Gene editing systems containing RNA guides targeting hydroxyacid oxidase 1 (HAO1) and their uses
Patent Information
- Application Number
- JP2023574534
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-01-19
- Filing Date
- 2022-06-03
- Publication Date
- 2025-06-11
AI Technical Summary
Current gene editing technologies, such as those using SpCas9 and Cas12a, face challenges in delivery and synthesis costs due to their size and require larger deletions and +1 insertions, leading to potential off-target sites and reduced specificity.
The development of a gene editing system utilizing a Cas12i polypeptide, specifically Cas12i2, with a smaller size and unique PAM sequence, paired with an RNA guide, which targets the hydroxy acid oxidase 1 (HAO1) gene, allowing for precise editing with reduced off-target effects and larger deletions.
The Cas12i2-based system achieves high editing efficiency and precision, reducing delivery and synthesis costs while minimizing off-target effects, making it suitable for treating primary hyperoxaluria (PH) by disrupting the HAO1 gene.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 63 / 197,073, filed June 4, 2021, U.S. Provisional Patent Application No. 63 / 225,046, filed July 23, 2021, U.S. Provisional Patent Application No. 63 / 292,889, filed December 22, 2021, and U.S. Provisional Patent Application No. 63 / 300,727, filed January 19, 2022, the contents of each of which are incorporated by reference herein in their entirety.
[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII copy created on Jun. 3, 2022 is named 116928-0040-0004WO00_SEQ.txt and is 367,354 bytes in size. [Background technology]
[0003] Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) genes, collectively known as the CRISPR-Cas or CRISPR / Cas system, are an adaptive immune system in archaea and bacteria that defends certain species against foreign genetic elements. Summary of the Invention
[0004] The present disclosure is based at least in part on the development of a system for gene editing of hydroxyacid oxidase 1 (HAO1) gene. The system includes a Cas12i CRISPR nuclease polypeptide (e.g., Cas12i2 polypeptide) and an RNA guide that mediates the cleavage of the CRISPR nuclease polypeptide at a gene site in the HAO1 gene. As reported herein, the gene editing system disclosed herein successfully edits the HAO1 gene with high editing efficiency and precision.
[0005] Without being bound by theory, the gene editing system disclosed herein may further exhibit one or more of the following advantageous features: Compared to SpCas9 and Cas12a, Cas12i effectors are smaller (1033-1093aa), which, together with their short mature crRNA (40-43nt), is favorable in terms of delivery and synthesis costs. Cas12i cleavage results in larger deletions compared to the small deletions and +1 insertions induced by Cas9 cleavage. Also, the Cas12i PAM sequence is different from that of Cas9. Thus, compared to Cas9, a larger and different portion of the gene site of interest can be disrupted with the Cas12i polypeptide and RNA guide. Using the unbiased approach of tagmentation-based tag insertion site sequencing (TTISS), more potential off-target sites with a higher number of unique insertion events were identified for SpCas9 compared to Cas12i2. See WO / 2021 / 202800. Thus, Cas12i, e.g., Cas12i2, can be more specific than Cas9.
[0006] Thus, provided herein is a gene editing system for editing the HAO1 gene, a pharmaceutical composition or kit comprising such a gene editing system, a method of using the gene editing system to produce a genetically modified cell, and the resulting cell thus produced.Also provided herein is the use of the gene editing system disclosed herein, the pharmaceutical composition and kit comprising such a gene editing system, and / or the genetically modified cell thus produced for treating primary hyperoxaluria (PH) in a subject.
[0007] In some embodiments, the disclosure features a system for gene editing of a hydroxyacid oxidase 1 (HAO1) gene, the system including (i) a Cas12i polypeptide or a first nucleic acid encoding a Cas12i polypeptide, and (ii) an RNA guide or a second nucleic acid encoding an RNA guide, the RNA guide including a spacer sequence specific to a target sequence in the HAO1 gene, the target sequence being adjacent to a protospacer adjacent motif (PAM), the PAM including a 5'-TTN-3' motif, the 5'-TTN-3' motif being located 5' to the target sequence.
[0008] In some embodiments, the Cas12i polypeptide can be a Cas12i2 polypeptide. In other embodiments, the Cas12i polypeptide can be a Cas12i4 polypeptide.
[0009] In some embodiments, the Cas12i polypeptide is a Cas12i2 polypeptide, wherein the Cas12i2 polypeptide comprises an amino acid sequence at least 95% identical to SEQ ID NO: 922 and comprises one or more mutations relative to SEQ ID NO: 922. In some embodiments, the one or more mutations in the Cas12i2 polypeptide are at positions D581, G624, F626, P868, I926, V1030, E1035, and / or S1046 of SEQ ID NO: 922. In some examples, the one or more mutations are amino acid substitutions, optionally, the amino acid substitutions are D581R, G624R, F626R, P868T, I926R, V1030G, E1035R, S1046G, or a combination thereof.
[0010] In one example, the Cas12i2 polypeptide comprises mutations at positions D581, D911, I926, and V1030 (e.g., amino acid substitutions of D581R, D911R, I926R, and V1030G). In another example, the Cas12i2 polypeptide comprises mutations at positions D581, I926, and V1030 (e.g., amino acid substitutions of D581R, I926R, and V1030G). In yet another example, the Cas12i2 polypeptide comprises mutations at positions D581, I926, V1030, and S1046 (e.g., amino acid substitutions of D581R, I926R, V1030G, and S1046G). In yet another example, the Cas12i2 polypeptide comprises mutations at positions D581, G624, F626, I926, V1030, E1035, and S1046 (e.g., amino acid substitutions of D581R, G624R, F626R, I926R, V1030G, E1035R, and S1046G). In another example, the Cas12i2 polypeptide comprises mutations at positions D581, G624, F626, P868, I926, V1030, E1035, and S1046 (e.g., amino acid substitutions of D581R, G624R, F626R, P868T, I926R, V1030G, E1035R, and S1046G).
[0011] An exemplary Cas12i2 polypeptide for use in any of the gene editing systems disclosed herein may comprise the amino acid sequence of any one of SEQ ID NOs: 923-927. In one example, an exemplary Cas12i2 polypeptide for use in any of the gene editing systems disclosed herein comprises the amino acid sequence of SEQ ID NO: 924. In another example, an exemplary Cas12i2 polypeptide for use in any of the gene editing systems disclosed herein comprises the amino acid sequence of SEQ ID NO: 927.
[0012] In some embodiments, the gene editing system may include a first nucleic acid encoding a Cas12i polypeptide (e.g., a Cas12i2 polypeptide disclosed herein). In some cases, the first nucleic acid is located in a first vector (e.g., a viral vector, such as an adeno-associated viral vector or an AAV vector). In some cases, the first nucleic acid is a messenger RNA (mRNA). In some cases, the nucleic acid encoding a Cas12i polypeptide (e.g., a Cas12i2 polypeptide disclosed herein) is codon-optimized.
[0013] In some embodiments, the target sequence can be within exon 1 or exon 2 of the HAO1 gene. In some examples, the target sequence includes 5'-CAAAGTCTATATATGACTAT-3' (SEQ ID NO: 1025), 5'-GGAAGTACTGATTTAGCATG-3' (SEQ ID NO: 1026), 5'-TAGATGGAAGCTGTATCCAA-3' (SEQ ID NO: 1046), 5'-CGGAGCATCCTTGGATACAG-3' (SEQ ID NO: 1047), or 5'-AGGACAGAGGGTCAGCATGC-3' (SEQ ID NO: 1052). In a specific example, the target sequence can be the nucleotide sequence of SEQ ID NO: 1047.
[0014] In some embodiments, the spacer sequence may be 20 to 30 nucleotides long. In some examples, the spacer sequence is 20 nucleotides long. In some examples, the spacer sequence includes 5'-CAAAGUCUAUAUAUGACUAU-3' (SEQ ID NO: 1093), 5'-GGAAGUACUGAUUUAGCAUG-3' (SEQ ID NO: 1094), 5'-UAGAUGGAAGCUGUAUCCAA-3' (SEQ ID NO: 1095), 5'-CGGAGCAUCCUUGGAUACAG-3' (SEQ ID NO: 1096), or 5'-AGGACAGAGGGUCAGCAUGC-3 (SEQ ID NO: 1097). In a specific example, the spacer sequence may include SEQ ID NO: 1096.
[0015] In some embodiments, the RNA guide comprises a spacer and a direct repeat sequence. In some examples, the direct repeat sequence is 23-36 nucleotides in length. In one example, the direct repeat sequence is at least 90% identical to any one of SEQ ID NOs: 1-10, or a fragment thereof that is at least 23 nucleotides in length. In some specific examples, the direct repeat sequence is any one of SEQ ID NOs: 1-10, or a fragment thereof that is at least 23 nucleotides in length. As a non-limiting example, the direct repeat sequence is 5'-AGAAAUCCGUCUUUCAUUGACGG-3' (SEQ ID NO: 10).
[0016] In specific examples, the RNA guide may comprise the nucleotide sequence of 5'-AGAAAUCCGUCUUUCAUUGACGGCAAAGUCUAUAUAUGACUAU-3' (SEQ ID NO: 967), 5'-AGAAAUCCGUCUUUCAUUGACGGGGAAGUACUGAUUUAGCAUG-3' (SEQ ID NO: 968), 5'-AGAAAUCCGUCUUUCAUUGACGGUAGAUGGAAGCUGUAUCCAA-3' (SEQ ID NO: 988), 5'-AGAAAUCCGUCUUUCAUUGACGGCGGAGCAUCCUUGGAUACAG-3' (SEQ ID NO: 989), or 5'-AGAAAUCCGUCUUUCAUUGACGGAGGACAGAGGGUCAGCAUGC-3' (SEQ ID NO: 994). In specific examples, the RNA guide may comprise SEQ ID NO: 989.
[0017] In some embodiments, the system may include a second nucleic acid encoding an RNA guide. In some examples, the nucleic acid encoding the RNA guide may be located in a viral vector. In some examples, the viral vector includes both a first nucleic acid encoding a Cas12i2 polypeptide and a second nucleic acid encoding an RNA guide.
[0018] In some embodiments, any of the systems described herein may include a first nucleic acid encoding a Cas12i2 polypeptide, the first nucleic acid being located in a first vector, and a second nucleic acid encoding an RNA guide, the second nucleic acid being located on a second vector. In some examples, the first vector and / or the second vector are viral vectors. In some specific examples, the first vector and the second vector are the same vector. In other examples, the first vector and the second vector are different vectors.
[0019] In some embodiments, any of the systems described herein may include one or more lipid nanoparticles (LNPs), wherein the one or more LNPs include a Cas12i2 polypeptide or a first nucleic acid encoding a Cas12i2 polypeptide, an RNA guide or a second nucleic acid encoding an RNA guide, or both.
[0020] In some embodiments, the system described herein may include a LNP that includes a Cas12i2 polypeptide or a first nucleic acid encoding a Cas12i2 polypeptide, and a viral vector that includes a second nucleic acid encoding an RNA guide. In some examples, the viral vector is an AAV vector. In other embodiments, the system described herein may include a LNP that includes an RNA guide or a second nucleic acid encoding an RNA guide, and a viral vector that includes a first nucleic acid encoding a Cas12i2 polypeptide. In some examples, the viral vector is an AAV vector.
[0021] In some embodiments, the present disclosure also provides pharmaceutical compositions comprising any of the gene editing systems disclosed herein, or kits comprising components of the gene editing systems.
[0022] In another aspect, the disclosure also features a method for editing a hydroxyacid oxidase 1 (HAO1) gene in a cell, the method comprising contacting a host cell with any of the systems disclosed herein to genetically edit the HAO1 gene in the host cell. In some examples, the host cell is cultured in vitro. In other examples, the contacting step is carried out by administering a system for editing the HAO1 gene to a subject comprising the host cell.
[0023] Also within the scope of the present disclosure are cells that contain a disrupted hydroxyacid oxidase 1 (HAO1) gene, which can be produced by contacting a host cell with a system disclosed herein to genetically edit the HAO1 gene in the host cell.
[0024] In yet another aspect, the present disclosure provides a method for treating primary hyperoxaluria (PH) in a subject. The method may include administering to a subject in need thereof any of the systems for editing hydroxyacid oxidase 1 (HAO1) gene disclosed herein or any of the modified cells disclosed herein. In some embodiments, the subject may be a human patient with PH. In some examples, the PH is PH1, PH2, or PH3. In a specific example, the PH is PH1.
[0025] Also provided herein is an RNA guide comprising: (i) a spacer sequence as disclosed herein that is specific for a target sequence in the hydroxyacid oxidase 1 (HAO1) gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM), the PAM comprising a 5'-TTN-3' motif, and the 5'-TTN-3' motif is located 5' to the target sequence; and (ii) a direct repeat sequence.
[0026] In some embodiments, the spacer can be 20 to 30 nucleotides in length. In some examples, the spacer is 20 nucleotides in length.
[0027] In some embodiments, the direct repeat sequence may be 23 to 36 nucleotides in length. In some examples, the direct repeat sequence is 23 nucleotides in length.
[0028] In some embodiments, the target sequence may be within exon 1 or exon 2 of the HAO1 gene. In some examples, the target sequence includes 5'-CAAAGTCTATATATGACTAT-3' (SEQ ID NO: 1025), 5'-GGAAGTACTGATTTAGCATG-3' (SEQ ID NO: 1026), 5'-TAGATGGAAGCTGTATCCAA-3' (SEQ ID NO: 1046), 5'-CGGAGCATCCTTGGATACAG-3' (SEQ ID NO: 1047), or 5'-AGGACAGAGGGTCAGCATGC-3' (SEQ ID NO: 1052). In a specific example, the target sequence may include SEQ ID NO: 1047.
[0029] In some embodiments, the spacer sequence may be written as 5'-CAAAGUCUAUAUAUGACUAU-3' (SEQ ID NO: 1093), 5'-GGAAGUACUGAUUUAGCAUG-3' (SEQ ID NO: 1094), 5'-UAGAUGGAAGCUGUAUCCAA-3' (SEQ ID NO: 1095), 5'-CGGAGCAUCCUUGGAUACAG-3' (SEQ ID NO: 1096), or 5'-AGGACAGAGGGUCAGCAUGC-3 (SEQ ID NO: 1097). In a specific example, the spacer sequence may include SEQ ID NO: 1096.
[0030] In some embodiments, the direct repeat sequence may be at least 90% identical to any one of SEQ ID NOs: 1-10, or a fragment thereof that is at least 23 nucleotides in length. In some examples, the direct repeat sequence is any one of SEQ ID NOs: 1-10, or a fragment thereof that is at least 23 nucleotides in length. As a non-limiting example, the direct repeat sequence is 5'-AGAAAUCCGUCUUUCAUUGACGG-3' (SEQ ID NO: 10).
[0031] In some embodiments, the RNA guide may comprise the nucleotide sequence of 5'-AGAAAUCCGUCUUUCAUUGACGGCAAAGUCUAUAUAUGACUAU-3' (SEQ ID NO: 967), 5'-AGAAAUCCGUCUUUCAUUGACGGGGAAGUACUGAUUUAGCAUG-3' (SEQ ID NO: 968), 5'-AGAAAUCCGUCUUUCAUUGACGGUAGAUGGAAGCUGUAUCCAA-3' (SEQ ID NO: 988), 5'-AGAAAUCCGUCUUUCAUUGACGGCGGAGCAUCCUUGGAUACAG-3' (SEQ ID NO: 989), or 5'-AGAAAUCCGUCUUUCAUUGACGGAGGACAGAGGGUCAGCAUGC-3' (SEQ ID NO: 994). In a specific example, the RNA guide may comprise SEQ ID NO: 989.
[0032] Also provided herein is any of the gene editing systems disclosed herein, pharmaceutical compositions or kits comprising such gene editing systems, or genetically modified cells generated by the gene editing systems, for use in treating PH in a subject, and use of the gene editing systems disclosed herein, pharmaceutical compositions or kits comprising such gene editing systems, or genetically modified cells generated by the gene editing systems, for the manufacture of a medicament for the treatment of PH in a subject.
[0033] The details of one or more embodiments of the invention are set forth in the description below. Other features or advantages of the invention will become apparent from the following drawings and detailed description of several embodiments, and from the appended claims.
[0034] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which can be better understood by reference to the drawings in conjunction with the detailed description of specific embodiments presented herein. [Brief description of the drawings]
[0035] [Figure 1] 1 is a graph showing the ability of RNPs prepared with Cas12i2 polypeptide and crRNA to edit the HAO1 gene in HEK293 cells. Darker grey bars represent target sequences with perfect homology to both Macaca mulatta and Macaca fascicularis sequences. [Diagram 2] 1 is a graph showing the ability of RNPs prepared with Cas12i2 polypeptide and crRNA to edit the HAO1 gene in HepG2 cells. [Diagram 3] 1 is a graph showing the ability of RNPs prepared with Cas12i2 polypeptide and crRNA to edit the HAO1 gene in primary hepatocytes. [Figure 4] FIG. 13 is a graph showing knockdown of HAO1 mRNA in primary human hepatocytes with Cas12i2 polypeptide and HAO1-targeting crRNA. [Figure 5A] Graph showing % indels induced by HAO1-targeting crRNA and variant Cas12i2 polypeptide of SEQ ID NO:924 or SEQ ID NO:927 in HepG2 cells. [Figure 5B] Shown are the size (left) and start position (right) of indels induced by variant Cas12i2 of SEQ ID NO: 924 and HAO1-targeting RNA guide of E1T3 (SEQ ID NO: 968) in HepG2 cells. [Figure 6] Graph showing % indels induced by chemically modified HAO1 targeting crRNA of SEQ ID NO:1091 and SEQ ID NO:1092, and variant Cas12i2 mRNA of SEQ ID NO:1089 or SEQ ID NO:1090. [Figure 7A]1 shows a plot showing tagmentation-based tag insertion site sequencing (TTISS) reads for variant Cas12i2 of SEQ ID NO: 924, and HAO1-targeting RNA guides E2T5 (SEQ ID NO: 989), E1T2 (SEQ ID NO: 967), E1T3 (SEQ ID NO: 968), and E2T10 (SEQ ID NO: 994). The black wedges and the numbers in the middle represent the percentage of on-target TTISS reads. Each grey wedge represents a unique off-target site identified by TTISS. The size of each grey wedge represents the percentage of TTISS reads mapping to a given off-target. [Figure 7B] 1 shows plots showing two replicates of TTISS reads for variant Cas12i2 of SEQ ID NO:927 and HAO1 targeting RNA guides E2T5 (SEQ ID NO:989), E1T2 (SEQ ID NO:967), and E1T3 (SEQ ID NO:968). Black wedges and numbers in the middle represent the percentage of on-target TTISS reads. Each grey wedge represents a unique off-target site identified by TTISS. The size of each grey wedge represents the percentage of TTISS reads mapping to a given off-target. [Figure 8] 1 is a Western blot showing knockdown of HAO1 protein after electroporation of primary human hepatocytes with variant Cas12i2 of SEQ ID NO: 924 and RNA guide E2T5 (SEQ ID NO: 989). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0036] The present disclosure relates to a system for gene editing of hydroxyacid oxidase 1 (HAO1) gene (also known as glycolate oxidase gene), comprising: (i) a Cas12i polypeptide or a first nucleic acid encoding a Cas12i polypeptide; and (ii) an RNA guide or a second nucleic acid encoding an RNA guide, wherein the RNA guide comprises a spacer sequence specific for a target sequence in the HAO1 gene, the target sequence is adjacent to a protospacer adjacent motif (PAM), the PAM comprises a 5'-TTN-3' motif, and the 5'-TTN-3' motif is located 5' to the target sequence. Also provided in the present disclosure are pharmaceutical compositions or kits comprising such systems, and uses thereof. Further disclosed herein are methods for editing the HAO1 gene in a cell, cells so produced containing a disrupted HAO1 gene, methods of treating primary hyperoxaluria (PH) in a subject, and RNA guides comprising (i) a spacer specific for a target sequence in the HAO1 gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM), the PAM comprising a 5'-TTN-3' motif, and the 5'-TTN-3' motif is located 5' to the target sequence, and (ii) a direct repeat sequence, and uses thereof.
[0037] A Cas12i polypeptide for use in the gene editing system disclosed herein can be a Cas12i2 polypeptide, such as a wild-type Cas12i polypeptide or a variant thereof, such as those disclosed herein. In some examples, the Cas12i2 polypeptide comprises an amino acid sequence at least 95% identical to SEQ ID NO: 922 and comprises one or more mutations relative to SEQ ID NO: 922. In other examples, the Cas12i polypeptide can be a Cas12i4 polypeptide, which is also disclosed herein.
[0038] definition The present disclosure will be described with respect to particular embodiments and with reference to certain figures but the disclosure is not limited thereto but only by the claims. The terms used hereinafter are generally to be understood in their ordinary sense unless otherwise indicated.
[0039] As used herein, the term "activity" refers to biological activity. In some embodiments, the activity includes enzymatic activity, such as the catalytic ability of the Cas12i polypeptide. For example, the activity can include nuclease activity.
[0040] As used herein, the term "HAO1" refers to "glycolate oxidase 1," also known as "hydroxyacid oxidase." HAO1 is a peroxisomal protein expressed primarily in the liver and pancreas, whose activities include the oxidation of glycolate and 2-hydroxy fatty acids. SEQ ID NO: 928 described herein provides an example of an HAO1 gene sequence.
[0041] As used herein, the term "Cas12i polypeptide" (also referred to herein as Cas12i) refers to a polypeptide that binds to a target sequence on a target nucleic acid specified by an RNA guide and has at least some amino acid sequence homology with a wild-type Cas12i polypeptide. In some embodiments, the Cas12i polypeptide comprises at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity with any one of SEQ ID NOs: 1-5 and 11-18 of U.S. Pat. No. 10,808,245, which is incorporated by reference for the subject matter and purposes referred to herein. In some embodiments, the Cas12i polypeptide comprises at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 8, 2, 11, and 9 of the present application. In some embodiments, the Cas12i polypeptide of the present disclosure is a Cas12i2 polypeptide described in WO / 2021 / 202800, the relevant disclosure of which is incorporated by reference for and with respect to the subject matter referenced herein. In some embodiments, the Cas12i polypeptide cleaves the target nucleic acid (e.g., as a nick or double-stranded break).
[0042] As used herein, the term "adjacent to" refers to a nucleotide or amino acid sequence closely adjacent to another nucleotide or amino acid sequence. In some embodiments, a nucleotide sequence is adjacent to (i.e., directly adjacent to) another nucleotide sequence if there are no nucleotides separating the two sequences. In some embodiments, a nucleotide sequence is adjacent to another nucleotide sequence if a small number of nucleotides (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides) separate the two sequences. In some embodiments, a first sequence is adjacent to a second sequence if the two sequences are separated by about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In some embodiments, a first sequence is adjacent to a second sequence if the two sequences are separated by at most 2 nucleotides, at most 5 nucleotides, at most 8 nucleotides, at most 10 nucleotides, at most 12 nucleotides, or at most 15 nucleotides. In some embodiments, a first sequence is adjacent to a second sequence if the two sequences are separated by 2-5 nucleotides, 4-6 nucleotides, 4-8 nucleotides, 4-10 nucleotides, 6-8 nucleotides, 6-10 nucleotides, 6-12 nucleotides, 8-10 nucleotides, 8-12 nucleotides, 10-12 nucleotides, 10-15 nucleotides, or 12-15 nucleotides.
[0043] As used herein, the term "complex" refers to a grouping of two or more molecules. In some embodiments, a complex includes a polypeptide and a nucleic acid molecule that interact with each other (e.g., bound, contacted, attached). For example, the term "complex" can refer to a grouping of an RNA guide and a polypeptide (e.g., a Cas12i polypeptide). Alternatively, the term "complex" can refer to a grouping of an RNA guide, a polypeptide, and a complementary region of a target sequence. In another example, the term "complex" can refer to a grouping of an HAO1-targeting RNA guide and a Cas12i polypeptide.
[0044] As used herein, the term "protospacer adjacent motif" or "PAM" refers to a DNA sequence adjacent to a target sequence (e.g., HAO1 target sequence) to which a complex comprising an RNA guide (e.g., HAO1 target RNA guide) and a Cas12i polypeptide binds. In a double-stranded DNA molecule, the strand containing the PAM motif is referred to as the "PAM strand" and the complementary strand is referred to as the "non-PAM strand." The RNA guide binds to a site in the non-PAM strand that is complementary to the target sequence disclosed herein.
[0045] In some embodiments, the PAM strand is a coding (e.g., sense) strand. In other embodiments, the PAM strand is a non-coding (e.g., antisense) strand. Because the RNA guide binds to the non-PAM strand via base pairing, the non-PAM strand is also known as the target strand, and the PAM strand is also known as the non-target strand.
[0046] As used herein, the term "target sequence" refers to a DNA fragment adjacent to a PAM motif (on the PAM strand). The complementary region of the target sequence is on the non-PAM strand. The target sequence may be directly adjacent to the PAM motif. Alternatively, the target sequence and the PAM may be separated by a small sequence segment (e.g., up to 5 nucleotides, e.g., up to 4, 3, 2, or 1 nucleotide). The target sequence may be located at the 3' end of the PAM motif or the 5' end of the PAM motif, depending on the CRISPR nuclease that recognizes the PAM motif, as known in the art. For example, the target sequence is located at the 3' end of the PAM motif for a Cas12i polypeptide (e.g., a Cas12i2 polypeptide such as those disclosed herein). In some embodiments, the target sequence is a sequence within the HAO1 gene sequence, including but not limited to the sequence set forth in SEQ ID NO:928.
