR2, and CDR3 domains of the VH region of an anti-LAG3 antibody, and the CDR1, CDR2, and CDR3 domains of the VL region of an anti-LAG3 antibody. In another embodiment, the antibody has at least about 70, 75, 80, 85, 90, 95, 97, or 99% (or any range derivable therein) of variable region amino acid sequence identity with the above-mentioned antibody.

[0064] d. TIM-3 Another immune checkpoint that can be targeted in the methods provided herein is Hepatitis A virus cellular receptor 2 (HAVCR2) and T cell immunoglobulin-mucin domain containing 3 (TIM-3), also known as CD366. The complete mRNA sequence of human TIM-3 has GenBank accession number NM_032782. TIM-3 inhibits IFNγ-producing CD4+ Th1 and CD8 + TIM-3 is found on the Tc1 cell surface. The extracellular region of TIM-3 consists of a membrane-distal single variable immunoglobulin domain (IgV) and a variable-length glycosylated mucin domain located close to the membrane. TIM-3 is an immune checkpoint, and together with other inhibitory receptors including PD-1 and LAG3, it mediates T cell exhaustion. TIM-3 has also been shown to be a CD4+ Th1-specific cell surface protein that regulates macrophage activation. The inhibitors of the present disclosure can block one or more functions of TIM-3 activity.

[0065] In some embodiments, the immune checkpoint inhibitor is an anti-TIM-3 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigen-binding fragment thereof, an immunoadhesin, a fusion protein, or an oligopeptide.

[0066] Anti-human-TIM-3 antibodies (or VH and / or VL domains derived therefrom) suitable for use in the present method can be generated using methods well known in the art. Alternatively, art-recognized anti-TIM-3 antibodies can be used. For example, anti-TIM-3 antibodies including MBG453, TSR-022 (also known as Cobolimab), and LY3321367 can be used in the methods disclosed herein. These and other anti-TIM-3 antibodies useful for the claimed invention can be found, for example, in U.S. Patent No. 9,605,070, U.S. Patent No. 8,841,418, US2015 / 0218274, and US2016 / 0200815. The teachings of each of the above publications are incorporated herein by reference. Antibodies that compete with any of these art-recognized antibodies for binding to LAG3 can also be used.

[0067] In some embodiments, the inhibitor comprises the heavy and light chain CDRs or VRs of an anti-TIM-3 antibody. Thus, in one embodiment, the inhibitor comprises the CDR1, CDR2, and CDR3 domains of the VH region of an anti-TIM-3 antibody, and the CDR1, CDR2, and CDR3 domains of the VL region of an anti-TIM-3 antibody. In another embodiment, the antibody has at least about 70, 75, 80, 85, 90, 95, 97, or 99% (or any range derivable therein) variable region amino acid sequence identity with the above-mentioned antibodies.

[0068] 2. Activation of costimulatory molecules In some embodiments, the immunotherapy comprises an activator (i.e., an agonist) of a costimulatory molecule. In some embodiments, the activator comprises an activator of B7-1 (CD80), B7-2 (CD86), CD28, ICOS, OX40 (TNFRSF4), 4-1BB (CD137; TNFRSF9), CD40L (CD40LG), GITR (TNFRSF18), and combinations thereof. Activators include agonist antibodies, polypeptides, compounds, and nucleic acids.

[0069] 3. Dendritic cell therapy Dendritic cell therapy induces an anti-tumor response by having dendritic cells present tumor antigens to lymphocytes, which activates lymphocytes and primes them to kill other cells that present the antigen. Dendritic cells are antigen-presenting cells (APCs) in the mammalian immune system. In cancer treatment, dendritic cells help target cancer antigens. One example of a dendritic cell-based cellular cancer therapy is sipuleucel-T.

[0070] One method of inducing dendritic cells to present tumor antigens is by vaccination with autologous tumor lysates or short peptides (small portions of proteins that correspond to protein antigens on cancer cells). These peptides are often given in combination with adjuvants (highly immunogenic substances) to increase immune and antitumor responses. Other adjuvants include proteins or other chemicals that attract and / or activate dendritic cells, such as granulocyte-macrophage colony-stimulating factor (GM-CSF).

[0071] Dendritic cells can also be activated in vivo by expressing GM-CSF in tumor cells, which can be accomplished by either genetically engineering the tumor cells to produce GM-CSF or by infecting the tumor cells with an oncolytic virus that expresses GM-CSF.

[0072] Another strategy is to remove dendritic cells from the patient's blood and activate them ex vivo. The dendritic cells are activated in the presence of tumor antigens, which can be single tumor-specific peptides / proteins or tumor cell lysates (a solution of broken tumor cells). These cells (with optional adjuvants) are injected to induce an immune response.

[0073] Dendritic cell therapy involves the use of antibodies that bind to receptors on the surface of dendritic cells. Antigens can be added to the antibodies, inducing dendritic cells to mature and provide immunity against tumors. Dendritic cell receptors, such as TLR3, TLR7, TLR8 or CD40, have been used as antibody targets.

[0074] 4. CAR-T and CAR-NK cell therapy Chimeric antigen receptors (also known as CARs, chimeric immune receptors, chimeric T cell receptors or artificial T cell receptors) are engineered receptors that combine new specificities with immune cells to target cancer cells. Typically, these receptors transfer the specificity of monoclonal antibodies to T cells, natural killer (NK) cells, or other immune cells. The receptors are called chimeric because they are a fusion of parts from different sources. CAR-T cell therapy refers to the treatment of using such transformed cells for cancer therapy, where the transformed cells are T cells. Similar therapies include, for example, CAR-NK cell therapy, which uses transformed NK cells.

[0075] The basic principle of CAR-T cell design requires an engineered receptor that combines antigen-binding function with T-cell activation function. The general premise of CAR-T cells is to artificially generate T cells that target markers found on cancer cells. Scientists can take T cells from humans, genetically modify them, and return them to the patient so that the T cells attack the cancer cells. After being engineered to become CAR-T cells, the T cells act as "living drugs." CAR-T cells produce a link from their extracellular ligand recognition domain to an intracellular signaling molecule that subsequently activates the T cell. The extracellular ligand recognition domain is usually a single-chain variable fragment (scFv). A key aspect of the safety of CAR-T cell therapy is how to ensure that only cancerous tumor cells are targeted and not normal cells. The specificity of CAR-T cells is determined by the choice of the molecule that is targeted.

[0076] Examples of CAR-T therapies include tisagenlecleucel (Kymriah) and axicabtagene ciloreucel (Yescarta).

[0077] 5. Cytokine therapy Cytokines are proteins produced by many types of cells present in tumors. They can modulate the immune response. Tumors often utilize cytokines to grow tumors and reduce immune responses. These immune modulating effects allow cytokines to be used as drugs to induce immune responses. Two commonly used cytokines are interferons and interleukins.

[0078] Interferons are produced by the immune system. They are usually involved in antiviral responses but also have applications for cancer. They fall into three groups: type I (IFNα and IFNβ), type II (IFNγ) and type III (IFNλ).

[0079] Interleukins have a range of immune system effects. IL-2 is an example of an interleukin cytokine therapy.

