Lentiviral Vectors

Abstract

The present invention relates to novel closed linear DNA vectors suitable for use in the production of lentiviral particles. Notably, the present invention relates to a new configuration of vectors (often called "payload" vectors) containing transgenes, which allows to prepare a higher yield of infectious lentiviral particles, notably lentiviral particles carrying transgenes, when compared to closed linear DNA vectors lacking this configuration. Furthermore, the inventors have developed improvements in lentiviral production with closed linear DNA through the optimization of vector input amounts and construct ratios. The present invention further relates to a method of using the constructs to generate infectious lentiviral particles, optionally with the improvement of the production vector and / or the optimization of the method.

Description

[Technical field]

[0001] The present invention relates to a novel closed linear DNA vector suitable for use in the production of lentiviral particles. Notably, the present invention relates to a new configuration of a vector (often referred to as a "payload" vector) containing a transgene, which allows for a higher yield of infectious lentiviral particles, notably a higher yield of lentiviral particles carrying a transgene, when compared to a closed linear DNA vector lacking this configuration. Furthermore, the inventors have developed an improvement in lentiviral production with closed linear DNA through the optimization of vector input amount and construct ratio. The present invention further relates to a method of producing infectious lentiviral particles using the construct, optionally with the improvement of the production vector and / or the optimization of the method described herein. [Background technology]

[0002] Viral vectors provide an efficient means for the modification of eukaryotic cells, and their use is now widespread in both academic laboratories and industrial fields, for both research and clinical gene therapy applications. The spectrum of viral vectors is very broad, ranging from DNA viruses, such as adenoviruses, to RNA viruses, such as retroviruses. Lentiviruses are a genus of viruses in the Retroviridae family, characterized by a positive-sense single-stranded RNA genome that encodes the gag, pol and env protein-encoding genes, along with the regulatory genes tat and rev. Infectious lentiviral virions enter host cells through direct fusion with the host cell membrane or receptor-mediated endocytosis, and upon entry, the lentiviral core is released and reverse transcription of the lentiviral genome occurs. The resulting double-stranded proviral DNA is then integrated into the genome of the infected host cell, where it relies on the host cellular machinery to initiate and complete the transcription and translation of viral proteins required for the assembly of infectious particles.

[0003] Based on this framework and taking advantage of the highly efficient integration ability of lentivirus, lentiviral particles (LVPs) have been developed as efficient vehicles for gene transfer in mammalian cells.The majority of lentiviral particles are derived from HIV-1, which is the most widely studied lentivirus, but other lentiviruses, such as HIV-2 and simian immunodeficiency virus, as well as non-primate lentiviruses, including feline immunodeficiency virus, bovine immunodeficiency virus and caprine arthritis-encephalitis virus, have also been developed as gene transfer vehicles.

[0004] To overcome safety concerns about the pathogenicity of HIV-1 in humans, several generations of replication-deficient lentiviral particle systems have been developed. In principle, this has been achieved by (1) generating a "minimal lentiviral genome" through the removal of unnecessary lentiviral virulence / accessory genes; (2) isolating lentiviral genes / sequences essential for lentivirus generation into suitable constructs / cassettes to minimize the possibility of generating replication-competent lentivirus. The most recently developed third generation lentiviral (LV) system consists of four separate vectors: two packaging vectors encoding rev and gag-pol, where (i) rev encodes protein expression for the nuclear export of the viral genome, (ii) gag and pol encode the viral capsid structural proteins, as well as the enzymes reverse transcriptase, integrase and protease, respectively; (iii) an envelope vector encodes env, which is responsible for the expression of the envelope glycoprotein that mediates cell entry; and (iv) a transport vector encodes a transgene driven by a heterologous strong promoter. Third generation quadruple transfection production systems are described, for example, in Dull et al., Journal Of Virology, 72 (1998), which is incorporated herein by reference. A further development is the development of self-inactivating (SIN) constructs, in which the transfer vector contains a SIN lentiviral long terminal repeat (LTR) configuration in which the cognate promoter / enhancer sequence in the U3 region of the 3'LTR is deleted, reducing the risk of unwanted activation of genes adjacent to the lentiviral particle insertion site and reducing the risk of lentiviral particle mobilization.

[0005] The improved safety profile of SIN lentiviral particles, coupled with their ability to stably transduce both dividing and non-dividing cells, has prompted the rapid growth of their use as gene therapy vectors in clinical studies. However, clinical trials require large quantities of high titers of infectious lentiviral particles, demanding efficient, cost-effective and scalable production methods.

[0006] Lentiviral particle synthesis can be subdivided into two main categories: stable lentiviral particle production and transient lentiviral particle production. The former method involves the transfection of a transfer vector encoding a single transgene into a stable lentiviral particle-producing cell line that has the necessary helper functions to produce functional lentiviral particles. However, the difficulties in developing a stable producing cell line capable of high titer lentiviral particle production mean that transient lentiviral particle production has been preferred. Current transient lentiviral particle production methods are based on the co-transfection of a permissive packaging cell line with multiple DNA vectors encoding lentiviral elements (rev, gag-pol, env) and transfer vectors. Typically, the DNA vectors are present in the form of plasmid DNA (pDNA), and the preferred packaging cells are the human embryonic kidney 293 cell line (HEK293) or its derivatives (e.g. HEK293T).

[0007] The production of large quantities of high-quality DNA required for transient lentiviral particle production is a major hurdle in the manufacturing process and a notable obstacle in the widespread clinical use of lentiviral particles for gene therapy. In addition, there are several drawbacks associated with the bioproduction of lentiviral particles in the pDNA platform. GMP pDNA manufacturing is costly and complex, and the DNA product may ultimately be contaminated with bacterial propagation elements that are unnecessary for virus production in mammalian cells. In addition, eukaryotic expression cassettes may occasionally contain gene sequences that produce toxic or problematic effects in bacteria, which limits their amplification. For example, some therapeutically relevant genes are difficult to propagate in bacteria due to sequence toxicity or complexity (Feldman et al. (2014) The Nav channel bench series:plasmid preparation. Methods X., 1:6-11; McMahon et al. (2015) NIH Public Access, 27:320-31).

[0008] Synthetic in vitro amplification as described in WO2010 / 086626, WO2012 / 017210, WO2016 / 132129 and WO2018 / 033730 (incorporated herein by reference in their entirety) allows the production of GMP closed linear DNA vectors up to multi-gram scale in 2 weeks. The resulting closed linear DNA molecules are minimal, contain only the user-defined sequence of interest, and are free of antibiotic resistance genes or origins of replication. Furthermore, the use of enzymatic DNA amplification platforms to produce closed DNA vectors for lentiviral particle production may allow lentiviral particle packaging of complex DNA sequences that were previously incompatible with bacterial propagation systems. Therefore, due to their favorable safety profile and ease of large-scale manufacturing, closed linear DNA vectors are promising alternatives to pDNA for use in lentiviral particle production.

[0009] Karda et al. (2019) demonstrated that closed linear DNA vectors can be used to produce lentiviral particles in a second generation lentiviral particle platform with transgene expression comparable to pDNA-derived lentiviral particles in vitro, and titer-matched vectors have similar transgene expression in vivo. However, it was observed that the infectious titers of lentiviral particles produced using closed linear DNA vectors were lower than pDNA-derived LV. Second generation lentiviral production involves the use of a single packaging plasmid encoding Gag, Pol, Rev and Tat genes, an envelope plasmid encoding VSVg, and a transfer vector in which transgene expression from the 5' wild-type LTR is Tat-dependent. When transferring this technology to a third generation lentiviral particle platform in which modified LTRs are used (both 5' and 3') and the dependency on Tat is removed, the applicants found that the infectious yield was further reduced. Indeed, although there appeared to be sufficient abundance of both transfected DNA (Figure 1B) and viral genomic RNA in the transfected cells for the generation of infectious particles (Figure 1), this did not result in a sufficient yield of infectious lentiviral particles carrying the transgene (Figure 2). Thus, the yield of infectious particles was not comparable to that achieved with other DNA vector formats. To address this, experiments were first performed to reduce the amount of vector DNA used in the transfection. This had the effect of increasing the total particle titer (Figure 2B). Next, studies were performed to optimize the construct ratio using reduced DNA input. These studies further increased the total particle titer but did not rescue the reduced yield of infectious particles (Figure 3). Thus, without being bound by theory, it is hypothesized by the inventors that the effect is related to the properties of the closed linear DNA itself.Therefore, the inventors have developed a novel closed linear DNA vector that can be used for lentiviral particle production and that results in significantly higher infectious titers than the "standard" closed linear DNA vector described in Karda et al. (2019) and comparable to those derived from pDNA. Summary of the Invention

[0010] The present invention relates to novel closed linear DNA vectors suitable for use in the production of lentiviral particles.The novel vectors have a configuration that allows them to prepare a higher yield of infectious lentiviral particles compared to closed linear DNA vectors that lack this configuration.The present invention further relates to a method for producing infectious lentiviral particles using the constructs described herein.

[0011] The present invention provides novel lentiviral transfer vectors in a closed linear DNA format, which contain a transgene of interest for inclusion within the lentiviral particle as an RNA molecule.

[0012] The present invention relates to: A closed linear DNA vector suitable for use as a lentiviral transfer vector, comprising, in 5' to 3' order, the sequence: (a) Hybrid 5′ long terminal repeat (LTR) sequence; (b) a promoter operably linked to the transgene; (c) 3′ self-inactivating (SIN) LTR sequence; (d) a poly(A) signal sequence; and (e) Spacer sequence A closed linear DNA vector comprising to provide.

[0013] Additional sequences, such as additional spacer sequences, may be included within the closed linear DNA vector. In the vector, the promoter and transgene, along with any additional sequences, are effectively flanked on both sides by 5' and 3' LTR sequences.

[0014] Thus, the present invention provides: A closed linear DNA vector suitable for use as a lentiviral transfer vector comprising: (a) a promoter operably linked to the transgene; and (b) sequences encoding a hybrid 5' long terminal repeat (LTR) and a 3' self-inactivating (SIN) LTR flanking the promoter and transgene; and (c) a sequence encoding a poly(A) signal located 3' of the 3' SIN LTR; and (d) a spacer sequence located 3' to the sequence encoding the poly(A) signal; A closed linear DNA vector comprising to provide.

[0015] Therefore, a novel arrangement according to any of the present invention includes a sequence within the lentiviral transfer vector that is present 3' of the 3'SIN LTR sequence to improve inclusion of the transgene into the lentiviral particle.

[0016] Furthermore, the spacer sequence of the closed linear DNA vector according to any description of the present invention may be any suitable length of nucleotide sequence. Spacer sequence is generally understood to be a non-coding DNA sequence that may or may not have a specific sequence. Spacer sequence may be at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, at least 1400 or at least 1500 nucleotides in length. Optionally, the spacer sequence may be any range of nucleotides of length disclosed herein. It may be preferred that the spacer is at least 250, at least 500 or most preferably at least 1000 nucleotides (1 kb) in length.

[0017] The LTR sequences contained within the closed linear DNA vector described herein in any embodiment are both modified from wild-type LTR sequences. The 5'LTR is a hybrid sequence, and the 5'LTR is modified, optionally by replacing all or part of the U3 region with a heterologous promoter. The 3'LTR is also modified so that the LVP produced is self-inactivating (SIN). This usually involves the deletion of all or part of the U3 region of the 3'LTR. Such modifications of the LTR are made to improve the safety of the LVP by (1) removing the requirement for the viral gene tat for transcription of the viral genome, thereby reducing the possibility of the emergence of replication-competent retroviruses (RCR) through recombination events during production, and (2) removing the risk of insertional mutagenesis through LTR enhancer activity. The modification of the LTR sequence represents the difference between second generation (wild-type LTR) and third generation (modified LTR) lentiviral transfer vectors.

[0018] Furthermore, the sequence encoding the poly(A) signal (or the poly(A) signal sequence) in the closed linear DNA vector described in any embodiment herein can be a sequence for a strong poly(A) signal. A strong poly(A) signal is a signal that provides efficient transcription termination. Those skilled in the art will recognize suitable poly(A) signals, such as the simian virus 40 (SV40) late poly(A) sequence, bovine growth hormone poly(A) (bGHpA), rabbit β-globin (rbGlob) or sequences with at least 90% homology thereto.