[0047] As used herein, the term "adjacent to" refers to a nucleotide or amino acid sequence closely adjacent to another nucleotide or amino acid sequence. In some embodiments, a nucleotide sequence is adjacent to (i.e., directly adjacent to) another nucleotide sequence if there are no nucleotides separating the two sequences. In some embodiments, a nucleotide sequence is adjacent to another nucleotide sequence if a small number of nucleotides (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides) separate the two sequences. In some embodiments, a first sequence is adjacent to a second sequence if the two sequences are separated by about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides. In some embodiments, a first sequence is adjacent to a second sequence if the two sequences are separated by at most 2 nucleotides, at most 5 nucleotides, at most 8 nucleotides, at most 10 nucleotides, at most 12 nucleotides, or at most 15 nucleotides. In some embodiments, a first sequence is adjacent to a second sequence if the two sequences are separated by 2-5 nucleotides, 4-6 nucleotides, 4-8 nucleotides, 4-10 nucleotides, 6-8 nucleotides, 6-10 nucleotides, 6-12 nucleotides, 8-10 nucleotides, 8-12 nucleotides, 10-12 nucleotides, 10-15 nucleotides, or 12-15 nucleotides.
[0048] As used herein, the term "spacer" or "spacer sequence" refers to a portion within an RNA guide that is the RNA equivalent of a target sequence (DNA sequence). A spacer contains a sequence that is capable of binding to a non-PAM strand via base pairing at a site complementary to the target sequence (in the PAM strand). Such spacers are also known to be specific to the target sequence. In some cases, a spacer can be at least 75% (e.g., at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99%) identical to the target sequence, excluding the RNA-DNA sequence difference. In some cases, a spacer can be 100% identical to the target sequence, excluding the RNA-DNA sequence difference.
[0049] As used herein, the term "RNA guide" or "RNA guide sequence" refers to any RNA molecule or modified RNA molecule that facilitates targeting of a polypeptide described herein (e.g., a Cas12i polypeptide) to a target sequence (e.g., a sequence of the HAO1 gene). For example, an RNA guide can be a molecule designed to be complementary to a specific nucleic acid sequence (a target sequence, e.g., a target sequence in the HAO1 gene). An RNA guide can include a spacer sequence and a direct repeat (DR) sequence. In some cases, an RNA guide can be a modified RNA molecule that includes one or more deoxyribonucleotides, e.g., in a DNA binding sequence contained within the RNA guide, that binds to a sequence complementary to the target sequence. In some examples, the DNA binding sequence can contain a DNA sequence or a DNA / RNA hybrid sequence. The terms CRISPR RNA (crRNA), pre-crRNA, and mature crRNA are also used herein to refer to an RNA guide.
[0050] As used herein, the term "complementary" refers to a first polynucleotide having a level of complementarity with a second polynucleotide such that the first polynucleotide (e.g., a spacer sequence of an RNA guide) and the second polynucleotide (e.g., a complementary sequence of a target sequence) can form a double-stranded complex through base pairing to allow an effector polypeptide complexed with the first polynucleotide to act on (e.g., cleave) the second polynucleotide. In some embodiments, the first polynucleotide can be substantially complementary to the second polynucleotide, i.e., having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% complementarity with the second polynucleotide. In some embodiments, the first polynucleotide is fully complementary to the second polynucleotide, ie, has 100% complementarity with the second polynucleotide.
[0051] The "percent identity" (also known as sequence identity) of two nucleic acid or two amino acid sequences is determined using the algorithm of Karlin and Altschul Proc. Natl. Acad. Sci. USA 87:2264-68, 1990, modified as in Karlin and Altschul Proc. Natl. Acad. Sci. USA 90:5873-77, 1993. Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. J. Mol. Biol. 215:403-10, 1990. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to the protein molecules of the invention. When gaps exist between the two sequences, Gapped BLAST can be used as described in Altschul et al., Nucleic Acids Res. 25(17):3389-3402, 1997. When utilizing BLAST, Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.
[0052] As used herein, the term "editing" refers to one or more modifications being introduced into a target nucleic acid, for example, a target nucleic acid in the HAO1 gene. The editing can be one or more substitutions, one or more insertions, one or more deletions, or a combination thereof. As used herein, the term "substitution" refers to one or more nucleotides being replaced with one or more different nucleotides relative to a reference sequence. As used herein, the term "insertion" refers to the increase of one or more nucleotides in a nucleic acid sequence relative to a reference sequence. As used herein, the term "deletion" refers to the loss of one or more nucleotides in a nucleic acid sequence relative to a reference sequence.
[0053] No particular process is suggested for how to make a sequence containing a deletion. For example, a sequence containing a deletion can be directly synthesized from individual nucleotides. In other embodiments, the deletion is made by providing a reference sequence and then modifying it. The nucleic acid sequence can be in the genome of an organism. The nucleic acid sequence can be in a cell. The nucleic acid sequence can be a DNA sequence. The deletion can be a frameshift mutation or a non-frameshift mutation. The deletion described herein refers to a deletion of up to several kilobases.
[0054] As used herein, the terms "upstream" and "downstream" refer to relative positions within a single nucleic acid (e.g., DNA) sequence in a nucleic acid molecule. "Upstream" and "downstream" each refer to the 5' to 3' direction in which RNA transcription occurs. A first sequence is upstream of a second sequence when the 3' end of the first sequence occurs before the 5' end of the second sequence. A first sequence is downstream of a second sequence when the 5' end of the first sequence occurs after the 3' end of the second sequence. In some embodiments, a 5'-NTTN-3' or 5'-TTN-3' sequence is upstream of the indel described herein, and a Cas12i-induced indel is downstream of the 5'-NTTN-3' or 5'-TTN-3' sequence.
[0055] I. Gene editing systems In some embodiments, the present disclosure provides a gene editing system comprising the RNA guide that targets HAO1 gene.Such gene editing system can be used to edit HAO1 target gene, for example, can be used to disrupt HAO1 gene.
[0056] Hydroxy acid oxidase 1 (HAO1, also known as glycolate oxidase [GOX or GO]) converts glycolate to glyoxylate. It has been proposed that inhibition of HAO1 in individuals with PH1 blocks the formation of glyoxylate, and excess glycolate is excreted via urine. The idea of treating PH1 by inhibiting HAO1 is further supported by the fact that some individuals with abnormal splice variants of HAO1 are asymptomatic for glycolic aciduria, thereby having increased urinary glycolic acid excretion without obvious renal pathology. Thus, inhibiting HAO1 expression blocks the production of glyoxylate, which in turn blocks the production of its metabolite, oxalate. Thus, the gene editing system disclosed herein that targets the HAO1 gene can be used to treat primary hyperoxaluria (PH) in subjects in need of treatment.
[0057] In some embodiments, the RNA guide is composed of a direct repeat component and a spacer component. In some embodiments, the RNA guide is bound to a Cas12i polypeptide. In some embodiments, the spacer component is specific for the HAO1 target sequence, and the HAO1 target sequence is adjacent to a 5'-NTTN-3' or 5'-TTN-3' PAM sequence described herein. In the case of a double-stranded target, the RNA guide binds to the first strand of the target (i.e., the non-PAM strand) and a PAM sequence described herein is present in the second complementary strand (i.e., the PAM strand).
[0058] In some embodiments, the disclosure provides a composition comprising a complex, the complex comprising an RNA guide targeting HAO1. In some embodiments, the disclosure comprises a complex comprising an RNA guide and a Cas12i polypeptide. In some embodiments, the RNA guide and the Cas12i polypeptide bind to each other at a molar ratio of about 1:1. In some embodiments, the complex comprising an RNA guide and a Cas12i polypeptide binds to a complementary region of a target sequence in the HAO1 gene. In some embodiments, the complex comprising an RNA guide targeting HAO1 and a Cas12i polypeptide binds to a complementary region of a target sequence in the HAO1 gene at a molar ratio of about 1:1. In some embodiments, the complex comprises an enzymatic activity, e.g., a nuclease activity, capable of cleaving the HAO1 target sequence and / or the complementary sequence. The RNA guide, the Cas12i polypeptide, and the complementary region of the HAO1 target sequence do not naturally occur either alone or together. In some embodiments, the RNA guide in the complex comprises a direct repeat and / or spacer sequence as described herein. In some embodiments, the sequence of the RNA guide has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to any one of SEQ ID NOs: 967-1023. In some embodiments, the RNA guide has any one of SEQ ID NOs: 967-1023.
[0059] In some embodiments, the disclosure described herein includes a composition comprising an RNA guide described herein and / or an RNA encoding a Cas12i polypeptide described herein. In some embodiments, the RNA guide and the RNA encoding a Cas12i polypeptide are included together in the same composition. In some embodiments, the RNA guide and the RNA encoding a Cas12i polypeptide are included in separate compositions. In some embodiments, the RNA guide comprises a direct repeat and / or a spacer sequence described herein. In some embodiments, the sequence of the RNA guide has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to any one of SEQ ID NOs: 967-1023. In some embodiments, the RNA guide has a sequence of any one of SEQ ID NOs: 967-1023.
[0060] The use of the gene editing system disclosed herein has advantages over other known nuclease systems. Cas12i polypeptide is smaller than other nucleases. For example, Cas12i2 is 1,054 amino acids long, S.pyogenes Cas9 (SpCas9) is 1,368 amino acids long, S.thermophilus Cas9 (StCas9) is 1,128 amino acids long, FnCpf1 is 1,300 amino acids long, AsCpf1 is 1,307 amino acids long, and LbCpf1 is 1,246 amino acids long. Cas12i RNA guides, which do not require transactivating CRISPR RNA (tracrRNA), are also smaller than Cas9 RNA guides. Smaller Cas12i polypeptide and RNA guide sizes are beneficial for delivery. Compositions comprising Cas12i polypeptides also demonstrate reduced off-target activity compared to compositions comprising SpCas9 polypeptides. See PCT / US2021 / 025257, which is incorporated by reference in its entirety. Furthermore, the indel induced by a composition comprising Cas12i polypeptide is different from the indel induced by a composition comprising SpCas9 polypeptide. For example, SpCas9 polypeptide mainly induces insertions and deletions of 1 nucleotide length. However, Cas12i polypeptide induces larger deletions, which can be beneficial in disrupting larger parts of genes such as HAO1.
[0061] Also provided herein is a system for gene editing of a hydroxyacid oxidase 1 (HAO1) gene, the system comprising: (i) a Cas12i polypeptide (e.g., a Cas12i2 polypeptide) or a first nucleic acid encoding a Cas12i polypeptide (e.g., a Cas12i2 polypeptide comprising an amino acid sequence at least 95% identical to SEQ ID NO: 922, which amino acid sequence may comprise one or more mutations relative to SEQ ID NO: 922); and (ii) an RNA guide or a second nucleic acid encoding an RNA guide, wherein the RNA guide comprises a spacer sequence specific for a target sequence within the HAO1 gene (e.g., within exon 1 or exon 2 of the HAO1 gene), the target sequence is adjacent to a protospacer adjacent motif (PAM), the PAM comprises a 5'-TTN-3' (5'-NTTN-3') motif, and the 5'-TTN-3' (5'-NTTN-3') motif is located 5' to the target sequence.
[0062] A. RNA guide In some embodiments, the gene editing systems described herein include an RNA guide that targets the HAO1 gene, e.g., exon 1 or exon 2 of the HAO1 gene. In some embodiments, the gene editing systems described herein can include two or more (e.g., 2, 3, 4, 5, 6, 7, 8, or more) RNA guides that target HAO1.
[0063] An RNA guide can direct a Cas12i polypeptide contained within a gene editing system described herein to an HAO1 target sequence. Two or more RNA guides can direct two or more separate Cas12i polypeptides described herein (e.g., Cas12i polypeptides having the same or different sequences) to two or more (e.g., 2, 3, 4, 5, 6, 7, 8, or 9 or more) HAO1 target sequences.
[0064] Those of skill in the art will understand upon reading the following examples of particular types of RNA guides that in some embodiments, the RNA guide is HAO1 target specific, i.e., in some embodiments, the RNA guide specifically binds to one or more HAO1 target sequences (e.g., within a cell) and does not bind to non-target sequences (e.g., non-specific DNA or random sequences within the same cell).
[0065] In some embodiments, the RNA guide comprises a spacer sequence followed by a direct repeat sequence, which refers to the sequence in the 5' to 3' direction. In some embodiments, the RNA guide comprises a first direct repeat sequence followed by a spacer sequence and a second direct repeat sequence, which refers to the sequence in the 5' to 3' direction. In some embodiments, the first direct repeat and the second direct repeat of such an RNA guide are identical. In some embodiments, the first direct repeat and the second direct repeat of such an RNA guide are different.
[0066] In some embodiments, the spacer sequence and the direct repeat sequence(s) of the RNA guide are present in the same RNA molecule. In some embodiments, the spacer and the direct repeat sequence are directly linked to each other. In some embodiments, a short linker is present between the spacer and the direct repeat sequence, for example, an RNA linker of 1, 2, or 3 nucleotides in length. In some embodiments, the spacer sequence and the direct repeat sequence(s) of the RNA guide are present in separate molecules, which are linked to each other by base pairing interactions.
[0067] Additional information regarding exemplary direct repeat and spacer components of RNA guides is provided below.
[0068] (i) Direct Repeat In some embodiments, the RNA guide comprises a direct repeat sequence. In some embodiments, the direct repeat sequence of the RNA guide has a length of 12-100, 13-75, 14-50, or 15-40 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides).
[0069] In some embodiments, the direct repeat sequence is a sequence in Table 1 or a portion of a sequence in Table 1. The direct repeat sequence can include nucleotides 1 to 36 of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence can include nucleotides 2 to 36 of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence can include nucleotides 3 to 36 of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence can include nucleotides 4 to 36 of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence can include nucleotides 5 to 36 of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence can include nucleotides 6 to 36 of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may comprise nucleotides 7 to 36 of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may comprise nucleotides 8 to 36 of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may comprise nucleotides 9 to 36 of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may comprise nucleotides 10 to 36 of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may comprise nucleotides 11 to 36 of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may comprise nucleotides 12 to 36 of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence can include nucleotides 13 to 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.The direct repeat sequence can include nucleotides 14 to 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.
[0070] The direct repeat sequence may comprise nucleotides 1 to 34 of SEQ ID NO: 9. The direct repeat sequence may comprise nucleotides 2 to 34 of SEQ ID NO: 9. The direct repeat sequence may comprise nucleotides 3 to 34 of SEQ ID NO: 9. The direct repeat sequence may comprise nucleotides 4 to 34 of SEQ ID NO: 9. The direct repeat sequence may comprise nucleotides 5 to 34 of SEQ ID NO: 9. The direct repeat sequence may comprise nucleotides 6 to 34 of SEQ ID NO: 9. The direct repeat sequence may comprise nucleotides 7 to 34 of SEQ ID NO: 9. The direct repeat sequence may comprise nucleotides 8 to 34 of SEQ ID NO: 9. The direct repeat sequence may comprise nucleotides 9 to 34 of SEQ ID NO: 9. The direct repeat sequence may comprise nucleotides 10 to 34 of SEQ ID NO: 9. The direct repeat sequence may comprise nucleotides 11 to 34 of SEQ ID NO: 9. The direct repeat sequence may comprise nucleotides 12 to 34 of SEQ ID NO: 9. In some embodiments, the direct repeat sequence is set forth in SEQ ID NO: 10. In some embodiments, the direct repeat sequence comprises a portion of the sequence set forth in SEQ ID NO: 10.
[0071] In some embodiments, the direct repeat sequence has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to a sequence in Table 1 or a portion of a sequence in Table 1. The direct repeat sequence can have at least 90% identity to a sequence that includes nucleotides 1 to 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence can have at least 90% identity to a sequence that includes nucleotides 2 to 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence can have at least 90% identity to a sequence that includes nucleotides 3 to 36 of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may have at least 90% identity to a sequence comprising 4 to 36 nucleotides of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may have at least 90% identity to a sequence comprising 5 to 36 nucleotides of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may have at least 90% identity to a sequence comprising 6 to 36 nucleotides of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may have at least 90% identity to a sequence comprising 7 to 36 nucleotides of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may have at least 90% identity to a sequence comprising 8 to 36 nucleotides of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence can have at least 90% identity to a sequence comprising 9 to 36 nucleotides of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence can have at least 90% identity to a sequence comprising 10 to 36 nucleotides of any one of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, or 8.The direct repeat sequence may have at least 90% identity to a sequence comprising 11 to 36 nucleotides of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may have at least 90% identity to a sequence comprising 12 to 36 nucleotides of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may have at least 90% identity to a sequence comprising 13 to 36 nucleotides of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may have at least 90% identity to a sequence comprising 14 to 36 nucleotides of any one of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, or 8. The direct repeat sequence may have at least 90% identity to a sequence comprising 14 to 36 nucleotides of any one of SEQ ID NO: 9. The direct repeat sequence can have at least 90% identity to a sequence comprising nucleotides 2 to 34 of SEQ ID NO: 9. The direct repeat sequence can have at least 90% identity to a sequence comprising nucleotides 3 to 34 of SEQ ID NO: 9.
[0072] The direct repeat sequence may have at least 90% identity to a sequence comprising nucleotides 4 to 34 of SEQ ID NO:9. The direct repeat sequence may have at least 90% identity to a sequence comprising nucleotides 5 to 34 of SEQ ID NO:9. The direct repeat sequence may have at least 90% identity to a sequence comprising nucleotides 6 to 34 of SEQ ID NO:9. The direct repeat sequence may have at least 90% identity to a sequence comprising nucleotides 7 to 34 of SEQ ID NO:9. The direct repeat sequence may have at least 90% identity to a sequence comprising nucleotides 8 to 34 of SEQ ID NO:9. The direct repeat sequence may have at least 90% identity to a sequence comprising nucleotides 9 to 34 of SEQ ID NO:9. The direct repeat sequence may have at least 90% identity to a sequence comprising nucleotides 10 to 34 of SEQ ID NO:9. The direct repeat sequence may have at least 90% identity to a sequence comprising nucleotides 11 to 34 of SEQ ID NO:9.
[0073] The direct repeat sequence can have at least 90% identity to a sequence comprising nucleotides 12 to 34 of SEQ ID NO: 9. In some embodiments, the direct repeat sequence has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to SEQ ID NO: 10. In some embodiments, the direct repeat sequence has at least 90% identity to a portion of the sequence set forth in SEQ ID NO: 10.
[0074] In some embodiments, a composition comprising a Cas12i2 polypeptide and an RNA guide comprising a direct repeat of SEQ ID NO: 10 and a spacer length of 20 nucleotides can introduce indels into an HAO1 target sequence. See, for example, Example 1, in which indels were measured in 44 HAO1 target sequences after an RNA guide and a Cas12i2 polypeptide of SEQ ID NO: 924 were delivered by RNP to HEK293T cells. See, for example, Example 2, in which indels were measured in 11 HAO1 target sequences after an RNA guide and a Cas12i2 polypeptide of SEQ ID NO: 924 were delivered by RNP to HepG2 cells. See, for example, Example 3, in which indels were measured in 5 HAO1 target sequences after an RNA guide and a Cas12i2 polypeptide of SEQ ID NO: 924 were delivered by RNP to primary hepatocytes.
[0075] In some embodiments, the direct repeat sequence is at least 90% identical to the reverse complement of any one of SEQ ID NOs: 1-10 (see Table 1). In some embodiments, the direct repeat sequence is the reverse complement of any one of SEQ ID NOs: 1-10.
[0076] [Table 1]
[0077] In some embodiments, the direct repeat sequence is a sequence in Table 2 or a portion of a sequence in Table 2. The direct repeat sequence can include nucleotides 1 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can include nucleotides 2 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can include nucleotides 3 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can include nucleotides 4 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can include nucleotides 5 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can include nucleotides 6 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can include nucleotides 7 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.The direct repeat sequence can include nucleotides 8 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can include nucleotides 9 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can include nucleotides 10 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can include nucleotides 11 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can include nucleotides 12 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can include nucleotides 13 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can include nucleotides 14 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
[0078] In some embodiments, the direct repeat sequence has at least 95% identity (e.g., at least 95%, 96%, 97%, 98%, or 99% identity) to a sequence in Table 2 or a portion of a sequence in Table 2. The direct repeat sequence can have at least 95% identity to a sequence comprising nucleotides 1 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 95% identity to a sequence comprising 2 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 95% identity to a sequence comprising 3 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 95% identity to a sequence comprising 4 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 95% identity to a sequence comprising 5 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 95% identity to a sequence including 6 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.The direct repeat sequence can have at least 95% identity to a sequence comprising 7 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 95% identity to a sequence comprising 8 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 95% identity to a sequence comprising 9 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 95% identity to a sequence comprising 10 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 95% identity to a sequence comprising 11 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 95% identity to a sequence comprising 12 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 95% identity to a sequence including nucleotides 13 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
[0079] In some embodiments, the direct repeat sequence has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to a sequence in Table 2 or a portion of a sequence in Table 2. The direct repeat sequence can have at least 90% identity to a sequence comprising nucleotides 1 to 36 of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 90% identity to a sequence comprising 2 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 90% identity to a sequence comprising 3 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 90% identity to a sequence comprising 4 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 90% identity to a sequence comprising 5 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 90% identity to a sequence including 6 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.The direct repeat sequence can have at least 90% identity to a sequence comprising 7 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 90% identity to a sequence comprising 8 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 90% identity to a sequence comprising 9 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 90% identity to a sequence comprising 10 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 90% identity to a sequence comprising 11 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 90% identity to a sequence comprising 12 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. The direct repeat sequence can have at least 90% identity to a sequence including 13 to 36 nucleotides of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
[0080] In some embodiments, the direct repeat sequence is at least 90% identical to the reverse complement of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. In some embodiments, the direct repeat sequence is at least 95% identical to the reverse complement of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953. In some embodiments, the direct repeat sequence is the reverse complement of any one of SEQ ID NOs: 936, 937, 938, 939, 940, 941, 942, 943, 944, 945, 946, 947, 948, 949, 950, 951, 952, or 953.
[0081] In some embodiments, the direct repeat sequence is at least 90% identical to SEQ ID NO: 954 or a portion of SEQ ID NO: 954. In some embodiments, the direct repeat sequence is at least 95% identical to SEQ ID NO: 954 or a portion of SEQ ID NO: 954. In some embodiments, the direct repeat sequence is at least 100% identical to SEQ ID NO: 954 or a portion of SEQ ID NO: 954.
[0082] [Table 2]
[0083] In some embodiments, the direct repeat sequence is a sequence in Table 3 or a portion of a sequence in Table 3. In some embodiments, the direct repeat sequence has at least 95% identity (e.g., at least 95%, 96%, 97%, 98%, or 99% identity) with a sequence in Table 3 or a portion of a sequence in Table 3. In some embodiments, the direct repeat sequence has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) with a sequence in Table 3 or a portion of a sequence in Table 3. In some embodiments, the direct repeat sequence is at least 90% identical to the reverse complement of any one of SEQ ID NOs: 959-961. In some embodiments, the direct repeat sequence is at least 95% identical to the reverse complement of any one of SEQ ID NOs: 959-961. In some embodiments, the direct repeat sequence is the reverse complement sequence of any one of SEQ ID NOs: 959-961.
[0084] [Table 3]
[0085] In some embodiments, the direct repeat sequence is a sequence in Table 4 or a portion of a sequence in Table 4. In some embodiments, the direct repeat sequence has at least 95% identity (e.g., at least 95%, 96%, 97%, 98%, or 99% identity) with a sequence in Table 4 or a portion of a sequence in Table 4. In some embodiments, the direct repeat sequence has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) with a sequence in Table 4 or a portion of a sequence in Table 4. In some embodiments, the direct repeat sequence is at least 90% identical to the reverse complement of any one of SEQ ID NOs: 962-964. In some embodiments, the direct repeat sequence is at least 95% identical to the reverse complement of any one of SEQ ID NOs: 962-964. In some embodiments, the direct repeat sequence is the reverse complement sequence of any one of SEQ ID NOs: 962-964.
[0086] [Table 4]
[0087] In some embodiments, the direct repeat sequences described herein include uracil (U). In some embodiments, the direct repeat sequences described herein include thymine (T). In some embodiments, the direct repeat sequences according to Tables 1-4 include sequences that include a thymine at one or more positions shown as uracil in Tables 1-4.
[0088] (ii) Spacer sequence In some embodiments, the RNA guide comprises a DNA target or spacer sequence. In some embodiments, the spacer sequence of the RNA guide has a length of 12-100, 13-75, 14-50, or 15-30 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides) and is complementary to a non-PAM strand sequence. In some embodiments, the spacer sequence is designed to be complementary to a specific DNA strand, e.g., a specific DNA strand of a genomic locus.
[0089] In some embodiments, the RNA guide spacer sequence is substantially identical to the complementary strand of the target sequence. In some embodiments, the RNA guide comprises a sequence (e.g., a spacer sequence) that has at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity with a reference nucleic acid sequence, e.g., the complementary strand of the target sequence. The percent identity between two such nucleic acids may be determined manually by inspection of two optimally aligned nucleic acid sequences, or may be determined by using standard parameters using software programs or algorithms (e.g., BLAST, ALIGN, CLUSTAL).
[0090] In some embodiments, the RNA guide comprises a spacer sequence, the spacer sequence having a length of 12-100, 13-75, 14-50, or 15-30 nucleotides (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides) and is at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to a region on the non-PAM strand that is complementary to the target sequence. In some embodiments, the RNA guide comprises a sequence that is at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% complementary to a target DNA sequence. In some embodiments, the RNA guide comprises a sequence that is at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to the target genome sequence. In some embodiments, the RNA guide comprises a sequence, e.g., an RNA sequence, where the RNA sequence is up to 50 in length and is at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to the region on the non-PAM strand that is complementary to the target sequence. In some embodiments, the RNA guide comprises a sequence that is at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to the target DNA sequence. In some embodiments, the RNA guide comprises a sequence that is at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% complementary to the target genome sequence.
