Methods for modulating host cell surface interactions with human cytomegalovirus - Patents.com

Abstract

Provided herein are methods for treating or preventing human cytomegalovirus (HCMV) infection, comprising modulating the interaction between the HCMV gH / gL / UL128-131A pentamer and a plasma membrane-expressed host cell protein, as well as methods for identifying modulators of such an interaction.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Patent Application No. 63 / 193,529, filed May 26, 2021, and U.S. Patent Application No. 63 / 345,811, filed May 25, 2022, the contents of which are incorporated by reference in their entireties herein.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 25, 2022, has the name 50474-270WO3_Sequence_Listing_5_25_22_ST25 and is 24,223 bytes in size.

[0003] Provided herein are methods for treating or preventing human cytomegalovirus (HCMV) infection, comprising modulating the interaction between the HCMV gH / gL / UL128-131A pentamer and a plasma membrane-expressed host cell protein, as well as methods for identifying modulators of such an interaction. [Background technology]

[0004] Human cytomegalovirus (HCMV) is a member of the Betaherpesvirinae subfamily of the Herpesviridae family, which establishes a lifelong infection in over 70% of the human population. After primary infection, HCMV becomes latent, and its reactivation causes severe morbidity and mortality in individuals who are immunosuppressed or undergoing organ or hematopoietic stem cell (HSC) transplantation. HCMV poses a particular threat during pregnancy due to its ability to cross the placental barrier and infect the fetus. HCMV infection affects 0.3%-2.3% of newborns and is the leading viral cause of congenital birth defects, including brain damage, hearing loss, learning disabilities, heart disease, and mental retardation. For these reasons, HCMV has been identified as a high-priority disease target by the Institute of Medicine. Effective antiviral therapeutics or vaccines should target early steps in the HCMV infection cycle, including viral entry into host cells. HCMV uses several envelope glycoprotein complexes, including two gHgL envelope glycoprotein complexes, gHgLgO (trimer) and gHgLpUL128-131A (pentamer), as well as glycoprotein B (gB), to enter different cell lines. HCMV trimer or pentamer binding to a cellular host receptor provides a triggering signal for the HCMV glycoprotein gB to catalyze membrane fusion between the virus and the infected cell, through a yet to be identified mechanism. This fusion allows HCMV to enter the cell, replicate, and establish its latency.

[0005] During the past decades, significant efforts have been established to develop vaccine candidates against HCMV infection. However, results from recent clinical trials have shown that HCMV vaccines have only shown moderate efficacy in preventing viral infection. Therefore, the development of effective therapeutic agents against HCMV represents an important unmet medical need. Summary of the Invention

[0006] In one aspect, the disclosure provides a method for identifying a modulator of an interaction between human cytomegalovirus (HCMV) gH / gL / UL128-131A pentamer and beta 2 microglobulin (B2M), comprising: (a) providing a candidate modulator; (b) contacting the HCMV gH / gL / UL128-131A pentamer with B2M in the presence or absence of the candidate modulator under conditions that allow binding of the HCMV gH / gL / UL128-131A pentamer to B2M; and (c) measuring binding of the HCMV gH / gL / UL128-131A pentamer to B2M, wherein an increase or decrease in binding in the presence of the candidate modulator compared to binding in the absence of the candidate modulator identifies the candidate modulator as a modulator of the interaction between HCMV gH / gL / UL128-131A pentamer and B2M. The method includes measuring binding of gH / gL / UL128-131A pentamer.

[0007] In another aspect, the disclosure features a method of identifying a modulator of a downstream activity of an HCMV gH / gL / UL128-131A pentamer, the method including: (a) providing a candidate modulator; (b) contacting the HCMV gH / gL / UL128-131A pentamer with B2M in the presence or absence of the candidate modulator under conditions that allow binding of the HCMV gH / gL / UL128-131A pentamer to B2M; and (c) measuring the downstream activity of the HCMV gH / gL / UL128-131A pentamer, where a change in the downstream activity in the presence of the candidate modulator compared to the downstream activity in the absence of the candidate modulator identifies the candidate modulator as a modulator of the downstream activity of the HCMV gH / gL / UL128-131A pentamer.

[0008] In another aspect, the disclosure features a method of identifying a modulator of a downstream activity of B2M, the method including: (a) providing a candidate modulator; (b) contacting B2M with an HCMV gH / gL / UL128-131A pentamer in the presence or absence of the candidate modulator under conditions that allow binding of B2M to the HCMV gH / gL / UL128-131A pentamer; and (c) measuring the downstream activity of B2M, where a change in the downstream activity in the presence of the candidate modulator compared to the downstream activity in the absence of the candidate modulator identifies the candidate modulator as a modulator of the downstream activity of B2M.

[0009] In some embodiments, the increase or decrease in binding is at least 50% as measured by surface plasmon resonance, biolayer interferometry, or enzyme-linked immunosorbent assay (ELISA).

[0010] In some aspects, the modulator is an inhibitor of a downstream activity of HCMV gH / gL / UL128-131A pentamer or B2M.

[0011] In some aspects, the change in downstream activity is a decrease in the amount, intensity, or duration of the downstream activity.

[0012] In some embodiments, the modulator is a small molecule, an antibody or antigen-binding fragment thereof, a peptide, a mimetic, or an inhibitory nucleic acid. In some embodiments, the inhibitory nucleic acid is an ASO or an siRNA. In some embodiments, the antigen-binding fragment is a bis-Fab, Fv, Fab, Fab'-SH, F(ab') 2 , a diabody, a linear antibody, an scFv, an scFab, a VH domain, or a VHH domain.

[0013] In some embodiments, the antibody or antigen-binding fragment thereof binds to the HCMV gH / gL / UL128-131A pentamer. In some embodiments, the antibody or antigen-binding fragment thereof binds to B2M.

[0014] In some embodiments, the downstream activity is infection of a cell by HCMV. In some embodiments, the infection is reduced in the presence of the modulator. In some embodiments, the infection is reduced by at least 40% as measured in a viral infection or entry assay using pseudotyped particles.

[0015] In some embodiments, the modulator is an antibody or antigen-binding fragment thereof that binds to the HCMV gH / gL / UL128-131A pentamer. In some embodiments, the modulator is an antibody or antigen-binding fragment thereof that binds to B2M.

[0016] In another aspect, the disclosure provides a modulator of the interaction between human cytomegalovirus (HCMV) gH / gL / UL128-131A pentamer and neuropilin 2 (NRP2), causing a decrease in binding of the gH / gL / UL128-131A pentamer to NRP2, comprising: (a) one or more of residues D197, D252, N172, M253, Y458, and L459 of NRP2; (b) a modulator of the interaction between gH / gL / UL128-131A pentamer and NRP2, causing a decrease in binding of the gH / gL / UL128-131A pentamer to NRP2; (c) one or both of residues K47 and R57 of the UL128 subunit of the gH / gL / UL128-131A pentamer; (d) one or both of residues A114 and A117 of the UL131A subunit of the gH / gL / UL128-131A pentamer.

[0017] In some aspects, the modulator binds to (a) all six of residues D197, D252, N172, M253, Y458, and L459 of NRP2; (b) both residues K47 and R57 of the UL128 subunit of the gH / gL / UL128-131A pentamer; (c) residue R193 of the UL130 subunit of the gH / gL / UL128-131A pentamer; and / or (d) both residues A114 and A117 of the UL131A subunit of the gH / gL / UL128-131A pentamer.

[0018] In some embodiments, the modulator reduces binding of gH / gL / UL128-131A pentamer to NRP2 by at least 50%. In some embodiments, the modulator reduces binding of gH / gL / UL128-131A pentamer to NRP2 by at least 90%.

[0019] In another aspect, the present disclosure provides an HCMV inhibitor that causes a decrease in binding of gH / gL / UL128-131A pentamer to thrombomodulin (THBD). The present invention relates to a modulator of the interaction between the gH / gL / UL128-131A pentamer and THBD, the modulator binding to (a) one or more of residues S49, D53, V66, D69, R83, C96, E154, A123, L125, S149 and C133 of THBD; (b) one or more of residues R42, Y44, R131, N134, Y137, R158, R163 and Y168 of the UL128 subunit of the gH / gL / UL128-131A pentamer; and / or (c) one or more of residues N164, Y169 and M171 of the UL130 subunit of the gH / gL / UL128-131A pentamer.

[0020] In some aspects, the modulator binds to (a) all eleven residues, S49, D53, V66, D69, R83, C96, E154, A123, L125, S149 and C133, of THBD; (b) all eight residues, R42, Y44, R131, N134, Y137, R158, R163 and Y168, of the UL128 subunit of the gH / gL / UL128-131A pentamer; and / or (c) all three residues, N164, Y169 and M171, of the UL130 subunit of the gH / gL / UL128-131A pentamer.

[0021] In some embodiments, the modulator reduces binding of the gH / gL / UL128-131A pentamer to THBD by at least 50%. In some embodiments, the modulator reduces binding of the gH / gL / UL128-131A pentamer to THBD by at least 90%.

[0022] In another aspect, the disclosure features a modulator of the interaction between human cytomegalovirus (HCMV) gH / gL / UL128-131A pentamer and beta 2 microglobulin (B2M), which causes a decrease in binding of the gH / gL / UL128-131A pentamer to B2M. In some aspects, the modulator reduces binding of the gH / gL / UL128-131A pentamer to B2M by at least 50%. In some aspects, the modulator reduces binding of the gH / gL / UL128-131A pentamer to THBD by at least 90%.

[0023] In some embodiments, the reduction in binding is measured by surface plasmon resonance, biolayer interferometry, or enzyme-linked immunosorbent assay (ELISA).

[0024] In some embodiments, the modulator causes a decrease in infection of a cell by HCMV compared to infection in the absence of said modulator, hi some embodiments, infection is reduced by at least 40% as measured in a viral infection or entry assay using pseudotyped particles.

[0025] In some embodiments, the modulator is a small molecule, an antibody or antigen-binding fragment thereof, a peptide, a mimetic, or an inhibitory nucleic acid. In some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide (ASO) or an siRNA. In some embodiments, the antigen-binding fragment is a bis-Fab, Fv, Fab, Fab'-SH, F(ab') 2 , a diabody, a linear antibody, an scFv, an scFab, a VH domain, or a VHH domain.

[0026] In some aspects, the antibody is a bispecific or multispecific antibody.

[0027] In some embodiments, the modulator further comprises a pharma- ceutically acceptable carrier.

[0028] In another aspect, the disclosure features a method for treating an HCMV infection in an individual, the method including administering to the individual an effective amount of any one of the modulators provided herein, thereby treating the individual. In some aspects, the duration or severity of the HCMV infection is reduced by at least 40% compared to an individual not administered the modulator.

[0029] In another aspect, the disclosure features a method for preventing HCMV infection in an individual, the method comprising administering to the individual an effective amount of any one of the modulators provided herein, thereby preventing HCMV infection in the individual.

[0030] In another aspect, the disclosure features a method for prophylaxis against a secondary HCMV infection in an individual, comprising administering to the individual an effective amount of any one of the modulators provided herein, thereby preventing a secondary HCMV infection in the individual. In some aspects, the secondary infection is an HCMV infection of an uninfected tissue.

[0031] In some aspects, the individual is immunocompromised, pregnant, or an infant.

[0032] In another aspect, the disclosure features the use of any one of the modulators provided herein in the manufacture of a medicament for treating an HCMV infection in an individual.

[0033] In another aspect, the disclosure features the use of any one of the modulators provided herein in the manufacture of a medicament for preventing HCMV infection in an individual.

[0034] In another aspect, the disclosure features the use of any one of the modulators provided herein in the manufacture of a medicament for the prophylaxis against a secondary HCMV infection in an individual. In some aspects, the secondary infection is an HCMV infection of an uninfected tissue.

[0035] In some aspects, the individual is immunocompromised, pregnant, or an infant.

[0036] In another aspect, the disclosure features any one of the modulators provided herein for use in a method of treating an HCMV infection in an individual, the method comprising administering to the individual an effective amount of the modulator, thereby treating the individual.

[0037] In another aspect, the disclosure features any one of the modulators provided herein for use in a method of preventing HCMV infection in an individual, the method comprising administering to the individual an effective amount of the modulator, thereby preventing HCMV infection in the individual.

[0038] In another aspect, the disclosure features any one of the modulators provided herein for use in a method of prophylaxis against a secondary HCMV infection in an individual, the method comprising administering to the individual an effective amount of the modulator, thereby preventing a secondary HCMV infection in the individual. In some aspects, the secondary infection is an HCMV infection of an uninfected tissue.

[0039] In some aspects, the individual is immunocompromised, pregnant, or an infant. [Brief description of the drawings]