[0080] 6. Adoptive T cell therapy Adoptive T cell therapy (ACT) is a form of passive immunization by the infusion of T cells (adoptive cell transfer). They are found in blood and tissues and are usually activated when they find a foreign pathogen. In particular, they can be activated when the surface receptors of the T cells encounter cells that present a portion of a foreign protein on their surface antigen. These can be either infected cells or antigen-presenting cells (APCs). T cells are found in normal and tumor tissues, where they are known as tumor-infiltrating lymphocytes (TILs). They are activated by the presence of APCs, such as dendritic cells, that present tumor antigens. Although these cells can attack tumors, the environment within the tumor is highly immunosuppressive, which may limit or prevent immune-mediated tumor killing.

[0081] Several methods have been developed to generate and obtain tumor-targeting T cells. Tumor antigen-specific T cells can be extracted from tumor samples (tumor infiltrating lymphocytes or "TIL") or filtered from blood. Following activation, culture may be performed ex vivo, and the resulting cells are administered to a subject. Activation can be performed via gene therapy and / or by exposing T cells to tumor antigens. T cells can be genetically modified to alter one or more characteristics, e.g., enhanced therapeutic efficacy. In some embodiments, T cells are genetically modified before being administered to a subject. In some embodiments, T cells that do not secrete TGF-β1 are used for adoptive T cell therapy. In some embodiments, T cells that do not express TGF-β1 (e.g., T cells that contain a knockout mutation of TGFB1) are used for adoptive T cell therapy. Genetically modified T cells and methods for generating such cells are further described elsewhere herein.

[0082] C. Oncolytic Viruses In some embodiments, the additional treatment comprises oncolytic viruses. Oncolytic viruses are viruses that preferentially infect and kill cancer cells. As infected cancer cells are destroyed by oncolysis, they release new infectious virus particles or virions to help destroy remaining tumors. Oncolytic viruses are believed to not only cause direct destruction of tumor cells, but also stimulate host anti-tumor immune responses for long-term immunotherapy.

[0083] D. Polysaccharide In some embodiments, the additional treatment comprises polysaccharides. Certain compounds found in mushrooms, mainly polysaccharides, can upregulate the immune system and may have anti-cancer properties. For example, beta-glucans such as lentinan have been shown in laboratory studies to stimulate macrophages, NK cells, T cells and immune system cytokines, and are being investigated in clinical trials as immune adjuvants.

[0084] E. Neoantigens In some embodiments, the additional therapy involves the administration of neo-antigens. Many tumors express mutations. These mutations potentially create new targetable antigens (neo-antigens) for use in T cell immunotherapy. CD8 in cancer lesions as identified using RNA sequencing data. + The presence of T cells is higher in tumors with high mutational burden. Levels of transcripts associated with natural killer cell and T cell cytolytic activity positively correlate with mutational load in many human tumors.

[0085] F. Chemotherapy In some embodiments, the additional therapy comprises chemotherapy. Suitable classes of chemotherapeutic agents include (a) alkylating agents, such as nitrogen mustards (e.g., mechlorethamine, cyclophosphamide, ifosfamide, melphalan, chlorambucil), ethylenimines and methylmelamines (e.g., hexamethylmelamine, thiotepa), alkyl sulfonates (e.g., busulfan), nitrosoureas (e.g., carmustine, lomustine, chlorozotocin, streptozocin), and triazines (e.g., dicarbazine); (b) antimetabolites, such as folic acid analogs (e.g., methotrexate), pyrimidine analogs (e.g., 5-fluorouracil, floxuridine, cytarabine, azauridine), and purine analogs and related substances (e.g., 6-mercaptopurine, , 6-thioguanine, pentostatin), (c) natural products such as vinca alkaloids (e.g., vinblastine, vincristine), epipodophyllotoxins (e.g., etoposide, teniposide), antibiotics (e.g., dactinomycin, daunorubicin, doxorubicin, bleomycin, plicamycin, and mitoxantrone), enzymes (e.g., L-asparaginase), and biological response modifiers (e.g., interferon-α), and (d) miscellaneous agents such as platinum coordination complexes (e.g., cisplatin, carboplatin), substituted ureas (e.g., hydroxyurea), methylhydrazine derivatives (e.g., procarbazine), and adrenal cortex suppressants (e.g., taxol and mitotane). In some embodiments, cisplatin is a particularly suitable chemotherapeutic agent.

[0086] Cisplatin is widely used to treat cancers, such as metastatic testicular or ovarian cancer, advanced bladder cancer, head and neck cancer, cervical cancer, lung cancer or other tumors. Cisplatin is not absorbed orally and must therefore be delivered via other routes, such as intravenous, subcutaneous, intratumoral or intraperitoneal injection. Cisplatin can be used alone or in combination with other agents and is administered at a dose of about 15 mg / m in clinical applications. 2 ~about 20mg / m 2It is contemplated in certain embodiments that an effective dose of is used for 5 days, every 3 weeks, for a total of 3 courses. In some embodiments, the amount of cisplatin delivered to a cell and / or subject with a construct comprising an Egr-1 promoter operably linked to a polynucleotide encoding a therapeutic polypeptide is less than the amount that would be delivered if cisplatin was used alone.

[0087] Other suitable chemotherapeutic agents include anti-microtubule agents, such as paclitaxel ("taxol") and doxorubicin hydrochloride ("doxorubicin"). The combination of an Egr-1 promoter / TNFα construct delivered via an adenoviral vector with doxorubicin has been determined to be effective in overcoming resistance to chemotherapy and / or TNF-α, suggesting that combined treatment of the construct with doxorubicin overcomes resistance to both doxorubicin and TNF-α.

[0088] Doxorubicin is poorly absorbed and is preferably administered intravenously. In certain embodiments, suitable intravenous doses for adults include about 60 mg / m2 to about 75 mg / m2 at about 21 day intervals, or about 25 mg / m2 to about 30 mg / m2 for 2 or 3 consecutive days repeated at about 3 to about 4 week intervals, or about 20 mg / m2 once a week. The lowest dose should be used in elderly patients if there is prior bone marrow suppression caused by prior chemotherapy or neoplastic bone marrow infiltration, or if the drug is combined with other myelopoiesis suppressing drugs.

[0089] Nitrogen mustard is another suitable chemotherapeutic agent useful in the methods of the present disclosure. Nitrogen mustards may include, but are not limited to, mechlorethamine (HN2), cyclophosphamide and / or ifosfamide, melphalan (L-sarcolysin), and chlorambucil. Cyclophosphamide (CYTOXAN® available from Mead Johnson, NEOSTAR® available from Adria) is another suitable chemotherapeutic agent. Suitable oral doses for adults include, for example, about 1 mg / kg / day to about 5 mg / kg / day, and intravenous doses include, for example, about 40 mg / kg to about 50 mg / kg initially in divided doses for about 2 to about 5 days, or about 10 mg / kg to about 15 mg / kg every about 7 to about 10 days, or about 3 mg / kg to about 5 mg / kg twice a week, or about 1.5 mg / kg / day to about 3 mg / kg / day. Because of adverse effects on the gastrointestinal tract, the intravenous route is preferred. The drug is sometimes administered intramuscularly, by infiltration, or into body cavities.