[0091] In some embodiments, the spacer sequence is a sequence in Table 5 or a portion of a sequence in Table 5. The references SEQ ID NOs: 466-920 should be considered equivalent to the recitation of SEQ ID NOs: 466-920, with each of the intervening numbers being 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509 , 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 599, 598, 599, 599, 599, 590, 591, 592, 593, 594, 595, 596 9, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 621, 622, 623, 624, 625, 626, 627, 628, 629, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 67 29, 630, 631, 632, 633, 634, 635, 636, 637, 638, 639, 640, 641, 642, 643, 644, 645, 646, 647, 648, 649, 650, 651, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 662, 663, 664, 665, 666, 667, 668, 669, 670, 671, 672, 673, 674, 675, 676, 677, 678, 679, 680, 681, 682, 683, 684, 685, 686, 687, 688,689, 690, 691, 692, 693, 694, 695, 696, 697, 698, 699, 700, 701, 702, 703, 704, 705, 706, 707, 708, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 7 48, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767, 768, 769, 770, 771, 772, 773, 774, 775, 776, 777, 778, 779, 780, 781, 782, 783, 784, 785, 786, 787, 788, 789, 790, 791, 792, 793, 794, 795, 796, 797, 798, 799, 800, 801, 802, 803, 804, 805, 806, 807 , 808, 809, 810, 811, 812, 813, 814, 815, 816, 817, 818, 819, 820, 821, 822, 823, 824, 825, 826, 827, 828, 829, 830, 831, 832, 833, 834, 835, 836, 837, 838, 839, 840, 841, 842, 843, 844, 845, 846, 847, 848, 849, 850, 851, 852, 853, 854, 855, 856, 857, 858, 859, 860, 861, 862, 863, 864, 865, 866, 8 It should be understood that 67, 868, 869, 870, 871, 872, 873, 874, 875, 876, 877, 878, 879, 880, 881, 882, 883, 884, 885, 886, 887, 888, 889, 890, 891, 892, 893, 894, 895, 896, 897, 898, 899, 900, 901, 902, 903, 904, 905, 906, 907, 908, 909, 910, 911, 912, 913, 914, 915, 916, 917, 918, 919, and 920 are present within the enumeration.
[0092] The spacer sequence may include nucleotides 1 to 16 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may include nucleotides 1 to 17 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may include nucleotides 1 to 18 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may include nucleotides 1 to 19 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may include nucleotides 1 to 20 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may include nucleotides 1 to 21 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may include nucleotides 1 to 22 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may include nucleotides 1 to 23 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may include nucleotides 1 to 24 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may comprise nucleotides 1 to 25 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may comprise nucleotides 1 to 26 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may comprise nucleotides 1 to 27 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may comprise nucleotides 1 to 28 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may comprise nucleotides 1 to 29 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may comprise nucleotides 1 to 30 of any one of SEQ ID NOs: 466 to 920.
[0093] In some embodiments, the spacer sequence has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to a sequence in Table 5 or a portion of a sequence in Table 5. The spacer sequence can have at least 90% identity to a sequence including nucleotides 1 to 16 of any one of SEQ ID NOs: 466-920. The spacer sequence can have at least 90% identity to a sequence including nucleotides 1 to 17 of any one of SEQ ID NOs: 466-920. The spacer sequence can have at least 90% identity to a sequence including nucleotides 1 to 18 of any one of SEQ ID NOs: 466-920. The spacer sequence can have at least 90% identity to a sequence including nucleotides 1 to 19 of any one of SEQ ID NOs: 466-920. The spacer sequence may have at least 90% identity to a sequence comprising nucleotide 1 to nucleotide 20 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may have at least 90% identity to a sequence comprising nucleotide 1 to nucleotide 21 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may have at least 90% identity to a sequence comprising nucleotide 1 to nucleotide 22 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may have at least 90% identity to a sequence comprising nucleotide 1 to nucleotide 23 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may have at least 90% identity to a sequence comprising nucleotide 1 to nucleotide 24 of any one of SEQ ID NOs: 466 to 920.
[0094] The spacer sequence may have at least 90% identity to a sequence comprising nucleotide 1 to nucleotide 25 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may have at least 90% identity to a sequence comprising nucleotide 1 to nucleotide 26 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may have at least 90% identity to a sequence comprising nucleotide 1 to nucleotide 27 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may have at least 90% identity to a sequence comprising nucleotide 1 to nucleotide 28 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may have at least 90% identity to a sequence comprising nucleotide 1 to nucleotide 29 of any one of SEQ ID NOs: 466 to 920. The spacer sequence may have at least 90% identity to a sequence comprising nucleotide 1 to nucleotide 30 of any one of SEQ ID NOs: 466 to 920.
[0095] [Table 5-1]
[0096] [Table 5-2]
[0097] [Table 5-3]
[0098] [Table 5-4]
[0099] [Table 5-5]
[0100] [Table 5-6]
[0101]
Table 5-7
[0102]
Table 5-8
[0103]
Table 5-9
[0104]
Table 5-10
[0105]
Table 5-11
[0106]
Table 5-12
[0107]
Table 5-13
[0108]
Table 5-14
[0109]
Table 5-15
[0110]
Table 5-16
[0111]
Table 5-17
[0112]
Table 5-18
[0113]
Table 5-19
[0114]
Table 5-20
[0115]
Table 5-21
[0116]
Table 5-22
[0117]
Table 5-23
[0118]
Table 5-24
[0119]
Table 5-25
[0120]
Table 5-26
[0121] [Table 5-27]
[0122] [Table 5-28]
[0123] [Table 5-29]
[0124] [Table 5-30]
[0125] The present disclosure includes all combinations of direct repeats and spacers listed above that are consistent with the disclosure herein.
[0126] In some embodiments, the spacer sequences described herein include uracil (U). In some embodiments, the spacer sequences described herein include thymine (T). In some embodiments, the spacer sequences according to Table 5 include sequences that include a thymine at one or more positions shown in Table 5 as uracil.
[0127] (iii) Exemplary RNA guides The present disclosure provides RNA guides comprising any combination of direct repeats and spacers described herein (e.g., described in Table 5 above). In some embodiments, the sequence of the RNA guide has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to any one of SEQ ID NOs: 967-1023. In some embodiments, the RNA guide has the sequence of any one of SEQ ID NOs: 967-1023.
[0128] In some embodiments, the exemplary RNA guides provided herein may include a spacer sequence of any one of SEQ ID NOs: 1093 to 1097. In one example, the RNA guide may include a spacer sequence of SEQ ID NO: 1096.
[0129] Any of the exemplary RNA guides disclosed herein may comprise a direct sequence of any one of SEQ ID NOs: 1-10, or a fragment thereof that is at least 23 nucleotides in length. In one example, the direct sequence may comprise SEQ ID NO: 10.
[0130] In specific examples, the RNA guides provided herein may comprise the nucleotide sequence of SEQ ID NO: 967, 968, 988, 989, or 994. In one example, the RNA guides provided herein comprise the nucleotide sequence of SEQ ID NO: 989.
[0131] (iv).Modification An RNA guide may include one or more covalent modifications to a reference sequence, particularly a parent polyribonucleotide, and these covalent modifications are included within the scope of the present disclosure.
[0132] Exemplary modifications can include any modification to the sugar, nucleobase, internucleoside linkage (e.g., phosphate linkage / phosphodiester linkage / phosphodiester backbone), and any combination thereof. Some of the exemplary modifications provided herein are described in detail below.
[0133] The RNA guide may include any useful modification, such as a modification to the sugar, nucleobase, or internucleoside linkage (e.g., phosphate / phosphodiester linkage / phosphodiester backbone). One or more atoms of the pyrimidine nucleobase may be replaced or substituted with an optionally substituted amino, an optionally substituted thiol, an optionally substituted alkyl (e.g., methyl or ethyl), or a halo (e.g., chloro or fluoro). In some embodiments, a modification (e.g., one or more modifications) is present in each of the sugar and the internucleoside linkage. The modification may be a modification from ribonucleic acid (RNA) to deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or a hybrid thereof). Additional modifications are described herein.
[0134] In some embodiments, the modification may include chemical or cell-induced modifications. For example, some non-limiting examples of intracellular RNA modifications are described by Lewis and Pan in "RNA modifications and structures cooperate to RNA guide-protein interactions" from Nat Reviews Mol Cell Biol, 2017, 18:202-210.
[0135] Different sugar modifications, nucleotide modifications, and / or internucleoside linkages (e.g., backbone structures) may be present at various positions in the sequence. It will be understood by those of skill in the art that the nucleotide analog or other modification(s) may be located at any position(s) of the sequence such that the function of the sequence is not substantially diminished. The sequence may contain from about 1% to about 100% modified nucleotides (either relative to the overall nucleotide content or relative to any one or more types of nucleotides, i.e., any one or more of A, G, U, or C), or any intervening percentage (e.g., 1%-20%>, 1%-25%, 1%-50%, 1%-60%, 1%-70%, 1%-80%, 1%-90%, 1%-95%, 10%-20%, 10%-25%, 10%-50%, 10%-60%, 10%-70%, 10%-80%, 10%-90%, 10%-10%). In some embodiments, the nucleic acid may contain modified nucleotides in the range of 0% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%).
[0136] In some embodiments, sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions in one or more ribonucleotides of the sequence, and backbone modifications may include modification or substitution of phosphodiester bonds. Specific examples of sequences include, but are not limited to, sequences that include modified backbones or sequences that include internucleoside modifications, including non-natural internucleoside linkages, e.g., modified or substituted phosphodiester bonds. Sequences with modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this application, and as often referred to in the art, modified RNAs that do not have a phosphorus atom in the internucleoside backbone may also be considered to be oligonucleosides. In certain embodiments, the sequence includes ribonucleotides that have a phosphorus atom in their internucleoside backbone.
[0137] Modified sequence backbones can include, for example, phosphorothioates; chiral phosphorothioates; phosphorodithioates; phosphotriesters; aminoalkyl phosphotriesters; methyl and other alkyl phosphonates, such as 3'-alkylene phosphonates and chiral phosphonates; phosphinates; phosphoramidates, such as 3'-amino phosphoramidates and aminoalkyl phosphoramidates; thionophosphoramidates; thionoalkyl phosphonates; thionoalkyl phosphotriesters; and boranophosphates with linear 3'-5' linkages, their 2'-5' linkage analogs, and those with reverse polarity, in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Also included are various salts, mixed salts, and free acid forms. In some embodiments, sequences can have negative or positive charges.
[0138] Modified nucleotides that may be incorporated into a sequence may be modified on the internucleoside bond (e.g., phosphate backbone). In the context of polynucleotide backbone, the terms "phosphate" and "phosphodiester" are used interchangeably herein. The backbone phosphate group may be modified by replacing one or more of the oxygen atoms with different substituents. Furthermore, modified nucleosides and nucleotides may include a wide range of replacements of unmodified phosphate moieties with alternative internucleoside bond types as described herein. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linked oxygens replaced by sulfur. Phosphate linkers can also be modified by replacement of the linking oxygen at nitrogen (bridging phosphoramidates), sulfur (bridging phosphorothioates), and carbon (bridging methylene phosphonates).
[0139] The alpha-thio substituted phosphate moieties are provided to impart stability to RNA and DNA polymers through the unnatural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently longer half-lives in the cellular environment.
[0140] In specific embodiments, the modified nucleoside comprises an alpha-thio-nucleoside (e.g., 5'-O-(1-thiophosphate)-adenosine, 5'-O-(1-thiophosphate)-cytidine (a-thio-cytidine), 5'-O-(1-thiophosphate)-guanosine, 5'-O-(1-thiophosphate)-uridine, or 5'-O-(1-thiophosphate)-pseudouridine).
[0141] Other internucleoside linkages that can be used in accordance with the present disclosure are described herein, including internucleoside linkages that do not contain a phosphorus atom.
[0142] In some embodiments, the sequence may include one or more cytotoxic nucleosides. For example, cytotoxic nucleosides may be incorporated into the sequence, such as a bifunctional modification. Cytotoxic nucleosides include, but are not limited to, adenosine arabinoside, 5-azacytidine, 4'-thio-aracytidine, cyclopentenylcytosine, cladribine, clofarabine, cytarabine, cytosine arabinoside, 1-(2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl)-cytosine, decitabine, 5-fluorouracil, fludarabine, floxuridine, gemcitabine, a combination of tegafur and uracil, tegafur ((RS)-5-fluoro-1-(tetrahydrofuran-2-yl)pyrimidine-2,4(1H,3H)-dione), troxacitabine, tezacitabine, 2'-deoxy-2'-methylidenecytidine (DMDC), and 6-mercaptopurine. Additional examples include fludarabine phosphate, N4-behenoyl-1-beta-D-arabinofuranosylcytosine, N4-octadecyl-1-beta-D-arabinofuranosylcytosine, N4-palmitoyl-1-(2-C-cyano-2-deoxy-beta-D-arabino-pentofuranosyl)cytosine, and P-4055 (cytarabine 5'-elaidate).
[0143] In some embodiments, the sequence comprises one or more post-transcriptional modifications (e.g., capping, cleavage, polyadenylation, splicing, polyA sequences, methylation, acylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and nitrosylation of thiol groups and tyrosine residues, etc.). The one or more post-transcriptional modifications can be any post-transcriptional modification, for example, any of the more than 100 different nucleoside modifications that have been identified in RNA (Rozenski, J, Crain, P, and McCloskey, J. (1999). The RNA Modification Database: 1999 update. Nucl Acids Res 27:196-197). In some embodiments, the first isolated nucleic acid comprises messenger RNA (mRNA). In some embodiments, the mRNA is selected from the group consisting of pyridin-4-one ribonucleosides, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5 In one embodiment, the nucleoside comprises at least one nucleoside selected from the group consisting of 1-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, and 4-methoxy-2-thio-pseudouridine.In some embodiments, the mRNA is 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4- The nucleoside comprises at least one nucleoside selected from the group consisting of thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1-methyl-pseudoisocytidine. In some embodiments, the mRNA is 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisobutyric acid), N6-isopropyl adenosine, ... The nucleoside comprises at least one nucleoside selected from the group consisting of N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine.In some embodiments, the mRNA comprises at least one nucleoside selected from the group consisting of inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine.
[0144] A sequence may be uniformly modified or unmodified along the entire length of the molecule. For example, one or more or all types of nucleotides (e.g., naturally occurring nucleotides, purines, or pyrimidines, or any one or more or all of A, G, U, C, I, pU) may be uniformly modified or unmodified in a sequence or within a given predetermined sequence region thereof. In some embodiments, the sequence includes pseudouridine. In some embodiments, the sequence includes inosine, which may aid the immune system in characterizing the sequence as endogenous versus viral RNA. Incorporation of inosine may also mediate improved RNA stability / reduced degradation. See, e.g., Yu, Z. et al. (2015) RNA editing by ADAR1 marks dsRNA as “self”. Cell Res. 25, 1283-1284, which is incorporated by reference in its entirety.
[0145] In some embodiments, one or more of the nucleotides of the RNA guide comprise a 2'-O-methyl phosphorothioate modification. In some embodiments, each of the first three nucleotides of the RNA guide comprise a 2'-O-methyl phosphorothioate modification. In some embodiments, each of the last four nucleotides of the RNA guide comprise a 2'-O-methyl phosphorothioate modification. In some embodiments, each of the first to last, second to last, and third to last nucleotides of the RNA guide comprise a 2'-O-methyl phosphorothioate modification, and the last nucleotide of the RNA guide is unmodified. In some embodiments, each of the first three nucleotides of the RNA guide comprise a 2'-O-methyl phosphorothioate modification, and each of the first to last, second to last, and third to last nucleotides of the RNA guide comprise a 2'-O-methyl phosphorothioate modification.
[0146] When the gene editing system disclosed herein comprises a nucleic acid, e.g., an mRNA molecule, encoding a Cas12i polypeptide disclosed herein, such a nucleic acid molecule may contain any of the modifications disclosed herein, if applicable.
[0147] B. Cas12i Polypeptides In some embodiments, a composition or system of the present disclosure comprises a Cas12i polypeptide as described in WO / 2019 / 178427, the relevant disclosure of which is incorporated by reference for the subject matter and purposes referenced herein.
[0148] In some embodiments, the gene editing system disclosed herein comprises a Cas12i2 polypeptide described herein (e.g., a polypeptide comprising SEQ ID NO: 922 and / or encoded by SEQ ID NO: 921). In some embodiments, the Cas12i2 polypeptide comprises at least one RuvC domain.
[0149] A nucleic acid sequence encoding a Cas12i2 polypeptide described herein can be substantially identical to a reference nucleic acid sequence, e.g., SEQ ID NO: 921. In some embodiments, a Cas12i2 polypeptide is encoded by a nucleic acid comprising a sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity to a reference nucleic acid sequence, e.g., SEQ ID NO: 921. The percent identity between two such nucleic acids may be determined manually by inspection of two optimally aligned nucleic acid sequences, or may be determined using standard parameters using a software program or algorithm (e.g., BLAST, ALIGN, CLUSTAL). One indication that two nucleic acid sequences are substantially identical is that the nucleic acid molecules hybridize to the complementary sequence of another under stringent conditions of temperature and ionic strength (e.g., within the range of moderate to high stringency). See, e.g., Tijssen, "Hybridization with Nucleic Acid Probes. Part I. Theory and Nucleic Acid Preparation" (Laboratory Techniques in Biochemistry and Molecular Biology, Vol 24).
[0150] In some embodiments, the Cas12i2 polypeptide is encoded by a nucleic acid sequence that has at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% or more sequence identity to a reference nucleic acid sequence, e.g., SEQ ID NO:921, but does not have 100% sequence identity.
[0151] In some embodiments, a Cas12i2 polypeptide of the disclosure comprises a polypeptide sequence having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:922.
[0152] In some embodiments, the disclosure describes Cas12i2 polypeptides that have a certain degree of amino acid sequence identity with one or more reference polypeptides, for example, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99%, but not 100%, sequence identity with the amino acid sequence of SEQ ID NO: 922. Homology or identity can be determined by amino acid sequence alignment, for example, using programs such as BLAST, ALIGN, or CLUSTAL, as described herein.
[0153] Also provided is a Cas12i2 polypeptide of the present disclosure having enzymatic activity, e.g., nuclease or endonuclease activity, comprising an amino acid sequence that differs from the amino acid sequence of SEQ ID NO:922 by 50, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 amino acid residues when aligned using any of the alignment methods described above.
[0154] In some instances, the Cas12i2 polypeptide can contain one or more mutations, e.g., at positions D581, G624, F626, P868, I926, V1030, E1035, S1046, or any combination thereof, relative to SEQ ID NO: 922. In some instances, the one or more mutations are amino acid substitutions, e.g., D581R, G624R, F626R, P868T, I926R, V1030G, E1035R, S1046G, or any combination thereof.
[0155] In some examples, the Cas12i2 polypeptide contains mutations at positions D581, D911, I926, and V1030. Such Cas12i2 polypeptides may contain amino acid substitutions of D581R, D911R, I926R, and V1030G (e.g., SEQ ID NO: 923). In some examples, the Cas12i2 polypeptide contains mutations at positions D581, I926, and V1030. Such Cas12i2 polypeptides may contain amino acid substitutions of D581R, I926R, and V1030G (e.g., SEQ ID NO: 924). In some examples, the Cas12i2 polypeptide may contain mutations at positions D581, I926, V1030, and S1046. Such Cas12i2 polypeptides may contain amino acid substitutions of D581R, I926R, V1030G, and S1046G (e.g., SEQ ID NO: 925). In some examples, Cas12i2 polypeptides may contain mutations at positions D581, G624, F626, I926, V1030, E1035, and S1046. Such Cas12i2 polypeptides may contain amino acid substitutions of D581R, G624R, F626R, I926R, V1030G, E1035R, and S1046G (e.g., SEQ ID NO: 926). In some examples, Cas12i2 polypeptides may contain mutations at positions D581, G624, F626, P868, I926, V1030, E1035, and S1046. Such a Cas12i2 polypeptide can contain the following amino acid substitutions (e.g., SEQ ID NO: 927): D581R, G624R, F626R, P868T, I926R, V1030G, E1035R, and S1046G.
[0156] In some embodiments, a Cas12i2 polypeptide of the disclosure comprises a polypeptide sequence having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:923, SEQ ID NO:924, SEQ ID NO:925, SEQ ID NO:926, or SEQ ID NO:927. In some embodiments, a Cas12i2 polypeptide having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:923, SEQ ID NO:924, SEQ ID NO:925, SEQ ID NO:926, or SEQ ID NO:927 maintains the amino acid changes (or at least one, two, three, etc. of these changes) that distinguish the polypeptide from its respective parent / reference sequence.
[0157] In some embodiments, the disclosure describes Cas12i2 polypeptides that have a certain degree of amino acid sequence identity with one or more reference polypeptides, for example, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99%, but not 100%, sequence identity with the amino acid sequence of SEQ ID NO: 923, SEQ ID NO: 924, SEQ ID NO: 925, SEQ ID NO: 926, or SEQ ID NO: 927. Homology or identity can be determined by amino acid sequence alignment, for example, using programs such as BLAST, ALIGN, or CLUSTAL, as described herein.
[0158] Also provided is a Cas12i2 polypeptide of the present disclosure having enzymatic activity, e.g., nuclease or endonuclease activity, comprising an amino acid sequence that differs from the amino acid sequence of SEQ ID NO:923, SEQ ID NO:924, SEQ ID NO:925, SEQ ID NO:926, or SEQ ID NO:927 by 50, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 amino acid residues when aligned using any of the alignment methods described above.
[0159] In some embodiments, a composition of the disclosure comprises a Cas12i4 polypeptide described herein (e.g., a polypeptide comprising and / or encoded by SEQ ID NO: 956). In some embodiments, the Cas12i4 polypeptide comprises at least one RuvC domain.
[0160] The nucleic acid sequence encoding the Cas12i4 polypeptide described herein can be substantially identical to a reference nucleic acid sequence, e.g., SEQ ID NO: 955. In some embodiments, the Cas12i4 polypeptide is encoded by a nucleic acid comprising a sequence having at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 99.5% sequence identity to a reference nucleic acid sequence, e.g., SEQ ID NO: 955. The percent identity between two such nucleic acids may be determined manually by inspection of two optimally aligned nucleic acid sequences, or may be determined using standard parameters using a software program or algorithm (e.g., BLAST, ALIGN, CLUSTAL). One indication that two nucleic acid sequences are substantially identical is that the nucleic acid molecules hybridize to the complementary sequence of another under stringent conditions of temperature and ionic strength (e.g., within a range of moderate to high stringency).
[0161] In some embodiments, the Cas12i4 polypeptide is encoded by a nucleic acid sequence that has at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% or more sequence identity to a reference nucleic acid sequence, e.g., SEQ ID NO: 955, but does not have 100% sequence identity.
[0162] In some embodiments, a Cas12i4 polypeptide of the disclosure comprises a polypeptide sequence having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:956.
[0163] In some embodiments, the disclosure describes Cas12i4 polypeptides that have a certain degree of amino acid sequence identity with one or more reference polypeptides, for example, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99%, but not 100%, sequence identity with the amino acid sequence of SEQ ID NO: 956. Homology or identity can be determined by amino acid sequence alignment, for example, using programs such as BLAST, ALIGN, or CLUSTAL, as described herein.
[0164] Also provided is a Cas12i4 polypeptide of the present disclosure having enzymatic activity, e.g., nuclease or endonuclease activity, comprising an amino acid sequence that differs from the amino acid sequence of SEQ ID NO:956 by 50, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 amino acid residues when aligned using any of the alignment methods described above.
[0165] In some embodiments, the Cas12i4 polypeptide comprises a polypeptide comprising the sequence of SEQ ID NO:957 or SEQ ID NO:958.
[0166] In some embodiments, a Cas12i4 polypeptide of the disclosure comprises a polypeptide sequence having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 957 or SEQ ID NO: 958. In some embodiments, a Cas12i4 polypeptide having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 957 or SEQ ID NO: 958 maintains the amino acid changes (or at least one, two, three, etc. of these changes) that distinguish it from its respective parent / reference sequence.
[0167] In some embodiments, the disclosure describes Cas12i4 polypeptides that have a certain degree of amino acid sequence identity with one or more reference polypeptides, for example, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99%, but not 100%, sequence identity with the amino acid sequence of SEQ ID NO: 957 or SEQ ID NO: 958. Homology or identity can be determined by amino acid sequence alignment, for example, using programs such as BLAST, ALIGN, or CLUSTAL, as described herein.
[0168] Also provided is a Cas12i4 polypeptide of the present disclosure having enzymatic activity, e.g., nuclease or endonuclease activity, comprising an amino acid sequence that differs from the amino acid sequence of SEQ ID NO:957 or SEQ ID NO:958 by 50, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 amino acid residues when aligned using any of the alignment methods described above.
[0169] In some embodiments, a composition of the disclosure comprises a Cas12i1 polypeptide described herein (e.g., a polypeptide comprising SEQ ID NO: 965). In some embodiments, a Cas12i4 polypeptide comprises at least one RuvC domain.
[0170] In some embodiments, a Cas12i1 polypeptide of the disclosure comprises a polypeptide sequence having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:965.
[0171] In some embodiments, the disclosure describes Cas12i1 polypeptides that have a certain degree of amino acid sequence identity with one or more reference polypeptides, for example, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99%, but not 100%, sequence identity with the amino acid sequence of SEQ ID NO: 965. Homology or identity can be determined by amino acid sequence alignment, for example, using programs such as BLAST, ALIGN, or CLUSTAL, as described herein.
[0172] Also provided is a Cas12i1 polypeptide of the present disclosure having enzymatic activity, e.g., nuclease or endonuclease activity, comprising an amino acid sequence that differs from the amino acid sequence of SEQ ID NO:965 by 50, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 amino acid residues when aligned using any of the alignment methods described above.
[0173] In some embodiments, a composition of the disclosure comprises a Cas12i3 polypeptide described herein (e.g., a polypeptide comprising SEQ ID NO: 966). In some embodiments, a Cas12i4 polypeptide comprises at least one RuvC domain.
[0174] In some embodiments, a Cas12i3 polypeptide of the disclosure comprises a polypeptide sequence having at least 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO:966.
[0175] In some embodiments, the disclosure describes Cas12i3 polypeptides that have a certain degree of amino acid sequence identity with one or more reference polypeptides, for example, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or even at least 99%, but not 100%, sequence identity with the amino acid sequence of SEQ ID NO: 966. Homology or identity can be determined by amino acid sequence alignment, for example, using programs such as BLAST, ALIGN, or CLUSTAL, as described herein.
[0176] Also provided is a Cas12i3 polypeptide of the present disclosure having enzymatic activity, e.g., nuclease or endonuclease activity, comprising an amino acid sequence that differs from the amino acid sequence of SEQ ID NO:966 by 50, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1, or 0 amino acid residues when aligned using any of the alignment methods described above.
