Ciliary Proteins as Biomarkers and Methods of Use - Patent application

Abstract

The present invention provides methods and kits for detecting ciliary markers in a sample, and their use for detecting and treating endothelial injury or dysfunction or vascular injury in a subject.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 63 / 191,126, filed May 20, 2021, the entire contents of which are incorporated by reference.

[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH This invention was made with Government support under Grant No. R61HL154254 awarded by the National Institutes of Health. The Government has certain rights in this invention.

[0003] Sequence Listing The Sequence Listing is attached to this application and is submitted as an ASCII text file of Sequence Listing entitled "650053.00884_ST25.txt", 1518 bytes in size and created on May 19, 2022. The Sequence Listing has been submitted electronically with this application via EFS-Web and is hereby incorporated by reference in its entirety. [Background technology]

[0004] Cilia are microtubule-based organelles that protrude from the apical luminal surface of endothelial cells (ECs) and are widely regarded as low-flow sensors. Previous reports have suggested that cilia on the EC surface are lost at high shear stress, and more recent evidence suggests that epilation, the physical removal of cilia from the cell surface, is the primary mechanism of cilia loss in mammalian cells. There is a need for new markers and methods to detect changes caused by high or low blood flow that lead to endothelial injury or dysfunction or vascular damage. Summary of the Invention [Problem to be solved by the invention]

[0005] Cilia and their associated proteins expressed on endothelial cells are lost when they encounter turbulent flow, and the cilia are removed from the cells and can be detected on red blood cells and body fluids. Thus, these free cilia can be used as a biomarker of changes in blood flow associated with vascular dysfunction and injury.

[0006] In one aspect, the present disclosure provides a method for detecting endothelial damage or dysfunction or vascular damage in a subject in need thereof, comprising detecting one or more markers of cilia in a biological sample from the subject, wherein a higher level of cilia detected in the biological sample compared to a control is indicative of endothelial damage or dysfunction or vascular damage.

[0007] In another aspect, the present disclosure provides a kit comprising at least one antibody that binds to at least one cilia marker and instructions for use.The kit may further comprise at least one secondary agent with detectable label.The one or more antibodies may bind to cilia marker selected from the group consisting of ARL13b, γ-tubulin, IFT88, inversin, nuclear factor-erythroid factor 2-related factor 2 (NRF2) and acetylated α-tubulin.

[0008] In another aspect, the disclosure provides a method of detecting an occlusive event associated with sickle cell disease (SCD) in a subject having SCD, the method comprising detecting one or more markers of cilia in a first biological sample from the subject.

[0009] In a further aspect, the present disclosure provides a method of detecting cilia on red blood cells in a sample from a subject, the method comprising obtaining a blood sample from the subject, separating red blood cells (RBCs) from the sample, and detecting one or more markers of cilia on the surface of the red blood cells. [Brief description of the drawings]

[0010] [Figure 1]Figure 1. Shear stress causes brain ECs to express less ciliary proteins in vitro. HBMVECs were subjected to graded intensities of shear stress (2 dyne / cm2, 4 dyne / cm2, 10 dyne / cm2) by an Ibidi flow system. A total of 2 dyne / cm2 was utilized as the "steady-state" flow condition. After flow for the indicated durations, expression of cilia-associated proteins was quantified as MFI by flow cytometry. NRF2, a transcription factor reported to control cilia formation and function, was also included in the study. Expression of proteins in samples was normalized to their respective "no flow" controls. ANOVAs were performed to compare experimental and steady-state control groups for the 10 min or 24 h time points. ANOVAs were two-fold. Analysis was also performed on the 2 dyne / cm2 group from 10 min to 24 h. No statistical differences were observed between the 4 dyne / cm2 and 10 dyne / cm2 groups in all three protein expression. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. For all groups reported in this figure, n=6 except for IFT88 (n=5 for the 10dyne group). [Figure 2A-K]Shear stress causes endothelial and epithelial cell collapse in vitro. (A-D) HUVECs grown on a monolayer. A fluid shear stress of 20 dyne / cm2 was perfused through the cells and the perfusate was collected. Droplet-concentrated perfusate was analyzed under a DIC microscope and stained with markers for cilia (acetylated α-tubulin) (B) and basal bodies (γ-tubulin) (C). Magnified images are also shown in boxes. (D) Overlaid images are shown. (E and F) Immunostaining for the presence or absence of cilia (acetylated α-tubulin, green, cilia; DAPI, blue, nuclei) from a population of epithelial cells before (upper panel) and after (lower panel) application of 10 dyne / cm2 shear stress, respectively. (G and H) Phase contrast DIC images of primary cilia in a single live cell (white dotted box). The same cells were imaged before and after application of 10 dyne / cm2 fluid shear stress for 4 min. (I) Perfusion under a DIC microscope. (J) In a separate experiment, the perfusate was collected and stained with a cilia marker (acetylated α-tubulin; green) to confirm the presence of cilia using both fluorescent and phase contrast imaging (I). (K) Cilia and cell lysates were immunoblotted with a cilia marker (acetylated α-tubulin) to molecularly confirm the presence of cilia in the perfusate (n=6). EK stands for porcine kidney epithelial cells (LLC-PK1). [Figure 3A-B] Figure 1: Shear stress results in ECs with fewer ciliary proteins in vivo. Flk1mCherryArl13bGFP double transgenic zebrafish embryos at 29.5 hpf were exposed to a temperature of 32 °C for 3 h. Single cells were harvested from dechorionated embryos and expression of cilia-specific proteins was quantified by flow cytometry in live ECs (mCherry+) versus non-ECs (mCherry-). Representative dot plots show the gating strategy applied during FACS analysis to identify ECs (A). Stress-responsive protein Klf4 was quantified in ECs (B). Protein quantification was performed by measuring MFI. [Figure 3C-D]Cilia-specific proteins were quantified in EC (C) and non-EC (D). Arl13b expression is characterized by enhanced green fluorescent protein expression. For Arl13b n=6 (for EC and non-EC); γ-tubulin n=5 (for EC and non-EC); Ift88 n=4 (EC) and n=5 (non-EC); inversin (n=3 for EC and non-EC); Klf4 n=3 (for EC and non-EC). Linear mixed models were used to examine differences between treatment and control groups within EC (mCherry+) or non-EC (mCherry-). Time treated nested within 1 day was treated as random. ARL13b and inversin expression data were log-transformed to improve fit. [Figure 4A-D] Figure 1: Sickle cells attach to brain ECs and induce defects, and cilia are found in sickle cell and SCD derived plasma. HBMVECs exposed to sickle cell (SS) or healthy (AA) RBCs were subjected to shear stress (1 dyne / cm2) and the percentage of SS (n=6) and AA (n=5) RBCs that adhered to ECs after stress induction was calculated, P=0.0081 (A). Prior to flow, SS and AA RBCs were tested for ARL13b cilia and the percentage of ARL13b cilia attached to circulating SS RBCs (n=16) vs. AA RBCs (n=12) was quantified, P<0.0001 (B). Following flow, ARL13b expression on SS RBCs (n=11) but not AA RBCs (n=6) upon interaction with ECs, P=0.0006 (C). (A-C) Mann-Whitney-Wilcoxon test P values ​​are shown. Representative fields of smears of SS RBCs (magnification 63x; scale bar = 20 µm) show the presence of cilia on these sickle RBCs as detected with a FITC-conjugated anti-Arl13b antibody (D). Western blot plots show the detection of cilia-specific proteins in plasma samples of healthy controls (AA) versus sickle RBCs (SS). [Figure 4E-F]Red asterisks represent the upper IFT88 band used for quantification (E). Note that western blots from only the four AA and SS samples are shown in E. Separate gels for the other six samples were run and quantified. Quantification includes all ten samples from each group. Cilia-specific proteins were quantified from healthy control (AA) (n=10) vs. sickle cell (SS) (n=10) plasma samples and normalized to the housekeeping protein bACTIN (F). *P<0.05, ***P<0.001. Two-tailed t-tests or Mann-Whitney-Wilcoxon tests were performed to compare between groups. [Figure 5A-B] Sickle cell-induced cilia shedding depends on increased EC ROS generation induced by RBCs. Human brain microvascular ECs were sham-treated or treated with the NOX inhibitor apocynin (A) or without sickle cell (SS RBCs) prior to exposure (n=6). Exposure of HBMVECs to SS RBCs increased ROS generation in ECs that is NOX-dependent. Flow cytometry analysis shows that ARL13b bound to SS RBCs (n=6) before (baseline) and after interaction with shear-stressed ECs pretreated with apocynin (B). *P<0.05, and ****P<0.0001. +a=ECs treated with apocynin. For A, one-way ANOVA test was performed, and for B, Wilcoxon signed rank test was performed. [Figure 6A-C] Figure 1: Attenuation of ROS production rescues ciliary proteins in ECs. HBMVECs were treated with ROS-inducing PMA in the presence or absence of the NOX inhibitor VAS2870. A non-treated group was also included as a control. ROS production was quantified as MFI by flow cytometry (A). Heme oxygenase 1 (HO-1), a protein that counteracts oxidative stress, was quantified (B). NRF2, a transcription factor reported to control cilia formation and function, was also included in the study (C). [Figure 6D-E]Ciliary proteins are downregulated by PMA and rescued by the NOX inhibitor VAS2870 (D and E). ****P<0.0001. ANOVA (1-way) was performed and Bonferroni's correction was used to adjust for multiple comparisons (n=5 for all groups). [Figure 7A-B] Figure 1: Validation of shear stress induced by the Ibidi flow system. Human brain microvascular endothelial cells were subjected to 10 dyne / cm2 shear stress for 24 hours, as induced by the Ibidi flow system, and subsequently monitored for flow-responsive genes KLF4 or KLF2 by qRT-PCR (A) and the respective proteins by flow cytometry (B). KLF4 and KLF2 gene expression was normalized to GAPDH and plotted as fold change. *P<0.05 [Figure 8A-F] Loss of ciliary proteins from brain endothelial cells after shear stress induced by the shaker method in vitro. Human brain microvascular endothelial cells were subjected to graded intensities of shear stress (4 dyne / cm2 and 10 dyne / cm2) induced by the "shaker" method, after which the expression of cilia-specific proteins was quantified by flow cytometry. Stress-responsive proteins were quantified together with non-ciliary housekeeping (B) or cilia-specific proteins (C-F) by measuring the median fluorescence intensity (A). For all proteins, intergroup comparisons (4 dyne vs. control, 10 dyne vs. control and 4 dyne vs. 10 dyne) were performed. P, 0.001 for Arl13b, tubulin, IFT88 and inversin proteins in all three group comparisons. For Alk1, P = 0.0003 for 4 dynes vs. control, P = 0.001 for 10 dynes vs. control, and P = 0.0004 for the comparison of 4 dynes vs. 10 dynes. For dyne, P = 0.001 for 4 dynes vs. control and 10 dynes vs. control, and P = 0.0173 for the comparison of 4 dynes vs. 10 dynes. N = 3 for all protein targets except β-actin, where n = 4. [Figure 9A-B]Figure 1 shows the scheme of in vitro and in vivo shear stress EC FACS experiments: (A) shows the scheme of processing of HBMVEC after shear stress for FACS analysis; (B) shows the scheme of fish processing conditions before FACS and subsequent analysis. [Figure 10] Figure 1: Experimental design of temperature-induced shear stress in zebrafish. The three groups and their respective incubation conditions are shown in diagram form. All blood flow parameters were assessed 48 hours post fertilization (hpf). [Figure 11A-B] Figure 1 shows PMBC flow parameters assessed at two temperatures, 32 °C and 35 °C. A shows pulse, blood flow velocity, vessel diameter and shear stress measured in the primitive midbrain channel (PMBC) across three groups (G1-G3 shown in Figure S2) at 32 °C. B shows pulse, blood flow velocity, vessel diameter and shear stress measured in PMBC across three groups (G1-G3 shown in Figure S2) at 35 °C. *P<0.001. [Figure 12A-B] Figure 1 shows DA flow parameters assessed at two temperatures, 32 °C and 35 °C. A shows pulse, blood flow velocity, vessel diameter and shear stress measured in the dorsal aorta (DA) across three groups (G1-G3 shown in Figure S2) at 32 °C. B shows pulse, blood flow velocity, vessel diameter and shear stress measured in the DA across three groups (G1-G3 shown in Figure S2) at 35 °C. *P<0.001. [Figure 13A-B] Figure 1 shows PMBC and DA flow parameters assessed at two temperatures at 32 °C. A shows pulse, blood flow velocity, vessel diameter and shear stress measured in the primitive midbrain channel (PMBC) across three groups (G1-G3 shown in Figure S2) at 32 °C. B shows pulse, blood flow velocity, vessel diameter and shear stress measured in the DA across three groups (G1-G3 shown in Figure S2). *P<0.0001. [Figure 14A-F]Whole mount images of Casper fish at 35 °C and 32 °C. A, D (group 1), B, E (group 2) and C, F (group 3). Casper transparent 48 hours post fertilization (48 hpf). Fish embryos incubated at 35 °C and 32 °C were stained with O-dianisidine stain (red blood cells). Note that the embryos of group 3 (C) at 35 °C show curved axes. Anterior is left and posterior is right. Dorsal is up. [Figure 15A-C] Cilia on circulating mouse sickle red blood cells. A and B show blood smears from SS sickle mice stained for IFT88 and Arl13b antibodies. Green staining is cilia on RBCs. Quantification in panel C is from a different experiment than panels A and B. For quantification of Arl13b positive cilia attached to control (AA) vs. sickle red blood cells (SS), 4 mice per group were used. One smear from each mouse and 4 fields in each smear were counted. Thus, combined data from 16 smears counted from control and sickle mouse groups (n=4 per group) are presented. #P<0.0001. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] The present invention provides a method and kit for detecting cilia in biological samples and its use. In this disclosure, we demonstrate that cilia can serve as a biomarker of flow changes (high or low) in disease states and thus be used as a prognostic or diagnostic marker of disease in patients. Flow rates can be lower or higher in the body, resulting in vascular injury and damage. Thus, the ECs underlying all blood vessels in the body are the first line of flow sensors that respond to altered flow patterns by distributing or retaining cilia on the cell surface. Thus, the net result is more or less cilia in biological fluids, which can be monitored by assays (e.g., ELISA analysis). In some embodiments, basal bodies associated with cilia serve as a marker of origin of cilia in biological fluids (serum, blood, urine, cerebrospinal fluid, semen, saliva, tears, synovial fluid, breast milk, bile, amniotic fluid, aqueous humor, vaginal lubrication, sweat, lymph, bone marrow).