[0090] Additional suitable chemotherapeutic agents include pyrimidine analogs, such as cytarabine (cytosine arabinoside), 5-fluorouracil (fluorouracil; 5-FU), and floxuridine (fluorodeoxyuridine; FudR). 5-FU can be administered to a subject at a dosage of anywhere from about 7.5 to about 1000 mg / m2. Furthermore, the dosing schedule for 5-FU can be of various durations, such as up to 6 weeks or as determined by one of ordinary skill in the art to which this disclosure pertains.

[0091] Another suitable chemotherapeutic agent, gemcitabine diphosphate (GEMZAR®, Eli Lilly & Co., "gemcitabine"), is recommended for the treatment of advanced and metastatic pancreatic cancer and therefore may also be useful in the present disclosure for these cancers.

[0092] The amount of chemotherapeutic agent delivered to the patient may vary. In one suitable embodiment, when chemotherapy is administered using the construct, the chemotherapeutic agent may be administered in an amount effective to cause the arrest or regression of cancer in the host. In other embodiments, the chemotherapeutic agent may be administered anywhere from 2 to 10,000 times less than the chemotherapeutic effective dose of the chemotherapeutic agent. For example, the chemotherapeutic agent may be administered in an amount about 20 times less, about 500 times less, or even about 5000 times less than the chemotherapeutic effective dose of the chemotherapeutic agent. The chemotherapeutic agents of the present disclosure may be tested in vivo in combination with the construct for the desired therapeutic activity as well as to determine effective dosages. For example, such compounds may be tested in suitable animal model systems, including but not limited to rats, mice, chickens, cows, monkeys, rabbits, and others, prior to testing in humans. In vitro testing may also be used to determine appropriate combinations and dosages as described in the Examples.

[0093] G. Surgery Approximately 60% of people with cancer undergo some type of surgery, including preventive, diagnostic or staging, curative, and palliative surgery. Curative surgery includes resection, in which all or part of the cancerous tissue is physically removed, excised, and / or destroyed, and may be used in conjunction with other therapies, such as the present treatment, chemotherapy, radiation therapy, hormone therapy, gene therapy, immunotherapy, and / or alternative therapies. Tumor resection refers to the physical removal of at least a portion of the tumor. In addition to tumor resection, surgical treatments include laser surgery, cryosurgery, electrosurgery, and microscopically-controlled surgery (Mohs surgery).

[0094] Removal of part or all of cancerous cells, tissues, or tumors may result in the formation of a cavity in the body. Treatment can be achieved by perfusion, direct injection, or local application of the area with additional anti-cancer therapy. Such treatment can be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments can also be in various dosages.

[0095] H. Other Agents It is contemplated that other agents may be used in combination with certain aspects of the present embodiment to improve the therapeutic efficacy of the treatment. These additional agents include agents that affect the upregulation of cell surface receptors and gap junctions, cytostatic and differentiation agents, cell adhesion inhibitors, agents that increase the sensitivity of hyperproliferative cells to apoptosis inducers, or other biological agents. An increase in intercellular signaling that increases the number of gap junctions increases the anti-hyperproliferative effect on adjacent hyperproliferative cell populations. In other embodiments, cytostatic or differentiation agents can be used in combination with certain aspects of the present embodiment to improve the anti-hyperproliferative efficacy of the treatment. Inhibitors of cell adhesion are contemplated to improve the efficacy of the present embodiment. Examples of cell adhesion inhibitors are focal adhesion kinase (FAK) inhibitors and lovastatin. It is further contemplated that other agents that increase the sensitivity of hyperproliferative cells to apoptosis, such as the antibody c225, can also be used in combination with certain aspects of the present embodiment to improve the efficacy of the treatment.

[0096] III. Administration of Therapeutic Compositions The therapeutic methods provided herein may include the combined administration of therapeutic agents such as a first cancer therapy (e.g., an immunotherapeutic agent, such as genetically modified T cells that do not express TGF-β1) and a second cancer therapy (e.g., a chemotherapeutic agent, an additional immunotherapeutic agent, etc.). The therapeutic methods may be administered in any suitable manner known in the art. For example, the first and second cancer treatments may be administered sequentially (at different times) or simultaneously (at the same time). In some embodiments, the first and second cancer treatments are administered in separate compositions. In some embodiments, the first and second cancer treatments are in the same composition.

[0097] The embodiments of the present disclosure relate to compositions and methods, including therapeutic compositions. Different therapies can be administered in one composition or in more than one composition, such as two, three, or four compositions. Various combinations of agents can be employed.

[0098] The therapeutic agents of the present disclosure can be administered by the same or different administration routes.In some aspects, the cancer therapy is administered intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intraorbitally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally.In some aspects, the antibiotic is administered intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intraorbitally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally.The appropriate dosage can be determined based on the type of disease to be treated, the severity and course of the disease, the individual's clinical condition, the individual's clinical history and response to treatment, and the judgment of the attending physician.

[0099] Treatments may include various "unit doses." A unit dose is defined as containing a planned amount of a therapeutic composition. The amount to be administered, as well as the specific route and formulation, are within the skill of the clinical professional to determine. A unit dose need not be administered as a single injection, but may include continuous infusion over a set period of time. In some embodiments, a unit dose includes a single administrable dose.

[0100] The amount to be administered, both in terms of number of treatments and unit doses, depends on the desired treatment effect. It is understood that an effective dose refers to the amount necessary to achieve a particular effect. In the implementation of certain embodiments, it is contemplated that a dose ranging from 10 mg / kg to 200 mg / kg can affect the protective ability of these agents. Thus, the dose can be about 0.1, 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200, 300, 400, 500, 1000 μg / kg, about 0.1, 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200, 300, 400, 500, 1000 mg / kg, approximately , 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200, 300, 400, 500, 1000 μg / day or about 0.1, 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200, 300, 400, 500, 1000 μg / day It is contemplated to include doses of 0, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200, 300, 400, 500, 1000 mg / day, or any range derivable therein. Further, such doses may be administered multiple times a day and / or on multiple days, weeks, or months.

[0101] In certain embodiments, an effective dose of the pharmaceutical composition is a dose capable of providing a blood level of about 1 μM to 150 μM. In other embodiments, an effective dose provides a blood level of about 4 μM to 100 μM; or about 1 μM to 100 μM; or about 1 μM to 50 μM; or about 1 μM to 40 μM; or about 1 μM to 30 μM; or about 1 μM to 20 μM; or about 1 μM to 10 μM; or about 10 μM to 150 μM; or about 10 μM to 100 μM; or about 10 μM to 50 μM; or about 25 μM to 150 μM; or about 25 μM to 100 μM; or about 25 μM to 50 μM; or about 50 μM to 150 μM; or about 50 μM to 100 μM (or any range derivable therein).In other aspects, the dose can provide blood levels of the following agents as a result of the therapeutic agent being administered to the subject: about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66 , 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 μM, at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 μM, or up to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 μM, or any range derivable therein.In certain aspects, a therapeutic agent administered to a subject is metabolized in the body to a metabolized therapeutic agent, in which case the blood levels may refer to the amount of that agent. Alternatively, to the extent that the therapeutic agent is not metabolized by the subject, the blood levels referred to herein may refer to the unmetabolized therapeutic agent.

[0102] The exact amount of the therapeutic composition will also depend on the professional judgment and will be peculiar to each individual. Factors influencing the dosage include the physical and clinical condition of the patient, the route of administration, the intended goal of treatment (relief of symptoms versus cure), and the efficacy, stability, and toxicity of the particular therapeutic agent or other therapy that the subject may be receiving.