[0177] The changes described herein can be one or more amino acid changes, but the changes to the Cas12i polypeptide can also be of a substantial nature, for example, fusion of the polypeptide as an amino and / or carboxyl terminal extension. For example, the Cas12i polypeptide can contain additional peptides, for example, one or more peptides. Examples of additional peptides can include epitope peptides for labeling, such as polyhistidine tags (His tags), Myc, and FLAG. In some embodiments, the Cas12i polypeptides described herein can be fused to a detectable moiety, for example, a fluorescent protein (e.g., green fluorescent protein (GFP) or yellow fluorescent protein (YFP)).
[0178] In some embodiments, the Cas12i polypeptide comprises at least one (e.g., 2, 3, 4, 5, or more) nuclear localization signal (NLS). In some embodiments, the Cas12i polypeptide comprises at least one (e.g., 2, 3, 4, 5, or more) nuclear export signal (NES). In some embodiments, the Cas12i polypeptide comprises at least one (e.g., 2, 3, 4, 5, or more) NLS and at least one (e.g., 2, 3, 4, 5, or more) NES.
[0179] In some embodiments, the Cas12i polypeptides described herein can be self-inactivating. See Epstein et al., "Engineering a Self-Inactivating CRISPR System for AAV Vectors," Mol. Ther., 24(2016):S50, which is incorporated by reference in its entirety.
[0180] In some embodiments, the nucleotide sequence encoding the Cas12i polypeptide described herein can be codon-optimized for use in a particular host cell or organism. For example, the nucleic acid can be codon-optimized for any non-human eukaryote, including mouse, rat, rabbit, dog, livestock, or non-human primate. Codon usage tables are readily available, for example, in the "Codon Usage Database" available at www.kazusa.orjp / codon / , and these tables can be adapted in several ways. See Nakamura et al. Nucl. Acids Res. 28:292 (2000), which is incorporated herein by reference in its entirety. Also, computer algorithms are available for codon-optimizing a particular sequence for expression in a particular host cell, for example, Gene Forge (Aptagen, Jacobus, PA). In some examples, the nucleic acid encoding the Cas12i polypeptide disclosed herein, for example, the Cas12i2 polypeptide, can be an mRNA molecule that can be codon-optimized.
[0181] Exemplary Cas12i polypeptide sequences and corresponding nucleotide sequences are listed in Table 6.
[0182] [Table 6-1]
[0183] [Table 6-2]
[0184]
Table 6-3
[0185]
Table 6-4
[0186]
Table 6-5
[0187]
Table 6-6
[0188]
Table 6-7
[0189]
Table 6-8
[0190]
Table 6-9
[0191]
Table 6-10
[0192]
Table 6-11
[0193]
Table 6-12
[0194] [Table 6-13]
[0195] [Table 6-14]
[0196] [Table 6-15]
[0197] [Table 6-16]
[0198] [Table 6-17]
[0199] [Table 6-18]
[0200] In some embodiments, the gene editing system disclosed herein may include a Cas12i polypeptide disclosed herein. In other embodiments, the gene editing system may include a nucleic acid encoding a Cas12i polypeptide. For example, the gene editing system may include a vector (e.g., a viral vector, e.g., an AAV vector, e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrhlO, AAV11, and AAV12) encoding a Cas12i polypeptide. Alternatively, the gene editing system may include an mRNA molecule encoding a Cas12i polypeptide. In some cases, the mRNA molecule may be codon-optimized.
[0201] II. Preparation of gene editing system components The present disclosure provides components of the gene editing system disclosed herein, such as methods for producing RNA guides, methods for producing Cas12i polypeptides, and methods for forming complexes between RNA guides and Cas12i polypeptides.
[0202] A. RNA guide In some embodiments, the RNA guide is produced by in vitro transcription of a template DNA. Thus, for example, in some embodiments, the RNA guide is generated by in vitro transcription of a template DNA encoding the RNA guide using an upstream promoter sequence (e.g., a T7 polymerase promoter sequence). In some embodiments, the template DNA encodes multiple RNA guides, or the in vitro transcription reaction includes multiple different template DNAs, each of which encodes a different RNA guide. In some embodiments, the RNA guide is produced using chemical synthesis methods. In some embodiments, the RNA guide is produced by expressing an RNA guide sequence in a cell transfected with a plasmid that includes a sequence encoding the RNA guide. In some embodiments, the plasmid encodes multiple different RNA guides. In some embodiments, multiple different plasmids, each encoding a different RNA guide, are transfected into the cell. In some embodiments, the RNA guide is expressed from a plasmid that encodes the RNA guide and also encodes a Cas12i polypeptide. In some embodiments, the RNA guide is expressed from a plasmid that expresses the RNA guide but does not express a Cas12i polypeptide. In some embodiments, the RNA guide is purchased from a commercial vendor. In some embodiments, the RNA guide is synthesized using one or more modified nucleotides, such as those described above.
[0203] B. Cas12i Polypeptides In some embodiments, the Cas12i polypeptide of the present disclosure can be prepared by (a) culturing bacteria that produce the Cas12i polypeptide of the present disclosure, isolating the Cas12i polypeptide, optionally purifying the Cas12i polypeptide, and forming a complex between the Cas12i polypeptide and an RNA guide. The Cas12i polypeptide can also be prepared by (b) known genetic engineering techniques, specifically by isolating the gene encoding the Cas12i polypeptide of the present disclosure from bacteria, constructing a recombinant expression vector, and then introducing the vector into a suitable host cell, where the host cell expresses the RNA guide for expression of the recombinant protein, and the recombinant protein forms a complex with the RNA guide in the host cell. Alternatively, the Cas12i polypeptide can be prepared by (c) an in vitro coupled transcription-translation system, followed by complex formation with the RNA guide.
[0204] In some embodiments, a host cell is used to express Cas12i polypeptide. The host cell is not particularly limited, and various known cells can be preferably used. Specific examples of host cells include bacteria, such as E. coli, yeast (budding yeast Saccharomyces cerevisiae and fission yeast Schizosaccharomyces pombe), nematodes (Caenorhabditis elegans), Xenopus laevis oocytes, and animal cells (e.g., CHO cells, COS cells, and HEK293 cells). The method for transferring the above expression vector into a host cell, i.e., the transformation method, is not particularly limited, and known methods, such as electroporation, calcium phosphate method, liposome method, and DEAE dextran method, can be used.
[0205] After the host is transformed with the expression vector, the host cell may be cultured, cultivated, or propagated for the production of the Cas12i polypeptide. After expression of the Cas12i polypeptide, the host cell may be harvested and the Cas12i polypeptide may be purified from the culture or the like by conventional methods (e.g., filtration, centrifugation, cell disruption, gel filtration chromatography, ion exchange chromatography, etc.).
[0206] In some embodiments, the methods for Cas12i polypeptide expression include translation of at least 5 amino acids, at least 10 amino acids, at least 15 amino acids, at least 20 amino acids, at least 50 amino acids, at least 100 amino acids, at least 150 amino acids, at least 200 amino acids, at least 250 amino acids, at least 300 amino acids, at least 400 amino acids, at least 500 amino acids, at least 600 amino acids, at least 700 amino acids, at least 800 amino acids, at least 900 amino acids, or at least 1000 amino acids of a Cas12i polypeptide. In some embodiments, methods for protein expression include translation of about 5 amino acids, about 10 amino acids, about 15 amino acids, about 20 amino acids, about 50 amino acids, about 100 amino acids, about 150 amino acids, about 200 amino acids, about 250 amino acids, about 300 amino acids, about 400 amino acids, about 500 amino acids, about 600 amino acids, about 700 amino acids, about 800 amino acids, about 900 amino acids, or about 1000 amino acids or more of a Cas12i polypeptide.
[0207] Various methods can be used to determine the level of production of Cas12i polypeptide in a host cell. Such methods include, but are not limited to, methods using polyclonal or monoclonal antibodies specific for Cas12i polypeptide or any of the labeling tags described elsewhere herein. Exemplary methods include, but are not limited to, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (MA), fluorescent immunoassay (FIA), and fluorescence-activated cell sorting (FACS). These and other assays are well known in the art (see, for example, Maddox et al., J. Exp. Med. 158:1211
[1983] ).
[0208] The present disclosure provides a method for in vivo expression of a Cas12i polypeptide in a cell, the method comprising providing a host cell with a polyribonucleotide encoding a Cas12i polypeptide, wherein the polyribonucleotide encodes the Cas12i polypeptide, expressing the Cas12i polypeptide in the cell, and obtaining the Cas12i polypeptide from the cell.
[0209] The present disclosure further provides a method of in vivo expression of a Cas12i polypeptide in a cell, comprising providing a host cell with a polyribonucleotide encoding a Cas12i polypeptide, the polyribonucleotide encoding the Cas12i polypeptide, and expressing the Cas12i polypeptide in the cell. In some embodiments, the polyribonucleotide encoding the Cas12i polypeptide is delivered to the cell with an RNA guide, and upon expression in the cell, the Cas12i polypeptide and the RNA guide form a complex. In some embodiments, the polyribonucleotide encoding the Cas12i polypeptide and the RNA guide are delivered to the cell in a single composition. In some embodiments, the polyribonucleotide encoding the Cas12i polypeptide and the RNA guide are contained in separate compositions. In some embodiments, the host cell is present in a subject, e.g., a human patient.
[0210] C. complex In some embodiments, the RNA guide targeting HAO1 is complexed with a Cas12i polypeptide to form a ribonucleoprotein. In some embodiments, the complexation of the RNA guide with the Cas12i polypeptide occurs at a temperature lower than about any one of 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, 37°C, 38°C, 39°C, 40°C, 41°C, 42°C, 43°C, 44°C, 45°C, 50°C, or 55°C. In some embodiments, the RNA guide does not dissociate from the Cas12i polypeptide over an incubation period of at least about any one of 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, or 4 hours or more at about 37°C.
[0211] In some embodiments, the RNA guide and the Cas12i polypeptide are complexed in a complexation buffer. In some embodiments, the Cas12i polypeptide is stored in a buffer, and the buffer is replaced with a complexation buffer, and the Cas12i polypeptide is complexed with the RNA guide. In some embodiments, the Cas12i polypeptide is stored in a complexation buffer.
[0212] In some embodiments, the complex formation buffer has a pH in the range of about 7.3 to 8.6. In one embodiment, the pH of the complex formation buffer is about 7.3. In one embodiment, the pH of the complex formation buffer is about 7.4. In one embodiment, the pH of the complex formation buffer is about 7.5. In one embodiment, the pH of the complex formation buffer is about 7.6. In one embodiment, the pH of the complex formation buffer is about 7.7. In one embodiment, the pH of the complex formation buffer is about 7.8. In one embodiment, the pH of the complex formation buffer is about 7.9. In one embodiment, the pH of the complex formation buffer is about 8.0. In one embodiment, the pH of the complex formation buffer is about 8.1. In one embodiment, the pH of the complex formation buffer is about 8.2. In one embodiment, the pH of the complex formation buffer is about 8.3. In one embodiment, the pH of the complex formation buffer is about 8.4. In one embodiment, the pH of the complex formation buffer is about 8.5. In one embodiment, the pH of the complex formation buffer is about 8.6.
[0213] In some embodiments, the Cas12i polypeptide may be overexpressed in a host cell and may form a complex with an RNA guide prior to purification as described herein. In some embodiments, an mRNA or DNA encoding the Cas12i polypeptide is introduced into a cell such that the Cas12i polypeptide is expressed in the cell. In some embodiments, the RNA guide is also introduced into a cell simultaneously, separately, or sequentially with a single mRNA or DNA construct such that a ribonucleoprotein complex is formed in the cell.
[0214] III. Gene Editing Methods The present disclosure also provides a method of modifying a target site in the HAO1 gene. In some embodiments, the method includes introducing an HAO1-targeting RNA guide and a Cas12i polypeptide into a cell. The HAO1-targeting RNA guide and a Cas12i polypeptide can be introduced into a cell as a ribonucleoprotein complex. The HAO1-targeting RNA guide and a Cas12i polypeptide can be introduced on a nucleic acid vector. The Cas12i polypeptide can be introduced as an mRNA. The RNA guide can be directly introduced into a cell. In some embodiments, the compositions described herein are delivered to a cell / tissue / liver / person to reduce HAO1 in the cell / tissue / liver / person. In some embodiments, the compositions described herein are delivered to a cell / tissue / liver / person to reduce oxalate production in the cell / tissue / liver / person. In some embodiments, the compositions described herein are delivered to a cell / tissue / liver / person to correct calcium oxalate crystal deposition in the cell / tissue / liver / person. In some embodiments, the compositions described herein are delivered to a person with primary hyperoxaluria.
[0215] Any of the gene editing systems disclosed herein can be used to engineer the HAO1 gene. The gene editing system can include an RNA guide and a Cas12i2 polypeptide. The RNA guide includes a spacer sequence specific to a target sequence in the HAO1 gene, for example, a spacer sequence specific to a region within exon 1 or exon 2 of the HAO1 gene.
[0216] A. Target Sequence In some embodiments, the RNA guides disclosed herein are designed to be complementary to a target sequence adjacent to a 5'-TTN-3'PAM sequence or a 5'-NTTN-3'PAM sequence.
[0217] In some embodiments, the target sequence is within the HAO1 gene or the locus of the HAO1 gene (e.g., within exon 1 or exon 2) and the RNA guide can bind to it via base pairing. In some embodiments, the cell has only one copy of the target sequence. In some embodiments, the cell has two or more copies of the target sequence, such as at least about any one of 2, 3, 4, 5, 10, or 100 or more copies.
[0218] In some embodiments, the HAO1 gene is a mammalian gene. In some embodiments, the HAO1 gene is a human gene. For example, in some embodiments, the target sequence is within the sequence of SEQ ID NO: 928 (or its reverse complementary sequence). In some embodiments, the target sequence is within an exon of the HAO1 gene set forth in SEQ ID NO: 928, for example, within the sequence of SEQ ID NO: 929, 930, 931, 932, 933, 934, or 935 (or its reverse complementary sequence). Target sequences within the exon region of the HAO1 gene set forth in SEQ ID NO: 928 are listed in Table 5. In some embodiments, the target sequence is within an intron of the HAO1 gene set forth in SEQ ID NO: 928 (or its reverse complementary sequence). In some embodiments, the target sequence is within a variant (e.g., a polymorphic variant) of the HAO1 gene sequence set forth in SEQ ID NO: 928 (or its reverse complementary sequence). In some embodiments, the HAO1 gene sequence is a homologous sequence of the sequence set forth in SEQ ID NO: 928 (or its reverse complementary sequence). For example, in some embodiments, the HAO1 gene sequence is a non-human HAO1 sequence. In some embodiments, the HAO1 gene sequence is the coding sequence set forth in SEQ ID NO: 1024 (or a reverse complement thereof). In some embodiments, the HAO1 gene sequence is a homologous sequence of the coding sequence set forth in SEQ ID NO: 1024 (or a reverse complement thereof).
[0219] In some embodiments, the target sequence is adjacent to a 5'-TTN-3'PAM sequence or a 5'-NTTN-3'PAM sequence, where N is any nucleotide. The 5'-NTTN-3' sequence may be directly adjacent to the target sequence or may be within a small number (e.g., 1, 2, 3, 4, or 5) nucleotides of the target sequence. In some embodiments, the 5'-NTTN-3' sequence is 5'-NTTY-3', 5'-NTTC-3', 5'-NTTT-3', 5'-NTTA-3', 5'-NTTB-3', 5'-NTTG-3', 5'-CTTY-3', 5'-DTTR-3', 5'-CTTR-3', 5'-DTTT-3', 5'-ATTN-3', or 5'-GTTN-3', in which Y is C or T, B is any nucleotide except A, D is any nucleotide except C or G, and R is A or G. In some embodiments, the 5'-NTTN-3' sequence is 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3'. The PAM sequence can be 5' to the target sequence.
[0220] The 5'-NTTN-3' sequence may be immediately adjacent to the target sequence or may be within, for example, a small number (e.g., 1, 2, 3, 4, or 5) nucleotides of the target sequence. In some embodiments, the 5'-NTTN-3' sequence is 5'-NTTY-3', 5'-NTTC-3', 5'-NTTT-3', 5'-NTTA-3', 5'-NTTB-3', 5'-NTTG-3', 5'-CTTY-3', 5'-DTTR-3', 5'-CTTR-3', 5'-DTTT-3', 5'-ATTN-3', or 5'-GTTN-3', in which Y is C or T, B is any nucleotide except A, D is any nucleotide except C, and R is A or G. In some embodiments, the 5'-NTTN-3' sequence is 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3'. In some embodiments, the RNA guide is designed to bind to a first strand (i.e., the non-PAM strand) of a double-stranded target nucleic acid, and the 5'-NTTN-3' PAM sequence is present in the second, complementary strand (i.e., the PAM strand). In some embodiments, the RNA guide binds to a region on the non-PAM strand that is complementary to a target sequence on the PAM strand adjacent to the 5'-NAAN-3' sequence.
[0221] In some embodiments, the target sequence is present within a cell. In some embodiments, the target sequence is present in the nucleus of a cell. In some embodiments, the target sequence is endogenous to the cell. In some embodiments, the target sequence is genomic DNA. In some embodiments, the target sequence is chromosomal DNA. In some embodiments, the target sequence is a protein-coding gene or a functional region thereof, such as a coding region, or a regulatory element, such as a promoter, enhancer, 5' or 3' untranslated region, etc.
[0222] In some embodiments, the target sequence is within an easily accessible region of the target sequence. In some embodiments, the target sequence is within an exon of the target gene. In some embodiments, the target sequence spans an exon-intron junction of the target gene. In some embodiments, the target sequence is within a non-coding region of the gene, such as a regulatory region.
[0223] B. Gene Editing In some embodiments, the Cas12i polypeptide has enzymatic activity (e.g., nuclease activity). In some embodiments, the Cas12i polypeptide induces one or more DNA double-strand breaks in a cell. In some embodiments, the Cas12i polypeptide induces one or more DNA single-strand breaks in a cell. In some embodiments, the Cas12i polypeptide induces one or more DNA nicks in a cell. In some embodiments, the DNA breaks and / or DNA nicks result in the formation of one or more indels (e.g., one or more deletions).
[0224] In some embodiments, the RNA guide disclosed herein forms a complex with a Cas12i polypeptide and directs the Cas12i polypeptide to a target sequence adjacent to a 5'-NTTN-3' sequence. In some embodiments, the complex induces a deletion (e.g., a nucleotide deletion or a DNA deletion) adjacent to a 5'-NTTN-3' sequence. In some embodiments, the complex induces a deletion adjacent to a 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the complex induces a deletion adjacent to a T / C rich sequence.
[0225] In some embodiments, the deletion is downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion is downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion is downstream of the T / C rich sequence.
[0226] In some embodiments, the deletion alters expression of the HAO1 gene. In some embodiments, the deletion alters function of the HAO1 gene. In some embodiments, the deletion inactivates the HAO1 gene. In some embodiments, the deletion is a frameshift deletion. In some embodiments, the deletion is a non-frameshift deletion. In some embodiments, the deletion results in cytotoxicity or cell death (e.g., apoptosis).
[0227] In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of the 5'-NTTN-3' sequence. In some embodiments, deletions begin within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of the T / C rich sequence.
[0228] In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the T / C rich sequence.
[0229] In some embodiments, the deletion begins within about 5 to about 10 nucleotides (eg, about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) of the 5'-NTTN-3' sequence. In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 5 to about 10 nucleotides (eg, about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) of the T / C rich sequence.
[0230] In some embodiments, the deletion begins within about 5 to about 10 nucleotides (eg, about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 5 to about 10 nucleotides (eg, about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the T / C rich sequence.
[0231] In some embodiments, the deletion begins within about 10 to about 15 nucleotides (eg, about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of the 5'-NTTN-3' sequence. In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 10 to about 15 nucleotides (eg, about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of the T / C rich sequence.
[0232] In some embodiments, the deletion begins within about 10 to about 15 nucleotides (eg, about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 10 to about 15 nucleotides (eg, about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the T / C rich sequence.
[0233] In some embodiments, the deletion ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5'-NTTN-3' sequence. In some embodiments, the deletion ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the T / C rich sequence.
[0234] In some embodiments, the deletion ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the T / C rich sequence.
[0235] In some embodiments, the deletion ends within about 20 to about 25 nucleotides (eg, about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of the 5'-NTTN-3' sequence. In some embodiments, the deletion ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion ends within about 20 to about 25 nucleotides (eg, about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of the T / C rich sequence.
[0236] In some embodiments, the deletion ends within about 20 to about 25 nucleotides (eg, about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion ends within about 20 to about 25 nucleotides (eg, about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the T / C rich sequence.
[0237] In some embodiments, the deletion ends within about 25 to about 30 nucleotides (eg, about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5'-NTTN-3' sequence. In some embodiments, the deletion ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion ends within about 25 to about 30 nucleotides (eg, about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the T / C rich sequence.
[0238] In some embodiments, the deletion ends within about 25 to about 30 nucleotides (eg, about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the T / C rich sequence.
[0239] In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5'-NTTN-3' sequence. In some embodiments, the deletion is 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG- It starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of the 3' or 5'-CTTC-3' sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides). In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the T / C-rich sequence.
[0240] In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-NTTN-3' sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. and terminates within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the T / C-rich sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the T / C-rich sequence.
[0241] In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of the 5'-NTTN-3' sequence. In some embodiments, the deletions are 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT ... It starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of the 5'-CTTG-3' or 5'-CTTC-3' sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides). In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of the T / C-rich sequence.
[0242] In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-NTTN-3' sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion is about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the T / C rich sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the T / C rich sequence.
[0243] In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5'-NTTN-3' sequence. In some embodiments, the deletions are 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT ... It starts within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of the 5'-CTTG-3' or 5'-CTTC-3' sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides). In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the T / C-rich sequence.
[0244] In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-NTTN-3' sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion is about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 5 to about 15 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the T / C rich sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the T / C rich sequence.
[0245] In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5'-NTTN-3' sequence. In some embodiments, the deletions are 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT ... It starts within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) of the 5'-CTTG-3' or 5'-CTTC-3' sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides). In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the T / C-rich sequence.
[0246] In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the 5'-NTTN-3' sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence and terminates with the 5'-AT and terminates within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the T / C rich sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the T / C rich sequence.
[0247] In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of the 5'-NTTN-3' sequence. The deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of the TTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 5 to about 10 nucleotides and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) of the T / C rich sequence.
[0248] In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the 5'-NTTN-3' sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. and terminates within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the T / C-rich sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the T / C-rich sequence.
[0249] In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5'-NTTN-3' sequence. In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the T / C rich sequence.
[0250] In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the 5'-NTTN-3' sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. and terminates within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 5 to about 10 nucleotides (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides) downstream of the T / C rich sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the T / C rich sequence.
[0251] In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5'-NTTN-3' sequence. In some embodiments, the deletion is 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-C It starts within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of the TTG-3' or 5'-CTTC-3' sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides). In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the T / C-rich sequence.
[0252] In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-NTTN-3' sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence and ends within 5'- It terminates within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the T / C-rich sequence and ends within about 20 to about 30 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the T / C-rich sequence.
[0253] In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of the 5'-NTTN-3' sequence. In some embodiments the deletion is 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) of the 5'-CTTG-3', 5'-CTTC-3', or 5'-CTTG-3' sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) of the T / C rich sequence.
[0254] In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-NTTN-3' sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion is within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the T / C-rich sequence and ends within about 20 to about 25 nucleotides (e.g., about 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides) downstream of the T / C-rich sequence.
[0255] In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the 5'-NTTN-3' sequence. In some embodiments the deletion is 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) of the T / C-rich sequence.
[0256] In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-NTTN-3' sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-NTTN-3' sequence. In some embodiments, the deletion is within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3' sequence. In some embodiments, the deletion begins within about 10 to about 15 nucleotides (e.g., about 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides) downstream of the T / C-rich sequence and ends within about 25 to about 30 nucleotides (e.g., about 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, or 33 nucleotides) downstream of the T / C-rich sequence.
[0257] In some embodiments, the deletion is up to about 40 nucleotides in length (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides). In some embodiments, the deletion is about 4 nucleotides to about 40 nucleotides in length (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides). In some embodiments, the deletion is about 4 nucleotides to about 25 nucleotides in length (e.g., about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides). In some embodiments, the deletion is about 10 to about 25 nucleotides in length (e.g., about 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 nucleotides). In some embodiments, the deletion is about 10 to about 15 nucleotides in length (e.g., about 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 nucleotides).
[0258] In some embodiments, the methods described herein are used to engineer cells containing the deletions described herein in the HAO1 gene. In some embodiments, the methods are performed using a complex comprising a Cas12i enzyme described herein and an RNA guide comprising a direct repeat and a spacer described herein. In some embodiments, the sequence of the RNA guide has at least 90% identity (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity) to any one of SEQ ID NOs: 967-1023. In some embodiments, the RNA guide has a sequence of any one of SEQ ID NOs: 967-1023.
[0259] In some embodiments, the RNA guide targeting HAO1 is encoded in a plasmid. In some embodiments, the RNA guide targeting HAO1 is synthetic or purified RNA. In some embodiments, the Cas12i polypeptide is encoded in a plasmid. In some embodiments, the Cas12i polypeptide is encoded by RNA, and the RNA is synthetic or purified.
[0260] C. Delivery Any of the components of the gene editing system disclosed herein can be formulated, for example, with a carrier, such as a carrier and / or polymeric carrier, for example, a liposome, and delivered to cells (e.g., prokaryotes, eukaryotes, plants, mammals, etc.) by known methods, including, but not limited to, transfection (e.g., lipid-mediated, cationic polymers, calcium phosphate, dendrimers), electroporation or other methods of membrane disruption (e.g., nucleofection), viral delivery (e.g., lentivirus, retrovirus, adenovirus, adeno-associated virus (AAV)), microinjection, biolistic projectiles ("gene guns"), fugene, direct sonic loading, cell squeezing, phototransfection, protoplast fusion, imparefection, magnetofection, exome-mediated transfer, lipid nanoparticle-mediated transfer, and any combination thereof.