[0012] Cilia length is often correlated with mechanosensing in blood vessels, with cells undergoing low shear stress having longer cilia and cells in blood vessels undergoing high shear stress having shorter or no cilia. Cilia consist of an axoneme that projects into the lumen and is anchored to the cell via transitional fibers that connect to the basal body, a centrosome-derived structure. Recent studies suggest that cilia can be physically removed from mammalian cells, a process called shedding, which releases the ciliary membrane and axonemes from the basal body. Examples demonstrate that detection or quantification of ciliary proteins in circulation can serve as biomarkers of pathological conditions of altered blood flow or altered blood viscosity. Examples show that high shear stress on endothelial cells reduced the expression of cilia-associated proteins by approximately 20% after 10 minutes of perfusion compared to steady-state controls (Figure 1). The reduction in protein expression in the group was even more pronounced (>50%) 24 hours after perfusion (Figure 1). Furthermore, in the brain and systemic vasculature, it has been hypothesized that occlusive events in SCD are initiated by the adhesion of sickle cells to the endothelium. Examples demonstrate that ciliary proteins may be high in the plasma of SCD patients. Plasma from 10 SCD patients and 10 healthy individuals was tested using Western blot for the presence of ciliary proteins ARL13b, γ-tubulin and IFT88 (Figure 4, E and F). Compared to healthy volunteers, all three ciliary proteins were enriched in plasma from SCD patients (Figure 4F), demonstrating a pathological condition with a predisposition to vascular obstruction and / or impaired blood flow, and ciliary proteins are present on the surface of RBCs and further accumulate on RBCs upon EC contact and are enriched in plasma. Ciliary proteins may be used as biomarkers to diagnose blood flow-mediated changes in the vascular endothelium.

[0013] In one embodiment, cilia-specific proteins can be quantified in plasma as biomarkers of endothelial injury or dysfunction. Examples have detected cilia fragments in exudates in cell cultures from ECs and epithelial cells, and fewer cilia-expressing cells in vivo in ECs. Furthermore, human sickle red blood cells exhibit enhanced ARL13b cilia protein on their surface compared to normal RBCs, and the presence of cilia protein on these sickle red blood cells was 2.3-fold higher when encountering brain ECs under intermittent flow conditions. These results are consistent with the detection of higher levels of cilia protein in SCD plasma compared to healthy plasma. Interestingly, we observed all three representative components of cilia structure (i.e., axonemes, transition zones, and basal bodies) in the plasma of SCD patients. In the case of SCD, identification of enhanced cilia proteins on RBCs may prognose adverse events such as weakening of the vessel wall and susceptibility to bleeding, both clinically relevant features observed in SCD patients. Having this information is beneficial to make informed clinical decisions.

[0014] method: In one embodiment, the present disclosure provides a method for detecting endothelial damage or dysfunction or vascular damage in a subject in need thereof.The method includes detecting one or more markers of cilia in a biological sample from the subject.As shown in the examples, a higher level of cilia detected in a biological sample compared to a control indicates endothelial damage or dysfunction or vascular damage in the subject.The method can then further include administering a therapeutic agent that can treat endothelial damage or dysfunction or vascular damage, or monitoring the subject's vasculature (e.g., MRI, etc.).

[0015] Endothelial injury or dysfunction is characterized by loss of barrier function and infiltration of cellular material into the vessel wall as well as loss of physiological vascular tone. There is loss of nitric oxide-mediated physiological vasodilation, increased endothelial adhesion, and migration of leukocytes and macrophages into the subendothelial vessel wall. Hypoxia, shear forces, and oxidative stress are the triggering events for endothelial dysfunction. Among other things, this results in a situation in which vasoactive substances that normally produce vasorelaxation, such as acetylcholine or serotonin, cause vasoconstriction. Disorders associated with endothelial dysfunction include hypertension, atherosclerosis, diabetes, immune system dysfunction, infections, inflammation, cardiovascular disease, stroke, sickle cell anemia, arterio-venous malformations, varicose veins, changes in tumor vasculature, thrombotic thrombocytopenic purpura (TTP), hemorrhage, and preeclampsia. Vascular injury is any disruption of blood vessel function, including that which causes blood loss, blood clots, bruising, swelling, pain, soreness or swelling.

[0016] As used herein, "subject" may be interchangeable with "patient" or "individual" and refers to an animal that may be a human or non-human animal in need of treatment. In certain embodiments, the subject is a human subject. The subject in need may be any subject that may be suffering from endothelial damage or dysfunction, including, but not limited to, subjects with or diagnosed with hypertension, atherosclerosis, diabetes, immune system dysfunction, infection, inflammation, cardiovascular disease, stroke, sickle cell disease, sickle cell anemia, arterio-venous malformation, varicose veins, tumor vasculature changes, hemorrhage, and pre-eclampsia. In one example, the subject has sickle cell disease.

[0017] The term "biological sample" as used herein includes, but is not limited to, a sample comprising tissue, cells, and / or biological fluids isolated from a subject. Examples of biological samples include, but are not limited to, tissue, cells, biopsy, blood, lymph, serum, plasma, urine, saliva, mucus, and tears. In some embodiments, the biological sample is a biopsy (such as a tumor biopsy). The biological sample can be obtained directly from the subject (e.g., by blood or tissue sampling) or from a third party (e.g., received from an intermediary such as a healthcare provider or laboratory technician). In some embodiments, the biological sample is selected from the group consisting of tissue, cells, biopsy, blood, lymph, serum, plasma, urine, saliva, mucus, and tears. In certain embodiments, the biological sample comprises a biopsy.

[0018] As used herein, the term "marker" or "biomarker" refers to a biological molecule present in a subject at various concentrations that is useful for predicting the risk or incidence of a disease or condition. For example, a biomarker can be a protein that is present in greater or lesser amounts in subjects at risk for endothelial or vascular injury. A biomarker can include a nucleic acid, ribonucleic acid, or polypeptide that is used as an indicator or marker of endothelial or vascular injury in a subject. In other embodiments, the marker can include a marker of cilia. In other embodiments, the marker can be a basal body ciliary marker. In certain embodiments, the marker can include one or more basal body markers selected from ADP-ribosylation factor-like protein 13B (ARL13b), interlaminar transport protein 88 homolog (IFT88), acetylated alpha tubulin, nuclear factor-erythroid factor 2-related factor 2 (NRF2), and gamma tubulin or inversin, and any suitable combination thereof. In some embodiments, the method includes detecting two or more ciliary markers, or three or more ciliary markers.

[0019] In some aspects, the one or more markers of cilia are ciliary markers or basal body ciliary markers. In some embodiments, the detecting step detects at least one ciliary marker and at least one basal body marker. The one or more markers can be selected from the group consisting of ARL13b, γ-tubulin, IFT88, inversin, nuclear factor-erythroid factor 2-related factor 2 (NRF2) and acetylated α-tubulin. In one example, the one or more ciliary markers are selected from ADP-ribosylation factor-like protein 13B (ARL13b), interlaminar transport protein 88 homolog (IFT88), acetylated-α-tubulin and nuclear factor-erythroid factor 2-related factor 2 (NRF2), and the one or more basal body markers are selected from γ-tubulin or inversin.

[0020] The term "control" for measuring the level of one or more markers can refer to a sample from a non-diseased patient, a positive control with a known amount of the marker, or can refer to an initial sample taken from the same patient from an earlier time point that can be used to monitor changes in the level of the marker over time. One skilled in the art can select an appropriate control to allow appropriate measurement of the level of the marker.

[0021] For example, the method may further comprise detecting one or more markers of cilia in a second biological sample from the same subject, the biological sample being taken at a later time than the first sample.In some embodiments, the increase in the level of cilia protein in the second sample compared to the first sample may indicate endothelial damage or dysfunction or vascular damage of the subject.Therefore, it is contemplated that the cilia markers described herein can be monitored and detected over time to assess the risk or occurrence of endothelial damage or dysfunction or vascular damage of the subject.

[0022] In some embodiments, detecting the one or more markers comprises contacting the sample with one or more antibodies against a marker of cilia and detecting the presence of the antibodies in the sample. Suitable antibodies against markers of cilia can be found in the art or can be made by using laboratory animals to make suitable monoclonal antibodies.

[0023] Suitable antibodies can be found commercially. Primary antibodies used herein include ARL13b (Proteintech catalog 17711-I-AP), acetylated tubulin (Sigma catalog T6793), IFT88 (Thermo Fisher Scientific catalog PA5-18467), inversin (Proteintech catalog 10585-I-AP), dynein (Thermo Fisher Scientific catalog MA1-070), g-tubulin (GeneTex catalog GTX113286), Alk1 (Abcam catalog ab51870), KLF4 (Proteintech catalog 11880-I-AP), HO-1 (BD, catalog 566391), NRF2 (BioLegend, catalog 939202) and b-actin (Sigma catalog A5441 and Cell Signaling Technology catalog 4970P). The secondary antibodies used are goat anti-mouse PECy7 (BioLegend), donkey anti-rabbit PE (Thermo Fisher Scientific), donkey anti-goat AF657 (Thermo Fisher Scientific), donkey anti-rabbit BV421 (BioLegend) and donkey anti-rabbit AF488 (Thermo Fisher Scientific). However, the present disclosure is not limited by these antibodies, and any suitable antibody that is specific, sensitive, and capable of binding strongly to a cilia marker can be used in the practice of the disclosure described herein.

