Genetically modified Saccharomyces yeast strains as prophylactic and therapeutic agents
Patent Information
- Application Number
- JP2023575845
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-03-07
- Filing Date
- 2022-06-10
- Publication Date
- 2025-07-23
AI Technical Summary
Conventional production and administration of therapeutic polypeptides, such as monoclonal antibodies, are expensive, time-consuming, and require complex manufacturing processes, leading to high costs and limited patient compliance due to the need for medical professionals to administer them via injection or infusion, and they are prone to degradation in the gastrointestinal tract.
Engineering Saccharomyces yeast strains to express therapeutic polypeptides in vivo, allowing for oral delivery and self-administration, which bypasses the need for complex manufacturing and protects the polypeptides from gastric enzymes.
Enables cost-effective, stable, and patient-friendly oral delivery of therapeutic polypeptides, improving treatment compliance and efficacy by utilizing genetically modified yeast strains that can synthesize and deliver polypeptides directly to the gastrointestinal tract.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] REFERENCE TO RELATED APPLICATIONS This application claims the benefit of the priority dates of U.S. Provisional Application No. 63 / 209,651, filed June 11, 2021, U.S. Provisional Application No. 63 / 299,693, filed January 14, 2022, and U.S. Provisional Application No. 63 / 317,385, filed March 7, 2022, the contents of each of which are incorporated by reference herein in their entirety. [Background technology]
[0002] Conventional therapeutic polypeptide(s) manufacturing at greater than 1 liter scale (e.g., small-scale, large-scale, or commercial-scale) in bioreactors, followed by downstream purification of the therapeutic polypeptide(s) is a costly and time-consuming process. In the United States, therapeutic polypeptide(s) intended for injection or infusion must comply with the U.S. FDA's Current Good Manufacturing Practice (CGMP) regulations that establish identity, strength, purity, and other qualities. Furthermore, purified polypeptides (e.g., therapeutic polypeptide(s)) are notoriously fragile and may misfold, aggregate, or precipitate, resulting in loss of efficacy. Thus, careful formulation, gentle handling, and / or cold chain logistics of the fragile purified therapeutic polypeptide(s) may be required to maintain efficacy of the therapeutic polypeptide(s) from production to the time of administration.
[0003] These factors, for example, make therapeutic polypeptide(s) several orders of magnitude more expensive to generate, manufacture, and distribute than small molecules similarly intended for therapeutic use. In addition, therapeutic polypeptide(s) are often administered by medical professionals using injections or intravenous infusions, requiring patients to travel to a medical facility to receive treatment. This can lead to poor patient compliance and poorer clinical outcomes for patients.
[0004] Some therapeutic polypeptide(s) include, for example, monoclonal antibodies. Some examples include, but are not limited to, adalimumab, infliximab, secukinumab, and ixekizumab, which neutralize proinflammatory cytokines and have been very successful in treating many inflammatory diseases. However, these therapeutic polypeptide(s) require needle injections, and their long-term use is associated with loss of efficacy and serious side effects due to anti-drug antibody responses and general immunosuppression. In addition, alternatives for other routes of administration are currently limited, since delivery of therapeutic polypeptide(s) (e.g., proteins, polypeptides, antibodies, or functional fragments thereof) via oral route to the gastrointestinal (GI) tract must overcome several major obstacles: 1) producing large quantities of therapeutic polypeptide(s) for oral delivery is expensive; 2) therapeutic polypeptides are sensitive to the high acidity of gastric juices, likely resulting in loss of therapeutic efficacy; and 3) therapeutic polypeptide(s) are typically sensitive to GI enzyme digestion, resulting in loss of efficacy.
[0005] For example, despite advances in research into Crohn's disease, ulcerative colitis, celiac disease, and other inflammatory or inflammation-related conditions, there remains a scarcity of potent and effective treatments for chronic use. Furthermore, there is a well-established commercial and medical need for therapeutic polypeptide(s) that are inexpensive, can be prepared without the need for downstream polypeptide processing and purification, are not immunogenic, eliminate cold chain logistics and cold storage, and are patient-friendly, e.g., can be self-administered in an oral dosage form.
[0006] These needs and other needs are met by the present disclosure. Summary of the Invention
[0007] The present disclosure provides a platform for an oral delivery route of therapeutic polypeptide(s) utilizing engineered Saccharomyces yeast capable of synthesizing such therapeutic polypeptide(s) in the intestine. The present disclosure also provides therapeutic methods utilizing the disclosed platform, as well as additional related methods and uses.
[0008] In one aspect, the present disclosure provides an engineered strain of Saccharomyces yeast, comprising: at least one site-specific chromosomal insertion of a nucleic acid encoding a therapeutic polypeptide, An engineered strain of Saccharomyces yeast is provided, wherein the therapeutic polypeptide is selected from a binding protein comprising an antigen-binding domain, an immunoglobulin, an antibody, a cytokine, a hormone, and a chemokine, or a combination thereof.
[0009] In some embodiments, the yeast is Saccharomyces boulardii.
[0010] In some embodiments, the yeast may further comprise a complete or partial deletion of URA3. In some embodiments, the yeast may further comprise a complete or partial deletion of GAP1. In some embodiments, the yeast is ura3(- / -) and gap1(- / -).
[0011] In some embodiments, the nucleic acid encoding a therapeutic polypeptide is integrated into at least two different locations in the yeast genome or into at least one hotspot in the yeast genome. In some embodiments, the nucleic acid encoding a therapeutic polypeptide is integrated into at least two different chromosomes. In some embodiments, the at least two different chromosomes include chromosomes VII and XVI.
[0012] In some embodiments, the yeast may further comprise a nucleic acid sequence encoding a dihydrofolate reductase (DHFR) integrated into the genome of the yeast, the DHFR optionally being a mammalian DFHR. Additionally or alternatively, in some embodiments, the yeast may further comprise one or more exogenous nucleic acids encoding a yeast DFR1.
[0013] In some embodiments, the therapeutic polypeptide is a binding protein comprising a structure selected from VHH, Fc-VHH, VHH-Fc, VHH-VHH, VHH-VHH-VHH-VHH, Fc-VHH-VHH, VHH-Fc-VHH, and VHH-VHH-Fc, wherein each or either of the VHH or Fc domains is connected to another VHH or Fc domain via an optional linker sequence.
[0014] In some embodiments, the therapeutic polypeptide is a binding protein that binds to TcdA, TcdB, or a combination thereof, hi some embodiments, the therapeutic polypeptide comprises the amino acid sequence of SEQ ID NO:5.
[0015] In some embodiments, the therapeutic polypeptide is a binding protein that binds to TNF-α. In some embodiments, the binding protein is an IgG or comprises at least one VHH domain. In some embodiments, the therapeutic protein comprises an amino acid sequence selected from any one of SEQ ID NOs: 6, 7, 19, and 20.
[0016] In some embodiments, the therapeutic polypeptide is a binding protein that binds to IL-17A. In some embodiments, the binding protein is an IgG or comprises at least one VHH domain. In some embodiments, the therapeutic protein comprises the amino acid sequence of SEQ ID NO:25.
[0017] In some embodiments, the therapeutic polypeptide is a bispecific binding protein that binds TNF-α and IL-17A. In some embodiments, the binding protein is an IgG or comprises at least two VHH domains. In some embodiments, the therapeutic protein comprises an amino acid sequence selected from any one of SEQ ID NOs: 8, 9, and 10.
[0018] In some embodiments, the therapeutic polypeptide is a binding protein that binds to Norovirus or Rotavirus. In some embodiments, the binding protein is an IgG or comprises at least one VHH domain. In some embodiments, the therapeutic protein comprises an amino acid sequence selected from any one of SEQ ID NOs: 13, 14, 15, and 16.
[0019] In some embodiments, the therapeutic polypeptide is a VHH that binds cwp84 and is fused to a lysine domain. In some embodiments, the therapeutic protein comprises an amino acid sequence selected from any one of SEQ ID NOs: 21 and 22.
[0020] In some embodiments, the therapeutic polypeptide is a cytokine or chemokine. In some embodiments, the cytokine is IL-22 or IL-10. In some embodiments, the cytokine or chemokine is fused to an Fc domain. In some embodiments, the therapeutic protein comprises an amino acid sequence selected from any one of SEQ ID NOs: 11, 12, and 27.
[0021] In some embodiments, the therapeutic polypeptide is GLP1. In some embodiments, the therapeutic protein comprises an amino acid sequence selected from any one of SEQ ID NOs: 17, 23, and 24.
[0022] In some embodiments, the therapeutic polypeptide is leptin. In some embodiments, the therapeutic protein comprises the amino acid sequence of SEQ ID NO: 18.
[0023] In some embodiments, the yeast comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 or more copies of a nucleic acid encoding a therapeutic polypeptide integrated into its genome.
[0024] In some embodiments, the yeast may further comprise at least one site-specific chromosomal insertion of a second nucleic acid encoding a second therapeutic polypeptide, The second therapeutic polypeptide is selected from a binding protein comprising a VHH domain, an immunoglobulin, a cytokine, and a chemokine, or a combination thereof.
[0025] In another aspect, the disclosure provides a method of binding an antigen in vivo comprising administering to a subject an engineered strain of Saccharomyces yeast disclosed herein (e.g., in the preceding aspects and embodiments). In some embodiments, the antigen is selected from TcdA, TcdB, both TcdA and TcdB, TNF-α, IL-17A, both TNF-α and IL-17A, cwp84, a rotavirus protein, or a norovirus protein.
[0026] In another aspect, the disclosure provides a method for treating or preventing a disease or condition, comprising administering to a subject in need thereof an effective amount of an engineered strain of Saccharomyces yeast according to any one of claims 1-37.
[0027] In some embodiments, the disease or condition is an inflammatory condition, hi some embodiments, the inflammatory condition is selected from inflammatory bowel disease (IBD), intestinal inflammation, Crohn's disease, and ulcerative colitis.
[0028] In some embodiments, the disease or condition is an infection. In some embodiments, the infection is a C. difficile infection, a Norovirus infection, a Rotavirus infection, or a combination thereof. In some embodiments, the subject further has IBD.
[0029] In some embodiments, the disease or condition is irritable bowel syndrome (IBS).
[0030] In some embodiments, the disease or condition is a neurodegenerative disease.
[0031] In some embodiments, the disease or condition is diabetes.
[0032] In some embodiments, the disease or condition is obesity.
[0033] In some embodiments, the disease or condition is fatty liver disease.
[0034] In some embodiments, the disease or condition is a metabolic disease.
[0035] In some embodiments, the disease or condition is graft-versus-host disease (GVHD).
[0036] In some embodiments, the disease or condition is an autoimmune disease.
[0037] In another aspect, the disclosure provides a method of selecting an engineered strain of Saccharomyces yeast, the Saccharomyces yeast comprising a nucleic acid sequence encoding dihydrofolate reductase (DHFR) integrated into the genome of the yeast, one or more exogenous nucleic acids encoding yeast DFR1, or a combination thereof, the method comprising contacting the Saccharomyces yeast with methotrexate and sulfanilamide. In some embodiments, the DHFR is a mammalian DHFR.
[0038] In some embodiments, methotrexate is at a concentration of 1 nM to 1 mM. In some embodiments, sulfanilamide is at a concentration of 0.1 to 10 mg / mL.
[0039] In some embodiments, the engineered strain of Saccharomyces yeast comprises: at least one site-specific chromosomal insertion of a nucleic acid encoding a therapeutic polypeptide, The therapeutic polypeptide is selected from binding proteins comprising an antigen-binding domain, immunoglobulins, antibodies, cytokines, hormones, and chemokines, or combinations thereof.
[0040] In some embodiments, the yeast is Saccharomyces boulardii.
[0041] In some embodiments, the yeast is ura3(- / -) and gap1(- / -).
[0042] In some embodiments, the nucleic acid encoding the therapeutic polypeptide is integrated at at least two different locations within the genome of the yeast.
[0043] In some embodiments, the yeast comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 or more copies of a nucleic acid encoding a therapeutic polypeptide integrated into its genome.
[0044] In some embodiments, the yeast further comprises at least one site-specific chromosomal insertion of a second nucleic acid encoding a second therapeutic polypeptide; The second therapeutic polypeptide is selected from a binding protein comprising a VHH domain, an immunoglobulin, a cytokine, and a chemokine, or a combination thereof.
[0045] Other systems, methods, features, and advantages of the present disclosure will be or become apparent to one of ordinary skill in the art upon review of the following drawings and detailed description. All such additional systems, methods, features, and advantages are intended to be included within this description, be within the scope of the present disclosure, and be protected by the accompanying claims. In addition, all optional and preferred features and modifications of the described embodiments can be used in all aspects of the present disclosure taught herein. Furthermore, the individual features of the dependent claims, and all optional and preferred features and modifications of the described embodiments, are combinable and interchangeable with each other.
[0046] Many aspects of the present disclosure can be better understood with reference to the following drawings. The components in the drawings are not necessarily to scale, emphasis instead being placed upon clearly illustrating the principles of the present disclosure. Moreover, in the drawings, like reference numbers designate corresponding parts throughout the several views. [Brief description of the drawings]
[0047] [Figure 1] Figure 1A shows in vitro characterization of a previously generated strain using a technique similar to that disclosed herein, Sb-ABAB (S. boulardii transformed with a plasmid containing the ABAB transgene cassette (pURA3-AT-yABAB-cMyc)). Figure 1A: ABAB antibodies in Sb-ABAB culture supernatant detected by Western blotting using an antibody specific for the cMyc tag. Figure 1B: Toxin neutralizing activity of Sb-ABAB culture supernatant compared to purified Fc-ABAB. Figure 1C: In vitro growth of Sb, Sb-EP (S. boulardii strain harboring an empty plasmid as a control) and Sb-ABAB. Figure 1D: ABAB expression levels in Sb-ABAB culture supernatant over multiple passages. Figure 1E: Antibiotic resistance profile of wild type Sb and Sb-ABAB. [Diagram 2]Characterization of the previously developed strain Sb-ABAB in vivo. Figure 2A: Mice pre-exposed to antibiotics were gavaged daily for 7 days with PBS, Sb, Sb-EP and Sb-ABAB (1010 CFU). All experimental data represent one of at least three separate experiments with three mice per group and are presented as ± sem. Figure 2B: Mouse weight was monitored. All experimental data represent one of at least three separate experiments with three mice per group and are presented as ± sem. Figure 2C: Yeast removed from the different groups was monitored, CFU peaked 1 day after gavage but rapidly dropped to undetectable levels 3 days after the final dose. All experimental data represent one of at least three separate experiments with three mice per group and are presented as ± sem. Figure 2D: Intestinal lavage fluid collected on day 3 was able to neutralize TcdB (10 pg / mL) on Vero cell monolayers. All experimental data represent one of at least three separate experiments with three mice per group and are presented as ± sem. Figure 2E: ABAB expression levels in Sb-ABAB culture supernatants over multiple passages in vitro for yeast strains recovered from fecal samples Sb-ABAB (f) versus non-passaged strains from frozen master stocks. All experimental data represent one of at least three separate experiments with three mice per group and are presented as ± sem. Figure 2F shows ABAB levels in feces on day 3 as determined by ELISA. All experimental data represent one of at least three separate experiments with three mice per group and are presented as ± sem. [Diagram 3]We show that bivalent anti-TNF-α VHH-Fc fusions are significantly more potent than monovalent anti-TNF-α VHHs in neutralizing TNF-α cytotoxicity. L929 cells (Figure 3A) were treated for either 6 or 24 hours. Cell rounding (which may be an indicator of apoptosis) was observed by microscopy. L929 cells were treated for either 6 or 24 hours with 100 ng / mL TNF-α alone (Figure 3B). Cell rounding (which may be an indicator of apoptosis) was observed by microscopy. L929 cells were treated for either 6 or 24 hours with monovalent anti-TNF-α (Figure 3C). Cell rounding (which may be an indicator of apoptosis) was observed by microscopy. L929 cells were treated for either 6 or 24 hours with bivalent anti-TNF-α VHH-Fc (Figure 3D). Cell rounding (which may be an indicator of apoptosis) was observed by microscopy. [Figure 4]Oral Sb-amTNF (FZ006m) protected mice from DSS-induced colitis and DSS and CDI comorbidity. Figure 4A shows that oral administration of FZ0006m had some tendency to protect against DSS-induced colitis, a mild colitis model. DSS-colitis and CDI comorbidity mice were orally dosed with either PBS or engineered yeast daily for 3 days before and 7 days after C. difficile spore challenge. n=10. (*) indicates P<0.05, (**) indicates P<0.01, and (***) indicates P<0.001. A more severe comorbidity model was used in Figure 4B. DSS-colitis and CDI comorbidity mice were orally dosed with either PBS or engineered yeast daily for 3 days before and 7 days after C. difficile spore challenge. Oral Sb-amTNF protected mice from weight loss (FIG. 4B). n=10. (*) indicates P<0.05, (**) indicates P<0.01, and (***) indicates P<0.001. A more severe comorbidity model was used in FIG. 4C. DSS-colitis and CDI comorbidity mice were orally dosed with either PBS or engineered yeast daily for 3 days before and 7 days after C. difficile spore challenge. Oral Sb-amTNF protected mice from death (FIG. 4C). n=10. (*) indicates P<0.05, (**) indicates P<0.01, and (***) indicates P<0.001. A more severe comorbidity model was used in FIG. 4D. DSS-colitis and CDI comorbidity mice were orally dosed with either PBS or engineered yeast daily for 3 days before and 7 days after C. difficile spore challenge. Oral Sb-amTNF protected mice from upregulation of the inflammatory cytokine TNF-α (Figure 4D). n=10. (*) indicates P<0.05, (**) indicates P<0.01, and (***) indicates P<0.001. A more severe comorbidity model was used in Figure 4E. DSS-colitis and CDI comorbidity mice were orally dosed with either PBS or engineered yeast daily for 3 days before and 7 days after C. difficile spore challenge.Oral Sb-amTNF protected mice from upregulation of IL-6 (FIG. 4E). n=10. (*) indicates P<0.05, (**) indicates P<0.01, and (***) indicates P<0.001. A more severe comorbidity model was used in FIG. 4F. DSS-colitis and CDI comorbidity mice were orally dosed with either PBS or engineered yeast daily for 3 days before and 7 days after C. difficile spore challenge. Oral Sb-amTNF protected mice from reduced colon length (FIG. 4F). n=10. (*) indicates P<0.05, (**) indicates P<0.01, and (***) indicates P<0.001. A more severe comorbidity model was used in FIG. 4G. DSS-colitis and CDI comorbidity mice were orally dosed with either PBS or engineered yeast daily for 3 days before and 7 days after C. difficile spore challenge. Oral Sb-amTNF protected mice from colonic tissue damage (FIG. 4G). n=10. (*) indicates P<0.05, (**) indicates P<0.01, and (***) indicates P<0.001. [Diagram 5]Activity of dimeric anti-TNF-α VHHs is shown. Figure 5A: Neutralizing activity. Serially diluted VHH-Fc or Humira were mixed with 10 pM human TNF-α before application to L929 cells. After 24 h of incubation, antibody-mediated inhibition of cytotoxicity was measured. Serially diluted G1 or Humira were mixed with 100 ng / ml biotinylated human TNF-α before being added to TNFR1-coated wells. Ability of antibody-mediated inhibition of TNF-α binding to TNFR1 was determined by competitive ELISA. Figure 5B: Binding affinity. Binding of serially diluted G1 or Humira on TNF-α-coated ELISA plates. Serially diluted G1 or Humira were mixed with 100 ng / ml biotinylated human TNF-α before being added to TNFR1-coated wells. The ability of antibody-mediated inhibition of TNF-α binding to TNFR1 was determined by competitive ELISA. Figure 5C: Blocking the interaction of TNF-α and TNFR1. Serially diluted G1 or Humira was mixed with 100 ng / ml biotinylated human TNF-α and then added to TNFR1-coated wells. The ability of antibody-mediated inhibition of TNF-α binding to TNFR1 was determined by competitive ELISA. [Figure 6] Characterization of Sb-ahTNF (FZ006) strain. Figure 6A: The growth rate of the two Sb-ahTNF strains is comparable to their parent strains. Figure 6B: Stable production of antibodies by Sb-ahTNF after extensive in vitro culture. Sb-ahTNF or Sb-EP were passaged in YPD medium for 8 days starting from 0.1 OD. Supernatants were collected every 24 hours and expression of ahTNF was measured by ELISA. Figure 6C: Neutralizing activity of ahTNF in supernatants from Sb-ahTNF 7-day cultures of Figure 6B. The concentration of antibodies in the supernatants was determined by ELISA and then serially diluted before mixing with 3ng / ml recombinant human TNF-α. After 30 minutes of incubation, the mixtures were applied to L929 monolayers and cytotoxicity was measured with a Resazurin Viability Kit. Control groups contained the same concentrations of purified G1 and HUMIRA®. [Figure 7]Oral Sb-amTNF and Sb-ABAB protected mice from the comorbidities of CDI and adoptive T cell transfer colitis (TCC). Figure 7A: Experimental design. Groups of T cell transferred RAG- / - mice (n=4) were challenged with C. difficile spores and then treated with PBS or yeast. Mice were euthanized and colonic tissues were analyzed. Figure 7B: H&E staining of colonic tissues of mice from different groups: a) RAG- / -, b) TCC, c) TCC treated with Sb-amTNF, d) TCC+CDI, e) TCC+CDI treated with Sb-ABAB, and f) TCC+CDI treated with Sb-amTNF and Sb-ABAB. Figure 7C: Histology scores of Figure 7B. Scores were blindly assessed based on colonic morphology, inflammatory cell infiltration, and signs of cell death. Normal control RAG- / - mice scored 0, no inflammation. TCC mice showed moderate inflammation. TCC+CDI mice showed severe inflammation. TCC mice treated with Sb-amTNF showed mild inflammation. Comorbidity mice treated with Sb-ABAB showed moderate inflammation, which was also reduced to mild inflammation when treated with Sb-amTNF. P values between groups are shown. Figure 7D: Comparison of fold change in IFN-γ mRNA expression between the indicated groups, P values between groups are shown. [Figure 8] The concentrations of ABAB antibodies secreted into the supernatants of parental strain, pep4 mutant clones, and negative control cultures in rich YPD medium, as measured by ELISA, are shown. [Figure 9] Figure 9 shows the kinetics of Sb-ABAB colonization and ABAB secretion in piglets. Two gnotobiotic piglets (2 days old) were fed 1010 CFU of Sb-ABAB daily for 11 days (days 1 to 11). Fecal swaps were collected daily starting 1 day before oral Sb-ABAB and continued until 3 days after the last dose. Fecal Sb-ABAB CFU measured by ELISA (Figure 9A) was determined. ABAB concentration measured by ELISA (Figure 9B) was determined. [Figure 10]Figure 10 shows the preventive efficacy of Sb-ABAB against CDI in mice. Figure 10A shows Kaplan-Meier survival curves. Statistical analysis was performed by comparing the indicated groups using the log-rank (Mantel-Cox) test. N=10, *p-value<0.05. Figure 10B shows H&E stained colon tissue sections. Statistical analysis was performed by comparing the indicated groups using the log-rank (Mantel-Cox) test. N=10, *p-value<0.05. [Figure 11] We show that oral Sb-ahTNF reduces TcdB-induced TNF-α expression in human colon tissue. Fresh human colon tissue was obtained from normal areas of colon cancer patients (UCLA Pathology). The tissue was cut into 3×3 mm size and placed in RPMI1640 medium (1 ml). The tissue was treated with nothing (blank control) or with supernatant (2.5 μl) from Sb-EP or Sb-ahTNF culture for 30 min, followed by addition of PBS or toxin B. The tissue was then incubated at 37° C. for 4 h. TNF-α levels in the supernatant were measured by ELISA (DY210, R&D Systems). [Figure 12] Repeated doses of oral Sb-amTNF do not induce anti-drug antibody responses. Figure 12A shows a diagram of the experimental design. Groups of mice (n=5) were treated with PBS, Sb-amTNF (109 CFU / dose), or purified anti-TNF-α VHH / VHH-Fc (10 mg / Kg per injection). Oral Sb-amTNF was given as 3 courses of treatment per day for a total of 36 doses. Purified anti-mouse VHH / VHH-Fc fusion polypeptide was injected ip for 2 courses for a total of 6 doses. Fecal and serum samples were collected for ELISA. Figure 12B shows ELISA detection of fecal IgA and serum IgG responses. Fecal samples (1:1 w / v in PBS) and serum samples (1000-fold diluted in PBS) were added to ELISA plates coated with purified anti-TNF VHH / VHH-Fc, and the OD of IgA in feces and IgG in serum samples was measured. [Figure 13-1] 1 shows an outline of the gene insertion method. [Figure 13-2] This is a continuation of Figure 13-1. [Figure 14] 1 shows exemplary DNA sequences of homologous arms used in the generation of engineered S. boulardii strains. [Figure 15] A schematic diagram of the delta and sigma insertion sites is shown. [Figure 16] Transformation efficiency at sigma and delta sites is shown. [Figure 17] The average yeGFP fluorescence after 24 h culture of clones with a GOI inserted at the sigma or delta site is shown. [Figure 18] Figure 2 shows that ABAB expression levels from S. boulardii in which the gene of interest was inserted in either pTEF or pTDH3 were 3-5 fold higher compared to those inserted at the delta site. [Figure 19] Figure 1 shows the stability of FZ002 clones. Different clones were passaged daily over 11 days. Supernatants of 24-h cultures were used to measure ABAB expression by ELISA. [Figure 20] Showing early production of ABAB by clones. Clones with different cell numbers as indicated were cultured for 3 h and ABAB was measured in the supernatant. [Figure 21] Comparison of anti-human TNF-α-Fc expression among different insertion positions (pTEF, pTDH3, and delta site) is shown. FZ006h is a strain in which anti-human TNF-α-Fc cassettes are inserted into the delta site(s), grows robustly in both YPD and SDCAA media, and has the highest and stable expression level among clones with the same insertion site. To detect the expression characteristics of anti-human TNF-α-Fc from strains with gene cassettes of interest inserted into the promoters of TEF and TDH3, the expression levels of anti-human TNF-α-Fc from pTEF-inserted strains and pTDH3-inserted strains are compared with those of FZ006h. Based on the standard curve (left), the anti-human TNF-α-Fc expression levels from S. boulardii in which the gene of interest is inserted into pTEF or pTDH3 are 2-5 times higher compared to genes inserted into the delta site. [Figure 22]Generation of a uracil auxotrophic S. boulardii yeast strain is shown. Knockout of the Ura3 gene (top) was accomplished using wild-type S. boulardii chemically transformed with a G418 antibiotic resistance knockout cassette to replace the Ura3 gene and its promoter via homologous recombination. The antibiotic cassette is flanked by LoxP sites. A screening strategy to isolate double allele knockout (Ura3- / -::G418+ / +) clones (bottom) was performed by transforming S. boulardii clones that successfully deleted the Ura3 gene in both alleles and were isolated on minimal complete medium containing G418 and the counterselective agent 5'FOA, which is toxic to yeast that are Ura3+ / + or Ura3+ / -. [Diagram 23] Ura3- / -::G418+ / + candidate clones (E37 and E38) are shown to be able to grow on medium containing (i) 5'FOA or (ii) G418, but are unable to grow on medium lacking uracil. [Figure 24] PCR on genomic DNA of Ura3- / -::G418+ / + candidate clones (E37 and E38) confirmed deletion of the URA3 gene in both alleles, indicating that it has been replaced by a G418 antibiotic resistance cassette. [Diagram 25] Figure 1 shows knockout of the GAP1 gene. A uracil auxotrophic strain (Ura3- / -::G418+ / +, clone E38) was chemically transformed with a phleomycin antibiotic resistance knockout cassette to replace the GAP1 gene and its promoter via homologous recombination. The antibiotic cassette is flanked by LoxP sites. [Figure 26] Screening and isolation of knockout clones that are GAP1(- / -)::phlo(+ / +). Transformed Sb clones that successfully deleted the GAP1 gene in both alleles (an extremely rare event) were isolated on minimal medium containing L-proline (as nitrogen source) and the counterselective agent D-histidine (which is toxic to yeast cells that are GAP1+ / + or GAP1+ / -). [Figure 27]GAP1(- / -)::phleo(+ / +) candidate clones (A2-1, A2-6, A2-7) show that they can grow on (i) medium containing D-His at 0.16% or 0.5%, or (ii) medium containing phleomycin at 5ug / mL, but cannot grow on minimal medium in which L-citrulline is the only nitrogen source. [Figure 28] PCR on genomic DNA of the GAP1(- / -)::phleo(+ / +) candidate clone (A2-1) confirmed deletion of the GAP1 gene in both alleles, indicating that it has been replaced by a phleomycin antibiotic resistance cassette. [Figure 29] Excision of both antibiotic cassettes at the URA3 and GAP1 loci is shown. To remove both the G418 and phleomycin antibiotic resistance cassettes in Sb clone A2-7, cells were chemically transformed with a plasmid carrying the Cre-recombinase enzyme (pPL5071-TEF1-Cre-URA3). Successful transformants were isolated on media lacking uracil. Random clones were selected and subjected to three rounds of restreaking (passage) on various selective media to lose the pPL5071 plasmid while (i) confirming the loss of both antibiotic cassettes. [Diagram 30] Concurrent screening of clones that have successfully excised both antibiotic cassettes and lost the Cre-recombinase plasmid shows that (i) the candidate clone grows well on rich medium. Lack of growth on (ii) YPD+G418, (iii) YPD+phleomycin indicates loss of both the G418 and phleomycin antibiotic resistance cassettes. Similarly, the GAP(- / -) and URA3(- / -) status is confirmed by failure to grow on (iv) MCL-citrulline medium and (v) SD-URA, respectively. (vi) Growth on SC+5'FOA confirms that the candidate clone does not carry any URA3 gene and has therefore lost the pPL5071-TEF1-Cre-URA3 plasmid. [Diagram 31]1 shows confirmation by PCR of loss of both antibiotic cassettes at the URA3 and GAP1 loci. [Diagram 32] 1 shows confirmation of the absence of antibiotic cassettes anywhere in the genome. [Diagram 33] FIG. 1 shows that mIL-22 mean expression levels correlate with MTX concentration upon DHFR selection. [Diagram 34] Screening of anti-hIL-17A-Fc expressing clones with URA3 or DHFR selection markers with gene of interest (GOI) cassette inserted at delta site. After transformation with FZMYA06-16 (URA3- / -, GAP1- / -) strain harboring a DNA fragment containing the GOI cassette together with URA3 or DHFR selection marker cassette flanked by delta insertion homology arms, positive clones were picked up from the corresponding plates: SDCAA+URA3 plates for URA3 selection and YPD+MTX for DHFR selection. 184 positive clones were subcultured in 600 μL YPD for 24 h at 37° C. with shaking at 250 rpm, respectively. Culture supernatants were diluted 10-fold and detected by ELISA. Data readout at OD450 nm. [Diagram 35] Screening of anti-hTNF-α-Fc expressing clones with URA3 or DHFR selection markers, in which the GOI cassette was inserted into the pTDH3 site. After transformation into FZMYA06-16 (URA- / -, GAP1- / - strain harboring a DNA fragment containing the GOI cassette together with the URA3 or DHFR selection marker cassette flanked by pTDH3 homology arms, positive clones were picked up from the corresponding plates: SDCAA without uracil for URA3 selection and YPD+MTX for DHFR selection. 