[0103] It is understood and appreciated by those skilled in the art that dosage units of μg / kg body weight or mg / kg body weight can be converted and expressed in equivalent concentration units of μg / ml or mM (blood levels), e.g., 4 μM to 100 μM. It is also understood that uptake is species and organ / tissue dependent. Applicable conversion factors and physiological assumptions to be made regarding uptake and concentration measurements are well known, allowing those skilled in the art to convert one concentration measurement to another and make reasonable comparisons and assertions regarding the doses, potencies and results described herein.

[0104] IV. Proteins As used herein, a "protein" or "polypeptide" refers to a molecule that comprises at least five amino acid residues. As used herein, a "peptide" refers to a molecule that comprises at least three amino acid residues. As used herein, the term "wild type" refers to the endogenous version of a molecule that naturally occurs in an organism. In some embodiments, a wild type version of a protein or polypeptide is employed, while in many embodiments of the present disclosure, a modified protein or polypeptide is employed. The above terms may be used interchangeably. A "modified protein" or "modified polypeptide" or "variant" refers to a protein or polypeptide whose chemical structure, particularly its amino acid sequence, has been altered compared to a wild type protein or polypeptide. In some embodiments, a modified / variant protein or polypeptide has at least one modified activity or function (recognizing that a protein or polypeptide may have multiple activities or functions). It is specifically contemplated that a modified / variant protein or polypeptide may be altered with respect to one activity or function, yet retains a wild type activity or function in other respects.

[0105] When a protein is specifically mentioned herein, this generally refers to a native (wild type) or recombinant protein, or a protein with any signal sequence removed, if desired. A protein may be directly isolated from the organism in which it is native, produced by recombinant DNA / exogenous expression methods, or produced by solid phase peptide synthesis (SPPS) or other in vitro methods. In certain aspects, there are isolated nucleic acid segments and recombinant vectors incorporating nucleic acid sequences encoding polypeptides (e.g., antibodies or fragments thereof). The term "recombinant" may be used with a polypeptide or with a specific polypeptide name, generally referring to a polypeptide produced from a nucleic acid molecule that has been manipulated in vitro, or a nucleic acid molecule that is a product of replication of such a molecule.

[0106] A. TGF-β1 Aspects of the present disclosure relate to transforming growth factor beta-1 (TGF-β1). TGF-β1 (NCBI Protein RefSeq NP_000651) is a cytokine encoded by gene TGFB1 (NCBI mRNA Refseq NM_000660). In some embodiments, cells are disclosed that have one or more genetically engineered mutations in the TGFB1 gene.

[0107] B. TGF-β2 Aspects of the present disclosure relate to transforming growth factor beta-2 (TGF-β2). TGF-β2 (NCBI Protein RefSeq NP_001129071) is a cytokine encoded by gene TGFB2 (NCBI mRNA Refseq NM_001135599). In some embodiments, cells are disclosed that have one or more genetically engineered mutations in the TGFB2 gene.

[0108] C. TGF-β3 Aspects of the present disclosure relate to transforming growth factor beta-1 (TGF-β3). TGF-β3 (NCBI Protein RefSeq NP_003230) is a cytokine encoded by gene TGFB3 (NCBI mRNA Refseq NM_003239). In some embodiments, cells are disclosed that have one or more genetically engineered mutations in the TGFB3 gene.

[0109] V. Cells and Preparations Particular embodiments relate to cells comprising the polypeptide or nucleic acid of the present disclosure. In some embodiments, the cells are immune cells. Immune cells contemplated herein include, but are not limited to, T cells, B cells, natural killer cells, and the like. In some embodiments, the immune cells are T cells. "T cells" include all types of immune cells expressing CD3, including helper T cells, natural killer T (NKT) cells, cytotoxic T cells, regulatory T cells (Tregs), and gamma-delta T cells. T cells are CD4 +T cells or CD8 + It may refer to a T cell. Immune cells contemplated herein include engineered immune cells, including immune cells engineered to express one or more exogenous proteins.

[0110] Suitable mammalian cells include primary cells and immortalized cell lines. Suitable mammalian cell lines include human cell lines, non-human primate cell lines, rodent (e.g., mouse, rat) cell lines, and the like. Suitable mammalian cell lines include, but are not limited to, HeLa cells (e.g., American Type Culture Collection (ATCC) No. CCL-2), CHO cells (e.g., ATCC Nos. CRL9618, CCL61, CRL9096), human embryonic kidney (HEK) 293 cells (e.g., ATCC No. CRL-1573), Vero cells, NIH 3T3 cells (e.g., ATCC No. CRL-1658), Huh-7 cells, BHK cells (e.g., ATCC No. CCL10), PC12 cells (ATCC No. CRL1721), COS cells, COS-7 cells (ATCC No. CRL1651), RATI cells, mouse L cells (ATCC No. CCLI.3), HLHepG2 cells, Hut-78, Jurkat, HL-60, NK cell lines (e.g., NKL, NK92, and YTS), and the like.

[0111] In some cases, the cell is not an immortalized cell line, but instead is a cell (e.g., a primary cell) obtained from an individual. For example, in some cases, the cell is an immune cell obtained from an individual. For example, the cell is a T lymphocyte obtained from an individual. In another example, the cell is a cytotoxic cell obtained from an individual. In another example, the cell is a stem cell (e.g., a peripheral blood stem cell) or a progenitor cell obtained from an individual.

[0112] In certain embodiments, the cells of the present disclosure may be specifically formulated and / or cultured in a specific medium. The cells may be formulated in a manner suitable for delivery to a recipient without adverse effects.

[0113] In certain aspects, the medium can be prepared using any of the media used to culture animal cells as the basal medium, such as AIM V, X-VIVO-15, NeuroBasal, EGM2, TeSR, BME, BGJb, CMRL 1066, Glasgow MEM, Improved MEM Zinc Option, IMDM, 199 Medium, Eagle MEM, αMEM, DMEM, Ham, RPMI-1640, and Fischer Medium, as well as any combination thereof, but the medium may not be particularly limited thereto, so long as it can be used to culture animal cells. In particular, the medium may be xeno-free or chemically defined.

[0114] The medium can be serum-containing or serum-free, or xenogeneic component-free. From the aspect of preventing contamination with components derived from different animals, the serum can be derived from the same animal as the stem cells. Serum-free medium refers to a medium that does not have raw serum or unpurified serum, and therefore can include a medium that has purified blood-derived components or animal tissue-derived components (such as growth factors).

[0115] The medium may or may not contain any serum replacement. Serum replacement may include substances that suitably contain albumin (e.g., albumin substitutes such as lipid-rich albumin, bovine albumin, recombinant albumin or humanized albumin, vegetable starch, dextran and protein hydrolysates), transferrin (or other iron transporters), fatty acids, insulin, collagen precursors, trace elements, 2-mercaptoethanol, 3'-thiolglycerol, or their equivalents. Serum replacement may be prepared, for example, by the method disclosed in WO 98 / 30679, which is incorporated herein by reference in its entirety. Alternatively, any commercially available substance may be used for greater convenience. Commercially available substances include Knockout Serum Replacement (KSR), Chemically Defined Concentrated Lipids (Gibco), and Glutamax (Gibco).