[0024] Suitably, the primary antibody that can bind to the cilia marker can be directly conjugated to the detectable marker.In other examples, a secondary reagent or secondary antibody that can bind to the first antibody can be used, and the secondary antibody is conjugated to the detectable marker.In some embodiments, a control protein is also used as a measure for the quantification of the marker, for example, the control protein is tested in multiple amounts, and the brightness of the signal is correlated with the amount of protein to create a curve that correlates the amount of the cilia marker in the sample.These techniques are well known in the art.

[0025] Suitable detectable markers are known in the art and include, for example, fluorescent proteins (green fluorescent protein (GFP), red fluorescent protein (RFP, dsRed, etc.), yellow fluorescent protein (YFP) EBFP, ECFP, mHoneydew, mBanana, mOrange, tdTomato, mTangerine, mStrawbery, mCherry, mGrape, mRaspberry, mPlum, etc., all of which are known in the art, including, for example, those described in Fluorescent Proteins and Their Applications in Imaging Living Cells and Tissues Dmitriy M. Chudakov, Mikhail V. Matz, Sergey Lukyanov and Konstantin A. Lukyanov, Physiological Reviews 2010 90:3, 1103-1163, which is incorporated by reference in its entirety), reporter enzymes, ligand / substrate binding (biotin / streptavidin), and others known in the art.

[0026] When a reporter enzyme is used, detection is achieved by measuring the activity of the reporter enzyme via incubation with an appropriate substrate to produce a measurable product. Suitable enzyme labels are horseradish peroxidase (HRP) and alkaline phosphatase (AP). Other suitable enzymes include, but are not limited to, β-galactosidase, acetylcholinesterase, and catalase. The choice of substrate depends on the assay sensitivity required and the equipment available for signal detection (spectrophotometer, fluorometer, or photometer).

[0027] In some embodiments, the detection method is detection by using enzyme-linked immunosorbent assay (ELISA). ELISA technology is readily known in the art. ELISA can be, among others, direct ELISA, indirect ELISA, or sandwich ELISA. In some aspects, direct or indirect immobilization of markers on a surface can be used. In other embodiments, primary or secondary antibody bays are immobilized on a suitable surface.

[0028] In another embodiment, detection is by flow cytometry using beads conjugated with markers, for example by binding the cilia marker to an antibody conjugated to the beads, or other suitable methods known in the art.

[0029] The methods described herein may have additional washing steps, which may be added to remove any addition of irrelevant proteins or other molecules that do not specifically bind to the antibody or reporter marker. Detection may involve measuring a signal generated in an assay directly or via a secondary reporter marker.

[0030] In some embodiments, the method further comprises administering a therapeutic agent to treat endothelial or vascular injury. As used herein, the terms "treat" or "treating" refer to alleviating symptoms, eliminating the cause of the resulting symptoms, either temporarily or permanently, and / or preventing or delaying the appearance, or reversing the progression or severity of symptoms resulting from the specified disease or disorder, respectively.

[0031] The detected endothelial damage or dysfunction or vascular damage can be associated with disease or disorder.Selected from sickle cell anemia, atherosclerosis, stroke, arteriovenous malformation, varicose veins, tumor vasculature changes, hemorrhage, preeclampsia and hypertension.Suitably, endothelial damage can be associated with preeclampsia, polycystic kidney disease, hypertension and stroke.

[0032] Sickle cell disease is a group of blood disorders, the most common of which is sickle cell anemia. Sickle cell disease causes vascular blockages that can lead to pain, ischemia, and organ damage. Appropriate treatment includes, among other things, medications to relieve pain and blood transfusions.

[0033] Atherosclerosis or atherosclerotic vascular disease is a disease of the walls of arteries, resulting in lesions and narrowing of the arteries. Damage to the endothelium disrupts the balance between vasoconstriction and vasodilation, initiating many events / processes that promote or exacerbate atherosclerosis, including increased endothelial permeability, platelet aggregation, leukocyte adhesion, and cytokine production. Appropriate treatments for atherosclerosis can be dietary changes, therapeutic drugs (e.g., statins and other cholesterol drugs, including cholesterol absorption inhibitors called ezetimibe (Zetia)), blood thinners (e.g., Warfrin, aspirin, coumadin, etc.), blood pressure medications, surgical procedures (angioplasty and stent placement, endarterectomy, fibrinolytic therapy).

[0034] Stokes is a medical condition in which insufficient blood flow to the brain leads to cell death. Endothelial dysfunction occurs after stroke, leading to oxidative stress, inflammation, increased vascular tone, blood-brain barrier (BBB) ​​damage, and further thrombotic vascular complications in the brain. Appropriate treatments, including blood thinners, are known. Stroke is associated with blood components leaking into the brain and can be pre-prognosticated by cilia biomarker testing, allowing preventative measures (e.g., anticoagulant treatment) before adverse effects.

[0035] Arteriovenous malformations (AVMs) occur when blood vessel groups in the body form incorrectly. In these malformations, arteries and veins abnormally intertwine to form direct connections, bypassing normal tissue. Monitoring of cilia protein levels allows for the detection of changes in flow within the lesion, which is currently diagnosed by imaging or after flow leaks. Therapeutic treatments such as inclusions of coils and the like and their effect on the malformation can also be determined by cilia biomarker detection kits.

[0036] Varicose veins, also known as varicose veins, are a medical condition in which superficial veins become enlarged and twisted. Dysfunctional endothelium has a pivotal role in perpetuating the inflammatory cascade, resulting in pathological venous changes and worsening chronic venous disease. Endothelial dysfunction may play a central role in the association between varicose veins and deep vein thrombosis. Current treatments are surgery, laser therapy and blood-reducing drugs. The efficacy of these treatments can be assessed and monitored by the methods described herein for detecting cilia biomarker profiles from blood.

[0037] Hemorrhage is blood escaping from the circulatory system through damaged blood vessels and compromised permeable endothelium. This leads to close monitoring and additional preventive clinical measures to stop the impending crisis. Preeclampsia is a pregnancy disorder characterized by the development of hypertension. Increased blood pressure in the mother leads to premature birth of the child. Therefore, early detection of increased blood pressure changes using cilia biomarkers would change the course of treatment. Endothelial dysfunction leads to hypertension and many of the other symptoms and complications associated with preeclampsia. Preeclampsia can be treated by hypertensive drugs, among others, premature birth of the baby.

[0038] Hypertension, also known as high blood pressure (HBP), is a medical condition in which blood pressure in the arteries is persistently elevated.Suitable treatments are known in the art, including, for example, blood pressure medications that can lower blood pressure.Hypertension leads to more ciliary proteins in the blood, thus leading to changes in medication regimens.

[0039] Polycystic kidney disease is associated with a tendency for blood vessels in the brain to bulge, and patients are monitored for vascular breakage and bleeding. Blood thinners and antihypertensive drugs are used. When a cilia test is performed, blood vessels prone to rupture may increase cilia proteins and their deposition in the blood, which changes the course of treatment.

[0040] Brain injury can be monitored using the cilia biomarker method described herein. The method can determine whether a patient needs an MRI examination. This has significant implications for return to work and saving MRI costs, or prioritizing which patients need immediate attention in the ER. Other benefits of cilia biomarker testing include minimizing "brain radiation" exposure to children and teens. Ciliary testing can also be used to determine whether and how effective treatment is for brain injury.

[0041] The methods described herein can be used to treat tumor vasculature. Blood vessels in tumors are tortuous and have abnormal flow. Therefore, normalizing blood flow will help drugs penetrate tumors. However, whether flow is normalized is currently determined by imaging. Cilia biomarker testing can help evaluate the effectiveness of flow in tumor beds after treatment. Also, cilia are longer on tumor cells that are resistant to treatment. There is no reliable detection platform for resistant cells. Cilia analysis of these cells using biomarker kits can inform resistant populations, which can then be targeted for killing.

[0042] Biological sample is the sample taken from the subject.For example, suitable biological sample can be serum, blood, urine, cerebrospinal fluid, semen, saliva, tears, synovial fluid, breast milk, bile, amniotic fluid, aqueous humor, vaginal lubrication, sweat, lymphatic fluid and bone marrow.In a preferred embodiment, biological sample is blood or plasma sample.

[0043] In another embodiment, the present disclosure provides a method for detecting an obstructive event associated with sickle cell disease (SCD) in a subject with SCD. The method includes detecting one or more markers of cilia in a biological sample from the subject. The present disclosure also provides a method for monitoring the level of a cilia marker in a biological sample taken from the subject over time. For example, the method may further include detecting one or more markers of cilia in a second biological sample from the same subject, the biological sample being taken at a later time than the first sample, and an increase in the level of a cilia protein in the second sample compared to the first sample indicates an obstructive event. Thus, it is contemplated that the cilia markers described herein can be monitored and detected over time to provide an assessment of the risk or onset of an obstructive event.

[0044] Detecting one or more markers can include contacting the sample with one or more antibodies against a marker of cilia and detecting the presence of the antibodies in the sample. In some embodiments, the method further includes contacting the sample with a secondary antibody having a detectable marker and detecting the detectable marker in the sample. In some examples, the first antibody or the second antibody is bound to a solid support. In some embodiments, the method includes, inter alia, ELISA or flow cytometry.

[0045] In some embodiments, the method further comprises administering a therapeutic agent to treat the occlusive event in the subject with SCD.

[0046] The term "occlusive event" includes, among other characteristics, weakening of the vessel wall or increased susceptibility to bleeding. Appropriate treatments include, but are not limited to, medications to reduce pain (NSAIDS, aspirin, narcotics, etc.) and blood transfusions, among others. Additionally, a scan may be recommended (e.g., MRI, etc.). For example, if cilia levels are high, a scan may be recommended as an aneurysm (dilated blood vessel) may be showing signs of breakage, which is not good for the patient's health. Currently, they routinely scan patients for such dilated blood vessels, hoping that they will not worsen over time. These scans are done at regularly scheduled visits to the clinic. Therefore, it is beneficial to save unnecessary scans by ordering the test. Also, scanning when necessary rather than routinely reduces the number of scans the subject is exposed to and provides a non-invasive means of monitoring the subject. Additionally, altering the course of treatment based on impending crisis is also clinically beneficial by identifying increased cilia.

[0047] In another embodiment, the present disclosure provides a method of detecting cilia on red blood cells in a sample from a subject, the method comprising obtaining a blood sample from the subject, isolating red blood cells (RBCs) from the sample, and detecting one or more markers of cilia on the surface of the red blood cells. Detection of cilia on the RBCs indicates damaged blood vessels. The method may further comprise obtaining a second blood sample from the subject, isolating a second set of red blood cells from the sample, detecting one or more markers of cilia on the surface of the RBCs, and comparing the level of cilia on the RBCs from the first sample to a second sample, the second sample being taken at a later time than the first sample, and an increase in cilia associated with the RBCs indicates damage to one or more blood vessels in the subject. The first and second samples may be taken weeks, months, or years apart for monitoring. Suitably, the method may include taking a third, fourth, fifth, sixth, etc. sample and comparing it with the previous sample to monitor the change in cilia concentration in the sample and change any changes in the subject. For example, samples may be taken monthly to monitor the conditions described herein. In some examples, samples may be taken weekly (e.g., pre-eclampsia) to monitor pregnant subjects.