[0019] Furthermore, the sequence encoding the poly(A) signal (or the poly(A) signal sequence) in the closed linear DNA vector described in any embodiment herein may contain additional helper sequences, optionally one or more upstream sequence elements (USEs), which may act to improve the efficiency of the poly(A) signal.

[0020] Furthermore, the sequence encoding the 3'SIN LTR (or the 3'SIN LTR sequence) in the closed linear DNA vector described in any embodiment herein contains a deletion compared to the wild-type LTR. Optionally, the deletion is in whole or in part within the U3 region of the 3'LTR. Optionally, the 3'SIN LTR contains a 133 nucleotide U3 deletion at nucleotide positions -149 to -9 relative to the transcription start site compared to the wild-type 3'LTR. The 3'LTR sequence can be further modified by required deletions or insertions. In a preferred embodiment, the modified 5' and 3'LTRs are derived from HIV-1. When alternative LTRs are used, similar deletions and insertions can be performed by those skilled in the art to achieve the same effect.

[0021] Additionally, the closed linear DNA vectors described in any embodiment herein may contain other sequences for other elements that may be beneficial in the production of infectious lentiviral particles. These other elements are described herein, including, but not limited to, any one or more of: WPRE, Psi, RRE, cPPT, GAG, POL, ENV, REV or any other packaging element.

[0022] Furthermore, the closed linear DNA vector may further comprise one or more additional spacer sequences. The additional spacer sequence is preferably a 5' spacer sequence, for example, it is located 5' of the sequence for 5' LTR. The additional spacer sequence may be any suitable length of nucleotide sequence. Spacer sequence is generally understood to be a sequence of non-coding DNA that may or may not have a specific sequence. The spacer sequence may be at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, at least 1400 or at least 1500 nucleotides in length. Optionally, the spacer sequence may be any range of nucleotides of length disclosed herein. It may be preferred that the spacer is at least 250, at least 500 or most preferably at least 1000 nucleotides (1 kb) in length. When the closed linear DNA vector comprises two or more spacer sequences, the spacer sequences may be of the same or different nucleotide sequences and may be of the same or different lengths.

[0023] The closed linear DNA transfer vector described in any embodiment herein provides a template for the RNA lentiviral "genome" that is inserted into the particle during production. Thus, part of the sequence (e.g., transgene) in the closed linear DNA vector is a template for the associated RNA sequence that is packaged into the particle. Thus, the DNA vector provides the associated code for the RNA sequence. Reference to "encoding" in this respect is understood to mean that the sequence of the closed linear DNA vector codes for single-stranded RNA (ssRNA). Thus, the closed linear DNA vector includes all the instructions for producing the correct single-stranded RNA for inclusion in the lentiviral particle. Thus, the closed linear DNA vector includes the sequence for the transgene, as well as the operably linked promoter, 5'LTR and 3'SIN LTR in the RNA.

[0024] Effectively, the 5'LTR and 3'SIN LTR form the "flanking ends" of lentiviral RNA, and therefore the sequence between these two elements in the closed linear DNA vector forms the lentiviral ssRNA for packaging. In conventional LV vectors, the ssRNA is then reverse transcribed to give a double-stranded DNA (dsDNA) product, which then enters the nucleus of the transfected cell. Thus, the closed linear DNA vector in this case contains the same sequences for the promoter and transgene in the reverse transcribed DNA. However, newer variants allow the ssRNA of the LV particle to be used as mRNA in the transfected cell.

[0025] It will be understood by those skilled in the art that other sequences contained within the closed linear transfer vector that are not located between (or flanked by) the 5'LTR and 3'SIN LTR are not included in the ssRNA inserted into the LV particle. Thus, the polyA signal sequence and spacer sequences from the closed linear transfer vector are transcribed in the producer cell, but the RNA is then efficiently processed to form the final RNA molecule for packaging, flanked on both sides by the LTRs.

[0026] Thus, with respect to a closed linear transfer vector, it may be described as containing sequences such as one or more of: a 5' LTR, a 3' SIN LTR, a transgene (also called payload), a promoter, a polyA signal sequence; a spacer sequence and any additional sequences, or it may alternatively be described as encoding such sequences, since production involves transcription of the sequences of the closed linear DNA vector into an RNA molecule.

[0027] The closed linear DNA vector described herein is a lentiviral transfer vector that contains a payload sequence or transgene.However, the inventors have determined that these modifications can also be applied to production vectors, and that these vectors are required for the production of lentiviral particles.

[0028] Thus, if the production vector(s) is formatted as a closed linear DNA vector, the modifications described above may also be applied to the production vector(s). Thus, the closed linear DNA production vector may comprise one or more spacer sequences. The spacer sequences may be present 3' of the gene / termination sequence / expression cassette and / or 5' of said sequence.

[0029] Thus, the present invention provides: A closed linear DNA vector suitable for use as a lentiviral production vector comprising: (a)(i) Lentivirus group-specific antigen (GAG) genes; (ii) lentiviral polymerase (POL) gene; (iii) the envelope gene (ENV); and / or (iv) Lentiviral Regulatory Gene (REV) At least one expression cassette comprising one or more of: (b) a spacer sequence located 3' of the expression cassette; A closed linear DNA vector comprising Includes.

[0030] Preferably, the envelope gene (ENV) is the vesicular stomatitis virus glycoprotein (VSV-G) gene. As used herein, an expression cassette may be as minimal as a promoter operably linked to a transgene, or it may include additional sequences, such as a termination sequence. As used herein, a termination sequence may include a polyA signal sequence, or may use a 3' SIN LTR.

[0031] Spacer sequences may therefore be present 3' and / or 5' to the expression cassette. Moreover, the spacer sequence of the closed linear DNA vector may be a nucleotide sequence of any suitable length. A spacer sequence is generally understood to be a sequence of non-coding DNA that may or may not have a specific sequence. The spacer sequence may be at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, at least 1400 or at least 1500 nucleotides in length. In some cases, the spacer sequence may be any range of nucleotides of length disclosed herein. It may be preferred that the spacer is at least 250, at least 500 or most preferably at least 1000 nucleotides (1 kb) in length. When the closed linear DNA vector comprises more than one spacer sequence, the spacer sequences may be the same or different nucleotide sequences and may be the same or different lengths.

[0032] Lentiviral production vectors comprising an expression cassette encoding GAG / POL or REV may preferably comprise a spacer sequence 3' of the expression cassette. Closed linear DNA vectors for use as lentiviral production vectors comprising an expression cassette encoding GAG / POL or REV may preferably comprise a spacer sequence 3' of the expression cassette.

[0033] Optionally, the present invention relates to a set of closed linear DNA vectors suitable for use in producing lentiviral particles, comprising at least one lentiviral transfer vector as described herein and at least one lentiviral production vector as described herein. Optionally, the set of closed linear DNA vectors comprises the lentiviral transfer vector as described herein, together with at least three lentiviral production vectors as described herein. The three lentiviral production vectors can separately code for GAG / POL, ENV and REV. Any or all of the vectors can comprise a 3' spacer sequence as defined herein.

[0034] One or more of the closed linear DNA vectors of the present invention can be used to improve the production of lentiviral particles. At least the closed linear DNA transfer vector can be used to improve the infection titer.

[0035] Thus, there is provided a method for improving the infectious titer of lentiviral particles when the transfer (payload) vector is a closed linear DNA vector, comprising the step of introducing into a packaging cell or a producer cell a novel closed linear DNA vector (also referred to as a "closed linear transfer vector") as described in any embodiment herein.

[0036] In addition to the novel closed linear DNA transfer vectors described herein, the method of producing lentiviral particles may further comprise the step of introducing one or more production vectors into the packaging cells. The one or more production vectors encode the viral elements required for the manufacture of lentiviral particles. The one or more production vectors may include the following: (a) lentivirus group-specific antigen (GAG) genes; and / or (b) a lentiviral polymerase (POL) gene; and / or (c) the envelope gene (ENV); and / or (d) Lentiviral regulatory gene (REV) The nucleic acid sequence may be encoded as one or more of the following:

[0037] Preferably, the envelope gene (ENV) is the vesicular stomatitis virus glycoprotein (VSV-G) gene. The VSV-G envelope protein allows for broad tropism across a range of species and cell types.

[0038] The GAG ​​and POL genes may be encoded or contained in a single production vector. Additionally, any one or more of the genes listed as (a)-(d) above may alternatively be provided on a closed linear DNA vector, such that the genes are not required on a separate production vector or may already be present in the producer cell.

[0039] Furthermore, the production vector may be in any suitable format, such as a closed linear or circular DNA vector or a mixture thereof. When the production vectors are closed linear DNA, they preferably contain at least one spacer sequence. The spacer sequence may preferably be included 3' of the gene or expression cassette in the vector. The spacer sequence of the closed linear DNA vector may be a nucleotide sequence of any suitable length. Spacer sequence is generally understood to be a sequence of non-coding DNA that may or may not have a specific sequence. The spacer sequence may be at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, at least 1400 or at least 1500 nucleotides in length. Optionally, the spacer sequence may be any range of nucleotides of length disclosed herein. It may be preferred that the spacer is at least 250, at least 500 or most preferably at least 1000 nucleotides (1 kb) in length. Alternatively or additionally, a spacer sequence may be present 5' to the gene or expression cassette.

[0040] Further, the packaging cell is a permissive cell. Optionally, the packaging cell is a HEK293 cell or a variant or derivative thereof. Additionally, if producer cells are used, the producer cells are a stable cell line expressing the accessory packaging functions required for lentiviral particle production.

[0041] Furthermore, the closed linear transfer vector and / or production vector may be introduced into the packaging or producer cells by any suitable means, such as transfection, optionally chemical transfection. When the closed linear transfer vector and / or production vector is introduced into the packaging or producer cells by chemical transfection, the transfection agent may be selected from any one of calcium phosphate (CaPO4), polyethyleneimine (PEI) or lipofectamine.

[0042] Additionally, a method is provided for producing and recovering lentiviral particles from packaging or producer cells prepared by the methods of the present invention, the method comprising: (a) inducing the production of lentiviral particles in packaging cells transfected with at least one closed linear DNA vector adapted for the production of lentiviral particles; and / or (b) culturing the transfected packaging or producer cells; and (c) recovering / isolating the produced recombinant lentiviral particles from the culture medium. Includes.

[0043] The method may also include the use of one or more closed linear production vectors as described elsewhere herein. Thus, the method may include one or more closed linear DNA production vectors comprising: (a)(i) Lentivirus group-specific antigen (GAG) genes; (ii) lentiviral polymerase (POL) gene; (iii) the envelope gene (ENV); and / or (iv) Lentiviral Regulatory Gene (REV) At least one expression cassette comprising one or more of: (b) a spacer sequence located 3' of the expression cassette; The method may further comprise the use of said vector comprising:

[0044] Preferably, the envelope gene (ENV) is the vesicular stomatitis virus glycoprotein (VSV-G) gene. The expression cassette is as previously described.

[0045] Furthermore, the method of producing lentiviral particles or improving infectious lentiviral titer using closed linear DNA transfer vectors can be optimized by changing the total amount of DNA used to transfect cells, notably by reducing the total amount of DNA used to transfect cells. This reduction is achieved when compared to other DNA vector types, such as plasmids. Preferably, the total amount of transfected DNA is less than 1 μg / ml, less than 0.9 μg / ml, less than 0.8 μg / ml or less than 0.75 μg / ml. Optimally, the total amount of transfected DNA is 0.7 μg / ml or less, such as 06. μg / ml or 0.5 μg / ml.

[0046] Additionally or alternatively, the method of producing lentiviral particles or improving infectious lentiviral titer using closed linear DNA transfer vectors can be optimized by changing the ratio between various DNA constructs.Thus, the construct ratio can be changed to achieve improved production of infectious lentiviral particles.