[0040] [Figure 1A-C]FIG. 1A is a plot showing normalized binding signals (percentage of maximum) of HCMV pentameric complexes encoded by Merlin and VR1814 strains and Neuropilin 1 (NRP1) and Neuropilin 2 (NRP2) detected using the cell surface discovery platform described in Martinez-Martin et al., Cell. 174(5):1158-1171.e19, 2018. FIG. 1B is a schematic showing the domain organization of human NRP2. FIG. 1C shows a front view of the HCMV pentameric complex (ribbon representation) bound to the NRP2 a2b1b2 domain (surface representation). The Fab has not been drawn for clarity. [Fig. 1D-H] Figure ID is a diagram of the HCMV pentamer distal region showing the NRP2 a1a2b1b2 domain, UL128-131A, gL, and gH N-terminus. Figure IE is a close-up of the HCMV pentamer distal region shown in Figure ID showing the interaction site between the HCMV pentamer and the NRP2 a2 domain (site 1), including residues N172, M253, and D197 of NRP2, and residues R57 and K47 of UL128. Bolded residues represent reverse charge mutations. Figure IF is a close-up of the HCMV pentamer distal region shown in Figure ID showing the interaction site between the HCMV pentamer and the NRP2 b2 domain (site 2), including residues Y458 and L459 of NRP2, residue R193 of UL130, and residues A114 and A1117 of UL131A. Bolded residues represent reverse charge mutations. Figure 1G is a close-up (surface representation) of the HCMV pentamer distal region depicted in Figure 1D, showing the surface interaction regions with NRP1 (sites 1 and 2). Figure 1H is a bar graph showing the binding affinity of the HCMV pentamer to NRP2 variants containing single point mutations (site 1: N172R, M253E, A254E; site 2: Y458R, L459R) compared to binding to wild-type (WT) NRP2. Kinetic parameters are representative of two independent assays. [Figure 2A-D]Figure 2A is a schematic showing the domain organization of human thrombomodulin (THBD). Figure 2B is a diagram of the HCMV pentamer-1 distal region showing the THBD lectin domains, UL128-131A, and gL, highlighting the sites of interaction between pentamer-1 and the THBD lectin domain (inset), including: Y44, R42, R131, N134, and Y137 of UL128; R83, E154, S149, D69, and V66 of THBD; and N164 and Y169 of UL130. (b) Y44, R42, R131, Y168, and R163 of UL128; L12 of THBD. 3C is a set of figures showing front and top views of the HCMV pentamer complex (dimer comprising pentamer 1 and pentamer 2) (ribbon representation) bound to the THBD lectin domain (surface representation), including a diagram of the HCMV pentamer 2 distal region showing the THBD lectin domain, UL128-131A, and gL, highlighting the sites of interaction between pentamer 2 and the THBD lectin domain (inset), including: A123, C133, C96, S49, and D53; and Y169 and M171 of UL130. FIG. 2C is a magnified view (surface representation) of the HCMV pentamer 1 distal region shown in FIG. 3C, showing the surface interaction region with THBD. FIG. 2D is a magnified view (surface representation) of the HCMV pentamer 2 distal region shown in FIG. 3D, showing the surface interaction region with THBD. [Figure 3A-C]Figure 3A is a pair of graphs showing the percentage of infected cells in human umbilical vein endothelial cells (HUVEC) or ARPE-19 cells treated with HCMV strain VR1814 virus for 48 hours and preincubated with the indicated concentrations of soluble recombinant CD46 (blue filled circle), NRP2 (red filled circle), anti-NRP2 antibody (red open circle), THBD (orange filled circle), a mixture of THBD protein and recombinant NRP2 (purple filled circle), or a mixture of recombinant THBD protein and anti-NRP2 (purple filled circle). Data shown are the mean ± SD of three independent experiments. Figure 3B is a bar graph showing the percentage of infected wild-type (WT) or NRP2 knockout (KO) HAP-1 cells in assays in which cells were transduced with an empty lentiviral vector, a lentiviral vector encoding CD46, or a lentiviral vector encoding THBD. Also shown are NRP2 KO cells transduced with a lentiviral vector encoding THBD and treated with Fab 8I21. Percentage of maximal infection (geometric mean ± SD of four independent experiments) is shown. ns: not significant. Figure 3C shows an overlay of HCMV pentamers complexed with NRP2 and THBD. The NRP2-a1 domain is shown in surface representation. [Fig. 3D-G] Figure 3D is a bar graph showing binding of HCMV pentamers to wild-type (WT) NRP2-Fc in the presence of increasing concentrations of THBD (starting at equimolar ratio). Addition of 100-fold excess of transforming growth factor beta receptor 3 (TGFβR3) is shown as a control. Figure 3E shows an overlay of a cryo-EM map of HCMV pentamers-NRP2 dimers with the dimeric structure of HCMV pentamers-THBD. Figure 3F shows the dimerization interface of HCMV pentamers mediated by UL128. Figure 3G shows an expanded top view of the dimer interaction interface (as shown in Figure 3F) mediated by UL128. [Figure 4A-I]Figure 4A shows a front view of the composite structure of the HCMV pentamer complex (ribbon representation) bound to the pentamer-specific neutralizing antibodies 2C12, 7I13, and 8I21 (shown in surface representation) and the gH-specific neutralizing antibodies 13H11 and MSL-109 (shown in surface representation). Figure 4B shows a close-up of the HCMV pentamer distal region showing the pentamer-specific neutralizing antibodies 2C12, UL128-131A, and gL, highlighting the site of interaction between the pentamer and 2C12. Figure 4C shows a close-up of the HCMV pentamer distal region showing the pentamer-specific neutralizing antibodies 2C12, UL128-131A, and gL, highlighting the site of interaction between the pentamer and 2C12. Figure 4D shows a close-up of the HCMV pentamer distal region highlighting the interaction interface between the pentamer and 2C12 (left) or 7I13 (right). Figure 4E is a close-up of the HCMV pentamer distal region showing 2C12, UL128-131A, and gL 2C12 and 7I13. Figure 4F is a close-up of the HCMV pentamer distal region showing 7I13, UL128-131A, and gL, highlighting the site of interaction between the pentamer and 7I13. Figure 4G is a close-up of the HCMV pentamer distal region showing 7I13, UL128-131A, and gL, highlighting the site of interaction between the pentamer and 7I13. Figure 4H is a close-up of the HCMV pentamer distal region showing 7I13, UL128-131A, and gL, highlighting the site of interaction between the pentamer and 7I13. Figure 4I is a close-up of the HCMV pentamer distal region showing 7I13, UL128-131A, and gL, highlighting the site of interaction between the pentamer and 7I13. [Figure 4J-M] Figure 4J is an overlay of HCMV pentamers bound to NRP2 and 2C12. Figure 4K is an overlay of HCMV pentamers bound to THBD and 7I13. Figure 4L is a bar graph showing binding of HCMV pentamers to WT NRP2-Fc in the presence of the indicated neutralizing Fabs (2C12, 7I13, 8I21, MSL-109, and 13H11). Figure 4M is a bar graph showing binding of HCMV pentamers to WT THBD-Fc in the presence of the indicated neutralizing Fabs (2C12, 7I13, 8I21, MSL-109, and 13H11). [Diagram 5] Figure 5 shows a model of HCMV pentamer-mediated entry of HCMV into epithelial and endothelial host cells. Receptor binding and possibly pentamer dimerization may mediate receptor clustering and promote high affinity, stable tethering of the viral membrane to the host cell membrane. Membrane tethering triggers the transition of gB from its pre-fusion to post-fusion conformation, initiating membrane fusion. [Figure 6A-B] Figure 6A shows the workflow for purification and reconstitution of NRP2-bound HCMV pentamers and Fabs 13H11 and 8I21. Figure 6B shows a graph and gel image showing the results of a size-exclusion chromatography (SEC) assay of NRP2-bound HCMV pentamers and Fabs 13H11 and 8I21. [Figure 6C] FIG. 6C is a representative cryo-EM micrograph showing HCMV pentamers bound to NRP2 and 13H11 and 8I21. [Figure 6D-F] Figure 6D is a set of images showing representative 2D class averages of monomeric and dimeric HCMV pentamer-NRP2 bound to 13H11 and 8I21. Figure 6E shows the processing workflow for obtaining ab-initio 3D reconstructions of monomeric and dimeric HCMV pentamer-NRP2 bound to 13H11 and 8I21. Figure 6F shows the data collection and processing workflow for obtaining 3D reconstructions of dimeric HCMV pentamer-NRP2 bound to 13H11 and 8I21. [Figure 6G] Figure 6G illustrates the data collection and processing workflow to obtain high-resolution 3D reconstructions of dimeric HCMV pentamer-NRP2 bound to 13H11 and 8I21. The reconstructions are shown in Figure 6H. [Figure 6H-I]Figure 6H is a heat map showing the distribution of assigned particle orientations determined with the workflow of Figure 6G, as well as the high-resolution 3D reconstructions of dimeric HCMV pentamer-NRP2 bound to 13H11 and 8I21. Figure 6I is a graph showing the Fourier shell correlation (FSC) between the half data sets for the global 3D reconstructions of HCMV pentamer-NRP2 bound to Fabs 13H11 and 8I21, as well as the focused refinement reconstructions (as shown in Figure 6G). [Figure 7A] FIG. 7A is an exemplary 3D map overlay of NRP2 bound to the HCMV pentamer. [Figure 7B] FIG. 7B is an exemplary 3D map overlay of THBD bound to the HCMV pentamer. [Figure 7C] FIG. 7C is an exemplary 3D map overlay of Fab 2C12 bound to the HCMV pentamer. [Figure 7D] FIG. 7D is an exemplary 3D map overlay of Fab 7I13 bound to the HCMV pentamer. [Figure 8A] FIG. 8A is a series of figures showing the superposition of the a2b1b2 domain of cryo-EM HCMV pentamer-NRP2 with the NRP2 crystal structure (PDB: 2QQO RMSD 0.6 Å / 328 Ca) and NRP1 crystal structures (2QQN, RMSD 2.0 Å / 316 Ca). [Figure 8B-C] Figure 8B is a pair of figures showing the superposition of the NRP2 a2 and b2 domains of cryo-EM HCMV pentamer-NRP2 with the NRP1 crystal structure (2QQN, a2: RMSD 0.7 Å / 98 Ca; b2: RMSD 0.8 Å / 122 Ca), and Figure 8C shows a sequence alignment of the a1a2b1b2 domains of NRP1 (SEQ ID NO:6) and NRP2 (SEQ ID NO:7). [Figure 8D] Figure 8D is a set of figures showing the HCMV pentamer-NRP2 interaction involving the a2 and b2 domains compared to the canonical binding sites of NRP2 b1-VEGFC peptide (PDB: 6TJT) and NRP1 b1-SARS-CoV-2 (PDB: 7JJC). [Figure 9A-B]Figure 9A shows the gHgL subunit of the HCMV pentameric complex (blue / pink) superimposed on the gHgL subunit of the HCMV trimeric complex (orange, PDB:7LBE) (Kschonsak et al., Cell, 184:1232-1244.e16, 2021); root mean square deviation (RMSD) 0.5 Å / 765 Cα). Figure 9B shows the cryo-EM HCMV pentameric-13H11-2C12-7I13 complex (blue / pink) superimposed on the X-ray HCMV pentameric complex (green, PDB:5VOB; Chandramouli et al., Sci. Immunol., 2:2017; RMSD 1.2 Å / 980 Cα). [Figure 9C-D] Figure 9C shows the HCMV pentamer-13H11-2C12-7I13 complex superimposed on the HCMV pentamer-NRP2-13H11-8I21 complex (yellow, RMSD 0.6 Å / 937 Ca) and Figure 9D shows a pair of images showing the HCMV pentamer-13H11-2C12-7I13 complex superimposed on both HCMV pentamer-THBD-13H11 molecules (purple / magenta, (1) RMSD 0.6 Å / 846 Ca, (2) RMSD 0.6 Å / 622 Ca). [Figure 10A-B] Figure 10A is a graph and gel image showing the results of a SEC assay of HCMV pentamer-THBD complexes bound to Fab 13H11 and MSL-109, and Figure 10B is a representative cryo-EM micrograph showing HCMV pentamer bound to THBD and Fab 13H11 and MSL-109. [Figure 10C-D] Figure 10C is a set of images showing representative 2D class averages of monomeric and dimeric HCMV pentamer-THBD bound to 13H11 and MSL-109. Figure 10D illustrates the processing workflow for obtaining ab-initio and high-resolution 3D reconstructions of monomeric and dimeric HCMV pentamer-THBD bound to Fab 13H11 and MSL-109. The reconstructions are shown in Figure 10E. [Figure 10E-F]Figure 10E is a heat map showing the distribution of assigned particle orientations determined with the workflow of Figure 10D, as well as the high-resolution 3D reconstructions of HCMV pentamer-THBD bound to Fab 13H11 and MSL-109. Figure 10F is a graph showing the FSC between the half-datasets for the overall monomeric pentamer-THBD 3D reconstruction bound to Fab 13H11 and MSL-109, as well as the focused refinement reconstruction (as shown in Figure 10D). [Figure 11A] Figure 11A shows the HCMV pentameric complex bound to THBD, showing the THBD TME-1 domain and the linker region located between the N-terminal lectin domain and the TME-1 domain. [Figure 11B] Figure 11B shows the structure of the THBD lectin domain, showing the secondary structure organization. [Figure 12A-B] Figure 12A is a set of graphs showing cell surface staining (as percent of maximum) of NRP2, CD46 and THBD on WT or NRP2 KO HAP-1 cells. Blue line: staining with isotype control antibody; green line: staining with target-specific antibody. Flow cytometry staining was performed in triplicate (n=10,000 cells). Figure 12B is a bar graph showing the percent of infected WT, NRP2 KO, or NRP2 KO+THBD HAP-1 cells in an assay in which cells were treated with VR1814 to obtain a small number of infected cells (MOI of 0.1) and virus spread was monitored on day 8 by staining for HCMV pp72 protein. [Figure 12C] Figure 12C is a set of photomicrographs showing representative images of infected cells from Figure 12A stained with anti-pp72. Scale bar is 10 micrometers. [Figure 13A-C] Figure 13A shows the workflow for purification and reconstitution of HCMV pentamers bound to Fabs 13H11, 2C12 and 7I13. Figure 13B shows a graph and gel image of the results of a SEC assay of HCMV pentamers bound to 13H11, 2C12 and 7I13. Figure 13C shows representative cryo-EM micrographs showing HCMV pentamers bound to 13H11, 2C12 and 7I13. [Fig. 13D-E] Figure 13D is a set of images showing representative 2D class averages of HCMV pentamers bound to 13H11, 2C12 and 7I13, and Figure 13E shows the processing workflow for obtaining ab-initio 3D reconstructions of HCMV pentamers bound to 13H11, 2C12 and 7I13. [Figure 13F] Figure 13F illustrates the data collection and processing workflow to obtain high-resolution 3D reconstructions of HCMV pentamers bound to 13H11, 2C12, and 7I13. The reconstructions are shown in Figure 8G. [Fig. 13G-H] Figure 13G is a heat map showing the distribution of assigned particle orientations determined with the workflow of Figure 8F, as well as the high-resolution 3D reconstructions of HCMV pentamers bound to 13H11, 2C12 and 7I13. Figure 13H is the FSC between the half-datasets for the global 3D reconstructions of HCMV pentamers bound to 13H11, 2C12 and 7I13, as well as the focused refinement reconstructions (as shown in Figure 8F). [Figure 14A] FIG. 14A shows the superposition of the cryo-EM HCMV pentamer-8I21 complex (blue / orange / pink) onto the X-ray HCMV pentamer-8I21 complex (green, PDB:5VOB RMSD 1.3A / 477 Cα). [Figure 14B-C] Figure 14B shows an overlay of the HCMV pentamer-NRP2 complex with the composite structures of HCMV pentamer bound to 2C12, 7I13 and 8I21. Figure 14C shows an overlay of the HCMV pentamer-THBD complex with the composite structures of HCMV pentamer bound to 2C12, 7I13 and 8I21. [Figure 15A-E]Figure 15A shows a front view of the HCMV pentamer complex (ribbon representation) bound to beta 2 microglobulin (B2M) (surface representation). Figure 15B shows a diagram of the HCMV pentamer distal region showing the N-terminal regions of B2M, UL128-131A, gL, and gH. Figure 15C shows a close-up view (surface representation) of the HCMV pentamer distal region showing the surface interaction region with B2M. Figure 15D shows an overlay of B2M with the interacting THBD lectin domain on the concave region of the UL subunit of the HCMV pentamer. Figure 15E shows an overlay of the B2M-bound HCMV pentamer with the B2M MHC class 1 complex (Protein Data Bank (PDB): 1A1M). [Figure 16A-C] Figure 16A is a graph showing the results of a SEC assay of HCMV pentamers mixed with olfactory receptor (OR14L1)(1-26)-EGFP. Figure 16B is an SDS-PAGE blot and mass spectrometry (MS) trace showing the identification of B2M as an HCMV pentamers binding partner. Figure 16C is a representative cryo-EM micrograph of pentamers-B2M bound to Fab 13H11 and MSL-109. [Fig. 16D-E] Figure 16D is a set of images showing representative 2D class averages of pentamer-B2M bound to Fab 13H11 and MSL-109, and Figure 16E is a schematic showing the processing workflow for obtaining ab-initio and high-resolution 3D reconstructions of pentamer-B2M bound to Fab 13H11 and MSL-109. [Fig. 16F-G] Figure 16F is a heatmap representation of the distribution of assigned particle orientations determined with the workflow of Figure 16E. Figure 16G is a graph showing the FSC between the half data sets for the 3D reconstruction of the global pentamer-B2M bound to Fab 13H11 and MSL-109. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0041] I. Definition Unless otherwise defined, all technical terms, designations, and other scientific terms used herein are intended to have the meanings commonly understood by those of ordinary skill in the art to which the present invention pertains. In some cases, terms having commonly understood meanings are defined herein for clarity and / or ease of reference, and the inclusion of such definitions herein should not necessarily be construed as representing a substantial difference from what is commonly understood in the art.

[0042] The term "about" as used herein refers to the normal error range for the respective value, which is readily understood by one of ordinary skill in the art. Reference to "about" with respect to a value or parameter herein includes (and describes) the embodiment directed to the value or parameter itself.

[0043] As used herein, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, "an isolated peptide" means one or more isolated peptides.

[0044] Throughout this specification and the claims, the word "comprise" or variations such as "comprises" or "comprising" will be understood to imply the inclusion of a stated integer or group of integers but not the exclusion of any other integer or group of integers.

[0045] The terms "patient," "subject," or "individual," used interchangeably herein, refer to a human patient.

[0046] An "intravenous" or "iv" dose, administration or formulation of a drug is administered through a vein, for example by infusion.

[0047] A "subcutaneous" or "sc" dose, administration or formulation of a drug is administered beneath the skin, for example, via a pre-filled syringe, auto-injector, or other device.

[0048] For purposes of this specification, "clinical status" refers to the health status of a patient. Examples include whether the patient is improving or worsening. In one embodiment, the clinical status is based on an ordinal scale of clinical status. In one embodiment, the clinical status is not based on whether the patient has a fever or not.

[0049] An "effective amount" refers to an amount of an agent (e.g., a therapeutic agent) effective to provide therapeutic / prophylactic benefits (e.g., as described herein) that outweigh any unwanted / undesirable side effects.

[0050] The term "pharmaceutical formulation" refers to a preparation in which the biological activity of one or more active ingredients is in a form such that it is effective and does not contain additional ingredients that are unacceptably toxic to the subject to which the formulation is administered. Such formulations are sterile. In one embodiment, the formulation is for intravenous (iv) administration. In another embodiment, the formulation is for subcutaneous (sc) administration.

[0051] A "native sequence" protein herein refers to a protein that comprises the amino acid sequence of a protein found in nature, including variants of a naturally occurring protein. As used herein, the term includes a protein isolated from its natural source or a protein that is recombinantly produced.

[0052] Unless otherwise indicated, the term "protein" as used herein refers to any naturally occurring protein from any vertebrate source, including mammals such as primates (e.g., humans) and rodents (e.g., mice and rats). The term encompasses "full-length" unprocessed proteins and all forms of proteins resulting from processing within a cell. The term also encompasses naturally occurring variants of the protein, such as splice variants or allelic variants, such as amino acid substitution or deletion variants. The term also encompasses isolated regions or domains of the protein, such as the extracellular domain (ECD).

[0053] An "isolated" protein or peptide is one that is separated from a component of its natural environment. In some embodiments, the protein or peptide is purified to greater than 95% or 99% purity, for example, as determined by electrophoresis (e.g., SDS-PAGE, isoelectric focusing (IEF), capillary electrophoresis) or chromatography (e.g., ion exchange or reverse phase HPLC).

[0054] An "isolated" nucleic acid refers to a nucleic acid molecule that is separated from a component of its natural environment. Isolated nucleic acid includes a nucleic acid molecule contained within a cell that normally contains the nucleic acid molecule, but where the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.

[0055] As used herein, the terms "human cytomegalovirus (HCMV) pentamer," "HCMV gH / gL / UL128-131A pentamer," and "HCMV pentamer" refer to a glycoprotein complex located on the outer surface of the viral envelope of human cytomegalovirus (HCMV) and composed of gH, gL, UL128, UL130 and UL131A glycoprotein subunits.

[0056] As used herein, the terms "human cytomegalovirus (HCMV) gH subunit," "gH subunit," and "gH" refer broadly to any native gH from any viral source, unless otherwise indicated. The term encompasses full-length gH and isolated regions or domains of gH. The term also encompasses naturally occurring variants of gH, such as splice variants or allelic variants. An exemplary HCMV gH amino acid sequence is provided as SEQ ID NO: 1. Minor sequence variations, particularly conservative amino acid substitutions of gH that do not affect the function and / or activity of gH, are also contemplated by the present invention.

[0057] As used herein, the terms "human cytomegalovirus (HCMV) gL subunit," "gL subunit," and "gL" refer broadly to any native gL from any viral source, unless otherwise indicated. The term encompasses full-length gL and isolated regions or domains of gL. The term also encompasses naturally occurring variants of gL, such as splice variants or allelic variants. An exemplary amino acid sequence of HCMV gL is provided as SEQ ID NO:2. Minor sequence variations, particularly conservative amino acid substitutions of gL that do not affect the function and / or activity of gL, are also contemplated by the present invention.