[0048] kit: In another embodiment, the present invention provides a kit for carrying out the method described herein, including a kit for measuring cilia markers in biological samples.Suitably, the kit can include at least one antibody that binds to at least one cilia marker, and instructions for use.The kit may further include at least one secondary antibody with a detection label.The kit contemplated herein can include one or more antibodies that bind to cilia markers, and the cilia markers are selected from the group consisting of ARL13b, γ-tubulin, IFT88, inversin, nuclear factor-erythroid factor 2-related factor 2 (NRF2) and acetylated α-tubulin.

[0049] In another embodiment, an ELISA kit for detecting cilia is provided. The ELISA kit includes a solid support, at least one primary antibody that specifically binds to cilia, at least one secondary antibody that is specific to the primary antibody and has a detectable marker, and instructions for use. The detectable marker can be an enzyme reporter. The detectable marker can be a fluorescent marker or a colorimetric marker. In one aspect, the ELISA kit can be used to screen for detection of basal bodies of cilia based on proteins expressed on cells of cilia origin using the methods described herein. The kit will include one or more antibodies specific to basal bodies of cilia described herein. In another aspect, a combination ELISA kit can be provided for screening both basal bodies of cilia and cilia markers. The kit can include at least one cilia marker and at least one basal body marker antibody, and a method for detecting both markers separately (e.g., a different reporter molecule for each marker). In another aspect, the kit can be an immunofluorescence detection kit for detecting cilia and basal bodies for basic research or clinical samples, and the kit includes one or more antibodies that bind to cilia markers. The primary antibody may be directly conjugated to a fluorescent molecule or a fluorescently conjugated secondary antibody may be used. Suitable antibodies are known and described herein.

[0050] The kits and methods described herein offer advantages over conventional detection methods. Because ECs experience altered flow or shear stress in various pathophysiological conditions, such as preeclampsia, polycystic kidney disease, hypertension, and stroke, to name a few, circulating ECs have been considered as possible biomarkers of vascular injury or endothelial dysfunction. However, their low circulation and difficulty in detection have limited their applications. On the other hand, as shown here, cilia from damaged ECs can be easily detected in circulation and biological samples. Considering that blood components are the only contact point of EC cilia expressed on the luminal side, this method is a better alternative to detect circulating ECs. Also, given that cilia are expressed in most EC beds and flow affects cilia integrity, any condition with impaired flow constitutes an opportunity for the application of cilia biomarkers, broadening the value of cilia biomarkers for vascular injury. At the very least, the ability to detect cilia proteins in blood or other bodily fluids and in various conditions affected by flow provides an additional tool in the clinical toolbox to inform physicians of possible pathology. In summary, our study warrants extensive investigation to understand whether and how circulating cilia-specific proteins can be developed into prognostic markers for diseases in which endothelial flow-related homeostasis is compromised.

[0051] The disclosure is not limited to the particular details of the structures, arrangement of components, or method steps described herein. The compositions and methods disclosed herein can be made, implemented, used, performed, and / or formed in a variety of ways that will become apparent to one of skill in the art in light of the following disclosure. The phraseology and terminology used herein are for descriptive purposes only and should not be considered as limiting the scope of the claims. Order indicators such as first, second, and third used in the specification and claims to refer to various structures or method steps are not meant to be construed as indicating any particular structure or step, or any particular order or configuration for such structures or steps. All methods described herein can be performed in any suitable order unless otherwise indicated herein or clearly contradicted by context. The use of any and all examples or illustrative language (e.g., "for example") provided herein is intended merely to facilitate the disclosure and does not imply any limitation on the scope of the disclosure unless specifically claimed. No language in the specification or structures shown in the drawings should be construed as indicating that any unclaimed element is essential to the practice of the disclosed subject matter. Use of the terms "including," "comprising," or "having" and variations thereof herein is meant to encompass the elements listed thereafter and equivalents thereof, as well as additional elements. Embodiments recited as "including," "comprising," or "having" particular elements are also contemplated as "consisting essentially of" and "consisting of" those specific elements.

[0052] The recitation of ranges of values ​​herein is intended to serve only as a shorthand method of individually referring to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated herein as if it were individually recited herein. For example, if a concentration range is stated as 1%-50%, it is intended that values ​​such as 2%-40%, 10%-30%, or 1%-3%, etc. are expressly recited herein. These are merely examples of what is specifically intended, and all possible combinations of numerical values ​​between the lowest and highest recited values ​​should be considered to be expressly stated in this disclosure. The use of the word "about" to describe a particular recited amount or range of amounts is meant to indicate that the amount includes values ​​very close to the recited amount, such as values ​​that may or will be taken into account due to manufacturing tolerances, equipment and human error in making measurements, and the like. All percentages relating to amounts are by weight unless otherwise indicated.

[0053] It is not admitted that any references, including non-patent or patent documents, cited herein constitute prior art. In particular, it will be understood that, unless otherwise stated, reference to any document herein does not constitute an admission that any of these documents form part of the common general knowledge in the art in the United States or any other country. Any discussion of a reference states what its author asserts, and the applicants reserve the right to challenge the accuracy and pertinence of any of the documents cited herein. All references cited herein are incorporated by reference in their entirety, unless otherwise stated. The present disclosure shall control in the event of any conflict between the definitions and / or explanations found in the cited references.

[0054] The following examples are intended for illustrative purposes only and are not intended as limitations on the invention or the appended claims. EXAMPLES

[0055] Example 1: Ciliary proteins are biomarkers of flow alterations in the vasculature Cilia are microtubule-based organelles present in most eukaryotic cells (1) and are differentiated based on the arrangement of nine outer microtubule doublets surrounding a central doublet, either (9+2) or not (9+0). 9+0 cilia are often referred to as primary nonmotile cilia, and 9+2 cilia as motile cilia (2). However, these definitions need to be revisited in light of recent evidence suggesting that mixed cilia (motile and nonmotile) can be found in eukaryotic cells (3). Cilia function as cellular mechanosensors. In endothelial cells (ECs) lining the vasculature, 9+0 cilia are often found on the apical (luminal) surface and are thought to sense blood flow and transduce these mechanical signals into intracellular chemical signals that control shear-responsive behavior (4,5). The role of primary endothelial cilia as mechanosensors has been reported in in vitro mouse aortic ECs, isolated mouse arteries, ex vivo blood vessels from human placenta, and in vivo mouse models (6-10). Shear stress from physiological blood flow induces ciliary bending (11). Shear stress, i.e., the tangential force of blood flow on the surface of the endothelium, normally varies throughout the macrovasculature and microvasculature and can change dramatically in different physiological and pathological conditions. Cilia length is often correlated with mechanosensing in blood vessels, with cells undergoing low shear stress having longer cilia and cells in blood vessels undergoing high shear stress having shorter or no cilia (12,13). In both zebrafish and mammals, primary cilia appear to be enriched in areas of low shear stress (11,14). At low shear stress, it has been suggested that in the mammalian retinal vasculature, primary cilia act in concert with bone morphogenetic protein 9 to minimize vessel regression before the onset of high shear stress-mediated vascular remodeling (15). Thus, overall, EC cilia are widely considered as low shear stress sensors. Our own studies have corroborated some of these earlier findings, identifying EC cilia in areas of low shear stress, such as branching junctions in the juvenile zebrafish vasculature (16). Thus, the question arises as to what happens to EC cilia under conditions of increased shear stress. Seminal studies by Iomini et al. have shown that EC cilia are more likely to develop at shear stress levels of 15 dyne / cm. 2 We show the disassembly of primary cilia from human umbilical vein ECs (HUVECs) subjected to laminar shear stress of 1000 nm for 1 h (13). Cilia consist of an axoneme that projects into the lumen and is anchored to the cell via transitional fibers that connect to the basal body, a centrosome-derived structure (1). Recent studies have suggested that cilia can be physically removed from mammalian cells, a process called shedding, which releases the ciliary membrane and axonemal threads from the basal body (17). Intact decidualized cilia were recovered in the culture medium and contained both membrane and axonemal thread fragments. Furthermore, this decalcification process was reported to be rapid and was suggested as the primary mode of cilia loss in mammalian cells. Another study observed whole cilia or partial cilia fragments in the urine of mice subjected to chemically induced acute kidney injury (18), presumably from renal epithelial cells, and thus this phenomenon was attributed to multiple cell types and tissues. The outcome of high shear stress-induced collapse in embryonic ECs has been directly linked to vascular instability and hemorrhage in embryonic zebrafish (16,19-21) as well as vascular barrier integrity (22,23). In mice (24,25), cilia mutants show extensive hemorrhage. These studies collectively suggest the hypothesis that cilia in ECs are disassembled (disintegrated) upon disruption of vascular homeostasis, thus causing the release of ciliary fragments into the circulation. Detection or quantification of ciliary proteins in the circulation could serve as biomarkers for pathological conditions of altered blood flow or altered blood viscosity. In this study, we tested this hypothesis using a combination of cell, vertebrate, and human model systems.