[0261] In some embodiments, the method includes delivering one or more nucleic acids (e.g., nucleic acids encoding a Cas12i polypeptide, an RNA guide, donor DNA, etc.), one or more transcripts thereof, and / or a preformed RNA guide / Cas12i polypeptide complex to a cell, where a ternary complex is formed. In some embodiments, the RNA guide and the RNA encoding the Cas12i polypeptide are delivered together in a single composition. In some embodiments, the RNA guide and the RNA encoding the Cas12i polypeptide are delivered in separate compositions. In some embodiments, the RNA guide and the RNA encoding the Cas12i polypeptide delivered in separate compositions are delivered using the same delivery technology. In some embodiments, the RNA guide and the RNA encoding the Cas12i polypeptide delivered in separate compositions are delivered using different delivery technologies. Exemplary intracellular delivery methods include, but are not limited to, viruses, such as AAV, or virus-like agents; chemical-based transfection methods, such as those using calcium phosphate, dendrimers, liposomes, lipid nanoparticles, or cationic polymers (e.g., DEAE-dextran or polyethyleneimine); non-chemical methods, such as microinjection, electroporation, cell squeezing, sonoporation, phototransfection, imparefection, protoplast fusion, bacterial conjugation, plasmid or transposon delivery; particle-based methods, such as gene guns, magnetofection or magnetically assisted transfection, the use of particle guns; and hybrid methods, such as nucleofection. In some embodiments, the lipid nanoparticles comprise an mRNA encoding a Cas12i polypeptide, an RNA guide, or an mRNA and an RNA guide encoding a Cas12i polypeptide. In some embodiments, the mRNA encoding a Cas12i polypeptide is a transcript of the nucleotide sequence set forth in SEQ ID NO: 921 or SEQ ID NO: 955, or a variant thereof.In some embodiments, the application further provides cells produced by such methods, and organisms (eg, animals, plants, or fungi) that contain or are produced from such cells.
[0262] D. Genetically Modified Cells Any of the gene editing systems disclosed herein can be delivered to a variety of cells. In some embodiments, the cell is an isolated cell. In some embodiments, the cell is in cell culture or a co-culture of two or more cell types. In some embodiments, the cell is ex vivo. In some embodiments, the cell is obtained from a living organism and maintained in cell culture. In some embodiments, the cell is a single-cell organism.
[0263] In some embodiments, the cell is a prokaryotic cell. In some embodiments, the cell is a bacterial cell or is derived from a bacterial cell. In some embodiments, the cell is an archaeal cell or is derived from an archaeal cell.
[0264] In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is or is derived from a plant cell. In some embodiments, the cell is or is derived from a fungal cell. In some embodiments, the cell is or is derived from an animal cell. In some embodiments, the cell is or is derived from an invertebrate cell. In some embodiments, the cell is or is derived from a vertebrate cell. In some embodiments, the cell is or is derived from a mammalian cell. In some embodiments, the cell is or is derived from a mammalian cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is a zebrafish cell. In some embodiments, the cell is a rodent cell. In some embodiments, the cell is synthetically produced, often referred to as an artificial cell.
[0265] In some embodiments, the cells are derived from a cell line. A wide variety of cell lines for tissue culture are known in the art. Examples of cell lines include, but are not limited to, 293T, MF7, K562, HeLa, CHO, and transgenic variants thereof. Cell lines are available from a variety of sources known to those skilled in the art (see, for example, American Type Culture Collection (ATCC) (Manassas, Va.)). In some embodiments, the cells are immortal or immortalized cells.
[0266] In some embodiments, the cell is a primary cell. In some embodiments, the cell is a stem cell, such as a totipotent stem cell (e.g., allopotent), pluripotent stem cell, multipotent stem cell, oligopotent stem cell, or unipotent stem cell. In some embodiments, the cell is an induced pluripotent stem cell (iPSC) or is derived from an iPSC. In some embodiments, the cell is a differentiated cell. For example, in some embodiments, the differentiated cell is a liver cell (e.g., hepatocyte), a biliary cell (e.g., a cholangiocyte), a stellate cell, a Kupffer cell, a hepatic sinusoidal endothelial cell, a muscle cell (e.g., a myocyte), a fat cell (e.g., an adipocyte), a bone cell (e.g., an osteoblast, an osteocyte, an osteoclast), a blood cell (e.g., a monocyte, a lymphocyte, a neutrophil, an eosinophil, a basophil, a macrophage, an erythrocyte, or a platelet), a neural cell (e.g., a neuron), an epithelial cell, an immune cell (e.g., a lymphocyte, a neutrophil, a monocyte, or a macrophage), a fibroblast, or a sex cell. In some embodiments, the cell is a terminally differentiated cell. For example, in some embodiments, the terminally differentiated cell is a neuronal cell, an adipocyte, a cardiac muscle cell, a skeletal muscle cell, an epidermal cell, or an intestinal cell. In some embodiments, the cell is an immune cell. In some embodiments, the immune cell is a T cell. In some embodiments, the immune cell is a B cell. In some embodiments, the immune cell is a natural killer (NK) cell. In some embodiments, the immune cell is a tumor infiltrating lymphocyte (TIL). In some embodiments, the cell is a mammalian cell, e.g., a human cell or a mouse cell. In some embodiments, the mouse cell is from a wild type mouse, an immunosuppressed mouse, or a disease-specific mouse model. In some embodiments, the cell is a cell within a living tissue, organ, or organism.
[0267] Also within the scope of the present disclosure are any of the genetically modified cells produced using any of the gene editing systems disclosed herein. Such modified cells may contain a disrupted HAO1 gene.
[0268] The compositions, vectors, nucleic acids, RNA guides, and cells disclosed herein may be used in therapy. The compositions, vectors, nucleic acids, RNA guides, and cells disclosed herein may be used in methods of treating a disease or condition in a subject. In some embodiments, the disease or condition is Any suitable delivery or administration method known in the art may be used to deliver the compositions, vectors, nucleic acids, RNA guides, and cells disclosed herein. Such methods may include contacting a target sequence with a composition, vector, nucleic acid, or RNA guide disclosed herein. Such methods may include a method of editing the HAO1 sequence disclosed herein. In some embodiments, cells engineered using the RNA guides disclosed herein are used for ex vivo gene therapy.
[0269] IV. Therapeutic uses Any of the gene editing systems disclosed herein or modified cells produced using such gene editing systems can be used to treat diseases associated with the HAO1 gene, such as primary hyperoxaluria (PH). In some embodiments, the PH is PH1, PH2, or PH3. In a specific example, the target disease is PH1.
[0270] Any of the gene editing systems, pharmaceutical compositions or kits comprising such gene editing systems, and RNA guides disclosed herein can be used to treat primary hyperoxaluria (PH) in a subject. PH is a rare genetic disorder that affects subjects of all ages, from infants to the elderly. PH includes three subtypes, which are related to genetic defects that alter the expression of three different proteins. PH1 is related to alanine dioxylate aminotransferase or AGT / AGT1. PH2 is related to glyoxylate / hydroxypyruvate reductase or GR / HPR, and PH3 is related to 4-hydroxy-2-oxoglutarate aldolase or HOGA.
[0271] In PH1, excess oxalate can also combine with calcium to form calcium oxalate in the kidneys and other organs. Calcium oxalate deposition can result in widespread accumulation of calcium oxalate (nephrocalcinosis) or formation of kidney and bladder stones (urolithiasis), causing kidney damage. Common kidney complications in PH1 include blood in the urine (hematuria), urinary tract infections, kidney damage, and end-stage renal disease (ESRD). Over time, the kidneys of patients with PH1 begin to fail and levels of oxalate may rise in the blood. Deposition of oxalate in tissues throughout the body, such as systemic oxalosis, can occur due to high blood oxalate levels and can lead to complications in the bones, skin, and eyes. Patients with PH1 usually suffer from kidney failure at a young age, with renal dialysis or dual kidney / liver organ transplants being the only treatment options.
[0272] In some embodiments, provided herein is a method for treating a target disease disclosed herein (e.g., PH, e.g., PH1), comprising administering any of the gene editing systems disclosed herein to a subject (e.g., a human patient) in need of treatment. The gene editing system can be delivered to a specific tissue or specific cell type where gene editing is required. The gene editing system can include a LNP, which includes one or more of the components, one or more vectors (e.g., viral vectors) encoding one or more of the components, or a combination thereof. The components of the gene editing system can be formulated to form a pharmaceutical composition, which can further include one or more pharma- ceutically acceptable carriers.
[0273] In some embodiments, modified cells produced using any of the gene editing systems disclosed herein can be administered to a subject (e.g., a human patient) in need of treatment. The modified cells can include substitutions, insertions, and / or deletions as described herein. In some examples, the modified cells can include cell lines modified with CRISPR nucleases, reverse transcriptase polypeptides, and edited template RNAs (e.g., RNA guides and RT donor RNAs). In some cases, the modified cells can be a heterogeneous population, the heterogeneous population including cells with different types of gene edits. Alternatively, the modified cells can include a substantially homogeneous cell population (e.g., at least 80% of the cells in the total population), the substantially homogeneous cell population including one particular gene edit in the HAO1 gene. In some examples, the cells can be suspended in a suitable medium.
[0274] In some embodiments, compositions comprising gene editing systems or components thereof are provided herein. Such compositions can be pharmaceutical compositions. Useful pharmaceutical compositions can be prepared, packaged, or sold in formulations suitable for oral, rectal, vaginal, parenteral, topical, pulmonary, intranasal, intralesional, buccal, ocular, intravenous, intravisceral, or another route of administration. Pharmaceutical compositions of the present disclosure can be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a "unit dose" refers to a discrete amount of a pharmaceutical composition (e.g., gene editing system or components thereof) administered to a subject, or a convenient fraction of such a dose, such as, for example, a half or a third of such a dose.
[0275] In some embodiments, a pharmaceutical composition comprising the gene editing system or components thereof described herein may be administered to a subject in need thereof, for example, a subject suffering from a liver disease associated with the HAO1 gene. In some cases, the gene editing system or components thereof may be delivered to specific cells or tissues (e.g., liver cells), and the gene editing system may function to genetically modify the HAO1 gene in such cells.
[0276] A formulation of a pharmaceutical composition suitable for parenteral administration may include an active agent (e.g., a gene editing system or its components, or modified cells) combined with a pharma- ceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such a formulation may be prepared, packaged, or sold in a form suitable for bolus administration or continuous administration. Some injectable formulations may be prepared, packaged, or sold in unit dosage form, for example, in ampoules or multi-dose containers containing a preservative. Some formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Some formulations may further include one or more additional ingredients, including, but not limited to, suspending agents, stabilizing agents, or dispersing agents.
[0277] The pharmaceutical composition may be in the form of a sterile injectable aqueous or oily suspension or solution. The suspension or solution may be formulated by known techniques and may contain, in addition to the cells, additional components such as dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using non-toxic parenterally acceptable diluents or solvents, such as water or saline. Other acceptable diluents and solvents include, but are not limited to, Ringer's solution, isotonic saline, and fixed oils, such as synthetic mono- or diglycerides. Other parentally administrable formulations that are useful include those that may contain the cells in packaged form, in liposomal preparations, or as a component of a biodegradable polymer system. Some compositions for sustained release or implantation may contain pharma-ceutically acceptable polymers or hydrophobic materials, such as emulsions, ion exchange resins, poorly soluble polymers, or poorly soluble salts.
[0278] V. KITS AND THEIR USES The present disclosure also provides kits that can be used to carry out the methods described herein, for example, for genetic modification of the HAO1 gene. In some embodiments, the kits include an RNA guide and a Cas12i polypeptide. In some embodiments, the kits include a polynucleotide encoding such a Cas12i polypeptide, and optionally the polynucleotide is contained in a vector, for example, a vector described herein. The Cas12i polypeptide (e.g., as a ribonucleoprotein) and the RNA guide can be packaged in the same or other containers in the kit or system, or in separate vials or other containers, and their contents can be mixed before use. In addition, the kits can optionally include buffers and / or instructions for use of the RNA guide and the Cas12i polypeptide.
[0279] In some embodiments, the kits may be useful for research purposes, for example, in some embodiments, the kits may be useful for studying gene function.
[0280] All references and publications cited herein are hereby incorporated by reference.
[0281] Additional Embodiments Additional embodiments are provided below and are also within the scope of the present disclosure.
[0282] Embodiment 1: A composition comprising an RNA guide, the RNA guide comprising (i) a spacer sequence that is substantially complementary or fully complementary to a region on the non-PAM strand in the HAO1 gene (the complementary sequence of the target sequence), and (ii) a direct repeat sequence, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM), and the PAM comprises the sequence 5'-NTTN-3'.
[0283] In embodiment 1, the target sequence can be within exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the HAO1 gene. In some examples, the HAO1 gene comprises the sequence of SEQ ID NO:928, the reverse complement of SEQ ID NO:928, a variant of SEQ ID NO:928, or the reverse complement of the variant of SEQ ID NO:928.
[0284] In embodiment 1, the spacer sequence is selected from the group consisting of: (a) nucleotides 1 to 16 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (b) nucleotides 1 to 17 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (c) nucleotides 1 to 18 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; and (d) nucleotides 1 to 19 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920. (e) nucleotides 1 to 20 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (f) nucleotides 1 to 21 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (g) nucleotides 1 to 22 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (h) any one of SEQ ID NOs: 466 to 920 (i) nucleotides 1 to 24 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (j) nucleotides 1 to 25 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (k) nucleotides 1 to 26 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (l) nucleotides 1 to 27 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920 The sequence may include (a) nucleotides 1 to 27 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920, (b) nucleotides 1 to 28 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920, (c) nucleotides 1 to 29 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920, or (d) nucleotides 1 to 30 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920.
[0285] In any of the compositions of embodiment 1, the spacer sequence is selected from the group consisting of: (a) nucleotides 1 to 16 of any one of SEQ ID NOs: 466 to 920; (b) nucleotides 1 to 17 of any one of SEQ ID NOs: 466 to 920; (c) nucleotides 1 to 18 of any one of SEQ ID NOs: 466 to 920; (d) nucleotides 1 to 19 of any one of SEQ ID NOs: 466 to 920; (e) nucleotides 1 to 20 of any one of SEQ ID NOs: 466 to 920; (f) nucleotides 1 to 21 of any one of SEQ ID NOs: 466 to 920; (g) nucleotides 1 to 22 of any one of SEQ ID NOs: 466 to 920; (h) SEQ ID NO: 46 (i) nucleotides 1 to 23 of any one of SEQ ID NOs: 466 to 920, (j) nucleotides 1 to 25 of any one of SEQ ID NOs: 466 to 920, (k) nucleotides 1 to 26 of any one of SEQ ID NOs: 466 to 920, (l) nucleotides 1 to 27 of any one of SEQ ID NOs: 466 to 920, (m) nucleotides 1 to 28 of any one of SEQ ID NOs: 466 to 920, (n) nucleotides 1 to 29 of any one of SEQ ID NOs: 466 to 920, or (o) nucleotides 1 to 30 of any one of SEQ ID NOs: 466 to 920.
[0286] In any of the compositions of embodiment 1, the direct repeat sequence may be any of the following: (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (h) nucleotides 8 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8. (i) nucleotides 9 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (m) SEQ ID NO: (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 1 to 8; (o) nucleotides 1 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 9; (p) nucleotides 2 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 9; (q) nucleotides 3 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 9;(r) nucleotides 4 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (s) nucleotides 5 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (t) nucleotides 6 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (u) nucleotides 7 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (v) nucleotides 8 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (w) nucleotides 9 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (x) nucleotides 10 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (y) nucleotides 11 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (z) nucleotides 12 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, or (aa) a sequence that is at least 90% identical to the sequence of SEQ ID NO:10 or a portion thereof.
[0287] In some examples, the direct repeat sequence is selected from the group consisting of: (a) nucleotide 1 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (b) nucleotide 2 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (c) nucleotide 3 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (d) nucleotide 4 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (e) nucleotide 5 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (f) nucleotide 6 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (g) nucleotide 7 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (h) nucleotide 8 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (i) nucleotide 9 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (j) nucleotide 10 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (k) nucleotide 11 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (l) SEQ ID NO: (i) nucleotides 12 to 36 of any one of SEQ ID NOs: 1 to 8, (m) nucleotides 13 to 36 of any one of SEQ ID NOs: 1 to 8, (n) nucleotides 14 to 36 of any one of SEQ ID NOs: 1 to 8, (o) nucleotides 1 to 34 of SEQ ID NO: 9, (p) nucleotides 2 to 34 of SEQ ID NO: 9, (q) nucleotides 3 to 34 of SEQ ID NO: 9, (r) nucleotides 4 to 34 of SEQ ID NO: 9, (s) nucleotides 5 to 34 of SEQ ID NO: 9, (t) nucleotides 6 to 34 of SEQ ID NO: 9, (u) nucleotides 7 to 34 of SEQ ID NO: 9, (v) nucleotides 8 to 34 of SEQ ID NO: 9, (w) nucleotides 9 to 34 of SEQ ID NO: 9, (x) nucleotides 10 to 34 of SEQ ID NO: 9, (y) nucleotides 11 to 34 of SEQ ID NO: 9, (z) nucleotides 12 to 34 of SEQ ID NO: 9, (or aa) SEQ ID NO: 10 or a part thereof).
[0288] In some examples, the direct repeat sequence is selected from the group consisting of (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (h) nucleotides 9 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, 3, (i) nucleotides 9 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953, (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953, (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953, (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953, (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953, (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953, or (o) a sequence that is at least 90% identical to the sequence of SEQ ID NO: 954 or a portion thereof.
[0289] In some examples, the direct repeat sequence is: (a) nucleotide 1 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (b) nucleotide 2 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (c) nucleotide 3 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (d) nucleotide 4 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (e) nucleotide 5 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (f) nucleotide 6 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (g) nucleotide 7 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (h) (i) nucleotides 8 to 36 of any one of SEQ ID NOs: 936 to 953; (j) nucleotides 10 to 36 of any one of SEQ ID NOs: 936 to 953; (k) nucleotides 11 to 36 of any one of SEQ ID NOs: 936 to 953; (l) nucleotides 12 to 36 of any one of SEQ ID NOs: 936 to 953; (m) nucleotides 13 to 36 of any one of SEQ ID NOs: 936 to 953; (n) nucleotides 14 to 36 of any one of SEQ ID NOs: 936 to 953; (or o) SEQ ID NO: 954 or a portion thereof.
[0290] In some examples, the direct repeat sequence is selected from the group consisting of: (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959; (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959; (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959; (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959; (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959; (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959; (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959; (h) nucleotides 8 to 8 of a sequence that is at least 90% identical to SEQ ID NO:959; (i) nucleotides 9 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959, (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959, (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959, (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959, (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959, (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959, or (o) a sequence that is at least 90% identical to SEQ ID NO: 960 or SEQ ID NO: 961, or a portion thereof.
[0291] In some examples, the direct repeat sequence is: (a) nucleotide 1 to nucleotide 36 of SEQ ID NO:959, (b) nucleotide 2 to nucleotide 36 of SEQ ID NO:959, (c) nucleotide 3 to nucleotide 36 of SEQ ID NO:959, (d) nucleotide 4 to nucleotide 36 of SEQ ID NO:959, (e) nucleotide 5 to nucleotide 36 of SEQ ID NO:959, (f) nucleotide 6 to nucleotide 36 of SEQ ID NO:959, (g) nucleotide 7 to nucleotide 36 of SEQ ID NO:959, (h) SEQ ID NO:95 (i) nucleotides 8 to 36 of SEQ ID NO:959, (j) nucleotides 10 to 36 of SEQ ID NO:959, (k) nucleotides 11 to 36 of SEQ ID NO:959, (l) nucleotides 12 to 36 of SEQ ID NO:959, (m) nucleotides 13 to 36 of SEQ ID NO:959, (n) nucleotides 14 to 36 of SEQ ID NO:959, or (o) SEQ ID NO:960 or SEQ ID NO:961, or a portion thereof).
[0292] In some examples, the direct repeat sequence is selected from the group consisting of (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (h) nucleotides 8 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963. (i) nucleotides 9 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963. (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963; (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963; (o) nucleotides 15 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963; or (p) a sequence that is at least 90% identical to the sequence of SEQ ID NO:964 or a portion thereof.
[0293] In some examples, the direct repeat sequence is: (a) nucleotide 1 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (b) nucleotide 2 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (c) nucleotide 3 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (d) nucleotide 4 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (e) nucleotide 5 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (f) nucleotide 6 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (g) nucleotide 7 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (h) nucleotide 8 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (i) nucleotides 8 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (j) nucleotides 10 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (k) nucleotides 11 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (l) nucleotides 12 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (m) nucleotides 13 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (n) nucleotides 14 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (o) nucleotides 15 to 36 of SEQ ID NO:962 or SEQ ID NO:963, or (p) SEQ ID NO:964 or a portion thereof).
[0294] In some examples, the spacer sequence is substantially complementary or completely complementary to the complementary sequence of any one of SEQ ID NOs: 11-465.
[0295] In any of the compositions of embodiment 1, the PAM may comprise the sequence 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3'.
[0296] In some instances, the target sequence is immediately adjacent to the PAM sequence.
[0297] In some instances, the RNA guide has a sequence that is at least 90% identical to any one of SEQ ID NOs: 967-1023.
[0298] In some examples, the RNA guide has the sequence of any one of SEQ ID NOs: 967-1023.
[0299] Embodiment 2: The composition of embodiment 1 may further comprise a Cas12i polypeptide or a polyribonucleotide encoding a Cas12i polypeptide, which may be one of the following: (a) a Cas12i2 polypeptide comprising a sequence at least 90% identical to the sequence of SEQ ID NO:922, SEQ ID NO:923, SEQ ID NO:924, SEQ ID NO:925, SEQ ID NO:926, or SEQ ID NO:927; (b) a Cas12i4 polypeptide comprising a sequence at least 90% identical to the sequence of SEQ ID NO:956, SEQ ID NO:957, or SEQ ID NO:958; (c) a Cas12i1 polypeptide comprising a sequence at least 90% identical to the sequence of SEQ ID NO:965; or (d) a Cas12i3 polypeptide comprising a sequence at least 90% identical to the sequence of SEQ ID NO:966.
[0300] In specific examples, the Cas12i polypeptide is (a) a Cas12i2 polypeptide comprising the sequence of SEQ ID NO:922, SEQ ID NO:923, SEQ ID NO:924, SEQ ID NO:925, SEQ ID NO:926, or SEQ ID NO:927; (b) a Cas12i4 polypeptide comprising the sequence of SEQ ID NO:956, SEQ ID NO:957, or SEQ ID NO:958; (c) a Cas12i1 polypeptide comprising the sequence of SEQ ID NO:965; or (d) a Cas12i3 polypeptide comprising the sequence of SEQ ID NO:966.
[0301] In any of the compositions of embodiment 2, the RNA guide and the Cas12i polypeptide may form a ribonucleoprotein complex. In some examples, the ribonucleoprotein complex binds to a target nucleic acid. In some examples, the composition is present in a cell.
[0302] In any of the compositions of embodiment 2, the RNA guide and the Cas12i polypeptide may be encoded in a vector, for example, an expression vector. In some examples, the RNA guide and the Cas12i polypeptide are encoded in a single vector. In other examples, the RNA guide is encoded in a first vector and the Cas12i polypeptide is encoded in a second vector.
[0303] Embodiment 3: A vector system comprising one or more vectors, wherein the one or more vectors encode an RNA guide and a Cas12i polypeptide as disclosed herein. In some examples, the vector system comprises a first vector encoding an RNA guide as disclosed herein and a second vector encoding a Cas12i polypeptide. The vectors may be expression vectors.
[0304] Embodiment 4: A composition comprising an RNA guide and a Cas12i polypeptide, wherein the RNA guide comprises (i) a spacer sequence that is substantially complementary or fully complementary to a region on the non-PAM strand in the HAO1 gene (the complementary sequence of the target sequence), and (ii) a direct repeat sequence.
[0305] In some examples, the target sequence is within exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the HAO1 gene, and the HAO1 gene may comprise the sequence of SEQ ID NO: 928, the reverse complement of SEQ ID NO: 928, a variant of the sequence of SEQ ID NO: 928, or the reverse complement of the variant of SEQ ID NO: 928.
[0306] In some examples, the spacer sequence is selected from the group consisting of: (a) nucleotides 1 to 16 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466-920; (b) nucleotides 1 to 17 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466-920; (c) nucleotides 1 to 18 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466-920; (d) nucleotides 1 to 19 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466-920. (e) nucleotides 1 to 19 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (f) nucleotides 1 to 21 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (g) nucleotides 1 to 22 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (h) nucleotides 1 to 23 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (i) nucleotides 1 to 24 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 466 to 920; (j) nucleotides 1 to 25 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 466 to 920; (k) nucleotides 1 to 26 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 466 to 920; (l) nucleotides 1 to 27 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 466 to 920; (m) nucleotides 1 to 28 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 466 to 920; (n) nucleotides 1 to 29 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 466 to 920; or (o) nucleotides 1 to 30 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 466 to 920.
[0307] In some examples, the spacer sequence is selected from the group consisting of: (a) nucleotides 1 to 16 of any one of SEQ ID NOs: 466-920; (b) nucleotides 1 to 17 of any one of SEQ ID NOs: 466-920; (c) nucleotides 1 to 18 of any one of SEQ ID NOs: 466-920; (d) nucleotides 1 to 19 of any one of SEQ ID NOs: 466-920; (e) nucleotides 1 to 20 of any one of SEQ ID NOs: 466-920; (f) nucleotides 1 to 21 of any one of SEQ ID NOs: 466-920; (g) nucleotides 1 to 22 of any one of SEQ ID NOs: 466-920; 0, (i) nucleotides 1 to 24 of any one of SEQ ID NOs: 466 to 920, (j) nucleotides 1 to 25 of any one of SEQ ID NOs: 466 to 920, (k) nucleotides 1 to 26 of any one of SEQ ID NOs: 466 to 920, (l) nucleotides 1 to 27 of any one of SEQ ID NOs: 466 to 920, (m) nucleotides 1 to 28 of any one of SEQ ID NOs: 466 to 920, (n) nucleotides 1 to 29 of any one of SEQ ID NOs: 466 to 920, or (o) nucleotides 1 to 30 of any one of SEQ ID NOs: 466 to 920.