[0116] In certain embodiments, the medium may contain one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty or more of the following: vitamins, such as biotin; DL-alpha tocopherol acetate; DL-alpha-tocopherol; vitamin A (acetate); proteins, such as BSA (bovine serum albumin) or human albumin, fatty acid free fraction V; catalase; human recombinant insulin; human transferrin; superoxide dismutase; other components, such as corticosterone; D-galactose; ethanolamine HCl; glutathione (reduced); L-carnitine HCl; linoleic acid; linolenic acid; progesterone; putrescine 2HCl; sodium selenite; and / or T3 (triiodotriiodo-I-thyronine). In specific embodiments, one or more of these may be explicitly excluded.

[0117] In some embodiments, the medium further comprises vitamins. In some embodiments, the medium comprises one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, or thirteen of the following (and any range derivable therefrom): biotin, DL-alpha tocopherol acetate, DL-alpha-tocopherol, vitamin A, choline chloride, calcium pantothenate, pantothenic acid, nicotinamide folate, pyridoxine, riboflavin, thiamine, inositol, vitamin B12, or the medium comprises a combination thereof or a salt thereof. In some embodiments, the medium comprises or consists essentially of biotin, DL-alpha tocopherol acetate, DL-alpha-tocopherol, vitamin A, choline chloride, calcium pantothenate, pantothenic acid, nicotinamide folate, pyridoxine, riboflavin, thiamine, inositol, and vitamin B12. In some embodiments, the vitamin comprises or consists essentially of biotin, DL-alpha tocopherol acetate, DL-alpha-tocopherol, vitamin A, or combinations or salts thereof. In some embodiments, the medium further comprises a protein. In some embodiments, the protein comprises albumin or bovine serum albumin, a fraction of BSA, catalase, insulin, transferrin, superoxide dismutase, or combinations thereof. In some embodiments, the medium further comprises one or more of the following: corticosterone, D-galactose, ethanolamine, glutathione, L-carnitine, linoleic acid, linolenic acid, progesterone, putrescine, sodium selenite, or triiodo-I-thyronine, or combinations thereof. In some embodiments, the medium comprises one or more of the following: B-27® supplement, xeno-free B-27® supplement, GS21™ supplement, or combinations thereof. In some embodiments, the medium comprises or further comprises amino acids, simple sugars, inorganic ions.In some embodiments, the amino acids include arginine, cystine, isoleucine, leucine, lysine, methionine, glutamine, phenylalanine, threonine, tryptophan, histidine, tyrosine, or valine, or a combination thereof. In some embodiments, the inorganic ions include sodium, potassium, calcium, magnesium, nitrogen, or phosphorus, or a combination or salt thereof. In some embodiments, the medium further includes one or more of the following: molybdenum, vanadium, iron, zinc, selenium, copper, or manganese, or a combination thereof. In certain embodiments, the medium comprises or consists essentially of one or more vitamins described herein and / or one or more proteins described herein, and / or one or more of the following: corticosterone, D-galactose, ethanolamine, glutathione, L-carnitine, linoleic acid, linolenic acid, progesterone, putrescine, sodium selenite, or triiodo-I-thyronine, B-27® supplement, xeno-free B-27® supplement, GS21™ supplement, amino acids (e.g., arginine, cystine, isoleucine, leucine, lysine, methionine, glutamine, phenylalanine, threonine, tryptophan, histidine, tyrosine, or valine), monosaccharides, inorganic ions (e.g., sodium, potassium, calcium, magnesium, nitrogen, and / or phosphorus) or salts thereof, and / or molybdenum, vanadium, iron, zinc, selenium, copper, or manganese. In specific embodiments, one or more of these may be explicitly excluded.

[0118] The medium may also contain one or more exogenously added fatty acids or lipids, amino acids (such as non-essential amino acids), vitamins, growth factors, cytokines, antioxidants, 2-mercaptoethanol, pyruvic acid, buffering agents, and / or inorganic salts, in specific embodiments, one or more of which may be explicitly excluded.

[0119] The one or more media components may be at least 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250 ng / L, at least 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250 ng / ml, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250μg / ml, at least 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250mg / ml, at most 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250mg / ml 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250ng / L, up to 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250ng / ml, up to 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250μg / ml, up to 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250mg / ml or about 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250ng / L, about 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 2 00, 250ng / ml, approximately 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250 μg / ml, about 0.1, 0.5, 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 180, 200, 250 mg / ml, or any range derivable therein.

[0120] In a specific embodiment, the cells of the present disclosure are specifically formulated. They may or may not be formulated as a cell suspension. In certain cases, they are formulated as a single dosage form. They may be formulated for systemic or local administration. Optionally, the cells are formulated for storage prior to use, and the cell formulation may include one or more cryopreservatives, such as DMSO (e.g., in 5% DMSO). The cell formulation may include albumin, including human albumin, and certain formulations include 2.5% human albumin. The cells may be specifically formulated for intravenous administration; for example, they are formulated for intravenous administration over less than one hour. In certain embodiments, the cells are in a formulated cell suspension that is stable at room temperature for 1, 2, 3, or 4 hours or more from the time of thawing.

[0121] In certain embodiments, the cells of the present disclosure comprise an exogenous T cell receptor (TCR) that may be of defined antigen specificity. In some embodiments, the TCR is an engineered TCR. In some embodiments, the TCR can be selected based on the absence or reduced alloreactivity to the intended recipient (examples include certain virus-specific TCRs, xenospecific TCRs, or cancer testis antigen-specific TCRs). In examples where the exogenous TCR is non-allo-reactive, the exogenous TCR undergoes a developmental process called allelic exclusion to suppress rearrangement and / or expression of the endogenous TCR locus during T cell differentiation, resulting in T cells that only express non-allo-reactive exogenous TCRs and are therefore non-allo-reactive. In some embodiments, the selection of the exogenous TCR may not necessarily be defined based on the lack of alloreactivity. In some embodiments, the endogenous TCR gene is modified by genome editing so that it does not express the protein. Genetic editing methods, such as those using the CRISPR / Cas9 system, are known in the art and described herein.

[0122] In some embodiments, the cells of the present disclosure comprise one or more chimeric antigen receptors (CARs). Examples of tumor cell antigens to which the CAR can be directed include, for example, at least 5T4, 8H9, αvβ6 integrin, BCMA, B7-H3, B7-H6, CAIX, CA9, CD19, CD20, CD22, CD30, CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD70, CD123, CD138, CD171, CEA, CSPG4, EGFR, ErbB2 (HER2), EGFR family including EGFRvIII, EGP2, EGP40, ERBB3, ERBB4, ErbB3 / 4, EPCAM, EphA2, EpCAM , folate receptor-a, FAP, FBP, fetal AchR, FRα, GD2, G250 / CAIX, GD3, glypican-3 (GPC3), Her2, IL-13Rα2, lambda, Lewis-Y, kappa, KDR, MAGE, MCSP, mesothelin, Muc1, Muc16, NCAM, NKG2D ligand, NY-ESO-1, PRAME, PSC1, PSCA, PSMA, ROR1, SP17, survivin, TAG72, TEM, carcinoembryonic antigen, HMW-MAA, AFP, CA-125, ETA, tyrosinase, MAGE, laminin receptor, HPV CARs include E6, E7, BING-4, calcium activated chloride channel 2, cyclin-B1, 9D7, EphA3, telomerase, SAP-1, BAGE family, CAGE family, GAGE ​​family, MAGE family, SAGE family, XAGE family, NY-ESO-1 / LAGE-1, PAME, SSX-2, Melan-A / MART-1, GP100 / pmel17, TRP-1 / -2, P. polypeptide, MC1R, prostate specific antigen, β-catenin, BRCA1 / 2, CML66, fibronectin, MART-2, TGF-βRII, or VEGF receptor (e.g., VEGFR2). The CAR may be the first, second, third, or more generation CAR. The CAR may be specific for any two non-identical antigens, or may be specific for more than two non-identical antigens.

