Novel pluripotent cells

JP2024522365A5Pending Publication Date: 2025-06-09KOREA RES INST OF BIOSCIENCE & BIOTECHNOLOGY +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2023575400
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-06-02
Filing Date
2022-06-02
Publication Date
2025-06-09

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
  • Figure 00000000_0001_ABST
    Figure 00000000_0001_ABST
Patent Text Reader

Abstract

The present invention relates to a method for converting non-pluripotent cells into pluripotent cells, cells produced by the method, and uses thereof. The pluripotent cells of the present invention have excellent cell differentiation ability and pluripotency capable of differentiating into three germ layers, while being low in tumorigenicity, and pluripotent cells at intermediate stages of reprogramming can be specifically isolated, and therefore it is possible to produce pluripotent cells with characteristics different from those of conventional induced pluripotent stem cells.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present invention relates to a method for converting non-pluripotent cells into pluripotent cells, cells converted by said method and uses thereof. [Background technology]

[0002] Pluripotent stem cells can infinitely renew themselves and differentiate into all mature cells. On the other hand, pluripotent stem cells are generally divided into embryonic stem cells, nuclear transfer embryonic stem cells and induced pluripotent stem cells (iPSCs). Embryonic stem cells are essentially derived from embryos, so they have limitations due to immune rejection and ethical limitations, while nuclear transfer embryonic stem cells, which are stem cells produced by transplanting the nucleus of somatic cells into egg cells, have the advantages of being free of immune rejection and capable of mass production, but have ethical limitations due to the use of egg cells and the disadvantage of carcinogenicity.

[0003] On the one hand, iPSCs are stem cells produced by inducing already differentiated somatic cells to a pre-differentiation cell stage through specific genetic manipulation. The advantage of iPSCs is that they can produce stem cells with individual / disease-specific pluripotency. However, they are limited by the fact that the efficiency of producing iPSCs from differentiated somatic cells is only 1% or less, and the efficiency of iPSCs to differentiate into desired specific cells is also low, and they are carcinogenic.

[0004] Therefore, there is a need to develop novel pluripotent cells and methods for producing novel pluripotent cells that have the pluripotency to differentiate into desired cells, and that have superior cell differentiation potential, with significantly reduced or smaller tumorigenicity compared to that exhibited by iPSCs. Summary of the Invention [Problem to be solved by the invention]

[0005] The present inventors have completed the present invention by producing pluripotent cells that hardly express iPSC characteristic marker genes (Nanog, Rex1, and Esrrb), have lower tumorigenicity than iPSCs, and have the cell differentiation ability and pluripotency to differentiate into three germ layers, by treating already differentiated non-pluripotent cells with reprogramming factors or by causing non-pluripotent cells to express reprogramming factors, thereby changing the cell fate. [Means for solving the problem]

[0006] In one embodiment of the invention, the invention provides a method of converting a non-pluripotent cell into a pluripotent cell, comprising inducing the non-pluripotent cell to express a reprogramming factor, thereby overexpressing a desmosome-associated gene or an epithelial cell differentiation-associated gene.

[0007] In another embodiment of the invention, the invention provides a pluripotent cell produced by the method of converting a non-pluripotent cell into a pluripotent cell.

[0008] In one embodiment of the present invention, the present invention provides a cell in which the expression level of a desmosome-associated gene or an epithelial cell differentiation-associated gene is higher than the expression level of the corresponding gene in an induced pluripotent stem cell (iPSC), or the expression level of the Spink2 gene is higher than the expression level of the gene in an iPSC, and the expression level of at least one gene selected from the group consisting of Nanog, Rex1 and Esrrb is reduced compared to the expression level of the corresponding gene in an iPSC.

[0009] In another embodiment of the present invention, the present invention provides a method for producing cells, comprising inducing differentiation of cells in which expression of desmosome-associated genes or epithelial cell differentiation-associated genes is higher than the expression level of the corresponding genes in induced pluripotent stem cells (iPSCs) or the expression level of Spink2 gene is higher than the expression level of said genes in iPSCs and the expression level of at least one gene selected from the group consisting of Nanog, Rex1 and Esrrb is decreased compared to the expression level of the corresponding genes in iPSCs.

[0010] In one embodiment of the present invention, the present invention provides a composition for cell transplantation or biological tissue regeneration, comprising as an active ingredient a pluripotent cell; a cell in which the expression level of a desmosome-associated gene or an epithelial cell differentiation-associated gene is higher than the expression level of the corresponding gene in an induced pluripotent stem cell (iPSC), or the expression level of the Spink2 gene is higher than the expression level of the gene in an iPSC, and the expression level of at least one gene selected from the group consisting of Nanog, Rex1 and Esrrb is reduced compared to the expression level of the corresponding gene in an iPSC; or a differentiation-induced cell.

[0011] In one embodiment of the present invention, the present invention provides a method for evaluating the efficacy or toxicity of a test substance, comprising contacting the test substance with a pluripotent cell; a cell in which expression of a desmosome-associated gene or an epithelial cell differentiation-associated gene is higher than the expression level of the corresponding gene in an induced pluripotent stem cell (iPSC), or the expression level of the Spink2 gene is higher than the expression level of the gene in an iPSC, and the expression level of at least one gene selected from the group consisting of Nanog, Rex1 and Esrrb is decreased compared to the expression level of the corresponding gene in an iPSC; or a differentiation-induced cell.

[0012] In another embodiment of the present invention, the present invention provides a method for regenerating a biological tissue by administering to an individual pluripotent cells; cells in which the expression of a desmosome-associated gene or an epithelial cell differentiation-associated gene is higher than the expression level of the corresponding gene in induced pluripotent stem cells (iPSCs), or the expression level of the Spink2 gene is higher than the expression level of the gene in iPSCs and the expression level of at least one gene selected from the group consisting of Nanog, Rex1 and Esrrb is reduced compared to the expression level of the corresponding gene in iPSCs; or differentiation-induced cells. Effect of the Invention

[0013] Pluripotent cells formed by the method of the present invention for converting non-pluripotent cells into pluripotent cells have excellent cell differentiation ability and pluripotency capable of differentiating into three germ layers, while having low tumorigenicity. By specifically isolating pluripotent cells at an intermediate stage of reprogramming, it is possible to achieve a shorter production period compared to conventional methods for producing induced pluripotent stem cells. [Brief description of the drawings]

[0014] [Figure 1] FIG. 1 is a schematic diagram of the process of reprogramming 2° MEFs to induced pluripotent stem cells (iPSCs) (iPSCR), the process of reprogramming 4F2A MEFs to neural stem cells (iNSCs) (PDR), and the process of reprogramming 4F2A MEFs to dopaminergic neural progenitor cells (iDPs) (PDR).

[0015] [Diagram 2] FIG. 2 is a schematic diagram illustrating the sorting of cells from which total RNA was collected on each day during the iPSCR and PDR process.