[0056] result Increased shear stress in ECs promotes their collapse in vitro. To test the effect of shear stress on EC cilia in vitro, we selected cells from the microvascular cerebral vascular bed, human primary cerebral microvascular ECs (HBMVECs), and the macrovascular venous bed, HUVECs. We applied shear stress of 0, 2, 4, and 10 dyne / cm to HBMVECs as previously reported (26). 2 Two different methods for subjecting cells to shear stress were used: a microfluidic device-based unidirectional shear stress method (Ibidi system) applied a laminar shear stress of 2 dyne / cm 2 and 4 and 10 dyne / cm for 10 minutes and 24 hours. 2 A stepwise intensities of shear stress were used, increasing from 4 to 10 dyne / cm (Figure 1). A shaker technique based on the shear stress associated with cyclic motion was used to measure the shear stress at 4 and 10 dyne / cm. 2 was applied for 4 min (Figure 8). After shear stress, cells were collected for FACS analysis of specific markers: KLF4, KLF2, ALK1 (flow), ARL13b (ciliary axoneme), γ-tubulin (ciliary basal body), IFT88 (ciliary transition zone protein), inversin (ciliary basal body), NRF2 (cilia-associated gene) and bACTIN (housekeeping gene) (Figure 9A). With both methods, we observed an increase in control flow marker expression in brain ECs. With the Ibidi method, expression of KLF4 (Figure 7A) and KLF2 (Figure 7B) was significantly increased at 10 dyne / cm compared to the "no flow" control at 24 h. 2 The shaker method showed a significant increase at 4 and 10 dyne / cm 2 A linear increase in ALK1-expressing cells was observed (P<0.0001) (Fig. 8A). Interestingly, with both methods, all cilia markers tested were 10 dyne / cm 2 and 4 dyne / cm 2 (Figure 1 and Figure 8, C-F) with no change in housekeeping bACTIN protein expression (Figure 8B). In the Ibidi method, lower protein expression levels were generally observed over a shorter period of 10 min compared to 24 h (Figure 1), which corresponds to the physiological steady-state situation of 2 dyne / cm2 At 10 minutes and 24 hours, the radiation intensity was clearly higher at 4 and 10 dyne / cm 2 The experimental groups (4 and 10 dyne / cm) showed a significant decrease in cilia-associated protein expression compared to the steady-state control group. 2 ) expressed approximately 20% less cilia-associated proteins after 10 min of perfusion (Figure 1). The reduction in protein expression in the group was even more pronounced (>50%) 24 h after perfusion (Figure 1). For HUVECs plated on a monolayer, we used a shaker method at 20 dyne / cm, as previously reported in the literature (27, 28). 2 High shear stress was applied at 10 dyne / cm. The effluent was collected, droplet concentrated, and analyzed by differential interference contrast (DIC) microscopy. Staining was performed on the effluent for the cilia markers acetylated α-tubulin and basal body (γ-tubulin). As shown (Figure 2, A-D), the effluent was positive for both acetylated α-tubulin (Figure 2B) and γ-tubulin (Figure 2C) proteins. We also used the shaker method to measure the shear stress of the effluent at 10 dyne / cm. 2 A shear stress of 100 s was applied to a porcine kidney epithelial cell line, LLC-PK1, and stained for acetylated α-tubulin, a cilia marker, following shear stress (Figure 2, E and F), which clearly demonstrated a loss of cilia marker staining following shear stress. Single cilia, observed by phase contrast microscopy (Figure 2G, white box), were missing following shear stress (Figure 2H). Furthermore, exudates collected from these experiments (Figure 2I) were positive for acetylated α-tubulin (Figure 2J), and a Western blot for acetylated α-tubulin clearly demonstrated expression in isolated cilia, with no actin protein detected in the same isolates (Figure 2K). Thus, collectively, these data support the notion that actin is a potent marker for cilia at 2 dyne / cm. 2 We argue that shear stress exceeding 100 s may affect the removal of cilia, the loss of ciliary proteins at the cell surface, and the presence of ciliary proteins and fragments in the effluent of macro- and microvascular beds and renal epithelial cells. Increasing shear stress in vivo results in ECs with less ciliary protein expression. To test the effect of shear stress on EC cilia in vivo, we took advantage of the versatility of the vertebrate zebrafish model system (Figure 9B). Previously, other researchers (29,30) reported that increasing the incubation temperature of zebrafish embryos from 28 °C to 34.5 °C increases their heart rate and blood flow. With increasing temperature, shear stress increased from 2.3 to 3.1 dyne / cm in the primitive midbrain venous channel (PMBC) (16). 2 and 2.0 to 2.97 dyne / cm in the dorsal aorta (DA). 2 However, these measurements were performed at 33 hours post fertilization (hpf) after 5 h of incubation from 28 to 33 hpf at higher temperatures. We performed a systematic analysis of the effects of temperature (32°C and 35°C) at shorter (3.5 h and 5 h) and longer (24 h) incubation periods starting at 28 hpf (when blood flow is initiated in the brain) and then measured blood flow related parameters in PMBC and DA at 48 hpf (Figures 10-13). Three groups of embryos (n=20-50 per group) (Figure 10) were analyzed for blood flow (pulse, blood flow velocity, vessel diameter, shear stress) parameters in both PMBC vessels (Figures 11 and 13A) and DA vessels (Figures 12 and 13B). Samples included Group 1 (G1): 0-48 hpf (28°C), Group 2 (G2): 0-28 hpf (28°C) followed by 3.5 or 5 h incubation at 32°C or 35°C and return to 28°C until 48 hpf, and Group 3 (G3): 0-28 hpf (28°C) followed by incubation at 32°C or 35°C until 48 hpf (Figure 10). We made the following overall observations: (a) 35°C over 32°C temperature showed more robust changes in blood flow parameters (pulse, velocity, vessel diameter, and shear stress) but also induced scoliosis (curvature of the spine) in the embryos (Figure 14), (b) regardless of vessel caliber or location, for the most part, G3 embryos showed higher blood flow parameters, (c) shear stress values ​​were significantly higher in the DA vessels (2.5-3 dyne / cm 2[32℃] or 3.5-5.2 dyne / cm 2 [35℃]), compared with PMBC (3-5 dyne / cm 2 [32℃] or 4-7 dyne / cm 2 (d) 3.5 h exposure at 32 °C also showed robust changes in the assessed parameters of PMBCs, except for blood flow velocity (Figure 13A), and no significant changes were observed in DA (Figure 13B). It is noteworthy that the increase in shear stress by this method only showed hemorrhage in cerebrovascular, not in the trunk, which is thought to be related to the loss of cilia in ECs (16). Therefore, we chose a shorter time point (29.5-32.5 hpf) and a lower temperature (32 °C) of approximately 3 h of incubation to increase shear stress in PMBCs of transgenic (Tg) (flk:mCherry; bactin:Arl13b-GFP) zebrafish embryos, labeling ECs as red and cilia as green. Single cell suspensions and subsequent FACS analysis on live and labeled ECs (Figure 9B) were performed as described in the methods section. Markers evaluated included Klf4 (flow), Arl13b (ciliary axoneme), γ-tubulin (ciliary basal body), inversin (ciliary basal body) and Ift88 (ciliary transition zone). In the shear stress-induced group (experiment), we observed the expected increase in Klf4 expression MFI in ECs (Figure 3, A and B). All ciliary markers evaluated were expressed by mCherry. + When assessed in the EC population, experimental samples showed a reduction compared to control samples (Figure 3C). - In the non-EC population (Figure 3D), the reduction in expression of the respective cilia-associated proteins was less pronounced compared to that observed in the EC population. These results suggest that increased shear stress in the brain vasculature of vertebrate embryos causes ECs to express fewer cilia proteins on their cell surface.

[0057] Circulating RBCs adhere to brain ECs and accumulate ciliary proteins after adhesion. To investigate circulating ciliary proteins in a pathophysiological model with translational and clinical implications, we chose sickle cell disease (SCD). SCD is caused by a single mutation in the β-globin gene that changes the sixth amino acid of hemoglobin's β-globin protein from glutamic acid to valine (31), which predisposes RBCs to high sickling for the production of sickle cell hemoglobin (Hb S), thus compromising the ability of Hb to deliver oxygen to tissues. In the brain and systemic vasculature, it has been hypothesized that occlusive events in SCD are initiated by the adhesion of sickle cells to the endothelium (32). Thus, we hypothesized that sickle cells adhere to brain ECs and induce ciliary shedding, resulting in higher ciliary proteins in plasma from SCD patients. We first investigated whether RBCs isolated from patients homozygous for Hb S (SS) preferentially adhere to monolayers of brain ECs compared to healthy volunteers with normal HbA (AA). A step-height flow chamber adhesion assay to quantify RBC adhesion to ECs was performed as previously described (33,34). Indeed, 1 dyne / cm 258% ± 9% of SS RBCs compared with 7% ± 1.8% of AA RBCs attached to brain ECs subjected to shear stress of 100 Hz (Figure 4A). Next, we performed flow cytometry analysis on circulating RBCs isolated from SS patients for the presence of the ciliary protein ARL13b before and after exposure to brain ECs in a flow chamber. Compared to AA RBCs, which showed 1% ± 0.47% of bound ARL13b, SS RBCs showed a remarkable 23-fold increase in bound ARL13b to 23% ± 2.5% before exposure of brain ECs to AA and SS RBCs, respectively (Figure 4B). Upon flow exposure, the presence of ARL13b on AA RBCs was not affected but increased further 2.3-fold to 54% ± 8.8% on SS RBCs (Figure 4C), suggesting that SS RBCs may have collected additional cilia from brain ECs. We performed blood smears to directly visualize the accumulation of ARL13b on SS RBCs (Figure 4D). Similar blood smears were isolated from sickle cell disease SS mice and immunostained for ARL13b and IFT88 proteins (Figure 15). Mouse RBCs expressing ARL13b and IFT88 positive cilia were found in smears from SS mice (Figure 15, A and B). Quantification (Figure 15) showed a two-fold enrichment of ARL13b positive RBCs in SS mouse blood compared to AA mouse blood. Finally, we examined the plasma of 10 SCD patients and 10 healthy individuals using Western blots for the presence of the cilia proteins ARL13b, γ-tubulin and IFT88 (Figure 4, E and F). All three cilia proteins were enriched in plasma from SCD patients compared to healthy volunteers (Figure 4F). Taken together, these data sets suggest that in pathological conditions predisposing to vascular obstruction and / or impaired blood flow, ciliary proteins are present on the surface of RBCs and further accumulate on RBCs upon EC contact, resulting in plasma enrichment. Thus, overall, our study suggests ciliary proteins as potential biomarkers for diagnosing blood flow-mediated alterations of the vascular endothelium.

[0058] EC cilia stability depends on ROS generation in brain ECs. To investigate the underlying mechanisms associated with the loss of cilia in brain ECs due to shear stress or RBC interaction, we focused on excess reactive oxygen species (ROS) and oxidative stress. Previous studies have suggested that the interaction of sickle RBCs with HUVECs induces endothelial oxidative stress (35). Therefore, we investigated whether adhesion of SS RBCs from SCD patients to brain ECs induces ROS generation in ECs. Indeed, SS RBC interaction with brain ECs increased EC ROS levels compared to basal levels of EC ROS (P<0.05; Figure 5A). Pretreatment of brain ECs with apocynin, an NADPH oxidase (NOX) inhibitor, reduced ROS generation in ECs to baseline levels (P<0.0001; Figure 5A), suggesting that SS RBC-induced increased ROS production in brain ECs depends on the activation of NOX enzymes. To investigate the effect of increasing ROS levels in ECs on SS RBCs-cilia, in subsequent experiments, we analyzed SS RBCs by flow cytometry for the presence of ciliary protein ARL13b before and after exposure to apocynin-pretreated brain ECs in a flow chamber. Before exposure to apocynin-treated brain ECs, SS RBCs showed about 35% ARL13b ciliary expression, whereas after exposure to apocynin-treated brain ECs, SS RBCs showed about 20% reduction in ARL13b expression (P<0.05, FIG. 5B). We interpret these data as meaning that inhibition of NOX enzymes in brain ECs by apocynin prevented SS RBCs from collecting additional ARL13b protein from brain ECs.

[0059] To evaluate whether attenuation of oxidative stress in brain ECs rescues cilia protein levels, we treated human brain ECs with PMA, a known oxidative stress inducer, in ECs in the presence or absence of the NOX small molecule inhibitor VAS2870. We then used flow cytometry methods to quantify the expression of total ROS, heme oxygenase 1 (HO-1, oxidative stress counter antibody), and cilia-associated proteins NRF2, IFT88, and γ-tubulin (Figure 6). As expected, PMA induced ROS in brain ECs (Figure 6A), which was partially attenuated by VAS2870. HO-1 levels (Figure 6B) were lower in PMA-treated brain ECs, and levels were restored to control levels upon NOX inhibition. Interestingly, all three cilia-associated proteins (Figure 6, C-E) were decreased upon PMA treatment, and levels were restored to baseline upon NOX inhibition in brain ECs. Taking sickle cell ROS data together with brain EC-based ROS data, oxidative stress appears to be one of the key pathways in ECs involved in ciliary stability.

[0060] Consideration Our study reveals that cilia-specific proteins can be quantified in plasma and should be investigated as biomarkers of endothelial injury or dysfunction. In ECs lining the vascular wall, cilia have been hypothesized as low-flow sensors (11). In support of this hypothesis, cilia are indeed abundant in regions of the vessel wall where flow is minimal, such as vascular curvatures (14,16). Under steady conditions, the vascular system undergoes constant flow; in the venous system, it is 1-4 dyne / cm. 2 The average shear stress in capillaries is reported to be 10-20 dyne / cm 2 In arteries, the shear force is 4 dyne / cm in the common carotid artery. 2 to 13 dyne / cm in the brachial artery 2 (36) We previously reported that in zebrafish embryos, incubation of embryos at 34.5°C resulted in a cerebral microvascular density of 2–4 dynes / cm. 2demonstrated that shear stress of up to 15 dyne / cm was induced, which resulted in cerebral hemorrhage and loss of ciliary structure in the primitive mesencephalic vein channel (16). Other researchers have also reported that loss of ciliary proteins in zebrafish causes cerebrovascular instability, resulting in hemorrhage (19). Furthermore, primary cilia were not observed in HUVECs (large blood vessels) at 15 dyne / cm. 2 (13) Thus, taken together, the laminar shear stresses observed in vivo of 4–20 dyne / cm 2 Shear forces of 100-200 nm are sufficient for ECs to lose ciliary proteins in vitro, which was indeed observed in this study, where we were able to detect ciliary fragments in excreta in cell cultures from ECs and epithelial cells, and could detect fewer cilia-expressing cells in vivo in ECs exposed to high shear stress.