84 positive clones were subcultured in 600 μL YPD for 24 h, shaking at 250 rpm at 37°C, respectively. Culture supernatants were diluted 20-fold and detected by ELISA. Data readout at OD450 nm. [Diagram 36]We show that Pep4 deletion enhances the stability of the secreted polypeptide. The concentrations of ABAB antibodies in the supernatants of pep4 mutant clones and parental and WT strain cultures in minimal medium were determined by ELISA and adjusted to take into account the expression / OD600 (E / O), which is the difference in optical density of the cultures measured at a wavelength of 600 nm. [Figure 37] Potential Thr1 and Thr4 null clones (numbered sectors) were grown on rich YPD and minimal SD (no threonine) media. Parental (+) and S. cerevisiae thr1 (-) strain controls were included. [Figure 38] Thr1 and Thr4 null clones were grown on rich YPD and minimal SD media, either without threonine (SD) or with standard 76ug / mL threonine (SD+threonine), including the parental (+) and S. cerevisiae thr1 (-) strains. [Figure 39] Cultures were seeded with equal numbers of a given yeast strain and GFP+ cells in minimal medium. GFP fluorescence versus culture density at 16 hours is shown here. Fresh medium was seeded daily with competing cultures for 4 days. Values were normalized to WT. GFP+ is a non-competitive culture of GFP-expressing cells only. [Diagram 40] S. boulardii (Sb.) expressing anti-TNF-α VHH3 is shown. Transformed Sb. expressed anti-TNF-α VHH3-HA (VHH format) with different selection markers (gray and black, URA3 auxotrophic selection; colored, FZE1 selection). 100-fold diluted supernatants harvested after 48 h of culture were reactive to human TNF-α and the HA tag was detected by HRP-anti-HA tag. OD450nm was measured for specific binding activity. [Diagram 41]S. boulardii (Sb.) expressing anti-TNF-α VHH3 is shown. Transformed Sb. expressed anti-TNF-α VHH3-HA (VHH format, orange line) and anti-TNF-α VHH3s-Fc (black line). Serially diluted supernatants harvested after 48 h of culture were mixed with human TNF-α (3 ng / ml) and then applied to L929 cells. After 24 h of incubation, antibody-mediated inhibition of cytotoxicity was shown as % inhibition. Supernatants of Sb. expressed anti-TNF-α VHH3-Fc are more potent than the produced anti-TNF-α VHH3 alone. [Diagram 42] Neutralizing activity of anti-TNF-α VHH3 expressing yeast supernatant. Transformed S. boulardii expressed anti-TNF-α VHH3 (VHH format). 40-fold diluted supernatants harvested after 72 h of induction culture were mixed with human TNF-α (6.25 ng / ml) and then applied to L929 cells. After 24 h of incubation, antibody-mediated inhibition of cytotoxicity was measured as proliferation FLI. The red line indicates the "proliferation FLI" of untransformed S. boulardii culture supernatant. [Diagram 43]Figure 1 shows the expression of functional Sc-FV-Fc antibody by Expi293 cells. Expression of Sc-FV-Fc by Expi293 was measured by SDS gel (top) and ELISA (bottom). 5 μl of the following supernatants were loaded on SDS gel for quantification: Lane 1: AVA LV-GS-HV-Fc; Lane 2: CAN LV-GS-HV-Fc; Lanes 3, 4: GIM LV-GS-HV-Fc; Lane 5: 1 μg BSA; Lanes 6, 7: HUM LV-GS-HV-Fc; Lanes 8, 9: MAV-LV-GS-HV-Fc; Lanes 10, 11: SILT LV-GS-HV-Fc. Quantitative ELISA was performed with 50-fold dilutions of the supernatants reacted with ELISA wells coated with Protein A. HRP-conjugated goat anti-human IgG (gamma) was used for detection of antibody binding at OD450nm. Anti-TNF-α VHH3 / VHH3-Fc was used as a standard. To detect specific antigen-binding activity, serially diluted supernatants were added to corresponding antigen-coated ELISA wells and detected by HRP-conjugated goat anti-human IgG (gamma) at OD450nm. Data are summarized in the table (below). Y, yes. [Diagram 44] Figure 1 shows the expression of Sc-Fv-Fc antibody by S. boulardii (Sb.). The expression of Sc-Fv-Fc by Sb. was measured by ELISA. Sc-Fv-Fc expressing Sb. supernatant was harvested after 48 h of culture in YPD. Two-fold diluted supernatant was added to ELISA wells coated with protein A. HRP-conjugated goat anti-human IgG (gamma) was used for detection of antibody binding at OD450 nm. Anti-TNF-α VHH3 / VHH3-Fc was used as a standard. To detect specific antigen binding activity, two-fold diluted supernatant was added to corresponding antigen-coated ELISA wells and detected by HRP-conjugated goat anti-human IgG (gamma) at OD450 nm. ND = not determined. [Diagram 45]Expression of functional VHHs (monomer, dimer), VHH-Fc, VHH-Sc-FV, VHH-Fc-VHH antibodies by S. boulardii (Sb.) is shown. Expression and antigen-specific binding activity of Sc-FV-Fc by Sb. was measured by ELISA. Sc-FV-Fc expressing Sb. supernatants were harvested after 48 h of culture in YPD. Serially diluted supernatants were added to ELISA wells coated with protein A. HA or Fc tag was detected by HRP-anti-HA tag and HRP-conjugated goat anti-human IgG (gamma) correspondingly. OD450nm was measured. Bioactivity was detected by neutralization assay. ND, not determined; NA, not available. [Figure 46] 1 shows the experimental design of an exemplary mouse db / db obesity model. [Figure 47] Figure 2 shows that FZ010m reduces blood glucose in db / db mice. Nine-week-old male db / db mice (n=4 / group) were gavaged daily with 109 CFU of either FZ010m (engineered S. boulardii (Sb) constitutively expressing functional mouse IL22 fused to an Fc fragment) or Sb control for 3 weeks. Body weight and food and water consumption were measured on days 0, 5, 10, 15, and 21). EchoMRI and fasting blood glucose levels were measured on day 22. No significant difference in body weight was observed between the Sb control and FZ010m groups. Treatment with FZ010m significantly reduced food and water consumption in mice and significantly reduced fasting blood glucose levels in db / db mice. [Figure 48] 1 shows an exemplary mouse high fat diet obesity model. [Figure 49]Figure 1 shows that FZ010m reduces blood glucose in mice on a high fat diet. Eight-week-old male c57BL6 / J mice (n=4) were fed a HFD for 11 days and then gavaged daily with either 109 CFU of FZ010m or Sb control along with the HFD. Body weight was measured on days 1, 7, 13, 19, and 22. EchoMRI and fasting blood glucose levels were measured on day 22. Mice treated with FZ010m for 12 days had significantly lower body weight and fasting blood glucose levels compared to mice in both the HFD or sb control groups. [Figure 50] A diagram of an exemplary generation of VHH1-Fc-VHH2 transgene constructs for genomic insertion is shown. Steps for generating four constructs of exemplary final integration cassettes (FIC1, FIC2, FIC3, FIC4) for yeast chromosomal integration. The anti-IL-17A gene was synthesized in pUC plasmid pUC-aIL17A. The pUC-aIL17A plasmid, together with the vector carrying the anti-TNF-α-Fc gene, was digested with restriction enzymes BamH1 and NheI to obtain four different vectors and one insert. The inserts were then ligated into a vector for transformation into competent E. coli cells. Four colonies were picked from each construct and the plasmids were extracted and verified via enzymatic digestion. The correct plasmids were used to transform yeast. [Figure 51] FIG. 1 shows a diagram of an exemplary generation of a VHH1-VHH2-Fc transgene construct for genomic insertion. Due to the lack of suitable restriction enzyme sites, Gibson assembly was used. An exemplary anti-IL-17A VHH2 gene was amplified by PCR using primers containing homologous overhangs and mixed with four individual linear vectors containing anti-TNF-α VHH2-Fc with different desired promoters and selection markers for Gibson assembly. After assembly, E. coli transformation was performed and four clones from each of the four vectors were picked for plasmid extraction. [Figure 52-1]The final insertion cassette (FIC) plasmids containing the VHH1-Fc-VHH2 and VHH1-VHH2-Fc genes were checked with restriction enzymes (KpnI / NheI and Dral / NcoI) and (NcoI / DraI), respectively. [Figure 52-2] Continuation of Figure 52-1. [Figure 53] A-B show the expression levels of bispecific antibodies with different final inserted cassettes. [Figure 54] The top clones were selected in the cell-based neutralization assay. The FIC5 clone with the highest expression of VHH1-VHH2-Fc was selected to verify the neutralization activity against human recombinant TNFα (left) and IL-17A (right). Clone G7-E1 (FZ008) showed consistent high expression of the fusion polypeptide and neutralization activity against TNFα and IL-17A. [Figure 55-1] An exemplary plasmid for development of FZMYA06-16 (ura3(- / -), gap1(- / -), Cir+) is shown. [Figure 55-2] Continuation of Figure 55-1. [Figure 56] 1 shows an exemplary strategy for the development of FZMYA06-16. [Figure 57] 1 shows an exemplary platform for auxotrophic S. boulardii strains from parent MYA796 to FZMYA06-16. [Figure 58] 1 shows an exemplary final characterization of FZMYA06-16 (growth phenotype). [Figure 59-1] An exemplary final characterization of FZMYA06-16 (PCR confirmation of site-specific deletion of both the URA3 gene and the replaced antibiotic cassette) is shown. [Figure 59-2] Continuation of Figure 59-1. [Figure 60-1] An exemplary final characterization of FZMYA06-16 (PCR confirmation of site-specific deletion of the GAP1 gene and replaced antibiotic cassette) is shown. [Figure 60-2] This is a continuation of Figure 60-1. [Figure 61] An exemplary final characterization of FZMYA06-16 (PCR confirmation of absence of antibiotic genes G418 or Phleo-R in the genome) is shown. [Figure 62-1] An exemplary final characterization of FZMYA06-16 (LoxP-scar at URA3 and GAP1 loci in the genome) is shown. [Figure 62-2] This is a continuation of Figure 62-1. [Figure 63] FIG. 1 shows an exemplary final characterization of FZMYA06-16 (growth curves at different pH conditions). [Figure 64-1] 1 shows an exemplary gene of interest (GOI) cassette containing plasmid platform. [Figure 64-2] Continuation of Figure 64-1. [Figure 65] Schematic insertion of the GOI cassette in the promoter region using endogenous homologous recombination method. [Figure 66] 1 shows an exemplary generation of engineered strains of Saccharomyces yeast. [Figure 67] FIG. 1 shows an exemplary flow chart for a strategy for the generation of engineered strains of Saccharomyces yeast expressing different formats of therapeutic polypeptides using the platform described herein. [Figure 68] 1 illustrates an exemplary FZ002 generation flow chart. [Figure 69] An exemplary PCR of the pTEF-ABAB-URA3 / DHFR cassette is shown. [Figure 70] FIG. 1 shows a schematic diagram of an exemplary first electroporation of FZMYA06-16. [Figure 71] FIG. 1 shows a schematic diagram of an exemplary screening process. [Figure 72] Functional activity (neutralization) screening is shown. [Figure 73] An exemplary ELISA screen is shown. [Figure 74] 1 shows an exemplary ELISA for clonal homogeneity screening. [Figure 75] The site-specific insertion of the expression cassette is shown. [Figure 76] An exemplary second electroporation of FZMYA06-16 is shown. Sb pTEF-ABAB-DHFR clones B2 and B10 were selected for competent cell preparation for the second electroporation. Sb pTEF-ABAB-URA3 clones C11 and D10 were selected for competent cell preparation for the second electroporation. [Figure 77] Expression cassette PCR from the plasmid for the second electroporation of pTEF-ABAB+ cells is shown. [Figure 78] The second electroporation positive clone screening is shown. [Figure 79] The second electroporation positive clone screening is shown. [Figure 80] The second electroporation positive clone screening is shown. [Figure 81] Exemplary top clones selected from each group are shown. [Figure 82] FIG. 1 shows the homogeneity of exemplary selected top ABAB expressing clones. [Figure 83] FIG. 1 shows the homogeneity of exemplary selected top ABAB expressing clones. [Figure 84] 1 shows the characterization of an exemplary S. boulardii (FZ002 clone) expressing ABAB. [Figure 85] 1 shows an exemplary characterization (growth curve) of FZ002. [Figure 86] 1 shows an exemplary characterization (growth curve) of FZ002. [Figure 87] 1 shows the characterization of an exemplary FZ002 (growth curve, passage 1). [Figure 88] 1 shows the characterization of an exemplary FZ002 (growth curve, passage 11). [Figure 89]Exemplary FZ002 characterization (stability) is shown. Different FZ002 clones (2E9, 6G1, delta+HS#1) and negative control (wild type Sb) were serially passaged every 24 hours for up to 11 passages (approximately 100 generations), seeded at OD600 of 0.1, and cultivated at 37°C with shaking at 250 rpm. Crude culture supernatants from each passage were collected and assayed by ELISA using TcdB capture and HRP-conjugated anti-Llama IgG (H+L) to detect the expression of ABAB. [Figure 90] An exemplary Sb-ABAB characterization (genotype confirmation) is shown. S. Boulardii vs. S. cerevisiae Fungal ITS library: 0.0% sequence alignment difference with S. cerevisiae boulardii, 0.71% difference with S. cerevisiae. Results reported as S. cerevisiae since they do not report subspecies. [Figure 91] 1 shows the characterization of an exemplary FZ002 (genomic insertion). [Figure 92] 1 shows the characterization of an exemplary FZ002 (genomic insertion). [Figure 93] 1 shows the characterization of an exemplary FZ002 (genomic insertion). [Figure 94] 1 shows the characterization of an exemplary FZ002 (genomic insertion). [Figure 95] 1 shows the characterization of an exemplary FZ002 (neutralizing activity against TcdB). [Figure 96] 1 shows exemplary characterization of FZ002 (antifungal susceptibility). [Figure 97] Characterization (antibiotic susceptibility) of exemplary Sb-ABAB is shown. Sb-ABAB were similar to wild type and were not susceptible to the following antibiotics at the indicated concentrations used to treat C. difficile infection: colistin at 42 μg / mL, gentamicin at 35 μg / ml, kanamycin at 400 μg / ml, metronidazole at 215 μg / ml, vancomycin at 45 μg / ml, and clindamycin at 19.8 μg / mL. [Figure 98]Characterization of exemplary Sb-ABAB (antifungal activity) is shown. Sb-ABAB was sensitive to G418, clotrimazole, ketoconazole, itraconazole at the concentrations shown. Antifungal susceptibility of FZ002 susceptible is similar to wild type. Neither WT nor FZ002 cells were sensitive to cefmetazole or ceftazidime, even at 10 mM. [Figure 99] Exemplary Sb-ABAB characterization (GI environment resistance) is shown. Sb-ABAB and wild type were treated with the indicated GI environment medium conditions for 1 hour and then cultured at 37° C. CFU counts after 24 hours of culture showed that Sb-ABAB was similar to the wild type and was resistant to most of the conditions tested, but was sensitive to HCL buffer 1.2 (mimics gastric environment) and 0.01 bile salts. [Figure 100] Exemplary FZ002 characterization (PK (in vivo); GOI expression in feces / gastrointestinal tract (in vivo)) is shown. C57BL / 6 male mice were administered FZ002 at 1x109 / dose / day (total of 4 doses) from DO to D3, followed by collection of fecal samples. Fecal samples were collected on DO and 1 day after the 1st, 2nd, 3rd dose, or 1 day and 4 days after the final dose. Each line indicates the kinetic changes of ABAB levels in fecal samples of each mouse. [Figure 101] Exemplary FZ002 characterization (colony forming units (CFU)) is shown. Time point 1 CFU (left): 1 mL sample was taken from 100 mL SDC medium seeded with 1 mL FZ002-6G1 (Lot 2021-08-11, 10^8 cells / mL) and incubated at 37°C and 250 rpm for 0 hours Sample name: AW-PRO-0123-FOS-SAM10.1.4.2-09DEC21 Result: ~8.83E+04 CFU. Time point 4 CFU (right): 1 mL sample was taken from 100 mL SDC medium seeded with 1 mL FZ002-6G1 (lot AW21024-016-FOS-RCB-10DEC2021, 10^8 cells / ml) and incubated for 0 hours at 37°C and 250 rpm Sample name: AW-PRO-0123-FOS-SAM10.6.2-14DEC21 Result: ~1.82E+05 CFU. [Figure 102]Exemplary ABAB expression from randomly selected colonies is shown. Fourteen colonies showed greater than 20 ng / mL per cell at OD600. Three colonies showed low expression (13 ng / ml to 20 ng / ml per cell at OD600 of ABAB). Two colonies showed no detectable ABAB expression. [Figure 103] 1 shows an exemplary FZ006 generation flow chart. [Figure 104] 1 shows an exemplary cassette-containing plasmid construction and cassette preparation. [Figure 105] 1 shows an exemplary first electroporation and colony formation following electroporation of FZMYA06-16. [Fig. 106] 1 illustrates an exemplary screening process. [Figure 107] An exemplary ELISA screen is shown. [Figure 108] 1 shows an exemplary ELISA for clonal homogeneity screening. [Fig. 109] 1 shows an exemplary site-specific insertion of an expression cassette. [Figure 110-1] Second electroporation of pTEF-ahTNF-α+ cells. Single colonies from two top clones transformed with pTEF-aTNF-α-Fc-URA3 (clones B10, C2) for transformation crossover with pTDH3-URA3 cassette. Single colonies from two top clones transformed with pTEF-aTNF-α-Fc-DHFR (clones A2, A4) for transformation crossover with pTDH3 cassette. FZMYA06-16 for single transformation of pTDH3 cassette or co-transformation of pTEF and pTDH3 cassettes. [Figure 110-2] This is a continuation of Figure 110-1. [Figure 111] Cassette preparation for the second electroporation of pTEF-ahTNF-α+ cells is shown. [Figure 112]A second electroporation with the pTEF / pTDH3-ahTNF-α-DFR1 cassette in FZMAY06-16 is shown. [Figure 113] 1 shows an exemplary second electroporation positive clone screening. [Fig. 114] 1 shows an exemplary second electroporation positive clone screening. [Fig. 115] 1 shows an exemplary second electroporation positive clone screening. [Fig. 116] Exemplary top clones from each group that were restreaked onto the corresponding selection plates are shown. [Figure 117] Exemplary top clones selected from each group are shown. [Fig. 118] 1 shows the characterization of an exemplary FZ006. [Figure 119] 1 shows the characterization (acute expression levels) of an exemplary FZ006. [Figure 120] 1 shows exemplary characterization of FZ006 (24 hour expression levels in cells cultured at passage 1 and passage 11). [Figure 121] Characterization of an exemplary FZ006 (2-hour acute expression of top clones and clonal homogeneity) is shown. [Figure 122] 1 shows the characterization (growth phenotype) of an exemplary FZ006. [Figure 123] 1 shows the characterization (growth phenotype) of an exemplary FZ006. [Figure 124] 1 shows an exemplary characterization (growth curve) of FZ006. [Figure 125-1] 1 shows an exemplary characterization (growth curve) of FZ006. [Figure 125-2] Continuation of Figure 125-1. [Fig. 126] 1 shows the characterization (expression stability) of an exemplary FZ006. [Figure 127] 1 shows the characterization (expression stability) of an exemplary FZ006. [Figure 128] 1 shows an exemplary characterization of site-specific insertion of an expression cassette. [Figure 129] 1 shows an exemplary characterization of site-specific insertion of an expression cassette. [Fig. 130] 1 shows an exemplary FZ006m generation flow chart. [Fig. 131] 1 shows an exemplary cassette-containing plasmid and cassette preparation for generation of FZ006m. [Fig. 132] An exemplary electroporation of FZMYA06-16 is shown. [Fig. 133] 1 shows an exemplary screening process for FZ006m. [Fig. 134] 1 shows an exemplary ELISA screen for FZ006m. [Fig. 135] ELISA for clonal homogeneity screening of FZ006m. [Fig. 136] 1 shows an exemplary construction of pTDH3-aTNF-α-Fc-aIL17A-DHFR. [Fig. 137] 1 shows an exemplary construction of pTDH3-aTNF-α-Fc-aIL17A-DFR1. [Figure 138] 1 shows an exemplary construction of pTEF-aTNF-α-Fc-aIL17A-DHFR. [Figure 139] 1 shows an exemplary construction of pTEF-aTNF-α-Fc-aIL17A-DFR1. [Fig. 140] 1 shows an exemplary construction of pTEF-aTNF-α-aIL17A-Fc DFR1. [Fig. 141] 1 shows an exemplary FZ008 generation flow chart. [Fig. 142] 1 shows an exemplary cassette-containing plasmid construction and cassette preparation. [Fig. 143] 1 shows an exemplary cassette-containing plasmid construction and cassette preparation. [Fig. 144] An exemplary electroporation of FZMYA06-16 is shown. [Fig. 145] FIG. 1 shows an exemplary screening process for FZ008 clone (VHH-Fc-VHH). [Fig. 146] ELISA screening of FZ008_ahTNF-α-Fc-ahIL17A. [Fig. 147] ELISA screening of FZ008_ahTNF-α-ahIL17A-Fc. [Fig. 148] 1 shows the characterization of an exemplary Sb-aTNF-α-aIL17A. [Figure 149] Exemplary characterization (specific binding activity) is shown. Both formats for hTNF-α (left) and hIL-17A (right) showed higher expression levels compared to FZ008_ahTNF-α-ahIL17A-Fc, but not FZ008_aTNF-α-Fc-aIL17A. [Fig. 150] Exemplary characterization (neutralizing activity) is shown. [Fig. 151] Exemplary characterizations (growth phenotypes) are shown. [Fig. 152] An exemplary characterization (site-specific insertion of an expression cassette) is shown. [Fig. 153] 1 shows an exemplary FZ010m generation flow chart. [Fig. 154] 1 shows an exemplary cassette-containing plasmid construction and cassette preparation. [Fig. 155] An exemplary electroporation of FZMYA06-16 is shown. [Fig. 156] 1 shows an exemplary screening process for FZ010m clones. [Fig. 157] ELISA screening of clones using the pTEF / pTDH3-mIL22-Fc-URA3 cassette. [Fig. 158] ELISA screening of FZ010m_pTEF-mIL22-Fc-DHFR. [Fig. 159] ELISA screening of FZ010m_pTDH3-mIL22-Fc-URA3 / DHFR. [Fig. 160] ELISA screening of cotransformation of FZ010m_pTEF-URA3+pTDH3-DHFR. [Fig. 161] Exemplary characterization of uniformity. [Fig. 162] Selection of top expressing clones homogeneity is shown. [Fig. 163] Food and water consumption is shown. [Fig. 164] Body weight and fasting blood glucose levels are shown. [Fig. 165] 1 shows an exemplary FZ014 generation flow chart. [Fig. 166] 1 shows an exemplary cassette preparation directly from a Golden Gate reaction. [Fig. 167] 1 shows the preparation of pTDH3-2KD1-Fc-aprotinin-DFR1 cassette. [Fig. 168] Positive clones after electroporation with different cassettes in FZMYA06-16 are shown. [Fig. 169] 1 shows an exemplary screening process for FZ014 clones. [Fig. 170] ELISA screening of FZ014_2KD1-Fc is shown. [Fig. 171] ELISA screening of FZ014_aprotinin-2KD1-Fc. [Fig. 172] ELISA screening of FZ014_2KD1-Fc-aprotinin. [Fig. 173] 1 shows a comparison of the expression of three formats of 2KD1-Fc. [Fig. 174] 1 shows an exemplary characterization (growth curve) of FZ024. [Fig. 175] 1 shows an exemplary characterization (growth curve) of FZ014. [Fig. 176] 1 shows an exemplary characterization of FZ014 (site-specific insertion of an expression cassette). [Fig. 177] 1 shows an exemplary characterization of FZ014 (ELISA to detect 2KD1 binding to RVA antigen). [Fig. 178]An exemplary characterization of FZ014 (virus neutralization assay) is shown: Virus = Wa att HRV strain, working dilution 1 / 500 > 1 / 250 dil 1-2; MA104 passaged 16 times from Friday to Monday; Assay development > Infected cells were stained with Nanobody 2KD1 labeled with Alexa 488, working dilution: 1 / 500 in PBS-Evan Blue, 45 min at 37°C. [Fig. 179] 1 shows an exemplary FZ016 generation flow chart. [Fig. 180] 1 shows an exemplary cassette preparation directly from a Golden Gate reaction. [Fig. 181] An exemplary electroporation of FZMYA06-16 is shown. [Fig. 182] 1 illustrates an exemplary screening process. [Fig. 183] 1 shows an exemplary ELISA screening of FZ016_M6-M4-Fc. [Fig. 184] 1 shows an exemplary ELISA screening of FZ016_M6-M5-Fc. [Fig. 185] Expression comparison of FZ016_M6-M4-Fc vs. FZ016_M6-M5-Fc is shown. [Fig. 186] FIG. 1 shows an exemplary ELISA blocking assay to detect the blocking effect of 2KD1 on blocking adhesion of NoVr VLP GII.4 / 1974 VLP native antigen to porcine gastric mucin. [Fig. 187] FIG. 1 shows an exemplary ELISA blocking assay to detect the blocking effect of 2KD1 on blocking adhesion of NoVr VLP GII.4 / 1974 VLP native antigen to H-type 3 carbohydrate. [Fig. 188] The schematic structure of FZ020 generation is shown. [Fig. 189] 1 shows an exemplary overview of the development of FZ020. [Fig. 190] 1 illustrates an exemplary FZ020 generation flow chart. [Fig. 191] 1 shows an exemplary cassette containing plasmid construct. [Fig. 192]1 shows an exemplary cassette preparation for FZ020 development. [Fig. 193] An exemplary first electroporation of FZMYA06-16 is shown. [Fig. 194] An exemplary screening process for FZ002_ABAB(pTDH3-DHFR) is shown. [Fig. 195] ELISA screening of FZ002_ABAB expression (pTDH3-DHFR) is shown. [Fig. 196] Top Sb-ABAB(pTDH3-DHFR) clone homogeneity check is shown. [Figure 197] FIG. 1 shows the characterization (growth phenotype) of the exemplary FZ002_ABAB-2E9 (pTDH3-ABAB-DHFR). [Figure 198-1] Characterization (growth curve) of exemplary FZ002_ABAB-2E9 (pTDH3-ABAB-DHFR). [Figure 198-2] This is a continuation of Figure 198-1. [Figure 199] FIG. 1 shows the characterization (stability) of the exemplary FZ002_ABAB-2E9 (pTDH3-ABAB-DHFR). [Figure 200] Characterization (acute expression) of an exemplary ABAB-2E9 (pTDH3-ABAB-DHFR). [Figure 201] Characterization of exemplary ABAB-2E9 (pTDH3-ABAB-DHFR) (genome-specific insertion site) is shown. [Fig. 202] 1 shows an exemplary generation and characterization of S. boulardii strain FZ002-2E9B2. [Fig. 203] Schematic diagram of FZE1 amplification copy number. [Fig. 204]Figure 1 shows the generation of S. boulardii strain FZ002-2E9-B2 by FZE1 to amplify copy number. Growth recovery is defined as an overnight culture during FZE1 treatment with an OD600 of at least half that of cells not treated with FZE1, which is considered growth recovery. Once the cells are harvested, plate the cells on YPD plates for expression level testing or proceed to the next level of treatment (higher concentration of FZE1). [Fig. 205] 13 shows the generation of S. boulardii strain FZ002-2E9B2 by FZE1 to amplify expression levels. [Fig. 206] 13 shows the generation of S. boulardii strain FZ002-2E9-B2 by FZE1 to amplify expression levels. [Fig. 207] FIG. 1 shows an exemplary schematic of the generation and characterization of S. boulardii strain FZ020. [Fig. 208] Transformation of TNF-α-Fc expression cassette and screening of transformants. [Fig. 209] ELISA screening of ahTNF-α+ABAB is shown. [Fig. 210] 1 shows the characterization (growth phenotype) of an exemplary FZ020. [Fig. 211] 1 shows the characterization of an exemplary FZ020 (genome-specific insertion site). [Fig. 212] 1 shows the characterization of an exemplary FZ020 (genome-specific insertion site). [Fig. 213] 1 shows the characterization of an exemplary FZ020 (binding activity to both TcdB and human TNFα). [Fig. 214] 1 shows the characterization of an exemplary FZ020 (neutralizing activity against TcdB and human TNFα). [Fig. 215] 1 shows an exemplary FZ024 development flow chart. [Fig. 216] PCR of leptin-HA-DFR1 / leptin-Fc-DFR1 cassette for development of FZ024 is shown. [Fig. 217] Electroporation of FZMYA06-16 is shown. [Fig. 218] 1 shows an exemplary screening process for the FZ024 clone. [Fig. 219] 1 shows an exemplary ELISA screening of FZ024 clones. [Fig. 220] An exemplary generation of the "leptin-HA" line for mouse studies is shown. Two frozen vials from the cell bank of FZY14-E6 were used (approximately 1x10^8 cells in 1 mL each) to inoculate 2x50 mL of YPD. [Fig. 221] 1 shows an exemplary FZ028 generation flow chart. [Fig. 222] 1 shows an exemplary cassette preparation directly from the Golden Gate reaction for the development of FZ028. [Fig. 223] Electroporation of FZMYA06-16 is shown. [Fig. 224] 1 shows an exemplary screening process for the FZ028 clone. [Fig. 225] 1 shows an exemplary ELISA screening of FZ028 clones. [Fig. 226] 1 illustrates an exemplary FZ010 generation flow chart. [Fig. 227] 1 shows an exemplary cassette-containing plasmid construct and cassette preparation for FZ010 development. [Fig. 228] An exemplary electroporation of FZMYA06-16 is shown. [Fig. 229] 1 illustrates an exemplary screening process. [Fig. 230] FIG. 1 shows the first 2 hour acute ELISA screen of FZ010_pTDH3-hIL22 fused to yFc(N297Q) at the N- or C-terminus. [Fig. 231] FIG. 1 shows the first 2 hour acute ELISA screen of FZ010_pTDH3-hIL22-DFR1. [Fig. 232] 1 shows an exemplary assessment of uniformity. [Fig. 233]A second 2 hour acute ELISA screen of FZ010_pTDH3-hIL22 fused to yFc(N297Q) at the N- or C-terminus is shown. [Fig. 234] A second 2 hour acute ELISA screen of FZ010_pTDH3-hIL22-DFR1 is shown. [Fig. 235] FIG. 1 shows an exemplary flow chart for the development of FZE1 (combination of methotrexate and sulfanilamide) selection for S. boulardii (Sb) (testing effective doses of FZE1 in Sb). [Fig. 236] Testing methotrexate (MTX) effective doses in S. boulardii (Sb). pCEV-G4-Km-DHFR and pCEV-G4-Km were transformed into FZMYA06-16 and single transformed clones were picked for growth characterization with MTX. Cells were seeded at OD=0.2 and 24-hour reads were taken. MTX alone, even at 500 nM, was not sufficient to affect growth inhibition. [Fig. 237] Testing the effective dose of sulfanilamide in S. boulardii (Sb) is shown. Sulfanilamide was prepared in DMSO. The carrier DMSO showed no toxicity to Sb. Sulfanilamide can be used at less than 10 mg / mL. [Fig. 238] Figure 1 shows a study of the effective dose of sulfanilamide in S. boulardii (Sb). Sulfanilamide (less than 5mg / ml) can be used in combination with MTX. [Fig. 239] Testing the effective dose of FZE1 (combination of MTX and sulfanilamide (Sulfa)) in S. bouldardii (Sb). For the combination, MTX >10-100 μM, sulfa can be used at 1 mg / ml. [Fig. 240]Testing the effective dose of FZE1 (combination of MTX and sulfanilamide (Sulfa)) in S. boulardii (Sb). In the combination, MTX can be used at 50-250 μM and sulfa can be used at 1 mg / ml. [Fig. 241] Validation of FZE1 dosage for selection in Sb is shown. DHFR selected transformants can be selected from 50-300 μM MTX and 1 mg / ml sulfur. In some cases, the optimized dose for DHFR selection is 250 μM MTX and 1 mg / ml sulfur due to clear background and relatively more transformants for screening. [Fig. 242] 1 shows the amino acid sequence similarity of mouse DHFR and yeast DFR1. [Fig. 243] FIG. 1 shows a schematic diagram of the development of S. boulardii (Sb) DFR1 as a selectable marker. [Fig. 244] Figure 1 shows that S. boulardii (Sb) anti-TNF-α-Fc-DFR1 inserted at different positions is expressed in FZE1 (sulfur 1 mg / mL + 50 µM MTX) and the selected clone shows the highest expression of the GOI. [Fig. 245] Screening of high expressing clones by DHFR. Screening of anti-hIL-17A-Fc expressing clones by URA3 or DHFR selection marker with GOI cassette inserted at delta site. After transformation with FZMYA06-16 (URA3- / -, GAP1- / -) strain harboring a DNA fragment containing the GOI cassette with URA3 or DHFR selection marker flanked by delta insertion homology arms, positive clones were picked up from the corresponding plates: SDCAA-URA3 plate for URA3 selection and YPD+FZE1 for DHFR selection. 184 positive clones were subcultured in 600 μl YPD for 24 h at 37° C. with shaking at 250 rpm, respectively. Culture supernatants were diluted 10-fold and detected by ELISA. Data readout at OD450 nm. [Fig. 246]Screening of high expression clones by DHFR. Screening of anti-hTNF-α-Fc expressing clones by positive URA3 or DHFR selection markers with GOI cassette inserted pTDH3 site. After transformation with FZMYA06-16 (URA3- / -, GAP1- / - strain harboring a DNA fragment containing the GOI cassette together with URA3 or DHFR selection marker flanked by pTDH3 homology arms, positive clones were picked up from the corresponding plates: SDCAA+URA3 plates for URA3 selection and YPD+FZE1 for DHFR selection. 84 positive clones were subcultured in 600 μl YPD for 24 h each at 37° C. with shaking at 250 rpm. Culture supernatants were diluted 20-fold and detected by ELISA. Data readout at OD450 nm. [Fig. 247] FIG. 1 shows a schematic diagram of copy number amplification and increased gene expression by FZE1. [Fig. 248] 1 shows amplification of the copy number of a GFP expression cassette by culturing engineered yeast carrying dihydrofolate reductase in medium containing FZE1. [Fig. 249] Figure 1 shows increased GFP expression by FZE1. When both low and high expressing clones were cultured in FZE1 medium for adaptation, the expression levels increased. [Fig. 250] Figure 1 shows the increase in ABAB expression by FZ002 after culturing yeast in medium containing FZE1. FZ002 clones 2E9 and 6G1 were kept cultivated in FZE1 culture medium until adaptation (left panel). Single clones were picked up to measure ABAB expression by ELISA and show OD450 (right panel). [Fig. 251] 1 shows increased expression of ABAB by FZ002 after culturing yeast in medium containing FZE1.