[0016] [Diagram 3]Figure 3 shows Nanog and SSEA-1 immunostained photographs of iPSCs obtained by iPSCR, where iPSCs were supplied with LIF until day 12 of iPSCR and iPSCs were supplied with LIF from day 5 to day 12 of iPSCR, Pax6 and PLZF immunostained photographs of iNSCs obtained by PDR, and FoxA2 immunostained photographs of iDPs obtained by PDR (scale bar: 200 μm).

[0017] [Figure 4] FIG. 4 shows alkaline phosphatase (AP) staining photographs of iPSCs obtained by iPSCR, where iPSCs were supplied with LIF until day 12 of iPSCR and iPSCs were supplied with LIF from day 5 to day 12 of iPSCR.

[0018] [Diagram 5] FIG. 5 shows phase contrast photographs of iPSCs obtained by iPSCR, iNSCs obtained by PDR, and iDPs obtained by PDR, where iPSCs were supplied with LIF until day 12 of iPSCR and iPSCs were supplied with LIF from day 5 to day 12 of iPSCR (scale bar: 200 μm).

[0019] [Figure 6] Figure 6 shows the results of principal component analysis (PCA) of microarray data of iPSCs obtained by iPSCR, iNSCs obtained by PDR, and iDPs obtained by PDR. Individual numbers indicate the day when RNA was obtained after reprogramming, F refers to fibroblasts, C refers to mesenchymal stem cells formed under conditions without LIF, P refers to iPSCR conditions in which LIF was supplied on day 12 of culture, P' refers to iPSCR conditions in which LIF was supplied on days 5 to 12 of culture, N refers to PDR conditions of reprogramming using iNSCs, and D refers to PDR conditions of reprogramming using iDPs.

[0020] [Figure 7]Figure 7 shows a Pearson correlation matrix indicating the microarray data hierarchical clustering of iPSCs obtained by iPSCR, iNSCs obtained by PDR, and iDPs obtained by PDR.

[0021] [Figure 8] Figure 8 shows a heatmap indicating the gene expression of cells on day 6 of the iPSCR and PDR processes (P6, P’6, N6, and D6) and cells on day 12 of the iPSCR and PDR processes (P12, P’12, N12, and D12).

[0022] [Figure 9] Figure 9 shows the expression patterns of genes that change during the iPSCR process.

[0023] [Figure 10] The upper part of Figure 10 shows the individual expression patterns of iPSCs obtained by iPSCR, iNSCs obtained by PDR, and iDPs obtained by PDR, where the iPSCs are those supplied with LIF until day 12 of iPSCR and those supplied with LIF from day 5 to day 12 of iPSCR. Here, the number of genes from each group is shown on the left, the numerical values are normalized based on the average expression values of each gene, shown as a line graph, and the thick line indicates the average value of gene expression (upper part of Figure 10). Furthermore, the lower part of Figure 10 shows the selection process of DEGs as a flowchart.

[0024] [Figure 11] Figure 11 shows the GO terms of 244 common genes visualized by ClueGO using network-based analysis. The main GO terms are shown as nodes (p-value < 0.08), and the lines connecting the nodes are created based on a predetermined cut-off pathway core (>0.4). The size of each node represents the p-value, shown in the order of p-value < 0.001; 0.001 < p-value < 0.05; and 0.05 < p-value < 0.01.

[0025] [Figure 12]Figure 12A shows a Venn diagram of group IV genes in 2° and 4F2A MEFs, Figure 12B shows a heat map depicting the expression of 244 genes in 2° MEFs during iPSCR, and Figure 12C shows a heat map depicting the expression of 244 genes in 4F2A MEFs during PDR.

[0026] [Figure 13] The top of Figure 13 shows the top 5 groups resulting from ClueGO analysis, the left panel shows representative GO terms and ranks for each group, and the right panel shows the percentage of genes associated with specific GO terms and term p-values. The bottom of Figure 13 shows the top 15 GO terms by GSEA, where GSEA was performed using the transcriptomes of intermediate cells (IC) obtained on day 6 of 2°MEF and 4F2A MEF reprogramming, the transcriptomes of 2°MEF and 4F2A MEF, and the transcriptomes of P12, P'12, N12, and D12, which were end-point cells on day 12 of 2°MEF and 4F2A MEF reprogramming. The bars show the normalized enrichment score (NES), which is the normalized high score and number of genes contained in each GO term.

[0027] [Figure 14] FIG. 14 is a graph showing the NES results of desmosomes and epithelial cell differentiation by gene set enrichment analysis.

[0028] [Figure 15] FIG. 15 shows transmission electron micrographs of day 6 cells of 2° MEF, iPSCR and iNSCR, iPSC and iNSC, where white arrows indicate mature desmosomes (scale bar: 0.5 μm).

[0029] [Figure 16]The upper part of Figure 16 shows transmission electron micrographs of the intercellular junction region of iPSCR and iNSCR cells on day 6, where the white arrow indicates mature desmosomes and the black arrow indicates immature desmosomes (scale bar: 0.5 μm). The lower part of Figure 16 is a table showing the number of mature desmosomes and immature desmosomes in each sample.

[0030] [Figure 17] FIG. 17 is a graph showing the expression of epithelial and mesothelial markers as a heat map.

[0031] [Figure 18] Figure 18A is a graph showing the results of microarray analysis of desmosome-associated genes during 2° MEF reprogramming as a heat map, Figure 18B is a graph showing the results of quantitative RT-PCR of desmosome-associated genes during 2° MEF reprogramming as a heat map, each value is log-normalized, and Figure 18C is a photograph of Western blot analysis of desmosome-associated genes during 2° MEF reprogramming, where Rpl7 and β-actin were used as loading controls.

[0032] [Figure 19] Figure 19A is a graph showing the expression of desmosome-associated genes during 2° B cell reprogramming analyzed using published microarray data (GSE52397) as a heat map. Figure 19B is a graph showing the pattern of epithelial identity and expression of desmosome-associated and pluripotency-associated genes changing during human bronchial epithelial cell (NHBE) and prostate epithelial cell (PrEC) reprogramming.

[0033] [Figure 20]Figure 20A shows the Western blot results of Dsp and Rpl7 expression during iPSCR and PDR of 2° MEFs classified as shDsp-GFP positive. The expression of shDsp is induced by IPTG treatment. The bar graph shows the quantitative expression of Dsp, and each sample was obtained on day 6 of iPSCR and iNSCR. Rpl7 was used as the loading control group (p value < 0.0001), DW stands for distilled water, and IPTG stands for isopropyl β-D-1-thiogalactopyranoside. Figure 20B shows the AP staining image of the whole well and the AP positive colony quantitative analysis result (p value = 0.0112) on day 12 of reprogramming, and Figure 20C shows the Nanog positive colony quantitative analysis result (p value = 0.0056) of each distilled water or IPTG treatment group on day 12 of reprogramming. Figure 20D shows the Pax6 positive colony quantitative analysis results (p value = 0.0202) of each distilled water or IPTG treatment group on the 12th day of reprogramming. Figure 20E shows the phase contrast image of the cell aggregates on the 6th day of iPSCR and the quantitative analysis results of the cell aggregates (shDsp (-), p value = 0.80; shDsp (+), p value = 0.0047), and Figure 20F shows the phase contrast image of the cell aggregates on the 6th day of iNSCR and the quantitative analysis results of the cell aggregates (shDsp (-), p value = 0.34; shDsp (+), p value = 0.0015). Furthermore, error bars in Figure 20A mean ± SEM (A), and error bars in Figures 20B-20F mean ± SD; statistical analysis was performed using two-tailed Student's t-test, with p-values ​​<0.05 considered significant, * indicates p-value <0.05, and ** indicates p-value <0.01.