[0061] The question of how cilia on the EC surface can be influenced by flow alterations to facilitate detachment remained open. In addition to increased or impeded physical flow, we hypothesized that blood components, especially RBCs, may also contribute to the disintegration process in pathological ECs (17) (Figure 7). We chose SCD, where RBC morphology changes to have a sickle-like shape and where RBCs are known to cause oxidative stress-mediated damage to the EC membrane (35,37,38). Furthermore, in SCD, blood flow is altered due to enhanced adhesion of sickle-shaped red blood cells to themselves and to the endothelium, which can promote vascular occlusion (39) and, subsequently, damage to the endothelium (35). Thus, this pathophysiological model provides an ideal opportunity to identify ciliary proteins emerging from the damaged endothelium that may be a consequence of sickle-shaped red blood cell adhesion to the endothelium. Notably, we found that human sickle RBCs showed enhanced ARL13b ciliary protein on their surface compared to normal RBCs, and the presence of ciliary protein on these sickle RBCs was 2.3-fold higher when they encountered brain ECs under intermittent flow conditions. These results are consistent with the detection of higher levels of ciliary protein in SCD plasma compared to healthy plasma. Interestingly, we observed all three representative components of ciliary structure, i.e., axonemes, transition zones, and basal bodies, in the plasma of SCD patients, suggesting that the disassembly of cilia is not partial. These results are also consistent with recent observations in mammalian cells, showing that cilia are shed from cells expressing mCherry-a-tubulin (an axonosome marker) and that a-tubulin is included in the ciliary fragments, suggesting that the axonosomes are shed together with the ciliary membrane (17).

[0062] To investigate the underlying mechanisms related to cilia stability in static and flow-induced sickle cell / brain EC interactions, we focused on oxidative stress and ROS generation (Figure 7). Human sickle cells adhere to brain ECs similar to HUVECs (35) and induce increased ROS generation. Sickle cells exposed to brain ECs treated with apocynin, a NOX inhibitor, showed a decrease in ciliary protein expression. These data argue that cilia on sickle cells are affected upon interaction with ROS-quenched brain ECs (Figure 7). To explain this result, two interrelated possibilities emerge; either ECs retain more cilia when oxidative stress is minimized, thereby causing RBCs to capture fewer cilia from ECs, or RBCs lose cilia when interacting with ROS-inhibited ECs, thereby becoming less cilia. It is difficult to distinguish between the two. Under static conditions, brain ECs responded to stress inducers such as PMA and showed enhanced total ROS, which quenched ROS production after PMA-induced oxidative stress when treated with a different NOX inhibitor, VAS2870. Interestingly, ciliary protein levels, which were reduced in PMA-treated brain ECs, returned to baseline in NOX inhibitor-treated brain ECs. The results under static conditions argue that EC cilia may not be available for interaction upon ROS inhibition, supporting the second hypothesis that RBCs lose cilia upon interaction with ROS-inhibited ECs. These results collectively argue that ciliary stability in both ECs and RBCs is susceptible to increased ROS levels in brain ECs. This interpretation is also consistent with previous studies in epithelial cells showing that reduced oxidative stress accelerates recovery of primary cilia length after ischemic injury in mouse kidneys (40).

[0063] In the case of SCD, identification of enhanced ciliary proteins on RBCs may prognosticate adverse events such as weakening of the vascular wall and susceptibility to bleeding, both clinically relevant features observed in SCD patients. Having this information is beneficial to make informed clinical decisions. Because ECs experience altered flow or shear stress in various pathophysiological conditions such as preeclampsia, polycystic kidney disease, hypertension, and stroke, to name a few, circulating ECs have been considered as possible biomarkers of vascular injury or endothelial dysfunction (41, 42). However, their low circulation and difficulty in detection have limited their application. On the other hand, as shown here, cilia from damaged ECs can be easily detected in the circulation. Given that blood components are the only contact point of EC cilia expressed on the luminal side, this method is probably a better alternative to detect circulating ECs. Also, given that cilia are expressed in most EC beds and that flow affects cilia integrity, any condition in which flow is compromised constitutes an opportunity for the application of cilia biomarkers, broadening the value of cilia biomarkers for vascular injury. At the very least, the ability to detect cilia proteins in blood or other bodily fluids and in a variety of conditions affected by flow provides additional tools in the clinical toolbox to inform physicians of possible pathology. In summary, our study warrants extensive investigation to understand whether and how cilia-specific proteins in the circulation can be developed into prognostic markers for diseases in which endothelial flow-related homeostasis is compromised.

[0064] method antibody Primary antibodies used in this study include ARL13b (Proteintech catalog 17711-I-AP), acetylated tubulin (Sigma catalog T6793), IFT88 (Thermo Fisher Scientific catalog PA5-18467), inversin (Proteintech catalog 10585-I-AP), dynein (Thermo Fisher Scientific catalog MA1-070), g-tubulin (GeneTex catalog GTX113286), Alk1 (Abcam catalog ab51870), KLF4 (Proteintech catalog 11880-I-AP), HO-1 (BD, catalog 566391), NRF2 (BioLegend, catalog 939202) and b-actin (Sigma catalog A5441 and Cell Signaling Technology catalog 4970P). Secondary antibodies used are goat anti-mouse PECy7 (BioLegend), donkey anti-rabbit PE (Thermo Fisher Scientific), donkey anti-goat AF657 (Thermo Fisher Scientific), donkey anti-rabbit BV421 (BioLegend) and donkey anti-rabbit AF488 (Thermo Fisher Scientific).

[0065] cell culture Primary HBMVECs (Cell Systems Corporation catalog ACBRI376) and HUVECs (Glyco Tech) were maintained at 37°C in a 5% CO2 incubator in endothelial cell complete medium (Promocell, catalog C22010). Cells were isolated from the cortical region of the brain from a pediatric male donor according to the vendor's instructions. Cells were isolated without antibody labeling to preserve the native properties of the cells for increased biological relevance. LL-CPK1 (CL101.1™) porcine kidney epithelial cells from proximal tubules were obtained from ATCC. All cell culture wells were seeded equally and wells were randomized to control vs. experimental conditions in duplicate or triplicate per condition. All experiments were performed between the 4th and 6th passages. Cells that reached approximately 90% confluence were used for shear stress experiments. For ROS quantification experiments, cells were treated with PMA (Sigma, catalog P8139-5MG) at a concentration of 50ng / mL for 1 hour. To inhibit ROS production in each experimental group, cells were treated with 20 μM NOX inhibitor VAS2870 (Sigma, catalog SML0273-5MG) 1 h prior to PMA treatment.

[0066] Human patient studies Blood samples were collected from adult patients with SCD homozygous for Hb S and healthy adult donors. Patients and donors were recruited under an approved study protocol at Duke University. All SCD patients had been transfection-free for at least 3 months, had not experienced an acute vaso-occlusive crisis in the past 3 weeks, and 98% of patients studied were taking hydroxyurea. Blood samples were collected in citrate tubes. All RBCs were purified with CaCl2+, along with plasma collection and removal of the buffy coat. 2+ and Mg 2+ The mixture was washed with PBS containing 0.05% CO.

[0067] Western blot Plasma isolated from blood drawn from patients with SCD (SS) and healthy (AA) volunteers was used for quantification of the following proteins: ARL13b, IFT88, and γ-tubulin. The samples were run on SDS-PAGE and conventional Western blotting was performed. Primary antibodies used were previously described. Secondary antibodies used included anti-rabbit HRP (catalog 7074, Cell Signaling Technology) and anti-mouse HRP (catalog 7076, Cell Signaling Technology). Quantification was performed using ImageJ software (NIH) and plotted against the housekeeping control protein bACTIN.

[0068] In vitro EC shear stress experiments Ibidi perfusion. To generate shear stress in vitro, we utilized an Ibidi pump system. Before starting the perfusion, HBMVECs were plated onto a μ-slide (channel height 0.6 mm; Ibidi, 81106) at 0.5 × 10 per slide. 6 The slide, medium and perfusion set (red, 10962) were incubated overnight in a humidified cell culture incubation chamber (37 °C in 5% CO2) before perfusion to prevent air bubble formation. Immediately prior to perfusion, medium was added to the syringe reservoir (12 mL total) to remove air bubbles. The μ-slide was mounted in the perfusion set under sterile conditions, and the fluidic unit was then connected to an Ibidi pump and air tubing in the cell culture incubation chamber. HBMVECs were perfused at 0, 2, 4, or 10 dyne / cm using the vendor-specific PumpControl software. 2 The animals were perfused for 10 min or 24 h at a total of 2 dyne / cm as a representation of steady state conditions that mimic in vivo conditions. 2 Including 10 dyne / cm 2 To prevent acute cell detachment at the onset of high shear stress at 4 dyne / cm 2 The flow was acclimated to 10 dyne / cm for 5 min, then 10 dyne / cm 2 The flow was performed for 10 minutes or 24 hours at 2 and 4 dyne / cm 2In experiments with , no acclimation was required and cells were subjected to flow for 10 min or 24 h. The minimum possible shear stress was 2.3 dyne / cm according to the manufacturer's recommendations using 0.6 mm μ-slides and a red perfusion set. 2 (Rounded to 2 dyne / cm 2 Immediately after perfusion, cells were trypsinized with TrypLE express (Thermo Fisher Scientific, 12604013) and used for downstream analysis. All samples subjected to any magnitude of perfusion were without flow control, respectively. Any protein expression in a given sample was normalized to that without flow control.

[0069] shaker method Shear stress was induced using a shaking incubator (New Brunswick Scientific) as previously described (43). The formula used to calculate stress was shear stress = (6 × F × m) / (w × h 2 ), where F=moment of inertia (i.e., a function of centrifugal force based on the rpm and size of the shaker), m=viscosity of the fluid (i.e., a function of temperature), w=diameter of the plate (i.e., a function of the area of ​​the dish), and h=height of the fluid (i.e., a function of volume). A 100 mm culture dish (confluent with cells) placed on an orbital shaker at 240 revolutions per minute (RPM) was incubated at 10 dyne / cm 2 At 96 RPM, it produces a shear stress of 4 dyne / cm 2 The cells were subjected to shear stress for 4 minutes. For HUVEC and epithelial cell shear stress experiments, collapse was induced by mechanical force as previously described (43,44). Cell populations were first briefly and gently rinsed with 10 mL of PBS (pH 7.4). 150 mm culture dishes were placed in a flow chamber as previously discussed (6). Cells were exposed to 10 or 20 dyne / cm. 2A shear stress of 1000 g was applied for 4 min. The medium containing the excised cilia was carefully transferred to a 50 mL centrifuge tube and centrifuged at 3000 g for 30 min at 4 °C. The supernatant containing the excised cilia was then transferred to a polyallomer tube and centrifuged at 70,000 g for 1 h at 4 °C in an ultracentrifuge. The purified primary cilia were then resuspended in PBS buffer or RIPA buffer for further analysis.

[0070] Quantitative reverse transcription PCR Total RNA was extracted using TRI Reagent and Direct-zol RNA Miniprep (Zymo Research, R2051). RNA was reverse transcribed into cDNA using 250 ng of total RNA (iScript gDNA clear cDNA synthesis kit; BioRad, 172-5034). RNA levels were quantified using custom-designed primers for KLF2, KLF4, and GAPDH (primer 3), and cDNA and primers were mixed with iTaq Universal SYBR Green Supermix (BioRad, 172-5121) and run with the following cycle protocol: 95°C for 2:00 min, followed by 40 cycles of 95°C for 0:10 min and 60°C for 0:30 min (BioRad, CFX96 Real-Time System). Quantification of gene expression was performed using the 2-ΔΔCT method (45). All samples were run in quadruplicate, and target genes were normalized to GAPDH. Primers were: KLF2 (133 bp) - forward: CACCAAGAGTTCGCATCTGA (SEQ ID NO: 1), reverse: CGTGTGCTTTCGGTAGTGG (SEQ ID NO: 2), KLF4 (132 bp) - forward: CGGCTGTGGATGGAAATTCG (SEQ ID NO: 3), reverse: ATGTGTAAGGCGAGGTGGTC (SEQ ID NO: 4); and GAPDH (128 bp) - forward: CCAAGGAGTAAGACCCCTGG (SEQ ID NO: 5), reverse: CAACTGTGAGGAGGGGAGAT (SEQ ID NO: 6).