[0047] When the packaging cells are transfected with four DNA constructs (closed linear transfer vector, GAG / POL vector, REV vector and ENV (or VSVg) vector), any suitable construct molar ratio can be used. However, to obtain an optimized infection titer, the construct molar ratio is preferably 4:1:2:1, 3:1:3:2, 3:1:3:1.5 or 3:1:2:1 (described as transfer:GAG / POL:REV:ENV DNA constructs). The construct ratio may be any suitable ratio falling between these ratios, such as 3:1:2.5:1. Preferably, the construct ratio is 4:1:2:1.

[0048] Also provided is a cell transfected with the closed linear transfer vector according to the first aspect of the invention. The cell may be a packaging cell or a producer cell as further defined herein. Additionally, the cell may also be transfected with one or more production vectors as described herein.

[0049] Further embodiments are described below and in the claims. Further advantages are described below. [Brief description of the drawings]

[0050] [Figure 1A] Figure 1A shows gene expression in packaging cells 72 hours after transfection with standard EF1α-eGFP-WPRE transfer vector and lentiviral production vector. RNA extracted from cells was subjected to RT-qPCR using probes LTR-P and eGFP to quantify full-length genomic RNA transcripts and total RNA transcripts derived from transfer vector, respectively. Transfer vector gene expression from standard closed linear DNA (dbDNA™) vectors without poly(A) signal sequence and spacer was similar to the corresponding plasmid DNA (pDNA), demonstrating that the low infection titers were not the result of insufficient transfer vector RNA. [Figure 1B]FIG. 1B shows DNA vector copies per cell measured by qPCR, demonstrating the excess of dbDNA vector copies compared to pDNA. Cells were transfected with 1 μg / ml total DNA. A 2:1:1:1 ratio of construct amounts was used for pDNA and a molar equivalent was used for dbDNA. Measurements were performed 72 hours after transfection. Data for each of the vectors is shown, showing a comparison of the levels of plasmid versus closed linear DNA. [Figure 2A] Figure 2A shows titers from production using the standard EF1α-eGFP-WPRE transfer vector without poly(A) sequence and spacer. This is a plot of construct vs. titer. Total viral particle titers (p24) were 5-fold lower for closed linear DNA (dbDNA™) transfections compared to the corresponding pDNA transfections. However, infectious viral titers for dbDNA™ transfections were below the limit of detection (LOD), demonstrating that in this case, very few infectious viral particles were produced. Legend: VP / mL is viral particles per milliliter and TU / mL is transducing units per milliliter (infectious titer). [Figure 2B] FIG. 2B shows total viral particle titers (VP / mL) in HEK293F producer cells transfected with decreasing total input standard closed linear vector at the indicated DNA:PEI ratios. [Diagram 3]While attempting to optimize conditions to improve infection titers, titers from production using standard EF1α-eGFP-WPRE transfer vector are shown (titer vs. construct plot). 1 μg / ml of plasmid construct was transfected in a mass ratio of 2:1:1:1 (eGFP:Gagpol:Rev:VSVg) and 0.5 μg / mL of closed linear dbDNA™ was transfected using molar equivalents (Mol) or the ratios shown. Optimizing conditions for dbDNA™ transfection resulted in a complete rescue of total particle titers (p24), but infection titers remained 100-fold lower for the standard closed linear DNA transfer vector compared to the plasmid. [Figure 4A] The results shown in Figures 4A and 4B (titer vs. construct plots) indicate that increasing the ratio of transfer vector does not rescue the infection titer (infection titer Figure 4A). The results of the genome titer assay (Figure 4B) suggest that packaging of the viral genome into particles is less efficient for closed linear DNA vectors compared to pDNA, and that increasing the amount of transfer vector does not improve this situation. [Figure 4B] Same as above. [Diagram 5]Figure 5 shows various closed linear DNA vector architectures used in the examples. LV-eGFP contains a restriction enzyme recognition sequence for the enzyme AvrII 3' of the 3'SIN LTR. LV-eGFP-pA contains an SV40 late poly(A) signal sequence 3' of the sequence for the 3'SIN LTR. LV-eGFP-pA-FTS contains an SV40 late poly(A) signal sequence and an F region stop sequence 3' of the sequence for the 3'SIN LTR. LV-eGFP-pA-RS1 contains an SV40 late poly(A) signal sequence and a 1 kb random spacer (RS) 3' of the sequence for the 3'SIN LTR. Also, RSV1-LV-eGFP-pA-RS1 contains a 1 kb 5' random spacer (RS) spacer. Other elements are sequences for the 5'LTR, EF1α promoter, eGFP transgene, random spacer (RS) and WPRE element. [Figure 6A] Figure 6 (A-C) shows the effect on total titer (6A), infectious titer (6B) and genomic titer (6C) of the various transfer vectors shown in Figure 5. Plots are construct vs. titer. In this case, LV-eGFP was compared to LV-eGFP-pA. In addition, for closed linear DNA vectors only, LV-eGFP was first digested using AvrII restriction enzyme to cleave sequences downstream of the 3'SIN LTR and reduce putative read-though interference. Addition of the SV40 late poly(A) sequence improved infectious and genomic titers for both plasmid and closed linear DNA production. [Figure 6B] Same as above. [Figure 6C] Same as above. [Figure 7A] Figure 7 (A-C) shows the effect on total titer (7A), infectious titer (7B) and genomic titer (7C) of the various constructs shown in Figure 5. Plots are construct vs. titer. Addition of an F region termination sequence or a 1 kb random spacer sequence downstream of the SV40 late poly(A) sequence further increases infectious and genomic titers relative to closed linear DNA. [Figure 7B] Same as above. [Figure 7C] Same as above. [Figure 8A] Figure 8 (A-B) demonstrates further optimization of transfection conditions for closed linear DNA vectors for infection titer when compared to pDNA, resulting in infection titers that were only two-fold lower than the plasmid. Figure 8A shows the effect of decreasing total input closed linear DNA on infection titer compared to the plasmid control, demonstrating a peak titer at 0.7 μg / mL. Figure 8B shows particle titers and infection titers for production using LV-eGFP-pA-RS1kb and optimized conditions. [Figure 8B] Same as above. [Figure 9A]Figure 9 (A-D) shows the plasmid maps for (A) proTLx transfer vector, (B) proTLx Gag-Pol production vector, (C) proTLx Rev production vector and (D) proTLx VSVg production vector used in the examples. (A) proTLx-K LV-eGFP-pA-RS1 contains the SV40 late poly(A) signal sequence 3' of the sequence for the 3'SIN LTR, and a 1 kb random spacer (RS) 3' of the sequence for the SV40 late poly(A) signal sequence. Other elements include the 5' modified LTR, the random spacer (RS), the HIV-1 Psi, the Rev response element (RRE), the cPPT, the EF1α promoter, the eGFP transgene, the WPRE, the 5' TelRL (protelomerase recognition site), the kanamycin resistance (KanR) promoter, the KanR gene and the sequence for the pUC ori. (B) proTLx Gag-Pol production vector contains the Gag and Pol genes. Other elements include a random spacer (RS), cPPT, RRE, beta-globin poly(A) signal sequence, kanamycin resistance (KanR) promoter, KanR gene, and sequences for pUC ori and 5'TelRL (protelomerase recognition site). (C) proTLx Rev production vector contains the Rev gene. Other elements include a 3'TelRL (protelomerase recognition site), a random spacer (RS), RSV promoter, HIV LTR poly(A) signal sequence, kanamycin resistance (KanR) promoter, KanR gene, and sequences for pUC ori. (D) proTLx VSVg production vector contains the VSVg envelope protein gene. Other elements include a 3'TelRL (protelomerase recognition site), a random spacer (RS), CMV enhancer and promoter, beta-globin intron, beta-globin poly(A) signal sequence, kanamycin resistance (KanR) promoter, KanR gene, and sequences for pUC ori. [Figure 9B] Same as above. [Figure 9C] Same as above. [Figure 9D] Same as above. [Figure 10A] Figure 10 (A-C) demonstrates further optimization of transfection conditions with respect to infection titers using the LV-RS1-eGFP-pA-RS1 transfer vector. Figure 10A shows infection titers comparing linear closed-end DNA LV-eGFP-pA-RS1 and LV-RS1-eGFP-pA-RS1, demonstrating a 1.8-fold improvement with 3'RS1. Figure 10B shows infection titers of LV produced using 0.7 μg / ml of DNA and the molar construct ratios shown. LV produced using 1 μg / mL of plasmid DNA at a mass ratio of 2:1:1:1 (eGFP:GagPol:Rev:VSVg) was used as a control. Figure 10C shows infection titers using LV-RS1-eGFP-pA-RS1 at low DNA input compared to plasmid. Closed linear DNA and plasmid DNA were transfected at a molar ratio of 4:1:2:1 and a mass ratio of 2:1:1:1, respectively. [Figure 10B] Same as above. [Figure 10C] Same as above. [Figure 11A] Figure 11 (A-B) shows the evaluation of the 3'RS1 kb in the production construct resulting in rescue of closed linear DNA derived LV. Figure 11A shows the infectious titer of LV produced using 0.7 μg / mL of dbDNA in a molar construct ratio of 4:1:2:1. The LV-RS1-eGFP-pA-RS1 transfer vector was used in combination with our standard accessory construct (Std), and each construct was iteratively exchanged for an equivalent construct containing the 3'RS1 element so that each production construct was tested independently and in combination with every other construct. Figure 11B shows the infectious titer of LV produced using the CAR19h28z transfer vector, GagPol-RS1, Rev-RS1 and VSVg (at a molar ratio of 4:1:2:1 with 0.7 μg / mL of dbDNA). Error bars represent standard deviation between replicates. [Figure 11B] Same as above. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0051] The present invention relates to novel closed linear DNA vectors suitable for use in the production of lentiviral particles, most notably, suitable for producing higher lentiviral infectious particle titers than closed linear DNA vectors lacking such constructs.

[0052] Lentiviral particles and their production Lentiviral particles (LVP) are a well-studied vector system based on human immunodeficiency virus (HIV-1). Other lentiviral systems, including HIV-2, simian immunodeficiency virus (SIM), and non-primate lentiviruses, such as feline immunodeficiency virus (FIV), equine infectious anemia virus (EIAV) and caprine arthritis encephalitis virus (CAEV), have also been developed as gene transfer systems. Lentiviral components useful for producing lentiviral particles are known in the art. See, for example, Zufferey et al. (1997) Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo, Nature Biotechnology, 15:871-875 and Dull et al. (1998) A third-generation lentivirus vector with a conditional packaging system, Journal of Virology, 72(11):8463-8471, and Table 1.

[0053] [Table 1]

[0054] Guided by safety concerns due to the pathogenic nature of HIV-1 in humans, various generations of lentiviral systems have been developed for the production of lentiviral particles. For a summary of lentiviral systems that can be used for lentiviral particle production, see Schweizer and Merten, 2010, Current Gene Therapy 10(6), 474-486; and Merten, Hebben and Bovolenta, 2016, Molecular Therapy - Methods & Clinical Development 3, 16017; doi:10.1038 / mtm.2016.17. The most widely used lentiviral systems for use in clinical and research and development purposes are: 1) Lentivirus group-specific antigen (GAG) genes and lentivirus polymerase (POL) proteins 2) Envelope protein (usually vesicular stomatitis virus glycoprotein (VSV-G)) 3) HIV regulator of virion protein (Rev) protein expression; and 4) A transfer vector containing a transgene or other coding sequence. This is a third generation four-vector system that expresses

[0055] Typically, the four DNA vectors described above are in the form of plasmid.Traditionally, each of the four plasmids is transfected into packaging cells, such as human embryonic kidney cells (e.g. HEK293), as adherent cell culture.Transiently transfected cells can produce lentiviral particles carrying gene of interest.

[0056] However, with increasing interest in suspension cultures, HEK293F is becoming more widely used since suspension cultures are easier to scale up commercially.

[0057] The present invention relates to novel closed linear DNA vectors that are suitable for use in the production of lentiviral particles by any appropriate method. Closed linear DNA vector The present inventors have developed a novel closed linear DNA vector, also referred to as a "closed linear transfer vector", which has certain characteristics that allow it to outperform existing closed linear DNA vectors in producing lentiviral particle infectious titers. The closed linear DNA vector may take any suitable form with any type of "closed" end. The closed linear DNA vector may also be referred to as a closed linear DNA molecule.