[0048] Additional advantages of the invention will be set forth in part in the description which follows and in part will be obvious from the description or may be learned by the practice of the invention. The advantages of the invention will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing summary and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0049] The present disclosure provides technology relating to engineered strains of Saccharomyces yeast that express a therapeutic polypeptide(s) and / or contain a nucleic acid encoding a therapeutic polypeptide(s). Such engineered strains of Saccharomyces yeast can, in some embodiments, provide stable, constitutive expression of a therapeutic polypeptide(s) without the need for traditional in vitro polypeptide expression systems (e.g., CHO or E. coli cells) utilizing bioreactors or bacterial fermenters followed by downstream polypeptide processing and purification prior to use as a therapeutic.
[0050] The engineered strains of Saccharomyces yeast of the present disclosure can be delivered, for example, orally or rectally, allowing for self-administration by the subject rather than a medical professional, which may result in improved compliance with treatment and ultimately favorable treatment and / or prevention of diseases and / or disorders.
[0051] Many modifications and other embodiments of the disclosed herein will be readily apparent to those skilled in the art to which the disclosed compositions and methods pertain having the benefit of the teachings presented in the foregoing description and the associated drawings. It is therefore to be understood that the disclosure is not limited to the specific embodiments disclosed, and that modifications and other embodiments are intended to be included within the scope of the appended claims. Those skilled in the art will recognize many variations and adaptations of the aspects described herein. These variations and adaptations are intended to be included within the teachings of the present disclosure and encompassed by the scope of the claims herein.
[0052] Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.
[0053] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has separate components and features that may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure.
[0054] Any recited method may be carried out in the order of events recited or in any other order that is logically possible. That is, unless expressly stated, it is in no way intended that any method or aspect set forth herein be interpreted as requiring that its steps be performed in a particular order. Thus, unless a method claim specifically recites in the claim or description that the steps are to be limited to a particular order, no order is intended to be inferred in any respect. This holds for any possible implicit basis for interpretation, including the obvious meaning derived from the arrangement of steps or operational flow, grammatical construction or punctuation, or logical matters regarding the number or type of aspects described in the specification.
[0055] All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publications provided herein may be different from the actual publication dates and may be independently confirmed.
[0056] Although aspects of the present disclosure may be described and claimed in particular legal classes (e.g., system specific legal classes), this is for convenience only, and those of skill in the art will understand that each aspect of the present disclosure may be described and claimed in any legal class.
[0057] It should also be understood that the terms used herein are for the purpose of describing particular embodiments only and are not intended to be limiting.Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the disclosed compositions and methods belong.Terms as defined in commonly used dictionaries should be interpreted to have meanings consistent with their meanings in the context of the present specification and related art, and should not be interpreted in an ideal or overly formal sense unless expressly defined herein.
[0058] Prior to describing the various aspects of this disclosure, the following definitions are provided and should be used unless otherwise indicated. Additional terms may be defined elsewhere in this disclosure.
[0059] definition As used herein, "comprising" is interpreted to mean the presence of the features, elements, steps, or components described as referenced, but does not exclude the presence or addition of one or more other features, elements, steps, components, or groups thereof. Furthermore, terms such as "by," "comprising," "comprises," "comprised of," "including," "includes," "included," "involving," "involves," "involved," and "such as" are each used in their open, non-limiting sense and may be used interchangeably. Furthermore, the term "comprising" is intended to include examples and embodiments encompassed by the terms "consisting essentially of" and "consisting of." Similarly, the term "consisting essentially of" is intended to include examples encompassed by the term "consisting of."
[0060] As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to an "engineered strain of Saccharomyces yeast," a "genetically modified yeast," a "carrier," or an "inflammatory bowel disease" includes, but is not limited to, mixtures or co-occurrences of two or more such engineered strains of Saccharomyces yeast, genetically modified yeast, carriers, or inflammatory bowel diseases, etc.
[0061] It should be noted that ratios, concentrations, amounts, and other numerical data may be expressed herein in a range format. It will further be understood that the endpoints of each range are significant both in relation to the other endpoint and independently of the other endpoint. There are several values disclosed herein, and each value is also understood to be disclosed herein as "about" that particular value, in addition to the value itself. For example, if the value "10" is disclosed, then "about 10" is also disclosed. Ranges may be expressed herein as from "about" one particular value, and / or to "about" another particular value. Similarly, when values are expressed as approximations by use of the antecedent "about," it will be understood that the particular value forms a further aspect. For example, if the value "10" is disclosed, then "10" is also disclosed.
[0062] When a range is expressed, a further embodiment includes from one particular value and / or to the other particular value. For example, if the stated range includes one or both of the boundaries, ranges excluding either or both of those included boundaries are also included in the disclosure, and the phrase "from x to y" includes ranges from "x" to "y" and ranges greater than "x" and less than "y". Ranges can also be expressed as upper limits, e.g., "about x, y, z, or less," and should be interpreted to include the specific ranges of "about x," "about y," and "about z," as well as the ranges "less than x," "less than y," and "less than z." Similarly, the phrase "about x, y, z, or greater" should be interpreted to include the specific ranges of "about x," "about y," and "about z," as well as the ranges "greater than x," "greater than y," and "greater than z." Additionally, the phrase "about 'x' to 'y'," where "x" and "y" are numerical values, includes "about 'x' to about 'y'."
[0063] It should be understood that such range formats are used for convenience and brevity and should thus be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range, but also all individual numerical values or subranges subsumed within that range, as if each numerical value and subrange were explicitly recited. To illustrate, a numerical range of "about 0.1% to 5%" should be interpreted to include not only the explicitly recited values of about 0.1% to about 5%, but also the individual values (e.g., about 1%, about 2%, about 3%, and about 4%) and subranges (e.g., about 0.5% to about 1.1%, about 5% to about 2.4%, about 0.5% to about 3.2%, and about 0.5% to about 4.4%, as well as other possible subranges) within the indicated range.
[0064] As used herein, the terms "about," "approximately," "about," and "substantially" mean that the amount or value in question may be an exact value or a value that provides an equivalent result or effect, as set forth in the claims or taught herein. That is, it is understood that the amounts, sizes, formulations, parameters, and other quantities and characteristics are not and need not be exact, but may be approximate and / or larger or smaller, if desired, to reflect tolerances, conversion factors, rounding, measurement errors, and the like, and other factors known to those skilled in the art to provide equivalent results or effects. In some circumstances, values that provide equivalent results or effects cannot be reasonably determined. In such cases, as used herein, unless otherwise indicated or inferred, "about," "approximately," and "about" are generally understood to be nominal values that indicate a variation of ±10%. In general, a quantity, size, formulation, parameter, or other quantity or characteristic is "about," "approximately," "about," "about," whether or not it is expressly stated as such. When "about," "approximately," or "or about" is used prior to a certain quantitative value, it is understood that the parameter also includes the particular quantitative value itself, unless otherwise specified.
[0065] As used herein, the term "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and the description includes cases where the event or circumstance occurs and cases where it does not occur.
[0066] "Diabetes" refers to a chronic disease characterized by hyperglycemia. Traditionally, the majority of diabetes cases are classified into two broad pathogenic categories: type 1 diabetes (T1D) and type 2 diabetes (T2D). However, in some subjects, this classification cannot be applied because other genetic, immunological, or neurointrinsic pathways are involved in the pathogenic mechanism.
[0067] "Inflammatory bowel disease" (IBD) refers to a group of gastrointestinal disorders characterized by chronic nonspecific inflammation of a portion of the gastrointestinal tract. Ulcerative colitis (UC) and Crohn's disease (CD) are the most prominent examples of IBD in humans. However, IBD is also known to occur in animals, particularly dogs, cats and horses. IBD is associated with many symptoms and complications, including growth retardation in children, rectal prolapse, blood in the stool (e.g., melena and / or bloody stool), wasting, iron deficiency, and anemia (e.g., iron deficiency anemia and anemia of chronic disease or anemia of chronic inflammation). The etiology or etiologies of IBD are unknown.
[0068] "Ulcerative colitis" (UC) refers to a chronic, nonspecific, and inflammatory ulcer disease with symptoms primarily in the colonic mucosa. It is frequently characterized by bloody diarrhea, abdominal cramps, blood and mucus in the stool, fatigue, fever, anemia, anorexia, weight loss, leukopenia, hypoalbuminemia, and elevated erythrocyte sedimentation rate (ESR). Complications of UC may include bleeding, toxic colitis, toxic megacolon, occasional rectovaginal fistula, and increased risk of developing colon cancer. Ulcerative colitis is also associated with complications far from the colon, such as arthritis, ankylosing spondylitis, sacroiliitis, posterior uveitis, erythema nodosum, pyoderma gangrenosum, and epididymal sclerosis. Treatment varies considerably depending on the severity and duration of the disease. For example, fluid therapy to prevent dehydration and electrolyte imbalance is often indicated in severe attacks. In addition, special dietary therapy is sometimes useful. Medications include various corticosteroids, sulfasalazine and some of its derivatives, and possible immunosuppressants.
[0069] "Crohn's disease" (CD) has much in common with ulcerative colitis. Crohn's disease is distinguishable in that the lesions tend to be sharply demarcated from adjacent normal bowel, in contrast to the lesions of ulcerative colitis, which are fairly diffuse. In addition, Crohn's disease primarily afflicts the ileum (ileitis) or the ileum and colon (ileocolitis). In some cases, only the colon is affected (granulomatous colitis), and occasionally the entire small intestine is involved (jejunoileitis). In rare cases, the stomach, duodenum, or esophagus are involved. Lesions include sarcoid-type epithelial granulomas in about half of the clinical cases. Crohn's disease lesions may be transmural, including deep ulcers, edema, and fibrosis, which may lead to obstruction and fistula formation, as well as abscess formation. This is in contrast to ulcerative colitis, which usually causes much shallower lesions, although ulcerative colitis is sometimes complicated by fibrosis, obstruction, fistula formation, and abscesses.
[0070] As used herein, "administering" can refer to administration, which can be oral and / or rectal, and can be continuous or intermittent. In various aspects, the disclosed organisms, compositions, and / or preparations can be administered therapeutically, i.e., administered to treat an existing disease or condition. In further various aspects, the disclosed organisms, compositions, and / or preparations can be administered prophylactically, i.e., administered for the prevention of a disease or condition.
[0071] As used herein, a "therapeutic agent" can refer to any substance, compound, molecule, etc. that can be biologically active or otherwise capable of inducing a pharmacological, immunogenic, biological and / or physiological effect on a subject to which it is administered by local and / or systemic action. A therapeutic agent can be a primary active agent, or in other words, a component(s) of a composition to which the composition's effect is due in whole or in part. A therapeutic agent can be a secondary therapeutic agent, or in other words, a component(s) of a composition to which an additional portion of the composition and / or other effect is due. Thus, the term encompasses compounds or chemicals traditionally considered to be drugs, vaccines, and biopharmaceuticals, including macromolecules such as proteins, peptides, hormones, nucleic acids, gene constructs, etc., as well as genetically modified microorganisms, etc. A therapeutic agent can be a biologically active agent used in medical applications, including veterinary applications. The term therapeutic agent also includes, but is not limited to, medicines; vitamins; mineral supplements; substances used in the treatment, prevention, diagnosis, cure, or mitigation of a disease or illness; or substances that affect the structure or function of the body, such as probiotic microorganisms, prebiotics; or prodrugs that become biologically active or more active after being placed in a given physiological environment.
[0072] As used herein, a "therapeutic polypeptide" refers to a protein or peptide having a biological activity involved in or associated with the treatment or prevention of a disease or condition.
[0073] As used interchangeably herein, a "subject," "individual," or "patient" can refer to a vertebrate organism, such as a mammal (e.g., a human, dog, cat, horse, pig, chicken, turkey, goat, sheep, cow, rabbit). A "subject" can also refer to a cell, a collection of cells, a tissue, an organ, or an organism, preferably a human and components thereof.
[0074] As used herein, the terms "treating" and "treatment" can generally refer to obtaining a desired pharmacological and / or physiological effect. Exemplary conditions that can be treated include, but are not limited to, Crohn's disease, ulcerative colitis, and other inflammatory bowel diseases and / or inflammation-related conditions, as well as diabetes, obesity, and certain infectious diseases. The effect can be therapeutic in terms of a partial or complete cure of the disease, disorder, condition, or adverse effects caused by the disease, disorder, or condition. The term "treatment" as used herein can include (a) inducing remission of the disease or condition being treated, (b) inhibiting the disease, i.e., preventing its development, and (c) relieving the disease, i.e., reducing or ameliorating the disease and / or its symptoms. Those in need of treatment (e.g., subjects in need thereof) can include those already suffering from the disorder, disease, or condition and / or those suspected of suffering from the disorder or condition. Treating a disease, disorder, or condition can include ameliorating at least one symptom of a particular disease, disorder, or condition, even if the underlying pathophysiology is not affected.
[0075] As used herein, the term "preventing", "preventing", or "prophylactic" refers to halting, precluding, avoiding, eliminating, preventing, stopping, or hindering the onset of a disease or condition that a subject may be predisposed to developing prior to the onset of the disease or condition. In some embodiments, "preventing" or "prophylactic" may simply refer to reducing the likelihood that a subject (e.g., a subject predisposed to developing a disease or condition) will develop a given disease or condition (e.g., Crohn's disease, diabetes, ulcerative colitis, etc.). This is because it is understood that most prophylactic agents are not 100% effective in preventing a disease or condition in all subjects who receive it. In some embodiments, "preventing" or "prophylactic" may refer to the prevention of disease relapse if the subject is currently in remission while undergoing treatment (i.e., "prevent" may be synonymous with maintaining remission in certain contexts).
[0076] As used herein, a "dose," "unit dose," or "dosage" can refer to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of a disclosed compound and / or pharmaceutical composition thereof calculated to produce a desired response or responses associated with its administration.
[0077] As used herein, a "therapeutic agent" can refer to treating, curing, and / or ameliorating a disease, disorder, or condition, or slowing the rate of progression of a disease, disorder, or condition.
[0078] As used herein, "effective amount" may refer to an amount of a disclosed compound or pharmaceutical composition provided herein sufficient to effect a beneficial or desired biological, emotional, medical, or clinical response in a cell, tissue, system, animal, or human. An effective amount may be administered in one or more administrations, applications, or dosages. The term may also include within its scope an amount effective to enhance or restore substantially normal physiological function.
[0079] As used herein, the term "therapeutically effective amount" refers to an amount sufficient to achieve a desired therapeutic outcome or have an effect on undesired symptoms, but generally insufficient to cause adverse side effects. The specific therapeutically effective dose level for any particular patient will depend on a variety of factors, including the disease, disorder, and / or condition being treated, and the severity of the disease, disorder, and / or condition, the particular composition used, the age, weight, general health, sex, and diet of the patient, the timing of administration, the route of administration, the excretion rate of the particular compound used, the duration of treatment, drugs used in combination with or simultaneously with the particular compound used, and similar factors that are within the knowledge and activity of the medical practitioner and may be well known in the medical field. When treating a particular disease, disorder, and / or condition, in some cases the desired response may be to inhibit the progression of the disease, disorder, and / or condition. This may involve only slowing the progression of the disease, disorder, and / or condition temporarily. However, in other cases it may be desirable to permanently halt the progression of the disease, disorder, and / or condition. This can be monitored for any particular disease, disorder, and / or condition by routine diagnostic methods known to those skilled in the art.
[0080] As used herein, the term "prophylactically effective amount" refers to an amount effective to prevent the development or onset of a disease, disorder, and / or condition.
[0081] For example, it is well within the skill of the art to start a dose of a compound at a level lower than that required to achieve a desired therapeutic effect, and gradually increase the dose until the desired effect is achieved. If desired, an effective daily dose can be divided into multiple doses for administration. Consequently, a single dose composition can contain such amounts or submultiples thereof to make up a daily dose. In the event of any contraindications, the dosage can be adjusted by the individual physician. In general, it is preferred to use the maximum dose of the pharmacological agent of the present invention (alone or in combination with other therapeutic agents), i.e., the highest safe dose according to sound medical judgment. However, it will be understood by those skilled in the art that a patient may insist on a lower dose or tolerated dose for medical reasons, psychological reasons, or any other reasons.
[0082] Response to a therapeutically effective dose of the disclosed compounds and / or pharmaceutical compositions can be measured by determining the physiological effect of the treatment or medicament, such as, for example, a reduction or absence of symptoms of a disease, disorder, and / or condition following administration of the treatment or pharmacological agent. Other assays are known to those of skill in the art and can be used to measure the level of response. The amount of treatment can be varied, for example, by increasing or decreasing the amount of the disclosed compounds and / or pharmaceutical compositions, by changing the disclosed compounds and / or pharmaceutical compositions administered, by changing the timing of administration, etc. Dosages can vary and can be administered in one or more dose administrations per day, over one or several days.
[0083] As used herein, the term "probiotic microorganism" or "probiotic bacteria" or "probiotic" refers to a microorganism or bacterium (e.g., including Saccharomyces yeast, engineered strains of Saccharomyces yeast, e.g., engineered strains of S. Boulardii) that confers a health or well-being benefit to a host when administered in an effective amount.
[0084] As used herein, the term "promoter" refers to a transcriptional regulatory sequence that is at least sufficient to promote transcription of a nucleotide sequence in DNA into an RNA transcript. A transcript transcribed from a promoter typically includes sequences from the promoter downstream of the transcription start site, and downstream sequences that, in the case of mRNA, code for an amino acid sequence. Promoters are the best characterized transcriptional regulatory sequences because of their predictable location immediately upstream of the transcription start site. Promoters include sequences that regulate the recognition, binding, and transcription initiation activity of RNA polymerase. These sequences can be cis-acting or responsive to trans-acting factors. Promoters can be constitutive or regulated, depending on the nature of the regulation. Promoters are often described as having two separate segments: the core and the extended promoter region. The core promoter contains sequences sufficient for RNA polymerase recognition, binding, and transcription initiation. The core promoter contains the transcription start site, the RNA polymerase binding site, and other general transcription binding sites, and is where the preinitiation complex forms and the general transcription machinery assembles. The preinitiation complex is generally within 50 nucleotides (nt) of the transcription start site (TSS). The core promoter also contains the sequence of the ribosome binding site required for translation of the mRNA into a polypeptide. The extended promoter region includes the so-called proximal promoter, which extends up to about 250 nucleotides upstream of the transcription start site (i.e., -250nt). This includes primary regulatory elements such as specific transcription factor binding sites. Many genes have been found to have transcriptional regulatory elements located further upstream. In particular, fragments containing most of the transcriptional regulatory elements of a gene can extend up to 700 nt or more upstream of the transcription start site. (See, e.g., US2007-0161031.) In certain genes, transcriptional regulatory sequences are found thousands of nucleotides upstream of the transcription start site.
[0085] As used herein, a nucleotide sequence is "operatively linked" or "operably linked" to a transcriptional regulatory sequence when the transcriptional regulatory sequence functions in a cell to regulate the transcription of the nucleotide sequence, including promoting transcription of the nucleotide sequence through interaction between a polymerase and a promoter.
[0086] As used herein, the term "mutation" refers to a change in a nucleotide or amino acid sequence. Mutations can include the substitution of one or more nucleotides (a single nucleotide substitution is referred to as a "SNV" or "point mutation"), the addition of one or more nucleotides, or the deletion of one or more nucleotides, as well as the changes in amino acid sequence (if any) that result from these nucleotide changes.
[0087] As used herein, "parenteral administration" includes administration by bolus injection or infusion, as well as administration by intravenous, intramuscular, intra-arterial, intrathecal, intracapsular, intraorbital, intraventricular, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intra-articular, subarachnoid, subcapsular, intraspinal, epidural, and intrasternal injection and / or infusion.
[0088] As used herein, a "vector" is a replicable nucleic acid in which one or more heterologous polypeptides can be expressed when the vector is transformed into a suitable host cell. Reference to a vector typically includes vectors that can introduce a nucleic acid encoding a polypeptide or a fragment thereof by restriction digestion and ligation. Reference to a vector also includes those vectors that contain a nucleic acid encoding a polypeptide. Vectors are used to introduce a nucleic acid encoding a polypeptide into a host cell for amplification of the nucleic acid or for expression / display of the polypeptide encoded by the nucleic acid. Vectors typically remain episomal, but can be designed to integrate a gene or a portion thereof into a chromosome of the genome. Vectors that are artificial chromosomes, such as yeast artificial chromosomes, are also contemplated. The selection and use of such vehicles are well known to those skilled in the art. Vectors also include "virus vectors" or "viral vectors". Viral vectors are engineered viruses that are operably linked to an exogenous gene to transfer the exogenous gene into a cell (as a vehicle or shuttle). As used herein, an "expression vector" includes vectors capable of expressing DNA that is operably linked to regulatory sequences, such as promoter regions, capable of effecting expression of such DNA fragments. Such additional segments may include promoter and terminator sequences, and may optionally include one or more origins of replication, one or more selectable markers, enhancers, polyadenylation signals, and the like. Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both. Thus, an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, phage, recombinant virus, or other vector, that upon introduction into an appropriate host cell results in expression of the cloned DNA. Suitable expression vectors are well known to those of skill in the art, and include those that are replicable in eukaryotic and / or prokaryotic cells, as well as those that remain episomal or that integrate into the host cell genome.
[0089] The term "pharmacologically acceptable" describes a material that is not biologically or otherwise undesirable, i.e., does not cause unacceptable levels of undesirable biological effects or interact in a deleterious manner.
[0090] The term "contacting" as used herein refers to bringing a disclosed compound or pharmaceutical composition into proximity with a cell, target protein or polypeptide, or other biological entity in a manner that can affect the activity of the cell, target protein or polypeptide, or other biological entity either directly, i.e., by interacting with the cell, target protein or polypeptide, or other biological entity itself, or indirectly, i.e., by interacting with another molecule, cofactor, factor, or protein or polypeptide on which the activity of the cell, target protein or polypeptide, or other biological entity itself depends.
[0091] Engineered strains of Saccharomyces yeast The present disclosure provides, inter alia, engineered strains of Saccharomyces yeast. In some embodiments, the engineered strains of Saccharomyces yeast express one or more therapeutic polypeptides described herein. In some embodiments, the engineered strains of Saccharomyces yeast include a nucleic acid encoding one or more therapeutic polypeptides described herein.
[0092] Also disclosed are techniques for the generation of engineered strains of Saccharomyces yeast. In one aspect, the method results in stable high expression of heterologous genes in the engineered strains of Saccharomyces yeast. In another aspect, the engineered strains of Saccharomyces yeast constitutively secrete (e.g., in the gastrointestinal tract of a subject) a therapeutic polypeptide(s). In yet another aspect, the method allows for multiple gene insertions, expression of full-length antibodies, expression of multiple therapeutic polypeptides, and / or expression of multiple enzymes for the production of a specific metabolic product.
[0093] In one aspect, the disclosure relates to engineered strains of Saccharomyces yeast that produce at least one (e.g., 1, 2, 3, 4, or more) therapeutic polypeptides capable of binding to one or more specific targets (e.g., disease targets) in a subject, where the therapeutic polypeptide(s) are produced in vivo in the subject. In another aspect, the at least one (e.g., 1, 2, 3, 4, or more) therapeutic polypeptides comprise a mammalian (e.g., human, dog, cat, horse, pig, chicken, turkey, goat, sheep, cow) cytokine or chemokine. Exemplary non-limiting cytokines include IL-1, IL-2, IL-4, TNF-α, IL-17A, IL-6, IL-8, IL-10, IL-12, GM-CSF, IL-13, IL-18, IL-20, IL-22, IL-23, IL-25, IL-27, IL-35, IL-39, TGF-β, or any combination thereof. In one aspect, the inhibition of the inflammatory cytokine is superior to that of an appropriate reference standard (e.g., inhibition of the inflammatory cytokine produced by an existing biologic). In another aspect, the at least one therapeutic polypeptide comprises an antibody, or a functional fragment thereof. In another aspect, the therapeutic polypeptide(s) comprises one or more of a soluble receptor or binding protein, one or more cytokines or chemokines, or any combination thereof. In another aspect, the therapeutic polypeptide(s) include, for example, the group of hormones, enzymes, antimicrobial peptides, microbial peptides, or therapeutic enzymes for the synthesis of therapeutic metabolites.
[0094] In further aspects, nucleic acids encoding therapeutic polypeptide(s) can be inserted in a site-specific manner at "hotspots," in one or more copies, to produce therapeutic polypeptide(s) stably and / or at high levels, or any combination of these characteristics. For purposes of this disclosure, a "hotspot" is a highly expressed genomic locus or loci. In some embodiments, the site-specific insertion inserts one or more nucleic acids encoding therapeutic polypeptide(s) into multiple sites in the genome (e.g., 2, 3, 4, 5, or 6 or more sites). In some embodiments, the site-specific insertion does not disrupt and / or replace any genes endogenously present in the genome. Exemplary hotspots include, but are not limited to, tef1, tdh3, tdh2, tef2, eno2, rpla1, rpla2, rpla3, rpla10e, pdc1, adh1, adh2, gpm1, fba1, rpl47a, pgk1, rpla4, ssm1a, ssm1b, rpl5a, rpl5b, upf1, rpl16a, rpl16b, cup1a, cup1b, rps31a, rpl2a, rpl2b, rps28a, rpl35b, pyk1, rpl9a, rpl9b, rpl27a, rps21, rpl43a, nab1a, nab1b, urp1a, and rps18eb.
[0095] In some embodiments, the site-specific insertion is performed using transposon-directed insertion (e.g., at a Ty, Delta, Sigma, pTEF, and / or pTDH3 site). In some embodiments, the site-specific insertion is a disruptive site-specific insertion (e.g., the inserted nucleic acid disrupts an originally existing nucleic acid). In some embodiments, the site-specific insertion is a non-disruptive site-specific insertion (e.g., the inserted nucleic acid replaces an originally existing nucleic acid). In some embodiments, the site-specific insertion is an end-in type site-specific insertion (e.g., into a hotspot). In some embodiments, the site-specific insertion is an end-out type site-specific insertion (e.g., into a hotspot). In some embodiments, the site-specific insertion method is highly efficient against an appropriate reference standard (e.g., a different site-specific insertion method).
[0096] In further aspects, the nucleic acid encoding the therapeutic polypeptide(s) can be inserted in a non-site-specific manner, in one or multiple copies, and can produce the therapeutic polypeptide(s) stably and / or at high levels, or any combination of these characteristics.
[0097] In some embodiments, engineered strains of Saccharomyces yeast contain modifications (e.g., insertions, deletions, mutations) to increase expression, secretion, and / or stability of a therapeutic polypeptide(s).
[0098] In some embodiments, engineered strains of Saccharomyces yeast contain modifications (e.g., insertions, deletions, mutations, etc.) to increase the safety (e.g., biocontainment) of such live biotherapeutic products.
[0099] Saccharomyces strains In some embodiments, an engineered strain of a Saccharomyces yeast of the present disclosure is a species of the genus Saccharomyces, including, but not limited to, Candida, Schizosaccharomyces, Kluyveromyces, Pichia, Issachenkia, Yarrowia, or Hansenula. Species classified as Saccharomyces include, for example, S.cerevisiae, S.bayanus, S.boulardii, S.bulderi, S.cariocanus, S.cariocus, S.chevalieri, S.dairenensis, S.ellipsoideus, S.eubayanus, S.exi can be S. florentinus, S. kluyveri, S. martiniae, S. monacensis, S. norbensis, S. paradoxus, S. pastorianus, S. spencerorum, S. turicensis, S. unisporus, S. uvarum, or S. zonatus.Candida species include C.albicans, C.ascalaphidarum, C.amphixiae, C.antarctica, C.argentea, and C.atlanti ca, C. atmosphaerica, C. blattae, C. bromeliacearum, C. carpophila, C. carvajalis, C. cerambycidarum, C. chauli odes, C. corydali, C. dosseyi, C. dubliniensis, C. ergatensis, C. fructus, C. glabrata, C. fermentati, and C. guilli ermondii, C. haemulonii, C. insectamens, C. insectorum, C. intermedia, C. jeffresii, C. kefyr, C. krusei, and C. lusi taniae, C. lyxosophila, C. maltose, C. marina, C. membranifaciens, C. milleri, C. oleophila, C. oregonensis parapsilosis C. quercitrusa C. rugosa C. sake C. shehatea C. temnochilae C. tenuis C. theae C. tolerans .tropicalis, C. tsuchiyae, C. sinolaborantium, C. sojae, C. subhashii, C. viswanathii, C. utilis, and C. ubatuben sis and Schizosaccharomyces strains and strains of S.po mbe, S. japonicus, S. octosporus, and S. cryophilus.Species classified as Kluyveromyces can be, for example, K. aestuarii, K. africanus, K. bacillisporus, K. blattae, K. dobzhanskii, K. hubeiensis, K. lactis, K. lodderae, K. marxianus, K. nonfermentans, K. piceae, K. sinensis, K. thermotolerans, K. waltii, K. wickerhamii, or K. yarrowii. Species classified as Pichia can be, for example, P. anomala, P. heedii, P. guilliermondii, P. kluyveri, P. membranifaciens, P. norvegensis, P. ohmeri, P. pastoris, P. methanolica, or P. subpelliculosa. Species classified as Issachenkia can be, for example, I. orientalis. A species classified as the genus Yarrowia may be, for example, Y. lipolytica. A species classified as the genus Hansenula may be, for example, H. subpelliculosa, H. anomala, H. polymorpha, H. holstii Wick, or H. capsulata Wick.
[0100] In one aspect, the Saccharomyces yeast may be S. boulardii, which is a generally recognized as safe (GRAS) organism for probiotic use, i.e., in unmodified form, it is a well-tolerated over-the-counter (OTC) probiotic for promoting gut health and improving diarrhea. In one aspect, S. boulardii grows well at 37° C. and is more tolerant to acidic environmental conditions than other strains of Saccharomyces yeast. However, in another aspect, molecular genetic tools for S. boulardii are not as well developed as those for, for example, S. cerevisiae.
[0101] In some embodiments, engineered strains of Saccharomyces yeast do not contain selectable markers (e.g., antibiotic selectable markers). In a further aspect, this complies with U.S. Food and Drug Administration regulations regarding antibiotic resistance genes, and in a still further aspect, eliminates the possibility of micro-scale fungal evolution under antibiotic pressure.
[0102] In some embodiments, an engineered strain of Saccharomyces yeast comprises a modification (e.g., a mutation, deletion, insertion, etc.) that allows for selection of a particular engineered strain of Saccharomyces yeast (e.g., a selectable marker). In some embodiments, the modification that allows for selection comprises a partial deletion of a gene utilized as a selectable marker. In some embodiments, the modification that allows for selection comprises a complete deletion of a gene utilized as a selectable marker.
[0103] In some embodiments, the selectable marker allows for positive and / or negative selection. In some embodiments, the selectable marker includes a prototrophic marker, an auxotrophic marker, a marker that confers drug resistance, an autoselectable marker, and / or a counterselectable marker. Non-limiting examples of genes utilized as selectable markers include ura3, gap1, leu2, his3, and trp1 (see, for example, IMADEARTIKA, HAYATI Journal of Biosciences, Volume 16, Issue 1, 2009, Pages 40-42, ISSN 1978-3019). Multiple selectable markers are known in the art. Those skilled in the art will readily recognize and understand how to select and use such markers in accordance with the teachings of the present disclosure.
[0104] In some embodiments, the selectable marker comprises a modification or deletion of the URA3 gene. URA3 encodes orotidine 5'-phosphate decarboxylase (ODCase), an essential enzyme that catalyzes one reaction in the synthesis of pyrimidines. Without wishing to be bound by any theory, loss of ODCase activity causes a lack of cell growth unless uracil or uridine is added to the medium. In contrast, when 5-FOA (5-fluoroorotic acid) is added to the medium, active ODCase converts 5-FOA to 5-fluorouracil, a toxic compound, causing cell death. Thus, engineered strains of Saccharomyces yeast that contain a deletion or inactivation of URA3 cannot survive without uracil or uridine. In some embodiments, engineered strains of Saccharomyces yeast can have a URA3 deletion [ura3 - / - or ura3(- / -)], while in other strains, URA3 can be mutated to be non-functional (ura3). In some embodiments, engineered strains of Saccharomyces yeast contain an insertion of URA3.