[0071] In vitro adhesion assay HBMVECs were cultured to confluence on clear glass slides precoated with 2% gelatin. Slides coated with brain ECs were washed and then fitted into a variable height flow chamber and tested for their ability to support RBC adhesion. The flow chamber was attached to the stage of an inverted phase contrast microscope (Diaphot, Nikon Inc.) connected to a heat plate (Tokai Hit Co., Ltd.) set at 37°C. Ca 2+ and Mg 2+ Fluorescently labeled RBCs suspended in PBS containing 0.2% (v / v) were injected into the flow chamber and allowed to attach to brain ECs for 10 min without flow. Prior to exposure to flow, a minimum of three fields of view were examined at each of seven different positions along a line facing the future flow, and the total number of fluorescent cells was counted. Fluid flow (Ca) was then controlled using a calibrated syringe pump. 2+ and Mg 2+ A 15-minute bout of PBS containing 0.1% ethanol was started. The effluent was collected and examined by flow cytometry for ciliary ejection from brain ECs by RBC contact. After exposure to flow, fields were examined and the number of fluorescently adherent RBCs to brain ECs was counted. The percentage of adherent cells was expressed as the number of cells attached per field after exposure to flow / total number of cells present per field before flow. The wall shear stress is t w =6Qm / wh 2 (In the formula, t w = wall shear stress (dyne / cm 2 )) where Q = volumetric flow rate (cm 3 / s); m = medium viscosity, w = width of the flow channel, and h = height of the flow chamber as a function of position along the microscope slide. Blood flow in small vessels is 1-2 dyne / cm 2 The flow may be continuous (non-pulsatile) with a shear stress of 0.05, or the flow may be intermittent (pulsatile). Our data were obtained using pulsatile flow conditions.

[0072] Measurement of Shear Stress Zebrafish Flow Parameters The transgenic line Tg(bact:Arl13b-GFP) was obtained from Brian Ciruna (University of Toronto, Toronto, Ontario, Canada). Tg(kdrl:mCherry-CAAX), Casper and wild-type AB lines were obtained from the Zebrafish Informational Resource Center. Embryos from the wild-type (AB) line were used in this study. Freshly fertilized embryos were procured by natural breeding of adult zebrafish and reared at 28.0 °C in E3 medium containing 0.1 mM N-phenylthiourea (PTU; Sigma) to inhibit pigmentation. For shear stress experiments, at 28 hpf, fish embryos were divided into three groups. The embryos were then cultured in the following three stages: G1: 0–48 hpf (28°C), G2: 0–28 hpf (28°C), followed by incubation at 32°C or 35°C for 3.5 or 5 h and return to 28°C until 48 hpf, and G3: 0–28 hpf (28°C), followed by incubation at 32°C or 35°C until 48 hpf (Figure 10). Control and experimental embryos were subsequently de-echoed at 48 hpf for imaging. A stereomicroscope (Zeiss SteREO Discovery V12 microscope equipped with a Hamamatsu Orca Flash high-speed camera and workstation equipped with HCImage software Hamamatsu Photonics) was used to visualize the blood vessels of zebrafish embryos as previously described (46). High-speed videomicroscopy movies of the heart and tail at 1000 frames per 10 s at 100x magnification were recorded for PMBCs and DAs. Recorded movies were analyzed according to our previous protocols (47,48) using MicroZebraLab blood flow from Viewpoint (version 3.4.4) and four cardiac parameters were calculated for each vessel using the following equations: pulse, blood flow velocity, vessel diameter, and shear stress: τ = 4 μV mean / D, where μ=blood viscosity (dyne / cm 2 ), V = mean blood flow velocity (μm / s), and D = vessel diameter (μm). This experiment was performed multiple times and data from three independent experiments are reported. Whole-mount staining of Casper zebrafish with O-dianisidine Embryos from the Casper strain were used to visualize hemorrhage in the brain after induction of shear stress, as described in the section above. At 48 hpf, embryos were dechorionated and stained with O-dianisidine (stains RBCs). Staining solution was prepared by mixing 0.6 mg / mL O-dianisidine (Sigma), 0.65% hydrogen peroxide, 0.01 M sodium acetate (pH 4.5) and 40% (v / v) ethanol solution. Embryos were washed in PTU-E3 medium, a home-made N-phenylthiourea dissolved in egg water, then 0.6 mg / mL staining solution was added and left in the dark for 15 min. After staining, embryos were post-fixed in 4% paraformaldehyde at 4 °C for at least 1 h. Embryos were fixed on slides using 3% (w / v) methylcellulose for imaging under a bright-field microscope (Stemi508, Zeiss). A Zeiss AxioCam ERc 5s professional digital camera was used for imaging.

[0073] In vivo (zebrafish) shear stress experiments Embryos from a cross between Tg(bact:Arl13b-GFP) and Tg(kdrl:mCherry-CAAX) were used in this study (Figure 9B). Freshly fertilized embryos were procured by natural breeding of adult zebrafish and kept at 28.0°C in 1x E3 embryo medium (E3 medium) containing 5mmol / L NaCl, 0.17mmol / L KCl, 0.33mmol / L CaCl2, 0.33mmol / L MgSO4 and 0.05% methylene blue. For shear stress experiments, at 29.5hpf, fish embryos were transferred to a 32.0°C incubator for 3 hours. Thereafter, control and experimental embryos were dechorionated and digested to obtain single cells (Figure 9B). The composition of the digestion buffer used was RPMI1640 medium (Thermo Fisher Scientific) supplemented with 10% FCS, collagenase D (1 mg / mL) and DNaseI (10 μg / mL). Embryos were digested for 30 min at 37 °C and subsequently passed through a 70 μm cell strainer. Cells were centrifuged at 300 g for 5 min and washed twice with PBS before use in downstream applications. This experiment was performed multiple times and data from three independent experiments are reported.

[0074] Flow cytometry Single cell suspensions were washed three times for 5 min at 300 g with FACS buffer (1x PBS with 5% FBS and 0.1% NaN3) followed by incubation with Live / Dead fixable yellow dead cell stain according to the manufacturer's protocol to exclude dead cells whenever applicable. Cells were then fixed and permeabilized with Cytofix / Cytoperm buffer (BD, Cat. 554722) or Transcription Factor Buffer Set (BD, Cat. 562574) and stained for the following proteins: ARL13b, IFT88, inversin, dynein, γ-tubulin, Alk1, KLF4, HO-1, NRF2 and bACTIN. Appropriate secondary reagents were used to detect the respective proteins. Primary antibodies were diluted 1:50 and secondary antibodies were diluted 1:500. BD perm wash buffer (Cat. 554723) was used for antibody dilution and washing. Primary antibodies were incubated for 45 minutes and secondary antibodies were incubated for 30 minutes at 4°C. Appropriate secondary antibody controls were included. To quantify total ROS, an assay kit was used according to the manufacturer's instructions (Thermo Fisher Scientific, Cat. 88-5930-74). After staining was completed, cells were resuspended in FACS buffer. Stained cells were run on a flow cytometer (BD LSRFortessa). Sample acquisition was performed using FACSDiva software (BD) and subsequently analyzed with FlowJo software. To determine the presence of the ciliary protein ARL13b on human RBCs, unlabeled RBCs before injection into the variable height flow chamber, as well as RBCs and RBC-containing effluents collected after interaction with brain ECs, were labeled with FITC-conjugated Arl13b antibody for 30 min on ice. RBCs were then washed and examined by flow cytometry analysis as previously described (49). To determine whether ROS generation in brain ECs is increased by sickle cells and may contribute to their collapse, slides coated with brain ECs were mock treated or pretreated with 10 μM of the NOX inhibitor apocynin for 1 h at 37 °C, washed, and mounted in the flow chamber. Treated brain ECs were then exposed to unlabeled sickle cells for 10 min. Sickle cells were lysed with RBC lysis buffer and brain ECs were scraped off the slides to test ROS levels using CM-H2-DCFDA (Invitrogen) as previously described in detail (50). One hundred thousand events per sample were acquired and examined by flow cytometry analysis. In separate experiments, unlabeled sickle erythrocytes were examined by flow cytometry for ARL13b ciliary protein binding before injection into the chamber (baseline levels) and after flow, as described above, and upon interaction with brain ECs treated with 10 μM apocynin.

[0075] Mouse sickle cell: Cilia staining and quantification For blood smear preparation, approximately 5 μL of whole blood from AA control and SS sickle mice was added to a glass slide and allowed to dry for 24 hours. The smear was fixed with acetone for 10 minutes. At the end of the incubation, the slide was washed with PBS and the primary antibody (ARL13b or IFT88) at a concentration of 1:500 was added to the slide and incubated overnight at 4°C. The slide was washed with PBS and the secondary antibody was added at a concentration of 1:500 and incubated for 1 hour at room temperature in the dark. At the end of the incubation, the slide was washed with PBS, mounting reagent was added, a cover slip was placed on the blood smear and imaged at 63x with a confocal microscope (Zeiss LSM510 laser module) with bright field for RBCs and 488 green channel for ARL13b or IFT88 positive cilia detection. All cilia positive RBCs were quantified with the multipoint tool of ImageJ software and represented as a graph.

[0076] statistics Data were presented as mean and SEM. Two-tailed t-tests or one- or two-way ANOVA were performed to compare groups for outcome. Pearson correlation and regression analysis were used to investigate relationships between continuous variables. In vivo cilia proteins under different shear stresses were expressed as fold changes relative to the mean of the control group. Linear mixed models (LMM) were then used to examine differences between experimental and control groups. EC (mCherry + ) or non-EC (mCherry - Differences in ciliary proteins (ARL13b, γ-tubulin, IFT88 and inversin) within the sham-derived hamsters were also analyzed by LMM. P<0.05 was considered significant. Multiple comparisons were adjusted using Dunnett's test, Tukey's test or Bonferroni correction. Data were log-transformed to improve the fit of some analyses. Non-parametric tests were used when parametric assumptions were not met. Statistical analyses were performed using SAS V9.4 (SAS Institute Inc.), R and GraphPad Prism software (version 9.0).