[0058] As used herein, the terms "human cytomegalovirus (HCMV) UL128 subunit," "UL128 subunit," and "UL128" refer broadly to any native UL128 from any viral source, unless otherwise indicated. The term encompasses full-length UL128 and isolated regions or domains of UL128. The term also encompasses naturally occurring variants of UL128, such as splice variants or allelic variants. An exemplary HCMV UL128 amino acid sequence is provided as SEQ ID NO:3. Minor sequence variations, particularly conservative amino acid substitutions of UL128 that do not affect the function and / or activity of UL128, are also contemplated by the present invention.

[0059] As used herein, the terms "human cytomegalovirus (HCMV) UL130 subunit," "UL130 subunit," and "UL130" refer broadly to any native UL130 from any viral source, unless otherwise indicated. The term encompasses full-length UL130 and isolated regions or domains of UL130. The term also encompasses naturally occurring variants of UL130, such as splice variants or allelic variants. An exemplary HCMV UL130 amino acid sequence is provided as SEQ ID NO: 4. Minor sequence variations, particularly conservative amino acid substitutions of UL130 that do not affect the function and / or activity of UL130, are also contemplated by the present invention.

[0060] As used herein, the terms "human cytomegalovirus (HCMV) UL131A subunit," "UL131A subunit," and "UL131A" refer broadly to any native UL131A from any viral source, unless otherwise indicated. The term encompasses full-length UL131A and isolated regions or domains of UL131A. The term also encompasses naturally occurring variants of UL131A, such as splice variants or allelic variants. An exemplary HCMV UL131A amino acid sequence is provided as SEQ ID NO:5. Minor sequence variations, particularly conservative amino acid substitutions of UL131A that do not affect the function and / or activity of UL131A, are also contemplated by the present invention.

[0061] As used herein, a "modulator" is an agent that modulates (e.g., increases, decreases, activates, or inhibits) a given biological activity, e.g., an interaction or a downstream activity resulting from the interaction. Modulators or candidate modulators can be, for example, small molecules, antibodies (e.g., bispecific or multispecific antibodies), antigen-binding fragments (e.g., bis-Fab, Fv, Fab, Fab'-SH, F(ab') 2 , diabody, linear antibody, scFv, ScFab, VH domain or VHH domain), peptide, mimetic, antisense oligonucleotide, or inhibitory nucleic acid (e.g., antisense oligonucleotide (ASO) or small interfering RNA (siRNA)).

[0062] By "increase" or "activate" is meant the ability to cause an overall increase, for example, of 20% or more, 50% or more, or 75%, 85%, 90%, or 95% or more. In some aspects, increase or activate can refer to a downstream activity of a protein-protein interaction.

[0063] By "reduce" or "inhibit" is meant the ability to cause an overall decrease, e.g., of 20% or more, 50% or more, or 75%, 85%, 90%, 95% or more. In some aspects, reducing or inhibiting can refer to a downstream activity of a protein-protein interaction.

[0064] "Affinity" refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., a receptor) and its binding partner (e.g., a ligand). As used herein, "binding affinity" refers to the intrinsic binding affinity reflecting a 1:1 interaction between members of a binding pair (e.g., a receptor and a ligand), unless otherwise indicated. The affinity of a molecule X for its partner Y is generally determined by the dissociation constant (K D Affinity can be measured by common methods known in the art, including those described herein.

[0065] As used herein, "complex" or "complexation" refers to the association of two or more molecules that interact with each other through bonds and / or forces that are not peptide bonds (e.g., van der Waals, hydrophobic, hydrophilic forces). In one aspect, the complex is a heteromultimer. The term "protein complex" or "polypeptide complex" as used herein should be understood to include complexes having non-proteinaceous entities (e.g., including but not limited to chemical molecules such as toxins or detection agents) conjugated to proteins in the protein complex.

[0066] The terms "host cell," "host cell line," and "host cell culture" are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include "transfected cells," "transformed cells," and "transformants," including the primary transformed cell and its progeny, regardless of the number of passages. The progeny may not be completely identical in nucleic acid content to the parent cell and may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein. In some aspects, the host cells are stably transformed with the exogenous nucleic acid. In other aspects, the host cells are transiently transformed with the exogenous nucleic acid.

[0067] The term "vector," as used herein, refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes vectors as self-replicating nucleic acid structures and vectors that integrate into the genome of a host cell into which they are introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "expression vectors."

[0068] The term "antibody" is used herein in the broadest sense and encompasses a variety of antibody structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments (e.g., bis-Fabs), so long as they exhibit the desired antigen-binding activity.

[0069] "Antigen-binding fragment" or "antibody fragment" refers to a molecule other than an intact antibody that contains a portion of an intact antibody that binds to the antigen to which the intact antibody binds. Examples of antigen-binding fragments include, but are not limited to, bis-Fab; Fv; Fab; Fab, Fab'-SH; F(ab') 2 linear antibodies; single-chain antibody molecules (eg, scFv, ScFab); and multispecific antibodies formed from antibody fragments.

[0070] "Single domain antibody" refers to an antibody fragment that contains all or a portion of the heavy chain variable domain or all or a portion of the light chain variable domain of an antibody. In some aspects, a single domain antibody is a human single domain antibody (see, e.g., U.S. Pat. No. 6,248,516 B1). Examples of single domain antibodies include, but are not limited to, VHHs.

[0071] A "Fab" fragment is an antigen-binding fragment produced by papain digestion of an antibody and consists of the entire L chain, the variable region domain of the H chain (VH), and the first constant domain of one heavy chain (CH1). Papain digestion of an antibody produces two identical Fab fragments. Pepsin treatment of an antibody produces a single large F(ab') fragment. 2 The resulting fragment corresponds roughly to two disulfide-linked Fab fragments with divalent antigen-binding activity and is still capable of cross-linking antigen. Fab' fragments differ from Fab fragments in that they have a few additional residues at the carboxy terminus of the CH1 domain including one or more cysteines from the antibody hinge region. Fab'-SH is the designation herein for Fab' in which one or more cysteine ​​residues of the constant domains bear a free thiol group. F(ab') 2 Antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.

[0072] The term "Fc region" is used herein to define the C-terminal region of an immunoglobulin heavy chain, including native sequence Fc regions and variant Fc regions. Although the boundaries of an immunoglobulin heavy chain Fc region can vary, the human IgG heavy chain Fc region is usually defined to extend from an amino acid residue at position Cys226 or from Pro230 to its carboxyl terminus. The C-terminal lysine of the Fc region (residue 447 according to the EU numbering system) can be removed, for example, during production or purification of the antibody, or by recombinantly engineering the nucleic acid encoding the antibody heavy chain. Thus, a composition of intact antibodies can include antibody populations in which all Lys447 residues have been removed, antibody populations in which the Lys447 residue has not been removed, and antibody populations having a mixture of antibodies with and without the Lys447 residue.

[0073] An "Fv" consists of a tight, non-covalently associated dimer of one heavy and one light chain variable domain. The folding of these two domains results in six hypervariable loops (three loops each from the H and L chain) that contribute amino acid residues for antigen binding and confer antigen-binding specificity to the antibody. However, even a single variable domain (or even half of an Fv containing only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although often with lower affinity than the entire binding site.

[0074] The terms "full length antibody," "intact antibody," and "whole antibody" are used interchangeably herein and refer to an antibody having a structure substantially similar to a native antibody structure or having a heavy chain that includes an Fc region as defined herein.

[0075] "Single-chain Fv", also abbreviated as "sFv" or "scFv", is an antibody fragment comprising the VH and VL antibody domains connected in a single polypeptide chain. Preferably, the scFv polypeptide further comprises a polypeptide linker between the VH and VL domains, which enables the scFv to form the desired structure for antigen binding. For a review of scFvs, see Pluckthun, The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pp. 269-315 (1994); Malmborg et al., J. Immunol. Methods 183:7-13, 1995.

[0076] The term "small molecule" refers to any molecule having a molecular weight of about 2000 Daltons or less, such as about 1000 Daltons or less. In some embodiments, a small molecule is a small organic molecule.

[0077] The term "mimetic" or "molecular mimetic" as used herein refers to a polypeptide that has sufficient similarity (e.g., secondary structure, tertiary structure) in conformation and / or binding capacity to a given polypeptide or to a portion of said polypeptide to bind to a binding partner. A mimetic may bind to a binding partner with equal, lesser, or greater affinity than the polypeptide it mimics. A molecular mimetic may or may not have significant amino acid sequence similarity to the polypeptide it mimics. A mimetic may be naturally occurring or engineered. In some embodiments, a mimetic is a mimic of a member of a binding pair. In other embodiments, a mimetic is a mimic of another protein that binds to a member of a binding pair. In some embodiments, a mimetic may perform all of the functions of the mimicked polypeptide. In other embodiments, a mimetic does not perform all of the functions of the mimicked polypeptide.

[0078] As used herein, the term "conditions that permit binding" of two or more proteins to one another refers to conditions (e.g., protein concentration, temperature, pH, salt concentration) under which two or more proteins would interact in the absence of a modulator or candidate modulator. Conditions that permit binding will vary for individual proteins and can differ between protein-protein interaction assays (e.g., surface plasmon resonance assays, biolayer interferometry assays, enzyme-linked immunosorbent assays (ELISAs), extracellular interaction assays, and cell surface interaction assays).

[0079] "Percent (%) amino acid sequence identity" with respect to a reference polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical to those in the reference polypeptide sequence, without considering any conservative substitutions as part of the sequence identity, after aligning the sequences and introducing gaps, if necessary, to obtain the maximum percent sequence identity. Alignment for determining percent amino acid sequence identity can be accomplished in a variety of ways that are within the skill of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms required to achieve maximum alignment over the entire length of the sequences being compared. However, for purposes herein, percent amino acid sequence identity values ​​are generated using the sequence comparison computer program ALIGN-2. The ALIGN-2 sequence comparison computer program was written by Genentech, Inc., and the source code has been submitted with user documentation to the US Copyright Office, Washington DC, 20559, and is registered under US Copyright Registration No. TXU510087. The ALIGN-2 program is publicly available from Genentech, Inc., South San Francisco, California, or can be compiled from the source code. The ALIGN-2 program must be compiled for use on UNIX operating systems, including Digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.

[0080] In situations where ALIGN-2 is used for amino acid sequence comparison, the % amino acid sequence identity of a given amino acid sequence A to, with, or relative to a given amino acid sequence B (alternatively, it can be stated that a given amino acid sequence A has or contains a particular % amino acid sequence identity to, with, or relative to a given amino acid sequence B) is calculated as follows: 100 times the fraction X / Y where X is the number of amino acid residues scored as identical matches by the sequence alignment program ALIGN-2 in its alignment of A and B, and Y is the total number of amino acid residues in B. It will be understood that if the length of amino acid sequence A is not equal to the length of amino acid sequence B, then the % amino acid sequence identity % of A to B will not equal the % amino acid sequence identity % of B to A. Unless otherwise specified, all amino acid sequence identity % values ​​used herein are obtained as described in the immediately preceding paragraph using the ALIGN-2 computer program.

[0081] As used herein, "treatment" (and grammatical variations thereof, such as "treat" or "treating") refers to a clinical intervention that seeks to alter the natural course of the individual being treated, and can be performed prophylactically or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, prevention of disease onset or recurrence (e.g., prevention of HCMV infection or symptoms thereof), reduction or prevention of secondary infection in patients with an infection (e.g., reduction or prevention of secondary infection of nervous tissue, immune cells, lymphatic tissue, and / or pulmonary tissue), alleviation of symptoms, reduction of any direct or indirect pathological consequences of the disease, slowing the rate of disease progression, amelioration or alleviation of the disease state, and remission or improved prognosis.

[0082] The "pathology" of a disease or condition includes all phenomena that impair the well-being of the patient.

[0083] "Amelioration," "ameliorating," "alleviation," "alleviating," or the like, refers to both therapeutic treatment and prophylactic or preventative measures, where the purpose is to ameliorate, prevent, slow down, reduce or inhibit a disease or condition, HCMV infection. Those in need of treatment include those already with the disease or condition as well as those prone to having the disease or condition or those in need of preventing the disease or condition.

[0084] II. Modulators of Protein-Protein Interactions In some aspects, the disclosure features an isolated modulator of an interaction between neuropilin 2 (NRP2), thrombomodulin (THBD), or beta 2 microglobulin (B2M) and human cytomegalovirus (HCMV) gH / gL / UL128-131A pentamer, wherein the isolated modulator causes a decrease in binding of the HCMV gH / gL / UL128-131A pentamer to NRP2, THBD, or B2M compared to binding in the absence of the modulator.

[0085] In some embodiments, the modulator comprises a pharma- ceutically acceptable carrier.

[0086] A. Modulators of the interaction between NRP2 and the HCMV gH / gL / UL128-131A pentamer In some aspects, the disclosure provides a modulator of the interaction between HCMV gH / gL / UL128-131A pentamer and neuropilin 2 (NRP2), causing a decrease in binding of the gH / gL / UL128-131A pentamer to NRP2, comprising: (a) one or more of residues D197, D252, N172, M253, Y458, and L459 of NRP2 (e.g., one, two, three, four, five, or all six of residues D197, D252, N172, M253, Y458, and L459); (b) a modulator of the interaction between the gH / gL / UL128-131A pentamer and NRP2, causing a decrease in binding of the gH / gL / UL128-131A pentamer to NRP2. (c) residue R193 of the UL130 subunit of the gH / gL / UL128-131A pentamer; and / or (d) one or both of residues A114 and A117 of the UL131A subunit of the gH / gL / UL128-131A pentamer.

[0087] In some aspects, the modulator binds to (a) all six of residues D197, D252, N172, M253, Y458, and L459 of NRP2; (b) both residues K47 and R57 of the UL128 subunit of the gH / gL / UL128-131A pentamer; (c) residue R193 of the UL130 subunit of the gH / gL / UL128-131A pentamer; and / or (d) both residues A114 and A117 of the UL131A subunit of the gH / gL / UL128-131A pentamer.

[0088] In some aspects, the modulator binds to (a) all six of residues D197, D252, N172, M253, Y458, and L459 of NRP2; (b) both residues K47 and R57 of the UL128 subunit of the gH / gL / UL128-131A pentamer; (c) residue R193 of the UL130 subunit of the gH / gL / UL128-131A pentamer; and (d) both residues A114 and A117 of the UL131A subunit of the gH / gL / UL128-131A pentamer.

[0089] In some embodiments, the modulator reduces binding of gH / gL / UL128-131A pentamers to NRP2 by at least 50%. In some embodiments, the reduction in binding is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%, or 100% (i.e., binding is abolished) relative to binding in the absence of the modulator, e.g., the reduction is 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, or 95%-100%. In some embodiments, the modulator reduces binding of gH / gL / UL128-131A pentamers to NRP2 by at least 90% (e.g., 90%-100%). In some embodiments, the reduction in binding is at least 50% (e.g., 50%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, or 95%-100%) as measured, for example, by surface plasmon resonance, biolayer interferometry, or enzyme-linked immunosorbent assay (ELISA).

[0090] In some embodiments, the modulator causes a decrease in infection of a cell by HCMV compared to infection in the absence of said modulator, hi some embodiments, infection is reduced by at least 40% as measured in a viral infection or entry assay using pseudotyped particles. In some embodiments, the reduction is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%, or 100% (i.e., no infection occurs), e.g., the reduction is between 5% and 15%, 15% and 25%, 25% and 35%, 35% and 45%, 45% and 55%, 55% and 65%, 65% and 75%, 75% and 85%, 85% and 95%, or 95% and 100%).

[0091] B. Modulators of the interaction between THBD and the HCMV gH / gL / UL128-131A pentamer In some aspects, the disclosure provides a modulator of the interaction between HCMV gH / gL / UL128-131A pentamer and thrombomodulin (THBD), causing a decrease in binding of the gH / gL / UL128-131A pentamer to THBD, comprising: (a) one or more of residues S49, D53, V66, D69, R83, C96, E154, A123, L125, S149, and C133 of THBD (e.g., one, two, three, four, five, six, seven, eight, nine, ten, or all eleven of residues S49, D53, V66, D69, R83, C96, E154, A123, L125, S149, and C133); (b) residue R of the UL128 subunit of the gH / gL / UL128-131A pentamer; and / or (c) one or more of residues N164, Y169 and M171 (e.g., one, two or all three of residues N164, Y169 and M171) of the UL130 subunit of the gH / gL / UL128-131A pentamer.

[0092] In some aspects, the modulator binds to (a) all eleven residues, S49, D53, V66, D69, R83, C96, E154, A123, L125, S149 and C133, of THBD; (b) all eight residues, R42, Y44, R131, N134, Y137, R158, R163 and Y168, of the UL128 subunit of the gH / gL / UL128-131A pentamer; and / or (c) all three residues, N164, Y169 and M171, of the UL130 subunit of the gH / gL / UL128-131A pentamer.

[0093] In some aspects, the modulator binds to (a) all eleven residues, S49, D53, V66, D69, R83, C96, E154, A123, L125, S149 and C133, of THBD; (b) all eight residues, R42, Y44, R131, N134, Y137, R158, R163 and Y168, of the UL128 subunit of the gH / gL / UL128-131A pentamer; and (c) all three residues, N164, Y169 and M171, of the UL130 subunit of the gH / gL / UL128-131A pentamer.