[0123] VI. Kits Certain aspects of the present disclosure also relate to kits containing the compositions of the present invention or compositions for carrying out the methods of the present invention. In some embodiments, the kits can be used to evaluate one or more biomarkers. In certain embodiments, the kits can be used to evaluate one or more biomarkers. ,000 or more probes, primers or primer sets, synthetic molecules or inhibitors, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 500, 1,000 or more probes, primers or primer sets, synthetic molecules or inhibitors, or up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 100, 500, 1,000 or more probes, primers or primer sets, synthetic molecules or inhibitors, or any value or range and combination derivable therein. In some aspects, there is a kit for assessing biomarker activity in a cell.

[0124] The kit may contain components that may be individually packaged or placed in containers, e.g., tubes, bottles, vials, syringes, or other suitable container means.

[0125] Individual components may also be provided in the kit in concentrated amounts; in some embodiments, components are provided individually at the same concentration as they are in solution with the other components. Concentrations of components may be provided as 1×, 2×, 5×, 10×, or 20×, or more.

[0126] Kits for using the disclosed probes, synthetic nucleic acids, non-synthetic nucleic acids, and / or inhibitors for prognostic or diagnostic applications are included as part of this disclosure. Any such molecules corresponding to any of the biomarkers identified herein are specifically contemplated, including nucleic acid primers / primer sets and probes that are identical or complementary to all or a portion of the biomarker, which may include coding sequences of the biomarkers as well as non-coding sequences of the biomarkers.

[0127] In certain aspects, negative and / or positive control nucleic acids, probes, and inhibitors are included in some kit embodiments. In addition, the kits may include samples that are negative or positive controls for methylation of one or more biomarkers.

[0128] Any embodiment of the disclosure that names a particular biomarker is intended to also encompass embodiments that involve biomarkers whose sequences are at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% identical to the mature sequence of the particular nucleic acid.

[0129] An embodiment of the present disclosure includes a kit for analyzing a pathology sample by assessing a biomarker profile for the sample, comprising two or more biomarker probes in suitable container means, wherein the biomarker probes detect one or more of the biomarkers identified herein. The kit may further comprise a reagent for labeling nucleic acids in the sample. The kit may also include a labeling reagent comprising at least one of an amine-modified nucleotide, a poly(A) polymerase, and a poly(A) polymerase buffer. The labeling reagent may comprise an amine-reactive dye.

[0130] It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein, and that different aspects may be combined. It is contemplated that the claims as originally filed will cover any claim that is multiple dependent on any filed claim or combination of filed claims. EXAMPLES

[0131] The following examples are included to demonstrate certain aspects of the invention. Those skilled in the art should recognize that the techniques disclosed in the following examples represent techniques discovered by the inventors to work well in the practice of the invention, and therefore can be considered to constitute particular modes for its practice. However, those skilled in the art should recognize in light of this disclosure that many changes can be made to the specific embodiments disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

[0132] Example 1 – CD8 via knockout of TGFB1 + Depletion of endogenous TGF-β1 in T cells result CD8 +We used CRISPR-Cas9 gene editing technology to deplete the gene TGFB1, which encodes TGF-β1, in T cells. We tested the efficiency of multiple gRNAs in naïve T cells stimulated with α-CD3 / α-CD28 beads, and selected the gRNA with the highest knockout efficiency. The selected gRNA had a guide target sequence of GGCCGACUACUACGCCAAGG (SEQ ID NO:1). This gRNA targeted the 3' region of the first exon of the TGFB1 gene, downstream of the start codon (Figure 1A). Comparison of Sanger sequencing results between non-targeting (NT) control gRNA-transfected T cells and TGFB1 gRNA-transfected T cells showed that the TGFB1 DNA sequence was efficiently disrupted by this gRNA, with high insertion / deletion rates and knockout scores (Figures 1A and 1B). At 2 days after bead stimulation, membrane-bound TGF-β1 levels were significantly higher in TGFB1 knockout CD8 cells compared to NT controls. + In contrast, TGFB1 gRNA downregulated CD8+ TGF-β1 expression in CD8+ cells, whereas in CD8+ TGF-β1 expression in CD8+ TGF-β1+ cells, whereas in CD8+ TGF-β1 ... + We demonstrated that TGFB1 was efficiently depleted in T cells.

[0133] TGFB1 knockout suppresses polyclonal activated CD8 + To determine whether this affected T cell effector function, control and knockout CD8 + Intracellular cytokine staining was performed on T cells. TGFB1 knockout T cells produced much more TNF-α and IFN-γ (Figures 2A and 2B) and slightly more granzyme B (Figures 2A and 2C) compared to NT controls, whereas IL-2 levels were not significantly affected (Figures 2A and 2B). These results were consistent with the CD8 + This suggests that TGFB1 knockout in T cells enhanced cytokine production.RM The ability to form endothelial cells was compared between NT control cells and knockout cells. RM In response to hypoxia and exogenous TGF-β1, conditions sufficient to induce CD103 + CD69 + T RM The population rates were roughly similar between control and TGFB1 knockout T cells, which was due to the CD8 + Depletion of endogenous TGF-β1 from T cells results in T RM This indicates that the formation was not dramatically affected.

[0134] To determine the effect of TGFB1 knockout in an antigen-specific context, T cells were engineered to stably express a gp100-specific, HLA-A*0201-restricted TCR (TCR-T). + CD8 + Knockouts were performed in TCR-T cells and the cells were then expanded using the rapid expansion protocol (REP) (Figure 3). + Intracellular cytokine staining was performed in control and TGFB1 knockout TCR-T cells after co-culture with the tumor cell line Mel526 and found that TGFB1 knockout TCR-T cells produced much more IFN-γ, TNF-α and granzyme B than control cells, which was consistent with the polyclonal stimulated CD8 +The results were consistent with those from T cells (Figures 4A-4C). In addition, IL-2 levels were also slightly higher in knockout TCR-T cells than in NT controls (Figures 4A and 4B). The cytotoxicity of NT control and TGFB1 knockout TCR-T cells co-cultured with Mel526 cells was measured by chromium release assay. TGFB1 knockout TCR-T cells showed increased cytolytic activity against Mel526 cells at various E:T ratios compared to control cells (Figure 5A). To compare the cytolytic activity of control and TGFB1 knockout TCR-T cells in high exogenous-TGF-β1 conditions, TCR-T cells were pretreated with high dose TGF-β1 for 4 days before chromium release assay. Interestingly, even in the presence of high dose exogenous TGF-β1, TGFB1 knockout TCR-T cells were still more efficient than NT controls in killing target cells (Figure 5B). In addition, both control and TGFB1 knockout TCR-T cells exhibited reduced cytotoxic activity in the presence of exogenous TGF-β1 compared to the same cells in the absence of exogenous TGF-β1 (Figure 5C). In summary, TGFB1 knockout suppressed the expression of CD8 + It dramatically enhances the anti-tumor effector functions of T cells, which shows great potential to improve the efficacy of adoptive T cell therapy (ACT) for the treatment of cancer patients.