[0077] References 1.Malicki JJ, Johnson CA. The cilium: cellular antenna and central processing unit. Trends Cell Biol. 2017;27(2):126-140. 2.Goetz SC, Anderson KV. The primary cilium: a signalling centre during vertebrate development. Nat Rev Genet. 2010;11(5):331-344. 3.Nguyen QPH, et al. Comparative super-resolution mapping of basal feet reveals a modular but distinct architecture in primary and motile cilia. Dev Cell. 2020;55(2):209-223. 4.Egorova AD, et al. Primary cilia as biomechanical sensors in regulating endothelial function. Differentiation. 2012;83(2):S56-S61. 5.Hierck BP, et al. Primary cilia sensitize endothelial cells for fluid shear stress. Dev Dyn. 2008;237(3):725-735. 6.Nauli SM, et al. Endothelial cilia are fluid shear sensors that regulate calcium signaling and nitric oxide production through polycystin-1. Circulation. 2008;117(9):1161-1171. 7.AbouAlaiwi WA, et al. Ciliary polycystin-2 is a mechanosensitive calcium channel involved in nitric oxide signaling cascades. Circ Res. 2009;104(7):860-869. 8.Mohieldin AM, et al. Vascular endothelial primary cilia: mechanosensation and hypertension. Curr Hypertens Rev. 2016;12(1):57-67. 9.Pala R, et al. The roles of primary cilia in cardiovascular diseases. Cells. 2018;7(12):E233. 10.Luu VZ, et al. Role of endothelial primary cilia as fluid mechanosensors on vascular health. Atherosclerosis. 2018;275:196-204. 11.Goetz JG, et al. Endothelial cilia mediate low flow sensing during zebrafish vascular development. Cell Rep. 2014;6(5):799-808. 12.Abdul-Majeed S, et al. Mechanisms regulating cilia growth and cilia function in endothelial cells. Cell Mol Life Sci. 2012;69(1):165-173. 13.Iomini C, et al. Primary cilia of human endothelial cells disassemble under laminar shear stress. J Cell Biol. 2004;164(6):811-817. 14.Dinsmore C, Reiter JF. Endothelial primary cilia inhibit atherosclerosis. EMBO Rep. 2016;17(2):156-166. 15.Vion AC, et al. Primary cilia sensitize endothelial cells to BMP and prevent excessive vascular regression. J Cell Biol. 2018;217(5):1651-1665. 16.Eisa-Beygi S, et al. Characterization of endothelial cilia distribution during cerebral-vascular development in zebrafish (Danio rerio). Arterioscler Thromb Vasc Biol. 2018;38(12):2806-2818. 17.Mirvis M, et al. Primary cilium loss in mammalian cells occurs predominantly by whole-cilium shedding. PLoS Biol. 2019;17(7):e3000381. 18.Kong MJ, et al. Fragmentation of kidney epithelial cell primary cilia occurs by cisplatin and these cilia fragments are excreted into the urine. Redox Biol. 2019;20:38-45. 19.Kallakuri S, et al. Endothelial cilia are essential for developmental vascular integrity in zebrafish. J Am Soc Nephrol. 2015;26(4):864-875. 20.Arnold CR, et al. Comparative analysis of genes regulated by Dzip1 / iguana and hedgehog in zebrafish. Dev Dyn. 2015;244(2):211-223. 21.Lamont RE, et al. Hedgehog signaling via angiopoietin1 is required for developmental vascular stability. Mech Dev. 2010;127(3-4):159-168. 22.Jones TJ, et al. Primary cilia regulates the directional migration and barrier integrity of endothelial cells through the modulation of hsp27 dependent actin cytoskeletal organization. J Cell Physiol. 2012;227(1):70-76. 23.Ma N, Zhou J. Functions of endothelial cilia in the regulation of vascular barriers. Front Cell Dev Biol. 2020;8:626. 24.Cortellino S, et al. Defective ciliogenesis, embryonic lethality and severe impairment of the Sonic Hedgehog pathway caused by inactivation of the mouse complex A intraflagellar transport gene Ift122 / Wdr10, partially overlapping with the DNA repair gene Med1 / Mbd4. Dev Biol. 2009;325(1):225-237. 25.Gorivodsky M, et al. Intraflagellar transport protein 172 is essential for primary cilia formation and plays a vital role in patterning the mammalian brain. Dev Biol. 2009;325(1):24-32. 26,DeStefano JG, et al. Effect of shear stress on iPSC-derived human brain microvascular endothelial cells (dhBMECs). Fluids Barriers CNS. 2017;14(1):20. 27.Worthen LM, Nollert MU. Intracellular calcium response of endothelial cells exposed to flow in the presence of thrombin or histamine. J Vasc Surg. 2000;32(3):593-601. 28.Zhang F, et al. Effects of fluid shear stress on expression of Smac / DIABLO in human umbilical vein endothelial cells. Curr Ther Res Clin Exp. 2013;74:36-40. 29.Barrionuevo WR, Burggren WW. O2 consumption and heart rate in developing zebrafish (Danio rerio): influence of temperature and ambient O2. Am J Physiol. 1999;276(2 pt 2):R505-R513. 30.Baker K, et al. Defective “pacemaker” current (Ih) in a zebrafish mutant with a slow heart rate. Proc Natl Acad Sci U S A. 1997;94(9):4554-4559. 31.Ingram VM. A specific chemical difference between the globins of normal human and sickle-cell anaemia haemoglobin. Nature. 1956;178(4537):792-794. 32.Switzer JA, et al. Pathophysiology and treatment of stroke in sickle-cell disease: present and future. Lancet Neurol. 2006;5(6):501-512. 33.Zennadi R, et al. Sickle red cells induce adhesion of lymphocytes and monocytes to endothelium. Blood. 2008;112(8):3474-3483. 34.Zennadi R, et al. Epinephrine acts through erythroid signaling pathways to activate sickle cell adhesion to endothelium via LW-alphavbeta3 interactions. Blood. 2004;104(12):3774-3781. 35.Sultana C, et al. Interaction of sickle erythrocytes with endothelial cells in the presence of endothelial cell conditioned medium induces oxidant stress leading to transendothelial migration of monocytes. Blood. 1998;92(10):3924-3935. 36.Reneman RS, Hoeks AP. Wall shear stress as measured in vivo: consequences for the design of the arterial system. Med Biol Eng Comput. 2008;46(5):499-507. 37.Nader E, et al. The red blood cell-inflammation vicious circle in sickle cell disease. Front Immunol. 2020;11:454. 38.Stuart J, Johnson CS. Rheology of the sickle cell disorders. Baillieres Clin Haematol. 1987;1(3):747-775. 39.Kurantsin-Mills J, et al. Flow dynamics of human sickle erythrocytes in the mesenteric microcirculation of the exchange-transfused rat. Microvasc Res. 1987;34(2):152-167. 40.Kim JI, et al. Reduction of oxidative stress during recovery accelerates normalization of primary cilia length that is altered after ischemic injury in murine kidneys. Am J Physiol Renal Physiol. 2013;304(10):F1283-F1294. 41.Erdbruegger U, et al. Circulating endothelial cells: markers and mediators of vascular damage. Curr Stem Cell Res Ther. 2010;5(4):294-302. 42.Tenreiro MM, et al. Cellular response of the blood-brain barrier to injury: potential biomarkers and therapeutic targets for brain regeneration. Neurobiol Dis. 2016;91:262-273. 43.Mohieldin AM, et al. Protein composition and movements of membrane swellings associated with primary cilia. Cell Mol Life Sci. 2015;72(12):2415-2429. 44.Mohieldin AM, et al. Proteomic identification reveals the role of ciliary extracellular-like vesicle in cardiovascular function. Adv Sci (Weinh). 2020;7(16):1903140. 45.Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 2008;3(6):1101-1108. 46.Al-Kandari H, et al. Ecotoxicological assessment of thermally- and hydrogen-reduced graphene Oxide / TiO2 photocatalytic nanocomposites using the zebrafish embryo model. Nanomaterials (Basel). 2019;9(4):488. 47.Benslimane FM, et al. Cardiac function and blood flow hemodynamics assessment of zebrafish (Danio rerio) using high-speed video microscopy. Micron. 2020;136:102876. 48.Yalcin HC. Hemodynamic Studies for Analyzing the Teratogenic Effects of Drugs in the Zebrafish Embryo. In: Felix L, ed. Teratogenicity Testing: Methods and Protocols. Springer; 2018:487-495. 49.Udani M, et al. Basal cell adhesion molecule / lutheran protein. The receptor critical for sickle cell adhesion to laminin. J Clin Invest. 1998;101(11):2550-2558. 50.MacKinney A, et al. Disrupting the vicious cycle created by NOX activation in sickle erythrocytes exposed to hypoxia / reoxygenation prevents adhesion and vasoocclusion. Redox Biol. 2019;25:101097.

Claims

1. 1. A method for quantifying at least one cilia biomarker in a sample from a subject, comprising: (a) analyzing cells of a blood sample obtained from a subject, (i) selectively identifying red blood cells in a blood sample; and (ii) detecting at least one cilia biomarker associated with red blood cells in the blood sample; and (b) quantifying at least one cilia biomarker associated with red blood cells in the blood sample; A method comprising:

2. 10. The method of claim 1, wherein step (a)(i) comprises flow cytometry.

3. The method of claim 1, further comprising comparing in (b) the amount of at least one cilia biomarker associated with red blood cells in the blood sample obtained as a result of the quantification with a control amount of at least one cilia biomarker associated with one or more control red blood cells in one or more control groups.

4. 4. The method of claim 3, wherein the quantification of the at least one ciliary biomarker in (b) indicates the presence of brain damage or the risk of developing brain damage in the subject when the amount of the at least one ciliary biomarker is higher than a control amount of the at least one ciliary biomarker associated with one or more control red blood cells in one or more control groups, wherein the one or more control groups do not have brain damage.

5. 4. The method of claim 3, wherein the quantification of the at least one ciliary biomarker in (b) indicates the presence of or risk of developing a condition if the amount of the at least one ciliary biomarker is higher than a control amount of the at least one ciliary biomarker associated with one or more control red blood cells in one or more control groups, wherein the one or more control groups do not have a disease comprising sickle cell disease, sickle cell disease-related pain, pre-eclampsia, polycystic kidney disease, stroke, atherosclerosis, hemorrhage, or pulmonary hypertension.

6. 10. The method of claim 1, further comprising performing (a)-(b) on a second blood sample taken from the subject at an earlier time point than the blood sample.

7. 2. The method of claim 1, wherein detecting at least one cilia biomarker in (a)(ii) comprises the steps of: (1) contacting a blood sample with at least one labeled antibody that binds to at least one cilia biomarker; and (2) measuring the amount of at least one antibody;

8. 2. The method of claim 1, wherein the at least one cilia biomarker comprises ADP-ribosylation factor-like protein 13B (ARL13b), intraflagellar transporter 88 (IFT88) protein, or a combination thereof.

9. 10. The method of claim 1, further comprising determining a relative risk of the subject developing vascular damage in brain tissue based at least in part on quantifying the at least one cilia biomarker in (b) relative to indicators obtained from controls or one or more control groups without vascular damage in brain tissue.

10. 1. A method for quantifying at least one cilia biomarker in a sample from a subject, comprising: (a) producing a fraction of a blood sample obtained from a subject, comprising: (i) introducing a blood sample to an antibody bound to a solid support under conditions sufficient for the antibody to bind to one or more cilia biomarkers in the blood sample; and (ii) selectively removing blood sample components that are not bound to the antibody; and (b) quantifying at least one cilia biomarker associated with red blood cells in the blood sample; A method comprising:

11. 11. The method of claim 10, comprising performing (a)-(b) by enzyme-linked immunosorbent assay (ELISA).

12. 11. The method of claim 10, further comprising the step of processing the blood sample prior to (a), including lysing the blood sample.

13. 11. The method of claim 10, wherein the amount of at least one cilia biomarker obtained by quantification in (b) indicates the presence or absence of a condition.

14. 14. The method of claim 13, wherein the condition comprises brain injury, sickle cell disease, sickle cell disease-related pain, pre-eclampsia, polycystic kidney disease, stroke, atherosclerosis, hemorrhage, or pulmonary hypertension.

15. 11. The method of claim 10, further comprising performing (a)-(b) on a second blood sample.

16. 16. The method of claim 15, wherein the second blood sample is taken from the subject at an earlier time point than the blood sample.

17. 16. The method of claim 15, wherein the second blood sample is from a second subject who does not have a disease selected from the group consisting of brain injury, sickle cell disease, pre-eclampsia, polycystic kidney disease, stroke, and pulmonary hypertension.

18. 11. The method of claim 10, wherein the at least one cilia biomarker comprises ADP-ribosylation factor-like protein 13B (ARL13b), intraflagellar transporter 88 (IFT88) protein, or a combination thereof.

19. 11. The method of claim 10, wherein the one or more markers are selected from the group consisting of dynein, gamma-tubulin, inversin, nuclear factor-erythroid factor 2-related factor 2 (NRF2), acetylated alpha-tubulin, and combinations thereof.

20. 11. The method of claim 10, further comprising providing a relative risk of the subject developing a vascular disorder in the brain based at least in part on the determination in (b).

Images