[0094] In some embodiments, the modulator reduces binding of the gO subunit of the gH / gL / UL128-131A pentamer to THBD by at least 50%. In some embodiments, the reduction in binding is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%, or 100% (i.e., binding is eliminated) relative to binding in the absence of the modulator, for example, the reduction is 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95% or 95%-100%. In some embodiments, the modulator reduces binding of gH / gL / UL128-131A pentamer to THBD by at least 90% (e.g., 90%-100%). In some embodiments, the reduction in binding is at least 50% (e.g., 50%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, or 95%-100%) as measured, for example, by surface plasmon resonance, biolayer interferometry, or enzyme-linked immunosorbent assay (ELISA).

[0095] In some embodiments, the modulator causes a decrease in infection of a cell by HCMV compared to infection in the absence of said modulator, hi some embodiments, infection is reduced by at least 40% as measured in a viral infection or entry assay using pseudotyped particles. In some embodiments, the reduction is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%, or 100% (i.e., no infection occurs), e.g., the reduction is between 5% and 15%, 15% and 25%, 25% and 35%, 35% and 45%, 45% and 55%, 55% and 65%, 65% and 75%, 75% and 85%, 85% and 95%, or 95% and 100%).

[0096] C. Modulators of the interaction between B2M and the HCMV gH / gL / UL128-131A pentamer In some aspects, the disclosure features a modulator of the interaction between human cytomegalovirus (HCMV) gH / gL / UL128-131A pentamer and beta 2 microglobulin (B2M), which causes a decrease in binding of the gH / gL / UL128-131A pentamer to B2M.

[0097] In some embodiments, the modulator reduces binding of gH / gL / UL128-131A pentamers to B2M by at least 50%. In some embodiments, the reduction in binding is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%, or 100% (i.e., binding is eliminated) relative to binding in the absence of the modulator, e.g., the reduction is 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, or 95%-100%. In some embodiments, the modulator reduces binding of gH / gL / UL128-131A pentamers to B2M by at least 90% (e.g., 90%-100%). In some embodiments, the reduction in binding is at least 50% (e.g., 50%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, or 95%-100%) as measured, for example, by surface plasmon resonance, biolayer interferometry, or enzyme-linked immunosorbent assay (ELISA).

[0098] In some embodiments, the modulator causes a decrease in infection of a cell by HCMV compared to infection in the absence of said modulator, hi some embodiments, infection is reduced by at least 40% as measured in a viral infection or entry assay using pseudotyped particles. In some embodiments, the reduction is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%, or 100% (i.e., no infection occurs), e.g., the reduction is between 5% and 15%, 15% and 25%, 25% and 35%, 35% and 45%, 45% and 55%, 55% and 65%, 65% and 75%, 75% and 85%, 85% and 95%, or 95% and 100%).

[0099] D. Small molecules In some embodiments, the modulator or candidate modulator is a small molecule. A small molecule is a molecule other than a binding polypeptide or antibody as defined herein. Binding small molecules can be identified and chemically synthesized using known methodologies (see, for example, WO 00 / 00823 and WO 00 / 39585). Binding small molecules are usually less than about 2000 daltons in size (e.g., less than about 2000, 1500, 750, 500, 250 or 200 daltons in size), and such small organic molecules that can bind preferably specifically to the polypeptides described herein can be identified without undue experimentation using known techniques. In this regard, it is noted that techniques for screening small molecule libraries for molecules that can bind to polypeptide targets are well known in the art (see, for example, WO 00 / 00823 and WO 00 / 39585). The small molecule to be attached can be, for example, an aldehyde, ketone, oxime, hydrazone, semicarbazone, carbazide, primary amine, secondary amine, tertiary amine, N-substituted hydrazine, hydrazide, alcohol, ether, thiol, thioether, disulfide, carboxylic acid, ester, amide, urea, carbamate, carbonate, ketal, thioketal, acetal, thioacetal, aryl halide, aryl sulfonate, alkyl halide, alkyl sulfonate, aromatic compound, heterocyclic compound, aniline, alkene, alkyne, diol, amino alcohol, oxazolidine, oxazoline, thiazolidine, thiazoline, enamine, sulfonamide, epoxide, aziridine, isocyanate, sulfonyl chloride, diazo compound, or acid chloride.

[0100] In some embodiments, binding of NRP2, THBD, or B2M to the HCMV gH / gL / UL128-131A pentamer is decreased in the presence of the small molecule (e.g., decreased by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, e.g., decreased by 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, or 95%-100%). In some embodiments, binding of NRP2, THBD, or B2M to the HCMV gH / gL / UL128-131A pentamer is increased in the presence of the small molecule (e.g., increased by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100%, e.g., increased by 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, 95%-100% or more than 100%). In some embodiments, downstream activity of NRP2, THBD, B2M, and / or HCMV gH / gL / UL128-131A pentamer (e.g., infection of cells with HCMV) is decreased in the presence of the small molecule (e.g., decreased by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, e.g., decreased by 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, or 95%-100%).

[0101] E. Antibodies and Antigen-Binding Fragments In some embodiments, the modulator or candidate modulator is an antibody or antigen-binding fragment thereof that binds to NRP2, THBD, B2M, and / or HCMV gH / gL / UL128-131A pentamer. In some embodiments, the antigen-binding fragment is a bis-Fab, Fv, Fab, Fab'-SH, F(ab') 2 , a diabody, a linear antibody, an scFv, an scFab, a VH domain, or a VHH domain.

[0102] In some embodiments, the modulator is a multispecific antibody, e.g., a bispecific antibody. In some embodiments, the modulator is a bispecific or multispecific antibody that binds to multiple epitopes of NRP2, THBD, B2M, and / or the HCMV gH / gL / UL128-131A pentamer. In some embodiments, the modulator is a bispecific or multispecific antibody that binds to two or more of NRP2, THBD, B2M, and the HCMV gH / gL / UL128-131A pentamer.

[0103] In some embodiments, binding of NRP2, THBD, or B2M to the HCMV gH / gL / UL128-131A pentamer is reduced in the presence of the antibody or antigen-binding fragment (e.g., reduced by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, e.g., reduced by 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95% or 95%-100%). In some embodiments, binding of NRP2, THBD, or B2M to the HCMV gH / gL / UL128-131A pentamer is increased in the presence of the antibody or antigen-binding fragment (e.g., increased by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or greater, e.g., increased by 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, 95%-100% or greater). In some embodiments, downstream activity of NRP2, THBD, B2M, and / or HCMV gH / gL / UL128-131A pentamer (e.g., infection of a cell with HCMV) is decreased in the presence of the antibody or antigen-binding fragment (e.g., decreased by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, e.g., decreased by 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, or 95%-100%).

[0104] F. Peptides In some embodiments, the modulator or candidate modulator is a peptide that binds to NRP2, THBD, B2M, and / or HCMV gH / gL / UL128-131A pentamer. The peptide may be a naturally occurring peptide or an engineered peptide. The peptide may bind to a binding partner with an affinity equal to, less than, or greater than the full-length protein. In some embodiments, the peptide performs all of the functions of the full-length protein. In other embodiments, the peptide does not perform all of the functions of the full-length protein.

[0105] In some embodiments, binding of NRP2, THBD, or B2M to the HCMV gH / gL / UL128-131A pentamer is decreased in the presence of the peptide (e.g., decreased by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, e.g., decreased by 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95% or 95%-100%). In some embodiments, binding of NRP2, THBD, or B2M to the HCMV gH / gL / UL128-131A pentamer is increased in the presence of the peptide (e.g., increased by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100%, e.g., increased by 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, 95%-100% or more than 100%). In some embodiments, downstream activity of NRP2, THBD, B2M, and / or HCMV gH / gL / UL128-131A pentamer (e.g., infection of cells with HCMV) is decreased in the presence of the peptide (e.g., decreased by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, e.g., decreased by 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, or 95%-100%).

[0106] G. Imitation In some embodiments, the modulator or candidate modulator is a mimetic, e.g., a molecular mimetic, that binds to NRP2, THBD, B2M, and / or HCMV gH / gL / UL128-131A pentamer. In some embodiments, the mimetic may perform all of the functions of the mimicked polypeptide. In other embodiments, the mimetic does not perform all of the functions of the mimicked polypeptide.

[0107] In some embodiments, binding of NRP2, THBD, or B2M to the HCMV gH / gL / UL128-131A pentamer is decreased in the presence of the mimetic (e.g., decreased by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, e.g., decreased by 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95% or 95%-100%). In some embodiments, binding of NRP2, THBD or B2M to the HCMV gH / gL / UL128-131A pentamer is increased in the presence of the mimetic (e.g., increased by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100%, e.g., increased by 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, 95%-100% or more than 100%). In some embodiments, downstream activity of NRP2, THBD, B2M, and / or HCMV gH / gL / UL128-131A pentamer (e.g., infection of cells with HCMV) is decreased in the presence of the mimetic (e.g., decreased by 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, e.g., decreased by 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95% or 95%-100%).

[0108] H. Assays for Modulation of Protein-Protein Interactions In some embodiments, binding of NRP2, THBD or B2M to the HCMV gH / gL / UL128-131A pentamer in the presence or absence of a candidate modulator is assessed in an assay for protein-protein interactions. Modulation of an interaction may be identified as an increase in protein-protein interaction in the presence of a modulator compared to protein-protein interaction in the absence of the modulator, e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, 100%, or greater than 100% (e.g., 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, 95%-100%, or greater than 100%) increase in protein-protein interaction. Alternatively, modulation may be identified as a decrease in protein-protein interaction in the presence of a modulator compared to protein-protein interaction in the absence of the modulator, e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95% or 100% (e.g., 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95% or 95%-100%) decrease in protein-protein interaction. The protein-protein interaction assay may be, for example, an SPR assay, a biolayer interferometry (BLI) assay, an enzyme-linked immunosorbent assay (ELISA), an extracellular interaction assay, or a cell surface interaction assay.

[0109] Exemplary methods for identifying modulators of protein-protein interactions, as well as agents that can modulate such interactions, are described in International Application No. PCT / US2020 / 025471, which is incorporated by reference in its entirety.

[0110] III. Methods of Treating or Preventing HCMV Infection A. Methods of Treating Individuals with HCMV Infection In some aspects, the disclosure features a method for treating an HCMV infection in an individual, comprising administering to the individual an effective amount of a modulator described herein (e.g., a modulator of the interaction between NRP2, THBD and / or B2M and the HCMV gH / gL / UL128-131A pentamer), thereby treating the individual. In some aspects, the disclosure features the use of a modulator described herein (e.g., a modulator of the interaction between NRP2, THBD and / or B2M and the HCMV gH / gL / UL128-131A pentamer) in the manufacture of a medicament for treating an HCMV infection in an individual. In some aspects, the individual is immunocompromised, pregnant, or an infant.

[0111] In some embodiments, the duration or severity of HCMV infection is reduced by at least 40% (e.g., 40%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, or 95%-100%) compared to an individual not administered the modulator. In some embodiments, the duration or severity of HCMV infection is reduced by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 100% (e.g., between 5% and 15%, between 15% and 25%, between 25% and 35%, between 35% and 45%, between 45% and 55%, between 55% and 65%, between 65% and 75%, between 75% and 85%, between 85% and 95%, or between 95% and 100%).

[0112] B. Methods for preventing HCMV infection or secondary infection In some aspects, the disclosure features a method for preventing HCMV infection in an individual, comprising administering to the individual an effective amount of a modulator described herein (e.g., a modulator of the interaction between NRP2, THBD and / or B2M and the HCMV gH / gL / UL128-131A pentamer), thereby preventing HCMV infection in the individual. In some aspects, the disclosure features the use of a modulator described herein (e.g., a modulator of the interaction between NRP2, THBD and / or B2M and the HCMV gH / gL / UL128-131A pentamer) in the manufacture of a medicament for preventing HCMV infection in an individual.

[0113] In some embodiments, the modulator reduces the likelihood of HCMV infection in an individual compared to infection in the absence of the modulator. In some embodiments, the likelihood, extent, or severity of HCMV infection is reduced in patients treated according to the methods described above compared to untreated patients or compared to patients treated using a control method (e.g., SOC), e.g., reduced by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% (e.g., reduced by 5% to 15%, 15% to 25%, 25% to 35%, 35% to 45%, 45% to 55%, 55% to 65%, 65% to 75%, 75% to 85%, 85% to 95%, or 95% to 100%).

[0114] In some aspects, the disclosure features a method of prophylaxis against a secondary HCMV infection in an individual (e.g., an individual having an HCMV infection), comprising administering to the individual an effective amount of a modulator described herein (e.g., a modulator of the interaction between NRP2, THBD and / or B2M and the HCMV gH / gL / UL128-131A pentamer), thereby preventing a secondary HCMV infection in the individual. In some aspects, the disclosure features the use of a modulator described herein (e.g., a modulator of the interaction between NRP2, THBD and / or B2M and the HCMV gH / gL / UL128-131A pentamer) in the manufacture of a medicament for prophylaxis against a secondary HCMV infection in an individual. In some aspects, the secondary infection is an infection of an uninfected tissue with HCMV.

[0115] In some embodiments, the modulator reduces the likelihood of a secondary HCMV infection in an individual compared to a secondary infection in the absence of the modulator. In some embodiments, the likelihood, extent, or severity of a secondary HCMV infection is reduced, e.g., by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% (e.g., reduced by 5% to 15%, 15% to 25%, 25% to 35%, 35% to 45%, 45% to 55%, 55% to 65%, 65% to 75%, 75% to 85%, 85% to 95%, or 95% to 100%) in patients treated according to the methods described above compared to untreated patients or compared to patients treated using a control method (e.g., SOC).

[0116] C. Combination Therapy In some embodiments of the above-described treatment and prevention methods, the method includes administering to the individual at least one additional therapy (e.g., one, two, three, four, or more additional therapies). The modulator of the interaction between NRP2, THBD and / or B2M and the HCMV gH / gL / UL128-131A pentamer may be administered to the individual prior to, concomitantly with, or after the at least one additional therapy.

[0117] In some embodiments, the additional therapy is a modulator of an interaction between a host cell protein (e.g., a plasma membrane-expressed host cell protein) and the HCMV gHgLgO trimer, e.g., a modulator that reduces binding of the HCMV gHgLgO trimer to a host cell protein. Exemplary modulators of such interactions are provided in International Application No. PCT / US2021 / 060887, which is incorporated by reference in its entirety.

[0118] D. Method of Delivery Compositions utilized in the methods described herein (e.g., modulators of the interaction between NRP2, THBD and / or B2M and the HCMV gH / gL / UL128-131A pentamer, e.g., small molecules, antibodies, antigen-binding fragments, peptides, mimetics, antisense oligonucleotides, or siRNAs) can be administered by any suitable method, including, for example, intravenous, intramuscular, subcutaneous, intradermal, transdermal, intra-arterial, intraperitoneal, intralesional, intracranial, intra-articular, intraprostatic, intrapleural, intratracheal, intrathecal, intranasal, intravaginal, intrarectal, topical, intratumoral, intraperitoneal, subconjunctival, intravesical, intramucosal, intrapericardial, subumbilical, intraocular, intraorbital, oral, transdermal, intravitreal (e.g., by intravitreal injection), eye drops, inhalation, injection, implantation, drip, continuous infusion, localized perfusion bath, directly to target cells, by catheter, lavage, in a cream, or in a lipid composition. The compositions utilized in the methods described herein can also be administered systemically or locally. The method of administration can vary depending on various factors, such as the compound or composition being administered and the severity of the condition, disease, or disorder being treated. In some aspects, the modulator of protein-protein interactions is administered intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intraorbitally, by implantation, by inhalation, intrathecally, intracerebroventricularly, or intranasally. Dosing can be by any suitable route, for example, injections, such as intravenous or subcutaneous injections, depending in part on whether the administration is brief or chronic. Various dosing schedules are contemplated herein, including, but not limited to, a single dose or multiple doses over various time points, bolus doses, and pulse infusions.

[0119] The modulators of protein-protein interactions described herein (and any additional therapeutic agents) may be formulated, dosed, and administered in a manner consistent with standards of medical practice. Factors to consider in this regard include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of delivery of the agent, the method of administration, the administration schedule, and other factors known to medical practitioners. The modulators need not be, but are optionally, formulated and / or co-administered with one or more agents currently used to prevent or treat the disorder in question. The effective amount of such other agents will depend on the amount of modulator present in the formulation, the type of disorder or treatment, and other factors discussed above. These will generally be used in the same dosages and by the same routes of administration as described herein, or about 1-99% of the dosages described herein, or at any dosage and by any route empirically / clinically determined to be appropriate.

[0120] III. Methods for identifying modulators of the interaction between HCMV gH / gL / UL128-131A pentamer and B2M A. Assays for Modulation of Interactions In some aspects, the invention features a method for identifying a modulator of the interaction between HCMV gH / gL / UL128-131A pentamer and beta 2 microglobulin (B2M), the method comprising: (a) providing a candidate modulator (e.g., a candidate modulator described in Section II herein); (b) contacting the HCMV gH / gL / UL128-131A pentamer with B2M in the presence or absence of the candidate modulator under conditions that allow binding of the HCMV gH / gL / UL128-131A pentamer to B2M; and (c) measuring binding of the HCMV gH / gL / UL128-131A pentamer to B2M, wherein an increase or decrease in binding in the presence of the candidate modulator compared to binding in the absence of the candidate modulator identifies the candidate modulator as a modulator of the interaction between HCMV gH / gL / UL128-131A pentamer and B2M.