[0105] In some embodiments, the selectable marker comprises a modification (e.g., deletion) of the GAP1 gene. GAP1 encodes a general amino acid permease involved in the uptake of all naturally occurring L-amino acids, related compounds such as ornithine and citrulline, and some D-amino acids, toxic amino acid analogs such as azetidine-2-carboxylate, and the polyamines putrescine and spermidine. GAP1 is also involved in the invasive growth of Saccharomyces strains. Thus, engineered strains of Saccharomyces yeast that contain a GAP1 modification (e.g., deletion) show reduced uptake of, for example, methionine, glycine, glutamine, and regulated nitrogen sources. In addition, loss of GAP1 reduces the ability of Saccharomyces yeast strains to grow invasively. Without wishing to be bound by any theory, strains in which GAP1 is modified (e.g., deleted) can be selected for use in minimal media in which L-proline is the only nitrogen source in combination with toxic D-Hi. Strains that are GAP1(- / -) can survive in media containing L-proline as the sole nitrogen source, and the toxic amino acid D-histidine is incorporated by GAP1 as a counterselection for D-His, which is toxic to yeast cells, resulting in the selection of GAP1(- / -) strains. Strains that do not contain an inactivating modification in GAP1 (e.g., GAP1(+ / +) strains) can be selected on minimal media where L-citrulline is the sole nitrogen source. In some embodiments, engineered strains of Saccharomyces yeast contain mutations in GAP1. In some embodiments, engineered strains of Saccharomyces yeast contain deletions in GAP1. In some embodiments, engineered strains of Saccharomyces yeast contain insertions in GAP1.
[0106] In some embodiments, the selectable marker comprises a modification of the dihydrofolate reductase (DHFR) gene (see, e.g., MacDonald C et al., Yeast. 2015;32(5):423-438). DHFR is an enzyme that uses NADPH as an electron donor to reduce dihydrofolate to tetrahydrofolate, which can be converted to the tetrahydrofolate cofactor used in one-carbon chemical transfer. DHFR confers resistance to methotrexate (MTX) and exhibits dose-effect selection. Thus, without wishing to be bound by any theory, DHFR can be used in some embodiments as a selectable marker with methotrexate in combination with sulfanilamide to screen for high-expressing strains. In some such embodiments, methotrexate is administered for selection at a concentration of about 1 nM, 5 nM, 10 nM, 20 nM, 50 nM, 75 nM, 100 nM, 150 nM, 200 nM, 250 nM, 500 nM, 750 nm, 1 μM, 5 μM, 10 μM, 20 μM, 50 μM, 75 μM, 100 μM, 150 μM, 200 μM, 250 μM, 500 μM, 750 μM, or 1 mM, or any concentration in between the aforementioned concentrations. In some such embodiments, methotrexate is administered for selection in combination with sulfanilamide. In some such embodiments, sulfanilamide is administered at about 0.1 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL, 0.5 mg / mL, 0.6 mg / mL, 0.7 mg / mL, 0.8 mg / mL, 0.9 mg / mL, 1 mg / mL, 2 mg / mL, 3 mg / mL, 4 mg / mL, 5 mg / mL, 6 mg / mL, 7 mg / mL, 8 mg / mL, 9 mg / mL, or 10 mg / mL, or any concentration between the aforementioned concentrations, for selection. In some such embodiments, about 0.8 nM to 20 nM methotrexate or 50 to 250 μM methotrexate and about 0.1 to 10 mg / mL, 1 to 10 mg / mL, or 1 to 5 mg / mL sulfanilamide are administered. In some embodiments, the selectable marker comprises DFR1, the yeast homolog of DHFR, for selection of chromosomal insertion of the transgene.In some embodiments, DHFR has a sensitivity to MTX comparable to that of DFR1. DHFR is found in all organisms and is functionally conserved. Despite the relatively low sequence identity between DHFR, DFR1, and other homologs, the high functional similarity may, in some embodiments, allow the use of multiple DHFR and DFR1 homologs in accordance with the disclosed technology. Table 1 shows exemplary amino acid sequences of DHFR and DFR1. Given the sequence homology of mammalian DFHR and yeast DFR1, the disclosed technology is not limited to the use of mouse DHFR, but rather, it is expected that any homolog will also function as a selection marker. In some embodiments, the disclosed engineered yeast may include a nucleic acid sequence encoding a mammalian DHFR. In some embodiments, the disclosed yeast may include one or more exogenous copies of a nucleic acid sequence encoding DFR1. Given the sequence homology of mammalian DFHR and yeast DFR1, the disclosed technology is not limited to the use of mouse DHFR, but rather, it is expected that any homolog from any organism will also function as a selection marker. In some embodiments, the disclosed engineered yeast can include a nucleic acid sequence encoding a mammalian DHFR. In some embodiments, the disclosed yeast can include one or more exogenous copies of a nucleic acid sequence encoding DFR1. [Table 1]
[0107] In some embodiments, the engineered strain of Saccharomyces yeast is auxotrophic. In one aspect, the auxotrophic engineered strain of Saccharomyces yeast is less likely to survive in the environment relative to an appropriate reference standard (e.g., the parent strain of Saccharomyces yeast).
[0108] In some embodiments, an engineered strain of Saccharomyces yeast has a similar growth curve when compared to the growth curve of an appropriate reference standard (eg, a parent strain of Saccharomyces yeast).
[0109] In some embodiments, extracts and / or supernatants from cultures of engineered strains of Saccharomyces yeast retain at least some activity relative to a therapeutic target, immune response, and / or alter at least one component of a metabolic pathway in a subject. In some such embodiments, at least some activity comprises at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% relative to a suitable reference standard.
[0110] Enhanced expression of stable therapeutic polypeptide(s) In some embodiments, engineered strains of Saccharomyces yeast contain one or more modifications (e.g., insertions, deletions, mutations, etc.) to increase expression, secretion, and / or stability of a therapeutic polypeptide(s).
[0111] In some embodiments, engineered strains of Saccharomyces yeast with increased expression, secretion, and / or stability of a therapeutic polypeptide(s) comprise a modification (e.g., an insertion, deletion, mutation, etc.) in a gene encoding a protease. In some such embodiments, the protease-encoding gene is or includes pep4 (yeast proteinase A). Pep4 is a vacuolar aspartyl hydrolase that not only degrades polypeptides in the vacuole, but also activates additional vacuolar proteases such as Prc1 (carboxypeptidase Y), Prb1 (proteinase B), and Lap4 (aminopeptidase I). In some such embodiments, the protease-encoding gene is or includes, for example, PRC1, PRB1, and LAP4. Without wishing to be bound by any theory, deletion and / or inactivation of proteases results in reduced degradation of the therapeutic polypeptide(s) produced by the engineered strains of Saccharomyces yeast, and therefore results in increased expression, secretion, and / or stability of the therapeutic polypeptide(s).
[0112] In some embodiments, enzyme-linked immunosorbent assays (ELISAs) are used to assess the effect of modifications to increase expression, secretion, and / or stability of the therapeutic polypeptide(s). In some embodiments, such assessment further comprises comparison of the expression, secretion, and / or stability of the therapeutic polypeptide(s) of the engineered strain of Saccharomyces yeast to an appropriate reference standard (e.g., the expression, secretion, and / or stability of the therapeutic polypeptide(s) in the corresponding parent strain of Saccharomyces yeast).
[0113] Multiple methods are known in the art for assessing polypeptide (e.g., expression, secretion, and / or stability of a therapeutic polypeptide(s). Those of skill in the art will readily recognize and understand how to select and use such methods in accordance with the present disclosure.
[0114] Enhanced biological safety Oral administration of S. boulardii probiotics has caused fungemia (e.g., the presence of fungi or yeast in the blood) in immunocompromised populations. Thus, there is a need in the art for improving the safety of probiotics, including, for example, engineered strains of Saccharomyces yeast described herein. In some embodiments, engineered strains of Saccharomyces yeast contain modifications (e.g., insertions, deletions, mutations, etc.) to increase the safety of such strains, particularly for use as live biotherapeutic products (e.g., probiotics). In some embodiments, such modifications cause the accumulation of toxic intermediates, leading to the regulation (e.g., reduction) of cell proliferation (e.g., in eukaryotic cells).
[0115] In some embodiments, engineered strains of Saccharomyces yeast with improved biosafety include modifications (e.g., insertions, deletions, mutations, etc.) in genes associated with metabolic pathways (e.g., to produce amino acid and / or nucleic acid components). Multiple genes associated with metabolic pathways are known in the art, and one of skill in the art will readily recognize and understand how to select such genes for modification in accordance with the present disclosure. In some embodiments, such modifications to engineered strains of Saccharomyces yeast reduce the immunogenicity of the engineered strain of Saccharomyces yeast and / or increase expression of a therapeutic polypeptide(s).
[0116] In some embodiments, the modification of a gene associated with a metabolic pathway comprises a modification to a threonine biosynthetic gene. In some such embodiments, the threonine biosynthetic gene is thr1. Modification of thr1, an upstream enzyme in the threonine biosynthetic pathway, can cause serum sensitivity when immunocompromised individuals are exposed to Saccharomyces yeast. Without wishing to be bound by any theory, it is understood that this sensitivity is due to the accumulation of the toxic intermediate molecule homoserine when cells are exposed to a low-threonine environment, such as serum, resulting in controlled (e.g., reduced) cell growth and thus the production of safer biological therapeutics relative to an appropriate reference standard (e.g., Saccharomyces yeast without modified thr1). In some embodiments, the engineered strain of Saccharomyces yeast comprises a mutation in thr1. In some embodiments, the engineered strain of Saccharomyces yeast comprises a deletion in thr1. In some embodiments, the engineered strain of Saccharomyces yeast comprises an insertion in thr1.
[0117] In some embodiments, the threonine biosynthetic gene is thr4. The Thr4 enzyme is immediately downstream of Thr1 in the threonine biosynthetic pathway and phosphorylates homoserine. A thr4 null strain of Saccharomyces yeast exhibits a similar phenotype to thr1 null cells. Without wishing to be bound by any theory, it is understood that the similar phenotype is the result of the toxic intermediate phosphohomoserine. In some embodiments, the engineered strain of Saccharomyces yeast comprises a mutation in thr4. In some embodiments, the engineered strain of Saccharomyces yeast comprises a deletion in thr4. In some embodiments, the engineered strain of Saccharomyces yeast comprises an insertion in thr4.
[0118] In some embodiments, the modification of a gene associated with a metabolic pathway comprises modification of the ura3 gene. As discussed above, ura3 encodes orotidine 5'-phosphate decarboxylase (ODCase), an enzyme that catalyzes one reaction in the synthesis of pyrimidine ribonucleotides (the building blocks of RNA). Without wishing to be bound by any theory, loss of ODCase activity causes a lack of cell growth unless uracil or uridine is added to the medium. In some embodiments, modification of the ura3 gene results in control (e.g., reduction) of cell growth relative to an appropriate reference standard (e.g., Saccharomyces yeast without a modified ura3 gene), resulting in the production of a safer biological therapeutic. In some embodiments, the engineered strain of Saccharomyces yeast comprises a mutation in ura3. In some embodiments, the engineered strain of Saccharomyces yeast comprises a deletion in ura3. In some embodiments, the engineered strain of Saccharomyces yeast comprises an insertion in ura3.
[0119] In some embodiments, the modification of a gene associated with a metabolic pathway comprises modification of the gap1 gene. As described above, gap1 encodes a general amino acid permease involved in the uptake of all naturally occurring L-amino acids, related compounds such as ornithine and citrulline, and some D-amino acids, toxic amino acid analogs such as azetidine-2-carboxylate, and the polyamines putrescine and spermidine. Without wishing to be bound by any theory, reduced uptake can cause a lack of cell growth. In some embodiments, modification of the gap1 gene results in controlled (e.g., reduced) cell growth relative to an appropriate reference standard (e.g., Saccharomyces yeast without a modified gap1 gene), resulting in the production of safer biological therapeutics. In some embodiments, the engineered strain of Saccharomyces yeast comprises a mutation in gap1. In some embodiments, the engineered strain of Saccharomyces yeast comprises a deletion in gap1. In some embodiments, the engineered strain of Saccharomyces yeast comprises an insertion of gap1.
[0120] Generation of yeast strains / expression systems In practicing the methods of the present invention, many conventional techniques in molecular biology, protein biochemistry, cell biology, microbiology, and recombinant DNA are used. For example, Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition, Ausubel et al. eds. (2007) Current Protocols in Molecular Biology series, Methods in Enzymology series (Academic Press, Inc., NY), MacPherson et al. (1991) PCR 1:A Practical Approach (IRL Press at Oxford University Press), MacPherson et al. al. (1995) PCR 2: A Practical Approach, Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual, Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition, Gait ed. (1984) Oligonucleotide Synthesis, U.S. Patent No. 4,683,195, Hames and Higgins eds.(1984)Nucleic Acid Hybridization, Anderson (1999) Nucleic Acid Hybridization, Hames and Higgins eds. (1984) Transcription and Translation, Immobilized Cells and Enzymes (IRL Press (1986)), Perbal (1984) A Practical Guide to Molecular Cloning, Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory), Makrides ed.See (2003) Gene Transfer and Expression in Mammalian Cells, Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London), and Herzenberg et al. eds. (1996) Weir's Handbook of Experimental Immunology.
[0121] In some embodiments, the disclosure provides techniques for generating and / or producing engineered strains of Saccharomyces yeast (e.g., engineered strains of Saccharomyces yeast produced according to the disclosure). In some such embodiments, the use of PCR to amplify sequences (e.g., ORFs of GOIs and sequences encoding selectable markers) may result in high copy insertions. In some embodiments, the generation and / or production of engineered strains of Saccharomyces yeast includes yeast codon optimization of the gene of interest (GOI). In some such embodiments, the GOI is produced, for example, using synthesis and / or polymerase chain reaction (PCR). In some embodiments, E. coli is transformed with the GOI and transformants are evaluated, for example, by diagnostic digestion and / or sequencing. In some embodiments, an expression cassette containing the GOI (e.g., a plasmid) is evaluated by PCR and gel electrophoresis (e.g., a DNA gel) to confirm the expression cassette by size. In some embodiments, the purified expression cassette is electroporated into Saccharomyces yeast (e.g., FZMAY06-16) and plated for selection. In some embodiments, the expression cassette is inserted into the genome of the Saccharomyces yeast (e.g., to improve stability). In some embodiments, supernatants from positive transformants are evaluated for acute expression of the therapeutic polypeptide(s) encoded by the GOI in the supernatant, e.g., by ELISA. In some embodiments, one or more (e.g., 2, 3, 4) rounds of clone screening are completed to verify the desired expression levels and purity of the clones. In some embodiments, cell banks (CBs) are generated from the desired clones and further evaluated for CB characterization.
[0122] In some embodiments, the disclosure provides techniques for evaluation of engineered strains of Saccharomyces yeast (e.g., engineered strains of Saccharomyces yeast produced according to the disclosure). In some embodiments, engineered strains of Saccharomyces yeast are evaluated for one or more of expression levels (e.g., by ELISA, Western blot), growth phenotype, growth curve, stability (e.g., by ELISA), genotype confirmation, genomic site-specific insertion (e.g., by polymerase chain reaction, PCR), genomic gene of interest inserted (GOI) cassette (e.g., by PCR), copy number of insertion, functional activity, antibiotic and / or antifungal susceptibility, gastrointestinal environment survival, efficacy (e.g., in animal models), pharmacokinetics (e.g., in vivo), GOI expression in feces / gastrointestinal track (e.g., in vivo), and / or potency (e.g., CFU identity, % positive expression).
[0123] Several methods relating to the modification, expression systems, and / or growth techniques of Saccharomyces yeast are known in the art, and one of skill in the art will readily recognize and understand how to select and use such methods in accordance with the present disclosure.
[0124] The following table provides details of specific embodiments of yeast strains that can be utilized in various ways for the purposes of the disclosed technology. [Table 2]
[0125] Therapeutic Polypeptide(s) The present disclosure provides therapeutic polypeptide(s) and engineered strains of Saccharomyces yeast that express such therapeutic polypeptide(s). In some embodiments, the engineered strains of Saccharomyces yeast comprise one or more nucleic acids encoding one or more therapeutic polypeptides. In some embodiments, the therapeutic polypeptide(s) are synthesized in the gastrointestinal tract of a subject (e.g., expressed from an engineered strain of Saccharomyces yeast that comprises a nucleic acid encoding one or more therapeutic polypeptides). The engineered yeasts of the present disclosure may have more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) copies of a gene of interest that encodes a therapeutic polypeptide integrated into their genome.
[0126] In some embodiments, the therapeutic polypeptide(s) is or includes a polymeric chain of amino acids that elicits a therapeutic effect (e.g., a result of medical treatment, the result of which is determined to be desirable and / or beneficial).
[0127] In some embodiments, the therapeutic polypeptide(s) comprise a naturally occurring amino acid sequence. In some embodiments, the therapeutic polypeptide(s) comprise a non-naturally occurring amino acid sequence. In some embodiments, the therapeutic polypeptide(s) comprise an amino acid sequence that is engineered in that it is designed and / or produced by the action of the hand of man. In some embodiments, the therapeutic polypeptide(s) may comprise or consist of natural amino acids, unnatural amino acids, or both. In some embodiments, the therapeutic polypeptide(s) may comprise or consist of only natural amino acids or only unnatural amino acids. In some embodiments, the therapeutic polypeptide(s) may comprise D-amino acids, L-amino acids, or both. In some embodiments, the therapeutic polypeptide(s) may comprise only D-amino acids. In some embodiments, the therapeutic polypeptide(s) may comprise only L-amino acids. In some embodiments, the therapeutic polypeptide(s) may include one or more pendant groups or other modifications, such as modifications or attachments to one or more amino acid side chains at the N-terminus of the therapeutic polypeptide(s), at the C-terminus of the therapeutic polypeptide(s), or any combination thereof. In some embodiments, such pendant groups or modifications may be selected from the group consisting of acetylation, amidation, lipidation, methylation, pegylation, etc., including combinations thereof. In some embodiments, the therapeutic polypeptide(s) may be cyclic and / or include a cyclic moiety. In some embodiments, the therapeutic polypeptide(s) is not cyclic and / or does not include any cyclic moiety. In some embodiments, the therapeutic polypeptide(s) is linear. In some embodiments, the therapeutic polypeptide(s) may be or include a stapled therapeutic polypeptide(s).In some embodiments, the term "polypeptide(s)" may be associated with the name of a reference polypeptide, activity, or structure, and in such cases is used herein to refer to polypeptides that share a related activity or structure, and therefore can be considered to be members of the same class or family of polypeptides.
[0128] In some embodiments, the therapeutic polypeptide(s) are monomeric. In some embodiments, the therapeutic polypeptide(s) are dimeric. In some embodiments, the therapeutic polypeptide(s) are multimeric. In some embodiments, the therapeutic polypeptide(s) are fusion polypeptides.
[0129] In some embodiments, the therapeutic polypeptide(s) is or includes a receptor, a cytokine, a chemokine, a hormone, an enzyme, an antimicrobial peptide, and / or any non-naturally occurring functional protein (such as a DARPin).
[0130] In some embodiments, the therapeutic polypeptide(s) is or comprises an antibody or a functional fragment thereof. In some embodiments, the antibody is a monoclonal antibody (e.g., an IgA, IgG, IgE, or IgM antibody). In some embodiments, the antibody is or comprises a bispecific antibody. In some embodiments, the antibody is or comprises a multispecific antibody. In some embodiments, the antibody is a human antibody, a humanized antibody, a chimeric antibody, a reverse chimeric antibody, an antibody with a light chain variable gene segment on its heavy chain, an antibody with a heavy chain variable gene segment on its light chain, as well as single chain Fv (scFv), single chain antibody, Fab fragment, F(ab') fragment, disulfide-linked Fv (sdFv), intrabody, minibody, diabody, and anti-idiotypic (anti-Id) antibody (including, for example, an anti-Id antibody against an antigen-specific TCR), or an epitope-binding fragment of any of the foregoing. Thus, "antigen-binding fragments" and "antigen-binding portions" and "epitope-binding fragments" of antigen-binding molecules are also encompassed herein and refer to fragments that retain the ability to bind to an antigen. The term "antigen-binding protein" also includes, for example, single domain antibodies (e.g., VHH antibodies or "camelid-like" antibodies), heavy chain-only antibodies, covalent diabodies, such as those disclosed in U.S. Patent Application Publication No. 2007 / 0004909, which is incorporated herein by reference in its entirety, and Ig-DARTS, such as those disclosed in U.S. Patent Application Publication No. 2009 / 0060910, which is incorporated herein by reference in its entirety. In some particular embodiments, the antibody is a canonical antibody comprising at least two heavy (H) chains and two light (L) chains (e.g., interconnected by disulfide bonds).
[0131] In some embodiments, antibodies include, for example, antibody mimetics or portions of antibodies that mimic the structure and / or function of an antibody or a particular fragment or portion thereof, including single chain antibodies and fragments thereof, and their digest fragments, particular parts, derivatives, and / or variants. There are five main heavy chain classes (or isotypes) that determine the functional activity of antibody molecules: IgM, IgD, IgG, IgA, and IgE. Each heavy and light chain contains a constant region and a variable region (also known as a "domain"). In combination, the heavy and light chain variable regions, also called "Fab regions", specifically bind to a given antigen. The light and heavy chain variable regions contain a "framework" region interrupted by three hypervariable regions, also called "complementarity determining regions" or "CDRs". The extent of the framework regions and CDRs has been defined (see, for example, Kabat et al., Sequences of Proteins of Immunological Interest, USDepartment of Health and Human Services, 1991). The Kabat database is currently maintained online. The sequences of the framework regions of different light or heavy chains are relatively conserved within a species, and the framework regions act to form a scaffold that provides for the correct orientation of the CDRs through non-covalent interactions between the chains.
[0132] Antibody CDRs are primarily responsible for binding to epitopes on antigens. The CDRs of each chain are typically referred to as CDR1, CDR2, and CDR3, are numbered sequentially starting from the N-terminus, and are also typically identified by the chain in which the particular CDR is located. Thus, HCDR3 is located in the variable domain of the heavy chain of the antibody in which it is found, while LCDR1 is the CDR1 from the variable domain of the light chain of the antibody in which it is found. Antibodies that bind to IL-3 IRA have specific VH and VL region sequences and therefore specific CDR sequences. Antibodies with different specificities generally have different CDRs. Although the CDRs vary from antibody to antibody, only a limited number of amino acid positions within the CDRs are directly involved in antigen binding. These positions within the CDRs are called specificity determining residues (SDRs).
[0133] The antibody Fc fragment region (Fc) plays a role in regulating immune cell activity. The Fc region functions to ensure that each antibody generates an appropriate immune response to a given antigen by binding to a specific class of proteins or polypeptides found on specific cells, such as B lymphocytes, follicular dendritic cells, natural killer cells, macrophages, and neutrophils, called "Fc receptors." The class of heavy chains in an antibody determines the effect of those classes, since the constant domains of the heavy chains constitute the Fc region of the antibody. Heavy chains in antibodies include alpha, gamma, delta, epsilon, and mu, which correlate with the antibody isotypes IgA, IgG, IgD, IgE, and IgM, respectively. Thus, different isotypes of antibodies have different types of effects due to the binding of their different Fc regions and the activation of different types of receptors. Exemplary Fc sequences are shown in Table 2. [Table 3]
[0134] South American camelids (e.g., alpacas and llamas) produce two isotypes of immunoglobulins, IgG2 and IgG3, called heavy chain antibodies or HCAbs because they lack light chains. The VH domain of HCAbs, called VHHs, is a single domain and is the smallest known antigen binder (approximately 15 kDa). VHHs are easy to express using microorganisms, including yeast, and are generally more stable than traditional antibody fragments. Due to the many favorable properties of VHHs, they have become widely used in research and show clear commercial potential. In some embodiments, the antibodies of the present disclosure are or include VHH-Fc antibodies (e.g., one or more VHHs derived from camelid heavy chain-only antibodies fused to an Fc domain, such as IgG, IgA, etc.). In some such embodiments, the VHH-Fc antibodies are or include a single VHH fused to an Fc region. In some such embodiments, the VHH-Fc antibody is or comprises two VHHs fused to an Fc region (e.g., VHH-VHH-Fc, Fc-VHH-VHH, VHH-Fc-VHH). In some embodiments, the two VHHs may be fused together without an Fc region. In some embodiments, the two VHHs may be fused together with another VHH to form a trimer or tetramer. In some such embodiments, the two VHHs are the same. In some such embodiments, the two VHHs are different. In some embodiments, the biological activity between the VHH-VHH-Fc, Fc-VHH-VHH, and VHH-Fc-VHH formats is similar. In some embodiments, the biological activity between the VHH-VHH-Fc, Fc-VHH-VHH, and VHH-Fc-VHH formats is different. In some embodiments, a particular format results in higher expression. In some embodiments, the selectable marker does not affect the overall screening or expression of the antibody.In summary, the present disclosure provides binding protein / polypeptide formats including, but not limited to, VHH, Fc-VHH, VHH-Fc, VHH-VHH, Fc-VHH-VHH, VHH-Fc-VHH, and VHH-VHH-Fc, where each or either of the domains (i.e., VHH or Fc) may be connected to another domain via an optional linker sequence.
[0135] In some embodiments, the therapeutic polypeptide(s) of the present disclosure further comprise a tag (e.g., an HA tag, a His tag, a FLAG-tag, etc.) Several tags are known in the art, and one of ordinary skill in the art will readily recognize and understand how to utilize such tags in accordance with the present disclosure.
[0136] In some embodiments, the therapeutic polypeptide(s) of the present disclosure further comprises a linker. In some such embodiments, the linker is a polypeptide linker. Several linkers are known in the art, and one of ordinary skill in the art will readily recognize and understand how to utilize such linkers in accordance with the present disclosure.
[0137] In some embodiments, the therapeutic polypeptide(s) of the present disclosure further comprises an aprotinin polypeptide. Exemplary aprotinin sequences are shown in Table 3. [Table 4]
[0138] In some embodiments, the therapeutic polypeptide(s) of the present disclosure are expressed from a recombinant expression vector. Expression vectors are generally derived from plasmid or viral DNA, or may contain elements of both. Thus, an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, phage, recombinant virus, or other vector, that upon introduction into a suitable host cell results in expression of the cloned DNA. Suitable expression vectors are well known to those skilled in the art and include those that are replicable in eukaryotic and / or prokaryotic cells, as well as those that remain episomal or that integrate into the host cell genome (e.g., engineered strains of Saccharomyces yeast) (see, e.g., Chen et al., Sci Transl.Med 2020).
[0139] In some embodiments, an expression vector is one into which a nucleic acid containing a desired DNA sequence (e.g., a DNA sequence encoding a therapeutic polypeptide(s) (GOI)) may be inserted by restriction and ligation such that it is operably linked to regulatory sequences and may be expressed as an RNA transcript. In some embodiments, a vector may further include one or more marker sequences (e.g., those described elsewhere herein) suitable for use in identifying cells that have or have not been transformed or transfected with the vector. Additional exemplary markers include, for example, genes encoding proteins or polypeptides that increase or decrease either resistance or sensitivity to antibiotics or other compounds, genes encoding enzymes whose activities are detectable by standard assays known in the art (e.g., β-galactosidase, luciferase, or alkaline phosphatase), and genes that clearly affect the phenotype of transformed or transfected cells, hosts, colonies, or plaques (e.g., green fluorescent protein).
[0140] As used herein, a coding sequence and a nucleic acid regulatory sequence are said to be "operably linked" when they are covalently linked in such a manner that the expression or transcription of the coding sequence is under the influence or control of the regulatory sequence. In some embodiments, two DNA sequences are said to be operably linked if it is desired that the coding sequence be translated into a functional polypeptide (e.g., a therapeutic polypeptide(s)), if induction of a promoter in the 5' regulatory sequence results in transcription of the coding sequence, and if the nature of the linkage between the two DNA sequences (1) does not result in the introduction of a frameshift mutation, (2) interferes with the ability of the promoter region to direct the transcription of the coding sequence, or (3) interferes with the ability of the corresponding RNA transcript to be translated into a polypeptide (e.g., a therapeutic polypeptide(s)). Thus, a promoter region would be operably linked to a coding sequence if it is capable of affecting the transcription of that DNA sequence and the resulting transcript can be translated into a desired protein or polypeptide (e.g., a therapeutic polypeptide(s)).
[0141] In some embodiments, when a nucleic acid encoding a therapeutic polypeptide of the present disclosure is expressed in a cell (e.g., Saccharomyces yeast), various transcription control sequences (e.g., promoters, enhancer sequences) can be used to direct its expression. The promoter may be a native promoter, i.e., the promoter of the gene in its endogenous context that provides normal regulation of expression of the gene. In some embodiments, the promoter may be a constitutive promoter, including, for example, pADH1, pADH2, pHXT7, pHXT4, pHXT2, pPKG1, pPYK1, pTPL1, pSED1a, pSED1b, pJEN1, where the promoter is unregulated to allow continuous transcription of its associated nucleic acid (e.g., a nucleic acid encoding a therapeutic polypeptide(s)). In some embodiments, the promoter may be an inducible promoter, including, for example, pICL1, pMAL62, pGUT1, pFBP1, pSUC2, pCUP1, pHGT9, pHGT10, pHGT12, pHGT17, pPCK1. In some embodiments, an inducible promoter is active in the presence or absence of a chemical or under some conditions. Non-limiting examples of promoters include pTDH3 and pTEF. Various conditional promoters, e.g., promoters controlled by the presence or absence of a molecule, can also be used. In some embodiments, the nucleic acid encoding the therapeutic polypeptide(s) is inserted into the endogenous promoter region of the host cell (e.g., an engineered strain of Saccharomyces yeast). In some such embodiments, the insertion into the endogenous promoter region results in better expression and / or less stress on the host relative to an appropriate reference standard (e.g., an engineered strain of Saccharomyces yeast in which an exogenous promoter is included in the nucleic acid encoding the therapeutic polypeptide(s).
[0142] In some embodiments, regulatory sequences required for gene expression may vary between species or cell types, but generally must include, as appropriate, 5' non-transcribed and 5' non-translated sequences involved in initiation of transcription and translation, respectively, such as the TATA box, capping sequence, CAAT sequence, etc. In particular, such 5' non-transcribed regulatory sequences include a promoter region that includes a promoter sequence for transcriptional control of an operably linked nucleic acid.
[0143] In some embodiments, the regulatory sequences include enhancer sequences or upstream activator sequences, if desired. The selection and design of appropriate vectors is understood in the art. Those of ordinary skill in the art will readily recognize and understand how to select and use such vectors following the teachings of this disclosure.
[0144] Expression vectors containing all the elements necessary for expression are commercially available and known to those skilled in the art. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Fourth Edition, Cold Spring Harbor Laboratory Press, 2012. In some embodiments, cells are engineered by the introduction of heterologous DNA (RNA) into the cells. The heterologous DNA (RNA) is placed under the operational control of transcriptional elements to allow expression of the heterologous DNA in the host cell (e.g., an engineered strain of Saccharomyces yeast). As will be readily understood by those skilled in the art, the therapeutic polypeptide(s) described herein can also be expressed in other cell types.
[0145] Nucleic acid molecules encoding the therapeutic polypeptide(s) of the disclosure can be introduced into a cell or cells using methods and techniques standard in the art. For example, the nucleic acid molecules can be introduced by standard protocols such as transformation, including chemical conversion, and electroporation, transduction, particle bombardment, etc. Expressing a nucleic acid molecule encoding a therapeutic polypeptide(s) of the disclosure can also be achieved by integrating the nucleic acid molecule into a genome. Integration of a nucleic acid (e.g., encoding a therapeutic polypeptide(s) described herein) can be achieved either by integration of the new nucleic acid into the genome of a yeast cell (e.g., an engineered strain of Saccharomyces yeast) or by transient or stable maintenance of the new nucleic acid as an episomal element. In some embodiments, in eukaryotic cells, permanent, heritable genetic changes are generally achieved by introducing a nucleic acid into the genome of the cell.
[0146] Antitoxin ABAB In some embodiments, the therapeutic polypeptide(s) of the disclosure is or comprises an antitoxin (antitoxin ABAB) against toxin A (also referred to as TcdA) and / or toxin B (also referred to as TcdB) produced by C. difficile.
[0147] In some embodiments, the anti-toxin ABAB is or comprises an antibody, or a functional fragment thereof, against TcdA, TcdB, or a combination thereof.