[0308] In some examples, the direct repeat sequence is selected from the group consisting of (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (h) nucleotides 8 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (i) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (ii) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (iii) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (iv) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (v) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (vi) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 i) nucleotides 9 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (o) nucleotides 1 to 34 of a sequence that is at least 90% identical to SEQ ID NO: 9; (p) nucleotides 2 to 34 of a sequence that is at least 90% identical to SEQ ID NO: 9; (q) nucleotides 3 to 34 of a sequence that is at least 90% identical to SEQ ID NO: 9;(r) nucleotides 4 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (s) nucleotides 5 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (t) nucleotides 6 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (u) nucleotides 7 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (v) nucleotides 8 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (w) nucleotides 9 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (x) nucleotides 10 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (y) nucleotides 11 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (z) nucleotides 12 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, or (aa) a sequence that is at least 90% identical to the sequence of SEQ ID NO:10 or a portion thereof.
[0309] In some examples, the direct repeat sequence is selected from the group consisting of: (a) nucleotide 1 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (b) nucleotide 2 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (c) nucleotide 3 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (d) nucleotide 4 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (e) nucleotide 5 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (f) nucleotide 6 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (g) nucleotide 7 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (h) nucleotide 8 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (i) nucleotide 9 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (j) nucleotide 10 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (k) nucleotide 11 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (m) nucleotides 13 to 36 of any one of SEQ ID NOs: 1 to 8, (n) nucleotides 14 to 36 of any one of SEQ ID NOs: 1 to 8, (o) nucleotides 1 to 34 of SEQ ID NO: 9, (p) nucleotides 2 to 34 of SEQ ID NO: 9, (q) nucleotides 3 to 34 of SEQ ID NO: 9, (r) nucleotides 4 to 34 of SEQ ID NO: 9, (s) nucleotides 5 to 34 of SEQ ID NO: 9, (t) nucleotides 6 to 34 of SEQ ID NO: 9, (u) nucleotides 7 to 34 of SEQ ID NO: 9, (v) nucleotides 8 to 34 of SEQ ID NO: 9, (w) nucleotides 9 to 34 of SEQ ID NO: 9, (x) nucleotides 10 to 34 of SEQ ID NO: 9, (y) nucleotides 11 to 34 of SEQ ID NO: 9, (z) nucleotides 12 to 34 of SEQ ID NO: 9, or (aa) SEQ ID NO: 10 or a portion thereof.
[0310] In some examples, the direct repeat sequence is selected from the group consisting of (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (h) nucleotides 8 to 8 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (i) nucleotides 9 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (ii) nucleotides 10 to 12 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (iii) nucleotides 13 to 14 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (iv) nucleotides 15 to 16 of a sequence that is at least 9 (i) nucleotides 8 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; or (o) a sequence that is at least 90% identical to the sequence of SEQ ID NO: 954 or a portion thereof.
[0311] In some examples, the direct repeat sequence is: (a) nucleotide 1 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (b) nucleotide 2 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (c) nucleotide 3 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (d) nucleotide 4 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (e) nucleotide 5 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (f) nucleotide 6 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (g) nucleotide 7 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (h) (i) nucleotides 8 to 36 of any one of SEQ ID NOs: 936 to 953; (j) nucleotides 10 to 36 of any one of SEQ ID NOs: 936 to 953; (k) nucleotides 11 to 36 of any one of SEQ ID NOs: 936 to 953; (l) nucleotides 12 to 36 of any one of SEQ ID NOs: 936 to 953; (m) nucleotides 13 to 36 of any one of SEQ ID NOs: 936 to 953; (n) nucleotides 14 to 36 of any one of SEQ ID NOs: 936 to 953; or (o) SEQ ID NO: 954 or a portion thereof.
[0312] In some embodiments, the direct repeat sequence comprises: (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959; (h) nucleotides 8 to 8 of a sequence that is at least 90% identical to SEQ ID NO: 959; (i) nucleotides 9 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959, (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959, (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959, (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959, (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959, (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to SEQ ID NO: 959, or (o) a sequence that is at least 90% identical to SEQ ID NO: 960 or SEQ ID NO: 961, or a portion thereof.
[0313] In some examples, the direct repeat sequence comprises (a) nucleotides 1 to 36 of SEQ ID NO:959, (b) nucleotides 2 to 36 of SEQ ID NO:959, (c) nucleotides 3 to 36 of SEQ ID NO:959, (d) nucleotides 4 to 36 of SEQ ID NO:959, (e) nucleotides 5 to 36 of SEQ ID NO:959, (f) nucleotides 6 to 36 of SEQ ID NO:959, (g) nucleotides 7 to 36 of SEQ ID NO:959, (h) nucleotides 8 to 36 of SEQ ID NO:959, (i) nucleotides 9 to 36 of SEQ ID NO:959, (j) nucleotides 10 to 36 of SEQ ID NO:959, (k) nucleotides 11 to 36 of SEQ ID NO:959, (l) nucleotides 12 to 36 of SEQ ID NO:959, (m) nucleotides 13 to 36 of SEQ ID NO:959, (n) nucleotides 14 to 36 of SEQ ID NO:959, or (o) SEQ ID NO:960 or SEQ ID NO:961, or a portion thereof.
[0314] In some examples, the direct repeat sequence is selected from the group consisting of (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (h) nucleotides 8 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963. (i) nucleotides 9 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963. (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (o) nucleotides 15 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; or (p) a sequence that is at least 90% identical to the sequence of SEQ ID NO: 964 or a portion thereof.
[0315] In some examples, the direct repeat sequence is: (a) nucleotide 1 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (b) nucleotide 2 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (c) nucleotide 3 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (d) nucleotide 4 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (e) nucleotide 5 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (f) nucleotide 6 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (g) nucleotide 7 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (h) nucleotide 8 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (i) nucleotides 9 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (j) nucleotides 10 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (k) nucleotides 11 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (l) nucleotides 12 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (m) nucleotides 13 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (n) nucleotides 14 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (o) nucleotides 15 to 36 of SEQ ID NO:962 or SEQ ID NO:963, or (p) SEQ ID NO:964 or a portion thereof.
[0316] In any of the compositions of embodiment 4, the spacer sequence may be substantially complementary or completely complementary to the complementary sequence of any one of SEQ ID NOs: 11-465.
[0317] In some instances, the target sequence is adjacent to a protospacer adjacent motif (PAM), and the PAM comprises the sequence 5'-NTTN-3'. In some instances, the PAM comprises the sequence 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3'.
[0318] In some cases, the target sequence is immediately adjacent to the PAM sequence. In some cases, the target sequence is within 1, 2, 3, 4, or 5 nucleotides of the PAM sequence.
[0319] In any of the compositions of embodiment 4, the Cas12i polypeptide is (a) a Cas12i2 polypeptide comprising a sequence at least 90% identical to the sequence of SEQ ID NO:922, SEQ ID NO:923, SEQ ID NO:924, SEQ ID NO:925, SEQ ID NO:926, or SEQ ID NO:927; (b) a Cas12i4 polypeptide comprising a sequence at least 90% identical to the sequence of SEQ ID NO:956, SEQ ID NO:957, or SEQ ID NO:958; (c) a Cas12i1 polypeptide comprising a sequence at least 90% identical to the sequence of SEQ ID NO:965; (or (d) a Cas12i3 polypeptide comprising a sequence at least 90% identical to the sequence of SEQ ID NO:966.
[0320] In some examples, the Cas12i polypeptide is (a) a Cas12i2 polypeptide comprising the sequence of SEQ ID NO:922, SEQ ID NO:923, SEQ ID NO:924, SEQ ID NO:925, SEQ ID NO:926, or SEQ ID NO:927; (b) a Cas12i4 polypeptide comprising the sequence of SEQ ID NO:956, SEQ ID NO:957, or SEQ ID NO:958; (c) a Cas12i1 polypeptide comprising the sequence of SEQ ID NO:965; or (d) a Cas12i3 polypeptide comprising the sequence of SEQ ID NO:966.
[0321] In any of the compositions of embodiment 4, the RNA guide and the Cas12i polypeptide may form a ribonucleoprotein complex. In some instances, the ribonucleoprotein complex binds to the target nucleic acid.
[0322] In any of the compositions of embodiment 4, the composition may be present intracellularly.
[0323] In any of the compositions of embodiment 4, the RNA guide and the Cas12i polypeptide may be encoded in a vector, for example, an expression vector. In some examples, the RNA guide and the Cas12i polypeptide are encoded in a single vector. In other examples, the RNA guide is encoded in a first vector and the Cas12i polypeptide is encoded in a second vector.
[0324] Embodiment 5: A vector system comprising one or more vectors, wherein the one or more vectors encode an RNA guide and a Cas12i polypeptide as disclosed herein. In some examples, the vector system comprises a first vector encoding an RNA guide as disclosed herein and a second vector encoding a Cas12i polypeptide. In some examples, the vector is an expression vector.
[0325] Embodiment 6: An RNA guide comprising: (i) a spacer sequence that is substantially complementary or completely complementary to a region on the non-PAM strand in the HAO1 gene (the complementary sequence of the target sequence); and (ii) a direct repeat sequence.
[0326] In some examples, the target sequence is within exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, or exon 7 of the HAO1 gene, and the HAO1 gene may comprise the sequence of SEQ ID NO: 928, the reverse complement of SEQ ID NO: 928, a variant of the sequence of SEQ ID NO: 928, or the reverse complement of the variant of SEQ ID NO: 928.
[0327] In some examples, the spacer sequence is selected from the group consisting of: (a) nucleotides 1 to 16 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466-920; (b) nucleotides 1 to 17 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466-920; (c) nucleotides 1 to 18 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466-920; (d) nucleotides 1 to 19 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466-920. (e) nucleotides 1 to 19 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (f) nucleotides 1 to 21 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (g) nucleotides 1 to 22 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (h) nucleotides 1 to 23 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 466 to 920; (i) nucleotides 1 to 24 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 466 to 920; (j) nucleotides 1 to 25 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 466 to 920; (k) nucleotides 1 to 26 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 466 to 920; (l) nucleotides 1 to 27 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 466 to 920; (m) nucleotides 1 to 28 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 466 to 920; (n) nucleotides 1 to 29 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 466 to 920; or (o) nucleotides 1 to 30 of a sequence that is at least 90% identical to any one of the sequences of SEQ ID NOs: 466 to 920.
[0328] In some examples, the spacer sequence is selected from the group consisting of: (a) nucleotides 1 to 16 of any one of SEQ ID NOs: 466-920; (b) nucleotides 1 to 17 of any one of SEQ ID NOs: 466-920; (c) nucleotides 1 to 18 of any one of SEQ ID NOs: 466-920; (d) nucleotides 1 to 19 of any one of SEQ ID NOs: 466-920; (e) nucleotides 1 to 20 of any one of SEQ ID NOs: 466-920; (f) nucleotides 1 to 21 of any one of SEQ ID NOs: 466-920; (g) nucleotides 1 to 22 of any one of SEQ ID NOs: 466-920; 0, (i) nucleotides 1 to 24 of any one of SEQ ID NOs: 466 to 920, (j) nucleotides 1 to 25 of any one of SEQ ID NOs: 466 to 920, (k) nucleotides 1 to 26 of any one of SEQ ID NOs: 466 to 920, (l) nucleotides 1 to 27 of any one of SEQ ID NOs: 466 to 920, (m) nucleotides 1 to 28 of any one of SEQ ID NOs: 466 to 920, (n) nucleotides 1 to 29 of any one of SEQ ID NOs: 466 to 920, or (o) nucleotides 1 to 30 of any one of SEQ ID NOs: 466 to 920.
[0329] In some examples, the direct repeat sequence is selected from the group consisting of (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (h) nucleotides 8 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (i) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (ii) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (iii) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (iv) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (v) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (vi) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 i) nucleotides 9 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (o) nucleotides 1 to 34 of a sequence that is at least 90% identical to SEQ ID NO: 9; (p) nucleotides 2 to 34 of a sequence that is at least 90% identical to SEQ ID NO: 9; (q) nucleotides 3 to 34 of a sequence that is at least 90% identical to SEQ ID NO: 9;(r) nucleotides 4 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (s) nucleotides 5 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (t) nucleotides 6 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (u) nucleotides 7 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (v) nucleotides 8 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (w) nucleotides 9 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (x) nucleotides 10 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (y) nucleotides 11 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (z) nucleotides 12 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, or (aa) a sequence that is at least 90% identical to the sequence of SEQ ID NO:10 or a portion thereof.
[0330] In some examples, the direct repeat sequence is selected from the group consisting of: (a) nucleotide 1 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (b) nucleotide 2 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (c) nucleotide 3 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (d) nucleotide 4 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (e) nucleotide 5 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (f) nucleotide 6 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (g) nucleotide 7 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (h) nucleotide 8 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (i) nucleotide 9 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (j) nucleotide 10 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (k) nucleotide 11 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (m) nucleotides 13 to 36 of any one of SEQ ID NOs: 1 to 8, (n) nucleotides 14 to 36 of any one of SEQ ID NOs: 1 to 8, (o) nucleotides 1 to 34 of SEQ ID NO: 9, (p) nucleotides 2 to 34 of SEQ ID NO: 9, (q) nucleotides 3 to 34 of SEQ ID NO: 9, (r) nucleotides 4 to 34 of SEQ ID NO: 9, (s) nucleotides 5 to 34 of SEQ ID NO: 9, (t) nucleotides 6 to 34 of SEQ ID NO: 9, (u) nucleotides 7 to 34 of SEQ ID NO: 9, (v) nucleotides 8 to 34 of SEQ ID NO: 9, (w) nucleotides 9 to 34 of SEQ ID NO: 9, (x) nucleotides 10 to 34 of SEQ ID NO: 9, (y) nucleotides 11 to 34 of SEQ ID NO: 9, (z) nucleotides 12 to 34 of SEQ ID NO: 9, or (aa) SEQ ID NO: 10 or a portion thereof.
[0331] In some examples, the direct repeat sequence is selected from the group consisting of (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (h) nucleotides 8 to 8 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (i) nucleotides 9 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (ii) nucleotides 10 to 12 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (iii) nucleotides 13 to 14 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (iv) nucleotides 15 to 16 of a sequence that is at least 9 (i) nucleotides 8 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; or (o) a sequence that is at least 90% identical to the sequence of SEQ ID NO: 954 or a portion thereof.
[0332] In some examples, the direct repeat sequence is: (a) nucleotide 1 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (b) nucleotide 2 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (c) nucleotide 3 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (d) nucleotide 4 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (e) nucleotide 5 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (f) nucleotide 6 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (g) nucleotide 7 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (h) (i) nucleotides 8 to 36 of any one of SEQ ID NOs: 936 to 953; (j) nucleotides 10 to 36 of any one of SEQ ID NOs: 936 to 953; (k) nucleotides 11 to 36 of any one of SEQ ID NOs: 936 to 953; (l) nucleotides 12 to 36 of any one of SEQ ID NOs: 936 to 953; (m) nucleotides 13 to 36 of any one of SEQ ID NOs: 936 to 953; (n) nucleotides 14 to 36 of any one of SEQ ID NOs: 936 to 953; or (o) SEQ ID NO: 954 or a portion thereof.
[0333] In some examples, the direct repeat sequence is selected from the group consisting of (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (h) nucleotides 8 to 8 of a sequence that is at least 90% identical to SEQ ID NO:959, (i) nucleotides 10 to 12 of a sequence that is at least 90% identical to SEQ ID NO:959, (ii) nucleotides 13 to 13 of a sequence that is at least 90% identical to SEQ ID NO:959, (iii) nucleotides 14 to 14 of a sequence that is at least 90% identical to SEQ ID NO:959, (iv) nucleotides 15 to 15 of a sequence that is at least 90% identical to SEQ ID NO:959, (v) nucleotides 16 to 16 of a sequence that is at least 90% identical to SEQ ID NO:959, (vi) nucleotides 17 to 17 of a sequence that is at least 90% identical to SEQ ID NO:959, (v) nucleotides 18 to 18 of a 959、(i) nucleotides 9 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, or (o) a sequence that is at least 90% identical to SEQ ID NO:960 or SEQ ID NO:961, or a portion thereof.
[0334] In some examples, the direct repeat sequence comprises (a) nucleotides 1 to 36 of SEQ ID NO:959, (b) nucleotides 2 to 36 of SEQ ID NO:959, (c) nucleotides 3 to 36 of SEQ ID NO:959, (d) nucleotides 4 to 36 of SEQ ID NO:959, (e) nucleotides 5 to 36 of SEQ ID NO:959, (f) nucleotides 6 to 36 of SEQ ID NO:959, (g) nucleotides 7 to 36 of SEQ ID NO:959, (h) nucleotides 8 to 36 of SEQ ID NO:959, (i) nucleotides 9 to 36 of SEQ ID NO:959, (j) nucleotides 10 to 36 of SEQ ID NO:959, (k) nucleotides 11 to 36 of SEQ ID NO:959, (l) nucleotides 12 to 36 of SEQ ID NO:959, (m) nucleotides 13 to 36 of SEQ ID NO:959, (n) nucleotides 14 to 36 of SEQ ID NO:959, or (o) SEQ ID NO:960 or SEQ ID NO:961, or a portion thereof.
[0335] In some examples, the direct repeat sequence is selected from the group consisting of (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (h) nucleotides 8 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963. (i) nucleotides 9 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963. (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (o) nucleotides 15 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; or (p) a sequence that is at least 90% identical to the sequence of SEQ ID NO: 964 or a portion thereof.
[0336] In some examples, the direct repeat sequence is: (a) nucleotide 1 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (b) nucleotide 2 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (c) nucleotide 3 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (d) nucleotide 4 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (e) nucleotide 5 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (f) nucleotide 6 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (g) nucleotide 7 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (h) nucleotide 8 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (i) nucleotides 9 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (j) nucleotides 10 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (k) nucleotides 11 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (l) nucleotides 12 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (m) nucleotides 13 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (n) nucleotides 14 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (o) nucleotides 15 to 36 of SEQ ID NO:962 or SEQ ID NO:963, or (p) SEQ ID NO:964 or a portion thereof.
[0337] In any of the RNA guides of embodiment 6, the spacer sequence may be substantially complementary or completely complementary to the complementary sequence of any one of SEQ ID NOs: 11-465.
[0338] In any of the RNA guides of embodiment 6, the target sequence may be adjacent to a protospacer adjacent motif (PAM), the PAM comprising the sequence 5'-NTTN-3', where N is any nucleotide. In some examples, the PAM comprises the sequence 5'-ATTA-3', 5'-ATTT-3', 5'-ATTG-3', 5'-ATTC-3', 5'-TTTA-3', 5'-TTTT-3', 5'-TTTG-3', 5'-TTTC-3', 5'-GTTA-3', 5'-GTTT-3', 5'-GTTG-3', 5'-GTTC-3', 5'-CTTA-3', 5'-CTTT-3', 5'-CTTG-3', or 5'-CTTC-3'.
[0339] In some instances, the target sequence is immediately adjacent to the PAM sequence, while in other instances, the target sequence is within 1, 2, 3, 4, or 5 nucleotides of the PAM sequence.
[0340] In some examples, the RNA guide has a sequence that is at least 90% identical to any one of SEQ ID NOs: 967-1023. In some specific examples, the RNA guide has a sequence that is at least 90% identical to any one of SEQ ID NOs: 967-1023.
[0341] Embodiment 7: A nucleic acid encoding an RNA guide as described herein.
[0342] Embodiment 8: A vector comprising an RNA guide as described herein.
[0343] Embodiment 9: A cell comprising a composition, RNA guide, nucleic acid, or vector described herein. In some examples, the cell is a eukaryotic cell, an animal cell, a mammalian cell, a human cell, a primary cell, a cell line, a stem cell, or a hepatic cell.
[0344] Embodiment 10: A kit comprising a composition, RNA guide, nucleic acid, or vector described herein.
[0345] Embodiment 11: A method of editing an HAO1 sequence, comprising contacting the HAO1 sequence with a composition or RNA guide described herein. In some examples, the method is performed in vitro. In other examples, the method is performed ex vivo.
[0346] In some instances, the HAO1 sequence is intracellular.
[0347] In some instances, the composition or RNA guide induces a deletion in the HAO1 sequence. In some instances, the deletion is adjacent to a 5'-NTTN-3' sequence, where N is any nucleotide. In some specific instances, the deletion is downstream of the 5'-NTTN-3' sequence. In some specific instances, the deletion is up to about 40 nucleotides in length. In some instances, the deletion is about 4 nucleotides to 40 nucleotides, about 4 nucleotides to 25 nucleotides, about 10 nucleotides to 25 nucleotides, or about 10 nucleotides to 15 nucleotides in length.
[0348] In some instances, the deletion begins within about 5 nucleotides to about 15 nucleotides, about 5 nucleotides to about 10 nucleotides, or about 10 nucleotides to about 15 nucleotides of the 5'-NTTN-3' sequence.
[0349] In some examples, the deletion begins within about 5 nucleotides to about 15 nucleotides, about 5 nucleotides to about 10 nucleotides, or about 10 nucleotides to about 15 nucleotides downstream of the 5'-NTTN-3' sequence.
[0350] In some instances, the deletion ends within about 20 nucleotides to about 30 nucleotides, about 20 nucleotides to about 25 nucleotides, or about 25 nucleotides to about 30 nucleotides of the 5'-NTTN-3' sequence.
[0351] In some instances, the deletion ends within about 20 nucleotides to about 30 nucleotides, about 20 nucleotides to about 25 nucleotides, about 25 nucleotides to about 30 nucleotides downstream of the 5'-NTTN-3' sequence.
[0352] In some examples, the deletion begins within about 5 to about 15 nucleotides downstream of the 5'-NTTN-3' sequence and ends within about 20 to about 30 nucleotides downstream of the 5'-NTTN-3' sequence.
[0353] In some examples, the deletion begins within about 5 to about 15 nucleotides downstream of the 5'-NTTN-3' sequence and ends within about 20 to about 25 nucleotides downstream of the 5'-NTTN-3' sequence.
[0354] In some examples, the deletion begins within about 5 to about 15 nucleotides downstream of the 5'-NTTN-3' sequence and ends within about 25 to about 30 nucleotides downstream of the 5'-NTTN-3' sequence.
[0355] In some examples, the deletion begins within about 5 to about 10 nucleotides downstream of the 5'-NTTN-3' sequence and ends within about 20 to about 30 nucleotides downstream of the 5'-NTTN-3' sequence.
[0356] In some examples, the deletion begins within about 5 to about 10 nucleotides downstream of the 5'-NTTN-3' sequence and ends within about 20 to about 25 nucleotides downstream of the 5'-NTTN-3' sequence.
[0357] In some examples, the deletion begins within about 5 to about 10 nucleotides downstream of the 5'-NTTN-3' sequence and ends within about 25 to about 30 nucleotides downstream of the 5'-NTTN-3' sequence.
[0358] In some examples, the deletion begins within about 10 to about 15 nucleotides downstream of the 5'-NTTN-3' sequence and ends within about 20 to about 30 nucleotides downstream of the 5'-NTTN-3' sequence.
[0359] In some examples, the deletion begins within about 10 to about 15 nucleotides downstream of the 5'-NTTN-3' sequence and ends within about 20 to about 25 nucleotides downstream of the 5'-NTTN-3' sequence.
[0360] In some examples, the deletion begins within about 10 to about 15 nucleotides downstream of the 5'-NTTN-3' sequence and ends within about 25 to about 30 nucleotides downstream of the 5'-NTTN-3' sequence.
[0361] In some examples, the 5'-NTTN-3' sequence is 5'-CTTT-3', 5'-CTTC-3', 5'-GTTT-3', 5'-GTTC-3', 5'-TTTC-3', 5'-GTTA-3', or 5'-GTTG-3'.
[0362] In some cases, the deletion overlaps with a mutation in the HAO1 sequence. In some cases, the deletion overlaps with an insertion in the HAO1 sequence. In some cases, the deletion removes a repeat expansion of the HAO1 sequence or a portion thereof. In some cases, the deletion disrupts one or both alleles of the HAO1 sequence.
[0363] In any of the compositions, RNA guides, nucleic acids, vectors, cells, kits, or methods of embodiments 1-10 described herein, the RNA guide may comprise the sequence of any one of SEQ ID NOs: 967-1023.
[0364] Embodiment 12: A method of treating primary hyperoxaluria (PH) in a subject, wherein PH is, optionally, PH1, PH2, or PH3, the method comprising administering to the subject any of the compositions, RNA, or cells described herein.
[0365] In any of the compositions, RNA guides, cells, kits, or methods described herein, the RNA guides and / or polyribonucleotides encoding Cas12i polypeptides can be contained within lipid nanoparticles. In some examples, the RNA guides and polyribonucleotides encoding Cas12i polypeptides are contained within the same lipid nanoparticle. In other examples, the RNA guides and polyribonucleotides encoding Cas12i polypeptides are contained within separate lipid nanoparticles.
[0366] Embodiment 13: An RNA guide comprising: (i) a spacer sequence complementary to a target site in the HAO1 gene, wherein the target site is on the non-PAM strand and complementary to the target sequence; and (ii) a direct repeat sequence, wherein the target sequence is any one of SEQ ID NOs: 1047, 1026, or 1025, or a reverse complementary sequence thereof.
[0367] In some examples, the direct repeat sequence is selected from the group consisting of (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (h) nucleotides 8 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (i) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (ii) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (iii) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (iv) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (v) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8, (vi) a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 i) nucleotides 9 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 1 to 8; (o) nucleotides 1 to 34 of a sequence that is at least 90% identical to SEQ ID NO: 9; (p) nucleotides 2 to 34 of a sequence that is at least 90% identical to SEQ ID NO: 9; (q) nucleotides 3 to 34 of a sequence that is at least 90% identical to SEQ ID NO: 9;(r) nucleotides 4 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (s) nucleotides 5 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (t) nucleotides 6 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (u) nucleotides 7 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (v) nucleotides 8 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (w) nucleotides 9 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (x) nucleotides 10 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (y) nucleotides 11 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, (z) nucleotides 12 to 34 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:9, or (aa) a sequence that is at least 90% identical to the sequence of SEQ ID NO:10 or a portion thereof.