[0121] In some aspects, the disclosure features a method of identifying a modulator of a downstream activity of an HCMV gH / gL / UL128-131A pentamer, the method including: (a) providing a candidate modulator; (b) contacting the HCMV gH / gL / UL128-131A pentamer with B2M in the presence or absence of the candidate modulator under conditions that allow binding of the HCMV gH / gL / UL128-131A pentamer to B2M; and (c) measuring the downstream activity of the HCMV gH / gL / UL128-131A pentamer, where a change in the downstream activity in the presence of the candidate modulator compared to the downstream activity in the absence of the candidate modulator identifies the candidate modulator as a modulator of the downstream activity of the HCMV gH / gL / UL128-131A pentamer.

[0122] In some aspects, the disclosure features a method of identifying a modulator of a downstream activity of B2M, the method including: (a) providing a candidate modulator; (b) contacting B2M with an HCMV gH / gL / UL128-131A pentamer in the presence or absence of the candidate modulator under conditions that allow binding of B2M to the HCMV gH / gL / UL128-131A pentamer; and (c) measuring the downstream activity of B2M, where a change in the downstream activity in the presence of the candidate modulator compared to the downstream activity in the absence of the candidate modulator identifies the candidate modulator as a modulator of the downstream activity of B2M.

[0123] In some embodiments, the increase or decrease in binding is at least 50% (e.g., 50%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, or 95%-100%) as measured by surface plasmon resonance, biolayer interferometry, or enzyme-linked immunosorbent assay (ELISA).

[0124] In some aspects, the modulator is an inhibitor of a downstream activity of HCMV gH / gL / UL128-131A pentamer or B2M.

[0125] In some embodiments, the modulator is a modulator as described in Section II herein, e.g., a small molecule, an antibody or an antigen-binding fragment thereof (e.g., bis-Fab, Fv, Fab, Fab'-SH, F(ab') 2 , diabody, linear antibody, scFv, scFab, VH domain, or VHH domain), peptide, mimetic, or inhibitory nucleic acid (e.g., ASO or siRNA).

[0126] In some embodiments where the modulator is an antibody or antigen-binding fragment thereof, the antibody or antigen-binding fragment thereof binds to the HCMV gH / gL / UL128-131A pentamer. In some embodiments, the antibody or antigen-binding fragment thereof binds to B2M. For example, in some embodiments, the modulator is an antibody or antigen-binding fragment thereof that binds to the HCMV gH / gL / UL128-131A pentamer, an antibody or antigen-binding fragment thereof that binds to B2M, or an antibody or antigen-binding fragment thereof that binds to the HCMV gH / gL / UL128-131A pentamer and B2M.

[0127] In some aspects, the change in downstream activity is a decrease in the amount, intensity, or duration of the downstream activity.

[0128] In some embodiments, the downstream activity is infection of cells by HCMV, and the infection is reduced in the presence of the modulator. The reduction in infection can be at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% reduction (e.g., 5% to 15%, 15% to 25%, 25% to 35%, 35% to 45%, 45% to 55%, 55% to 65%, 65% to 75%, 75% to 85%, 85% to 95%, or 95% to 100% reduction), for example, when measured in a viral infection assay or viral entry assay using pseudotyped particles. In some embodiments, the infection is reduced by at least 40% when measured in a viral infection assay or viral entry assay using pseudotyped particles.

[0129] In some embodiments, the candidate modulator is provided to cells (e.g., mammalian cells), cell culture medium, conditioned medium, and / or purified forms of HCMV gH / gL / UL128-131A pentamers and / or B2M. In some embodiments, the candidate modulator is provided at a concentration of at least 0.1 nM, 0.5 nM, 1 nM, 10 nM, 50 nM, 100 nM, 250 nM, 500 nM, 750 nM, 1 μM, 2 μM, 3 μM, 5 μM, or 10 μM. In some embodiments, the candidate modulator is provided at a concentration between 0.1 nM and 10 μM. In some embodiments, the candidate modulator is provided in solution, e.g., in a soluble form.

[0130] In some embodiments, a candidate modulator is identified as a modulator if the increase in binding is at least 70%. In some embodiments, the increase in binding is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, or more than 100% (e.g., the increase is 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, 95%-100%, or more than 100%). In some embodiments, the increase in binding is at least 70%.

[0131] In some embodiments, a candidate modulator is identified as a modulator if the reduction in binding is at least 70%. In some embodiments, the reduction in binding is at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or 100% (e.g., the reduction in binding is between 5% and 15%, between 15% and 25%, between 25% and 35%, between 35% and 45%, between 45% and 55%, between 55% and 65%, between 65% and 75%, between 75% and 85%, between 85% and 95%, or between 95% and 100%). In some embodiments, the reduction in binding is at least 70%.

[0132] i. Assays for modulation of protein-protein interactions In some embodiments, binding of the HCMV gH / gL / UL128-131A pentamer to B2M in the presence or absence of a candidate modulator is assessed in an assay for protein-protein interactions. Modulation of the interaction between the HCMV gH / gL / UL128-131A pentamer and B2M may be identified as an increase in protein-protein interaction in the presence of a modulator compared to the protein-protein interaction in the absence of the modulator, e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, 100%, or greater than 100% increase (e.g., a 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, 95%-100%, or greater than 100% increase) of protein-protein interaction. Alternatively, modulation may be identified as a decrease in a protein-protein interaction in the presence of a modulator compared to a protein-protein interaction in the absence of the modulator, e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 95%, or 100% decrease (e.g., a 5%-15%, 15%-25%, 25%-35%, 35%-45%, 45%-55%, 55%-65%, 65%-75%, 75%-85%, 85%-95%, or 95%-100% decrease) of a protein-protein interaction. The assay for protein-protein interactions can be, for example, an SPR assay, a biolayer interferometry (BLI) assay, an enzyme-linked immunosorbent assay (ELISA), an extracellular interaction assay as described in WO 2020 / 205626, or a cell surface interaction assay as described in WO 2020 / 205626.

[0133] All patents, patent publications and literature cited herein are hereby incorporated by reference in their entirety. EXAMPLES

[0134] Example 1. Structural basis of HCMV pentamer receptor recognition and antibody neutralization A. Introduction Human cytomegalovirus (HCMV) is a member of the beta-herpesvirus family and is responsible for severe morbidity and mortality in immunocompromised individuals (Kotton et al., Nat. Rev. Nephrol., 6:711-721, 2010). HCMV infection poses a particular threat during pregnancy and is the leading viral cause of congenital birth defects (Hyde et al., Reviews in Medical Virology, 20(5):311-326, 2010).

[0135] HCMV displays broad cell tropism and utilizes the gH / gL / UL128-130-131A pentameric complex ("pentamer") to bind to different receptor proteins and infect diverse cell types, including epithelial, endothelial and myeloid cells (Connolly et al., Nat. Rev. Microbiol., 19(2), 110-121, 2021; E et al., Proc. Natl. Acad. Sci., 116(14):7043-7052, 2019; Martinez-Martin et al., Cell, 174(5):1158-1171, 2018; Nguyen and Kamil, Viruses, 10(12):704, 2018). HCMV receptor binding is thought to provide a triggering signal for the gB glycoprotein to catalyze membrane fusion between the virus and the host cell, allowing HCMV to enter the cell, replicate, and establish its latency (Malito et al., Curr. Opin. Virol., 31:43-51, 2018). Neuropilin 2 (NRP2) deficiency has been demonstrated to render selected endothelial and epithelial cells resistant to HCMV infection, indicating a critical role for NRP2 as an HCMV receptor (Martinez-Martin et al., Cell, 174(5):1158-1171, 2018), although the structural basis of this interaction remains unclear. HCMV pentamers also bind thrombomodulin (THBD) with nanomolar affinity, although the role of THBD in HCMV entry remains enigmatic (Martinez-Martin et al., Cell, 174(5):1158-1171, 2018).

[0136] Upon infection, HCMV elicits extremely potent neutralizing antibodies against the pentamer, highlighting the importance of this complex as a therapeutic and vaccine candidate against HCMV (Macagno et al., J. Virol., 84(2):1005-1013, 2010). Despite significant efforts, a vaccine against HCMV remains an unmet medical need, and no approved therapies are currently available to treat congenital HCMV infection (Biron, Antiviral Research, 71(2-3):154-163, 2006; Chen et al., Viruses, 12(1):21, 2019). This gap is mainly due to the lack of structural understanding of the interaction between the pentamer and host cell receptors, and limited knowledge of epitopes relevant for pentamer neutralization.

[0137] In this example, we determine the high-resolution structure of the pentamer complexed with the cellular receptors NRP2 and THBD. These structures highlight the specific interactions required for HCMV pentamer-receptor recognition and reveal unexpected dimerization of the pentamer-receptor complex. Importantly, the interactions between the pentamer and NRP2 or THBD are mutually exclusive, and both are not co-receptors but rather functional receptors mediating entry into different cell types. This example also reports the structure of the pentamer bound to a series of potently neutralizing antibodies that identify key neutralization sites for HCMV. These studies provide a framework for understanding HCMV receptor recognition and antibody-based neutralization.

[0138] B. Summary of Results The examples provided herein present a comprehensive structural, biophysical, and functional analysis of the HCMV pentamer, providing important insights into its structure, receptor recognition, cell entry, and neutralization. These studies reveal how the majority of the pentameric subunit UL128-131A binds to two completely different functional receptor proteins, NRP2 and THBD, shedding light on how HCMV achieves broad cell tropism and receptor specificity for different cell types. Neuropilin 1 and 2 have been shown to use their b1 domains to interact with the CendR motif of binding partners, including VEGF and the spike protein of SARS-CoV-2 (Daly et al., Science, 370(6518):861-865, 2020; Parker et al., J. Biol. Chem., 287(14):11082-11089, 2012); however, structural studies demonstrate that NRP2 does not utilize this canonical binding site, instead engaging the pentamer to the UL128 and UL131A subunits through a key interaction between the a2 and b2 domains (Figures 1E, 1F, 1H, and 8A; Wrapp et al., bioRxiv, p.2021.03.25.436804, 2021). Upon pentamer binding, the NRP2 a1 domain displaces from the a2b1b2 core and relocates to the binding site between UL128 and gL (Figure 1D). Notably, the NRP2 a1 domain binds to the same region of the pentamer that is recognized by the THBD receptor (Figures 1A-1H and 2A-2D), indicating that HCMV pentamers have evolved opportunistic binding sites that can recognize multiple different interaction partners with high affinity for entry into different cell types.

[0139] In these examples, we show for the first time that THBD is a relevant functional receptor for HCMV (Figures 3A and 3B). The mutually exclusive binding of NRP2 and THBD to the pentamer revealed by these structural and biophysical studies (Figures 3D-3F) further suggests that HCMV likely does not use these proteins as co-receptors, but rather uses the pentamer to enter epithelial and endothelial cells via two alternative pathways. Based on the expression profiles of NRP2 and THBD, the NRP2 receptor is primarily used for epithelial cell infection, while THBD may be the main receptor for endothelial and myeloid cell infection (Sartain et al., J. Immunol., 196(2):832-845, 2016; Bachem et al., J. Exp. Med., 207(6):1273-1281, 2010). It was previously proposed that the pentamer undergoes a large conformational change upon receptor binding to trigger gB-mediated membrane fusion and HCMV entry (Chandramouli et al., Sci. Immunol., 2(30):2017). However, the present structural studies suggest that NRP2 or THBD interaction does not significantly alter the conformation of the pentamer (Figures 9C and 9D). Thus, the pentamer may trigger gB activation through a different mechanism that does not involve a large pentamer conformational change, perhaps similar to that recently proposed for the HCMV trimer (Kschonsak et al., Cell, 184(5):1232-1244.e16, 2021).

[0140] The present structure reveals that HCMV pentamers can undergo dimerization in which the NRP2 a1 and THBD lectin-like domains are sandwiched between two pentamers. This apparent receptor-mediated dimerization of pentamers occurs in a head-to-head manner via the UL128 subunit and the NRP2 or THBD receptors, respectively (Figures 2B and 3G). This method of receptor engagement by pentamers is clearly distinct from that observed for HCMV trimers, where each host receptor was seen to engage only one copy of the trimer (Kschonsak et al., Cell, 184(5):1232-1244.e16, 2021). It is noteworthy that these structural observations seem consistent with the experimental design required for the identification of human receptors involved in trimer or pentamer recognition (Martinez-Martin et al., Cell, 174(5):1158-1171, 2018). Indeed, although PDGFRα was identified as a trimeric receptor using classical affinity purification and mass spectrometry approaches (Kabanova et al., Nat. Microbiol., 1(8):16082, 2016), identification of physiologically relevant pentamer-receptor interactions may only be possible through pentamer oligomerization, possibly via increased receptor binding activity and potentially mimicking the molecular arrangement of two opposing membranes (i.e., viral envelope and host cell) (Martinez-Martin et al., Cell, 174(5):1158-1171, 2018). The apparent requirement for receptor-mediated dimerization of pentamers and the lack of structural rearrangements upon receptor binding support the model of pentamer-specific HCMV entry into host cells shown in Figure 5. In this model, receptor binding correlates with pentamer dimerization, which then mediates receptor clustering and ultimately promotes high-affinity and stable tethering of the viral membrane to the host cell membrane. Through an as yet unknown mechanism, receptor-mediated pentamer dimerization and membrane tethering triggers the transition of gB from its prefusion to a postfusion conformation, presumably initiating membrane fusion via localized capture of gB upon pentameric clustering and / or fluctuations within the viral membrane bilayer.The recent high-resolution structure of HCMV gB in its prefusion conformation (Liu et al., Sci. Adv., 7(10), 2021) should open new avenues to test these and other hypotheses. Future high-resolution structural studies will be required to address the structural basis of the interaction of HCMV pentamers (or trimers) with prefusion gB and the mechanisms required to trigger membrane fusion.

[0141] HCMV pentamers elicit the most potent neutralizing antibody responses against HCMV, but the structural basis of this neutralization remains poorly understood. These results show that Fab 2C12 directly interferes with NRP2 domain binding, blocking the binding between the pentamers and NRP2 (Figures 4A-4M). More importantly, Fab 7I13 is a potent neutralizing antibody that binds to the surface of the pentamers blocking both NRP2 and THBD, blocking pentamers' receptor interactions and potentially pentamers' dimerization (Figures 4A-4M). Overall, this example presents the structural basis of pentamers' receptor engagement and neutralization, revealing insights into the broad cell tropism and cell entry mechanisms of HCMV. These findings provide a framework for the future development of effective vaccines and therapeutics against HCMV.

[0142] C. Method i. Generation of HCMV glycoproteins and Fab constructs Codon-optimized (for expression in human cells) HCMV gH, gL, UL128, UL130, UL131A, and NRP2 genes were synthesized and subcloned into the plasmid expression vector pRK5 (Genentech). The gH gene contained only the extracellular domain (first 716 amino acids), which was fused to a C-terminal Myc-Avi-8xHIS tag. For protein purification purposes, UL130 was fused to a C-terminal double Strep tag.

[0143] ii. Protein Expression and Purification HCMV pentamers were purified in three steps as previously described for HCMV trimers (Kschonsak et al., Cell, 184(5):1232-1244.e16, 2021). EXPI293F™ cells were transfected with plasmids encoding the individual subunits. Expression supernatants corresponding to 50 µL of expression were concentrated to a volume of 1–2 L by tangential flow filtration (TFF), loaded onto 20 mL of Ni SEPHAROSE™ Excel resin (Cytiva), washed with 13 column volumes (CV) of wash buffer (50 mM Tris pH 8.0, 300 mM NaCl, 5% glycerol, 20 mM imidazole), and eluted in 5 CV elution buffer (50 mM Tris pH 8.0, 300 mM NaCl, 5% glycerol, 400 mM imidazole). The eluent was applied to 3 mL of STREP-TACTIN® XT high affinity resin (IBA Lifesciences) and allowed to bind for 2 hours. The resin was washed with 10 CV of Strep Wash Buffer (25 mM HEPES pH 7.5, 300 mM NaCl, 5% glycerol) and eluted from the beads in Strep Wash Buffer supplemented with 50 mM biotin. The eluate was concentrated with an AMICON® Ultra Centrifugal Filter Device (30 kDa MWCO) and loaded onto a SUPERDEX™ 200 10 / 300 or 16 / 60 column equilibrated with Pentamer-SEC Buffer (25 mM HEPES pH 7.5, 300 mM NaCl, 5% glycerol).

[0144] Human Fc-tagged NRP2 protein was expressed in 30 mL cultures of EXPI293F™ cells, transfected with 30 μg of plasmid DNA and grown for 7 days. After harvesting the expression medium culture supernatant, the Fc fusion protein was purified with 0.15 mL of TOYOPEARL® AF-r Protein A HC-650F (Tosoh Bioscience, Grove City, OH). Unbound proteins and medium components were removed by washing with 10 CV of phosphate-buffered saline (PBS, pH 7.4). The NRP2-huFc fusion was eluted from the resin using elution buffer (50 mM phosphate, pH 2.9) and immediately neutralized to a pH of ∼6.0 by adding 0.05 mL of 20×PBS pH 11.0. The protein was further refined by size-exclusion chromatography (SEC) purification performed on a ZENIX®-C SEC 300 column (Sepax Technology, Newark, DE) connected to an ULTIMATE™ 3000 HPLC System (Thermo Fisher Scientific, Waltham, MA). The column was equilibrated in 1× PBS, pH 7.4, and the sample was separated by isocratic elution at a flow rate of 1.5 mL / min.