[0148] In some embodiments, the antitoxin against C. difficile toxin A and / or toxin B is or comprises a tetraspecific VHH fusion polypeptide. In some such embodiments, the tetraspecific VHH fusion polypeptide comprises four unique toxin-neutralizing VHHs, two against toxin A and two against toxin B. In some such embodiments, the tetraspecific VHH fusion polypeptide is fused to an Fc fragment (e.g., a human IgG1 Fc fragment).
[0149] In some embodiments, the engineered strain of Saccharomyces yeast expresses the antitoxin ABAB.
[0150] Exemplary antitoxin ABAB sequences are summarized in Table 4. [Table 5]
[0151] anti-TNF-α In some embodiments, the therapeutic polypeptide(s) of the present disclosure is or comprises an antibody against TNF-α. Exemplary sequences of antibodies against TNF-α are summarized in Table 5.
[0152] In some embodiments, engineered strains of Saccharomyces yeast express an antibody to TNF-α (e.g., FZ006). In some embodiments, engineered strains of Saccharomyces yeast express an antibody to TNF-α and the antitoxin ABAB (e.g., FZ020). [Table 6]
[0153] anti-IL-17A In some embodiments, the therapeutic polypeptide(s) of the present disclosure is or comprises an antibody to IL-17A. Exemplary sequences of antibodies to IL-17A are summarized in Table 6.
[0154] In some embodiments, an engineered strain of Saccharomyces yeast expresses an antibody against IL-17A (eg, FZ004). [Table 7]
[0155] A bispecific antibody against hIL-17A and TNF-α In some embodiments, the therapeutic polypeptide(s) of the disclosure are or comprise a bispecific antibody. In some embodiments, engineered strains of Saccharomyces yeast efficiently secrete functional bispecific neutralizing antibodies. In some such embodiments, the antibody format comprises two fused anti-cytokine single domain antibodies, or VHH, either at both the N-terminus and C-terminus of human IgG1 Fc, or only at the N-terminus (VHH-Fc-VHH and VHH-VHH-Fc). In some embodiments, the functional bispecific antibody is or comprises a bispecific antibody against IL-17 and TNF-α. In some embodiments, different promoters drive the different expression of anti-TNFα / IL-17A bispecific antibody genes.
[0156] In some embodiments, an engineered strain of Saccharomyces yeast expresses a bispecific antibody against IL-17A and TNF-α (eg, FZ008).
[0157] Exemplary sequences of bispecific antibodies against IL-17A and TNF-α are summarized in Table 7. [Table 8]
[0158] IL-22 In some embodiments, the therapeutic polypeptide(s) of the disclosure is or comprises an IL-22 polypeptide (e.g., a functional IL-22 polypeptide). Exemplary sequences of IL-22 polypeptides are summarized in Table 8.
[0159] In some embodiments, engineered strains of Saccharomyces yeast disclosed herein express an IL-22 polypeptide (e.g., FZ010). In some such embodiments, the IL-22 polypeptide is linked to an Fc domain. In some embodiments, engineered strains of Saccharomyces yeast disclosed herein express an IL-22 polypeptide and a bispecific antibody against IL-17A and TNF-α (e.g., FZ012). [Table 9]
[0160] Anti-rotavirus VHH In some embodiments, the therapeutic polypeptide(s) of the disclosure is or comprises an anti-rotavirus VHH (e.g., anti-rotavirus VHH, 2KD1). In some embodiments, the anti-rotavirus VHH is fused to aprotinin. Aprotinin is a single-chain polypeptide isolated from bovine lung that has antifibrinolytic and anti-inflammatory activity. As a broad-spectrum serine protease inhibitor, bovine aprotinin competitively and reversibly inhibits the activity of several different esterases and proteases, including trypsin, chymotrypsin, kallikrein, plasmin, tissue plasminogen activator, and tissue and leukocyte proteinases, attenuating the systemic inflammatory response (SIR), fibrinolysis, and thrombin generation. This agent also inhibits pro-inflammatory cytokine release and maintains glycoprotein homeostasis. Without wishing to be bound by any theory, fusion of aprotinin to an anti-rotavirus VHH (e.g., 2KD1) may reduce or eliminate digestion of the anti-rotavirus VHH (e.g., anti-rotavirus VHH, 2KD1) in the gastrointestinal tract and / or reduce inflammation.
[0161] In some embodiments, the engineered strains of Saccharomyces yeast disclosed herein express an anti-rotavirus VHH (eg, FZ014).
[0162] Exemplary sequences of anti-rotavirus VHH polypeptides are summarized in Table 9. [Table 10]
[0163] Monospecific and bispecific VHH-Fc against norovirus In some embodiments, the therapeutic polypeptide(s) of the disclosure is or comprises a monospecific or bispecific VHH-Fc against Norovirus (e.g., M6M5-Fc and M6M4-Fc). In some such embodiments, the VHH against Norovirus further comprises a tag (e.g., an HA tag).
[0164] In some embodiments, engineered strains of Saccharomyces yeast disclosed herein express a bispecific VHH-Fc (e.g., M6M5-Fc and M6M4-Fc) against Norovirus (e.g., FZ016). In some embodiments, engineered strains of Saccharomyces yeast disclosed herein express a monospecific VHH-Fc against Norovirus (e.g., FZ016c). In some embodiments, engineered strains of Saccharomyces yeast disclosed herein express a bispecific VHH-Fc against Norovirus and antitoxin ABAB (e.g., FZ018).
[0165] Exemplary sequences of bispecific or monospecific VHH-Fc against Norovirus are summarized in Table 10. [Table 11]
[0166] GLP-1 In some embodiments, the therapeutic polypeptide(s) of the present disclosure is or comprises a GLP-1 polypeptide (e.g., a functional GLP-1 polypeptide). Exemplary sequences of GLP-1 polypeptides are summarized in Table 11.
[0167] In some embodiments, an engineered strain of Saccharomyces yeast disclosed herein expresses a GLP-1 polypeptide (e.g., a functional GLP-1 polypeptide, a human functional GLP-1 polypeptide) (e.g., FZ022). [Table 12]
[0168] Leptin In some embodiments, the therapeutic polypeptide(s) of the present disclosure is or comprises a leptin polypeptide. (E.g., a functional leptin polypeptide.) Exemplary sequences of leptin polypeptides are summarized in Table 12. In some such embodiments, the leptin polypeptide further comprises a tag (e.g., an HA tag).
[0169] In some embodiments, engineered strains of Saccharomyces yeast disclosed herein express a leptin polypeptide (e.g., a functional leptin polypeptide, a human functional leptin polypeptide) (e.g., FZ024). [Table 13]
[0170] Anti-human TNF-α IgG1 In some embodiments, the therapeutic polypeptide(s) of the disclosure is or comprises an anti-TNF-α IgG1. In some such embodiments, the anti-TNF-α IgG1 comprises Humira. In some such embodiments, the anti-TNF-α IgG1 comprises adalimumab. Exemplary sequences of anti-TNF-α IgG1 are summarized in Table 13.
[0171] In some embodiments, an engineered strain of Saccharomyces yeast disclosed herein expresses an anti-TNF-α IgG1 (eg, FZ026). [Table 14]
[0172] VHH against cwp84 fused to the lysine domain In some embodiments, the therapeutic polypeptide(s) of the present disclosure is or comprises a VHH against cwp84 fused to a lysine domain. Exemplary sequences of VHH against cwp84 fused to a lysine domain are summarized in Table 14.
[0173] In some embodiments, engineered strains of Saccharomyces yeast disclosed herein express a VHH against cwp84 fused to a lysine domain (eg, FZ028). [Table 15]
[0174] IL-10 In some embodiments, the therapeutic polypeptide(s) of the disclosure is or comprises an IL-10 polypeptide. (E.g., a functional IL-10 polypeptide.) Exemplary sequences of IL-10 polypeptides are summarized in Table 15.
[0175] In some embodiments, an engineered strain of Saccharomyces yeast disclosed herein expresses an IL-10 polypeptide (e.g., a functional IL-10 polypeptide, a human functional leptin polypeptide) (e.g., FZ030). [Table 16]
[0176] Table 16 summarizes the structures and sequences of exemplary therapeutic polypeptide(s) of the disclosure. [Table 17]
[0177] use The present disclosure provides, inter alia, engineered strains of Saccharomyces yeast having therapeutic or clinical utility, compositions comprising same, and methods of treating various diseases and conditions using same. Methods of administering engineered strains of Saccharomyces yeast and / or compositions thereof to a subject in need thereof are also described herein. In some embodiments, the subject may have an inflammatory bowel disease, such as, for example, Crohn's disease, ulcerative colitis, or another inflammatory bowel disease, or may have an immune-related condition, or liver disease, graft-versus-host disease, diabetes, obesity, neurodegenerative disease, pain, stroke, cardiovascular disease, infectious disease, autoimmune disease, colon cancer, and other gastrointestinal malignancies, or dysbiosis affecting the skin, mouth, gastrointestinal tract, vagina, or another organ. Other compositions, compounds, methods, features, and advantages of the present disclosure will be, or will become, apparent to one of skill in the art upon review of the following figures, detailed description, and examples. All such additional compositions, compounds, methods, features, and advantages are intended to be included in this description and within the scope of the present disclosure.
[0178] Also disclosed herein are methods of treating (e.g., including treatment during remission to minimize symptoms) or preventing (e.g., prevention of relapse, including maintenance treatment) diseases, disorders, and / or conditions associated with inflammation in a subject. In some embodiments, the method comprises administering to a subject in need thereof a therapeutically effective amount of an engineered strain of Saccharomyces yeast described herein and / or a disclosed pharmaceutical composition described herein. In some embodiments, the subject can be a vertebrate, such as, for example, a human, dog, cat, horse, cow, pig, sheep, goat, rabbit, chicken, or turkey. In some embodiments, the mammal is a human. In some embodiments, the disease is associated with inflammation. In some embodiments, the disease can be, for example, ulcerative colitis, Crohn's disease, another inflammatory bowel disease, colon cancer, diabetes, obesity, eczema, bacterial vaginosis, vaginal yeast infection, Alzheimer's disease, stress, depression, anxiety, bipolar disorder, neurodegenerative disease, pain, stroke, cardiovascular disease, infectious disease, autoimmune disease, or any combination thereof.
[0179] In some aspects, the subject has a disease associated with inflammation, and treatment with an engineered strain of Saccharomyces yeast described herein is considered therapeutic. In other aspects, the subject is at risk for a disease associated with inflammation (e.g., an immune-related condition), and treatment with an engineered strain of Saccharomyces yeast is considered prophylactic. In some embodiments, the engineered strain of Saccharomyces yeast has an additional probiotic effect, such as that associated with a wild-type (e.g., non-engineered or parent) strain of Saccharomyces yeast, including, for example, S. boulardii. In some aspects, the treatment reduces at least one symptom of the subject's inflammation-associated disease, disorder, and / or condition relative to the subject's symptoms prior to treatment. In another aspect, the symptom can be, for example, one or more of diarrhea, fever, fatigue, weight loss, blood in the stool, abdominal cramps, abdominal pain, loss of appetite, intestinal damage, rash, itchiness, stomatitis, or any combination thereof.
[0180] Also disclosed herein is a method of treating or preventing a disease associated with inflammation in a subject, the method comprising administering to the subject a therapeutically effective amount of an engineered strain of Saccharomyces yeast described herein, and / or a pharmaceutical composition disclosed to the subject. In another aspect, the subject may be a mammal and the disease may be associated with inflammation.In one aspect, the disease is ulcerative colitis, Crohn's disease, celiac disease, irritable bowel syndrome (IBS), colitis induced by C. difficile or another bacterium or virus, or by T cell transfer, or by dextran sulfate sodium (DSS), another inflammatory bowel disease, including but not limited to rotavirus, norovirus, cytomegalovirus, herpes virus, enteric viruses, adenovirus, human papilloma virus, acute self-limiting colitis, bacterial enteritis, intestinal clostridium. diseases of the GI tract, mycobacterial infections of the GI tract, spirochetal infections of the GI tract, fungal infections of the GI tract, protozoal or helminthic infections of the GI tract, intestinal inflammation (e.g., chronic intestinal inflammation); cardiovascular disease, including but not limited to, coronary artery disease, peripheral artery disease, cerebrovascular disease, renal artery stenosis, aortic aneurysm, cardiomyopathy, hypertensive heart disease, heart failure, pulmonary heart disease, arrhythmias, endocarditis, inflammatory cardiac hypertrophy, myocarditis, valvular heart disease, congenital heart disease, rheumatic heart disease; cancer, e.g., esophageal cancer, gastric cancer, rectal cancer, small intestinal cancer, gastrointestinal stromal cancer, tumors, nasopharyngeal cancer, colon cancer, or other gastrointestinal cancer, diabetes mellitus (type 1 or type 2), hypoglycemia, hypercholesterolemia, or other metabolic disease, obesity, fatty liver disease, steatohepatitis, cirrhosis, liver cancer, eczema, psoriasis, hidradenitis suppurativa, skin ulcers, bacterial vaginosis, vaginal yeast infection, rotavirus, norovirus HIV-associated inflammation, rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, amyotrophic lateral sclerosis, systemic lupus erythematosus, food allergies, malabsorption, diarrhea, acid reflux (e.g., GERD), dysbiosis, diverticulitis, The subject may be suffering from sepsis, solid tumors, including but not limited to breast cancer, bladder cancer, head and neck squamous cell carcinoma, melanoma, neuroblastoma, lung cancer, ovarian cancer, non-small cell lung cancer, liquid tumors, including but not limited to lymphoma, large B-cell lymphoma, diffuse large B-cell lymphoma, acute myeloid leukemia, inflammation-associated aging, neurological diseases, including but not limited to Alzheimer's disease, depression, stress, anxiety, bipolar disorder, schizophrenia, multiple sclerosis, Parkinson's disease, stroke, or any combination thereof. In some embodiments, the subject has a disease associated with inflammation. In other embodiments, the subject is at risk for a disease associated with inflammation and an autoimmune disease.In some embodiments, the treatment reduces at least one symptom of the inflammation-related disease in the subject relative to the subject's symptoms before the treatment. In other embodiments, the symptom can be diarrhea, fever, fatigue, weight loss, blood in the stool, abdominal cramps, abdominal pain, loss of appetite, intestinal damage, rash, itching, stomatitis, or any combination thereof.
[0181] In some embodiments, a method of treating or preventing an inflammation-associated disease in a subject comprises administering to the subject a therapeutically effective amount of an engineered strain of Saccharomyces yeast described herein, or a composition comprising same (e.g., a pharmaceutical composition).
[0182] Clostridium Difficile infection (CDI) Clostridium difficile, or Clostridioides difficile (C. difficile), is a Gram-positive, spore-forming anaerobic bacillus that is widely distributed in the intestinal tract of humans and animals as well as in the environment. C. difficile spores are transmitted by the fecal-oral route, and the pathogen is widespread in the environment. Potential reservoirs of C. difficile include asymptomatic carriers, infected patients, contaminated environments, and animal intestinal tracts (dogs, cats, pigs, and birds). Approximately 5% of adults and 15-70% of infants are colonized with C. difficile, and the incidence of colonization is several times higher in hospitalized patients or residents of nursing homes (Czepiel J et al. Eur J Clin Microbiol Infect Dis. 2019;38(7):1211-1221).
[0183] Infection with C. difficile occurs largely as a result of spore transmission. Spores are resistant to heat, acid, and antibiotics. The main protective barrier against C. difficile infection (CDI) is the normal gut microbiota. After reaching the intestine, bile acids play an important role in inducing C. difficile spore germination. In vitro, primary bile acids (e.g., cholic acid and chenodeoxycholic acid) generally stimulate C. difficile spore germination, while secondary bile acids (e.g., deoxycholic acid and lithocholic acid) inhibit this process.
[0184] Once the gut microbial balance is upset, C. difficile takes over the large intestine and begins to colonize. This may be the first step of infection, without wishing to be bound by any theory. The pathogen is not invasive, and toxicity is understood to be mainly due to two major toxins, which damage the epithelial cell cytoskeleton, causing disruption of tight junctions, fluid secretion, neutrophil adhesion, and local inflammation, leading to the destruction of the integrity of the intestinal barrier and loss of function. Most important for the pathogenesis of C. difficile disease are toxins A and B, both of which are enterotoxic and cytotoxic, but traditionally toxin A is called "endotoxin A" (TcdA) and toxin B is called "cytotoxic B" (TcdB). C. difficile transferase (CDT, or binary toxin) is a third toxin produced by some C. difficile strains, including the epidemic PCR ribotype 027. The toxin is delivered to the cytoplasm where it inactivates the Rho family of GTPases. Rho proteins are involved in actin polymerization and thus stabilize the cytoskeleton. As a result of the inactivation of Rho proteins, the inflammatory process is intensified. In more severe cases, microcytosis covered with a pseudomembrane (composed of destroyed enterocytes, neutrophils, and fibrin) begins to develop on the intestinal mucosal surface.
[0185] In some embodiments, engineered strains of Saccharomyces yeast described herein are useful for treating and / or preventing CDI. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing CDI express anti-toxin ABABs described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing CDI include S. boulardii (e.g., FZ002) that express anti-toxin ABABs described herein.
[0186] In some embodiments, engineered strains of Saccharomyces yeast described herein are useful for treating and / or preventing CDI associated with inflammatory bowel disease (IBD). In some cases, CDI is associated with a worse clinical outcome in subjects diagnosed with or suffering from IBD. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing CDI associated with IBD express anti-TNFα and anti-toxin ABAB described herein (e.g., FZ020).
[0187] Inflammatory bowel disease (IBD) Inflammatory bowel disease (IBD) is characterized by chronic inflammation of the gastrointestinal tract and is understood to result from the interaction between genetic and environmental factors that affect the immune response. Ulcerative colitis (UC) and Crohn's disease (CD) are the major forms of IBD and are chronic and frequently relapsing illnesses characterized by bloody diarrhea and abdominal cramps that require long-term treatment, frequent hospitalizations, and even surgery. These diseases are characterized by dysregulation of the mucosal immune system and dysbiosis of the intestinal microflora. According to the Centers for Disease Control and Prevention (CDC), approximately 3.1 million (or 1.3%) American adults suffer from IBD, with direct treatment costs exceeding $7 billion annually. Despite significant efforts to develop therapeutics, hospitalization rates for these diseases in the United States have been steadily increasing over the past decades, with a significant increase in hospitalization rates from 44.2 to 59.7 per 100,000 in the 10-year period from 2003 to 2013. Furthermore, total hospitalization costs also continue to rise, causing significant economic losses to patients, insurance companies, and employers. Severe complications of IBD can be debilitating and ultimately lead to death.
[0188] The cause of inflammatory bowel disease is unclear. The pathogenesis of CD and UC most likely involves an interaction between genetic and environmental factors, such as bacterial factors, but no clear etiological factors have been identified so far. The leading theory is that an abnormal immune response, possibly driven by the gut microbiota, occurs in IBD. However, it is understood that T cells play a key role in the pathogenesis. Activated T cells can produce both anti-inflammatory and pro-inflammatory cytokines. One existing therapy involves systemic treatment with anti-TNF monoclonal antibodies. A single intravenous dose of cA2 infliximab antibody ranging from 5 to 20 mg / kg resulted in dramatic clinical improvement of active Crohn's disease. The use of systemically administered recombinant IL-10 in a 7-day treatment regimen using doses ranging from 0.5 to 25 μg / kg showed a decrease in Crohn's disease activity scores and an increase in remission. However, these strategies require systemic administration via injection of purified protein or polypeptide therapeutics, which is expensive and not convenient for patients. Existing strategies for UC management also involve the use of anti-inflammatory and immunosuppressive drugs, such as corticosteroids, which are often associated with systemic immunosuppression. However, up to 40% of patients do not respond to initial treatment. Of those who initially respond, 13%-46% of patients will relapse within the following year. Thus, current treatment options for UC are suboptimal, and novel therapies are needed.
[0189] TNF-α plays a key role in the pathogenesis of UC in both animal models and humans and is widely accepted as a therapeutic target for inflammatory disorders such as IBD. US Food and Drug Administration (FDA)-approved anti-TNF-α biologics, including infliximab, adalimumab, golimumab, and certolizumab pegol, have revolutionized therapy for a variety of chronic inflammatory disorders, including rheumatoid arthritis, psoriatic arthritis, ankylosing spondylitis, CD, and UC. All of these antibody therapeutics must be administered parenterally. Although systemically delivered anti-TNF-α biologics are highly effective, their long-term use is often associated with loss of efficacy due to anti-drug antibody responses and immunosuppressive side effects. IL-17A is the most extensively studied member of the IL-17 family. IL-17A plays a key role in host defense against a variety of microbial pathogens and tissue inflammation. IL-17A-producing CD4+ T helper cells (also called Th17 cells) have been extensively studied in the past decade and have been shown to be potent inducers of tissue inflammation and are associated with the pathogenesis of many experimental autoimmune diseases and human inflammatory conditions. Substantial evidence suggests that IL-17A-producing cells, including Th17 cells, are involved in human psoriasis, rheumatoid arthritis, multiple sclerosis, inflammatory bowel disease, and asthma. Anti-IL-17A is FDA approved for the treatment of psoriasis, and this pathway has also been investigated in asthma, rheumatoid arthritis, multiple sclerosis, transplant rejection, and inflammatory bowel disease.
[0190] Interleukin-22 (IL-22) is often described as a cytokine expressed by immune cells but acting exclusively on non-immune cells. Its role is best understood at so-called barrier surfaces such as the skin, lung, and intestine, where the effects of IL-22 ligation are typically accompanied by proliferation, regeneration, or activation of innate immune mechanisms. IL-22 can act synergistically with IL-17 and / or TNFα. In the intestine, IL-22 signaling promotes important functions including host defense against pathogens and wound healing. Intestinal recombinant IL-22 application may have beneficial effects on liver and pancreatic injury, ulcerative colitis, and graft-versus-host disease.
[0191] In some embodiments, engineered strains of Saccharomyces yeast described herein are useful for treating and / or preventing IBD (e.g., UC and CD). In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing IBD express an anti-TNFα as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing IBD include S. boulardii that express an anti-TNFα antibody as described herein (e.g., FZ006). In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing IBD express a bispecific antibody against IL-17A and TNF-α as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing IBD include S. boulardii that express a bispecific antibody against IL-17A and TNF-α as described herein (e.g., FZ008). In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing IBD express an IL-22 polypeptide as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing IBD include S. boulardii expressing IL-22 (e.g., FZ010). In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing IBD express IL-22 and a bispecific antibody against IL-17A and TNF-α as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing IBD include S. boulardii expressing IL-22 and a bispecific antibody against IL-17A and TNF-α (e.g., FZ012). In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing IBD express an anti-human TNF-α IgG1 as described herein.In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing IBD include S. boulardii expressing anti-human TNF-α IgG1 (eg, FZ026).
[0192] Intestinal inflammation and neurological disorders Intestinal inflammation is a contributing factor to many serious diseases and disorders, such as metabolic and neurological disorders, which significantly affect the quality of human life and cause substantial loss of function, morbidity, and even mortality.Recent studies have shown that chronic intestinal inflammation is a potential important factor in the initiation and development of neurodegenerative diseases, including, for example, depression, Parkinson's disease, and Alzheimer's disease.
[0193] Neurodegenerative diseases occur when neurons in the central nervous system (e.g., brain and spinal cord) or peripheral nervous system lose function and die over time. The risk of developing neurodegenerative diseases increases dramatically with age. Human life expectancy is increasing every year, meaning that more people will be affected by neurodegenerative diseases in the coming decades. One potential cause of neurodegenerative diseases that is becoming increasingly recognized is gut inflammation. The connection between the brain and the gut via the gut-brain axis is becoming more and more evident. One such connection between the brain and the gut begins with the enteric nervous system (ENS). The ENS contains two layers of hundreds of millions of nerve cells that line the gastrointestinal tract from the esophagus to the rectum and can cause emotional changes. There is evidence that stimuli from the gastrointestinal (GI) system can send signals to the central nervous system (CNS) via the ENS. Thus, gut inflammation can cause mood changes via the gut-brain axis. Interestingly, psychological disorders such as anxiety and depression are widespread in patients with irritable bowel syndrome (IBS). Thus, the treatment and / or prevention of intestinal inflammation may result in the treatment and / or prevention of neurodegenerative and / or neurological diseases.
[0194] For example, proinflammatory cytokines such as TNF-α and interleukin 17A (IL-17A) are important immune mediators that contribute to the pathogenesis of many inflammatory diseases, as well as chronic intestinal inflammation and immune-related conditions. Without wishing to be bound by any theory, the use of neutralizing antibodies that specifically bind to cytokines and block their interaction with receptors on immune cells, thus inhibiting downstream inflammatory pathways, may provide a means of controlling cytokine-mediated inflammation. Thus, in some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation and immune-related diseases (e.g., neurological diseases) express antibodies against proinflammatory cytokines, including, for example, bispecific antibodies against IL-17A and TNF-α and / or anti-TNF-α IgG1 described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation and / or immune-related conditions include S. boulardii expressing bispecific antibodies against IL-17A and TNF-α (e.g., FZ008). In some such embodiments, an engineered strain of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation comprises S. boulardii expressing an anti-TNF-α VHH (e.g., FZ006). In some such embodiments, an engineered strain of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation comprises S. boulardii expressing an anti-TNF-α IgG1 (e.g., FZ026). In some embodiments, an engineered strain of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation comprises S. boulardii expressing an anti-IL-17A antibody described herein (e.g., FZ004). In some embodiments, an engineered strain of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation comprises S. boulardii expressing an IL-10 as described herein (e.g., FZ030).
[0195] diabetes Diabetes mellitus is a chronic disease characterized by hyperglycemia. Impaired glucose tolerance and hyperglycemia are the primary clinical and diagnostic features of diabetes and are understood to be the result of absolute or relative insulin deficiency or resistance to its action. Diabetes-related chronic hyperglycemia can cause end-organ dysfunction and failure, which may include, for example, the retina, kidneys, nerves, and blood vessels.
[0196] Traditionally, the majority of diabetes cases are classified into two broad pathogenic categories: type 1 diabetes (T1D) and type 2 diabetes (T2D). However, in some subjects, this classification cannot be applied because other genetic, immunological, or neurointrinsic pathways are involved in the pathogenic mechanism. T1D is associated with a lack of insulin due, at least in part, to immune-mediated destruction of pancreatic beta-cells. T2D is the most common form of diabetes and is understood to result, at least in part, from insulin resistance. The emerging role of inflammation in the pathology of both T1D and T2D and associated metabolic disorders has led to increased interest in targeting inflammation to improve the prevention and control of both T1D and T2D.
[0197] In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing diabetes express a GLP-1 therapeutic polypeptide(s) described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing diabetes include S. boulardii (e.g., FZ022) that express a GLP-1 polypeptide (e.g., a human active GLP-1 therapeutic polypeptide(s)) described herein.
[0198] In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing diabetes express a leptin therapeutic polypeptide(s) described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing diabetes include S. boulardii (e.g., FZ024) that express a leptin polypeptide (e.g., a human active leptin therapeutic polypeptide(s) described herein).
[0199] In some embodiments, engineered strains of Saccharomyces yeast useful for the treatment and / or prevention of diabetes express an IL-22 therapeutic polypeptide(s) described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for the treatment and / or prevention of diabetes include S. boulardii expressing an IL-22 therapeutic polypeptide(s) described herein (e.g., FZ010).
[0200] In some embodiments, engineered strains of Saccharomyces yeast described herein are useful for treating and / or preventing low-grade chronic intestinal inflammation associated with diabetes. In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with diabetes express an anti-TNF-α as described herein. In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with diabetes include S. boulardii that express an anti-TNF-α antibody as described herein (e.g., FZ006). In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with diabetes include S. boulardii that express an anti-IL-17A antibody as described herein (e.g., FZ004). In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with diabetes include S. boulardii that expresses IL-10 as described herein (e.g., FZ030). In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with diabetes express a bispecific antibody against IL-17A and TNF-α as described herein. In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with diabetes include S. boulardii expressing a bispecific antibody against IL-17A and TNF-α (e.g., FZ008). In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with diabetes express an IL-22 polypeptide or an IL-22-Fc fusion as described herein. In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with diabetes include S. boulardii expressing IL-22 (e.g., FZ010).In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with diabetes express IL-22 and a bispecific antibody against IL-17A and TNF-α as described herein. In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with diabetes include S. boulardii expressing IL-22 and a bispecific antibody against IL-17A and TNF-α (e.g., FZ012). In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with diabetes express anti-human TNF-α IgG1 as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with diabetes include S. boulardii expressing anti-human TNF-α IgG1 (e.g., FZ026).
[0201] obesity Obesity, as defined in adults by a body mass index (BMI) of 30 or greater, is a growing public health problem worldwide. The World Health Organization reports that 13% of adults over the age of 18 are clinically obese, totaling more than 600 million people. Health risks from obesity stem from its association with an increased risk of several diseases, including hypertension, type 2 diabetes, cardiovascular disease, osteoarthritis, renal failure, liver disease, and some types of cancer. Interestingly, chronic inflammation, a phenotype associated with obesity, is known to be a major factor contributing to disease progression of the above chronic diseases.
[0202] Obesity-related inflammation is initially caused by excess nutrients and localized in specialized metabolic tissues, such as white adipose tissue, which acts as the main energy source and is composed mainly of adipocytes. Adipocytes are endocrine cells that secrete a wide range of cytokines, hormones, and growth factors, called adipokines, and are specialized in storing energy as triglycerides in cytoplasmic lipid droplets. Excess nutrients cause activation of metabolic signaling pathways, including c-Jun N-terminal kinase (JNK), nuclear factor kappa B (NFkB), and protein kinase R. Without wishing to be bound by any theory, it is understood that activation of these pathways causes induction of low levels of inflammatory cytokines, resulting in a low-grade inflammatory response. Excess nutrients and obesity also cause hyperplasia and hypertrophy of white adipose tissue adipocytes, as well as extensive tissue remodeling and increased free fatty acids, resulting in altered adipokine production and a low-grade inflammatory response. Obesity also causes increased endoplasmic reticulum stress, which leads to activation of the unfolded protein response, which leads to increased oxidative stress and upregulation of inflammatory cytokines. All of these pathways contribute to the initiation of obesity-associated inflammation. Although obesity-associated inflammation is primarily localized to white adipose tissue, other tissues have been shown to increase inflammation under obesity, including the liver, pancreas, and brain.
[0203] In some embodiments, engineered strains of Saccharomyces yeast useful for the treatment and / or prevention of obesity express a GLP-1 therapeutic polypeptide(s) described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for the treatment and / or prevention of obesity include S. boulardii expressing a human active GLP-1 therapeutic polypeptide(s) described herein (e.g., FZ022).
[0204] In some embodiments, engineered strains of Saccharomyces yeast useful for the treatment and / or prevention of obesity express a leptin therapeutic polypeptide(s) described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for the treatment and / or prevention of obesity include S. boulardii expressing a human active leptin therapeutic polypeptide(s) described herein (e.g., FZ024).
[0205] In some embodiments, engineered strains of Saccharomyces yeast useful for the treatment and / or prevention of obesity express an IL-22 therapeutic polypeptide(s) described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for the treatment and / or prevention of obesity include S. boulardii expressing an IL-22 therapeutic polypeptide(s) described herein (e.g., FZ010).
[0206] In some embodiments, engineered strains of Saccharomyces yeast described herein are useful for treating and / or preventing chronic intestinal inflammation associated with obesity. In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with obesity express an anti-TNF-α as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with obesity include S. boulardii expressing an anti-TNFα antibody as described herein (e.g., FZ006). In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with obesity express a bispecific antibody against IL-17A and TNF-α as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with obesity include S. boulardii expressing a bispecific antibody against IL-17A and TNF-α as described herein (e.g., FZ008). In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with obesity express IL-22 alone or an IL-22-Fc fusion as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with obesity include S. boulardii expressing IL-22 (e.g., FZ010). In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with obesity express IL-22 and a bispecific antibody against IL-17A and TNF-α as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with obesity include S. boulardii expressing IL-22 and a bispecific antibody against IL-17A and TNF-α (e.g., FZ012).In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with obesity express an anti-human TNF-α IgG1 as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with obesity include S. boulardii that expresses an anti-human TNF-α IgG1 (e.g., FZ026). In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with obesity include S. boulardii that expresses an anti-IL-17A antibody as described herein (e.g., FZ004). In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with obesity include S. boulardii that expresses IL-10 as described herein (e.g., FZ030).