[0368] In some examples, the direct repeat sequence is selected from the group consisting of: (a) nucleotide 1 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (b) nucleotide 2 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (c) nucleotide 3 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (d) nucleotide 4 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (e) nucleotide 5 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (f) nucleotide 6 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (g) nucleotide 7 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (h) nucleotide 8 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (i) nucleotide 9 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (j) nucleotide 10 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (k) nucleotide 11 to nucleotide 36 of any one of SEQ ID NOs: 1 to 8; (m) nucleotides 13 to 36 of any one of SEQ ID NOs: 1 to 8, (n) nucleotides 14 to 36 of any one of SEQ ID NOs: 1 to 8, (o) nucleotides 1 to 34 of SEQ ID NO: 9, (p) nucleotides 2 to 34 of SEQ ID NO: 9, (q) nucleotides 3 to 34 of SEQ ID NO: 9, (r) nucleotides 4 to 34 of SEQ ID NO: 9, (s) nucleotides 5 to 34 of SEQ ID NO: 9, (t) nucleotides 6 to 34 of SEQ ID NO: 9, (u) nucleotides 7 to 34 of SEQ ID NO: 9, (v) nucleotides 8 to 34 of SEQ ID NO: 9, (w) nucleotides 9 to 34 of SEQ ID NO: 9, (x) nucleotides 10 to 34 of SEQ ID NO: 9, (y) nucleotides 11 to 34 of SEQ ID NO: 9, (z) nucleotides 12 to 34 of SEQ ID NO: 9, or (aa) SEQ ID NO: 10 or a portion thereof.
[0369] In some examples, the direct repeat sequence is selected from the group consisting of (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (h) nucleotides 8 to 8 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (i) nucleotides 9 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (ii) nucleotides 10 to 12 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (iii) nucleotides 13 to 14 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936-953, (iv) nucleotides 15 to 16 of a sequence that is at least 9 (i) nucleotides 8 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to any one of SEQ ID NOs: 936 to 953; or (o) a sequence that is at least 90% identical to the sequence of SEQ ID NO: 954 or a portion thereof.
[0370] In some examples, the direct repeat sequence is: (a) nucleotide 1 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (b) nucleotide 2 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (c) nucleotide 3 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (d) nucleotide 4 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (e) nucleotide 5 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (f) nucleotide 6 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (g) nucleotide 7 to nucleotide 36 of any one of SEQ ID NOs: 936-953; (h) (i) nucleotides 8 to 36 of any one of SEQ ID NOs: 936 to 953; (j) nucleotides 10 to 36 of any one of SEQ ID NOs: 936 to 953; (k) nucleotides 11 to 36 of any one of SEQ ID NOs: 936 to 953; (l) nucleotides 12 to 36 of any one of SEQ ID NOs: 936 to 953; (m) nucleotides 13 to 36 of any one of SEQ ID NOs: 936 to 953; (n) nucleotides 14 to 36 of any one of SEQ ID NOs: 936 to 953; or (o) SEQ ID NO: 954 or a portion thereof.
[0371] In some examples, the direct repeat sequence is selected from the group consisting of (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (h) nucleotides 8 to 8 of a sequence that is at least 90% identical to SEQ ID NO:959, (i) nucleotides 10 to 12 of a sequence that is at least 90% identical to SEQ ID NO:959, (ii) nucleotides 13 to 13 of a sequence that is at least 90% identical to SEQ ID NO:959, (iii) nucleotides 14 to 14 of a sequence that is at least 90% identical to SEQ ID NO:959, (iv) nucleotides 15 to 15 of a sequence that is at least 90% identical to SEQ ID NO:959, (v) nucleotides 16 to 16 of a sequence that is at least 90% identical to SEQ ID NO:959, (vi) nucleotides 17 to 17 of a sequence that is at least 90% identical to SEQ ID NO:959, (v) nucleotides 18 to 18 of a 959、(i) nucleotides 9 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to SEQ ID NO:959, or (o) a sequence that is at least 90% identical to SEQ ID NO:960 or SEQ ID NO:961, or a portion thereof.
[0372] In some examples, the direct repeat sequence comprises (a) nucleotides 1 to 36 of SEQ ID NO:959, (b) nucleotides 2 to 36 of SEQ ID NO:959, (c) nucleotides 3 to 36 of SEQ ID NO:959, (d) nucleotides 4 to 36 of SEQ ID NO:959, (e) nucleotides 5 to 36 of SEQ ID NO:959, (f) nucleotides 6 to 36 of SEQ ID NO:959, (g) nucleotides 7 to 36 of SEQ ID NO:959, (h) nucleotides 8 to 36 of SEQ ID NO:959, (i) nucleotides 9 to 36 of SEQ ID NO:959, (j) nucleotides 10 to 36 of SEQ ID NO:959, (k) nucleotides 11 to 36 of SEQ ID NO:959, (l) nucleotides 12 to 36 of SEQ ID NO:959, (m) nucleotides 13 to 36 of SEQ ID NO:959, (n) nucleotides 14 to 36 of SEQ ID NO:959, or (o) SEQ ID NO:960 or SEQ ID NO:961, or a portion thereof.
[0373] In some examples, the direct repeat sequence is selected from the group consisting of (a) nucleotides 1 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (b) nucleotides 2 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (c) nucleotides 3 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (d) nucleotides 4 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (e) nucleotides 5 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (f) nucleotides 6 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (g) nucleotides 7 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963, (h) nucleotides 8 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO:962 or SEQ ID NO:963. (i) nucleotides 9 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (j) nucleotides 10 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (k) nucleotides 11 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (l) nucleotides 12 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963. (m) nucleotides 13 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (n) nucleotides 14 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; (o) nucleotides 15 to 36 of a sequence that is at least 90% identical to the sequence of SEQ ID NO: 962 or SEQ ID NO: 963; or (p) a sequence that is at least 90% identical to the sequence of SEQ ID NO: 964 or a portion thereof.
[0374] In some examples, the direct repeat sequence is: (a) nucleotide 1 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (b) nucleotide 2 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (c) nucleotide 3 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (d) nucleotide 4 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (e) nucleotide 5 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (f) nucleotide 6 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (g) nucleotide 7 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (h) nucleotide 8 to nucleotide 36 of SEQ ID NO:962 or SEQ ID NO:963; (i) nucleotides 9 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (j) nucleotides 10 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (k) nucleotides 11 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (l) nucleotides 12 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (m) nucleotides 13 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (n) nucleotides 14 to 36 of SEQ ID NO:962 or SEQ ID NO:963, (o) nucleotides 15 to 36 of SEQ ID NO:962 or SEQ ID NO:963, or (p) SEQ ID NO:964 or a portion thereof.
[0375] In some instances, the RNA guide has a sequence that is at least 90% identical to any one of SEQ ID NOs: 989, 968, or 967. In some specific instances, the RNA guide has a sequence that is at least 90% identical to any one of SEQ ID NOs: 989, 968, or 967.
[0376] In some instances, each of the first three nucleotides of the RNA guide comprises a 2'-O-methyl phosphorothioate modification.
[0377] In some instances, each of the last four nucleotides of the RNA guide comprises a 2'-O-methyl phosphorothioate modification.
[0378] In some instances, the first to last, second to last, and third to last nucleotide of the RNA guide each comprise a 2'-O-methyl phosphorothioate modification, and the last nucleotide of the RNA guide is unmodified.
[0379] In some examples, the RNA guide has a sequence that is at least 90% identical to any one of SEQ ID NOs: 1082 to 1087. In some specific examples, the RNA guide has a sequence that is at least 90% identical to any one of SEQ ID NOs: 1082 to 1087.
[0380] In some embodiments, the HAO1 target RNA guide comprises at least 90% identity to any one of SEQ ID NOs: 1082-1087. In some embodiments, the HAO1 target RNA guide comprises at least one of SEQ ID NOs: 1082-1087. In some embodiments, the HAO1 target RNA guide comprises at least 90% identity to SEQ ID NO: 1083 or SEQ ID NO: 1084 binds via base pairing to a complementary region of the HAO1 target sequence of SEQ ID NO: 1047. In some embodiments, the HAO1 target RNA guide comprises at least 90% identity to SEQ ID NO: 1083 or SEQ ID NO: 1084 binds via base pairing to a complementary region of the HAO1 target sequence of SEQ ID NO: 1047. In some embodiments, the HAO1 target RNA guide comprises at least 90% identity to SEQ ID NO: 1085 or SEQ ID NO: 1086 binds via base pairing to a complementary region of the HAO1 target sequence of SEQ ID NO: 1026. In some embodiments, the HAO1 targeting RNA guide of SEQ ID NO: 1085 or SEQ ID NO: 1086 binds via base pairing to a complementary region of the HAO1 target sequence of SEQ ID NO: 1026. In some embodiments, the HAO1 targeting RNA guide comprising at least 90% identity to SEQ ID NO: 1087 or SEQ ID NO: 2293 binds via base pairing to a complementary region of the HAO1 target sequence of SEQ ID NO: 1025. In some embodiments, the HAO1 targeting RNA guide of SEQ ID NO: 1087 or SEQ ID NO: 2293 binds via base pairing to a complementary region of the HAO1 target sequence of SEQ ID NO: 1025.
[0381] Embodiment 14: A nucleic acid encoding the RNA guide of embodiment 13 described herein.
[0382] Embodiment 15: A vector comprising the nucleic acid of embodiment 14 described herein.
[0383] Embodiment 16: A vector system comprising one or more vectors, wherein the one or more vectors encode (i) an RNA guide of embodiment 13 described herein, and (ii) a Cas12i polypeptide. In some examples, the vector system comprises a first vector encoding an RNA guide and a second vector encoding a Cas12i polypeptide.
[0384] Embodiment 17: A cell comprising an RNA guide, nucleic acid, vector, or vector system of any of embodiments 13 to 16 described herein. In some examples, the cell is a eukaryotic cell, an animal cell, a mammalian cell, a human cell, a primary cell, a cell line, a stem cell, or a T cell.
[0385] Embodiment 18: A kit comprising an RNA guide, a nucleic acid, a vector, or a vector system according to embodiments 13 to 16 described herein.
[0386] Embodiment 19: A method of editing an HAO1 sequence, comprising contacting the HAO1 sequence with an RNA guide of embodiment 13 described herein. In some examples, the HAO1 sequence is within a cell.
[0387] In some instances, the RNA guide induces an indel (e.g., an insertion or deletion) in the HAO1 sequence.
[0388] Embodiment 20: A method of treating primary hyperoxaluria (PH) in a subject, wherein PH is optionally PH1, PH2, or PH3, the method comprising administering to the subject an RNA guide of embodiment 12 described herein.
[0389] General Technology The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are described in Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press, Oligonucleotide Synthesis (MJ Gait, ed. 1984), Methods in Molecular Biology, Humana Press, Cell Biology: A Laboratory Notebook (JECellis, ed., 1989) Academic Press, Animal Cell Culture (RIFreshney, ed. 1987), Introuction to Cell and Tissue Culture (JP Mather and PE Roberts, 1998) Plenum Press, Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JBGriffiths, and DG Newell, eds. 1993-8) J. Wiley and Sons, Methods in Enzymology (Academic Press, Inc.), Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.): Gene Transfer Vectors for Mammalian Cells (JMMiller and MP Calos, eds., 1987), Current Protocols in Molecular Biology (FMAusubel, et al. eds. 1987), PCR: The Polymerase Chain Reaction, (Mullis, et al., eds. 1994), Current Protocols in Immunology (JEColigan et al., eds., 1991), Short Protocols in Molecular Biology (Wiley and Sons, 1999), Immunobiology (C.A. Janeway and P. Travers, 1997), Antibodies (P. Finch, 1997), Antibodies: a practice approach (D. Catty., ed., IRL Press, 1988 - 1989), Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000), Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999), The Antibodies (M. Zanetti and J.D. Capra, eds. Harwood Academic Publishers, 1995), DNA Cloning: A practical Approach, Volumes I and II (D.N. Glover ed. 1985), Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds. (1985>>, Transcription and Translation (B.D. Hames & S.J. Higgins, eds. (1984>>, Animal Cell Culture (R.I. Freshney, ed. (1986>>, Immobilized Cells and Enzymes (lRL Press, (1986>>, and are fully described in the literature such as B. Perbal, A practical Guide To Molecular Cloning (1984), F.M. Ausubel et al. (eds.).
[0390] Without further elaboration, it is believed that one skilled in the art can utilize the present invention to its fullest extent based on the above description. The following specific embodiments are therefore to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way. All publications cited herein are incorporated by reference for the purpose or subject matter referred to herein. EXAMPLES
[0391] The following examples are provided to further illustrate some embodiments of the present invention, but are not intended to limit the scope of the invention, and it will be understood that by their illustrative nature, other procedures, methodologies, or techniques known to those skilled in the art may be used instead.
[0392] Example 1 - Cas12i2-mediated editing of HAO1 target sites in HEK293T cells This example describes genome editing of the HAO1 gene using Cas12i2 introduced into HEK293T cells.
[0393] Cas12i2 RNA guide (crRNA) was designed and ordered from Integrated DNA Technologies (IDT). For initial guide screening in HEK293T cells, target sequences were designed by tiling the coding exons of HAO1 for the 5'-NTTN-3'PAM sequence, and then a spacer sequence was designed for the target sequence 20bp downstream of the PAM sequence. The HAO1 target RNA guide sequences are shown in Table 7. In the figure, "E#T#" can also be represented as "Exon#Target#".
[0394] [Table 7-1]
[0395] [Table 7-2]
[0396] [Table 7-3]
[0397] [Table 7-4]
[0398] [Table 7-5]
[0399] The Cas12i2 RNP complex formation reaction was performed by mixing purified Cas12i2 polypeptide of SEQ ID NO:924 (400 μM) with HAO1 targeting crRNA (1 mM in 250 mM NaCl) at a volume ratio of 1:1 (Cas12i2:crRNA) (2.5:1 crRNA:Cas12i2 molar ratio). The complex formation was incubated on ice for 30-60 min.
[0400] HEK293T cells were harvested and counted using TRYPLE™ (recombinant cell dissociation enzyme, ThermoFisher). Cells were washed once with PBS and resuspended in SF buffer + supplements (SF cell line 4D-NUCLEOFECTOR™ X Kit S, Lonza #V4XC-2032) at a concentration of 16,480 cells / μL. Resuspended cells were diluted to 3×10 5 Cells / reaction were dispensed into Lonza 16-well NUCLEOCUVETTE® strips. Complexed Cas12i2 RNP was added to each reaction at a final concentration of 10 μM (Cas12i2), and then transfection enhancer oligo was added at a final concentration of 4 μM. The final volume of each electroporation reaction was 20 μL. A non-targeted guide was used as a negative control.
[0401] The strips were subjected to electroporation using an electroporation device (program CM-130, Lonza 4D-NUCLEOFECTOR™). Immediately after electroporation, 80 μL of pre-warmed DMEM+10% FBS was added to each well and mixed gently by pipette. For each technical replicate plate, 10 μL (30,000 cells) of diluted nucleofected cells were plated in a pre-warmed 96-well plate with wells containing 100 μL of DMEM+10% FBS. The editing plates were incubated at 37° C. and 5% CO2 for 3 days.
[0402] After 3 days, wells were harvested using TRYPLE™ (recombinant cell dissociation enzyme, ThermoFisher) and transferred to a 96-well TWIN.TEC® PCR plate (Eppendorf). The medium was flicked off and cells were resuspended in 20 μL of QUICKEXTRACT™ (DNA extraction buffer, Lucigen). Samples were then cycled in a PCR machine at 65° C. for 15 minutes, 68° C. for 15 minutes, and 98° C. for 10 minutes. Samples were then frozen at −20° C.
[0403] Samples for next generation sequencing (NGS) were prepared by several rounds of PCR. The first round (PCR I) was used to amplify the genomic regions flanking the target site and add NGS adaptors. The second round (PCR II) was used to add NGS indexes. Reactions were then pooled, purified by column purification, and quantified in a fluorometer (Qubit). Sequencing was performed using a 150 cycle NGS instrument (NEXTSEQ™ v2.5) medium or high output kit (Illumina) and was performed on an NGS instrument (NEXTSEQ™ 550, Illumina).
[0404] For NGS analysis, the indel mapping function used the fastq file of the sample, the amplicon reference sequence, and the forward primer sequence. For each read, the editing behavior (match, mismatch, insertion, deletion) between the read and the reference sequence was calculated using the kmer scan algorithm. To remove the small amount of primer dimers present in some samples, the first 30 nt of each read were required to match the reference, and reads with more than half of the mapping nucleotides mismatched were filtered out. A maximum of 50,000 reads that passed these filters were used for analysis, and a read was counted as an indel read if it contained an insertion or deletion. The % indel was calculated as the number of indel-containing reads divided by the number of reads analyzed (the maximum number of reads that passed the filter was 50,000). The QC criterion for the minimum number of reads that passed the filter was 10,000.
[0405] Figure 1 shows HAO1 indels in HEK293T cells after RNP delivery. Error bars represent the average of three technical replicates across one biological replicate. After delivery, indels were detected within and / or adjacent to each of the HAO1 target sites for each of the RNA guides. Delivery of E1T2, E1T3, E1T6, E1T7, E1T13, T1T17, E2T4, E2T5, E2T9, E2T10, E3T6, E3T19, E3T22, and E3T28 resulted in indels in more than 70% of NGS reads. Thus, HAO1-targeted RNA guides induced indels within exon 1, exon 2, and exon 3 in HEK293T cells.
[0406] Thus, this example shows that HAO1 can be individually targeted by Cas12i2 RNP in mammalian cells such as HEK293T cells.
[0407] Example 2 - Cas12i2-mediated editing of HAO1 target sites in HepG2 cells This example describes genome editing of the HAO1 gene using Cas12i2 introduced into HepG2 cells by RNP.
[0408] RNP complexation reactions were carried out with various RNA guides in Table 7 as described in Example 1. HepG2 cells were harvested and counted using TRYPLE™ (recombinant cell dissociation enzyme, ThermoFisher). Cells were washed once with PBS and resuspended in SF buffer + supplements (SF cell line 4D-NUCLEOFECTOR™ X Kit S, Lonza #V4XC-2032) at a concentration of 13,889 cells / μL. Resuspended cells were dispensed into Lonza 16-well NUCLEOCUVETTE® strips at 2.5e5 cells / reaction. Complexed Cas12i2 RNP was added to each reaction at a final concentration of 20 μM (Cas12i2) and no transfection enhancer oligo was added. The final volume of each electroporation reaction was 20 μL. A non-targeted guide was used as a negative control.
[0409] The strips were subjected to electroporation using an electroporation device (program DJ-100, Lonza 4D-NUCLEOFECTOR™). Immediately after electroporation, 80 μL of pre-warmed EMEM+10% FBS was added to each well and mixed gently by pipette. For each technical replicate plate, 10 μL (25,000 cells) of diluted nucleofected cells were plated in a pre-warmed 96-well plate with wells containing 100 μL EMEM+10% FBS. The editing plates were incubated at 37° C. and 5% CO2 for 3 days.
[0410] After 3 days, wells were harvested using TRYPLE™ (recombinant cell dissociation enzyme, ThermoFisher) and transferred to a 96-well TWIN.TEC® PCR plate (Eppendorf). The medium was flicked off and cells were resuspended in 20 μL of QUICKEXTRACT™ (DNA extraction buffer, Lucigen). Samples were then cycled in a PCR machine at 65° C. for 15 minutes, 68° C. for 15 minutes, and 98° C. for 10 minutes. Samples were then frozen at −20° C. Samples were analyzed by NGS as described in Example 1.
[0411] Figure 2 shows HAO1 indels in HepG2 cells after RNP delivery. Error bars represent the average of three technical replicates across one biological replicate. After delivery, indels were detected within and / or adjacent to each of the HAO1 target sites for each of the RNA guides. Thus, the HAO1 target RNA guide induced indels within exon 1, exon 2, and exon 3 in HepG2 cells.
[0412] Thus, this example shows that HAO1 can be targeted by Cas12i2 RNP in mammalian cells, such as HepG2 cells.
[0413] Example 3 - Cas12i2-mediated editing of HAO1 target sites in primary hepatocytes This example describes genome editing of HAO1 using Cas12i2 introduced into primary hepatocytes by RNP.
[0414] RNP complex formation reaction was carried out with the RNA guides in Table 7 as described in Example 1. Primary hepatocytes from human donors were thawed very quickly from liquid nitrogen in a 37°C water bath. Cells were added to pre-warmed hepatocyte collection medium (Thermofisher, CM7000) and centrifuged at 100g for 10 minutes. Cell pellets were resuspended in an appropriate volume of hepatocyte plating medium (Williams Medium E, Thermofisher A1217601, supplemented with Hepatocyte Plating Complement Pack (with serum), Thermofisher CM3000). Cells were subjected to trypan blue viability counting in an INCUCYTE® disposable hemocytometer (Fisher scientific, 22-600-100). The cells were then washed in PBS and resuspended in P3 buffer plus supplements (P3 Primary Cell 4D-NUCLEOFECTOR™ X Kit, Lonza, VXP-3032) at a concentration of approximately 7,500 cells / μL. The resuspended cells were dispensed into 16-well Lonza NUCLEOCUVETTE strips at 150,000 cells / reaction for mRNA reads or into single Lonza NUCLEOCUVETTES® at 500,000 cells / reaction. Complexed Cas12i2 RNP was added to each reaction at a final concentration of 20 μM (Cas12i2), followed by transfection enhancer oligos at a final concentration of 4 μM. The final volume of each electroporation reaction was either 20 μL in a 16-well nucleocuvette strip format or 100 μL in a single nucleocuvette format. A non-targeted guide was used as a negative control.
[0415] The strips were electroporated using the DS-150 program and the single nucleocuvette was electroporated using the CA137 program (Lonza 4D-NUCLEOFECTOR™). Immediately after electroporation, pre-warmed hepatocyte plating medium was added to each well and mixed very gently by pipette. For each technical replicate plate, all cell suspensions of diluted nucleofected cells were plated into pre-warmed collagen-coated 96-well or 24-well plates (Thermofisher) with wells containing hepatocyte plating medium. The cells were then incubated in a 37° C. incubator. After the cells had attached after 4 hours, the medium was changed to hepatocyte maintenance medium (Williams medium E supplemented with William's E medium Cell Maintenance Cocktail, Thermofisher CM 4000, Thermofisher A1217601). After 2 days, the medium was replaced with fresh hepatocyte maintenance medium.
[0416] Four to five days after RNP electroporation, the medium was aspirated and the cells were harvested by shaking (500 rpm) with 2 mg / ml collagenase IV (Thermofisher, 17104019) dissolved in PBS containing Ca / Mg (Thermofisher) in a 37°C incubator. After dissociating the cells from the plate, they were transferred to a 96-well TWIN.TEC® PCR plate (Eppendorf) and centrifuged. The medium was flicked off and the cell pellet for NGS read was resuspended in 20 μL of QUICKEXTRACT™ (DNA extraction buffer, Lucigen). The samples were then subjected to cycles of 65°C for 15 min, 68°C for 15 min, and 98°C for 10 min in a PCR machine and analyzed by NGS as described in Example 1.
[0417] For mRNA reads, cell pellets were frozen at -80°C, then resuspended in lysis buffer and DNA / RNA was extracted with RNeasy kit (Qiagen) according to the manufacturer's instructions. DNA extracted from samples was analyzed by NGS. Isolated RNA was checked for quantity and purity using nanodrop, and then this RNA was used to perform cDNA synthesis using 5x iScript reverse transcription mix (Bio-Rad laboratories) according to the manufacturer's recommendations. Template cDNA was appropriately diluted to be in the linear range of the subsequent analysis. The diluted cDNA was used to establish a 20 μL digital droplet PCR (ddPCR-BioRad laboratories) reaction using the target-specific primers and probe for HAO1, ATTGTGCACTGTCAGATCTTGGAAACGGCCAAAGGATTTTTCCTCACCAATGTCTTGTCGATGACTTTCACATTCTGGCACCCACTCAGAGCCATGGCCAACCGGAATTCTTCCTTTAGTAT (SEQ ID NO: 1088), and 2x ddPCR Supermix for Probes No dUTP (BioRad laboratories) according to the manufacturer's instructions. The reaction was used to generate droplets using an Automated Droplet Generator (BioRad Laboratories) according to the manufacturer's recommendations. The plate was sealed using a PX1 PCR plate sealer (BioRad Laboratories) and the generated droplets were subjected to PCR amplification using a C1000 Touch thermal cycler (BioRad Laboratories) using the conditions recommended by the manufacturer. PCR amplified droplets were read in a QX200 Droplet Reader (BioRad Laboratories) and the acquired data was analyzed using QX Manager version 1.2 (BioRad Laboratories) to determine the absolute copy number of mRNA present in each reaction for the appropriate target.
[0418] As shown in Figure 3, each RNA guide tested induced indels within and / or adjacent to the HAO1 target site. Indels were not induced in the non-targeted control. Thus, the HAO1-targeted RNA guide induced indels in primary hepatocytes. Indels were then correlated with the mRNA levels for each target to determine whether indels lead to mRNA knockdown and subsequent protein knockdown. Figure 4 shows the % mRNA knockdown of HAO1 in edited cells compared to unedited control cells. A higher percentage of NGS reads contained indels using HAO1 E2T5 (SEQ ID NO: 989) compared to HAO1 E2T4 (SEQ ID NO: 988), but HAO1 E2T4 led to a greater knockdown of HAO1 mRNA.
[0419] Thus, this example shows that HAO1 can be targeted by Cas12i2 RNP in mammalian cells, such as primary human hepatocytes.
[0420] Example 4 - Editing of HAO1 target site in HepG2 cells with Cas12i2 variants This example describes indel evaluation for the HAO1 target using variants introduced into HepG2 cells by transient transfection.