[0145] Human THBD-Flag and NRP2-Flag were purified from 10 L of expression supernatant. The supernatant was incubated with 10 mL of M2 agarose Flag resin (Sigma) and incubated at 4° C. for 20 hours. The resin was washed with 10 CV FLAG wash buffer (25 mM HEPES pH 7.5, 200 mM NaCl, 5% glycerol) and eluted with FLAG wash buffer supplemented with 0.2 mg / ml FLAG peptide. The eluate was concentrated with an AMICON® ultracentrifugal filter device (30 kDa MWCO) and loaded onto a SUPERDEX™ 200 10 / 60 column equilibrated in SEC buffer (25 mM HEPES pH 7.5, 200 mM NaCl).

[0146] Fragment antigen binding region (Fab) MSL-109 heavy and light chains were co-expressed under the phoA promoter in E. coli 34B8 cells (in-house strain) for 20 hours at 30°C in phosphate-limited medium (CRAP). The pellet from 1L expression was resuspended in 70mL lysis buffer (1x PBS, 25mM EDTA) supplemented with Roche protease inhibitor tablets and lysed by sonication. The lysate was clarified by centrifugation at 25,000xg for 1 hour and subsequently passed through a 0.45μm filter. The clarified lysate was loaded onto a 5mL HiTrap Protein G HP (Cytiva) column equilibrated in lysis buffer. The column was washed with 10-20 CV lysis buffer and eluted with 0.58% (v / v) acetic acid. The pH of the eluate was immediately adjusted by addition of SP-A buffer (20 mM MES pH 5.5) and loaded onto a 5 mL HiTrap SP HP cation exchange chromatography column (Cytiva). The Fab was eluted with a linear 20 CV gradient against SP-B buffer (20 mM MES pH 5.5, 500 mM NaCl). The eluate was concentrated using an AMICON® Ultra Centrifugal Filter Device (10 kDa MWCO) and further purified on a SUPERDEX™ 200 10 / 300 column equilibrated in Fab-S200 buffer (25 mM Tris pH 7.5, 300 mM NaCl). The purified Fab was concentrated with an AMICON® Ultra Centrifugal Filter Device (10 kDa MWCO) and eluted with liquid N 2 The heavy and light chains of Fabs 2C12, 7I13, 8I21 and 13H11 were co-expressed under the phoA promoter in E. coli 34B8 cells (in-house strain) in phosphate-limiting medium (CRAP) for 20 hours at 30°C. The pellet from the 4L expression was dissolved in 250 mL of lysis buffer (25 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 2 mM NaN) supplemented with Roche protease inhibitor tablets. 3 ) and lysed by sonication. Subsequent purification followed a protocol similar to that described for MSL-109.

[0147] Complexes between pentamers, Fabs and THBD were generated by incubation with at least a 1.2 molar excess of Fabs and receptors on ice for at least 1 hour and purified by SEC to remove excess Fabs / receptors. Pentamers-NRP2-Fab complexes were formed in two steps. First, pentamers and NRP2 were mixed and purified by SEC, followed by the addition of excess Fabs 8I21 and 13H11 and a second round of SEC purification.

[0148] iii. Cryo-EM sample preparation and data acquisition The HCMV pentameric complexes shown in this study were prepared as previously described for HCMV trimers (Kschonsak et al., Cell, 184(5):1232-1244.e16, 2021). For the HCMV pentameric gHgL-UL128-UL130-UL131A+NRP2+8I21+13H11 complex, a holey carbon grid (ULTRAUFOIL® 25 nM Au R 0.6 / 1 300 mesh; QUANTIFOIL®) was glow discharged for 20 seconds using a Solarus plasma cleaner (Gatan). For all other pentameric complexes, holey carbon grids (ULTRAUFOIL® 25 nM Au R 0.6 / 1 300 mesh; QUANTIFOIL®) were incubated with a thiol-reactive self-assembly reaction mixture of 4 mM monothioalkane (C11) PEG6-OH (11-mercaptoundecyl) hexaethylene glycol (SPT-0011P6, SensoPath Technologies, Inc., Bozeman, MT) (Meyerson et al., Sci. Rep., 4:7084, 2014). The grids were incubated with this self-assembled monolayer (SAM) solution for 24 h. Prior to grid freezing, the grids were removed from the SAM solution and rinsed with EtOH. 3 µL of sample at concentrations between 0.66 and 1.8 mg / mL were applied to grids, blotted on one side with a Leica EM GP (Leica) using a blotting time of 3.5 seconds at 100% humidity, and plunge-frozen in liquid ethane cooled with liquid nitrogen. Pentamer-NRP2-8I21-13H11 samples were gently crosslinked with 0.025% EM grade glutaraldehyde for 10 min at room temperature and quenched in 9 mM Tris pH 7.5 prior to grid application.

[0149] Movie stacks of HCMV pentamers gHgL-UL128-UL130-UL131A+2C12+7I13+13H11 and HCMV pentamers gHgL-UL128-UL130-UL131A+NRP2+8I21+13H11 were collected using SerialEM (Mastronarde, J. Struct. Biol., 152(1):36-51, 2005) on a Titan Krios G3i (ThermoFisher Scientific, Waltham, MA) operating at 300 keV with a bioquantum energy filter equipped with a K2 Summit direct electron detector camera (Gatan Inc., Pleasanton, CA). Images were recorded at 165,000x magnification, corresponding to 0.824 Å / pixel, using a 20 eV energy slit. Each image stack was captured at ∼50 eÅ. -2 The image contained 50 frames recorded every 0.2 s for an accumulated dose of 10 μm and a total exposure time of 10 s. Images were recorded at a set defocus range of 0.5 to 1.5 μm.

[0150] Movie stacks of the HCMV pentamer gHgL-UL128-UL130-UL131A+THBD+MSL-109+13H11 were collected using SerialEM (Mastronarde, J. Struct. Biol., 152(1):36-51, 2005) on a Titan Krios G3i (ThermoFisher Scientific, Waltham, MA) operating at 300 keV with a bioquantum energy filter equipped with a K3 Summit direct electron detector camera (Gatan Inc., Pleasanton, CA). Images were recorded in EFTEM mode at 105,000x magnification, corresponding to 0.838 Å / pixel, using a 20 eV energy slit. Each image stack was captured at ~60 eÅ. -2 It contains 60 frames recorded every 0.05 s for an accumulated dose of 1000 and a total exposure time of 3 s. Images were recorded at a set defocus range of 0.5 to 1.5 μm.

[0151] iv. Cryo-EM data processing Cryo-EM data were processed using a combination of RELION (Scheres, J. Struct. Biol., 180(3):519-530, 2012), cisTEM (Grant et al., eLife, 7:e35383, 2018), and cryoSparc (Punjani et al., Nat. Methods, 14(3):290-296, 2017) software packages, similar to previous work on HCMV trimers (Kschonsak et al., Cell, 184(5):1232-1244.e16, 2021).

[0152] Cryo-EM data of HCMV pentamer-2C12-7I13-13H11 were processed as described in Figures 13A-13H. For the generation of the first ab-initio reconstruction, 18,326 movies were motion corrected and contrast transfer function parameters were fitted in cisTEM. A total of 1,527,802,766 potential particles were picked using the circular blob picking tool in cisTEM. Particles were sorted in two rounds of cisTEM 2D classification to select the best aligning particles, resulting in 184,833 particles. These particles were subjected to ab-initio 3D generation in cisTEM with three target volumes. Volumes corresponding to HCMV pentamers bound to Fabs 2C12, 7I13 and 13H11 were used as 3D references for high-resolution 3D refinement. For the generation of high-resolution 3D reconstructions of the pentamer-2C12-7I13-13H11 complex, we corrected all 18,326 movies for frame motion using the MotionCor2 (Zheng et al., Nature Methods, 14:331-332, 2017) implementation in RELION and fitted contrast transfer function parameters using the 30-4.5 Å band of the spectrum with CTFFIND-4 (Rohou and Grigorieff, J. Struct. Biol., 192(2):216-221, 2015). CTF-fitted images were filtered based on a detected fit resolution better than 8 Å. A total of 5,128,264 particles were picked by template matching with gautomatch (MRC Laboratory of Molecular Biology) using the 30 Å low-pass filtered pentamer-2C12-7I13-13H11 complex reference structure. Particles were sorted during the RELION 2D classification and 4,792,984 selected particles were imported into cisTEM for 3D refinement.The first pentamer-2C12-7I13-13H11 reconstruction was obtained after automatic and manual refinement using a mask around the pentamer-2C12-7I13-13H11 complex by applying a low-pass filter (filter resolution 20 Å) and a score threshold of 0.30 outside the mask, so that in each cycle only 30% of the best-scoring particle images were included in the 3D reconstruction. The weight outside the mask was gradually reduced from 0.5 to 0.15 in iterative rounds of manual refinement (no data beyond 3.8 Å were used in the refinement). To improve the quality of the map, the map was divided into three different regions using a mask and a focused refinement was performed after applying a low-pass filter (filter resolution 20 Å) and a score threshold of 0.20 outside the mask. The focus map was sharpened in cisTEM with the following parameters: flattening from a resolution of 8 Å, -90 Å to 8 Å from the origin of the reciprocal space. 2 and a polarization efficiency filter (Rosenthal and Henderson, J. Mol. Biol., 333(4):721-745, 2003). For model building and drawing, a composite map was generated from the three individual focused 3D maps using phenix combine_focused_maps (Afonine et al., Acta Crystallogr. Sect. D Struct. Biol., 74(6):531-544, 2018).

[0153] Cryo-EM data for HCMV pentamer-THBD-13H11-MSL109 were processed as described in Figures 10A-10F. 10,926 movies were motion corrected using an implementation of motion correction in Relion, and aligned micrographs were imported into cisTEM for CTF estimation via CTFFIND4. A total of 9,167 images with a CTF fit resolution of at least 5 Å were selected for ab-initio particle picking using an exclusion and template radius of 30 Å. The resulting 10,680,163 particle coordinates were extracted using a box size of 400 pixels and 1.07 Å / pixel. Multiple rounds of hierarchical 2D classification and class selection ultimately resulted in three particle stacks: 78,577 particle stacks consisting of 2D classes in which the entire dimer was clearly resolved, 172,398 particle stacks containing several further classes in which the dimer was almost completely resolved, and 504,492 particle stacks containing all 2D classes with at least some well-resolved regions. An ab initio C2-symmetric 3D map was generated from the 78,577 particle stack, and an initial intermediate resolution initial map was obtained by automatic 3D refinement using C2 symmetry. A 172,398 particle stack was exported to Relion, and the C2-symmetric initial map was used as a template for 3D automatic refinement, first with C2 and finally with C1 symmetry with C2 symmetry relaxation. This resulted in an intermediate resolution HCMV pentamer-dimer map in which a single asymmetrically bound THBD was resolved at the dimer interface. Returning to cisTEM, the most comprehensive 504,492 particle stack was then refined in C1 against this asymmetric map using the full molecular mask and three different focus masks: one containing only THBD and UL128, UL130, UL131 of both protomers, one containing only gL, gH, 13H11, and MSL109 of a single protomer of the pseudodimer, and one containing only gL, gH, 13H11, and MSL109 of the other protomer.Phenix Resolve cryo-EM density correction was applied to each of these, and the final map used for model building was generated by combining the UCSF Chimera density-corrected maps by fitting the focus maps to the full molecular map by correlation, resampling to a common grid, and taking the highest value among the three focus maps for each voxel (vop maximum). Local resolution was calculated from the unsharpened, unfiltered half maps using Relion post-processing.

[0154] HCMV pentamers-NRP2-13H11-8I21 cryo-EM data were processed as described in Figure 6A-6I. 21,357 movies were motion corrected using Relion, CTF parameters were estimated with CTFFIND4, and images with a CTF fit resolution of at least 5 Å were selected for further processing. Relion ab-inito Laplace-of-Gaussian particle picking resulted in 982,313 particle coordinates, which were extracted using a box size of 142 pixels and a pixel size of 3 Å. After 2D classification, the 2D class of apparent HCMV pentamers (69,767 particles) was re-extracted to a box size of 400 pixels and 1.07 Å / pixel and subjected to Relion ab initio 3D refinement followed by 3D automatic refinement to obtain the initial pentamer map. For the dimeric pentamer-NRP2-8I21-13H11, 2D class selection was used as a template for Relion template-based particle picking, yielding 1,300,844 coordinates. These coordinates were extracted to a box size of 400 pixels and 1.07 Å / pixel and subjected to hierarchical 2D classification and selection, ultimately yielding 72,745 particles. These particles were directly imported into cisTEM and refined against the initial dimeric pentamer map using a full molecular mask (data beyond 6.7 Å was not used for refinement). For the monomeric pentamer-NRP2-8I21-13H11 complex, 21,357 images with a CTF fit resolution of at least 6 Å were selected for further processing. A total of 2,532,206 particles were picked by template matching with projections from a 30 Å low-pass filtered single pentamer-NRP2-8I21-13H11 reconstruction using gautomatch (MRC Laboratory of Molecular Biology). Particles were extracted using a 66px box size and 5.4 Å pixel size and sorted using Relion 2D classification, extracting 2,252,924 particles with a 280px box size and 1.35 Å pixel size.These particles were imported directly into the cisTEM and refined against the initial monomeric pentamer map using a full molecular mask (data beyond 4 Å were not used for refinement). To improve the quality of the map, the mask was used to split the map into three different regions and a low-pass filter (filter resolution 20 Å) and a score threshold of 0.20 were applied outside the mask, followed by focused refinement. The final map used for model building was generated by applying Phenix Resolve cryo-EM density correction to each of these maps and then combining the density-corrected maps in UCSF Chimera. Local resolution was calculated from the unsharpened and unfiltered half-maps using Relion post-processing for the dimeric pentamer NRP2-8I21-13H11. For the monomeric pentamer-NRP2-8I21-13H11 complex, local resolution was determined in the cisTEM using a reimplementation of the blocres algorithm.

[0155] v. Model construction and structural analysis The gH and gL, UL128, UL130 and UL131A subunits of the HCMV pentamer structure (Chandramouli et al., Sci. Immunol., 2(30):2017) were fitted as rigid bodies to the cryo-EM map. The THBD lectin domain was constructed based on a homology model of human RegIIalpha (PDB:4MTH, (Mukherjee et al., Nature, 505(7481):103-107, 2014)) using SwissModel (Waterhouse et al., Nucleic Acids Res., 46(W1):W296-W303, 2018). The structure of NRP2 (PDB:2QQO) was used as a template for modeling the NRP2 a1-a2-b1b2 domains. The resulting models were fitted as rigid bodies to the cryo-EM map. After extensive rebuilding and manual refinement, multiple rounds of real-space refinement with the phenix.real_space_refinement (Afonine et al., Acta Crystallogr. Sect. D Struct. Biol., 74(6):531-544, 2018) tool were used to correct for global structural differences between the initial model and the map. The models were further manually refined in Coot (Emsley et al., Acta Crystallogr. Sect. D Struct. Biol., 66(4):486-501, 2010) through iterative rounds of model building and real-space refinement in Isolde (Croll, Acta Crystallogr. Sect. D Struct. Biol., D74:519-530, 2018) and Phenix (Afonine et al., Acta Crystallogr. Sect. D Struct. Biol., 74(6):531-544, 2018).Models were validated using phenix.validation_cryoem (Afonine et al., Acta Crystallogr. Sect. D Struct. Biol., 74(6):531-544, 2018) with built-in MolProbity scoring (Williams et al., Protein Sci., 27(1):293-315, 2018). Figures were generated using PyMOL (PyMOL Molecular Graphics System, v.2.07 Schrodinger, LLC) and UCSF ChimeraX (Goddard et al., Protein Sci., 27(1):14-25, 2018). Sequences were aligned using Clustal Omega (Sievers et al., Mol. Syst. Biol., 7(1), 2011) in JalView (Waterhouse et al., Bioinformatics, 25(9):1189-1191, 2009) and displayed in ESPript 3.0 (Robert and Gouet, Nucleic Acids Res., 42(W1):W320-W324, 2014).

[0156] vi. Cells and viruses The cells used in these studies were the same as those described in Martinez-Martin et al., Cell, 174(5):1158-1171, 2018. ARPE-19 is a male cell line derived from a naturally occurring retinal pigment epithelial (RPE) cell line (ATCC CRL-2302) and cultured in D-MEM / F-12+GLUTAMAX™ (Thermo Fisher Scientific) supplemented with 10% FBS and penicillin / streptomycin (Thermo Fisher Scientific). HAP-1 cells are a male chronic myeloid leukemia (CML) cell line derived from the KBM-7 cell line, obtained from Horizon Genomics GmbH, and cultured in Iscove's Modified Dulbecco's Medium (IMDM)+GLUTAMAX™ in the presence of 10% FBS and penicillin / streptomycin. Human umbilical vein endothelial cells (HUVEC, pooled from male and female donors) were obtained from Lonza, provided by Fondazione IRCCS Policlinico San Matteo, Pavia, Italy, and cultured in ENDOGRO™-VEGF complete medium (Millipore). HEK293FT is a female human embryonic kidney cell line isolate derived from human embryonic kidney cells transformed with SV40 large T antigen (Thermo Fisher Scientific). HEK 293FT cell line was cultured in D-MEM + 10% FBS, 0.1 mM MEM non-essential amino acids, GLUTAMAX™, 1 mM MEM sodium pyruvate, and 500 mg / mL GENETICIN™ (Thermo Fisher Scientific). All cell lines were confirmed to be free of Mycoplasma. HCMV clinical isolate VR1814 was provided by Virologia e Microbiologia, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy. HCMV VR1814 was propagated in HUVEC. ARPE-19 and HAP-1 cells were authenticated by analysis of short tandem repeat (STR) loci at ATCC and Horizon Genomics GmbH, respectively.HUVECs were authenticated by expression of CD31 / 105, von Willebrand factor VIII, and positive for acetylated low-density lipoprotein uptake. HEK293FT were purchased from Thermo Fisher Scientific and authenticated by their ability to produce high titers of infectious lentiviral particles.