[0034] [Figure 21] FIG. 21 shows western blot images and quantitative analysis graphs of phospho-Akt and total Akt for iPSCR and iNSCR on day 6 depending on the presence or absence of Dsp knockdown (iPSCR, p-value=0.0002; iNSCR, p-value=0.0055).

[0035] [Figure 22]Figure 22 shows the results of reverse transcription qPCR (RT-qPCR) analysis of DSP expression by overexpression of DSP in human fibroblasts (DSP-OE), the results are normalized to the expression of RPL7, and EV indicates empty vector (p value < 0.0001). Figure 22B shows the results of quantitative analysis of the number of AP-positive colonies on day 16 of iPSCR of DSP-overexpressing fibroblasts (p value = 0.0102). Figure 22C shows the results of quantitative analysis of the number of PAX6-positive colonies on day 16 of iNSCR of DSP-overexpressing fibroblasts (p value = 0.0053). Figure 22D is a representative AP staining image of AP-positive colonies on day 16 of iPSCR of DSP-overexpressing fibroblasts, and Figure 22E is an enlarged image of the boxed area in Figure 22D. Scale bars are 100 μm, error bars in Figure 22A are ±SEM(A), error bars in Figure 22B are ±SE, and error bars in Figures 22C and 22D are ±SD. Statistical analysis was performed using two-tailed Student's t-test, with p-values ​​<0.05 considered significant, * indicates p-value <0.05, ** indicates p-value <0.01, and *** indicates p-value <0.001.

[0036] [Diagram 23]Figure 23A shows phase contrast images of fin membranes after zebrafish fin amputation, where fin membrane amputation was performed at 2 pf and photographed 24 hours later. In the graph, light grey indicates the percentage of fin membrane growth 1 day post amputation (dpa) vs. 0 dpa, and dark grey indicates fin membrane inhibition 1 dpa vs. 0 dpa. Scale bar is 100 μm (n=60, 56 embryos, p-value<0.0001). MO means morpholino, hpa means hours post amputation. Figure 23B shows phase contrast images of whole-mount in situ hybridization analysis of fin membranes and blastema marker gene (junbb) expression in regenerating fins by comparison of control MO or dsp-mixed MO. Uncut fins were used as control groups, dotted lines indicate the boundaries of the fin membrane, scale bar is 100 μm, hpf means hours post-fertilization (n=40, 48 embryos, p-value<0.0001). Figure 23C shows phase contrast and fluorescence composite images of mature fins after control MO, pou5f3 MO (positive control) and dsp mixed MO injection and electroporation. Injections of substances were made into the dorsal half of the 2dpa blastema and photographed 24 hours later, and the graphs show the dorsal vs. ventral fin proliferation (light grey) and the average inhibition of dorsal vs. ventral fins (dark grey). The lines in the left image of Figure 23C indicate the fins at 2dpa, scale bar is 500 μm (n=7 zebrafish, p-value<0.0001). Furthermore, error bars are ±SD, two-tailed paired Student's t-test was used for statistical analysis, and a P value < 0.05 was considered significant (***p value < 0.001).

[0037] [Figure 24] FIG. 24 shows the decreased expression of gene markers associated with blastema cells by inhibition of Dsp gene expression as confirmed by RT-PCR, with Rpl13a used as an internal control.

[0038] [Diagram 25]Figures 25A and 25B show immunostaining and phase contrast images of Dsp and Dsc3 of cells at day 6 of iPSCR and iNSCR under normal conditions, respectively. Black asterisks indicate Dsp and Dsc3 positive cells in colonies, and white asterisks indicate Dsp and Dsc3 negative cells (scale bar: 50 μm). Figure 25C is a schematic diagram of sampling for scRNA-seq. Figure 25D shows single cell library counts at each reprogramming day. Figure 25E shows branch reprogramming trajectories by Slingshot as UMAP plots of cells during iPSCR or iNSCR, with shading showing differently at each cell collection time point, and dotted lines showing failed reprogramming pathways.

[0039] [Figure 26] FIG. 26 shows photographs taken via a microscope of intermediate cell induction via transient expression of reprogramming factors, the induced pluripotent stem cells (iPSCs) and neural stem cells (iNSCs) formed therefrom.

[0040] [Figure 27] Figure 27A shows scRNA-seq data of iPSCR and iNSCR day 5-7 cells as UMAP plot. Figure 27B shows the signature score distribution of shisa8 and Dsp genes, and Figure 27C shows the signature score distribution of identity gene sets defining dICs and gICs in UMAP (scale bar indicates minimum to maximum signature score shown throughout the reprogramming process). Figure 27D shows phase contrast and immunostaining images of reattachment of gICs from day 6 of iPSCR or iNSCR, immunostaining was performed with Nanog 6 days after reattachment (D+6) (scale bar: 100 μm). Figure 27E shows reverse transcription qPCR results of Nanog, Dsp, Shisa8 and Cdk1 genes, where 2° MEFs were used as negative control and iPSCs were used as positive control, and the samples of day 6 and gICs were isolated on day 6 in total cells. FIG. 27F shows reprogramming pathways predicted to be dependent on the presence or absence of Shisa8 expression.

[0041] [Figure 28] Figure 28A shows UMAP plots of cells in the iPSC or iNSC process for each gene set signature score. Figure 28B shows UMAP plots of cells at day 5 and day 7, with shading varying at each harvest time point. Figure 28C shows the results of RT-qPCR analysis of pluripotency markers, where 2° MEFs were used as negative controls, iPSCs were used as positive controls, and day 6 samples and gICs were isolated at day 6 in day 6 total cells. Error bars are ± SE. Figure 28D shows the total number of cells with different shading by harvest time point for each cluster as a bar plot. Figure 28E shows UMAP plots of cells highlighting the progeny of cluster 1 and cluster 8 during the iPSCR process, and Figure 28F shows UMAP plots of cells highlighting the progeny of cluster 1 and cluster 8 during the iNSCR process, with color and intensity indicating the progeny probability estimated by WOT and harvest time point.

[0042] [Figure 29] FIG. 29 shows a graph obtained by comparing the expression of gene markers of intermediate cells (IC) and induced pluripotent stem cells (iPSC).