[0135] method Cells and reagents Healthy donor peripheral blood mononuclear cells (PBMCs) were collected by leukapheresis and stored in liquid nitrogen until use. All human sample collections were performed with informed consent and approved by the Institutional Review Board (IRB) of UT MD Anderson Cancer Center. Recombinant Cas9 enzyme and human TGFB1 guide RNA were purchased from Synthego. All flow cytometry antibodies and human TGF-β1 ELISA kits were purchased from Biolegend. MHC-I-gp100 tetramers were from Fred Hutchinson Cancer Research Center.

[0136] CD8 + Polyclonal stimulation of T cells Naïve CD8 + T cells (CD8 + CD45RA + CCR7 + ) were sorted by flow cytometry and were naïve CD8 + T cell purity was greater than 99%. CD8 cells were cultured at a bead:cell ratio of 1:4 using Dynabeads® Human T-Activator CD3 / CD28 (Life Technologies) for T cell expansion and activation. + T cells were activated.

[0137] In vitro induction of resident memory T cells Sorted naïve CD8 + T cells (CD8 + CD45RA + CCR7 + ) were activated using Dynabeads® human T-activator CD3 / CD28 (Life Technologies) for T cell expansion and activation at a bead:cell ratio of 1:4 in 2% O2. After 4 days, 1.25ng / mL recombinant TGF-β1 was added. After an additional 2 days, T cells were harvested and the beads removed using a magnet prior to downstream analysis.

[0138] Retroviral infection Retroviral supernatant was produced in 293GP packaging cell line. Briefly, 70% confluent 293GP 10 cm plates were co-transfected with 10 μg MSGV vector plasmid and 5 μg RD114 envelope plasmid DNA using Lipofectamine 3000. The medium was changed 1 day after transfection. On day 3, viral supernatant was collected, centrifuged to remove cell debris, and frozen at -80°C for future use. PBMCs (HLA-A*0201) from healthy donors were thawed and activated the same day with 30 ng / mL anti-CD3 (OKT3) and 300 U / ml IL-2. After 3 days, activated T cells were transduced with retroviral supernatant by centrifugation at 32°C and 2,000 g for 2 h, and then tetramer-positive CD8 + The cells were cultured for an additional 3 days before being sorted for T cells.

[0139] CRISPR-Cas9 knockout CRISPR-Cas9 gene knockout was performed by transient Cas9 / gRNA ribonucleoprotein (RNP) complex electroporation using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza). Selected TCR-T or activated naïve CD8 + Wash the T cells and add 1 x 10 cells per 20 µl of reaction. 6 The cells were resuspended in P3 buffer at 100 μl / reaction. 40 pmol of recombinant SpCas9 protein and 80 pmol of chemically modified synthetic sgRNA (2:1 molar ratio of gRNA:Cas9) per reaction were precomplexed at room temperature for 15 min to generate RNP complexes. 20 μl of cell suspension was mixed with RNP and electroporated using EH-115 protocol in 16-well cuvette strips. Cells were allowed to recover for 15 min at 37° C. and then cultured in 300 U / ml IL-2.

[0140] Cell Culture and Rapid Expansion Protocol (REP) CD8 +The medium for T cells was RPMI1640, 10% FBS, 4mM glutamine, and 2-mercaptoethanol. For REP, CTL lines were expanded using 30ng / mL anti-CD3 (OKT3), and allogeneic PBMCs or LCLs as feeder cells were irradiated 200x. Cultures were fed with 50U / ml IL-2 every 3 days. After 14 days, expanded cells were subjected to further analysis. Mel526 cells were cultured in RPMI1640, 10% FBS, 4mM glutamine, 1x non-essential amino acids, 1mM sodium pyruvate, and 1% penicillin / streptomycin. All cells were tested for mycoplasma using a PCR-based test, and cryopreserved stock vials were used after thawing within 1 month.

[0141] Flow cytometry At specific time points during culture, cells were stained with antibodies against CD8, LAP, CD103, CD69, IL-2, IFN-γ, TNF-α, or granzyme B, or with the MHC-I-gp100 peptide tetramer. For intracellular cytokine staining, cells were restimulated with anti-CD3 / CD28 beads in the presence of brefeldin A for 16 h and then fixed and permeabilized before staining. All FACS data were acquired on a Novocyte flow cytometer and analyzed with FlowJo software (Tree Star, Inc.).

[0142] Chromium release assay Tumor target cells were labeled with 100 μCi 51Cr for 2 h. After washing, the labeled tumor target cells were plated at 2,000 cells / well (four replicates) in 96-well V-bottom plates and incubated with 20,000 TCR-T cells at various effector:tumor (E:T) ratios for 4 h. Negative controls were labeled tumor target cells without effector T cells, and positive controls were tumor target cells incubated with trypan lysis buffer (0.4% trypan blue, 10% Nonidet P40). Then, 30 μl of supernatant from each well was collected, and the amount of 51Cr in the supernatant was measured with a MicroBeta Microplate counter (PerkinElmer), and the killing efficiency was calculated as % killing=100%×(sample mean−negative control mean) / (positive control mean−negative control mean).

[0143] statistical analysis Graphical presentation and statistical analysis of data were performed using GraphPad Prism (version 7, GraphPad software, San Diego, CA) and Excel. Data were presented as mean and STD. Student's t-test was used to compare results between experimental groups. p<0.05 was considered statistically significant. Statistical significance is presented as * p<0.05, ** p<0.01.

[0144] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of this disclosure.Although the compositions and methods of the present invention have been described in specific embodiments, it will be apparent to those skilled in the art that modifications may be applied to the methods and steps or steps of the methods described herein without departing from the concept, spirit and scope of the present invention.More specifically, it is apparent that certain agents that are both chemically and physiologically related may be substituted for the agents described herein and still achieve the same or similar results.All such similar substitutions and modifications that are apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the present invention as defined by the appended claims.

[0145] References The references disclosed herein, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. TIFF2024517641000001.tif20861TIFF2024517641000002.tif47128

Claims

1. Human CD8 that does not secrete TGF-β1 + A method for treating a subject with cancer comprising administering T cells to said subject, comprising administering to said subject a human CD8 T cell that does not secrete TGF-β1. + T cells.