[0157] vii. Flow cytometry staining Flow cytometry staining was performed as described by Martinez-Martin et al., Cell, 174(5):1158-1171, 2018. For cell surface staining, adherent cells (ARPE-19, HUVEC and HAP-1) were gently detached with a cell scraper, washed twice with PBS + 2% FBS and incubated for 30 min on ice with 2 μg / ml of specific anti-neuropilin 2 and anti-CD46 antibodies (AF2215 and AF2005, R&D systems), anti-thrombomodulin antibody (clone 141C01, Abcam) or normal sheep IgG affinity pure (R&D Systems) as isotype control in PBS + 0.5% BSA + 2 mM EDTA. After washing twice, cells were incubated with 2 mg / ml anti-mouse IgG (H+L) Alexa Fluor 594 conjugate (Thermo Fisher Scientific) secondary antibody for 30 min on ice, washed twice, and acquired on a FACS LSRFORTESSA™ (BD Biosciences) flow cytometer. Analysis was performed using FlowJo software (TreeStar).

[0158] viii. Microneutralization of viruses Serial dilutions of antibodies and soluble recombinant proteins were preincubated with HCMV clinical isolates (strain VR1814) for 1 h at 37°C and added to confluent monolayers of ARPE-19, HUVEC or HAP-1 cells cultured in 96-well flat-bottom plates (multiplicity of infection (MOI) 1). Serial dilutions (1:3) were used for the microneutralization assay, with the first dilution being 20 μg / mL. Infected cells were harvested after 3 days, fixed with BD CYTOFIX / CYTOPERM™ (Thermo Fisher Scientific), washed twice with PBS+2% FBS and incubated with 2 μg / mL of a specific mouse anti-pp72 antibody (clone 6E1, Santa Cruz Biotechnology, SC-69834) or an isotype control in PBS+0.5% BSA+2 mM EDTA for 30 min on ice. After washing twice, cells were incubated with 2 μg / mL goat anti-mouse IgG (H+L) Alexa Fluor 647 conjugate (Thermo Fisher Scientific) secondary antibody for 30 min on ice. Dead cells were excluded from the count by staining with 7-aminoactinomycin D (7-AAD; BioLegend). Samples were acquired using a FACS LSRFORTESSA™ (BD Biosciences) flow cytometer. Analysis was performed using FlowJo software (TreeStar). The percentage of infected cells was calculated by FACS. Dose-response curves were generated by plotting relative infected cells against the MFI signal. The concentration causing 50% inhibition of infection (IC50) was calculated by nonlinear regression using Prism 8 (GraphPad Software).

[0159] ix. Gene overexpression and gene knockout Gene overexpression and knockout (KO) for these studies were performed as described by Martinez-Martin et al., Cell, 174(5):1158-1171, 2018. Human Nrp2 (accession number AF022860), CD46 (accession number NM_002389) and THBD (accession number AF495471) were ordered from the GenEZ ORF database (Genscript) and cloned into pCDH-EF1-MCS (System Biosciences). Lentiviral particles were produced by PEI transfection of HEK293FT (Thermo Fisher Scientific) with pCDH-EF1-MCS (System Biosciences), pMD2.G (Addgene) and psPAX (Addgene) and purified on a sucrose cushion. CRISPR / Cas9-mediated HAP-1 KO of NRP2 was generated by Horizon Genomics GmbH. Lentiviral transduced HAP-1 cells were selected with 0.5mg / ml puromycin (Thermo Fisher Scientific) for 3 days. Single clones were expanded and effective KO of the target gene was analyzed by flow cytometry and confirmed by Sanger sequencing. The guide RNA used for CRISPR / Cas9 of NRP2 was 5'_GGGTAGTCCTGGGGGTAACC_3' (SEQ ID NO: 8).

[0160] x. Diffusion assay To examine cell spreading, HAP1 cell monolayers were inoculated with HCMV VR1814 at an MOI of 0.1 PFU / cell (virus was titrated on ARPE-19 cells). Infected cell cultures were then stained on day 2 or day 8 with 2 μg / mL mouse anti-pp72 antibody (clone 6E1. Santa Cruz Biotechnology, SC-69834) or isotype control for 30 min on ice. Infected HAP1-Nrp2 KO was used as a control and did not show the presence of any infection.

[0161] xi. Biolayer Interferometry The interactions between NRP2, THBD, Fab, and HCMV pentamers were analyzed by biolayer interferometry using the OCTET® Red96 system (ForteBio) as previously described (Kschonsak et al., Cell, 184(5):1232-1244, 2021). All data were collected at 25°C using 96-well black flat-bottom plates (Greiner Bio-One). Recombinant NRP2-Fc or THBD-Fc proteins were captured on anti-human Fc-coated (AHC) sensors (Sartorius) and tested for binding to CMV pentamers as soluble analytes. The sensors were equilibrated for 10 min according to the manufacturer's instructions prior to assay in PBS. All steps, including loading, baseline, association, and dissociation, were performed in PBS. To compare the relative binding between HCMV pentamers and NRP2 WT and mutant proteins, NRP2-Fc protein was captured on the AHC sensor and tested for binding to the pentamers as a soluble analyte at a concentration of 50 nM. Binding to NRP2 mutant proteins was expressed relative to binding to NRP2 WT protein. The binding units at the end of the association step were used to calculate the relative binding shown in the plot. For NRP2-THBD competition experiments, THBD-Flag was added at different concentrations (1:1; 1:10; 1:50; 1:100 molar excess) relative to the pre-equilibrated pentamer-NRP2-Fc complex. For Fab competition experiments, Fab 2C12, 7I13, 8I21, 13H11 or MSL-109 was added in excess to the pre-equilibrated pentamer-NRP2-Fc complex at a concentration of 100 μg / ml. In all cases, data were acquired using an OCTET® Red 96 instrument (Forte Pall software version 9.0). Biaevaluation software version 4.1 (GE Healthcare) was then used to calculate kinetic parameters. Data were fitted to a 1:1 Langmuir binding model.

[0162] xii. Quantification and statistical analysis In Figures 6A-6I, 9A-9D, 11A, and 11B, resolution estimates of the cryo-EM density maps are based on a 0.143 Fourier shell correlation (FSC) criterion (Rosenthal and Henderson, J. Mol. Biol., 333(4):721-745, 2003).

[0163] In Figures 3A and 3B, statistical parameters including exact values ​​of n, precision measures (geometric mean ± SEM), and statistical significance are reported in the figures and in the "Brief Description of Figures". Data were determined to be statistically significant when p<0.05. No statistical methods were used to predetermine sample size, no blinding of examiners was required, and no data points were excluded. Data were analyzed in Prism 8 (GraphPad Software) using a two-tailed nonparametric Mann-Whitney U test for comparison of two groups, or a Kruskal-Wallis test (and Dunn's post hoc test) when comparing three or more groups (asterisks indicate statistical significance *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001). Cell-surface interaction screen data were analyzed and represented using Microsoft Excel (version 14.7).

[0164] Example 2. Structural basis of pentamer-NRP2 receptor binding Previous structural studies of HCMV glycoprotein complexes have shown that these molecules are refractory to high-resolution structure determination due to their inherent flexibility, elongated nature, and numerous glycosylation sites (Ciferri et al., Proc. Natl. Acad. Sci., 112(6):1767-1772, 2015). Therefore, we reconstituted HCMV pentamers in complex with the soluble ectodomain of neuropilin 2 (NRP2) and the neutralizing Fabs 13H11 and 8I21 and determined their structures using single particle cryo-electron microscopy (cryo-EM) (Figures 1A-1H and 6A-6I). Two-dimensional class averaging identified two particle populations: one population was monomeric and one pentamer represented the majority of particles bound to one copy of NRP2. Unexpectedly, a second dimeric population was identified in which two pentameric complexes wrapped around a single NRP2 molecule and arranged in a head-to-head manner (Figures 6D-6F).

[0165] The structure of the monomeric pentamer-NRP2 complex bound to 13H11 and 8I21 was determined to a resolution of ∼3.1 Å (Figures 6G-6I). Focused 3D reconstructions allowed the construction of structural models of most of the pentamer-13H11-8I21 complex as well as the NRP2 a2, b1 and b2 domains (Figures 1C, 1D and 7A and Table 1). The density for the a1 domain of NRP2 was weaker than the rest of the complex (Figures 1D and 6G), likely due to flexibility or the ability of the a1 domain to interact loosely with the pentamer in different orientations. No density was observed for the C-terminal MAM domain of NRP2, despite its presence in the protein constructs and samples. TIFF2024521783000001.tif210170

[0166] In agreement with previous observations (Wrapp et al., bioRxiv, p.2021.03.25.436804, 2021), three main sites of interaction between NRP2 and the pentamer were identified (Figure 1E-1G). In site 1, the calcium coordination region in the a2 domain of NRP2 establishes charge interactions with residues localized in the N-terminal domain of UL128 of the pentamer (Figure 1E-1G). Specifically, NRP2-D197 and NRP2-D252 interact with UL128-K47, and NRP2-N172 contacts UL128-R57 (Figure 1E). Site 2 is established between the b2 domain of NRP2 and the C-terminal strands of UL130 and UL131A (Figure 1F and 1G). Notably, charge reversal mutations on the pentamer at either site 1 or site 2 were found to disrupt NRP2 binding (Figure 1H). Compared to the unbound NRP2 structure, the a1 domain displaces from the a2b1b2 core upon pentamer binding and relocates to a third interaction site, site 3, accommodated along the concave face of the UL component at the binding site between UL128 and gL (Figure 1D). This region is not well resolved in the cryo-EM map, suggesting that a1 domain binding to the monomeric pentamer is dynamic, consistent with the observation that NRP2 can still interact with the pentamer in the absence of the a1 domain, albeit to a lesser extent (Wrapp et al., bioRxiv, p.2021.03.25.436804, 2021).

[0167] Although the folds of NRP1 and NRP2 are conserved, the site of NRP2 interaction with the HCMV pentamer is distinct in NRP1, providing a structural basis for the specificity of the NRP2 receptor (Figures 8A-8C; Appleton et al., EMBO J., 26:4902-4912, 2007). Interestingly, NRP1 and NRP2 proteins are known to interact with several common partners, including VEGF and the spike protein of SARS-CoV-2, via the way their respective b1 domains interact with [R / K]XX[R / K] (CendR) motifs in the binding partners (Daly et al., Science, 370(6518):861-865, 2020; Parker et al., J. Biol. Chem., 287(14):11082-11089, 2012). However, the structure presented here and work from the McLellan group (Wrapp et al., bioRxiv, p.2021.03.25.436804, 2021) clearly demonstrate that the interaction between the pentamer and NRP2 does not involve this common binding surface on the b1 domain, but rather requires specific interactions between the a2 and b2 domains of NRP2 and the UL components of the pentamer, specifically UL128 and UL131A (Figures 1E-1G and 8D; Daly et al., Science, 370:861-865, 2020; Parker et al., J. Biol. Chem., 287:11082-11089, 2012). These features highlight the structural economy that underlies the wide variety of cellular proteins with which the pentamer can interact.

[0168] NRP2 receptor interaction with the pentamer may propagate a conformational change that allows or disallows binding of other HCMV glycoproteins, such as prefusion gB. We compared the cryo-EM structure of the pentamer bound to NRP2 with a previously determined crystal structure of the pentamer in the absence of receptor (PDB:5VOB (Chandramouli et al., Sci. Immunol., 2(30):2017)) as well as with the structure of the HCMV gHgLgO trimer (only gH and gL subunits (Kschonsak et al., Cell, 184(5):1232-1244, 2021). Notably, in agreement with previous findings (Wrapp et al., bioRxiv, p.2021.03.25.436804, 2021), highly similar conformations of gH / gL were observed across all comparisons (Figures 9A and 9B), implying that distinct mechanisms must underlie activation of the HCMV fusion machinery, as discussed below.

[0169] Example 3. Structural basis of pentamer-THBD receptor binding We next reconstituted a stoichiometric complex of the soluble THBD ectodomain with HCMV pentamers and Fabs 13H11 and MSL-109, and determined the structure to an overall resolution of ~3.3 Å (Figures 2A–2D, 7B, and 10A–10F and Table 1). Reminiscent of the dimeric population of NRP2 head-to-head pentamers, 2D classification revealed two pentameric molecules wrapped around one THBD receptor in a head-to-head manner that interact through the UL128 subunit (Figure 2B). In this dimeric complex structure, the N-terminal lectin-like domain of THBD is sandwiched between the two pentameric molecules, specifically between two concave surfaces formed by the UL components at the interaction site of UL128 with gL (Figure 2B). Additional low-resolution density was observed in the direction of the anchor point of the receptor on the host cell membrane, likely corresponding to the linker region connecting the THBD TME1 and the THBD lectin-like domain on the convex face of the pentamer formed by the UL130 and UL131A subunits (Figure S11A). Binding of THBD did not induce any significant structural rearrangements of the pentamer (Supplementary Figure S4D), as observed for the NRP2-pentamer complex (Figure S9C).

[0170] The THBD lectin-like domain is a globular domain composed of six β-strands (b1–b6) and two α-helices (a1 and a2) inserted between b2 and b3 (Figure 11B). The two opposing surfaces of THBD are recognized by the same region of the two engaged pentameric molecules, revealing a remarkable structural plasticity of this interface (Figure 2B). Specifically, the N-terminal region of UL128 (UL128-R42 or UL128-Y44) interacts with either THBD-R83 and THBD-E154 or THBD-a123 and THBD-L125, respectively (Figure 2B). Similarly, the hairpin of UL130 centered around residues UL130-Y169 interacts with THBD-S149 on one side and THBD-C133 on the other side (Figure 2B). Furthermore, the C-terminal region UL128 (UL128-R131, UL128-N134, UL128-Y137) of pentamer 1 interacts with THBD-V66 and THBD-D69, and a distinct region UL128 (UL128-R158, UL128-R163, UL128-Y168) on pentamer 2 contacts THBD-S49 and THBD-D53 (Figure 2B). Overall, the structure reveals a surprisingly large and multispecific interaction footprint between THBD and the pentameric dimer in overlapping regions on the UL128 and UL130 subunits (Figures 2C and 2D).

[0171] Example 4. THBD is a functional receptor for HCMV and competes with NRP2 for pentamer binding To determine whether THBD is a functional receptor for HCMV, we tested the ability of soluble protein and antibodies to inhibit virus entry in epithelial and endothelial cells. As expected, recombinant NRP2 and pan-NRP antibodies (Appleton et al., EMBO J., 26(23):4902-4912, 2007) dose-dependently inhibited HCMV infection in epithelial and endothelial cells (Figure 3A; Martinez-Martin et al., Cell, 174(5):1158-1171, 2018). Although recombinant THBD reduced virus infection to a much lower extent, the combination of recombinant THBD with NRP2 inhibited HCMV entry to a higher level than NRP2 alone, suggesting a potential functional role for THBD in HCMV infection (Figure 3A), consistent with published results (Martinez-Martin et al., Cell, 174(5):1158-1171, 2018). To further test this hypothesis, we investigated the ability of THBD to mediate HCMV entry in cells lacking NRP2 (Figures 3B and 12A). Although overexpression of THBD had minimal effect on HCMV infection of HAP-1 wild type (WT), its overexpression in NRP2 knockout (KO) cells dramatically increased virus entry (Figures 3B, 12A and 12B). As a control, the experiment was repeated in the presence of 0.1 μg / mL of 8I21 mAb. Addition of pentamer-specific mAb completely abolished infection, confirming pentamer-specific infection (Figure 3B). Furthermore, we observed that THBD-expressing cells were able to spread the virus (Figure 12C). Taken together, these data indicate that both NRP2 and THBD are relevant receptors for HCMV that can function as independent receptors or co-receptors.

[0172] These structural analyses suggest how the pentamer evolved to engage structurally distinct receptors localized on the surface of different cells. Notably, NRP2 and THBD bind to the pentamer through unique interaction surfaces, and superposition of the pentamer-NRP2 complex with the pentamer-THBD complex demonstrates that these receptors share overlapping binding sites on the pentamer (Figure 3C). Specifically, the common interaction site is localized at the interface where UL128 engages gL and is responsible for binding the NRP2 a1 domain and the THBD N-terminal lectin domain, indicating that these interaction partners cannot simultaneously bind to the pentamer (Figure 3C). To test the observations, competition experiments were performed by incubating HCMV pentamers bound to NRP2 with increasing amounts of THBD, and it was observed that THBD can compete for NRP2 binding at high concentrations (Figure 3D). Overall, these structural and biophysical data indicate that NRP2 and THBD do not function as co-receptors, but rather mediate HCMV tropism by acting as independent receptors.