[0043] [Diagram 30]Figure 30A shows the Western blot images and quantitative analysis results of phospho-Akt and total Akt of iPSCR and iNSCR on day 6 depending on the presence or absence of MK2206 (Akt inhibitor). Rpl7 was used as a loading control, and the p value of iPSCR was 0.00008 and the p value of iNSCR was 0.00095. Figure 30B shows the quantitative analysis results of IC aggregates of iPSCR on day 6 depending on the presence or absence of MK2206 (p value = 0.0009), and Figure 30C shows the quantitative analysis results of IC aggregates of iNSCR on day 6 depending on the presence or absence of MK2206 (p value = 0.0019). Figure 30D shows the overall well images and quantitative analysis results of AP-positive colonies in iPSC colonies on day 12 depending on the presence or absence of MK2206 (p value = 0.0020), and Figure 30E shows the overall well images and quantitative analysis results of Pax6-positive colonies in iNSCR colonies on day 12 depending on the presence or absence of MK2206 (p value = 0.0020). Figure 30F shows the overall well images and quantitative analysis results of AP-positive colonies in iPSCs depending on the presence or absence of MK2206, and Figure 30G shows the RT-qPCR analysis results of Rex1, a pluripotency-related marker, in iPSCs depending on the presence or absence of MK2206 (p value = 0.13). Figure 30H shows the fluorescent images and quantitative analysis results of Pax6-positive cells in iNSCs depending on the presence or absence of MK2206 (scale bar: 100 μm, p value = 0.15). Figure 30I shows RT-qPCR analysis of Pax6, a neural stem cell marker, in iNSCs depending on the presence or absence of MK2206. Error bars in Figure 30A are ±SEM, error bars in Figures 30B-30F and 30H are ±SD, and error bars in Figures 30G and 30I are ±SE. All statistical analyses were performed using two-tailed Student's t-tests.

[0044] [Diagram 31] FIG. 31 shows a graph obtained by comparing the expression of gene markers of intermediate cells (IC) and induced pluripotent stem cells (iPSC).

[0045] [Diagram 32] FIG. 32 shows photographs confirming that cells naturally differentiated from intermediate cells (IC) into various cells that constitute the three germ layers.

[0046] [Diagram 33] FIG. 33 shows photographs confirming the transformation of intermediate cells into induced pluripotent stem cells (iPSCs) and neural stem cells (iNSCs).

[0047] [Diagram 34] FIG. 34 shows the extent of tumor formation in mice administered intermediate cells and induced pluripotent stem cells (iPSCs). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0048] According to an aspect of the invention, the invention relates to a method for converting a non-pluripotent cell into a pluripotent cell, comprising inducing the non-pluripotent cell to express a reprogramming factor, thereby overexpressing a desmosome-associated gene or an epithelial cell differentiation-associated gene.

[0049] "Pluripotency" refers to the ability of a cell to form the entire lineage of the body or somatic cells (i.e., embryonic compatibility). Pluripotency can be determined by evaluating the pluripotency characteristics of some cells. In the present invention, pluripotency characteristics include, but are not limited to, the ability to differentiate into ectoderm, mesoderm, and endoderm.

[0050] Non-pluripotent cells are cells that do not have pluripotency, and are already differentiated and do not have the ability to differentiate into ectoderm, mesoderm and endoderm.In some embodiments of the present invention, non-pluripotent cells can be cells derived from animals, more preferably mammalian cells (e.g., but not limited to, human, mouse, rat, cat, hamster, guinea pig, pig, dog, horse, cow, etc.), particularly human cells.Furthermore, non-pluripotent cells can be cells collected from individuals who need to administer customized cell therapy products.

[0051] In certain embodiments of the present invention, the method of converting a non-pluripotent cell into a pluripotent cell may be performed in vivo or in vitro.

[0052] In another embodiment of the present invention, the non-pluripotent cell can be, but is not limited to, cells derived from various tissues such as mammalian bone marrow, skin, skeletal muscle, thymus, liver, spleen, heart, brain, eyeball, digestive tract, cartilage, kidney, testis, ovary, adipose tissue, peripheral blood and epithelial tissue.For example, the non-pluripotent cell can be, but is not limited to, fibroblast, organ epithelial cell, prostate epithelial cell, endothelial cell, hepatocyte, B cell, T cell, blood cell, monocyte, chondrocyte, muscle cell, nerve cell, etc.

[0053] Inducing a non-pluripotent cell to express a reprogramming factor can be accomplished by introducing a gene encoding the reprogramming factor into the non-pluripotent cell or by treating the non-pluripotent cell with the reprogramming factor in an exogenous manner, thereby allowing the non-pluripotent cell to express the reprogramming gene.

[0054] The term "reprogramming" refers to a method for the conversion of one type of cell into another type of cell. Through reprogramming, the original cell may be converted into a less specialized cell or may be converted into a specialized cell.

[0055] The term "reprogramming factor" refers to a drug that can increase the effect of cell production, alone or in combination with other drugs, including, but not limited to, polynucleotides, polypeptides and small molecules. Examples of reprogramming factors include, for example, transcription factors and small molecule reprogramming agents. In addition, the reprogramming factor can be one or more proteins selected from OCT4 polypeptide (OCT3 polypeptide or POU5F1 polypeptide), SOX2 polypeptide, NANOG polypeptide, KLF4 polypeptide, LIN28 polypeptide, C-MYC polypeptide, SV40LT polypeptide, hTERT polypeptide, SALL4 polypeptide, GLIS polypeptide, ESRRB polypeptide, DPPA2 polypeptide, ECAT1 polypeptide, SOX1 polypeptide, SOX3 polypeptide, KLF2 polypeptide, KLF5 polypeptide, L-MYC polypeptide, N-MYC polypeptide, LRH1 polypeptide and UTF1 polypeptide. In particular, the reprogramming factor may be one or more proteins selected from an OCT4 polypeptide (OCT3 polypeptide or POU5F1 polypeptide), a Sox2 polypeptide, a KLF4 polypeptide and a C-MYC polypeptide, or may be an OCT4 polypeptide, a Sox2 polypeptide, a KLF4 polypeptide and a C-MYC polypeptide.

[0056] Furthermore, the amino acid sequences of OCT4 polypeptides (OCT3 polypeptides or POU5F1 polypeptides), SOX2 polypeptides, NANOG polypeptides, KLF4 polypeptides, LIN28 polypeptides, C-MYC polypeptides, SV40LT polypeptides, hTERT polypeptides, SALL4 polypeptides, GLIS polypeptides, ESRRB polypeptides, DPPA2 polypeptides, ECAT1 polypeptides, SOX1 polypeptides, SOX3 polypeptides, KLF2 polypeptides, KLF5 polypeptides, L-MYC polypeptides, N-MYC polypeptides, LRH1 polypeptides and UTF1 polypeptides from various species can be obtained from public databases (e.g., GenBank or UniProt). By way of example, UniProt provides the amino acid sequences of human OCT4 polypeptide, human OX2 polypeptide, human KLF4 polypeptide and human C-MYC polypeptide under the names UniProtKB-Q01860, UniProtKB-P48431, UniProtKB-O43474, UniProtKB-P01106 and UniProtKB-Q9H9Z2, respectively.

[0057] Methods for introducing genes encoding reprogramming factors into cells can be those known in the art, and the genes encoding reprogramming factors can be introduced into cells by, for example, but not limited to, transient transfection, microinjection, transduction, electric cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE-dextran-mediated transfection, polybrain-mediated transfection, electroporation, gene guns, or other known methods for introducing nucleic acids into cells (Wu et al., J. Bio. Chem., 267:963-967, 1992; Wu and Wu, J. Bio. Chem., 263:14621-14624, 1988).