[0058] Closed linear DNA is generally understood to be double-stranded DNA that is covalently closed or capped at each end. The double-stranded or duplex sections of DNA are therefore complementary. When denatured, closed linear DNA can form a single-stranded circle. Depending on the orientation, the DNA may be closed at each end by any suitable structure, including a cross, a hairpin, or a hairpin loop. The ends of closed linear DNA may consist of non-complementary sequences, thus forcing the DNA into a single-stranded configuration of a cross, a hairpin, or a hairpin loop. Alternatively, the sequences may be complementary such that the ends form a hairpin.

[0059] It may be preferred that the ends are formed by a portion of the target sequence of the protelomerase enzyme. The protelomerase target sequence is any DNA sequence whose presence in the DNA template allows the enzymatic activity of protelomerase, which cuts the double-stranded sections of DNA and religates them, leaving behind covalently closed ends. In general, the protelomerase target sequence includes any perfect palindromic sequence, i.e., any double-stranded DNA sequence with two-fold rotational symmetry or perfect inverted repeat. The closed linear DNA may have a portion of the protelomerase target sequence at one or both ends. The protelomerase target sequence may be a sequence for the same cognate protelomerase at each end, or may be a cognate sequence for a different protelomerase for each end. Closed linear DNA constructed through the action of various protelomerase enzymes has been previously disclosed by the applicants in WO2010 / 086626, WO2012 / 017210, WO2016 / 132129 and WO2018 / 033730, all of which are incorporated by reference. Closed linear DNA constructed using in vitro DNA amplification and subsequent protelomerase enzyme cleavage has the advantage that closed linear DNA can be produced in an in vitro, cell-free environment and scaled up for commercial production. These closed linear DNA vectors are known as Doggybone™ DNA or dbDNA™. Closed linear DNA vectors are produced using Applicants' previous method in an in vitro, cell-free manner based on polymerase-based amplification of a DNA template bearing at least one protelomerase target sequence, and processing of the amplified DNA with protelomerase to produce closed linear DNA.

[0060] Closed linear DNA can be constructed by conversion of a plasmid carrying the requisite protelomerase target sequence into a closed linear DNA vector, but this is not an efficient production method.

[0061] Other closed linear DNA vectors have been constructed by various in vitro strategies, including capping of PCR products, and "minimalistic immunogenic defined gene expression" (MIDGE) vectors. MIDGE is generated by digestion of both prokaryotic and eukaryotic backbones after isolation of the plasmid from bacterial cells, followed by ligation of the required DNA sequence for end-filling into the hairpin sequence. Structures produced by such methods may also be suitable for the DNA vectors of the present invention.

[0062] DNA "ministrings" produced in vivo in cell cultures, based on the action of protelomerase, are also closed linear DNA vectors that may be suitable for use in the present invention.

[0063] Other types of closed linear DNA that may be suitable include DNA closed at the ends by cruciform structures, which also may be produced enzymatically in cell culture or in vitro.

[0064] It may be preferable that the closed linear DNA be produced in a cell-free system, as this ensures purity of the product; alternatively, rigorous purification of closed linear DNA produced by cell-based methods may be required by regulatory authorities.

[0065] Closed linear DNA vectors can be designed to be minimal vectors that contain only the sequences necessary for their desired function and structure (i.e., the sequences they deliver and the sequences encoding closed ends at the ends of the double-stranded linear sections, e.g., cruciforms, hairpins, or hairpin loops). Unnecessary or foreign sequences (e.g., bacterial sequences) that can be excluded from closed linear DNA vectors can include bacterial origins of replication, bacterial selection markers (e.g., antibiotic resistance genes), and unmethylated CpG dinucleotides. The absence of such sequences allows for the creation of "minimal" vectors that do not contain foreign genetic material. This can be preferable if the cells are to be used for therapeutic purposes, since no genetic material (i.e., antibiotic resistance genes) is introduced that could affect the performance of the vector or cause unwanted side effects.

[0066] The applicants have previously used closed linear DNA vectors in the production of "second generation" lentiviral vectors. Such closed linear DNA vectors did not contain any further modifications when compared with commonly used pDNA vectors. Such unmodified closed linear DNA vectors as described above are inefficient transfer vectors for lentiviral vector production, especially for third generation lentiviral methods as demonstrated in Example 1. Therefore, the inventors have developed a novel closed linear DNA vector, referred to herein as "closed linear transfer vector", which has designed properties that enable it to outperform existing closed linear DNA vectors in the production of lentiviral particle infectious titers.

[0067] In one aspect, the present invention provides a closed linear DNA vector suitable for use as a lentiviral transfer vector, comprising the following in 5' to 3' order: (a) Hybrid 5′ long terminal repeat (LTR) sequence; (b) a promoter operably linked to the transgene; (c) 3′ self-inactivating (SIN) LTR sequence; (d) a poly(A) signal sequence; and (e) Spacer sequence The present invention relates to a closed linear DNA vector comprising the sequence:

[0068] Additional sequences, such as additional spacer sequences, may be included within the closed linear DNA vector. In the vector, the promoter and transgene are effectively flanked by 5' and 3' LTR sequences, along with any additional sequences for inclusion into the particle. As used herein, "flanked" or "flanking" does not mean that the 5' LTR and 3' SIN LTR must be immediately adjacent to the promoter and transgene, but instead results in both ends of the RNA molecule being packaged into the LV particle. Those skilled in the art will appreciate that the LTR sequences from the "flanking" ends of the single-stranded RNA for packaging into the LV particle. In retroviruses, the sequences flanked by the LTRs are partially transcribed into an RNA intermediate, then reverse transcribed into complementary DNA (cDNA), and finally into dsDNA (double-stranded DNA) with the entire LTR. The LTR then mediates the integration of the DNA into another region of the host chromosome via an LTR-specific integrase.

[0069] In one aspect, the present invention therefore provides a method for producing a method of treating a subject comprising: a) a promoter operably linked to the transgene; b) a hybrid 5' long terminal repeat (LTR)-encoding sequence and a 3' SIN LTR-encoding sequence flanking the promoter and transgene; c) a sequence encoding a poly(A) signal located 3' of the 3' LTR; and d) a spacer sequence located 3' to the sequence encoding the poly(A) signal; The present invention relates to a novel closed linear DNA vector, referred to herein as a "closed linear transfer vector", comprising:

[0070] This closed linear transfer vector is suitable for use as a transfer vector (lentiviral vector) for the production of infectious lentiviral particles. In particular, properties (c) a sequence encoding a poly(A) signal and (d) a spacer sequence provide a novel closed linear DNA vector with characteristics that improve the production of infectious titers of lentiviral particles. Such infectious particles contain a transgene. These properties are described in more detail below.

[0071] As previously explained, sequences in closed linear DNA transfer vectors can be described as sequences that code for elements within the RNA molecule, or as sequences for those elements themselves, and because closed linear DNA is double stranded, it is understood that both the relevant sequence element and its complementary sequence are present within the vector.

[0072] Poly(A) signal sequence The polyadenylation process is generally required for the synthesis of messenger RNA (mRNA), where RNA cleavage is coupled with the synthesis of polyadenosine monophosphate (adenine base) on the newly formed 3' end of the RNA. The sequence elements for polyadenylation include a polyadenylation signal (poly(A) signal) in the RNA sequence. In the mRNA, the added stretch of polyadenosine monophosphate is called a polyadenylation tail (poly(A) tail). The poly(A) tail can contribute to an increase in translation efficiency.

[0073] The present inventors have discovered that including a sequence encoding a polyadenylation (poly(A)) signal (or "poly(A) signal sequence") 3' of a sequence encoding a 3'LTR in a closed linear DNA molecule for use as a lentiviral transfer vector increases both genome titer and infectious virus titer (see Example 1 and FIG. 6). Poly(A) signal sequences can be found 3' of eukaryotic protein-coding genes. In general, the central sequence motif AAUAAA or AUUAAA is the key element of a poly(A) signal in RNA, and this central sequence may require flanking auxiliary elements for both 3'-end cleavage and polyadenylation of pre-messenger RNA, as well as to facilitate downstream transcription termination. Several poly(A) signals are known in the art, and any suitable sequence may be used. A poly(A) signal in RNA may include the sequence AAUAAA and includes at least one sequence that is GU-rich and / or at least one sequence that is U-rich.

[0074] Preferably, the sequence encoding the poly(A) signal encodes a strong poly(A) signal. Thus, a strong poly(A) signal sequence is preferred. Some strong poly(A) signals are known in the art, and they can be defined as providing efficient transcription termination. Transcription termination is the process in which both the transcription complex and the nascent RNA are released from the template DNA. Those skilled in the art can use routine methods to determine whether a poly(A) signal provides efficient termination. In a preferred embodiment, the sequence encoding the strong poly(A) signal is selected from the SV40 late poly(A) sequence or a sequence having at least 90% homology therewith, the rabbit β-globin (rbGlob) poly(A) sequence or a sequence having at least 90% homology therewith, or the bovine growth hormone poly(A) (bGHpA) or a sequence having at least 90% homology therewith. Such can be described as a "strong" poly(A) signal.

[0075] The sequence encoding the poly(A) signal may further comprise an upstream sequence element (USE), which is well known in the art and is believed to improve the efficiency of the polyadenylation signal.

[0076] Spacer sequence 3'spacer sequence The inventors have discovered that including a spacer sequence 3' of the sequence encoding the poly(A) signal in the novel closed linear DNA vector described above further increases both the genome titer and the infectious virus titer (see Example 1 and Figure 7). The spacer sequence 3' of the sequence encoding the poly(A) signal (poly(A) signal sequence) in the novel closed linear DNA vector can also be referred to as downstream spacer sequence or 3'spacer sequence. Interestingly, the incorporation of the same spacer sequence into a plasmid-based lentiviral transfer vector does not affect the virus titer (see Example 1 and Figure 7), and therefore this effect appears to be dependent on the format of the closed linear vector itself. The spacer sequence may be of any suitable length and any suitable sequence. Preferably, the spacer sequence of the novel closed linear transfer vector can be at least 250 nucleotides in length. The spacer may be at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700 or at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, at least 1400 or at least 1500 nucleotides in length. It may be preferred that the spacer is at least 250, at least 500 or most preferably at least 1000 nucleotides (1 kb) in length. The spacer separates the sequence encoding the poly(A) signal from the closed end of the linear DNA molecule. If the end is closed by a portion of the protelomerase sequence, the 3' end of the spacer sequence may be adjacent to the 5' end of that portion of the protelomerase sequence. If the end is closed by a hairpin, the same concept can be applied and the sequences for the hairpin and the spacer may be adjacent. The spacer sequence may be a sequence of any suitable length. The carrying capacity of the lentiviral vector genome does not need to be considered in determining the length of the spacer sequence, since it is not present in the final lentiviral vector (infectious lentiviral particle).

[0077] Since the spacer sequence exists in double-stranded DNA, the spacer sequence can be determined in terms of base pair length. The spacer sequence is optionally a non-coding DNA, for example, it does not code for a protein or RNA product. The sequence of the spacer can be random. Without being bound by theory, the inventors hypothesize that the spacer sequence promotes efficient RNA processing when the transfer vector exists in the form of closed linear DNA. The inventors noted that this is a specific requirement for the architecture of closed linear DNA, and that the addition of the spacer sequence in the plasmid DNA did not make a difference in the infection titer (see Example 1 and Figure 7).