[0173] Example 5. HCMV pentamer dimers engage NRP2 and THBD in a similar structure The unexpected dimeric structure of the pentamer bound to NRP2 is highly similar to the dimeric population observed upon THBD binding (Figure 3E). The a1 domain of NRP2 is wrapped between two pentameric molecules, similar to the N-terminal lectin domain of THBD, whereas the a2b1b2 domain of NRP2 engages with only one of the pentamers to form a strikingly asymmetric assembly (Figure 3E). Notably, these two receptor superassemblies also share a conserved dimerization interface mediated by a network of residues in the N-terminal region of the UL128 subunit, which is localized in the most distal region of the pentamer (Figures 3F and 3G), suggesting a potential physiological relevance of the dimeric assembly.

[0174] Example 6. Structural basis of pentamer neutralization by monoclonal antibodies Highly potent neutralizing antibodies against HCMV have been isolated from immortalized memory B cells of HCMV-immune donors and shown to target conformational epitopes in the pentamer (Macagno et al., J. Virol., 84(2):1005-1013, 2010; Ciferri et al., PLoS Pathog., 11(10), 2015). To provide a picture of these neutralizing interactions, we determined the structures of the pentamer bound to the highly potent neutralizing Fabs 2C12 and 7I13, as well as to the gH-binding Fab 13H11, to an overall resolution of ∼2.9 Å (Figures 13A-13H). Remarkably, 2C12 binds to the UL131A and UL128 subunits of the pentamer in the same region recognized by the NRP2 a2b1b2 domain (Figures 4A-4E and 4J). Specifically, Y55, Y116, G119, and N120 from the light chain of 2C12 bind to the N-terminal region of UL131A between residues T24-N28, and the heavy chain of 2C12 (N81, Q125, and V130) recognizes UL131A-K27 and UL128-R51, R108, and I109 (Figures 4B-4E). Fab 7I13 has a large footprint (~1,200 Å). 2) and binds to the same surface on the pentamer that recognizes the THBD and NRP2 a1 domains (Figures 4E-4I and 4K). Residues from both the light and heavy chains of 7I13 contact UL128 on residues Y44, P59, R131, N134 and L135, and bind UL130 at R168, Y169, M171 and N200 through a combination of hydrophobic, polar and charge interactions (Figures 4F-4I). Fab 8I21, shown in the structure of the pentamer-NRP2 complex (Figures 6A-6I), recognizes the pentamer in a region that does not overlap with the THBD or NRP2 binding sites (Figures 4A and 14A-14C). Superposition of the 2C12-7I13-pentamer structure with the NRP2-pentamer or THBD-pentamer structures shows that 2C12 blocks NRP2 binding but not THBD binding (Figures 4J and 14B), and comparison of these structures suggests that 7I13 can block the binding of both receptors, NRP2 and THBD (Figures 4K and 14C). Indeed, competitive interaction experiments on the pentamers show that NRP2 binding is blocked by 2C12 and 7I13 but not by 8I21 or a gH-specific neutralizing antibody (Figure 4L), whereas THBD binding is blocked by 7I13 but not by 2C12, 8I21 or a gH-specific neutralizing antibody (Figure 4M).

[0175] Example 7. Identification of beta2 microglobulin as a novel HCMV pentamer interactor Beta 2 microglobulin (B2M) was also discovered as a further interacting partner and its structure in complex with the HCMV pentamer was determined.

[0176] A previous genome-wide CRISPR / Cas9 screen identified an olfactory receptor (OR14L1) as a putative receptor for the HCMV pentamer, and a synthetic peptide containing the N-terminal 26 residues of OR14L1 was suggested as the minimal region required for interaction (E et al., Proc. Natl. Acad. Sci. USA, 116:7043-7052, 2019). Since ORL4L1 is a multi-transmembrane G protein-coupled receptor (GPCR) belonging to the olfactory receptor subfamily, we attempted to reconstitute the HCMV pentamer with the reported OR14L1 minimal peptide fused to GFP, and non-stoichiometric binding was observed (Figures 16A and 16B). Cryo-EM and multiple rounds of 3D classification were used to isolate particles bound to the OR14L1 peptide and determine their structures (Figures 16C-16G). Although no additional density describing the OR14L1 peptide-GFP fusion was observed (data not shown), a subset of particles (~10%) was identified that showed additional density (~3.5 Å resolution) corresponding to a beta-sandwich fold at the concave interface of the UL subunit (Figure S16E). SDS-PAGE and mass spectrometry showed that the sample contained an abundant additional co-purifying protein, beta 2 microglobulin (B2M), an 11.8 kDa cellular protein present in body fluids and tissue culture medium (Figure S16B). Although its presence in the cryo-EM map was unexpected, B2M has previously been shown to bind HCMV virions and increase HCMV ability to infect cells (Grundy et al., J. Gen. Virol., 68(3):793-803, 1987). Rigid-body refinement was used to place the beta-sandwich fold determined from the previous crystal structure of B2M firmly into this density (Figures 15A and 15B, Smith et al., Immunity, 4:215-228, 1996). The structure reveals that B2M contacts the same regions on UL128 and UL130 that are recognized by THBD, further demonstrating the structural plasticity of this region on the pentamer (Figures 15C and 15D).

[0177] Although B2M normally binds noncovalently to the α3 domain of major histocompatibility complex (MHC) class I to contribute to cell-mediated immune responses against viral infection and malignant transformation (Li et al., Chin. Med. J. (Engl.), 129:448-455, 2016), our structural analysis indicates that the association between B2M and the pentamer is incompatible with simultaneous binding to MHC class I (Figure S15E).

[0178] The foregoing invention has been described in some detail by way of illustration and example for clarity of understanding, but the descriptions and examples should not be construed as limiting the scope of the invention. The disclosures of all patent and scientific literature cited herein are hereby incorporated by reference in their entireties.

Claims

**Claim 1** A method for identifying a modulator of the interaction between human cytomegalovirus (HCMV) gH / gL / UL128-131A pentamer and beta-2 microglobulin (B2M), comprising: (a) providing a candidate modulator; (b) contacting HCMV gH / gL / UL128-131A pentamer with B2M in the presence or absence of the candidate modulator under conditions that permit binding of the HCMV gH / gL / UL128-131A pentamer to B2M; and (c) measuring the binding of the HCMV gH / gL / UL128-131A pentamer to B2M, wherein an increase or decrease in the binding in the presence of the candidate modulator compared to the binding in the absence of the candidate modulator identifies the candidate modulator as a modulator of the interaction between the HCMV gH / gL / UL128-131A pentamer and B2M, measuring the binding of the HCMV gH / gL / UL128-131A pentamer to B2M A method comprising the steps of: **Claim 2** A method for identifying a modulator of the downstream activity of the HCMV gH / gL / UL128-131A pentamer, comprising: (a) providing a candidate modulator; (b) contacting HCMV gH / gL / UL128-131A pentamer with B2M in the presence or absence of the candidate modulator under conditions that permit binding of the HCMV gH / gL / UL128-131A pentamer to B2M; and (c) measuring the downstream activity of the HCMV gH / gL / UL128-131A pentamer, wherein a change in the downstream activity in the presence of the candidate modulator compared to the downstream activity in the absence of the candidate modulator identifies the candidate modulator as a modulator of the downstream activity of the HCMV gH / gL / UL128-131A pentamer, measuring the downstream activity of the HCMV gH / gL / UL128-131A pentamer A method comprising the steps of: **Claim 3** A method for identifying a modulator of the downstream activity of B2M, comprising: (a) providing a candidate modulator; (b) contacting B2M with HCMV gH / gL / UL128-131A pentamer in the presence or absence of the candidate modulator under conditions that permit binding of B2M to the HCMV gH / gL / UL128-131A pentamer; and Measuring the downstream activity of B2M, wherein a change in the downstream activity in the presence of a candidate modulator as compared to the downstream activity in the absence of the candidate modulator identifies the candidate modulator as a modulator of the downstream activity of B2M, measuring the downstream activity of B2M A method comprising. **Claim 4** The method according to claim 1, wherein when the increase or decrease in binding is measured by surface plasmon resonance, biolayer interferometry, or enzyme-linked immunosorbent assay (ELISA), it is at least 50%. **Claim 5** The method according to any one of claims 1 to 4, wherein the modulator is an HCMV gH / gL / UL128-131A pentamer or an inhibitor of the downstream activity of B2M. **Claim 6** The method according to claim 2 or 3, wherein the change in downstream activity is a decrease in the amount, intensity, or duration of the downstream activity. **Claim 7** The method according to any one of claims 1 to 3, wherein the modulator is a small molecule, an antibody or an antigen-binding fragment thereof, a peptide, a mimetic, or an inhibitory nucleic acid. **Claim 8** The method according to claim 7, wherein the inhibitory nucleic acid is an ASO or siRNA. **Claim 9** The method according to claim 7, wherein the antigen-binding fragment is a bis-Fab, Fv, Fab, Fab'-SH, F(ab')2, diabody, linear antibody, scFv, scFab, VH domain, or VHH domain. **Claim 10** The method according to claim 7, wherein the antibody or an antigen-binding fragment thereof binds to the HCMV gH / gL / UL128-131A pentamer. **Claim 11** The method according to claim 7, wherein the antibody or an antigen-binding fragment thereof binds to B2M. **Claim 12** The method according to any one of claims 2 or 3, wherein the downstream activity is cell infection by HCMV. **Claim 13** The method according to claim 12, wherein the infection decreases in the presence of the modulator. **Claim 14** The method according to claim 13, wherein when measured by a virus infection assay or a virus entry assay using pseudotyped particles, the infection decreases by at least 40%. **Claim 15** The method according to any one of claims 1 to 3, wherein the modulator is an antibody or an antigen-binding fragment thereof that binds to the HCMV gH / gL / UL128-131A pentamer. **Claim 16** The method according to any one of claims 1 to 3, wherein the modulator is an antibody or an antigen-binding fragment thereof that binds to B2M. **Claim 17** A modulator of the interaction between human cytomegalovirus (HCMV) gH / gL / UL128-131A pentamer and neuropilin 2 (NRP2), which causes a decrease in the binding of the gH / gL / UL128-131A pentamer to NRP2, (a) one or more of the residues D197, D252, N172, M253, Y458, and L459 of NRP2; (b) one or both of the residues K47 and R57 of the UL128 subunit of the gH / gL / UL128-131A pentamer; (c) the residue R193 of the UL130 subunit of the gH / gL / UL128-131A pentamer; and / or (d) one or both of the residues A114 and A117 of the UL131A subunit of the gH / gL / UL128-131A pentamer that binds to the modulator.

18. (a) all six of the residues D197, D252, N172, M253, Y458, and L459 of NRP2; (b) both of the residues K47 and R57 of the UL128 subunit of the gH / gL / UL128-131A pentamer; (c) the residue R193 of the UL130 subunit of the gH / gL / UL128-131A pentamer; and / or (d) both of the residues A114 and A117 of the UL131A subunit of the gH / gL / UL128-131A pentamer The modulator according to claim 17, which binds to the above.

19. The modulator according to claim 17, which reduces the binding of the gH / gL / UL128-131A pentamer to NRP2 by at least 50%.

20. The modulator according to claim 19, which reduces the binding of the gH / gL / UL128-131A pentamer to NRP2 by at least 90%.

21. A modulator of the interaction between HCMV gH / gL / UL128-131A pentamer and thrombomodulin (THBD), which causes a decrease in the binding of the gH / gL / UL128-131A pentamer to THBD, (a) one or more of the residues S49, D53, V66, D69, R83, C96, E154, A123, L125, S149, and C133 of THBD; (b) one or more of the residues R42, Y44, R131, N134, Y137, R158, R163, and Y168 of the UL128 subunit of the gH / gL / UL128-131A pentamer; and / or (c) A modulator that binds to one or more of residues N164, Y169, and M171 of the UL130 subunit of the gH / gL / UL128-131A pentamer. That binds to **Claim 22** (a) All 11 of residues S49, D53, V66, D69, R83, C96, E154, A123, L125, S149, and C133 of THBD; (b) All 8 of residues R42, Y44, R131, N134, Y137, R158, R163, and Y168 of the UL128 subunit of the gH / gL / UL128-131A pentamer; and / or (c) All 3 of residues N164, Y169, and M171 of the UL130 subunit of the gH / gL / UL128-131A pentamer The modulator according to claim 21, which binds to **Claim 23** The modulator according to claim 21, which reduces the binding of the gH / gL / UL128-131A pentamer to THBD by at least 50%. **Claim 24** The modulator according to claim 23, which reduces the binding of the gH / gL / UL128-131A pentamer to THBD by at least 90%. **Claim 25** A modulator of the interaction between the human cytomegalovirus (HCMV) gH / gL / UL128-131A pentamer and beta-2 microglobulin (B2M) that causes a decrease in the binding of the gH / gL / UL128-131A pentamer to B2M. **Claim 26** The modulator according to claim 25, which reduces the binding of the gH / gL / UL128-131A pentamer to B2M by at least 50%. **Claim 27** The modulator according to claim 26, which reduces the binding of the gH / gL / UL128-131A pentamer to THBD by at least 90%. **Claim 28** The modulator according to any one of claims 19, 20, 23, 24, 26, and 27, wherein the decrease in binding is measured by surface plasmon resonance, biolayer interferometry, or enzyme-linked immunosorbent assay (ELISA). **Claim 29** The modulator according to any one of claims 17, 21, and 25, which causes a decrease in the infection of cells by HCMV compared to infection in the absence of the modulator. **Claim 30** The modulator according to claim 29, wherein the infection is reduced by at least 40% when measured in a virus infection assay or a virus entry assay using pseudotyped particles. **Claim 31** The modulator according to any one of claims 17, 21, and 25, which is a small molecule, an antibody or an antigen-binding fragment thereof, a peptide, a mimetic, or a suppressive nucleic acid.

32. The modulator according to claim 31, wherein the suppressive nucleic acid is an antisense oligonucleotide (ASO) or siRNA.

33. The antigen-binding fragment is bis-Fab, Fv, Fab, Fab'-SH, F(ab'), ２ , diabody, linear antibody, scFv, scFab, VH domain, or VHH domain, the modulator according to claim 31.

34. The modulator according to claim 31, wherein the antibody is a bispecific antibody or a multispecific antibody.

35. The modulator according to any one of claims 17, 21, and 25, further comprising a pharmaceutically acceptable carrier.

36. A method for treating HCMV infection in an individual, comprising administering to the individual an effective amount of the modulator according to any one of claims 17, 21, and 25, thereby treating the individual.

37. The method according to claim 36, wherein the duration or severity of HCMV infection is reduced by at least 40% as compared to an individual not administered the modulator.

38. A method for preventing HCMV infection in an individual, comprising administering to the individual an effective amount of the modulator according to any one of claims 17, 21, and 25, thereby preventing HCMV infection in the individual.

39. A method for preventing secondary HCMV infection in an individual, comprising administering to the individual an effective amount of the modulator according to any one of claims 17, 21, and 25, thereby preventing secondary HCMV infection in the individual.

40. The method according to claim 39, wherein the secondary infection is HCMV infection of non-infected tissue.

41. The method according to claim 36, wherein the individual is in an immunocompromised state, pregnant, or an infant.

42. Use of the modulator according to any one of claims 17, 21, and 25 in the manufacture of a medicament for treating HCMV infection in an individual.

43. Use of the modulator according to any one of claims 17, 21, and 25 in the manufacture of a medicament for preventing HCMV infection in an individual.

44. Use of the modulator according to any one of claims 17, 21, and 25 in the manufacture of a medicament for preventing secondary HCMV infection in an individual.

45. The use according to claim 44, wherein the secondary infection is HCMV infection of non-infected tissue.

46. The use according to claim 42, wherein the individual is in an immunocompromised state, pregnant, or is an infant.

47. A modulator according to any one of claims 17, 21 and 25 for use in a method of treating HCMV infection in an individual, the method comprising administering to the individual an effective amount of the modulator according to any one of claims 17, 21 and 25, thereby treating the individual.

48. A modulator according to any one of claims 17, 21 and 25 for use in a method of preventing HCMV infection in an individual, the method comprising administering to the individual an effective amount of the modulator according to any one of claims 17, 21 and 25, thereby preventing HCMV infection in the individual.

49. A modulator according to any one of claims 17, 21 and 25 for use in a method of preventing secondary HCMV infection in an individual, the method comprising administering to the individual an effective amount of the modulator according to any one of claims 17, 21 and 25, thereby preventing secondary HCMV infection in the individual.

50. A modulator for use according to claim 49, wherein the secondary infection is HCMV infection of non-infected tissue.

51. A modulator for use according to claim 47, wherein the individual is in an immunocompromised state, pregnant, or is an infant.

52. The method according to claim 38, wherein the individual is in an immunocompromised state, pregnant, or is an infant.

53. The method according to claim 39, wherein the individual is in an immunocompromised state, pregnant, or is an infant.

54. The use according to claim 43, wherein the individual is in an immunocompromised state, pregnant, or is an infant.

55. The use according to claim 44, wherein the individual is in an immunocompromised state, pregnant, or is an infant.

56. A modulator for use according to claim 48, wherein the individual is in an immunocompromised state, pregnant, or is an infant.

57. A modulator for use according to claim 49, wherein the individual is in an immunocompromised state, pregnant, or is an infant.

Images