[0058] The reprogramming factors may be provided as RNA, linear DNA, peptides or proteins or cell extracts of pluripotent stem cells.

[0059] Furthermore, when genes encoding reprogramming factors are introduced into non-pluripotent cells, the species from which the reprogramming factors and the non-pluripotent cells originate can be the same, for example, human reprogramming factors can be introduced into human cells by transformation.

[0060] Furthermore, when introducing genes encoding reprogramming factors into cells, the genes can be introduced using a plasmid vector, a viral vector or other expression cassette. Furthermore, nucleotide sequences encoding genes encoding reprogramming factors can be inserted into an appropriate vector and introduced into non-pluripotent cells to express the desired polypeptide. Examples of vectors include plasmids, autonomously replicating sequences and transposable elements. Further examples of vectors include, but are not limited to, plasmids, phagemids, cosmids, yeast artificial chromosomes (YACs), artificial chromosomes such as bacterial artificial chromosomes (BACs) or P1-derived P1-derived artificial chromosomes (PACs), bacteriophages such as lambda phage or M13 phage, and animal viruses. Examples of animal virus categories useful as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex viruses), poxviruses, baculoviruses, papilloma viruses and papovaviruses (e.g., SV40). Examples of expression vectors are the pClneo vector (Promega) for expression in mammalian cells; pLenti4 / V5-DEST for lentivirus-mediated gene transfer and expression in mammalian cells. TM , pLenti6 / V5-DEST TM and pLenti6.2 / V5-GW / lacZ (Invitrogen).

[0061] In other embodiments of the present invention, the vector may be an episomal vector that is maintained extrachromosomally. The term "episomal" refers to a vector that can replicate without integration into the host's chromosomal DNA, and the lack of gradual loss from dividing host cells also means that the vector replicates extrachromosomally or episomally. The vector is engineered to carry a sequence that encodes a DNA replication origin or "ori" from lymphotropic herpesvirus or gammaherpesvirus, adenovirus, SV40, bovine papillomavirus, or yeast, particularly the lymphotropic herpesvirus or gammaherpesvirus replication origin corresponding to oriP of EBV. In certain embodiments, the lymphotropic herpesvirus may be Epstein-Barr virus (EBV), Kaposi's sarcoma herpesvirus (KSHV), herpesvirus saimiri (HS), or Marek's disease virus (MDV). Epstein-Barr virus (EBV) and Kaposi's sarcoma herpesvirus (KSHV) are also examples of gammaherpesviruses.

[0062] In one embodiment of the present invention, a vector containing an expression cassette that causes expression of reprogramming factors in the presence of antibiotics such as tetracycline can be introduced into non-pluripotent cells.Furthermore, the expression cassette can contain a Nanog-GFP reporter.The expression cassette can cause expression of reprogramming factors in the presence of doxycycline, and in particular, the expression cassette can cause expression of OCT4 polypeptide, Sox2 polypeptide, KLF4 polypeptide and C-MYC polypeptide upon administration of doxycycline, but is not limited thereto.

[0063] Methods for determining whether the genes encoding the reprogramming factors have been sufficiently introduced into the cells include molecular biological assays well known to those skilled in the art, such as, for example, Southern and Northern blotting, RT-PCR and PCR; biochemical assays, such as detecting the presence or absence of certain proteins / peptides by immunological means (e.g., ELISA and Western blots).

[0064] Furthermore, to confirm whether the genes encoding the reprogramming factors have been sufficiently introduced into the cells, a first screening process of the cells in which the reprogramming factors have been introduced can be isolated and continuously cultured in a medium containing an antibiotic that is resistant to the antibiotic upon treatment with the antibiotic, which can be, but is not limited to, a tetracycline-based antibiotic such as doxycycline.

[0065] Furthermore, treating non-pluripotent cells with reprogramming factors in an exogenous manner can be performed, but is not limited to, by directly contacting the reprogramming factors with the cells or by culturing the cells in a medium containing the reprogramming factors.

[0066] In one embodiment of the present invention, the cell induction to express reprogramming factors can be cultured in reprogramming medium.As reprogramming medium, the medium generally used for reprogramming iPSC, neural stem cell (iNSC) and dopaminergic neural progenitor cell can be used.Reprogramming medium can contain or not contain leukemia inhibitory factor (LIF). For example, reprogramming media may include medium containing knockout DMEM (Thermo Fisher Scientific), knockout serum replacement (Thermo Fisher Scientific), FBS, Glutamax, MEM-NEAA, 1× penicillin / streptomycin, and β-mercaptoethanol (Thermo Fisher Scientific), medium containing knockout DMEM (Thermo Fisher Scientific), knockout serum replacement (Thermo Fisher Scientific), FBS, Glutamax, MEM-NEAA, 1× penicillin / streptomycin, β-mercaptoethanol (Thermo Fisher Scientific), and LIF (Millipore, Billerica, MA, USA), medium containing DMEM / F12 (Thermo Fisher Scientific), neurobasal medium (Thermo Fisher Scientific), BSA, N2 (Thermo Fisher Scientific), B27 (Thermo Fisher Scientific), Glutamax, β-mercaptoethanol, FGF2 (Peprotech, Rocky Hill, NJ, USA), and medium containing LIF (Millipore, Billerica, MA, USA). Culture medium containing FGF4 (Peprotech) and EGF (Peprotech), Advanced DMEM / F12 (Thermo Fisher Scientific), Neurobasal Medium (Thermo Fisher Scientific), BSA, N2, B27, Glutamax, FGF8b (Peprotech), SHH (Peprotech), and β-mercaptoethanol or mTeSR 1 (STEMCELL Technologies, Vancouver, BC, USA).The medium may be: medium supplemented with CHIR99021 (Tocris Bioscience, Bristol, UK), A83 01 (Tocris) and NaB (Sigma Aldrich) including medium; medium containing Advanced DMEM / F12 (Thermo Fisher Scientific), neurobasal medium (Thermo Fisher Scientific), BSA, N2 (Thermo Fisher Scientific), B27 (Thermo Fisher Scientific), Glutamax, β-mercaptoethanol, FGF2 (Peprotech, Rocky Hill, NJ, USA), FGF4 (Peprotech), EGF (Peprotech), CHIR99021, A83 01 and hLIF (Peprotech).

[0067] Furthermore, in certain embodiments of the present invention, cells induced to express reprogramming factors may express desmosome-associated genes or epithelial cell differentiation-associated genes.

[0068] Desmosomes are a type of intercellular junction in epithelia, a type of intercellular junction that connects keratin filaments of adjacent cells. Desmosomes are composed of the cytoskeletal linker proteins desmosomal cadherins (i.e., desmocollins (Dsc) and desmogleins (Dsg)), armadillo proteins (i.e., plakoglobin and plakophilin) ​​and desmoplakin (Dsp).

[0069] On the one hand, cadherin and desmocollin proteins are involved in cell-cell adhesion, while desmoplakin (Dsp) proteins function to link desmosomes to keratin.