[0078] 5'spacer sequence The inventors have discovered that including a spacer sequence 5' of the 5' long terminal repeat (5'LTR) in the novel closed linear DNA molecule described above further improves the infectious virus titer (see Example 2 and Figure 7B). The spacer sequence 5' of the 5'LTR in the novel closed linear DNA molecule may be referred to as the upstream spacer sequence. The spacer sequence may be of any suitable length and any suitable sequence. Preferably, the sequence of the downstream spacer is not identical to the sequence of the upstream spacer. Preferably, the sequence of the downstream spacer may be different from the sequence of the upstream spacer. Preferably, the spacer sequence of the novel closed linear transfer vector may be at least 250 nucleotides in length. The spacer may be at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700 or at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, at least 1400 or at least 1500 nucleotides in length. Preferably, the spacer is at least 1 kb in length. The spacer separates the 5'LTR from the closed end of the linear DNA molecule. If the end is closed by a portion of the protelomerase sequence, the 5' end of the upstream spacer sequence may be adjacent to the 3' end of that portion of the protelomerase sequence. If the end is closed by a hairpin, the same concept can be applied and the sequences for the hairpin and the spacer may be adjacent. The upstream spacer sequence may be a sequence of any suitable length. Since it is not present in the final lentiviral vector (infectious lentiviral particle), the carrying capacity of the lentiviral vector genome does not need to be taken into consideration in determining the length of the upstream spacer sequence.

[0079] Since upstream spacer sequence exists in double-stranded DNA, upstream spacer sequence can be determined in terms of base pair length.Upstream spacer sequence can be non-coding DNA, for example, it does not code protein or RNA product.The sequence of upstream spacer can be random.Also, the sequence can be different from any downstream spacer sequence.

[0080] Transgene The closed linear transfer vector of any embodiment of the present invention may include an expression cassette that comprises, consists of, or consists essentially of a eukaryotic promoter operably linked to a sequence that codes for a product of interest. The sequence that codes for a product of interest may be referred to as a transgene. The transgene may code for an RNA product, such as an inhibitory RNA (e.g., a microRNA or a small hairpin RNA (shRNA)), or a protein product (via a messenger RNA). The closed linear transfer vector of any embodiment of the present invention preferably includes a promoter or enhancer operably linked to the transgene. One or more promoters or enhancers may be used as needed. Any suitable promoter or enhancer may be used. These are for the expression of the transgene when the lentiviral vector is constructed and applied to the cell that it is desired to target.

[0081] The transgene selected depends on the specific use intended for the lentiviral vector.Exemplary, non-limiting examples of transgene include therapeutic RNA coding transgene (e.g., transgene coding antisense RNA complementary to target RNA or DNA sequence), gene therapy transgene coding protein that is missing or absent in diseased subjects, and vaccine transgene used for DNA vaccination (i.e., coding protein whose expression induces vaccination of recipient organism against said protein).

[0082] A "promoter" is a nucleotide sequence that initiates and regulates transcription of a polynucleotide. Promoters can include inducible promoters (expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), repressible promoters (expression of a polynucleotide sequence operably linked to the promoter is repressed by an analyte, cofactor, regulatory protein, etc.), and constitutive promoters. The term "promoter" or "enhancer" is intended to include full-length promoter regions and functional (e.g., transcription or translation controlling) segments of these regions. The term includes bidirectional promoters.

[0083] In the example, EF1α (elongation factor 1-alpha) is used as the promoter. It is a constitutive promoter and therefore may be desirable for use in expressing transgenes in target cells when lentiviral vectors are delivered. Modified EF1α promoters may also be used, such as the hEF1α-HTLV promoter, a hybrid promoter that includes the human EF1α core promoter and the R segment and part of the U5 sequence of the human T-cell leukemia virus (HTLV) type 1 long terminal repeat (R-U5'). The EF1α promoter exhibits strong activity and produces long-term sustained expression of transgenes in vivo. R-U5' is coupled to the core promoter and improves RNA stability. Alternative promoters suitable for use in the present invention include, but are not limited to: cytomegalovirus (CMV) promoter, mouse stem cell virus (MSCV) promoter, phosphoglycerate kinase 1 (PGK) promoter, thymidine kinase (TK) promoter, spleen focus forming virus (SFFV) promoter, CAG promoter and polyubiquitin C (UBC) promoter or their transcriptionally active fragments. Also, promoters can be selected to allow cell-specific expression when lentiviral vectors are administered in vivo. For example, targeting melanoma cells has been achieved by including tyrosinase promoter or enhancer fragments. Those skilled in the art can select cell-specific promoters suitable for use in the present invention.

[0084] "Operably linked" refers to an arrangement of elements such that the components so described are configured to perform their normal functions. Thus, a given promoter operably linked to a nucleic acid sequence is capable of affecting the expression of that sequence when the appropriate enzymes are present. The promoter need not be contiguous with the sequence, so long as it functions to direct the expression of that sequence. Thus, for example, intervening sequences that are not translated but are transcribed may be present between the promoter sequence and the nucleic acid sequence, and the promoter sequence would still be considered to be "operably linked" to the coding sequence. Thus, the term "operably linked" is intended to encompass any spacing or orientation of the promoter element and the transgene that allows initiation of transcription of the transgene upon recognition of the promoter element by a transcription complex in vivo.

[0085] In certain embodiments, multicistronic expression cassettes can be used in closed linear transfer vectors. Multicistronic expression cassettes contain multiple genes operably linked to a single promoter in a single expression cassette, allowing translation of multiple genes from a single transcript. Multicistronic expression cassettes may be desirable because they allow selectable drug or marker genes to be co-expressed, allow manageable construct size, allow constant production of desired gene products, and provide the opportunity to include conditional cytotoxic genes as a safeguard in case adverse clinical events may occur. Methods for designing and producing functional multicistronic expression cassettes are well known in the art and include the use of internal ribosome entry sites (IRES), self-cleaving 2A peptides, and / or bidirectional promoters. See, e.g., Shaimardanova et al. (2019) Production and Application of Multicistronic Constructs for Various Human Disease Therapies. Pharmaceutics, 11(11):580, doi:10.3390 / pharmaceutics11110580 and Golding, M. & Mann, M. (2011) A bidirectional promoter architecture enhances lentiviral transgenesis in embryonic and extraembryonic stem cells. Gene Therapy, 18:817-826, https: / / doi.org / 10.1038 / gt.2011.26.

[0086] LTR sequence In any embodiment of the present invention, the closed linear transfer vector comprises sequences encoding a 5' long terminal repeat (LTR) and a 3' LTR flanking a promoter and a transgene. Alternatively, the vector comprises a 5' long terminal repeat (LTR) sequence and a 3' LTR sequence flanking a promoter and a transgene. Thus, the order is: 5' LTR; a promoter operably linked to a transgene; 3' LTR. Additional sequences may be included between the LTRs. Additional sequences may be present in the vector outside the sequences flanked by the LTRs.

[0087] LTR is a virus-derived element that facilitates the integration of transgenes into the genome of host cells.Wild-type LTR contains a unique 3' (U3) region, a repeat (R) region, and a unique 5' (U5) region, so that both wild-type 5'LTR and 3'LTR have U3-R-U5 structure.In the third generation lentiviral particle platform, the sequence that codes for LTR is modified compared to wild-type lentiviral LTR, so that lentiviral-based vectors are safer for use in research and clinical settings.

[0088] The LTR sequences used in the present invention can be derived from any lentivirus. Lentiviruses are a genus of retroviruses that include human immunodeficiency viruses (HIV-1 to 3). Lentiviral vectors can be derived from primate lentiviruses (HIV-2 and simian immunodeficiency virus (SIV)) and non-primate lentiviruses (e.g., Maedi-visna virus (MVV), feline immunodeficiency virus (FIV), equine infectious anemia virus (EIAV), caprine arthritis encephalitis virus (CAEV), Jembrana disease virus (JDV), puma lentivirus, lion lentivirus, and bovine immunodeficiency virus (BIV)), although HIV-based vectors constitute the majority of lentiviral vectors in current use. Thus, the LTRs can be derived from any lentivirus, but are preferably derived from HIV-1.

[0089] In any embodiment of the present invention, the 5'LTR is a hybrid LTR (also may be referred to as modified 5'LTR). Hybrid LTR indicates that a portion of the wild-type LTR is removed and a heterologous sequence is inserted. The hybrid 5'LTR may allow Tat-independent transcription. To reduce or eliminate the dependency on Tat, all or part of the U3 region may be deleted. To maintain expression, the function of the U3 region may be replaced using a heterologous promoter. Such a promoter may be another viral promoter, such as the cytomegalovirus (CMV) promoter.

[0090] Any suitable sequence for a hybrid 5'LTR can be used in the present invention, and several are known in the art. The hybrid 5'LTR is not a wild-type viral LTR.

[0091] In a preferred embodiment, the sequence encoding the 5'LTR is partially deleted and fused to a heterologous enhancer or promoter element to allow Tat-independent expression of the transgene. Thus, the 5'LTR sequence is thus partially deleted and fused to a heterologous enhancer or promoter element.

[0092] In a preferred embodiment, the sequence encoding the 3'LTR is that for a 3' self-inactivating (SIN) LTR. Alternatively, the vector comprises a 3'SIN LTR sequence. The 3'SIN LTR has one or more deletions compared to the wild-type lentiviral 3'LTR and can be referred to as a modified 3'LTR. The one or more deletions are transferred to the 5'LTR after one round of reverse transcription. This deletion abolishes the transcription of the full-length virus after it is integrated into the host cell. The one or more deletions can include partial or complete deletion of promoter or enhancer elements including the TATA box and binding sites for the transcription factors Sp1 and NF-κB. 3'SIN LTRs are well known in the art and the skilled artisan can identify suitable constructs. In a preferred embodiment, the 3'SIN LTR comprises a 133 nucleotide deletion at nucleotide positions -149 to -9 relative to the transcription start site of the wild-type lentiviral 3'LTR within the U3 region of the 3'LTR. The SIN 3'LTR is not the wild-type viral LTR.

[0093] In addition to the deletion in 3'LTR, 3'SIN LTR can contain heterologous sequences that provide specific functions. Therefore, 3'LTR can also be described as hybrid LTR. Any heterologous sequence element can be inserted into 3'LTR. For example, heterologous regulatory elements can be inserted. Any suitable sequence encoding hybrid SIN 3'LTR can be used in the present invention, and some are known in the art. Hybrid SIN 3'LTR is not wild-type viral LTR.

[0094] Additionally, the 3'SIN LTR may contain a USE element in place of the deletion of the U3 region. Preferably, the USE element is derived from SV40. The sequence contained in the closed linear DNA vector of the invention is preferably a sequence encoding the LTR from HIV-1, although it will be apparent that similar modifications can be applied to other suitable LTRs with similar effect.

[0095] Contains sequences encoding other elements The closed linear transfer vector may contain sequences encoding further elements or sequences for additional elements, as summarized in Table 1. Such elements may include the RNA packaging signal Psi (ψ), which may usually be located 3' of the 5'LTR, the Rev response element (RRE), which may usually be located 3' of the Psi, and the central polypurine tract (cPPT), which may usually be located 3' of the RRE. Further additional functional sequences, such as primer binding sites (PBS), may be encoded or included, or the Woodchuck Hepatitis Post-Transcriptional Regulatory Element (WPRE) may also be advantageously included in the closed linear transfer vector of the present invention to obtain more stable expression of the transgene in vivo. The WPRE may increase transgene expression from viral vectors, although the exact mechanism of action is not known. The WPRE is most effective when placed downstream of the transgene in close proximity to the polyadenylation signal. The WPRE may be substituted for other post-transcriptional regulatory elements (PRE) from other viruses. WPRE is believed to reduce read-through during transcription from lentiviral 3'LTR and is used in this example. Given its presence in the originally tested closed linear DNA vector (before modification), it was surprising to the inventors that the performance of closed linear lentiviral transfer vectors could be improved by carrying out the modifications described herein.

[0096] Methods for Producing Lentiviral Vectors In a second aspect of the present invention, there is provided herein a method for producing infectious lentiviral particles (LVP), also described as lentiviral vectors.

[0097] In embodiments, the methods described herein comprise transfecting a packaging cell with a closed linear transfer vector as described above, and one or more production vectors.