[0207] Fatty Liver Disease (FLD) and Other Liver Diseases Fatty liver disease (FLD, or "fatty liver") corresponds to the presence of macrocapsular changes without inflammation (steatosis) and lobular inflammation in the absence of significant alcohol use. It can be divided into two subgroups: NAFL (nonalcoholic fatty liver) or simply steatosis and NASH (nonalcoholic steatohepatitis). NAFL is defined as the presence of hepatic steatosis without evidence of hepatocellular injury in the form of hepatocyte ballooning. NASH is defined as the presence of hepatic steatosis and inflammation with hepatocellular injury (ballooning), Mallory hyaline, and a combination of lymphocytic and neutrophilic inflammatory infiltrates in the surrounding areas with or without fibrosis.
[0208] Interestingly, in both non-alcoholic and alcoholic liver disease models, the interleukin-20 (IL-20) family of cytokines reduces liver damage and inflammation. For example, interleukin-22 (IL-22), a member of the IL-20 subfamily, controls lipid metabolism in the liver through activation of the STAT3 signaling pathway. Thus, in some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing FLD express the IL-22 therapeutic polypeptide(s) described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing FLD include S. boulardii expressing the IL-22 therapeutic polypeptide(s) described herein (e.g., FZ010).
[0209] The gut-liver axis describes the physiological interactions between the gut and the liver and has important implications for the maintenance of health. Disruption of this equilibrium is a key factor in the evolution and progression of many liver diseases. Intestinal inflammation leads to impaired gut barrier function, resulting in the translocation of microorganisms and microbial products, called microbial or pathogen-associated molecular patterns (MAMPs / PAMPs), to the liver, causing liver inflammation. Thus, in some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing FLD express anti-inflammatory therapeutic polypeptide(s), such as anti-TNFα, IL-17A, as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing FLD include S. boulardii expressing therapeutic polypeptide(s), such as anti-TNFα, IL-17A, as described herein (e.g., FZ006, FZ008, FZ026).
[0210] Graft-versus-host disease (GVHD) Graft-versus-host disease (GVHD) is a systemic disorder that occurs when immune cells of the graft recognize the host as foreign and attack the recipient's somatic cells. "Graft" refers to the transplanted or donated tissue, and "host" refers to the recipient's tissue. GVHD is a significant cause of morbidity in subjects undergoing treatments such as allogeneic cell therapy or transplantation. Immune cell recognition of the host can induce a "cytokine storm," an associated proinflammatory response triggered by cytokines.
[0211] Thus, in some such embodiments, engineered strains of Saccharomyces yeast useful for the treatment and / or prevention of GVHD express IL-22 therapeutic polypeptide(s) and / or monospecific or bispecific antibodies to IL-17A and / or TNF-α as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for the treatment and / or prevention of GVHD include S. boulardii expressing IL-10 or IL-22 therapeutic polypeptide(s) and / or monospecific or bispecific antibodies to IL-17A and / or TNF-α as described herein (e.g., FZ004, FZ006, FZ008, FZ010, FZ012, FZ030, and FZ026). S. boulardii expressing the IL-10 or IL-22 therapeutic polypeptide(s) described herein and / or monospecific or bispecific antibodies against IL-17A and TNF-α (e.g., FZ004, FZ006, FZ008, FZ010, FZ012, FZ030, and FZ026) can also be used to treat metabolic diseases.
[0212] Gastrointestinal viruses (rotavirus, norovirus, etc.) Viruses are the causative agents of acute infectious gastroenteritis, which causes inflammation of the lining of the gastrointestinal tract, resulting in a syndrome of sudden onset of vomiting, watery diarrhea, or both in otherwise healthy individuals. Two different viruses account for the majority of cases. Rotavirus is the main agent of sporadic severe gastroenteritis in young children and is responsible for approximately 1600 child deaths worldwide each day, mainly in developing countries. Norovirus is the main agent of epidemic infectious gastroenteritis in both young children and adults. Outbreaks of gastroenteritis in closed settings, such as cruise ships and nursing homes, are typical symptoms of norovirus infection. However, norovirus is also a common cause of sporadic severe gastroenteritis in young children (e.g., Franco MA et al., Goldman's Cecil Medicine. 2012; 2144-2147).
[0213] Rotaviruses, belonging to the family Reoviridae, are large, icosahedral, non-enveloped viruses with a segmented, double-stranded RNA genome and a triple-layered protein coat. Rotaviruses are classified into groups A-G based on the presence of cross-reactive antigenic epitopes and their overall genetic relatedness. Group A rotaviruses are the major enteric pathogens of humans and many other species. Group B viruses have been identified sporadically in outbreaks of adult diarrheal disease in China and more recently in studies of children with sporadic gastroenteritis, mainly in India. Group C rotaviruses are relatively rarely associated with diarrheal disease in humans and animals worldwide. Groups D-G rotaviruses have been isolated only from animals, mainly avian species. Rotaviruses are 100 nm particles with three concentric circular protein layers; the core is composed of VP1, VP2, and VP3 and a segmented, double-stranded RNA genome, the middle layer is formed by VP6, the most abundant and antigenic structural viral protein, and the outer layer is composed of VP7 and VP4. The genome is composed of 11 segments of double-stranded RNA, each approximately 18 kilobases long, that code for six structural and six nonstructural proteins. As with virtually all other RNA viruses, the rotavirus RNA polymerase is error-prone, which, together with selective pressures such as the evolution of immunity, leads to viral diversity. For rotaviruses, gene reassortment, the mixing of gene segments from different parental viruses in cells co-infected with two or more strains, and rearrangement of the viral genome also contribute to genetic diversity. Reassortment of gene segments between animal and human rotavirus strains also occurs in the natural environment, especially in developing countries.
[0214] Norovirus, one of five genera in the family Caliciviridae, is a relatively small, non-enveloped, icosahedral virus with a positive-sense, single-stranded RNA genome. The Norovirus genus is further divided into five genogroups (GI-GV), of which only three (GI, GII, and GIV) are known to infect humans. GIII and GV viruses infect cattle and mice, respectively, and these animal viruses have not been shown to infect humans to date. Viruses within each genogroup are further divided into genotypes (more than 25 have been described) and subgroups. Norwalk virus is the prototype genogroup I genotype 1 (GI.1) virus. The norovirus genome is approximately 7.7 kilobases in size and consists of three open reading frames, the first of which encodes nonstructural proteins essential for viral replication. The second open reading frame encodes the major capsid protein, viral protein 1 (VP1). When expressed as a recombinant protein, 180 VP1 molecules autoassemble into virus-like particles that are important for the study of norovirus epidemiology and immunity.
[0215] Thus, in some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing rotavirus express an anti-rotavirus VHH as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing rotavirus include S. boulardii expressing an anti-rotavirus VHH as described herein (e.g., FZ014).
[0216] In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing Norovirus express bispecific VHH-Fc against Norovirus described herein (e.g., M6M5-Fc and M6M4-Fc). In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing Norovirus include S. boulardii expressing bispecific VHH-Fc against Norovirus described herein (e.g., M5, M6M5-Fc and M6M4-Fc) (e.g., FZ016).
[0217] In some embodiments, the subject is infected with both Norovirus and C. difficile. Thus, in some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing Norovirus and C. difficile co-infection express a bispecific VHH-Fc (e.g., M6M5-Fc and M6M4-Fc) against Norovirus as described herein and an antitoxin ABAB. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing Norovirus and C. difficile co-infection include S. boulardii expressing a bispecific VHH-Fc (e.g., M6M5-Fc and M6M4-Fc) against Norovirus as described herein and an antitoxin ABAB (e.g., FZ018).
[0218] gastrointestinal tract infection IL-22 is a key cytokine for maintaining homeostasis at various mucosal barriers, including the gastrointestinal tract. During infection with enteric pathogens, IL-22 is greatly upregulated, leading to the induction of multiple antimicrobial factors, wound healing, and restoration of barrier function. In the intestine, IL-22 signaling promotes important functions, including host defense against pathogens and wound healing. Intestinal recombinant IL-22 application may have beneficial effects on liver and pancreatic injury, ulcerative colitis, and graft-versus-host disease.
[0219] In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing enteric pathogen colonization and infection express an IL-22 polypeptide as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing enteric pathogen colonization and infection include S. boulardii (e.g., FZ010) that express an IL-22 polypeptide as described herein.
[0220] cardiovascular disease Intestinal inflammation can cause a decrease in the integrity of the intestinal barrier, which in turn increases circulating levels of bacterial structural elements and microbial metabolites, including trimethylamine-N-oxide and short chain fatty acids, and promote the development of cardiovascular disease (CVD). In some embodiments, engineered strains of Saccharomyces yeast described herein are useful for treating and / or preventing intestinal inflammation associated with CVD. In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with CVD express anti-TNF-α as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with CVD include S. boulardii expressing an anti-IL17A or anti-TNF-α antibody as described herein (e.g., FZ004 or FZ006). In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with CVD express a bispecific antibody against IL-17A and TNF-α as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with CVD include S. boulardii expressing a bispecific antibody against IL-17A and TNF-α (e.g., FZ008). In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with CVD express IL-22 alone or an IL-22-Fc fusion as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with CVD include S. boulardii expressing IL-22 (e.g., FZ010). In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with CVD express IL-22 and a bispecific antibody against IL-17A and TNF-α as described herein.In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with CVD include S. boulardii that express IL-22 and a bispecific antibody against IL-17A and TNF-α (e.g., FZ012). In some embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with CVD express an anti-human TNF-α IgG1 as described herein. In some such embodiments, engineered strains of Saccharomyces yeast useful for treating and / or preventing intestinal inflammation associated with CVD include S. boulardii that expresses an anti-human TNF-α IgG1 (e.g., FZ026).
[0221] Irritable bowel syndrome (IBS) Irritable bowel syndrome (IBS) is a gastrointestinal-related disorder that manifests as persistent abdominal pain or discomfort and is generally correlated with alterations in bowel habits as well as frequency and form of stool. IBS was once assumed to affect mostly Western populations, but is increasingly prevalent in developing countries in Asia. IBS is subclassified as constipation-predominant IBS (IBS-C), diarrhea-predominant IBS (IBS-D), alternating or mixed IBS (A / M-IBS), and post-infectious IBS (PI-IBS). Patients with IBS increasingly present with a wide range of neuropsychiatric symptoms such as deterioration of gastrointestinal physiology, including visceral hypersensitivity, altered intestinal membrane permeability, and gastrointestinal motility dysfunction. The gut-brain axis links the interrelationships between intestinal and central events in IBS-related gastrointestinal pathology, neuropathology, and psychopathology. The pathophysiology of IBS involves altered signaling by the gut-brain axis, dysbiosis, aberrant visceral pain signaling, and intestinal immune activation. Immune activation plays a role in the pathogenesis of IBS through bidirectional communication between the nervous and immune systems. The gut microbiota is associated with IBS, and changes in gut microbiota composition, temporal stability, and metabolic activity have been described in patients with IBS.
[0222] In some embodiments, engineered strains of Saccharomyces yeast described herein are useful for treating and / or preventing IBS by affecting intestinal inflammation, barrier function, and gut microbiota (e.g., FZ004, FZ006, FZ008, FZ010, FZ012, FZ026, and FZ030).
[0223] Compositions (e.g., pharmaceutical compositions) In another aspect, disclosed herein is a pharmaceutical composition comprising one or more engineered strains of Saccharomyces yeast and at least one pharma- ceutically acceptable carrier or diluent. In some aspects, the pharmaceutical composition can be formulated as an oral dosage form, a rectal dosage form, a vaginal dosage form, or a topical dosage form. In some aspects, the oral dosage form comprises an enteric coating. In yet another aspect, the pharmaceutical composition disclosed herein is less expensive to manufacture than monoclonal or polyclonal antibodies. In any of these aspects, administration of the pharmaceutical composition does not induce an anti-drug response.
[0224] In various aspects, the present disclosure relates to pharmaceutical compositions comprising a therapeutically effective amount of an engineered strain of Saccharomyces yeast described herein. As used herein, "a pharma- ceutically acceptable carrier" means one or more of pharma- ceutically acceptable diluents, preservatives, antioxidants, solubilizers, emulsifiers, colorants, release agents, coating agents, sweeteners, flavorings and perfuming agents, and adjuvants. The disclosed pharmaceutical compositions may be conveniently provided in unit dosage form and prepared by any of the methods well known in the art of pharmacy and pharmaceutical science.
[0225] In further aspects, the disclosed pharmaceutical compositions comprise a therapeutically effective amount of at least one of the disclosed engineered strains of the S. boulardii organism, a pharma- ceutically acceptable carrier, optionally one or more other therapeutic agents, and optionally one or more adjuvants. The disclosed pharmaceutical compositions include those suitable for oral administration.
[0226] In various aspects, the disclosure also relates to pharmaceutical compositions comprising a pharma- ceutically acceptable carrier or diluent and, as an active ingredient, a therapeutically effective amount of one or more engineered strains of Saccharomyces yeast. In one aspect, the therapeutically effective amount of the pharmaceutical composition comprises about 1 billion to about 10 billion colony forming units (CFU) of the engineered strain of Saccharomyces yeast, or about 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 10 billion CFU of the engineered strain of Saccharomyces yeast, or any combination of the foregoing values, or a range encompassing any of the foregoing values.
[0227] In practice, the organisms of the present disclosure (e.g., engineered strains of Saccharomyces yeast) can be combined as active ingredients in intimate admixture with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques. The carrier can take a wide variety of forms, depending on the form of preparation desired for administration, e.g., oral or parenteral (including intravenous). Thus, the pharmaceutical compositions of the present disclosure can be presented as discrete units suitable for oral administration, such as capsules, cachets, or tablets, each containing a predetermined amount of the active ingredient, or suitable for vaginal administration, including bioadhesive delivery systems, phase change poloxamers, tablets, suppositories, creams, gels, vaginal rings, etc., suitable for rectal administration (i.e., suppositories and / or enemas), or suitable for topical administration (e.g., solutions, lotions, creams, ointments, gels, pastes, aerosol foams, aerosol sprays, powders, solids, transdermal patches, etc.). Additionally, the compositions can be presented as powders, granules, solutions, suspensions in aqueous liquids, non-aqueous liquids, oil-in-water emulsions, or water-in-oil liquid emulsions. In some embodiments, the composition is presented in combination with food (e.g., food provided to animals such as pigs or poultry, medical food for humans). In addition to the common dosage forms described above, the compounds of the present disclosure and / or their pharmaceutically acceptable salt(s) can also be administered by controlled release means and / or delivery devices. These compositions can be prepared by any of the methods of pharmacy. In general, such methods include the step of bringing into association the active ingredient with the carrier which constitutes one or more necessary ingredients. In general, the compositions are prepared by uniformly and intimately admixing the active ingredient with liquid carriers or finely divided solid carriers, or both. The product can then be conveniently shaped into the desired presentation.
[0228] For ease of administration and uniformity of dosage, it is particularly advantageous to formulate the above-mentioned pharmaceutical composition in unit dosage form. As used herein, the term "unit dosage form" refers to physically separate units suitable as unit dosages, each unit containing a predetermined amount of active ingredient calculated to produce a desired therapeutic effect in association with the necessary pharmaceutical carrier. That is, "unit dosage form" is interpreted to mean a single dose in which all active and inactive ingredients are combined in a suitable system, such that a patient or a person administering a drug to a patient can open a single container or package with the entire dose contained therein, and there is no need to mix any components together from two or more containers or packages. Typical examples of unit dosage forms are tablets (including scored or coated tablets) for oral administration, capsules or pills, powder packets, wafers, and divided multiples thereof. This list of unit dosage forms is in no way intended to be limiting, but is intended to represent typical examples of unit dosage forms.
[0229] The pharmaceutical compositions disclosed herein comprise one or more engineered strains of Saccharomyces yeast of the present disclosure as active ingredients, a pharmaceutically acceptable carrier, and optionally one or more additional therapeutic agents. In various aspects, the disclosed pharmaceutical compositions may comprise a pharmaceutically acceptable carrier and an engineered strain of Saccharomyces yeast described herein. In further aspects, the engineered strains of Saccharomyces yeast described herein may also be included in a pharmaceutical composition in combination with one or more other therapeutically active compounds. The compositions include compositions suitable for oral administration. The pharmaceutical compositions are conveniently provided in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy.
[0230] Techniques and compositions for making dosage forms useful for the materials and methods described herein are described, for example, in the following references:Modern Pharmaceutics,Chapters 9 and 10(Banker & Rhodes,Editors,1979)、Pharmaceutical Dosage Forms:Tablets(Lieberman et al.,1981)、Ansel,Introduction to Pharmaceutical Dosage Forms 2nd Edition(1976)、Remington’s Pharmaceutical Sciences,17th ed.(Mack Publishing Company,Easton,Pa.,1985)、Advances in Pharmaceutical Sciences(David Ganderton,Trevor Jones,Eds.,1992)、Advances in Pharmaceutical Sciences Vol 7.(David Ganderton,Trevor Jones,James McGinity,Eds.,1995)、Aqueous Polymeric Coatings for Pharmaceutical Dosage Forms(Drugs and the Pharmaceutical Sciences,Series 36(James McGinity,Ed.,1989)、Pharmaceutical Particulate Carriers:Therapeutic Applications:Drugs and the Pharmaceutical Sciences,Vol 61(Alain Rolland,Ed.,1993)、Drug Delivery to the Gastrointestinal Tract(Ellis Horwood Books in the Biological Sciences.Series in Pharmaceutical Technology、J.G.Hardy,S.S.Davis,Clive G.Wilson,Eds.)、Modern Pharmaceutics Drugs and the Pharmaceutical Sciences,Vol 40(Gilbert S.Banker,Christopher T.Rhodes,Eds.)。
[0231] The compounds described herein are typically administered in admixture with a suitable pharmaceutical diluent, excipient, filler, or carrier (herein referred to as pharma- ceutically acceptable carrier, or carrier), suitably selected for the intended form of administration and consistent with conventional pharmaceutical practice. The deliverable compound is in a form suitable for oral administration. Carriers include solids or liquids, and the type of carrier is selected based on the type of administration used. The compound can be administered as a dosage having a known amount of the compound.
[0232] Oral administration may be the preferred dosage form due to ease of administration, with tablets and capsules representing the most advantageous oral dosage unit forms, in which case solid pharmaceutical carriers are obviously used. However, other dosage forms may be suitable depending on the clinical population (e.g., age and severity of clinical condition), the solubility characteristics of the particular disclosed compound used, and the like. Thus, the disclosed compounds can be administered in oral dosage forms as pills, powders, granules, elixirs, tinctures, suspensions, syrups, and emulsions. In some embodiments, the disclosed compounds (e.g., engineered strains of Saccharomyces yeast described herein) are encapsulated. In preparing compositions for oral dosage forms, any convenient pharmaceutical media can be used. For example, carriers such as water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents, etc. can be used to form oral liquid preparations such as suspensions, elixirs, and solutions, while carriers such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents, etc. can be used to form oral solid preparations such as powders, capsules, and tablets. Because of their ease of administration, tablets and capsules are the preferred oral dosage units, whereby solid pharmaceutical carriers are used. Optionally, tablets can be coated by standard aqueous or nonaqueous techniques.
[0233] The disclosed pharmaceutical compositions in oral dosage form may include one or more pharmaceutical excipients and / or additives. Non-limiting examples of suitable excipients and additives include gelatin, natural sugars such as sugar or lactose, lecithin, sucrose, trehalose, inulin, ACP, alginates, sodium ascorbate, magnesium sulfate, pectin, starch (e.g., corn starch or amylose), dextran, Avicel (microcrystalline cellulose), maltodextrin, magnesium stearate, silicon dioxide, polyvinylpyrrolidone, polyvinyl acetate, gum arabic, alginic acid, tylose, talc, lycopodium, silica gel (e.g., colloidal), cellulose, cellulose derivatives (e.g., cellulose derivatives in which the hydroxyl groups of the cellulose are partially acylated with low-saturated fatty acid alcohols, etc.), and mixtures thereof. esterified cellulose ethers and / or low saturated aliphatic oxyalcohols, for example methyloxypropylcellulose, methylcellulose, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose phthalate), fatty acids and magnesium, ascorbic acid, sodium ascorbate, calcium or aluminium salts of fatty acids having 12 to 22 carbon atoms, in particular saturated (for example stearates), emulsifiers, oils and fats, in particular vegetable (for example peanut oil, castor oil, olive oil, sesame oil, cottonseed oil, corn oil, wheat germ oil, sunflower seed oil, cod liver oil, in each case optionally hydrated); saturated fatty acids C 12 H 24 O2~C 18 H 36Glycerol and polyglycerol esters of O2, and mixtures thereof, in which the glycerol hydroxy groups can be wholly or only partially esterified (e.g., monoglycerides, diglycerides, and triglycerides); pharma- ceutically acceptable mono- or polyhydric alcohols and polyglycols, e.g., polyethylene glycol and its derivatives, aliphatic saturated alcohols, including monohydric aliphatic alcohols (1-20 carbon atoms) or polyhydric alcohols (e.g., glycerol, diethylene glycol, pentacrylitol, sorbitol, mannitol, etc.). or esters of unsaturated fatty acids (having 2 to 22 carbon atoms, particularly 10 to 18 carbon atoms) (which may also be optionally etherified), esters of citric acid and primary alcohols, acetic acid, urea, benzyl benzoate, dioxolane, glyceroformal, tetrahydrofurfuryl alcohol, polyglycol ethers of 01 to 012 alcohols, dimethylacetamide, lactamide, lactate, ethyl carbonate, silicones (particularly polydimethylsiloxanes of medium viscosity), calcium carbonate, sodium carbonate, calcium phosphate, sodium phosphate, magnesium carbonate, magnesium sulfate, and the like.
[0234] Other auxiliary substances useful for the preparation of oral dosage forms are those which cause disintegration (so-called disintegrants), such as crosslinked polyvinylpyrrolidone, sodium carboxymethyl starch, sodium carboxymethylcellulose or microcrystalline cellulose. Oral dosage forms can also be produced using conventional coating substances. For example, those which may be considered are polymers and copolymers of acrylic acid and / or methacrylic acid and / or their esters; copolymers of acrylic acid and methacrylic acid esters with a lower ammonium group content (e.g. Eudragit® RS), copolymers of acrylic acid and methacrylic acid esters with trimethylammonium methacrylate (e.g. Eudragit® RL); polyvinyl acetate; fats, oils, waxes, fatty alcohols; hydroxypropylmethylcellulose phthalate or hydroxypropylmethylcellulose acetate succinate; cellulose acetate phthalate, polyvinyl acetate phthalate, carboxymethylcellulose acetate ... Cellulose; methylcellulose phthalate, methylcellulose succinate, methylcellulose phthalate succinate and methylcellulose phthalate half ester; zein; ethylcellulose and ethylcellulose succinate; shellac, gluten; ethyl carboxyethylcellulose; ethacrylate-maleic anhydride copolymer; maleic anhydride-vinyl methyl ether copolymer; styrene-maleic acid copolymer; 2-ethyl-hexyl-acrylate maleic anhydride; crotonic acid-vinyl acetate copolymer; glutamic acid / glutamic acid ester copolymer; carboxymethylethylcellulose glycerol monooctanoate; cellulose acetate succinate; polyarginine.
[0235] Plasticizers that may be considered as coating materials in the disclosed oral dosage forms include esters of citric and tartaric acid (acetyl-triethyl citrate, acetyl-tributyl citrate, tributyl citrate, triethyl citrate); glycerol and glycerol esters (glycerol diacetate, -triacetate, acetylated monoglycerides, castor oil); phthalic acid esters (dibutyl phthalate, diamyl phthalate, diethyl phthalate, dimethyl phthalate, dipropyl phthalate), di-(2-methoxy- or 2-ethoxyethyl)-phthalate, ethyl phthalyl glycolate, Butylphthalylethyl glycolate and butyl glycolate; alcohols (propylene glycol, polyethylene glycols of various chain lengths); adipates (diethyl adipate, di-(2-methoxy- or 2-ethoxyethyl)-adipate; benzophenone; diethyl and dibutyl sebacate, dibutyl succinate, dibutyl tartrate; diethylene glycol dipropionate; ethylene glycol diacetate, -dibutyrate, -dipropionate; tributyl phosphate, tributyrin; polyethylene glycol sorbitan monooleate (polysorbates such as Polysorbar 50); sorbitan monooleate.
[0236] In addition, suitable binder, lubricant, disintegrant, coloring agent, flavoring agent, flow inducer and melting agent can be included as carrier.The pharmaceutical carrier used can be, for example, solid or liquid.The example of solid carrier includes, but is not limited to, lactose, terra alba, sucrose, glucose, methylcellulose, dicalcium phosphate, calcium sulfate, mannitol, sorbitol talc, starch, gelatin, agar, pectin, acacia, Avicel (microcrystalline cellulose), maltodextrin, magnesium stearate, silicon dioxide and stearic acid.The example of liquid carrier is sugar syrup, peanut oil, olive oil and water.
[0237] In various embodiments, binders can include, for example, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tragacanth, alginates or sodium alginate, carboxymethylcellulose, polyethylene glycol, waxes, etc. Lubricants used in these dosage forms include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, etc. In further embodiments, disintegrants can include, for example, starch, methylcellulose, agar, bentonite, xanthan gum, etc.
[0238] In various embodiments, oral dosage forms, such as solid dosage forms, can include the disclosed microorganisms in contact with one or more biodegradable polymers. Suitable biodegradable polymers useful for achieving controlled release of drugs include, for example, polylactic acid, polyglycolic acid, copolymers of polylactic acid and polyglycolic acid, caprolactone, polyhydroxybutyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacylates, and hydrogels, preferably covalently crosslinked hydrogels.
[0239] The tablet may contain the active ingredient in admixture with non-toxic pharma- ceutically acceptable excipients suitable for tablet manufacture.These excipients may be, for example, inert diluents such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents such as corn starch or alginic acid; binders such as starch, gelatin or acacia, and lubricants such as magnesium stearate, stearic acid or talc.The tablet may be uncoated or may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract, thereby providing sustained activity over a longer period of time.
[0240] Tablets containing the disclosed microorganisms can be prepared by compression or molding, optionally with one or more accessory ingredients or adjuvants. Compressed tablets can be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active agent or dispersing agent. Molded tablets can be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.
[0241] In another aspect, the engineered strain of Saccharomyces yeast can be lyophilized in a pharmaceutical composition. In some embodiments, the engineered strain of Saccharomyces yeast can be mixed with a cryoprotectant to improve survival during lyophilization. In some aspects, the pharmaceutical composition can be formulated as an oral dosage form. In one aspect, the oral dosage form can be a capsule, tablet, caplet, gelcap, powder, liquid solution, suspension, or any combination thereof. In some aspects, the oral dosage form comprises an enteric coating.
[0242] In one aspect, oral dosage forms are preferred over other methods of administering therapies targeting inflammatory cytokines. In some aspects, standard therapies, such as for Crohn's disease, ulcerative colitis, etc., may include administration of biologics and / or other therapeutic agents by injection or infusion. In some aspects, such drug administration reduces patient compliance, since travel to the treatment site must be prepared and medical personnel must be trained to administer the therapy by injection or infusion. In other aspects, therapeutic agents administered by injection or infusion may require sterility and / or induce an immune response in the subject. Thus, in one aspect, the disclosed pharmaceutical compositions and oral dosage forms represent a significant improvement over current therapies, since they can be self-administered by patients at home and do not induce an immune response. In yet another aspect, the pharmaceutical compositions disclosed herein are less expensive to manufacture than monoclonal or polyclonal antibodies.
[0243] In various embodiments, solid oral dosage forms such as tablets or capsules can be coated with an enteric coating to prevent rapid disintegration in the stomach. In various embodiments, enteric coating agents include, but are not limited to, hydroxypropylmethylcellulose phthalate, methacrylic acid-methacrylic acid ester copolymer, polyacetate-phthalate, and cellulose acetate phthalate. Akihiko Hasegawa "Application of solid dispersions of Nifedipine with enteric coating agent to prepare a sustained-release dosage form" Chem.Pharm.Bull.33:1615-1619(1985). Various enteric coating materials can be selected based on testing to achieve an enteric coated dosage form originally designed to have a preferred combination of dissolution time, coating thickness, and diametral compressive strength (see, e.g., SC Porter et al. "The Properties of Enteric Tablet Coatings Made From Polyvinyl Acetate-phthalate and Cellulose acetate Phthalate", J.Pharm.Pharmacol.22:42p(1970)). In further embodiments, the enteric coating may include hydroxypropyl-methylcellulose phthalate, methacrylic acid-methacrylic acid ester copolymer, polyacetate-phthalate, and cellulose acetate phthalate.
[0244] In various embodiments, the oral dosage form may be a solid dispersion with a water-soluble or water-insoluble carrier. Examples of water-soluble or water-insoluble carriers include, but are not limited to, polyethylene glycol, polyvinylpyrrolidone, hydroxypropyl methylcellulose, phosphatidylcholine, polyoxyethylene hydrogenated castor oil, hydroxypropyl methylcellulose phthalate, carboxymethylethylcellulose, or hydroxypropyl methylcellulose, ethylcellulose, or stearic acid.
[0245] In various aspects, oral dosage forms can be liquid dosage forms, including those that are ingested or alternatively administered as mouthwash or gargle.For example, liquid dosage forms can include aqueous suspensions containing active substances mixed with excipients suitable for the manufacture of aqueous suspensions.In addition, oily suspensions can be formulated by suspending active ingredients in vegetable oils, such as peanut oil, olive oil, sesame oil, or coconut oil, or mineral oils, such as liquid paraffin.Oily suspensions can also include various excipients.The pharmaceutical compositions of the present disclosure can also be in the form of oil-in-water emulsions, which can also include excipients such as sweeteners and flavorings.
[0246] For the preparation of solutions or suspensions, for example, water, in particular sterile water, or physiologically acceptable organic solvents such as alcohols (ethanol, propanol, isopropanol, 1,2-propylene glycol, polyglycols and their derivatives, fatty alcohols, partial esters of glycerol), oils (for example peanut oil, olive oil, sesame oil, almond oil, sunflower oil, soybean oil, castor oil, bovine hoof oil), paraffin, dimethyl sulfoxide, triglycerides, etc. may be used.
[0247] In the case of liquid dosage forms, such as drinkable solutions, the following substances may be used as stabilizers or solubilizers: lower aliphatic mono- and polyhydric alcohols having 2 to 4 carbon atoms, such as ethanol, n-propanol, glycerol, polyethylene glycols having a molecular weight of 200 to 600 (e.g., 1 to 40% aqueous solution), diethylene glycol monoethyl ether, 1,2-propylene glycol, organic amides, such as amides of aliphatic C1 to C6-carboxylic acids with ammonia or primary, secondary or tertiary C1 to C4-amines, or C1 to C4 hydroxyamines, such as urea, urethane, acetamide, N-methylacetamide, N,N-diethylacetamide, N,N-dimethylacetamide, lower aliphatic amines and diamines having 2 to 6 carbon atoms, such as ethylenediamine, hydroxyethyltheophylline, tromethamine (e.g., 0.1 to 20% aqueous solution), aliphatic amino acids.
[0248] The preparation of the disclosed liquid dosage forms may include solubilizers and emulsifiers, for example the following non-limiting examples can be used: polyvinylpyrrolidone, sorbitan fatty acid esters such as sorbitan trioleate, phosphatides such as lecithin, acacia, tragacanth, polyoxyethylated sorbitan monooleate and other ethoxylated fatty acid esters of sorbitan, polyoxyethylated fats, polyoxyethylated oleotriglycerides, linolized oleotriglycerides, polyethylene oxide condensation products of fatty alcohols, alkylphenols or fatty acids, or 1-methyl-3-(2-hydroxyethyl)imidazolidone-(2). In this context, polyoxyethylated means that the substance in question contains polyoxyethylene chains, the degree of polymerization of which is generally between 2 and 40, in particular between 10 and 20. Polyoxyethylated substances of this kind can be obtained, for example, by reaction of hydroxyl-containing compounds (e.g. mono- or diglycerides, or unsaturated compounds such as those containing oleic acid groups) with ethylene oxide (e.g. 40 moles of ethylene oxide per mole of glyceride). Examples of oleotriglycerides are olive oil, peanut oil, castor oil, sesame oil, cottonseed oil, corn oil. See also Dr. HP Fiedler "Lexikon der Hillsstoffe fur Pharmazie, Kostnetik und angrenzende Gebiete" 1971, pages 191-195.
[0249] In various embodiments, the liquid dosage forms may further comprise preservatives, stabilizers, buffer substances (e.g., phosphate buffered saline, PBS), flavor correctors, sweeteners, colorants, antioxidants, complexing agents, etc. For example, complexing agents that may be considered are chelating agents such as ethylenediaminetetraacetic acid, nitrilotriacetic acid, diethylenetriaminepentaacetic acid and their salts.
[0250] Optionally, it may be necessary to stabilize the liquid dosage form with a physiologically acceptable base or buffer in a pH range of about 6 to 9. Wherever possible, neutral or slightly basic pH values (maximum pH 8) may be preferred.