[0421] Cas12i2 variants of SEQ ID NO:924 and SEQ ID NO:927 were individually cloned into pcda3.1 backbone (Invitrogen). Nucleic acids encoding RNA guides E1T2 (SEQ ID NO:967), E1T3 (SEQ ID NO:968), E2T4 (SEQ ID NO:988), E2T5 (SEQ ID NO:989), E2T10 (SEQ ID NO:994) were cloned into pUC19 backbone (New England Biolabs). Plasmids were then maxiprepped and diluted.
[0422] HepG2 cells were harvested and counted using TRYPLE™ (recombinant cell dissociation enzyme, ThermoFisher). Cells were washed once with PBS and resuspended in SF buffer + supplements (SF cell line 4D-NUCLEOFECTOR™ X Kit S, Lonza #V4XC-2032).
[0423] Approximately 16 hours prior to transfection, 25,000 HepG2 cells in EMEM / 10% FBS were plated into each well of a 96-well plate. On the day of transfection, the cells were 70-90% confluent. For each well to be transfected, a mixture of Lipofectamine™ 3000 and Opti-MEM® was prepared and then incubated at room temperature for 5 minutes (Solution 1). After incubation, the Lipofectamine™:OptiMEM® mixture was added to a separate mixture containing the nuclease plasmid, the RNA guide plasmid, and the P3000 reagent (Solution 2). For the negative control, crRNA was not included in Solution 2. Solution 1 and Solution 2 were mixed by pipetting up and down and then incubated at room temperature for 15 minutes. After incubation, the Solution 1 and Solution 2 mixture was added dropwise to each well of the 96-well plate containing the cells.
[0424] After 3 days, wells were harvested using TRYPLE™ (recombinant cell dissociation enzyme, ThermoFisher) and transferred to a 96-well TWIN.TEC® PCR plate (Eppendorf). The medium was flicked off and cells were resuspended in 20 μL of QUICKEXTRACT™ (DNA extraction buffer, Lucigen). Samples were then cycled in a PCR machine at 65° C. for 15 minutes, 68° C. for 15 minutes, and 98° C. for 10 minutes. Samples were then frozen at −20° C. and analyzed by NGS as described in Example 1.
[0425] As shown in FIG. 5A, comparable indel activity in the two Cas12i2 variants was observed for E1T2, E1T3, E2T4, E2T5, E2T10. FIG. 5B shows the indel size frequency (left) and indel start position relative to the PAM for E1T3 and variant Cas12i2 of SEQ ID NO: 924. As shown on the left, the deletions ranged in size from 1 nucleotide to about 40 nucleotides. The majority of the deletions were about 6 nucleotides to about 27 nucleotides long. As shown on the right, the target sequence is represented starting at position 0 and ending at position 20. The indels started within about 10 nucleotides and about 35 nucleotides downstream of the PAM sequence. The majority of the indels started near the end of the target sequence, for example, about 18 nucleotides to about 25 nucleotides downstream of the PAM sequence.
[0426] Thus, this example demonstrates that HAO1 can be targeted by multiple Cas12i2 polypeptides.
[0427] Example 5 - Editing of HAO1 in primary human hepatocytes using Cas12i2 mRNA constructs This example describes indel assessment for the HAO1 target site via delivery of Cas12i2 mRNA and a chemically modified HAO1-targeting RNA guide.
[0428] The mRNA sequences corresponding to the variant Cas12i2 sequence of SEQ ID NO: 924 and the variant Cas12i2 sequence of SEQ ID NO: 927 were synthesized by Aldeveron with 1-pseudo-U modified nucleotide using CleanCap® Reagent AG (TriLink Biotechnologies). The Cas12i2 mRNA sequences shown in Table 8 further included a C-terminal NLS.
[0429] [Table 8-1]
[0430] [Table 8-2]
[0431] [Table 8-3]
[0432] Cas12i2 RNA guides were designed with 3'-end modified phosphorothioated 2'O-methyl base guides or 5'-end and 3'-end modified phosphorothioated 2'O-methyl base guides as specified in Table 9 and ordered from Integrated DNA Technologies (IDT). Each variant Cas12i2 mRNA was mixed with crRNA at a volume ratio of 1:1 (Cas12i2:crRNA) (1050:1 crRNA:Cas12i2 molar ratio). The mRNA and crRNA were mixed immediately before electroporation. Primary human hepatocytes were cultured and subjected to electroporation as described in Example 3.
[0433] [Table 9]
[0434] FIG. 6 shows the editing of the HAO1 target site by variant Cas12i2 mRNA and 3'-end modified E2T5 (SEQ ID NO: 1091) or 5'- and 3'-end modified E2T5 (SEQ ID NO: 1092). Indels in the HAO1 target site were introduced after electroporation of either Cas12i2 mRNA of SEQ ID NO: 1089 or SEQ ID NO: 1090 and RNA guide of SEQ ID NO: 1091 or SEQ ID NO: 1092. Approximately 50% of NGS reads contained indels after electroporation of Cas12i2 mRNA of SEQ ID NO: 1090 and RNA guide of SEQ ID NO: 1091 or SEQ ID NO: 1092. A statistically significantly higher % indels was observed using variant Cas12i2 mRNA of SEQ ID NO: 1090 compared to variant Cas12i2 mRNA of SEQ ID NO: 1089. No statistical difference was observed using 5'- and 3'-modified RNA guide E2T5 versus 3'-only modified RNA guide E2T5.
[0435] Thus, this example shows that HAO1 can be targeted by Cas12i2 mRNA constructs and chemically modified RNA guides in mammalian cells.
[0436] Example 6 - Off-target analysis of Cas12i2 and HAO1-targeting RNA guides This example describes on-target versus off-target evaluation of Cas12i2 variants and HAO1-targeting RNA guides.
[0437] HEK293T cells were transfected with a plasmid encoding variant Cas12i2 of SEQ ID NO: 924 or variant Cas12i2 of SEQ ID NO: 927, and plasmids encoding E2T5 (SEQ ID NO: 989), E1T2 (SEQ ID NO: 967), E1T3 (SEQ ID NO: 968), and E2T10 (SEQ ID NO: 994) according to the method described in Example 16 of PCT / US21 / 25257. Then, the tagmentation-based tag insertion site sequencing (TTISS) method described in Example 16 of PCT / US21 / 25257 was performed.
[0438] Figures 7A and 7B show plots showing on-target and off-target TTISS reads. The black wedges and numbers in the middle represent the percentage of on-target TTISS reads. Each grey wedge represents a unique off-target site identified by TTISS. The size of each grey wedge represents the percentage of TTISS reads mapping to a given off-target site. Figure 7A shows TTISS reads for variant Cas12i2 of SEQ ID NO:924, and Figure 7B shows TTISS reads for variant Cas12i2 of SEQ ID NO:927.
[0439] As shown in FIG. 7A, the pair of variant Cas12i2 of sequence number 924 with E2T5 demonstrated low probability of off-target editing, as 100% of TTISS reads were mapped on-target. No TTISS reads were mapped to potential off-target sites. E1T2 also demonstrated low probability of off-target editing. For E1T2, 98% of TTISS reads were mapped on-target, with two potential off-target sites representing a total of 2% of TTISS reads. For E5T10, 95% of TTISS reads were mapped on-target, with two potential off-target sites representing a total of 5% of TTISS reads. E2T10 demonstrated a higher probability of off-target editing using the TTISS method. For E2T10, only 65% of TTISS reads were mapped on-target, with four potential off-target sites representing a total of 35% of the remaining TTISS reads. For E2T10, one potential off-target represented the majority of potential off-target TTISS reads.
[0440] As shown in FIG. 7B, the pairing of variant Cas12i2 of SEQ ID NO: 927 with E2T5 demonstrated low probability of off-target editing, as 100% of TTISS reads were mapped on-target. No TTISS reads were mapped to potential off-target sites. Also, the pairing of variant Cas12i2 of SEQ ID NO: 927 with E1T2 or E1T3 demonstrated low probability of off-target editing. For E1T2, 100% of TTISS reads in replicate 1 and 96% of TTISS reads in replicate 2 were mapped on-target, with two potential off-target sites representing the remaining 4% of TTISS reads in replicate 2. For E1T3, 100% of TTISS reads in replicate 1 and 92% of TTISS reads in replicate 2 were mapped on-target, with two potential off-target sites representing the remaining 8% of TTISS reads in replicate 2.
[0441] Thus, this example shows that compositions comprising Cas12i2 and an HAO1-targeting RNA guide contain distinct off-target activity profiles.
[0442] Example 7 - HAO1 protein knockdown with Cas12i2 and HAO1-targeting RNA guide This example describes the use of Western blot to identify knockdown of HAO1 protein using variant Cas12i2 of SEQ ID NO:924 and an HAO1-targeting RNA guide.
[0443] Primary hepatocytes from human donors were thawed very quickly from liquid nitrogen in a 37°C water bath. The cells were added to pre-warmed hepatocyte collection medium (Thermo Fisher, CM7000) and centrifuged at 100g for 10 minutes. The cell pellet was resuspended in an appropriate volume of hepatocyte plating medium (Williams Medium E, Thermo Fisher A1217601, supplemented with Hepatocyte Plating Complement Pack (with serum), Thermo Fisher CM3000). The cells were subjected to trypan blue viability counting in an Inucyte disposable hemocytometer (Fisher scientific, 22-600-100). The cells were then washed in PBS and resuspended in P3 buffer + supplements (Lonza, VXP-3032) at a concentration of approximately 5000 cells / μL. Resuspended cells were dispensed into Lonza electroporation cuvettes at 500,000 cells / reaction.
[0444] For the RNP reaction, E2T5 (SEQ ID NO: 989) was used as the HAO1 target RNA guide. RNP was added to each reaction at a final concentration of 20 μM (Cas12i2), and then transfection enhancer oligo was added at a final concentration of 4 μM. Unelectroporated cells and cells subjected to electroporation without cargo were used as negative controls.
[0445] The strips were subjected to electroporation using an electroporation device (program CA137, Lonza 4D-nucleofector). Immediately after electroporation, pre-warmed hepatocyte plating medium was added to each well and mixed very gently by pipette. For each technical replicate plate, 500,000 cells of diluted nucleofected cells were plated in a pre-warmed collagen-coated 24-well plate (Thermo Fisher) with wells containing hepatocyte plating medium. The cells were then incubated at 37°C. After the cells had attached after 24 hours, the medium was changed to hepatocyte maintenance medium (William's medium E supplemented with William's E medium Cell Maintenance Cocktail, Thermo Fisher CM 4000, Thermo Fisher A1217601). Fresh hepatocyte maintenance medium was replaced every 48 hours.
[0446] Sixteen days after RNP electroporation, media was aspirated and cells were gently washed with PBS. Cells were then lysed in RIPA Lysis and Extraction buffer (Thermo Fisher 89901) + 1X protease inhibitors (Thermo Fisher 78440) for 30 min on ice, with samples mixed every 5 min. Cell lysates were quantified via Pierce BCA Protein Assay Kit (Thermo Fisher 23227). 15 μg total protein per sample was prepared for SDS-PAGE in 1X Laemmlli Sample buffer (BioRad 1610747) and 100 mM DTT, then heated at 95 °C for 10 min. Samples were run on a 4-15% TGX gel (BioRad 5671084) at 200 V for 45 min. Samples were transferred to 0.2 um nitrocellulose membranes (BioRad 1704159) using a Transblot Turbo system. Membranes were blocked in Intercept TBS Blocking Buffer (Li-cor 927-60001) for 30 minutes at room temperature. Blots were then incubated overnight at 4°C in primary anti-HAO1 antibody (Genetex GTX81144) at a dilution of 1:1000 and primary anti-vinculin antibody (Sigma V9131) at a dilution of 1:2500 in blocking buffer. Blots were washed three times for 5 minutes each with TBST (ThermoFisher 28360) and then incubated with IR680 anti-mouse (ThermoFisher PI35518) and IR800 anti-rabbit secondary antibodies (ThermoFisher PISA535571) at a dilution of 1:12500 in TBST for 1 hour at room temperature. Blots were then washed three times for 5 min each with TBST and visualized on a Li-cor Odyssey CLX.
[0447] Knockdown of HAO1 protein was observed in primary human hepatocytes at day 7 after editing with Cas12i2 RNP and E2T5 targeting the HAO1 gene (lanes 1-3 in FIG. 8). No HAO1 knockdown was observed for the buffer only control (lanes 4-7).
[0448] Thus, this example shows that HAO1 protein levels were reduced following editing with Cas12i2 and an HAO1-targeting RNA guide.
[0449] Other embodiments All of the features disclosed herein may be combined in any combination. Each feature disclosed herein may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only one example of a generic series of equivalent or similar features.
[0450] From the above description, those skilled in the art can easily ascertain the essential features of the present invention, and can make various changes and modifications to the present invention to adapt it to various uses and conditions without departing from the spirit and scope thereof. Accordingly, other embodiments are also within the scope of the claims.
[0451] Equivalent While several embodiments of the invention have been described and illustrated herein, those skilled in the art will readily envision various other means and / or structures for performing the functions described herein and / or obtaining one or more of the results and / or advantages described herein, and each of such variations and / or modifications are deemed to be within the scope of the embodiments of the invention described herein. More generally, all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and those skilled in the art will readily appreciate that the actual parameters, dimensions, materials, and / or configurations will depend on the particular application or applications for which the teachings of the invention are used. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments of the invention described herein. Thus, the above-described embodiments are presented by way of example only, and it should be understood that within the scope of the appended claims and their equivalents, the embodiments of the invention may be practiced otherwise than as specifically described and claimed. The inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods is included within the inventive scope of the present disclosure, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent.
[0452] All definitions and uses herein should be understood to take precedence over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.
[0453] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may include the entire document.
[0454] As used in this specification and the claims, unless clearly indicated to the contrary, the indefinite articles "a" and "an" should be understood to mean "at least one."
[0455] As used herein in the specification and claims, the term "and / or" should be understood to mean "either or both" of the elements so conjoined, e.g., elements that are present conjunctively in some cases and disjunctively in other cases. Multiple elements listed with "and / or" should be interpreted in the same manner, i.e., "one or more" of the elements so conjoined. Other elements other than the elements specifically identified by the "and / or" clause may optionally be present, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to "A and / or B", when used with an open-ended term such as "comprising", may refer in one embodiment to only A (optionally including elements other than B), in another embodiment to only B (optionally including elements other than A), in yet another embodiment to both A and B (optionally including other elements), etc.
[0456] As used in this application, in the specification and claims, "or" should be understood to have the same meaning as "and / or" defined above. For example, when separating items in a list, "or" or "and / or" is to be interpreted as inclusive, i.e., including at least one of, but also including more than one, and optionally including additional unlisted items, of some elements or a list of elements. Only terms clearly indicating the contrary, such as "only one of" or "exactly one of," or when used in the claims, "consisting of" refers to the inclusion of exactly one element of some elements or a list of elements. In general, as used herein, the term "or" is only to be interpreted as indicating exclusive alternatives (e.g., "one or the other, but not both") when preceded by terms of exclusivity, such as "either," "one of," "only one of," or "exactly one of." When used in the claims, "consisting essentially of" has its ordinary meaning as used in the field of patent law.
[0457] As used herein in the specification and claims, the phrase "at least one" should be understood in reference to a list of one or more elements to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each element specifically listed in the list of elements, and not excluding any combination of elements in the list of elements. This definition also allows for the optional presence of elements other than those specifically identified in the list of elements to which the phrase "at least one" refers, whether or not related to the specifically identified elements. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B" or, equivalently, "at least one of A and / or B") can refer in one embodiment to at least one A, optionally including two or more As, and no B (optionally including elements other than B); in another embodiment to at least one B, optionally including two or more Bs, and no A (optionally including elements other than A); in yet another embodiment to at least one A, optionally including two or more As, and at least one B, optionally including two or more Bs (optionally including other elements); and so forth.
[0458] It is also to be understood that, unless expressly stated to the contrary, in any method claimed in this specification that includes two or more steps or actions, the order of the method steps or actions is not necessarily limited to the order in which the method steps or actions are recited.
Claims
1. A gene editing system for gene editing of the hydroxyacid oxidase 1 (HAO1) gene, comprising: (i) a Cas12i2 polypeptide or a first nucleic acid encoding said Cas12i2 polypeptide, wherein said Cas12i2 polypeptide comprises an amino acid sequence that is at least 95% identical to SEQ ID NO: 922 and comprises one or more mutations relative to SEQ ID NO: 922, a Cas12i2 polypeptide or a first nucleic acid; (ii) an RNA guide or a second nucleic acid encoding said RNA guide, wherein said RNA guide comprises a spacer sequence specific for a target sequence within the HAO1 gene, said target sequence being adjacent to a protospacer adjacent motif (PAM), said PAM comprising a motif of 5'-TTN-3', and said motif of 5'-TTN-3' being located 5' relative to said target sequence, an RNA guide or a second nucleic acid; The gene editing system, wherein said one or more mutations in said Cas12i2 polypeptide are at positions D581, G624, F626, P868, I926, V1030, E1035, and / or S1046 of SEQ ID NO:
922.
2. Said Cas12i2 polypeptide is: (i) mutations at positions D581, D911, I926, and V1030; (ii) mutations at positions D581, I926, and V1030; (iii) mutations at positions D581, I926, V1030, and S1046; (iv) mutations at positions D581, G624, F626, I926, V1030, E1035, and S1046, or (v) mutations at positions D581, G624, F626, P868, I926, V1030, E1035, and S1046, the gene editing system according to claim 1.
3. Said Cas12i2 polypeptide is: (i) amino acid substitutions of D581R, D911R, I926R, and V1030G; (ii) amino acid substitutions of D581R, I926R, and V1030G; (iii) amino acid substitutions of D581R, I926R, V1030G, and S1046G; (iv) amino acid substitutions of D581R, G624R, F626R, I926R, V1030G, E1035R, and S1046G, or (v) amino acid substitutions of D581R, G624R, F626R, P868T, I926R, V1030G, E1035R, and S1046G, the gene editing system according to claim 2.
4. The gene editing system according to claim 1, wherein the Cas12i2 polypeptide comprises the amino acid sequence of SEQ ID NO: 927, 924, 923, 925 or 926.
5. The gene editing system according to claim 1, comprising the first nucleic acid encoding the Cas12i2 polypeptide.
6. The gene editing system according to claim 5, wherein the first nucleic acid is messenger RNA (mRNA).
7. The gene editing system according to claim 5, wherein the first nucleic acid is a DNA fragment contained within a viral vector.
8. The gene editing system according to claim 1, wherein the target sequence is within exon 1 or exon 2 of the HAO1 gene.
9. The target sequence is (i) 5'-CAAAGTCTATATATGACTAT-3' (SEQ ID NO: 1025), (ii) 5'-GGAACTACTGATTTAGCATG-3' (SEQ ID NO: 1026), (iii) 5'-TAGATGGAAGCTGTATCCAA-3' (SEQ ID NO: 1046), (iv) 5'-CGGAGCATCCTTGGAATACAG-3' (SEQ ID NO: 1047), or (v) 5'-AGGACAGAGGGTCAGCATGC-3 (SEQ ID NO: 1052), and the gene editing system according to claim 8.
10. The spacer sequence is (i) 5'-CAAAGUCUATAUAUUGACUAU-3' (SEQ ID NO: 1093, (ii) 5'-GGAACTACUGAUUUAGCAUG-3' (SEQ ID NO: 1094), (iii) 5'-UAGATGGAAGCUGUAUCCAA-3' (SEQ ID NO: 1095), (iv) 5'-CGGAGCAUCCUUGGAUACAG-3' (SEQ ID NO: 1096), or (v) 5'-AGGACAGAGGGUCAGCAUGC-3 (SEQ ID NO: 1097), and the system according to claim 9.
11. The gene editing system according to claim 1, wherein the RNA guide comprises the spacer and a direct repeat sequence.
12. The gene editing system according to claim 11, wherein the direct repeat sequence is identical to at least 90% of any one of SEQ ID NOs: 1-10, or a fragment thereof that is at least 23 nucleotides in length.
13. The gene editing system according to claim 12, wherein the direct repeat sequence is 5'-AGAAAUCCGUCUUCUCAUUGACGG-3' (SEQ ID NO: 10).
14. The RNA guide is (i) 5'-AGAAAUCCGUCUUCUCAUUGACGGCAAAGUCAUAUAUACUAUA-3' (SEQ ID NO: 967), (ii) 5'-AGAAAUCCGUCUUCUCAUUGACGGGGAUGACUUGAGCAUG-3' (SEQ ID NO: 968), (iii) 5'-AGAAAUCCGUCUUCUCAUUGACGGUAGACGGAAGCUGUACCAA-3' (SEQ ID NO: 988), (iv) 5'-AGAAAUCCGUCUUCUCAUUGACGGCGGAGCAUCCUUGGAUACAG-3' (SEQ ID NO: 989), or (v) 5'-AGAAAUCCGUCUUCUCAUUGACGGAGGACAGAGGGUCAGCAUGC-3' (SEQ ID NO: 994) The gene editing system according to claim 1, comprising a nucleotide sequence of.
15. The gene editing system according to claim 1, wherein the system comprises the RNA guide.
16. The RNA guide is (i) 5'-AGAAAUCCGUCUUCUCAUUGACGGCAAAGUCAUAUAUACUAUA-3' (SEQ ID NO: 967), (ii) 5'-AGAAAUCCGUCUUCUCAUUGACGGGGAUGACUUGAGCAUG-3' (SEQ ID NO: 968), (iii) 5'-AGAAAUCCGUCUUCUCAUUGACGGUAGACGGAAGCUGUACCAA-3' (SEQ ID NO: 988), (iv) 5'-AGAAAUCCGUCUUCUCAUUGACGGCGGAGCAUCCUUGGAUACAG-3' (SEQ ID NO: 989), or (v) 5'-AGAAAUCCGUCUUCUCAUUGACGGAGGACAGAGGGUCAGCAUGC-3' (SEQ ID NO: 994) The gene editing system according to claim 15, comprising a nucleotide sequence of.
17. The gene editing system according to claim 1, wherein the system comprises one or more lipid nanoparticles (LNP), and the one or more LNP include (i), (ii), or both. The gene editing system according to claim 17, comprising a first nucleic acid which is an mRNA encoding the Cas12i2 polypeptide, and the RNA guide.
19. A gene editing system for gene editing of the hydroxyacid oxidase 1 (HAO1) gene, comprising: (i) a Cas12i polypeptide or a first nucleic acid encoding the Cas12i polypeptide; (ii) an RNA guide or a second nucleic acid encoding the RNA guide, wherein the RNA guide contains a spacer sequence specific to a target sequence within exon 1 or exon 2 of the HAO1 gene, the target sequence is adjacent to a protospacer adjacent motif (PAM), the PAM contains a motif of 5'-TTN-3', and the motif of 5'-TTN-3' is located 5' to the target sequence, and includes an RNA guide or a second nucleic acid; The target sequence is 【Chemical 1】 A gene editing system comprising the same.
20. The spacer sequence is 【Chemical 2】 The gene editing system according to claim 19, comprising the same.
21. The RNA guide is (i) 5'-AGAAAUCCGUCUUUCAUUUGACGGCAAAGUCAUAUAUAGACUAU-3' (SEQ ID NO: 967); (ii) 5'-AGAAAUCCGUCUUUCAUUUGACGGGGAAGUACUGAUUUAGCAUG-3' (SEQ ID NO: 968); (iii) 5'-AGAAAUCCGUCUUUCAUUUGACGGUAGAUUGGAAGCUGUAUCCA-3' (SEQ ID NO: 988); (iv) 5'-AGAAAUCCGUCUUUCAUUUGACGGCGGAGCAUCCUUGGAUACAG-3' (SEQ ID NO: 989); or (v) 5'-AGAAAUCCGUCUUUCAUUUGACGGAGGACAGAGGGUCAGCAUGC-3' (SEQ ID NO: 994). The gene editing system according to claim 20, comprising a nucleotide sequence.
22. A pharmaceutical composition comprising the gene editing system according to any one of claims 1 to 21.
23. A kit comprising elements (i) and (ii) of the gene editing system according to any one of claims 1 to 21.
24. A method for editing the hydroxyacid oxidase 1 (HAO1) gene in a cell, the method comprising contacting a host cell with the gene editing system for editing the HAO1 gene according to any one of claims 1 to 21 to genetically edit the HAO1 gene in the host cell, wherein the host cell is cultured in vitro.
25. A pharmaceutical composition for treating primary hyperoxaluria (PH) in a subject, the pharmaceutical composition comprising the gene editing system for editing the hydroxyacid oxidase 1 (HAO1) gene according to any one of claims 1 to 21.
26. The pharmaceutical composition according to claim 25, wherein the PH is PH1.
27. An RNA guide comprising: (i) a spacer sequence specific for a target sequence in the hydroxyacid oxidase 1 (HAO1) gene, wherein the target sequence is adjacent to a protospacer adjacent motif (PAM), the PAM comprising a motif of 5'-TTN-3', and the motif of 5'-TTN-3' is located 5' to the target sequence; and (ii) a direct repeat sequence.
28. The target sequence comprises [Chemical Formula 3] The RNA guide according to claim 27.
29. The spacer sequence comprises 【Chemical Formula 4】 The RNA guide according to claim 28.
30. (i) 5'-AGAAAUCCGUCUUUCAUUUGACGGCAAAGUCUAUAUAUGACUAU-3' (SEQ ID NO: 967), (ii) 5'-AGAAAUCCGUCUUUCAUUUGACGGGGAAGUACUGAUUUAGCAUG-3' (SEQ ID NO: 968), (iii) 5'-AGAAAUCCGUCUUUCAUUUGACGGUAGAUUGGAAGCUGU AUCAA-3' (SEQ ID NO: 988), (iv) 5'-AGAAAUCCGUCUUUCAUUUGACGGCGGAGCAUCCUUGGAUACAG-3' (SEQ ID NO: 989), or (v) 5'-AGAAAUCCGUCUUUCAUUUGACGGAGGACAGAGGGUCAGCAUGC-3' (SEQ ID NO: 994). The RNA guide according to claim 27.