[0098] In an embodiment, the methods described herein comprise the step of transfecting a production cell with a closed linear transfer vector as described above. Production Vector As used herein, the term "production vector" or "production construct" refers to a vector that contains sequences encoding the components necessary to produce lentiviral particles and "package" a gene of interest (or transgene) into the final infectious lentiviral particle. They may also be referred to as "packaging elements" (particularly GAG, POL, or REV elements). A production vector contains an expression cassette, which refers to a separate component of a vector, and contains one or more genes and regulatory sequences that are delivered to and ultimately expressed by a transfected packaging cell. One or more production vectors, each containing one or more expression cassettes, may be transfected into a packaging cell. In the art, they may also be referred to as "accessory constructs" or "helper constructs".

[0099] The lentiviral regulator of virion protein (REV) gene expression encodes an RNA-binding protein that binds to Rev response elements (RREs) in unspliced ​​or partially spliced ​​transcripts, promoting their transport from the nucleus to the cytoplasm.

[0100] The envelope (ENV) gene encodes the envelope protein that is essential for the produced lentiviral particles to enter host cells. The lentiviral particles may be pseudotyped vectors that contain modified envelope proteins, envelope proteins from different viruses, or chimeric envelope proteins, allowing transduction of host cells that lack CD4. A range of different envelope proteins can be used to produce envelope pseudotyped lentiviral particles. Thus, for example, the ENV gene may encode the vesicular stomatitis virus glycoprotein (VSV-G) protein, which binds to LDL-receptor family members and allows lentiviral particles to infect a wide range of cell types of many distinct host species, including various human cells. Preferably, the ENV gene encodes VSV-G. Alternative envelope proteins may be selected by one of skill in the art, including the envelope proteins of non-human retroviruses, such as the ecotropic retroviruses murine leukemia virus (MULV), gibbon ape leukemia virus (GALV), feline endogenous RD114 retrovirus, Moloney MULV 4070A, Moloney MULV strain 10A1, as well as rabies virus glycoproteins, and measles virus hemagglutinin and fusion glycoproteins.

[0101] The GAG ​​genes code for a polyprotein that is translated from the unspliced ​​mRNA and is then cleaved by the viral protease (PR) into the matrix protein, capsid and nucleocapsid proteins. The lentiviral polymerase (POL) gene codes for the enzyme proteins reverse transcriptase, protease and integrase.

[0102] Each function (or component) may be derived from any suitable lentivirus, however, in a preferred embodiment, GAG-POL and REV are derived from an HIV virus, in particular HIV-1 or HIV-2.

[0103] At present, it is believed in the art that the optimal number of vectors that are fed into cells from any source is 4 in total.This optimal number appears to be necessary to minimize the risk of virus propagation.However, in the future, it may be possible to use more than 4 or less than 4 vectors to produce lentiviral particles.For example, use 2, 3, 5 or 6 vectors.

[0104] In a preferred embodiment, packaging cells are transfected with a closed linear transfer vector and at least one production vector, each production vector comprising: 1) Lentivirus group-specific antigens (GAGs); 2) lentiviral polymerase (POL) protein; 3) an envelope protein (preferably vesicular stomatitis virus glycoprotein (VSV-G)); or 4) HIV regulator of virion protein (Rev) protein expression The nucleic acid sequence includes at least one expression cassette encoding one or more of the following:

[0105] A production vector may contain two or more expression cassettes. The GAG ​​gene and the POL gene may be contained on a single production vector. Thus, the GAG ​​and POL may share the same promoter sequence.

[0106] It should be noted that "production vectors" are sometimes referred to in the art as "packaging vectors." The production vector can be provided to the cell in the form of a closed linear DNA vector, or a circular DNA vector, such as a plasmid or minicircle. It may be preferred that all of the DNA vectors used are closed linear DNA, or a mixture of vector architectures can be used.

[0107] Closed linear production vector When the production vector is in the form of a closed linear DNA vector, it may take any suitable form, with any kind of "closed" ends, as explained above. When the production vector is in the form of a closed linear DNA vector, it may be referred to as a closed linear production vector.

[0108] The inventors have discovered that inclusion of a spacer sequence 3' of the expression cassette in a closed linear production vector provides improved infectious titers (see Examples 3 and 4, and Figures 10A and 12A).

[0109] The present invention therefore relates to a closed linear DNA vector suitable for use as a production vector (closed linear production vector) comprising: a) (i) Lentivirus group-specific antigen (GAG) genes; (ii) a lentiviral polymerase (POL) gene; and / or (iii) the envelope gene (ENV); and / or (iv) Lentiviral Regulatory Gene (REV) and / or at least one expression cassette comprising one or more of: b) a spacer sequence located 3' of the expression cassette The present invention further relates to a closed linear production vector comprising:

[0110] An expression cassette is a separate component of vector DNA that consists of at least one gene and regulatory sequences (e.g., promoter) to be expressed by a transfected cell, as well as termination elements, which may be any suitable element, including a polyA sequence or indeed an LTR or modified LTR.

[0111] The spacer sequence 3' of the expression cassette in the closed linear production vector may be of any suitable length and any suitable sequence. Preferably, the spacer sequence of the closed linear production vector may be at least 250 nucleotides in length. The spacer may be at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700 or at least 800, at least 900, at least 1000, at least 1100, at least 1200, at least 1300, at least 1400 or at least 1500 nucleotides in length. It may be preferred that the spacer is at least 250, at least 500 or most preferably at least 1000 nucleotides (1 kb) in length. The spacer separates the expression cassette from the closed end of the linear DNA molecule. If the end is closed by a portion of the protelomerase sequence, the 3' end of the spacer sequence may be adjacent to the 5' end of that portion of the protelomerase sequence. When the end is closed by hairpin, the same concept can be applied, and the sequence for hairpin and spacer can be adjacent.Spacer sequence can be any suitable length sequence.Since it does not exist in the final lentiviral vector (infectious lentiviral particle), the capacity of lentiviral vector genome does not need to be considered in determining the length of spacer sequence.

[0112] Since the spacer sequence exists in double-stranded DNA, the spacer sequence can be determined in terms of base pair length. The spacer sequence can be non-coding DNA, for example, it does not code for protein or RNA product. The sequence of the spacer can be random. Without being bound by theory, the inventors assume that the spacer sequence promotes efficient RNA processing when the transfer vector exists in the form of closed linear DNA. When two spacer sequences exist, it may be preferable that they are different sequences.

[0113] The production vector or vectors used may have the same vector architecture or a mixture of vector architectures may be used, in other words any combination of production vectors in the form of closed linear DNA vectors with or without 3' spacer sequences or circular DNA vectors such as plasmids or minicircles may be used.

[0114] It will be understood by those skilled in the art that the closed linear transfer vector of the present invention may further comprise any one or more of the packaging elements described above and / or the elements outlined in Table 1. These packaging elements may be present in the closed linear transfer vector as part of a multicistronic expression cassette or as a separate expression cassette. For example, an expression cassette encoding a GAG gene may be included in the closed linear transfer vector.

[0115] Packaging Cells As used herein, the term "packaging cell" refers to a cell for use in the production of lentiviral particles. Preferably, the packaging cell is a mammalian cell.

[0116] Mammalian cells for the production of lentiviral particles are known in the art. Representative examples of packaging cells include human embryonic kidney (HEK) 293 cells and their derivatives or variants. For example, in some embodiments, 293 variants may be selected for their ability to grow in suspension under serum-free conditions, which is ideally highly permissive for transfection. One example of such a variant is HEK293F cells. Alternatively, 293 variants, such as HEK293T cells, may be selected for their ability to grow in adherent cell culture. Other cell types for use as packaging cells include, but are not limited to, HeLa cells, A549 cells, KB cells, CKT1 cells, NIH / sT3 cells, Vero cells, Chinese hamster ovary (CHO) cells, or any eukaryotic cell that supports the lentivirus life cycle.

[0117] The packaging cells may be constitutive or inducible. The packaging cells are cultured in a serum-free medium selected for the particular cells used and permissive for the production of lentiviral particles. The serum-free medium allows for the production of lentiviral particles suitable for therapeutic applications. For a general overview of serum-free media, see Chapter 9 of Culture of Animal Cells (Serum-Free Media): A Manual of Basic Technique; ed. Freshen, RI, 2000, Wiley-Lisps, pp. 89-104 and 105-120. In general, serum-free media are engineered to improve the growth of each cell line in culture, with the possibility of inclusion of any of the following: selected secreted cellular proteins, diffusible nutrients, amino acids, organic and / or inorganic salts, vitamins, trace metals, sugars and lipids, and possibly other compounds, such as growth-promoting substances (e.g. cytokines). Such media are commercially available, and one skilled in the art can select the appropriate medium for the mammalian host cells. The medium may be supplemented with additives, such as non-ionic surfactants used to control shear forces in suspension cultures, such as Pluronic® F68 (Invitrogen, Catalog No. 24040-032), anti-aggregation agents (e.g., Invitrogen, Catalog No. 0010057AE) and L-glutamine or L-glutamine substitutes, such as L-alanyl-L-glutamine dipeptides, such as GlutaMAX™ (Invitrogen, Catalog No. 35050-038). The medium and additives used in the present invention are advantageously GMP-compliant. For example, a non-limiting example of a commercially available serum-free medium that can be used to grow 293F cells in suspension is Gibco LV-MAX Production Medium (ThermoFisher Scientific, Catalog No. A3583401).

[0118] Alternatively, packaging cells may be cultured in an adherent system using methods well known in the art, see, e.g., Merten et al. (2011) Large-Scale Manufacture and Characterization of a Lentiviral Vector Produced for Clinical Ex Vivo Gene Therapy Application. Human Gene Therapy, 22(3):343-356. http: / / doi.org / 10.1089 / hum.2010.060.

[0119] Productive Cells As used herein, the term "producer cell" refers to a cell for use in the production of lentiviral particles. A producer cell is simply a stable cell line in which all or part of the packaging functions required for producing infectious lentiviral particles are inserted into the cell genome so that a closed linear transfer vector is introduced by transient transfection. Such producer cells are known in the art, see, for example, U.S. Patent No. 5,686,279, Ory et al. (1996) A stable human-derived packaging cell line for production of high titer retrovirus / vesicular stomatitis virus G pseudotypes. PNAS USA, 93:11400-11406 and Sanber et al. (2015) Construction of stable packaging cell lines for clinical lentiviral vector production. Sci Rep, 5:9021.

[0120] Producer cells can be constitutive or inducible and are well known in the art (Farson et al. (2001) A new-generation stable inducible packaging cell line for lentiviral vectors. Hum Gene Ther, 12(8):981-97. doi:10.1089 / 104303401750195935. and Merten, OW, Hebben, M. & Bovolenta, C. (2016) Production of lentiviral vectors. Mol. Ther. Methods Clin. Dev. 3:16017).

[0121] Hybrid stable cell lines have also been developed in which some packaging functions are integrated into the cell genome, while others are provided through transient transfection of packaging vectors. Thus, combinations of these producers may be used, with some of the production vectors integrated into the cell genome, while others are provided through transient transfection. Those skilled in the art will appreciate that several different methods and reagents can be used to produce infectious lentiviral particles.

[0122] Therefore, it can be understood by those skilled in the art that there are many ways to produce lentiviral vectors using the novel closed linear transfer vectors of the present invention. Overall, the packaging or producer cells into which the closed linear transfer vectors are introduced should have all of the packaging functions necessary to produce functional lentiviral particles, which can be introduced into the cells through transient transfection, stably integrated into the cell genome, or a combination of the two.

[0123] Transfection In the method of the present invention, packaging cells, such as HEK293F cells, grown in suspension under serum-free conditions, are transfected with one or more vectors adapted for the production of lentiviral particles.Preferably, the transfection is a transient transfection.

[0124] The various functions required for lentiviral particle production can be provided to the packaging cell by any number of vectors. In particular, these functions can be provided by at least one, two, three or four vectors. In a particular embodiment of the present invention, the various functions required for lentiviral particle production are provided to the packaging cell by transfection, in particular transient transfection, of four vectors adapted for producing lentiviral particles, where one vector encodes the envelope protein (Env vector), one vector encodes the lentiviral Gag and Pol proteins (Gag-Pol vector), one vector encodes the lentiviral Rev protein (Rev vector), and one vector is the closed linear transfer vector of the present invention that comprises a transgene expression cassette between the sequences encoding the lentiviral 5' hybrid LTR and 3' SIN LTR.