[0251] To enhance the solubility and / or stability of the disclosed microorganisms in the disclosed liquid dosage forms, it may be advantageous to use α-, β-, or γ-cyclodextrin or derivatives thereof, particularly hydroxyalkyl-substituted cyclodextrins, such as 2-hydroxypropyl-β-cyclodextrin or sulfobutyl-β-cyclodextrin. Co-solvents such as alcohols may also improve the solubility and / or stability of the compounds according to the present disclosure in pharmaceutical compositions.
[0252] The pharmaceutical composition of the present disclosure may be in a form suitable for rectal administration, in which the carrier is solid. The mixture is preferably formed into unit-dose suppositories. Suitable carriers include cocoa butter and other materials commonly used in the art. Suppositories can be conveniently formed by first mixing the composition with softened or melted carrier(s), followed by cooling and shaping.
[0253] The pharmaceutical compositions of the present disclosure may be in a form suitable for topical administration. As used herein, the phrase "topical application" refers to administration to a biological surface, which includes, for example, skin areas (e.g., hands, forearms, elbows, legs, face, nails, anal and genital areas) or mucous membranes. By selecting an appropriate carrier and optional other ingredients that may be included in the composition, as detailed herein below, the compositions of the present disclosure may be formulated into any form typically used for topical application. Topical pharmaceutical compositions may be in the form of creams, ointments, pastes, gels, lotions, milks, suspensions, aerosols, sprays, foams, dusting powders, pads, and patches. Additionally, the compositions may be in a form suitable for use in transdermal devices. These formulations may be prepared utilizing the compounds of the present disclosure, or pharma- ceutically acceptable salts thereof, via conventional processing methods. As an example, a cream or ointment is prepared by mixing about 5% to about 10% by weight of the compound with hydrophilic materials and water to produce a cream or ointment having the desired consistency.
[0254] In compositions suitable for transdermal administration, the carrier optionally comprises a penetration enhancer and / or a suitable wetting agent, optionally in combination with a small proportion of suitable additives of any nature, which additives do not introduce significant harmful effects to the skin.The above-mentioned additives may facilitate administration to the skin and / or may be useful for preparing the desired composition.These compositions may be administered in various ways, for example, as a transdermal patch, as a spot-on, as an ointment.
[0255] Ointments are semi-solid preparations typically based on petrolatum or petroleum derivatives. The particular ointment base used is one that provides optimal delivery of the active agent selected for a given formulation, and preferably also provides other desired properties (e.g., emulsification). Like other carriers or vehicles, ointment bases must be inert, stable, non-irritating, and non-sensitizing. As described in Remington: The Science and Practice of Pharmacy, 19th Ed., Easton, Pa.: Mack Publishing Co. (1995), pp. 1399-1404, ointment bases can be classified into four types: oleaginous bases, emulsifiable bases, emulsion bases, and water-soluble bases. Oleaginous ointment bases include, for example, vegetable oils, fats obtained from animals, and semi-solid hydrocarbons obtained from petroleum. Emulsifiable ointment bases, also known as absorbent ointment bases, contain little or no water and include, for example, hydroxystearin sulfate, anhydrous lanolin, and hydrophilic petrolatum. Emulsion ointment bases are either water-in-oil (W / O) emulsions or oil-in-water (0 / W) emulsions and include, for example, cetyl alcohol, glyceryl monostearate, lanolin, and stearic acid. Preferred water-soluble ointment bases are prepared from polyethylene glycols of various molecular weights.
[0256] Lotions are preparations that are applied to the skin surface without friction. Lotions are typically liquid or semi-liquid preparations in which solid particles, including active agents, are present in a water or alcohol base. Lotions are typically preferred for treating large body areas, as it is easier to apply a more fluid composition. Lotions are typically suspensions of solids, often including liquid oily emulsions of the oil-in-water type. In general, it is necessary to finely divide the insoluble materials in lotions. Lotions typically contain suspending agents to produce better dispersions, as well as compounds that are useful for localizing and holding the active agent in contact with the skin, such as methylcellulose, sodium carboxymethylcellulose, etc.
[0257] Creams are viscous liquids or semisolid emulsions, either oil-in-water or water-in-oil. Cream bases are typically water-washable and contain an oil phase, an emulsifier, and an aqueous phase. The oil phase, also called the "internal" phase, is generally composed of petrolatum and / or fatty alcohols such as cetyl alcohol or stearyl alcohol. The aqueous phase is typically, but not necessarily, larger in volume than the oil phase and generally contains a humectant. Emulsifiers in cream formulations are generally nonionic, anionic, cationic, or amphoteric surfactants. For further information, reference may be made to Remington: The Science and Practice of Pharmacy, supra.
[0258] Pastes are semi-solid dosage forms in which the bioactive agent is suspended in a suitable base. Depending on the nature of the base, pastes are divided into fatty pastes or those made from single-phase aqueous gels. The base in fatty pastes is generally petrolatum, hydrophilic petrolatum, etc. Pastes made from single-phase aqueous gels generally incorporate carboxymethylcellulose, etc. as a base. For further information, one may further refer to Remington: The Science and Practice of Pharmacy.
[0259] Gel formulations are semi-solid suspension-type systems. Single-phase gels contain organic macromolecules distributed substantially uniformly throughout the carrier liquid, which is typically aqueous, but preferably contains alcohol and optionally oil. Preferred organic macromolecules, i.e., gelling agents, are crosslinked acrylic acid polymers, such as the family of carbomer polymers, for example, carboxypolyalkylenes, commercially available under the trademark Carbopol. Other types of preferred polymers in this context are hydrophilic polymers, such as polyethylene oxide, polyoxyethylene-polyoxypropylene copolymers, and polyvinyl alcohol; modified celluloses, such as hydroxypropylcellulose, hydroxyethylcellulose, hydroxypropylmethylcellulose, hydroxypropylmethylcellulose phthalate, and methylcellulose; gums, such as tragacanth and xanthan gum; sodium alginate; and gelatin. To prepare a homogeneous gel, dispersing agents, such as alcohol or glycerin, can be added, or the gelling agent can be dispersed by grinding, mechanical mixing or stirring, or a combination thereof.
[0260] Sprays generally provide the active agent in an aqueous and / or alcoholic solution that can be misted onto the skin for delivery. Such sprays include those formulated to provide a concentration of the active agent solution at the site of administration after delivery, for example, the spray solution may be composed primarily of alcohol or other similar volatile liquids in which the active agent can dissolve. Upon delivery to the skin, the carrier evaporates, leaving a concentrated active agent at the site of administration.
[0261] Foam compositions are typically formulated in a single or multi-phase liquid form and housed in a suitable container, optionally with a propellant that facilitates expulsion of the composition from the container, thus converting it into a foam upon application. Other foam-forming techniques include, for example, the "bag-in-a-can" formulation technique. Compositions formulated in this manner typically contain a low boiling point hydrocarbon, e.g., isopropane. When such compositions are applied at body temperature and stirred, the isopropane vaporizes to produce a foam, in a manner similar to pressurized aerosol foaming systems. Foams can be aqueous or aqueous alkanol, but are typically formulated with a high alcohol content, which evaporates quickly upon application to the user's skin, promoting the active ingredient through the upper skin layers to the treatment site.
[0262] A skin patch typically includes a backing to which a reservoir containing an active agent is attached. The reservoir can be, for example, a pad in which the active agent or composition is dispersed or soaked, or a liquid reservoir. The patch typically also includes a front water-permeable adhesive that adheres and secures the device to the treatment area. Silicone rubber with self-adhesive properties can alternatively be used. In either case, a protective permeable layer can be used to protect the adhesive side of the patch before use. The skin patch can also include a removable cover that helps protect it during storage.
[0263] Examples of patch configurations that can be utilized with the present invention include single-layer or multi-layer drug adhesive systems that feature drug directly contained within the skin contact adhesive.In such transdermal patch designs, the adhesive not only serves to fix the patch to the skin, but also serves as a formulation base that contains drug and all excipients under a single backing film.In multi-layer drug adhesive patches, the membrane is placed between two different drug adhesive layers, or multiple drug adhesive layers are incorporated under a single backing film.
[0264] Examples of pharma- ceutically acceptable carriers suitable for pharmaceutical compositions for topical application include carrier materials well known for use in the cosmetic and medical fields as bases for, for example, emulsions, creams, aqueous solutions, oils, ointments, pastes, gels, lotions, milks, foams, suspensions, aerosols, etc., depending on the final form of the composition. Thus, representative examples of suitable carriers according to the present invention include, but are not limited to, water, liquid alcohols, liquid glycols, liquid polyalkylene glycols, liquid esters, liquid amides, liquid protein hydrolysates, liquid alkylated protein hydrolysates, liquid lanolin and lanolin derivatives, and similar materials commonly used in cosmetic and pharmaceutical compositions. Other suitable carriers according to the present invention include, but are not limited to, alcohols, such as monohydric and polyhydric alcohols, e.g., ethanol, isopropanol, glycerol, sorbitol, 2-methoxyethanol, diethylene glycol, ethylene glycol, hexylene glycol, mannitol, and propylene glycol; ethers, such as diethyl or dipropyl ether; polyethylene glycol and methoxypolyoxyethylene (carbowaxes having molecular weights ranging from 200 to 20,000); polyoxyethylene glycerol, polyoxyethylene sorbitol, stearoyl diacetin, and the like.
[0265] The topical composition of the present disclosure may be presented in a pack or dispenser device (e.g., an FDA approved kit) that may contain one or more unit dosage forms containing the active ingredient, if desired. The dispenser device may, for example, include a tube. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser device may also be accompanied by a notice in a form prescribed by a government agency regulating the manufacture, use, or sale of pharmaceuticals, the notice reflecting approval by the agency of the form of the composition for human or veterinary administration. Such notice may include, for example, a label approved by the U.S. Food and Drug Administration for prescription drugs, or an approved package insert. Compositions including topical compositions formulated in a pharmaceutically acceptable carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
[0266] Another patch system configuration that can be used according to the present invention is a reservoir transdermal system design, characterized by including a liquid compartment containing a drug solution or suspension separated from a release liner by a semipermeable membrane and an adhesive. The adhesive component of this patch system can be incorporated either as a continuous layer between the membrane and the release liner or in a concentric configuration around the membrane. Yet another patch system configuration that can be used according to the present invention is a matrix system design, characterized by including a semisolid matrix containing the drug solution or suspension in direct contact with the release liner. The component responsible for skin adhesion is incorporated into the overlay and forms a concentric configuration around the semisolid matrix.
[0267] The pharmaceutical composition (or formulation) may be packaged in a variety of ways. Generally, an article for distribution includes a container containing the pharmaceutical composition in an appropriate form. Suitable containers are well known to those skilled in the art and include, for example, materials such as bottles (plastic and glass), sachets, foil blister packs, and the like. The container may also include a tamper-evident assembly to prevent inadvertent access to the contents of the package. In addition, the container typically has a label affixed thereto that describes the contents of the container and any appropriate warnings or instructions.
[0268] The disclosed pharmaceutical compositions may be presented in a pack or dispenser device, which may contain one or more unit dosage forms containing the active ingredient, if desired. The pack may, for example, contain metal or plastic foil, such as a blister pack. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also have attached thereto a notice associated with the container in a format prescribed by a government agency regulating the manufacture, use, or sale of pharmaceuticals, the notice reflecting approval by the agency of the form of the drug for human or veterinary administration. Such notice may, for example, be a label approved by the U.S. Food and Drug Administration for prescription drugs, or an approved product insert. Pharmaceutical compositions containing the disclosed compounds formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition.
[0269] The exact dosage and frequency of administration, as is well known to those skilled in the art, depends on a variety of factors specific to the particular organism or mixture of organisms disclosed, the particular condition being treated and the severity of the condition being treated, the medical history of the subject to whom the dosage is administered, such as the age, weight, sex, extent of the disorder, and general physical condition of the particular subject, as well as other medications that the individual may be taking. Furthermore, it will be apparent that the above-mentioned effective daily amounts may be reduced or increased depending on the response of the treated subject and / or depending on the evaluation of the physician prescribing the compounds of the present disclosure.
[0270] Depending on the mode of administration, the pharmaceutical composition may contain from 0.05 to 99% by weight, preferably from 0.1 to 70% by weight, more preferably from 0.1 to 50% by weight of active ingredient and from 1 to 99.95% by weight, preferably from 30 to 99.9% by weight, more preferably from 50 to 99.9% by weight of a pharma- ceutically acceptable carrier, all percentages being based on the total weight of the composition.
[0271] For example, in the treatment of conditions such as Crohn's disease, ulcerative colitis, or other forms of inflammatory bowel disease, suitable dosage levels are generally about 1 billion to about 10 billion CFU per unit dosage, and can be administered in single or multiple doses. Within this range, dosages can be about 10, 50, 100, 150, 200, 250, or about 30 billion CFU of genetically modified S. boulardii per day. The compound can be administered on a regimen of 1 to 4 times per day, preferably 1 or 2 times per day. In an exemplary embodiment, an oral dosage form can contain 5 billion CFU in a 250 mg capsule, and two capsules can be administered twice per day. This dosage regimen can be adjusted to provide an optimal therapeutic response.
[0272] In one embodiment, in the pharmaceutical composition, the oral dosage form comprises an engineered strain of Saccharomyces yeast from about 1 billion colony forming units (CFU) to about 10 billion CFU per unit dose, or about 10, 50, 60, 70, 80, 90, or about 10 billion CFU per unit dose, or any combination of the foregoing values, or a range encompassing any of the foregoing values. In some embodiments, the pharmaceutical composition is acid resistant.
[0273] In another embodiment, the method comprises administering the pharmaceutical composition for about 3 days to about 4 weeks, months, or years, or for about 3, 4, 5, 6, or 7 days, or for 2, 3, or 4 weeks, or for about 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 months, or for about 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80 years, or more years, or any combination of the foregoing values, or a range encompassing any of the foregoing values. In another embodiment, the pharmaceutical composition is administered once a day to four times a day, or 1, 2, 3, or 4 times a day.
[0274] Such unit doses described herein above and below can be administered more than once a day, for example, 2, 3, 4, 5, or 6 times a day. In various embodiments, such therapy can be extended for weeks or months, in some cases, for years, or as long as the patient's symptoms persist. In one embodiment, in the case of inflammatory bowel disease, oral dosage forms can be administered as long as symptoms persist. In one embodiment, in one example of inflammatory bowel disease, oral dosage forms can be administered to maintain disease remission for several years or lifelong. However, it will be understood that the specific dose level for any particular patient will depend on a variety of factors, including the activity of the specific compound used, the age, weight, general health, sex, and diet of the individual being treated, the time and route of administration, excretion rate, other drugs previously administered, and the severity of the specific disease being treated, as will be well understood by those skilled in the art.
[0275] A typical dosage might be 1 mg to about 100 mg tablets or 1 mg to about 300 mg tablets taken once a day, or multiple times a day, or one time-release capsule or tablet containing a proportionately higher content of active ingredient taken once a day. The time-release effect can be obtained by capsule materials that dissolve at different pH values, by capsules that release slowly by osmotic pressure, or by any other known means of controlled release.
[0276] It may be necessary to use dosages outside these ranges in some cases, as will be apparent to one of skill in the art. Furthermore, it should be noted that the clinician or treating physician will know when and how to initiate, interrupt, adjust, or terminate therapy in conjunction with the response of an individual patient.
[0277] The disclosed pharmaceutical compositions may further comprise other therapeutically active compounds that are typically applied in the treatment of the above mentioned pathological or clinical conditions.
[0278] Administration Administration of the disclosed technology (e.g., engineered strains of Saccharomyces yeast and pharmaceutical compositions comprising same) can be done in a single dose, continuously, or intermittently. Methods of determining the most effective means and dosages of administration are known to those of skill in the art and will vary depending on the composition used, the purpose of therapy, and the like. Single or multiple administrations can be carried out with the dose level and pattern selected by the treating physician. In some embodiments, the disclosed technology is administered once daily for a period of time. In some embodiments, the disclosed technology is administered twice daily for a period of time. In some such embodiments, the period of time includes, for example, days (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 14, 21, or 30 days), months (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months), or years (e.g., 1, 2, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, or more years).
[0279] Methods for carrying out suitable dosage formulations and techniques of the present disclosure are known in the art. Routes of administration can also be determined, and methods for determining the most effective route of administration are known to those skilled in the art and will vary depending on the composition used for treatment, the purpose of treatment, the health condition or disease stage of the subject being treated, and the target cell or tissue. Non-limiting examples of routes of administration include oral administration, vaginal administration, nasal administration, injection, topical application, and suppository.
[0280] In any of these embodiments, the engineered strain of Saccharomyces yeast occupies the subject's intestine about 3 to about 5 days after oral delivery of the pharmaceutical composition. In one embodiment, due to this temporary occupancy of the intestine, the dosage of the pharmaceutical compositions disclosed herein, as well as the duration of treatment, can be carefully controlled using the disclosed oral delivery mechanisms.
[0281] Combination therapy Also provided herein are methods of treating and / or preventing a disease, disorder, and / or condition in a subject in need thereof, comprising administering to the subject an effective amount of an engineered strain of Saccharomyces yeast described herein, or a pharmaceutical composition comprising same, and a therapeutically effective amount of an antibiotic. In some embodiments, the antibiotic is administered simultaneously with the engineered strain of Saccharomyces yeast described herein, or a pharmaceutical composition comprising same. In some embodiments, the antibiotic is administered prior to the engineered strain of Saccharomyces yeast described herein, or a pharmaceutical composition comprising same. In some embodiments, the antibiotic is administered after the engineered strain of Saccharomyces yeast described herein, or a pharmaceutical composition comprising same.
[0282] In some embodiments, the antibiotic may be selected from, for example, metronidazole, ciprofloxacin, rifaximin, ampicillin, tetracycline, amoxicillin, doxycycline, levofloxacin, potassium clavulanate, vancomycin, sulfamethosazole, trimethoprim, clindamycin, tinidazole, tyrosine, or any combination thereof. In one aspect, the pharmaceutical compositions disclosed herein are superior to probiotic compositions containing only bacteria due to the ability to co-administer antibiotics as needed. Furthermore, in this aspect, unlike bacterial probiotics, the engineered strains of Saccharomyces yeast are not susceptible to antibiotics.
[0283] In some embodiments, the effectiveness of drugs used parenterally can be improved by regulating intestinal function.It is well known that intestinal microbes can affect cancer treatment.Without wishing to be bound by any theory, intestinal inflammation affects the abundance and composition of intestinal microbes, which in turn affects anti-cancer treatment, and therefore, in some embodiments, engineered strains of Saccharomyces yeast can be administered together with anti-cancer drugs to improve the effectiveness of treatment.
[0284] Having now described aspects of the present disclosure, the following examples generally describe some additional aspects of the present disclosure. Aspects of the present disclosure will be described in conjunction with the following examples and corresponding text and drawings, but there is no intent to limit the present disclosure to these illustrative aspects. On the contrary, the intent is to cover all alternatives, modifications, and equivalents included within the spirit and scope of the present disclosure. EXAMPLES
[0285] The following examples are presented to provide those of ordinary skill in the art with a complete disclosure and description of how the compounds, compositions, articles, devices and / or methods claimed herein are made and evaluated, are intended to be purely exemplary of the invention, and are not intended to limit the scope of what the inventors regard as their disclosure. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless otherwise specified, parts are parts by weight, temperature is in ° C. or is at ambient temperature, and pressure is at or near atmospheric pressure.
[0286] Example 1: Sb-mSdAb (BioPYM™) Technology Platform The work described herein builds a novel platform technology against, for example, enteric pathogens by engineering the probiotic yeast Saccharomyces boulardii to secrete, for example, multispecific single domain (VHH) antibodies (Sb-mSdAb) to directly neutralize key enteric disease biomarkers. This platform is also referred to as Bioengineered Probiotic Yeast Medicines (BioPYM™).
[0287] Using this innovative technology, we generated an exemplary therapeutic lead, Sb-ABAB, designated FZ002, which constitutively secretes tetraspecific single domain antibodies ABAB as mSdAb fusion polypeptides consisting of four non-overlapping VHHs that potently and broadly neutralize two major C. difficile enterotoxins, TcdA and TcdB. Secretion of functional ABAB was confirmed both in vitro and in vivo. For in vitro characterization, secretion of ABAB was confirmed by Western immunoblotting (Figure 1A), and the expected neutralizing activity of secreted ABAB against both TcdA and TcdB, as well as purified Fc-ABAB fusion polypeptides, was also confirmed (Figure 1B). The final Sb-ABAB clone had comparable growth to wild-type Sb and empty plasmid-transformed Sb (Sb-EP) controls (Figure 1C), and also had stable growth secreting ABAB over 7 days of passaging (Figure 1D). Compared with the wild type, Sb-ABAB was similarly resistant to a panel of antibiotics, but not to the antifungal G418, which is toxic to eukaryotic cells ( Fig. 1E ).
[0288] To investigate the in vivo properties of Sb-ABAB and the highest achievable dose in mice, 10Mice were orally gavaged with colony forming units (CFU) of engineered yeast (Figure 2A). Mice gavaged with S. boulardii (Sb), Sb-EP (Sb yeast transformed with an "empty plasmid" (pURA3-AT-cMyc) containing no ABAB transgenes), or Sb-ABAB gained weight similar to placebo (PBS) (Figure 2B), and these strains shared comparable persistence patterns in these mice (Figure 2C). Furthermore, Sb-ABAB, unlike Sb-EP, secreted functional ABAB in the ileum, cecum, and colon of mice after oral gavage (Figure 2D). Finally, Sb-ABAB recovered from mouse feces continued to stably secrete ABAB (Figure 2E). ABAB levels in feces on day 3 were determined by ELISA (Figure 2F). Furthermore, we showed that oral FZ002 conferred significant protection against both primary and recurrent C. difficile infection in mice.
[0289] Figures 9A-9B show that piglets administered Sb-ABAB eliminated viable yeast and ABAB in the feces. Figures 10A-10B show that mice gavaged with Sb-ABAB are protected from death and intestinal inflammation induced by C. difficile. Prior to the bacterial challenge, mice were administered PBS, Sb-EP, or Sb-ABAB (10 9 Mice were gavaged with 10 4 CFU of C. difficile spores were challenged. Mice survival and intestinal histology are shown.
[0290] Example 2: Construction of Sb-amTNF We constructed a prototype yeast Sb-amTNF (FZ006m) secreting anti-mouse TNF-α VHH, which allowed us to evaluate the therapeutic potential of the engineered yeast against intestinal inflammatory disease in conventional mice. We showed that homodimers of anti-mouse TNF-α VHH fused to Fc showed the highest neutralizing activity (Figures 3A-3D). We therefore engineered Sb-amTNF strains by inserting VHH / VHH-Fc cassettes within the pTEF or pTDH locus of auxotrophic Sb strains. Sb-amTNF stably secreted functional anti-mouse TNF-α VHH / VHH-Fc as detected by ELISA and cell culture assays (Figures 3A-3D).
[0291] Example 3: Oral Sb-amTNF reduces the severity of intestinal inflammatory disease First, we tested whether intestinal delivery of a potent TNF-α neutralizing antibody improves symptoms of dextran sulfate sodium (DSS)-colitis. Mice continued to drink water containing 2% DSS for 8 days as previously described. Starting on day 3, mice were given 10 9 CFU of Sb-amTNF were gavaged daily for 11 days. Control groups were gavaged with the same amount of Sb-EP control or PBS. Figure 4A shows that none of these mice treated with oral Sb-amTNF died, whereas 20% of the mice died in the control group. Because DSS-colitis alone did not induce significant clinical mortality in mice, we utilized a significantly severe intestinal inflammation model of DSS-colitis in comorbid C. difficile infection. In this comorbidity model, mice developed severe intestinal inflammation, tissue damage, and 80% of the mice died. Since TNF-α was significantly upregulated, we investigated whether anti-TNF-α antibodies delivered to the intestine by engineered S. boulardii would ameliorate disease severity and reduce intestinal inflammation. Comorbidity mouse groups were treated with PBS, Sb-EP, or Sb-amTNF for 10 min at 4°C. 9CFU / dose were orally administered daily from day -3 to day 7 (11 doses total). Whereas in the PBS and Sb-EP control groups, significant weight loss was evident and approximately 80% of the mice died from the disease, oral Sb-amTNF conferred substantial protection with significantly lower weight loss (Figure 4B) and 40% of the mice died (Figure 4C). Upregulation of colonic proinflammatory cytokines TNF-α (Figure 4D) and IL-6 (Figure 4E) was also significantly reduced. Subsequently, colon length reduction and tissue damage were also significantly ameliorated in mice treated with oral Sb-amTNF (Figures 4F-4G). Taken together, our proof-of-concept data showed that intestinal delivery of anti-TNF-α neutralizing antibodies via engineered S. boulardii (oral Sb-amTNF) significantly improved disease severity by reducing intestinal inflammation and tissue damage.
[0292] Example 4: Construction of a yeast strain secreting anti-human TNF-α neutralizing antibody Sb-ahTNF (FZ006) From the immune VHH yeast display library, eight VHHs that bind to human TNF-α protein or polypeptide and neutralize its cytotoxic activity against L929 cells have been identified. These VHHs were then randomly paired to form monomeric VHH-Fc and dimeric VHH / VHH-Fc, and 14 candidates with the best neutralizing activity were identified (Figure 5A). Compared to adalimumab (trade name as HUMIRA®), the heterodimer G1 was 24-fold more potent in neutralizing human TNF-α-mediated cytotoxicity of L929 cells (Figure 5A). G1 had a higher binding affinity to TNF-α than HUMIRA in ELISA (Figure 5B), and was more potent in blocking TNF-α binding to TNFR1 as determined by competitive ELISA (Figure 5C).
[0293] To construct an engineered yeast secreting an anti-human TNF-α antibody, an expression cassette for ahTNF (VHH-Fc fusion) was optimized and inserted into the yeast genome using the same strategy as that used to generate other therapeutic leads. The resulting yeast Sb-ahTNF strain (designated FZ006) had the same growth rate as the parent strain (Figure 6A) and stably expressed ahTNF over nearly 100 generations (8 days) of culture (Figure 6B). A representative 24-hour culture supernatant collected for the 7th day of passage had 1.2ug / ml of ahTNF. The ahTNF in the yeast supernatant had similar neutralizing activity as the G1 antibody purified from HEK293 cultures and was significantly more potent than Humira in neutralizing the cytotoxicity of human TNF-α against cultured L929 cells (Figure 6C). These data demonstrated that FZ006 stably expresses a fully functional anti-human TNF-α antibody.
[0294] Example 5: Experimental Method Sequencing Whole genome sequencing can be performed using PacBio P6C4 chemistry and Illumina HiSeq-1000 high-throughput sequencing technology, followed by standard assembly and annotation procedures, focusing specifically on loci where cassettes, e.g., the ahTNF cassette, have been inserted or where sequencing of site-specific insertions can be completed.
[0295] Growth of Sb strains The growth kinetics, as well as stability, uniformity, and thermotolerance of FZ006 and related strains (e.g., engineered strains of Saccharomyces yeast described herein) can be characterized. Knowledge of these factors can be used in upstream scale-up processes to effect commercial preparation of the disclosed products. The medium was chemically defined and free of animal-derived content. Synthetic Yeast Nitrogen Base (YNB) with glucose and yeast synthetic dropout medium supplements was used. For example, both Sb-amTNF and Sb-ahTNF grow well in this medium as wild-type yeast.
[0296] Daily passaging of engineered strains of Saccharomyces yeast described herein, including, for example, FZ006, in YNB medium was performed over a 10-day period or for approximately 100-120 generations of engineered strains of Saccharomyces yeast described herein, including, for example, FZ006, and growth was monitored by measuring the optical density and viability of the yeast cultures. Thermotolerance experiments were performed by culturing engineered strains of Saccharomyces yeast described herein, including, for example, FZ006, and the parent strain, at different temperatures (30, 37, 40, and 45° C.) for 4 hours. After culture conditions were optimized, high-density cultures in a BioFlo 320 were performed to allow for scaling of process development as needed. Engineered strains of Saccharomyces yeast described herein, including, for example, FZ006, were monitored for stability and homogeneity by sampling at different culture densities during fermentation and measuring growth and secretion (e.g., ahTNF secretion) of randomly chosen clones.
[0297] Stress state of stomach, intestines and bile salts Stress tolerance to gut environment was evaluated for several leads, such as FZ002 and FZ006, following the previously described protocol. Cultures of either engineered or wild-type yeast cells (OD = 0.8-1.2) were harvested by centrifugation, washed with distilled water, and then incubated for 1 h at 37 °C in: 1) a simulated gastric environment constructed by an aqueous solution containing 3 g / L pepsin (3200-4500 U / mg) and 5 g / L NaCI (pH 2.0), 2) a simulated gut environment aqueous solution containing 1 g / L pancreatin (903 U / mg) and 5 g / L NaCI (pH 8.0), and 3) YPD (yeast extract, peptone, dextrose) liquid medium supplemented with 0.1% mixture of bile salts (50% sodium cholate and 50% sodium deoxycholate). For experiments on solid media, exponentially grown cells in liquid YPD (4%) were diluted to an OD of 1.0 and 5 µL of this dilution was used to inoculate solid YPD medium (4%) supplemented with different concentrations of bile salts. Colonies were visualized after 48 h at 37 °C. The parameters generated here will be useful for validating the growth of engineered lead yeast strains in future CMC development.
[0298] Antibiotic susceptibility Exemplary Sb-ABAB and FZ002 were tested for susceptibility to a panel of antifungal and antibacterial agents as previously described (Figures 96-99). This important QC assay is useful not only to confirm the identity of engineered yeast strains, including, for example, FZ006 and FZ002, but also to determine potential bacterial contamination. Four antifungal agents (clotrimazole, fluconazole, itraconazole, and ketoconazole) were tested (Figure 96). A panel of antibacterial agents has been tested for another exemplary therapeutic lead FZ002 and Sb-ABAB against C. difficile (Figure 1E and Figure 97). Additional agents can be evaluated, including amoxicillin, ampicillin, bacitracin, ceftriaxone, chloramphenicol, cloxacillin, enrofloxacin, erythromycin, methicillin, penicillin G, streptomycin, and tetracycline from Sigma Aldrich. The parental strain was tested in parallel and, as previously reported ( Fig. 1E ), no changes in the antibiotic resistance profile were identified.
[0299] Example 6: Analytical method development Identification of FZ006 and additional exemplary engineered Saccharomyces yeast strains The full genome sequence of FZ006 and other exemplary engineered strains of Saccharomyces yeast described herein sets the basis for their identity. In addition, biochemical / phenotypic characteristics can be used to verify the identity of FZ006 and other exemplary engineered strains of Saccharomyces yeast described herein. To develop analytical methods to ensure the identity of the engineered Saccharomyces yeast strains described herein (including, for example, FZ006) during process development and manufacturing, primers used to amplify the rDNA internal transcribed spacer region (ITS) were used (Figure 90). In addition, primers for amplifying the 18S and 26S ribosomal RNA genes (on the ATCC product sheet), as well as the ahTNF cassette and flanking sequences, can also be synthesized. These primers can be used to amplify the corresponding genes for sequencing. In addition to sequence information, morphology and growth kinetics, the stress resistance patterns and antibiotic / antifungal resistance profiles described above can be used to determine the identity of engineered Saccharomyces yeast strains, including, for example, FZ006.
[0300] Strength of FZ006 and additional exemplary engineered Saccharomyces yeast strains The strength of the exemplary engineered Saccharomyces yeast strains described herein, including, for example, FZ006, is determined by two factors: the number of viable yeast and its production of GOI (e.g., nucleic acid encoding ahTNF). The viability of the exemplary engineered Saccharomyces yeast strains described herein, including, for example, FZ006, is determined by staining with a vital dye and counting colony forming units (CFU) on a viewing plate under an automated cell counter. The production of therapeutic polypeptide(s) (e.g., ahTNF) is measured by the amount of antibody secreted in picograms (picograms per cell per day, PCD) by one yeast in 24 hours under given culture conditions. Using synthetic YNB culture medium, 0.1 OD of the overnight culture is transferred to 50 mL of fresh medium and the exemplary engineered Saccharomyces yeast strains described herein, including, for example, FZ006, are cultured to late logarithmic phase of OD10. Culture supernatants can be collected every 3 hours for 24 hours and the amount of therapeutic polypeptide(s) produced, including, for example, ahTNF, can be determined by ELISA.