2. (a)(i) Human CD8 + T cells do not express TGF-β1, or (ii) human CD8 + the T cells express a mutant TGF-β1 protein; or (iii) human CD8 + The T cells are derived from CD8+ T cells from the subject, and optionally human CD8 + the T cells are tumor-infiltrating lymphocytes; and / or (b) Human CD8 + the T cell comprises a mutation in TGFB1, and optionally (i) the mutation is an alteration in a region of exon 1 of TGFB1, optionally wherein the region of exon 1 comprises the sequence of SEQ ID NO:1; or (ii) the mutation is a nonsense mutation, or (iii) the mutation is a frameshift mutation; and / or (c) the cancer is melanoma; and / or (d) the cancer is recurrent; and / or (e) the subject has been pretreated for cancer with a pretreatment, and optionally, the subject has been determined to be resistant to the pretreatment; and / or (f) The method comprises: + Human CD8 containing T cells + administering to a subject a population of human CD8 T cells + Each cell of the population of T cells does not secrete TGF-β1; and / or (g) the method further comprises administering an additional cancer therapy, optionally wherein the additional cancer therapy is chemotherapy, radiation therapy, or immunotherapy; A cell for use according to claim 1.

3. A method for the production of human CD8, comprising the step of introducing into a cell a Cas nuclease and a guide RNA targeting TGFB1. + Methods for genetically modifying T cells.

4. (a) the guide RNA targets a region of exon 1 of TGFB1, and optionally the region of exon 1 comprises the sequence of SEQ ID NO: 1; and / or (b) the Cas nuclease is Cas9 or Cas12a; 4. The method of claim 3.

5. A mutation is generated in TGFB1 in the cell, and optionally (a) the mutation is generated using a Cas nuclease; and / or (b) the mutation is a frameshift or nonsense mutation; 5. The method of claim 3 or 4.

6. (a) the Cas nuclease and the guide RNA are introduced into the cell via transfection or electroporation; and / or (b) the method comprises: + and / or further comprising obtaining the T cells; (c) Human CD8 + T cells are tumor-infiltrating lymphocytes; 4. The method of claim 3.

7. 1. A genetically modified immune cell for use in a method for treating a subject having cancer, the method comprising: (a) modifying immune cells from a subject to generate genetically modified immune cells that do not secrete TGF-β1; and (b) administering the genetically modified immune cells to a subject. The cell comprising:

8. (a) (i) the genetically modified immune cells do not express TGF-β1; or (ii) the genetically modified immune cells express a mutant TGF-β1 protein; or (iii) secretion of TGF-β1 is undetectable in the genetically modified immune cells; or (iv) secretion of TGF-β1 is reduced by at least 80% in the genetically modified immune cells compared to a control or reference cell population; or (v) secretion of TGF-β1 is reduced by at least 90% in the genetically modified immune cells compared to a control or reference cell population; or (vi) expression of TGF-β1 is undetectable in the genetically modified immune cells; or (vii) expression of TGF-β1 is reduced by at least 80% in the genetically modified immune cells compared to a control or reference cell population; or (viii) expression of TGF-β1 is reduced by at least 90% in the genetically modified immune cells compared to a control or reference cell population; and / or (b) (i) the immune cell is a natural killer T cell; or (ii) the immune cells have been engineered to express a cloned T cell receptor (TCR) or a chimeric antigen receptor (CAR); or (iii) the immune cell is an engineered CAR-T cell or an engineered TCR-T cell; or (iv) the immune cell is a T cell, and optionally the T cell is a CD4 + T cells or CD8 + are T cells; and / or (c) the immune cell is a tumor-infiltrating lymphocyte; and / or (d) modifying the immune cell comprises targeting a region of exon 1 of TGFB1 using a Cas nuclease and a guide RNA, optionally wherein the region of exon 1 comprises SEQ ID NO: 1; and / or (e) modifying the immune cell comprises generating a mutation in TGFB1; and optionally (i) the mutation is a frameshift or nonsense mutation, and / or (ii) the mutation is in exon 1 of TGFB1; and / or (f) the subject is a human subject; and / or (g) the method further comprises, prior to step (a) of claim 7, obtaining immune cells from the subject; and / or (h) the cancer is melanoma; and / or (i) the cancer is a recurrent cancer; and / or (j) the subject has been pretreated for cancer with a pretreatment, and optionally, the subject has been determined to be resistant to the pretreatment; and / or (k) the method further comprises administering an additional cancer therapy, optionally wherein the additional cancer therapy is chemotherapy, radiation therapy, or immunotherapy; A cell for use according to claim 7.

9. Human immune cells that contain a genetic modification that prevents the cells from secreting TGF-β1.

10. (a) (i) the immune cell is a T cell, and optionally the T cell is a CD8 + T cells or CD4 + are T cells, or (ii) the immune cell is a natural killer T cell, or (iii) the immune cell expresses a cloned TCR or CAR; or (iv) the immune cell is an engineered CAR-T cell or an engineered TCR-T cell; and / or (b) (i) the genetic modification comprises a modification of a region of exon 1 of TGFB1, and optionally, the region of exon 1 comprises SEQ ID NO: 1; or (ii) the genetic alteration is a nonsense mutation in TGFB1; or (iii) the genetic modification is a deletion of TGFB1; or (iv) the genetic alteration is a frameshift mutation in TGFB1; and / or (c) the cell is or is derived from a tumor-infiltrating lymphocyte; The cell of claim 9.

11. A population of human immune cells comprising the human immune cell of claim 9 or 10.

12. (a) (i) secretion of TGF-β1 is undetectable in a population of human immune cells; or (ii) secretion of TGF-β1 is reduced by at least 80% in a population of human immune cells compared to a control or reference cell population; or (iii) secretion of TGF-β1 is reduced by at least 90% in a population of human immune cells compared to a control or reference cell population; and / or (b) (i) expression of TGF-β1 is undetectable in a population of human immune cells; or (ii) expression of TGF-β1 is reduced by at least 80% in a population of human immune cells compared to a control or reference cell population; or (iii) expression of TGF-β1 is reduced by at least 90% in the population of human immune cells compared to a control or reference cell population; 12. The population of human immune cells of claim 11.

13. (a) a human immune cell according to claim 9 or 10; (b) a pharma- ceutically acceptable excipient; 23. A pharmaceutical composition comprising:

14. The pharmaceutical composition of claim 13, for administration to a subject to treat a subject having cancer.

15. (a) the cancer is melanoma; and / or (b) the cancer is a recurrent cancer; and / or (c) the subject has been pretreated with cancer; and / or (d) the subject has been determined to be refractory to prior treatment; and / or (e) the human immune cells are derived from cells from the subject; 15. The pharmaceutical composition of claim 14. (a) a population of human immune cells according to claim 11; (b) a pharma- ceutically acceptable excipient; 23. A pharmaceutical composition comprising:

17. The pharmaceutical composition of claim 16, for administration to a subject to treat a subject having cancer. (a) the cancer is melanoma; and / or (b) the cancer is a recurrent cancer; and / or (c) the subject has been pretreated with cancer; and / or (d) the subject has been determined to be refractory to prior treatment; and / or (e) the human immune cells are derived from cells from the subject; 18. The pharmaceutical composition of claim 17. (a) a population of human immune cells according to claim 12; (b) a pharma- ceutically acceptable excipient; 23. A pharmaceutical composition comprising:

20. The pharmaceutical composition of claim 19, for administration to a subject to treat a subject having cancer.

21. (a) the cancer is melanoma; and / or (b) the cancer is a recurrent cancer; and / or (c) the subject has been pretreated with cancer; and / or (d) the subject has been determined to be refractory to prior treatment; and / or (e) the human immune cells are derived from cells from the subject; 21. The pharmaceutical composition of claim 20.

Images