[0125] Alternatively, the closed linear transfer vector of this vector can be transiently transfected into stable producer cells carrying all or part of the complementary set of packaging functions required to produce infectious lentiviral particles.

[0126] A variety of techniques known in the art can be used to introduce nucleic acid molecules into packaging or producer cells. Such techniques include chemically-facilitated transfection using compounds such as calcium phosphate, cationic lipids, cationic polymers, liposome-mediated transfection, etc.; non-chemical methods such as electroporation, particle bombardment, or microinjection; and infection with a virus containing the nucleic acid molecule of interest (sometimes referred to as "transduction").

[0127] However, according to a preferred embodiment of the present invention, transient transfection is performed using polyethyleneimine (PEI) as a transfection reagent. PEI is a synthetic water-soluble polymer and is widely used as a transfection reagent. PEI has high gene transfer activity in many cell lines while exhibiting low cytotoxicity, is cost-effective, and is therefore compatible with industrial-scale production applications. PEI is available as both linear and branched polymers with a wide range of molecular weights and polydispersity, a physicochemical parameter that is important for efficient gene transfer activity (Godbey WT et al., J. Control Release, 60, 149160 (1999)). In certain embodiments, the PEI used in the present invention is a linear PEI of 20-25 kD. For example, in certain embodiments, the PEI used in the present invention is PEIPro® (available from PolyPlus). PEIPro® transfection reagent is a linear PEI derivative that is free of components of animal origin and provides highly effective and reproducible gene delivery. Other PEI or cationic polymers similar in structure for transfecting cells are disclosed in US Pat. No. 6,013,240 and European Patent No. 0770140.

[0128] Those skilled in the art will be able to adapt the transfection method to the particular cell culture being performed. The packaging cell can be transfected with the closed linear transfer vector of the present invention together with one or more production vectors. The production vector can be in any suitable form, including closed linear DNA (with or without 3' spacer sequence as described herein) or circular DNA, such as a plasmid or minicircle. The production vector can encode one or more of the packaging elements GAG, POL, REV and / or ENV. It may be preferred that GAG and POL are encoded on a single production vector.

[0129] Packaging cells can be transfected with closed linear transfer vector and one or more production vectors using any suitable molar ratio of constructs.For example, when packaging cells are transfected with four DNA constructs (closed linear transfer vector, GagPol vector, Rev vector and ENV vector (preferably VSVg vector)), any suitable ratio of constructs can be used.The ratio of constructs of transfer:GagPol:Rev:VSVg DNA constructs can be 4:1:2:1, 3:1:2:1, 3:1:3:1.5 or 3:1:3:2.

[0130] Induction In the embodiment of the present invention in which induction system is used for the production of lentiviral particles, packaging cells or producer cells containing the closed linear transfer vector of the present invention can be induced to start producing lentiviral particles.Induction systems are well known in the art, for example, the Tet-on and Tet-off systems, which are based on the addition or removal, respectively, of tetracycline / doxycycline antibiotics in culture medium, which induce gene transcription through tetracycline response element (TRE).Alternative induction systems include, but are not limited to, the Tet-on / cumate induction system and the ecdysone induction system.

[0131] In an alternative embodiment of the present invention, the construct system may be used for the production of lentiviral particles. culture After transfection, for example after adding a mixture of DNA and PEI to the cell culture, the cell culture is grown for a period of time which may consist of 36 to 72 hours, in particular up to 48 hours after transfection.

[0132] Methods for culturing transfected packaging or producer cells are known in the art and include the use of various cell culture media, appropriate gas concentrations / exchanges and temperature control that promote cell growth and integration of the construct into the cell's genome.

[0133] In certain embodiments, the medium used to culture the packaging or producer cells is the same as the medium used to transfect the cells. For example, in the case of transfection of a mixture of PEI and vector, the mixture may be in Gibco LV-MAX production medium (ThermoFisher Scientific, Catalog No. A3583401), and the cells may be grown in said Gibco LV-MAX production medium (ThermoFisher Scientific, Catalog No. A3583401) after transfection.

[0134] The cultivation can be carried out in several cultivation devices, for example, bioreactors adapted for the cultivation of cells in suspension. The bioreactor can be a single-use (disposable) bioreactor or a reusable bioreactor. The bioreactor can be selected, for example, from a culture vessel or a bag and tank reactor. Non-limiting representative bioreactors include Ambr15 (Sartorius), Ambr250 (Sartorius), iCELLis fixed-bed bioreactor (Pall Life Sciences), Scale-X hydro (Univercells), HyPerforma single-use bioreactor (ThermoScientific).

[0135] collect The lentiviral particles can then be recovered (or harvested) by one or more recovery steps using standard techniques well known in the art.

[0136] Whole particle infectious titers and genomic titers can be determined by standard methods known in the art, including but not limited to those methods demonstrated in the Examples below. Thus, the present invention provides novel closed linear DNA vectors suitable for the production of lentiviral particles.The present invention further relates to a method of using the constructs to generate infectious lentiviral particles.

[0137] The invention will now be described with reference to the following non-limiting examples. Working Example Materials and Methods Plasmid / closed linear DNA cloning and production All sequences for standard DNA lentiviral constructs (eGFP transgene, GagPol, Rev and VSG) were selected from the widely used lentiviral third generation production system and obtained from the publicly available source Addgene (www.addgene.org). The sequences were synthesized de novo and cloned into Touchlight's proTLx backbone (Figure 9A-D). The resulting plasmids (pDNA) were used as templates to generate the corresponding closed linear DNA versions through Touchlight's dbDNA manufacturing process (WO2010 / 086626). The various closed linear DNA constructs produced are shown in Figure 4.

[0138] Additionally, all modifications to the standard eGFP transgene to include the new elements described herein were synthesized de novo at Touchlight (Hampton, UK) and underwent the same procedures for pDNA and closed linear DNA manufacture.

[0139] The CAR-T gene was designed based on the 1928z sequence described by the Sadelain Laboratory (Eyquem, J. et al. Targeting a CAR to the TRAC locus with CRISPR / Cas9 enhances tumour rejection. Nature 543, (2017)).

[0140] Lentivirus production: cell culture, transfection and harvest For all lentivirus production, HEK293F cells (Gibco virus producer cells, A35347) were grown in a platform shaking incubator at 37°C, 8% CO2 and 125 rpm using 50-100 mL volumes of LV-MAX production medium (A3583401) in Erlenmeyer flasks with vented caps according to the manufacturer's recommendations.

[0141] The day before transfection, dilute 50 mL of culture with 1 x 10 cells. 6 On the day of transfection, a total of 0.5–1 μg / mL of DNA containing the four lentiviral production constructs—eGFP transfer vector, GagPol, Rev, and VSVg—was transfected using PEIPro (PolyPlus Transfection) as the transfection reagent according to the manufacturer's recommendations for suspension cells.

[0142] At 48 / 72 hours post-transfection, harvesting was performed by centrifugation of 50 mL cultures at 1300 rpm for 5 min followed by filtration of the supernatant (0.45 μm). The supernatant was then aliquoted and stored at −80° C. for later analysis. The cell pellet was resuspended and washed with 50 mL PBS (Sigma Aldrich, D8537) before being used for analysis of cell density (trypan blue), eGFP expression of cells using a CytoFlex flow cytometer (Beckman Coulter), and −80° C. storage of the cell pellet for later gene expression analysis.

[0143] DNA delivery and gene expression analysis Total DNA and RNA were extracted from the packaging cell pellet using DNeasy Blood and Tissue and RNeasy Plus Mini kits, respectively, from Qiagen (www.qiagen.com), following the recommended protocol. For DNA delivery, the extracted total DNA was then analyzed by singleplex qPCR analysis with StepOnePlus qPCR (Applied Biosystems) using custom TaqMan primer / probe sets (IDT Technologies) for lentivirus target sequences with copy number standard curves using sufficient reference material in separate reactions; and RNAseP TaqMan copy number reference assay (Applied Biosystems) with wild-type HEK293F genomic DNA standard curves to assess the number of DNA vector copies delivered per cell during transfection. For gene expression analysis, 1 μg of RNA was used to synthesize cDNA with SuperScript III First-Strand Synthesis SuperMix (Thermo Fisher Scientific) for qRT-PCR. The cDNA was then analyzed by duplex qPCR analysis using custom FAM dye TaqMan primer / probe sets (IDT Technologies, https: / / eu.idtdna.com) against the lentiviral target sequence and either the GAPDH / 18S gene expression housekeeping gene VIC dye endogenous control (Applied Biosystems), with copy number standard curves using sufficient reference material to assess the normalized number of transcripts generated. Prior to these assays, several TaqMan primer / probe sets per target were designed using IDT's PrimerQuest online tool (www.idtdna / primerquest), and then tested to select the best performing ones, the sequences of which are shown in the table below.For eGFP we used a validated TaqMan Gene Expression Assay (FAM) from Applied Biosystems (4331182, Assay ID Mr04097229_mr).

[0144] [Table 2]

[0145] Lentivirus sample analysis: total titer, infectious titer and genomic titer To assess the total titer (lentiviral particles per mL, LP / mL) from the diluted lentiviral supernatant, a lentivirus-associated p24 ELISA kit (Cell Biolabs, VPK-107-5) was used according to the instructions provided by the manufacturer.

[0146] To measure the infection titer (transducing units per mL, TU / mL), adherent HEK293T (Lenti-XTM 293T, Takara, 632180) were cultured and seeded in 6-well plates the day before and exposed to various dilutions of lentiviral supernatant with 12 μg / mL polybrene (Santa Cruz, sc-134220) on the day of infection. The plates were centrifuged at 900×g for 30 min at room temperature and then incubated at 37° C. and 5% CO2 for 72 h. 72 h after infection, the cells were trypsinized and washed with PBS, and the eGFP expression of the cells was analyzed by a Cytoflex flow cytometer (Beckman Coulter). Supernatant dilutions giving 5-25% eGFP positive cells were used to calculate the infection titer (TU / mL) using the following formula: TU / mL = (FxC / V)xD, where F = frequency of GFP+ cells (%GFP+ cells / 100), C = number of cells per well seeded for transduction, V = inoculation volume (mL) (0.1 mL) and D = lentivirus dilution factor.

[0147] To measure the infection titer of CAR19hCD28z LVV, 5x105 THP-1 cells were seeded per well of a 24-well plate on the day of infection. Cells were infected with serial dilutions of LVV supernatant in medium containing 8μg / mL polybrene and centrifuged at 1000xg for 1 hour at room temperature. 48 hours after infection, cells were washed and stained with anti-mouse F(ab')2 fragment IgG conjugated with Alexa Fluor 647 as described above, and analyzed by FACS to determine CAR19h28z expression. The infection titer was calculated as described above.

[0148] Genomic titers (genomic particles per mL, GP / mL) were calculated using Takara's Lenti-X qRT-PCR titration kit (631235), which requires genomic RNA extraction of lentiviral supernatant and subsequent lentiviral genome copy quantification by qRT-PCR.