[0070] Dsg1, Dsg2, Dsg3, Dsg4, Dsc1, Dsc2, Dsc3, plakoglobin (Jup), plakophilin 1 to plakophilin 3 (Pkp1 to Pkp3), Perp, Dsp, krt8, etc. are known as desmosome-associated genes or epithelial cell differentiation-associated genes. However, in the present invention, the desmosome-associated genes or epithelial cell differentiation-associated genes whose expression levels are measured are not limited to these. On the other hand, the desmosome-associated gene or epithelial cell differentiation-associated gene whose expression level is measured in the method of converting a non-pluripotent cell into a pluripotent cell may be at least one gene selected from Dsp, Evpl, Dsg1a, Dsg1b, Dsg1c, Dsg3, Jup, Perp, Pkp1 and Krt8, or at least one gene selected from Dsg3, Dsg4, Dsp, Evpl, Jup, Perp and Pkp1, and the desmosome-associated gene or epithelial cell differentiation-associated gene may be Dsp and Pkp1. The nucleotide sequence of the desmosome-associated gene or epithelial cell differentiation-associated gene may be obtained from a known database such as GenBank, for example, GenBank Accession ID: 109620 or GenBank Accession ID: 832, which provides the nucleotide sequence of the Dsp gene.

[0071] In another embodiment of the present invention, the expression level of a gene can be measured at the nucleic acid level of the protein encoded by the gene or the mRNA or gene encoded by the gene. The amount of protein can be determined using an antibody that specifically binds to the protein encoded by the gene, and preferably, the level of protein expression itself can be measured without using an antibody.

[0072] For example, protein expression measurements may be performed using, but are not limited to, protein chip analysis, immunoassays, ligand binding assays, matrix desorption / ionization time-of-flight mass spectrometry (MALDI-TOF) analysis, surface-enhanced laser desorption / flight mass spectrometry (SELDI-TOF) analysis, radial immunoassays, radial immunodiffusion, radial immunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, immunohistochemistry analysis, immunocytochemistry analysis, complement fixation analysis, 2D electrophoresis analysis, liquid chromatography-mass spectrometry (LC-MS), liquid chromatography-mass spectrometry / mass spectrometry (LC-MS / MS), western blot, enzyme-linked immunosorbent assay (ELISA), and the like.

[0073] Furthermore, the measurement of mRNA expression of a gene can be performed using, but is not limited to, transcription-polymerase chain reaction (RT-PCR), competitive reverse transcription-polymerase reaction (competitive RT-PCR), real-time reverse transcription-polymerase reaction (real-time RT-PCR), RNase protection assay (RPA), Northern blotting, single-cell RNA sequencing, DNA chips, etc. The agent for measuring the mRNA level of a gene is preferably a primer pair or a probe, and since the nucleic acid information of the gene is known from GenBank, etc., a person skilled in the art can design a primer or a probe that specifically amplifies a specific region of these genes based on the sequence. Furthermore, the agent for measuring the mRNA level of a gene can include a primer pair, a probe, or an antisense nucleotide that specifically binds to the gene.

[0074] In some embodiments of the invention, the invention may further comprise the overexpression and subsequent reduction of a desmosome-associated gene or an epithelial cell differentiation-associated gene, where the desmosome-associated gene or the epithelial cell differentiation-associated gene may be reduced to a level lower than the expression of the corresponding gene in the induced pluripotent stem cell.

[0075] Furthermore, in some embodiments of the present invention, the method of converting non-pluripotent cells into pluripotent cells may further include isolating cells in which desmosome-associated genes or epithelial cell differentiation-associated genes are overexpressed. Cell separation may be performed using methods known in the art for isolating cells with high expression levels of target proteins or target genes. For example, cells may be separated by centrifugation using cell weight or density differences, cell separation using a flow cytometer, etc., mechanical separation, or enzymatic separation, or cell morphology.

[0076] In other embodiments of the invention, the method of converting non-pluripotent cells to pluripotent cells may involve isolating cells during a period of rapid decline in desmosome-associated genes or epithelial cell differentiation-associated genes.

[0077] Reprogramming can be limited before, after or during cell separation by methods known in the art. Limiting reprogramming can mean stopping some or all of reprogramming. For example, reprogramming medium can be modified by adding components that prevent the production of induced pluripotent stem cells (e.g., JAK inhibitors) to the reprogramming medium or removing feeder MEFs. Substances known in the art can be used as substances to limit reprogramming, for example, but not limited to, JMJD3 can be used. Furthermore, the method of converting non-pluripotent cells to pluripotent cells can include limiting the expression of reprogramming factors. Limiting the expression of reprogramming factors can be limiting or stopping the expression of some or all of reprogramming factors.

[0078] The condition for restricting the expression of the reprogramming factor may include, but is not limited to, changing the condition for expressing the reprogramming factor (e.g., excluding tetracycline from the medium in which the cells are cultured when the cells are administered tetracycline such as doxycycline, and the like, when the cells can express the reprogramming factor) or treating the cells with a viral vector to knock out the reprogramming factor. Furthermore, the cell separation in the method of converting a non-pluripotent cell to a pluripotent cell may be performed while inhibiting the expression of at least one gene selected from the group consisting of Nanog, Rex1 and Esrrb. In another embodiment of the present invention, the method of converting a non-pluripotent cell to a pluripotent cell may further include selecting cells that further express Shisa8 gene among cells in which the expression level of desmosome-related genes or epithelial cell differentiation-related genes is higher than the expression level of the corresponding gene in iPSCs. The Shisa8 gene is a gene that encodes the Shisa family member 8 protein. GenBank provides the nucleotide sequence of the Shisa8 gene, for example, the GenBank accession ID of the human Shisa8 gene is 440829. Furthermore, the expression of Shisa8 gene can be measured by the above-mentioned method for measuring the expression level of a gene. In another embodiment of the present invention, the method of converting a non-pluripotent cell into a pluripotent cell can further comprise culturing the selected cell in a reprogramming medium. The selected cell can have a property of being re-detachable. Furthermore, the method of converting a non-pluripotent cell into a pluripotent cell can further comprise culturing the selected cell in a reprogramming medium. The reprogramming medium is generally a medium used for reprogramming into iPSC, neural stem cell (iNSC) and dopaminergic neural progenitor cells as described above. On the other hand, as the reprogramming medium, a medium suitable for reprogramming into ectodermal, endodermal or mesodermal cells known in the art can be used.

[0079] According to an embodiment of the present invention, the method for converting non-pluripotent cells into pluripotent cells may further include cells with a higher expression level of Spink2 gene than induced pluripotent cells (iPSCs). The Spink2 gene is a gene encoding serine protease inhibitor Kazal type 2 (Spink2), also known as acrosin-trypsin inhibitor. The Spink2 gene is a gene marker that is specifically expressed in the pluripotent cells of the present invention and is not substantially expressed in conventional pluripotent stem cells.

[0080] Furthermore, GenBank provides the nucleotide sequence of the Spink2 gene, for example, the GenBank accession ID of the human Spink2 gene is 6691. Furthermore, expression of the Spink2 gene can be measured by the above-mentioned methods for measuring the expression level of a gene.