[0301] Quality & Purity The quality and purity can be determined primarily during the manufacturing process. Parameters that can be used include, for example, sterility, physical appearance, pH of the culture, endotoxin levels, bioburden, viability, purity, and identity. To ensure the quality and purity of the exemplary engineered Saccharomyces yeast strains described herein, including, for example, FZ006, all chemicals used in the culture can be United States Pharmacopeia (USP) grade or food grade to generate a cell bank. The cell bank can be developed, for example, according to CVD standard protocols. The exemplary engineered Saccharomyces yeast strains described herein, including, for example, FZ006, can be grown on agar plates with a non-selective chemically defined medium. The cultures can be checked to ensure uniformity and morphology of colony type prior to harvesting and resuspension in medium supplemented with 20% glycerol. Frozen vials (100) can be prepared and stored in a dedicated -80°C freezer. Three vials can be tested for purity based on the tests described in the USP. If any microbial contamination is identified, the bank can be discarded and a new cell bank can be generated.
[0302] Example 7: Pharmacokinetic and safety profiles of exemplary engineered Saccharomyces yeast strains, including, for example, FZ006 and FZ002 Oral Sb-amTNF protected mice from intestinal tissue damage and inflammation-associated DSS-colitis, suggesting that viable Sb-amTNF distributed to the colon and produced therapeutic levels of amTNF. The pharmacokinetic (PK) properties of FZ006, Sb-ABAB, and FZ002 were evaluated by determining gastrointestinal distribution, attachment or excretion of yeast, secretion of ahTNF or ABAB, and clearance of yeast and antibodies, or ABAB (Figures 2A-2F, Chen et al, Sci.Transl.Med 2020). Potential anti-drug responses were determined by assessing host anti-amTNF IgA and IgG following oral long-lasting FZ006m administration (Figures 12A-12B). Additionally, for example, the ability of intestinal FZ006 to translocate to the circulation can be determined in immunosuppressed mice.
[0303] Pharmacokinetics of exemplary engineered Saccharomyces yeast strains, including, for example, FZ006 and FZ002 Preliminary PK studies showed that oral gavage of FZ002 resulted in the elimination of viable yeast in the mouse intestine and the secretion of ABAB (Figures 2A-2E). Oral Sb-amTNF also resulted in a significant reduction in colitis symptoms by improving intestinal inflammation (Figures 4A-4G). These data indicated that viable yeast reached the mouse lower intestine after oral administration and secreted therapeutic doses of neutralizing antibodies. The intestinal distribution of yeast can be systematically investigated in parallel with the production and excretion of antibodies. Mice were administered 10 8 , 10 9、 and 10 10 CFU / dose / day for 7 days. 10By including a dose of CFU, mouse tolerability of oral FZ006 can be evaluated at the highest dose achievable through a gavage needle. Feces can be collected from each mouse prior to oral yeast administration (for background) and then daily for up to 7 days after cessation of yeast treatment). In each group, 6 mice (3 males and 3 females) can be euthanized on days 0, 1, 3, 6, 9, and 14 and the following tissues / organs can be collected: small and large intestine (different segments and lavage fluids from ileum, cecum, and colon), mesenteric lymph nodes (MLN), liver, spleen, and blood samples. All samples can be analyzed based on the assays described above. Mouse feces and intestinal lavage fluids can be diluted in PBS and plated on Sabouraud agar plates, which can be selected for growth of Sb to determine CFU between groups, as described above. Sb colonies can be picked randomly and placed into liquid culture to measure secretion (e.g., secretion of ahTNF) to verify stable antibody production. MLN, spleen, and liver tissues may be weighed, homogenized, and filtered to assess absorption and potential systemic dissemination of viable yeast. These tissues, along with blood samples, can then be placed on Sabouraud agar to identify colonies, and if any colonies are observed, the yeast can be analyzed by PCR for the ahTNF gene, as previously described. To assess absorption, distribution, and excretion of ahTNF, feces, intestinal contents, segments of intestinal tissue, MLN, liver tissue lysates, and blood samples can be diluted in protease-containing PBS, and the amount of ahTNF, for example, can be quantified via standard ELISA.
[0304] Exemplary Host Anti-ahTNF Responses Following Oral FZ006 Administration It can be determined whether oral FZ006 induces mucosal IgA and systemic IgG against secreted ahTNF over the course of multiple FZ006 treatments. The dose of oral FZ006 that shows the highest enteroendocrine secretion of ahTNF in PK studies and is administered a total of 21 times can be selected, thereby evaluating whether oral FZ006 induces long-lasting potential anti-drug responses that may reduce the therapeutic potential of FZ006. Groups of mice (n=10, 5 males and 5 females) can be orally administered FZ006 daily for 7 days (considered as one oral FZ006 treatment cycle), followed by a 14-day rest period. This can be repeated three times for three oral FZ006 cycles (a total of 21 doses of FZ006). A control group can receive the same amount of Sb-EP. A control of systemically injected purified ahTNF (iv injection of 10 mg / kg ahTNF) can also be included. Fecal and blood samples of mice can be collected on day 0, prior to the first oral dose of yeast, and then on day 7 after each oral FZ006 cycle. Ten days after the final FZ006 dose, mice can be euthanized and intestinal washings collected. Specific IgA from feces and intestinal washings, as well as serum IgG against ahTNF, can be measured by ELISA using plates coated with purified anti-human TNF antibodies. If an anti-ahTNF antibody response was detected, neutralization of ahTNF activity by host anti-ahTNF antibodies was determined using a cell-based bioassay (Figure 5A).
[0305] Determination of Sb systemic transport in immunosuppressed individuals following exemplary oral FZ006 administration Sb has been used as a probiotic since the 1950s and has been studied extensively in clinical trials with an excellent safety profile. However, rare cases of fungemia were identified, mostly in individuals with severe comorbidities and central venous catheters in the intensive care unit. In animals, 10 mg of engineered yeast, the highest possible dose achieved via gavage needle, was administered without observing any side effects. 10CFU are administered. For example, it can be determined whether oral FZ006 leaks into the systemic circulation of immunosuppressed mice. Mice (n=10, 5 males and 5 females) can be injected ip with 100 mg / kg cyclophosphamide on alternate days (0, 2, 4, 6, and 8) for a total of 5 injections to induce immunosuppression. On day 3, mice can be injected with 10 10 CFU of FZ006 are gavaged for 7 consecutive days. Control groups of mice can be fed PBS or Sb-EP. Mice can be euthanized on day 10 and blood, MLN, spleen, and liver tissue can be collected to determine the presence of viable yeast. In addition, samples can be plated on BHI agar plates and bacterial counts determined to determine, for example, whether FZ006 or Sb-EP treatment affects bacterial translocation. Previous studies have found that probiotic Sb yeast helps maintain gut barrier function and reduce bacterial translocation from the gut lumen into the blood circulation. Oral FZ006, as well as other exemplary engineered strains of Saccharomyces yeast described herein, when administered to humans, may show additional beneficial effects on gut barrier function by reducing gut inflammation via secretion of therapeutic polypeptide(s) (e.g., anti-human TNF-α).
[0306] Further Experiments and Expected Results Characterization of other products (e.g., engineered strains of Saccharomyces yeast described herein, e.g., FZ006) can be performed. When analyzing PK results, the following can be monitored: 1) when mice begin to clear e.g., FZ006 after oral administration, how long the mice continue clearing yeast after the last dose, 2) when the clearance of yeast stabilizes, 3) the intestinal location of viable yeast, 4) the relationship between oral dose and intestinal therapeutic polypeptide(s) (e.g., ahTNF) production, and 5) the intestinal distribution of therapeutic polypeptide(s) (e.g., ahTNF) and its systemic dissemination. These studies can yield useful information regarding the intestinal kinetics of engineered strains of Saccharomyces yeast described herein (e.g., FZ006), as well as the secretion and distribution of therapeutic polypeptide(s) (e.g., ahTNF). It is expected that there may be undetectable systemic dissemination of viable yeast and absorption of therapeutic polypeptide(s) (e.g., ahTNF) in normal mice. Without wishing to be bound by any theory, due to the complex gut environment and the constitutive production of therapeutic polypeptide(s) (e.g., ahTNF) by engineered strains of Saccharomyces yeast (e.g., FZ006), it may be difficult to accurately measure gut metabolism of therapeutic polypeptide(s) (e.g., ahTNF). However, PK studies may allow for the assessment of stable gut levels of therapeutic polypeptide(s) (e.g., ahTNF) during oral yeast administration. Although the levels of gut therapeutic polypeptide(s) (e.g., ahTNF) may vary in different pathophysiological conditions, ADME / PK studies and animal efficacy studies may provide knowledge regarding oral doses of engineered strains of Saccharomyces yeast (e.g., FZ006) that lead to therapeutic levels of gut therapeutic polypeptide(s) (e.g., anti-TNF antibodies). This information may be important for determining future doses and schedules for oral treatment of engineered strains of Saccharomyces yeast (e.g., FZ006) in clinical trials.
[0307] VHHs are generally non-immunogenic, even when injected systemically. ahTNF, an exemplary therapeutic polypeptide(s) delivered to the intestine via probiotic yeast, should have even less risk of inducing anti-drug responses. For example, if detectable levels of IgA or IgG against ahTNF are induced, for example, with 21 doses of FZ006 over 8 weeks, it can be determined whether the magnitude of the anti-VHHs response is dose- and time-dependent, so that the extent of the anti-drug response can be minimized by optimizing the administration and schedule of the engineered strain of Saccharomyces yeast containing FZ006. Sb showed a protective effect in immunosuppressed mice, preventing the transfer of bacteria and pathogens into the circulation. When high doses of Sb are administered, low counts of Sb can be detected systemically in immunosuppressed mice. In this case, mice may experience adverse effects, which are closely monitored during administration of the engineered strain of Saccharomyces yeast containing FZ006 or Sb-EP. Any adverse effects may be correlated with the number of Sb in circulation. If such a correlation is established and significant adverse effects occur, the experiment can be repeated to evaluate whether systemic fluconazole can efficiently remove the yeast from the bloodstream and alleviate symptoms. In such cases, serum-sensitive yeast can be engineered for therapeutic strains such that the engineered yeast dies rapidly once seeded in the bloodstream.
[0308] Example 8: Preclinical efficacy evaluation of FZ006 in human TNF-α transgenic mice Because FZ006 secretes ahTNF (VHH-Fc fusion) that neutralizes only human TNF-α, its therapeutic efficacy can be verified using human TNF-α transgenic mice. IBD is a complex disease, and no single animal disease model can recapitulate the pathogenesis of the disease in humans. Therefore, both DSS-induced colitis and adoptive T cell transfer-induced colitis can be used as models, since these are the two most widely used animal colitis models to mimic some aspects of the pathogenesis of human UC.
[0309] The DSS-induced colitis model is one of the most widely used model types in preclinical research due to its relatively simple protocol. Colitis results from the damaging effect of DSS, a negatively charged sulfated polysaccharide, on epithelial cells. Inflammation limited to the colon is primarily induced by proinflammatory cytokines, namely TNF-α, produced by innate immune cells and is primarily characterized by ulceration and granulocytic infiltration. The adoptive T cell transfer model is used to induce chronic colonic inflammation that resembles some key aspects of human IBD. This model involves the transfer of naive CD4 T cells from donor mice to syngeneic immunodeficient recipients. + T cells (i.e., CD4+CD45RB hi ) that leads to colonic inflammation, primarily at about 10 weeks after cell transfer. This inflammation is due to the T regs This is due to a lack of CD4 cells compared to control patients. + CD45RB low CD4 cells produce less IL-10, IL-4, and more proinflammatory cytokines, such as TNF-α, than T cells. + CD45RB hi This is consistent with observations in IBD patients that show intestinal tissue with an influx of T cells. Both DSS and adoptive T cell transfer models have been widely used to evaluate the therapeutic efficacy of anti-TNF-α agents for UC because inflammation is primarily localized in the colon and TNF-α plays a major role in the immunopathology of colitis. Therefore, these two models can be used to evaluate the therapeutic efficacy of FZ006.
[0310] Efficacy of oral FZ006 against DSS-induced colitis in human TNF-α transgenic mice Because FZ006 secretes anti-human TNF-α VHH-Fc that neutralizes only human TNF-α, its therapeutic efficacy can be verified using human TNF-α transgenic Tg1006 mice. Tg1006 mTNFKO mice (mTNFα:- / -, hTNFα:+ / -; from Taconic), which express only human TNF-α, can spontaneously develop severe arthritis in both front and hind paws at approximately 20 weeks of age due to overexpression of human TNF-α. Both DSS acute colitis and chronic colitis in Tg1006 mice can be induced according to previously published protocols. In the acute colitis model, mice are fed 3% (weight / volume) DSS in drinking water for 7 days. Long-lasting chronic colitis can be induced by three cycles of 2% DSS (8 days of DSS induction, 14 days of water). Because these Tg mice overexpress human TNF-α, it is expected that they may develop more severe colitis symptoms than normal conventional mice in both acute and chronic models.
[0311] To evaluate the therapeutic efficacy of FZ006 against acute colitis, mice were treated with FZ006 (10 mg / kg / day) daily for 11 days, starting from the third day of DSS treatment. 7 , 10 8 , or 10 9 Control mice were orally administered 10 9 CFU of Sb-EP can be gavaged. Clinical symptoms such as body weight, diarrhea, temperature, and survival rate can be monitored. In addition to clinical symptoms, experiments can be designed to evaluate the protection of oral FZ006 against mouse intestinal tissue damage and inflammation. On the day after the last yeast administration and 7 days after the last administration, 4 mice (2 males and 2 females) are euthanized and colonic tissues are collected from these mice to evaluate tissue damage and inflammation via histology. In addition, cytokine levels in blood and colonic tissue can be evaluated using multiplex ELISA as previously described. In addition to monitoring symptoms of disease, fecal samples and intestinal washings can be collected to monitor the intestinal distribution and clearance of viable yeast, as well as the secretion of ahTNF.
[0312] To evaluate the therapeutic efficacy of FZ006 against chronic colitis, mice were treated with water, Sb-EP, or FZ006 (10 7 , 10 8 , or 10 9 CFU) can be gavaged daily from days 3 to 14, 24 to 35, and 45 to 56, covering several DSS treatment and post-treatment periods. Mice can be monitored for clinical symptoms such as body weight, diarrhea, body temperature, and mouse survival. In addition to clinical symptoms, experiments can be designed to evaluate the protection of oral FZ006 against mouse intestinal tissue damage and inflammation. All but four mice (two males and two females) from each group can be subjected to the same dosing schedule and euthanized on the day of the last oral yeast administration of each cycle. Colon tissue from these mice can be collected for length measurements and macroscopic examination. Intestinal epithelial damage and inflammation can be examined via histology. Proinflammatory cytokines and chemokines in intestinal tissue and blood circulation can be evaluated using multiplex ELISA, as previously described. In addition to monitoring symptoms of disease, fecal samples and intestinal washings can be collected to monitor the intestinal distribution and clearance of viable yeast, as well as the secretion of ahTNF. As previously proposed, fecal and blood samples can be evaluated for anti-drug responses to see if anti-ahTNF IgG and IgA are induced. These results can be compared with data generated from previous experiments to understand whether host intestinal inflammatory disease alters the PK and anti-drug response of FZ006.
[0313] Therapeutic efficacy of FZ006 in an immune T cell transfer model using Rag mice In this model, we first isolated CD4 T cells from 8-week-old Tg1006 mice using published protocols. + CD45Rb hiT cells can be prepared. Briefly, donor splenocytes are isolated from gently minced spleens through a 70 μm cell strainer. T cells are separated from other cells using the T cell EasySep kit (STEMCELL Technologies). CD4 + CD45Rb hi T cells were isolated using a cell sorter and then cultured in sex-matched RAG - / - The recipient mice (Jackson Laboratories) were then transferred with T cell transfer inhibitors (T cell transfer inhibitors) into the recipient mice. Chronic colitis was allowed to fully develop in the recipient mice after 10 weeks of transplantation. The control group consisted of RAG mice without T cell transfer, which did not develop colitis. - / - It's a mouse.
[0314] Based on previous observations, inflammatory disease occurs primarily about 10 weeks after T cell transfer. When diarrhea occurs about 10 weeks after T cell injection, mice may be orally gavaged with FZ006 daily for 14 days. The previously determined dose of FZ006 that provides the best protection in the DSS colitis model may be used. Control groups may be gavaged with PBS or the same dose of Sb-EP. Disease symptoms are closely monitored during and after oral yeast treatment. If diarrhea recurs after cessation of FZ006 treatment, another series of oral FZ006 treatments may be initiated. A series of treatments of up to three episodes may be performed for chronic DSS-colitis to assess whether oral FZ006 can reduce the severity and duration of colitis in T cell-transferred mice when compared to control treatment. In addition to monitoring for disease symptoms, four mice from each group may be euthanized at the end of the first episode of FZ006 treatment and intestinal tissue can be collected to assess mucosal protection as previously described.
[0315] Expected results Sb-amTNF protected conventional mice from severe colitis induced by DSS and C.difficile, suggesting that the yeast strain expressed therapeutic doses of anti-mouse TNF-α in the intestine. Oral FZ006 can exhibit similar PK properties as Sb-amTNF and is expected to express anti-human TNF-α in the mouse intestine. Therefore, human-specific FZ006 should significantly reduce DSS-colitis in Tg1006 transgenic mice expressing human TNF. It is also expected that oral FZ006 can protect mice from colitis in an adoptive T cell transfer model. Because transgenic mice express only human TNF-α, overexpression of TNF-α may cause significantly more severe colitis than conventional mice. In such cases, significant protection was observed, as oral Sb-amTNF provided significant protection against severe colitis induced by DSS together with C.difficile (Figures 4A-4G). Considering the high affinity and potent neutralizing activity of G1, 7 or 10 8 A significant efficacy of oral FZ006 at low doses of CFU was observed against intestinal inflammation compared to the control group, and may even reduce clinical symptoms, intestinal tissue damage, and inflammation. One potential problem is that CD4 + CD45Rb hi Adoptively transferred RAG T cells overexpressing human TNF-α - / - The mice may experience intestinal inflammation and onset of disease symptoms much earlier than normally observed. Disease symptoms in mice can be monitored as early as 6 weeks after T cell transfer. However, typically, adoptive T cell transfer models are highly reproducible, and the time window for disease onset should be easily identified. Based on these experiments, an oral yeast administration schedule can be designed to test the therapeutic efficacy of FZ006.
[0316] When testing therapeutic efficacy, up to 10 9 Oral doses of yeast CFU can be used. Human studies have shown that up to 2 g of dry Sb per day can be used in combination with one capsule (4 × 1010 Given the difference in body size between mice and humans, the daily dose of 10 9 CFU of oral yeast is a significantly higher dose. As shown in Figure 2C, mice were administered 10 10 After daily oral gavage of CFU of yeast, approximately 10 6 ~10 7 Only CFU of viable yeast / g feces were removed, suggesting that the majority of gavaged yeast in solution was not viable and was likely killed by stomach acidity. Thus, although high oral doses were used in mice in these experiments, the amount of viable yeast reaching the colon was relatively low. This issue could be mitigated by future formulation developments that encapsulate the viable yeast in the dry powder with an enteric-coated capsule, protecting the viable yeast from stomach acidity and potentially improving therapeutic potential.
[0317] statistical analysis Differences in Sb clearance and anti-TNF-α antibody levels can be assessed using Fisher's exact test. Survival times and survival rates can be compared using Kaplan-Meier, Wilcoxon and log-rank tests. Comparisons of clinical symptoms weight loss and diarrhea can be made using analysis of variance and covariance and Duncan's multiple comparison test. Data are expressed as mean ± SEM or SD. The protective effect of FZ006 can be analyzed with either a two-tailed Mann-Whitney test or an unpaired t-test. All statistical analyses can be performed using GraphPad Prism v.6 and data can be considered significant at a P value of less than 0.05.
[0318] Animal Selection The effect of sex on the response to engineered yeast in colitis is unknown. To reduce biological variables, both male and female animals can be used. For mice, 6-10 week old C57BL / 6J with body weights of 16-22 g can be used. Breeders of Tg1006 with a C57BL background are from Taconic. Each group may have 10-24 animals to minimize experimental error from differences between mice. A description of the animal use, procedures, and power as well as statistical analyses are provided above.
[0319] Example 9: Additional comorbidity model of CDI with adoptive T cell transfer colitis The method for T cell transfer colitis (TCC) was previously described. CD4 T cells were cultured from 8-week-old female C57BL / 6 donor mice. + CD45Rb hi Prepare T cells and incubate female RAG T cells on day 0 - / - recipient mice (Figure 7A). Moderate colitis developed 3 weeks after T cell injection (TCC alone group, Figures 7B-7D). CDI was induced by antibiotic cocktail treatment followed by oral gavage of C. difficile spores (VP110463, 10 4 For yeast treatment, mice groups were treated with Sb-amTNF (10 9 CFU / day / mouse), Sb-ABAB (10 9 CFU / day / mouse), or FZ006p (Sb-amTNF+Sb-ABAB, each 5 × 10 8 CFU / day / mouse) were orally administered from days 19 to 22 (Figure 7A). Mice were euthanized on day 22 and colon tissues were collected for histology and quantitative real-time RT-PCR analysis of interferon gamma (IFN-γ) mRNA expression. Sections were stained with H&E and photomicrographs were recorded at multiple locations and scored blindly by two investigators.
[0320] These new preliminary data show that oral Sb-amTNF reduced colonic tissue damage (Figures 7B-7C) and inflammation (Figure 7A) in TCC mice. Although oral Sb-ABAB alone did not significantly reduce IFN-y mRNA expression in colonic tissue (Figure 7D), its combination with Sb-amTNF substantially reduced colonic inflammation and tissue damage in co-morbid mice (Figures 7B-7D), indicating a synergistic effect of the combination therapy. These data are consistent with those shown in Figures 6A-6C, where oral FZ006p significantly protected mice against co-morbid CDI and DSS colitis.
[0321] Example 10: Generation and application of yeast strains This example provides an exemplary method for the generation of yeast strains. c MYA-796 is a parent diploid strain from ATCC and is a whole genome sequenced strain formally named Saccharomyces cerevisiae Meyen ex. ECHansen (also known as Saccharomyces boulardii or Saccharomyces cerevisiae var. boulardii). Genomic information can be extracted from the whole genome shotgun sequencing project of GenBank JRHY00000000 Saccharomyces sp. "boulardii" strain ATCC MYA-796.
[0322] d MYA-796(ura3- / -) is a mutant mouse model of ura3- / -, which is characterized by the absence of a functional ura3 gene. cThis is a uracil auxotrophic strain generated on the MYA-796 parent strain. Ura3 is a gene on chromosome V of MYA-796. Ura3 encodes orotidine 5'-phosphate decarboxylase (ODCase), an enzyme that catalyzes one reaction in the synthesis of pyrimidine ribonucleotides (building blocks of RNA). Ura3 allows for both positive and negative selection, making dMYA-796(ura3- / -) a powerful tool for genome engineering. This strain was genetically modified using homologous recombination, combined with a loxp-loopout strategy. A double knockout from the Ura3 gene can be generated by one or two steps of homologous recombination with two different antibiotic cassettes, flanked on the outside by 5-HAL-ura3 (40bp) and 6-HAL-ura3 (40bp) and on the inside by LoxP sites, replacing the URA3 gene. The double positive strains with both antibiotic resistances were screened, and then further URA3 counter selection (negative selection) with 5'-FOA for URA3 double knockout phenotype was completed. PCR-based site-specific deletion of the genomic Ura3 gene and insertion of the antibiotic marker cassette were completed using Cre-LoxP to delete both antibiotic cassettes. The LoxP (locus of X (cross)over at P1) site is a 34 base pair long recognition sequence (ATAACTTCGTATAGCATACATTATACGAAGTTAT, SEQ ID NO: 23) consisting of two 13 bp long palindromic repeats separated by an 8 bp long asymmetric core spacer sequence. After successful transformation with the Cre plasmid, loop-out of the antibiotic marker cassette adjacent to the LoxP site was induced. Cre plasmid positive clones were selected, and then the Cre plasmid was naturally lost by culturing the clones without selection stress. Screening of clones that lost the original antibiotic resistance and lost the Cre plasmid selection marker but were positive for 5'-FOA counter selection was performed. PCR and sequencing were performed to confirm the deletion of the antibiotic cassette and LoxP scar. CRISPR / Cas9 was also used to target genes and generate desired variants. Exemplary variants include: eMYA-796 (ura3- / -, gap1- / -), f MYA-796(ura3- / -,gap1- / -,pep4- / -), g MYA-796(ura3- / -,gap1- / -,prb1- / -), h MYA-796(ura3- / -, gap1- / -, thr1- / -), i Examples include MYA-796 (ura3- / -, gap1- / -, thr4- / -).
[0323] Mutations in protease genes for enhanced and stable protein or polypeptide(s) expression and secretion In addition to maximizing expression of the therapeutic polypeptide(s) by integrating highly expressed regions of the yeast genome with cassettes that utilize the cellular machinery of these loci, the expression, secretion, and stability of the protein or polypeptide (e.g., therapeutic polypeptide(s)) was also increased by deleting genes encoding proteases. pep4 (yeast proteinase A Pep4) is a vacuolar aspartyl hydrolase that not only degrades proteins or polypeptides in the vacuole but also activates additional vacuolar proteases such as Prc1 (carboxypeptidase Y), Prb1 (proteinase B), and Lap4 (aminopeptidase I). Without wishing to be bound by any theory, it was hypothesized that deleting pep4 increases secretion of the protein or polypeptide of interest (e.g., therapeutic polypeptide(s)) by removing or preventing maturation of all of these degradative enzymes.
[0324] To test the validity of this approach, pep4 was deleted from a S. boulardii strain (Sb-ABAB) that secretes neutralizing antibodies to C. difficile toxins A and B. Using a chemical transformation protocol, Sb-ABAB cells were transformed with PCR-amplified cassettes that conferred resistance to either geneticin or phleomycin. The homology sequences of these cassettes were designed to completely remove the pep4 open reading frame near the start codon and a short sequence of the gene promoter. Each resistance gene was surrounded by two LoxP sites to allow for subsequent removal by transformation of a Cre recombinase plasmid. Because the engineered strain of exemplified Saccharomyces yeast is a gap1 mutant, a Cre recombinase plasmid was designed containing the selectable and counterselectable gene gap1. Cells with successful pep4 targeted integration were selected on rich medium containing geneticin or phleomycin, and pep4 mutant clones were confirmed by colony PCR. Sb-ABAB pep4 clones 10 and 6b were confirmed to be pep4 mutants.
[0325] These protease null clones were cultured in rich YPD medium for 24 h in parallel with parental Sb-ABAB cells, as well as wild-type (WT) yeast that does not secrete ABAB antibodies and unseeded medium as a negative control. Supernatants from each culture were collected and the concentration of ABAB in the samples was determined using a designed ELISA protocol, followed by comparison with concentration reference standards included in the ELISA plate. The designed ELISA involves coating plates with C. difficile toxin B, blocking with milk, incubating the plates with supernatant diluted in milk, and treating with HRP-conjugated antibodies targeting the therapeutic polypeptide(s). The results showed that deletion of pep4 led to an approximately 42% increase in the concentration of ABAB in the supernatant (Figure 8).
[0326] Since intracellular proteases can degrade proteins or polypeptides (e.g., therapeutic polypeptide(s)) in the extracellular environment, either due to secretion or release following cell death, loss of pep4 and inhibition of the enzyme it activates was tested to determine whether increased stability of the protein or polypeptide of interest was observed over a longer period of time. Sb-ABAB pep4 null clones were cultured in parallel with control strains in unbuffered minimal medium that was acidified during yeast growth. Previously, it was observed that stability of the protein or polypeptide over 24 hours was lower in unbuffered medium. Supernatant samples were collected from each culture every 24 hours over a 5-day period, and the concentration of ABAB antibodies was determined using the ELISA protocol outlined above. The data showed that the concentration of ABAB was higher and more stable in samples from the pep4 mutants (Figure 36). In addition to minimizing degradation of therapeutic polypeptide(s) released into the intestine during treatment, this approach allows the use of S. boulardii cells for high and stable expression and purification of secreted proteins or polypeptides of interest. Due to the suc...
Claims
1. An engineered strain of Saccharomyces yeast, comprising at least one site-specific chromosomal insertion of a nucleic acid encoding a therapeutic polypeptide, wherein the therapeutic polypeptide is selected from a binding protein comprising an antigen-binding domain, an immunoglobulin, an antibody, a cytokine, a hormone, an enzyme, a peptide, and a chemokine, or a combination thereof, an engineered strain of Saccharomyces yeast.
2. The engineered strain of Saccharomyces yeast according to claim 1, wherein the yeast is Saccharomyces boulardii.
3. The engineered strain of Saccharomyces yeast according to claim 2, further comprising a complete or partial deletion of URA3.
4. The engineered strain of Saccharomyces yeast according to claim 1, further comprising a complete or partial deletion of GAP1.
5. The engineered strain of Saccharomyces yeast according to claim 1, wherein the yeast is ura3(− / −) and gap1(− / −).
6. The nucleic acid encoding the therapeutic polypeptide is integrated at at least two different positions within the genome of the yeast, or at at least one hot spot within the genome of the yeast, optionally the nucleic acid encoding the therapeutic polypeptide is integrated into at least two different chromosomes, and further optionally the at least two different chromosomes include chromosome VII and XVI, the engineered strain of Saccharomyces yeast according to claim 1.
7. (i) further comprising a nucleic acid sequence encoding dihydrofolate reductase (DHFR) integrated into the genome of said yeast, said DHFR optionally being mammalian DHFR, or (ii) further comprising one or more exogenous nucleic acids encoding yeast DFR1, the engineered strain of Saccharomyces yeast according to claim 1. **Claim 8** The engineered strain of Saccharomyces yeast according to claim 1, wherein the therapeutic polypeptide is a binding protein comprising a structure selected from VHH, Fc-VHH, VHH-Fc, VHH-VHH, VHH-VHH-VHH-VHH, Fc-VHH-VHH, VHH-Fc-VHH, and VHH-VHH-Fc, and each or any of said VHH or Fc domains is connected to another VHH or Fc domain via an optional linker sequence. **Claim 9** The engineered strain of Saccharomyces yeast according to claim 1, wherein the therapeutic polypeptide is selected from binding proteins that bind to TcdA, TcdB, TcdA and TcdB, TNF-α, IL-17A, TNF-α and IL-17A, norovirus, rotavirus, or cwp84. **Claim 10** The engineered strain of Saccharomyces yeast according to claim 1, wherein the therapeutic polypeptide is selected from cytokines, chemokines, GLP1, and leptin. **Claim 11** The engineered strain of Saccharomyces yeast according to claim 10, wherein the cytokine is IL-22 or IL-10, and optionally the cytokine or chemokine is fused to an Fc domain. **Claim 12** The engineered strain of Saccharomyces yeast according to claim 1, wherein the therapeutic protein comprises an amino acid sequence selected from any one of SEQ ID NOs: 5-25 and 27. **Claim 13** The engineered strain of Saccharomyces yeast according to claim 1, wherein said yeast contains at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10, or more copies of said nucleic acid encoding said therapeutic polypeptide integrated into its genome.
14. Further comprising at least one site-specific chromosomal insertion of a second nucleic acid encoding a second therapeutic polypeptide, The engineered strain of Saccharomyces yeast according to claim 1, wherein said second therapeutic polypeptide is selected from a binding protein containing a VHH domain, an immunoglobulin, a cytokine, and a chemokine, or a combination thereof.
15. A method of binding to an antigen in vivo, comprising administering to a subject the engineered strain of Saccharomyces yeast according to claim 1, optionally wherein said engineered strain of Saccharomyces yeast further comprises at least one site-specific chromosomal insertion of a second nucleic acid encoding a second therapeutic polypeptide, and said second therapeutic polypeptide is selected from a binding protein containing a VHH domain, an immunoglobulin, a cytokine, and a chemokine, or a combination thereof.
16. The method according to claim 15, wherein said antigen is selected from TcdA, TcdB, both TcdA and TcdB, TNF-α, IL-17A, both TNF-α and IL-17A, cwp84, a rotavirus protein, or a norovirus protein.
17. A method of treating or preventing a disease or condition, comprising administering to a subject in need thereof an effective amount of the engineered strain of Saccharomyces yeast according to claim 1.
18. The method according to claim 17, wherein said disease or condition is an inflammatory condition or an infection.
19. The method according to claim 18, wherein the inflammatory condition is selected from inflammatory bowel disease (IBD), intestinal inflammation, Crohn's disease, and ulcerative colitis, or the infection is C. difficile infection, norovirus infection, rotavirus infection, or a combination thereof.
20. The method according to claim 17, wherein the disease or condition is selected from irritable bowel syndrome (IBS), neurodegenerative disease, colorectal cancer, diabetes, obesity, eczema, bacterial vaginitis, vaginal candidiasis, stress, depression, anxiety, bipolar disorder, stroke, cardiovascular disease, fatty liver disease, metabolic disease, graft-versus-host disease (GVHD), or autoimmune disease.