[0149] Gene expression analysis by qRT-PCR Total RNA was extracted from cell pellets collected during lentivirus harvest using the RNeasy Plus Mini kit (Qiagen, 74134) according to the manufacturer's protocol for animal cells. cDNA synthesis was performed from 1 μg of total RNA using SuperScript III First-Strand Synthesis SuperMix for qRT-PCR (ThermoFisher Scientific, 11752050). Copy number standard curves (10 8 ~10 2copies / well) were run alongside diluted cDNA from the harvested samples. The genomic RNA was double stranded with full length genomic RNA (LTR-P set: oligos MH531-5'TGTGTGCCCGTCTGTTGTGT 3' (SEQ ID NO: 14) and MH532-5'GAGTCCTGCGTCGAGAGAGC 3' (SEQ ID NO: 15) and fluorescent probe LRT-P (5'FAM-CAGTGGCGCCCGAACAGGGA-BHQ 3' (SEQ ID NO: 13); Integrated DNA Technologies) or FAM dye primer / probe set for total RNA from transgenes (Enhanced GFP, FAM TaqMan Gene Expression Assay; Applied Biosystems, 4351370, Assay ID Mr04097229_mr), and VIC dye primer / probe set for eukaryotic 18S rRNA endogenous control (VIC / MGB probe; Applied Biosystems, 4319413E) using Fast Advanced Master Mix (ThermoFisher qPCR runs were performed using a qPCR kit (Scientific, 4444556). Endogenous controls were used for sample normalization, and transcript copy numbers were calculated for each sample from a copy number standard curve. EXAMPLES

[0150] result Prior Art Constructions Figure 1A shows gene expression in producer cells 72 hours after transfection with standard EF1α-eGFP-WPRE transfer vector and lentiviral packaging constructs. RNA extracted from cells was subjected to RT-qPCR using probes LTR-P and eGFP to quantify full-length genomic RNA transcripts and total RNA transcripts, respectively. Transfer vector gene expression from closed linear DNA (dbDNA™) constructs was similar to that for the corresponding plasmid DNA (pDNA), demonstrating that the low infection titers were not the result of insufficient transfer vector RNA. It is believed that the unique structure of closed linear DNA vectors alters transfection and expression in producer cells, negatively affecting titers. RT-qPCR was used to analyze DNA copy number and transcript abundance in producer cells 72 hours after transfection. This revealed that cells transfected with closed linear DNA contained 3-4 times more DNA copies per cell of each construct compared to plasmids (Figure 1B).

[0151] Figure 2 shows titers from production using a "standard" transfer vector without poly(A) sequences and spacers. The total virus titer (p24) was 5-fold lower for closed linear DNA (dbDNA) transfections compared to the corresponding plasmid DNA (pDNA) transfections. However, the infectious virus titer for closed linear DNA (dbDNA) transfections was below the detection limit, demonstrating that in this case, very few infectious virus particles are produced. Legend: VP / ml is virus particles per milliliter and TU / ml is transducing units (infectious titer) per milliliter.

[0152] Following these results, attempts were made to optimize conditions for closed linear DNA transfection and results from these experiments can be seen in Figure 3. Optimizing conditions for closed linear DNA transfection resulted in a complete rescue of total particle titers (p24), however, infectious titers remained 100-fold lower for closed linear DNA compared to plasmid.

[0153] Further optimization work was carried out to see whether increasing the amount of transgene payload could increase the infection titer. The results shown in Figures 4A and 4B show that increasing the transgene does not rescue the infection titer. The results from the genome titer assay (Figure 4B) suggest that packaging of the viral genome into particles is less efficient for closed linear DNA compared to pDNA, and increasing the amount of transfer vector does not improve this situation.

[0154] New Architecture A novel closed linear DNA architecture shown in Figure 5 was constructed (above) and tested in transfection experiments (above). Figure 6 (A-C) shows the effect of various constructs on total particle titer, infectious titer and genomic titer. Cleavage downstream of the 3'LTR using AvrII restriction enzyme digestion did not improve titer, suggesting no read-through interference. However, addition of SV40p(A) improves both pDNA and closed linear DNA lentiviral vector titers.

[0155] Figure 7 (A-C) shows the results that adding a spacer to the closed linear DNA construct (either an F region termination sequence (FTS) or a 1 kb spacer (RS1)) further improves both the infectious and genomic titers from SV40 poly(A) alone. As can be seen, this effect is only seen in the closed linear DNA vector and not in the plasmid. Also, the effect appears to be independent of the sequence of the spacer.

[0156] FIG. 8 shows further optimization of routine transfection conditions for closed linear DNA vectors in terms of infectious titer compared to pDNA, which resulted in a two-fold lower infectious titer compared to plasmids. EXAMPLES

[0157] 5'spacer sequence A novel closed linear DNA architecture was constructed (above) and tested in transfection experiments (above). Figure 10A shows that the addition of a 1 kb random spacer sequence (RS1) upstream of the CMV / 5'LTR in addition to the 3'SV40 poly(A) and 3'spacer (LV-RS1-eGFP-pA-RS1) further improved both the infectious titer and the genomic titer from the SV40 poly(A) and 3'spacer sequence. The addition of the 5'spacer sequence resulted in a further 2-fold improvement in the infectious titer.

[0158] Optimized closed linear production vector Closed linear production vectors were constructed (above) and tested in transfection experiments (above). Production was performed in which each production construct was exchanged individually or in groups for an equivalent amount of the additional 3' RS1kb. Figure 11A shows the results that including the 3' spacer sequence in the closed linear production vector improved infectious titers. Addition of RS1kb to either GagPol or VSVg substantially improved infectivity. The combination of GagPol-RS1kb and Rev-RS1kb yielded the highest titers. EXAMPLES

[0159] Construct ratio optimization High-throughput optimization of construct ratios for the four DNA constructs eGFP payload, GagPol, Rev and VSVg for the new transfer vector architecture (LV-RS1-eGFP-pA-RS1) was performed using 0.7 μg / mL of total input transfer vector. Several conditions in which transfer vector and Rev were increased yielded significant improvements in infectious titers over our previous condition of 4:3:3:4. In particular, using a ratio of 3:1:2:1, up to 1.4 × 10 6 Titers of TU / mL were achieved (Figure 10B). EXAMPLES

[0160] CAR19h28z Lentiviral Particles Lentiviral particles expressing CAR19h28z (LV-RS1kb-1928z-LpA-RS1kb), including downstream SV40 LpA and flanking RS1kb, were generated. HEK293F suspension cells were co-transfected with LV-RS1kb-1928z-LpA-RS1kb, GagPol-RS1kb, Rev-RS1kb and VSVg at a molar ratio of 4:1:2:1 for dbDNA (0.7 μg / mL DNA; 1:3 DNA:PEI) and a mass ratio of 2:1:1:1 for plasmids (1 μg / mL DNA; 1:2 DNA:PEI), and supernatants were harvested after 72 hours for infection titer analysis by CD19 FACS of transduced THP1 cells. As shown in Figure 10B, using a fully optimized set of constructs and optimized transfection conditions, the infectious titers for LVP CAR1928z were equivalent whether plasmid or dbDNA was used as the starting material. Together, these data demonstrate that closed linear DNA can be used as an alternative starting material to plasmid for the production of high titer LV. EXAMPLES

[0161] Optimization of all vector inputs and construct ratios rescues all particle titers This example used standard prior art closed linear DNA constructs, however beneficial effects are also demonstrated in improved constructs (Examples 3 and 4).

[0162] The observed differences in closed linear DNA expression profiles indicated that transfection conditions and construct ratios needed to be further optimized to achieve titers comparable to the industry standard (plasmid). Total DNA input was assessed by transfecting cells with 0.5, 0.75 or 1.0 μg / mL of closed linear DNA vectors using a construct ratio of 2:1:1:1. Samples were harvested 72 hours post-transfection and analyzed for transfection efficiency and total p24 titers. A clear dose-dependent increase in total particle titers was observed as total DNA was reduced (Figure 2B, demonstrating a 6-fold increase in total particle titers using the lowest total input DNA).

[0163] Low infectious particle titers are not improved by increasing the transferred vector To identify conditions that yielded high particle titers, the infectivity of closed linear derived particles was compared to plasmid. A comparative study was performed between standard plasmid conditions (2:1:1:1; 1 μg / mL) and closed linear vector (0.5 μg / mL) using molar equivalents to the plasmid and two optimized ratio conditions of 0.5:1:3:1 and 0.5:3:3:1. This confirmed that the total particle titers using the optimized closed linear ratio conditions were comparable and reproducible to the plasmid, however, the infectious titers were found to be approximately 100-fold lower (Figure 3). The low infectious titers correlated with low abundance of lentiviral genomic RNA (vgRNA), suggesting that the particles may be empty due to insufficient vector transfer. This supports the hypothesis that the low infectivity of closed linear DNA derived LV is related to low packaging efficiency.

Claims

1. A closed circular linear DNA vector suitable for use as a lentiviral transfer vector, comprising, in the following 5' to 3' order, the sequences: (a) a hybrid 5' long terminal repeat (LTR) sequence; (b) a promoter operably linked to a transgene; (c) a 3' self-inactivating (SIN) sequence; (d) a poly(A) signal sequence; and (e) a spacer sequence A closed circular linear DNA vector comprising.

2. The closed circular linear DNA vector according to claim 1, wherein the spacer sequence is at least 250 nucleotides in length.

3. The closed circular linear DNA vector according to claim 1, wherein the promoter and the transgene are flanked on both sides by 5' and 3' LTR sequences.

4. The closed circular linear DNA vector according to claim 1, further comprising one or more additional spacer sequences, preferably a 5' spacer sequence located 5' of the hybrid 5' LTR sequence.

5. The closed circular linear DNA vector according to claim 4, wherein the 5' spacer sequence is at least 250 nucleotides in length.

6. The closed circular linear DNA vector according to claim 1, wherein the hybrid 5' LTR has all or part of the U3 region replaced by a heterologous promoter.

7. The closed circular linear DNA vector according to claim 1, wherein the poly(A) signal sequence comprises an additional helper sequence, optionally wherein the helper sequence is one or more upstream sequence elements (USEs).

8. The closed circular linear DNA vector according to claim 1, wherein the poly(A) signal is a strong poly(A) signal.

9. The closed circular linear DNA vector according to claim 1, wherein the poly(A) signal is selected from the SV40 late poly(A) sequence, rabbit β-globin poly(A) (rbGlob) or bovine growth hormone poly(A) (bGHpA) or a sequence having at least 90% homology with said sequences.

10. The closed circular linear DNA vector according to claim 1, wherein the 3' SIN LTR contains one or more deletions, optionally deletions in the U3 region, compared to the wild-type LTR.

11. The closed circular linear DNA vector according to claim 10, wherein the 3'SIN LTR contains a 133-nucleotide U3 deletion of nucleotides -149 to -9 with respect to the transcription start site as compared to the wild-type 3'LTR.

12. A method for improving the infectivity titer of lentiviral particles when the transfer vector is a closed circular linear DNA vector, the method comprising introducing the closed circular linear DNA vector according to any one of claims 1 to 11 into a packaging cell or a productive cell.

13. The method according to claim 12, further comprising introducing into the packaging cell one or more production vectors encoding viral elements required for the production of lentiviral particles.

14. The one or more production vectors are as follows: (e) a lentiviral group-specific antigen (GAG) gene; and / or (f) a lentiviral polymerase (POL) gene; and / or (g) an envelope gene (ENV); and / or (h) a lentiviral regulatory gene (REV) The method according to claim 13, comprising one or more of the above.

15. The method according to claim 14, wherein one or more of the production vectors are closed circular linear DNA vectors optionally containing a spacer sequence.

16. The closed circular linear DNA vector is: (a) i. a lentiviral group-specific antigen (GAG) gene; ii. a lentiviral polymerase (POL) gene; iii. an envelope gene (ENV); and / or iv. a lentiviral regulatory gene (REV) at least one expression cassette containing one or more of the above, and (b) a spacer sequence located 3' of the expression cassette The method according to claim 15, comprising the above.

17. The method according to claim 14, wherein the envelope gene is a vesicular stomatitis virus glycoprotein (VSV-G) gene.

18. The method according to claim 14, wherein the GAG gene and the POL gene are contained in a single production vector.

19. The method according to claim 12, wherein the packaging cell is a HEK293 cell or a variant or derivative thereof.

20. The method according to claim 12, wherein the vector is introduced into the packaging cell or the productive cell by transfection, optionally by chemical transfection.

21. The transfection agent is selected from any one of calcium phosphate (CaPO ４ ), polyethyleneimine (PEI) or lipofectamine, the method according to claim 20.

22. The method according to claim 15, wherein the closed circular transfer vector, the GAG-POL coding production vector, the REV coding production vector and the ENV coding production vector are supplied to the packaging cell at a construct molar ratio of 4:1:2:

1.

23. (a) inducing production of the lentiviral particles in a packaging cell or a productive cell transfected with at least one closed circular DNA vector adapted for production of lentiviral particles; and / or (b) culturing the transfected packaging cell or productive cell; and (c) recovering / isolating the produced recombinant lentiviral particles from the culture medium The method according to claim 12, further comprising.

Images