[0081] In certain embodiments of the present invention, the pluripotent cells may exhibit a 1- to 700-fold (excluding 1) increase in expression of the Spink2 gene compared to induced pluripotent stem cells. Specifically, the Spink2 gene of the pluripotent cells may exhibit a 10-fold or greater, 1- to 700-fold (excluding 1), 3- to 650-fold, 10- to 600-fold, or 20- to 570-fold increase in expression compared to induced pluripotent stem cells. In certain embodiments of the present invention, the Spink2 gene of the pluripotent cells may exhibit an expression level that is approximately 569-fold (39.81 / 0.07=568.71) higher than that of induced pluripotent stem cells.

[0082] In another embodiment of the present invention, the expression level of the desmosome-associated gene or epithelial cell differentiation-associated gene in the pluripotent cells is at least about 2-fold, at least 3-fold, at least 5-fold, at least 10-fold, at least 15-fold, or at least 20-fold lower than that of the Spink2 gene. Furthermore, the expression level of the desmosome-associated gene or epithelial cell differentiation-associated gene may be about 2-20-fold, about 5-15-fold, or about 7-10-fold lower than that of the Spink2 gene.

[0083] In another embodiment of the present invention, the pluripotent cells may show reduced expression of at least one gene selected from the group consisting of Nanog, Rex1 and Esrrb, compared with the expression level of the corresponding gene in iPSCs.GenBank provides the nucleotide sequences of Nanog, Rex1 and Esrrb, and the expression of Nanog, Rex1 and Esrrb genes may be determined by the above-mentioned method for measuring the expression level of genes.

[0084] Furthermore, the pluripotent cells may exhibit a 10-fold or more, 11-fold or more, 12-fold or more, 13-fold or more, 14-fold or more, 15-fold or more, 16-fold or more, 17-fold or more, 18-fold or more, 19-fold or more, 20-fold or more, or 100-fold or more, decrease in expression of at least one gene selected from the group consisting of Nanog, Rex1 and Esrrb, compared to the expression level of the corresponding gene in iPSCs. Furthermore, the expression of the Nanog gene may be decreased by 100-fold or more, compared to the expression level in iPSCs.

[0085] In certain embodiments of the present invention, the pluripotent cells may be cells that have reduced tumorigenicity compared to iPSCs.

[0086] In other embodiments of the invention, the pluripotent cells are capable of differentiating into cells that constitute the ectoderm, mesoderm or endoderm.

[0087] In another embodiment of the present invention, pluripotent cells can be formed by reducing the expression of desmosome-associated genes or epithelial cell differentiation-associated genes in cells in which these genes are overexpressed.Furthermore, pluripotent cells can be cells formed by reducing the expression of the Dsp gene in cells expressing the Dsp gene and the Shisa8 gene.

[0088] In another embodiment of the present invention, the pluripotent cell can be a cell that expresses the Spink2 gene and the expression of at least one gene selected from the group consisting of Shisa3, Foxo4, Ptp4a3, Blvra, Mbnl3, Mthfd2 and Dctpp1 and Spink2 genes is increased as the expression level of the corresponding gene in iPSCs. GenBank provides the nucleotide sequences of Shisa3, Foxo4, Ptp4a3, Blvra, Mbnl3, Mthfd2 and Dctpp1, and the method for measuring the expression of Shisa3, Foxo4, Ptp4a3, Blvra, Mbnl3, Mthfd2 and Dctpp1 genes is the same as the above method used for the expression level of genes.

[0089] The Shisa3 gene is a gene encoding a single transmembrane protein Shisa3. Shisa3 and the Shisa3 gene encoding it may have a sequence published under gene ID: 330096 (NCBI reference sequence: NC_000071.7) or gene ID: 152573 (NCBI reference sequence: NC_000004.12). Shisa3 is known to play an essential role in the maturation of prostate mesenchymal cells by independently attenuating the signaling pathways of FGF and WNT.

[0090] The Foxo4 gene is a gene encoding the forkhead box protein O4 peptide (Foxo4). Foxo4 and the Foxo4 gene encoding it may have a sequence published under gene ID: 54601 (NCBI Reference Sequence: NC_000086.8) or gene ID: 4303 (NCBI Reference Sequence: NC_000023.11). Foxo4 is a transcription factor involved in the control of the insulin signaling system, and is known to be involved in cell cycle inhibition or increased proteasome activity in embryonic stem cells.

[0091] The Ptp4a3 gene is a gene encoding protein tyrosine phosphatase type IVA 3 (Ptp4a3). Ptp4a3 and the Ptp4a3 gene encoding it may have a sequence published under gene ID: 19245 (NCBI Reference Sequence: NC_000081.7) or gene ID: 4303 (NCBI Reference Sequence: NC_000023.11). Ptp4a3 belongs to the protein tyrosine phosphatase (PTP) family, which are cell signaling molecules that help control various cellular processes. Ptp4a3 is known to be involved in enhancing cell proliferation and mobility or promoting tumor metastasis.

[0092] The Blvra gene is a gene encoding biliverdin reductase A (Blvra). Blvra and the Blvra gene encoding it may have a sequence published under gene ID: 109778 (NCBI Reference Sequence: NC_000068.8) or gene ID: 644 (NCBI Reference Sequence: NC_000007.14). Blvra belongs to the biliverdin reductase family, which catalyzes the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. It is known that mutations in the Blvra gene have been detected in diseases such as hyperbilirubinemia or cholestasis.

[0093] The Mbnl3 gene is a gene encoding muscle blind-like protein 3 (Mbnl3). The Mbnl3 gene may have a sequence published under gene ID: 171170 (NCBI Reference Sequence: NC_000086.8) or gene ID: 55796 (NCBI Reference Sequence: NC_000023.11). Mbnl3 is known to be involved in the regulation of alternative splicing and to play a role in the pathology of muscle atrophy.

[0094] Mthfd2 gene is a gene encoding Mthfd2. Mthfd2 and the Mthfd2 gene encoding it can have the sequence published in gene ID: 17768 (NCBI reference sequence: NC_000072.7) or gene ID: 10797 (NCBI reference sequence: NC_000002.12). Mthfd2 functions as a homodimer and can form a complex with magnesium or inorganic phosphate, thereby binding to NAD.

[0095] Dctpp1 gene is a gene encoding dCTP pyrophosphatase 1 (Dctpp1). Dctpp1 and the Dctpp1 gene encoding it can have a sequence published under gene ID: 66422 (NCBI Reference Sequence: NC_000073.7) or gene ID: 79077 (NCBI Reference Sequence: NC_000016.10). Dctpp1 is an enzyme that converts dCTP to dCMP and inorganic pyrophosphate. Diseases associated with Dctpp1 include aspartylglucosaminuria and otosclerosis.

[0096] Pluripotent cells can have granular morphology, but are not limited thereto.Furthermore, pluripotent cells can be differentiated into, but are not limited to, CD34 cells, hemogenic endothelial cells, hematopoietic stem and progenitor cells (HSCs), hematopoietic pluripotent progenitor cells, T cell progenitor cells, NK cell progenitor cells, T cells, NKT cells, NK cells and B cells.Furthermore, pluripotent cells can be differentiated into iPSCs, iNSCs or iDPs.

[0097] In one embodiment of the present invention, the present invention relates to pluripotent cells or cells with increased expression of desmosome-associated genes or epithelial cell differentiation-associated genes produced by the method of converting non-pluripotent cells into pluripotent cells. The cells with increased expression of desmosome-associated genes or epithelial cell differentiation-associated genes may be cells expressing the Dsp gene and the Shisa8 gene. The cells expressing the Dsp gene and the Shisa8 gene produced through the cells with increased expression of desmosome-associated genes or epithelial cell differentiation-associated genes express the Spink2 gene and further express one or more marker genes selected from the group consisting of Shisa3, Foxo4, Ptp4a3, Blvra, Mbnl3, Mthfd2 and Dctpp1, and may be granule cells, but the present invention is not limited thereto. The characteristics of the pluripotent cells are the same as those described above.

[0098] The cells expressing the Dsp gene and the Shisa8 gene formed in the process of converting a non-pluripotent cell into a pluripotent cell differentiate into a target cell or naturally dedifferentiate into three germ layers when cultured in a medium known to be suitable for reprogramming a target cell, such as an iPSC reprogramming medium, an iNSC reprogramming medium, an iDP reprogramming medium, or a tri-germ layer (ectoderm, mesoderm, and endoderm) cell used in the examples of the present specification, or subjected to conditions suitable for reprogramming a target cell. As a medium known to be suitable for reprogramming a target cell and a condition suitable for reprogramming a target cell, a medium and a condition known in the field to which the present invention belongs can be used.

[0099] The endoderm, mesoderm and ectoderm form three germ layers: the endoderm produces cells that form the stomach, colon, liver, pancreas, bladder, urethral mucosa, epithelial parts of the respiratory tract, lungs, pharynx, thyroid gland, parathyroid gland and small intestine tissue; the mesoderm produces cells that form skeletal muscle, bone, dermis, connective tissue, urogenital system, heart, blood (lymphocytes), kidney and spleen; and the ectoderm produces cells that form the central nervous system, eye lens, skull and sensory, ganglion and nerve, pigment cells, head connective tissue, epithelium, hair and mammary glands.

[0100] In another embodiment of the present invention, the present invention relates to a cell in which the expression of desmosome-associated genes or epithelial cell differentiation-associated genes is higher than the expression level of the corresponding genes in iPSCs, or the expression level of Spink2 gene is higher than the expression level of the corresponding genes in iPSCs, and the expression level of at least one gene selected from the group consisting of Nanog, Rex1 and Esrrb is reduced compared to the expression level of the corresponding genes in iPSCs. The cell in which the expression of desmosome-associated genes or epithelial cell differentiation-associated genes is higher than the expression level of the corresponding genes in iPSCs may be a cell expressing at least one gene selected from the group consisting of Dsp, Evpl, Dsg1a, Dsg1b, Dsg1c, Dsg3, Jup, Perp, Pkp1 and Krt8, or at least one gene selected from the group consisting of Dsg3, Dsg4, Dsp, Evpl, Jup, Perp and Pkp1, and in particular may be a cell expressing the Dsp gene and the Shisa8 gene, but the present invention is not limited thereto. Furthermore, cells in which the expression level of the Spink2 gene is higher than the expression level of the gene in iPSCs may be cells that exhibit pluripotency, which is the ability to differentiate into either ectodermal, mesodermal or endodermal cells, and may have the characteristics of the above-mentioned pluripotent cells.

[0101] In another embodiment of the present invention, the present invention relates to a method for producing cells, comprising inducing differentiation of pluripotent cells; or cells in which the expression of desmosome-associated genes or epithelial cell differentiation-associated genes is higher than the expression level of the corresponding genes in iPSCs, or the expression level of Spink2 gene is higher than the expression level of said genes in iPSCs, and the expression level of at least one gene selected from the group consisting of Nanog, Rex1 and Esrrb is decreased compared to the expression level of the corresponding genes in iPSCs. Inducing cell differentiation can be performed by culturing the cells of interest under conditions known to be suitable for the differentiation of the cells of interest, such as ectodermal cells, mesodermal cells, endodermal cells, iPSCs or neural stem cells (iNSCs), or by creating such conditions in vivo or ex vivo. In another embodiment of the present invention, the present invention relates to a composition for cell transplantation or biological tissue regeneration, comprising pluripotent cells as active ingredients; cells in which the expression level of desmosome-related genes or epithelial cell differentiation-related genes is higher than the expression level of the corresponding genes in iPSCs, or the expression level of Spink2 gene is higher than the expression level of the corresponding genes in iPSCs, and the expression level of at least one gene selected from the group consisting of Nanog, Rex1 and Esrrb is reduced compared to the expression level of the corresponding genes in iPSCs; or differentiation-induced cells. The biological tissue may be a damaged tissue selected from tissues with ulcers or bedsores, brain tissue damage due to cell degeneration, partial brain tissue loss due to surgical procedures, brain tissue damage due to traumatic brain disease, brain tissue damage due to inflammatory brain disease, damaged bone tissue, damaged periodontal tissue, tissue damage due to central nervous system disease, and tissue damage due to intractable dermatitis, and the biological tissue regeneration may be, but is not limited to, restoration of damaged tissue, epithelium regeneration, secretory gland or hair follicle regeneration, microvascularization of skin tissue, wound healing, correction of defects in soft tissue, bone healing or bone regeneration, cartilage regeneration, etc.

[0102] In one embodiment of the present invention, the present invention relates to a method for converting non-pluripotent cells into pluripotent cells, iPSCs or iNSCs, comprising overexpressing desmosome-associated genes or epithelial cell differentiation-associated genes in non-pluripotent cells, wherein the method can increase the efficiency of reprogramming non-pluripotent cells into pluripotent cells, iPSCs or iNSCs.Increasing reprogramming efficiency means that the number of pluripotent cells, iPSCs or iNSCs obtained is increased by more than 1-fold or the time required to obtain pluripotent cells, iPSCs or iNSCs is shortened, compared with the case where non-pluripotent cells are converted into pluripotent cells, iPSCs or iNSCs without overexpressing desmosome-associated genes or epithelial cell differentiation-associated genes in non-pluripotent cells.

[0103] On the other hand, in one embodiment of the present invention, the overexpression of desmosome-associated genes or epithelial cell differentiation-associated genes in the method of converting non-pluripotent cells to pluripotent cells, iPSCs or iNSCs can be achieved by using the above-mentioned method used to introduce genes encoding reprogramming factors into non-pluripotent cells. Furthermore, the characteristics of non-pluripotent cells and pluripotent cells are the same as above. The overexpressed desmosome-associated genes or epithelial cell differentiation-associated genes can be at least one gene selected from the group consisting of Dsp, Evpl, Dsg1a, Dsg1b, Dsg1c, Dsg3, Jup, Perp, Pkp1 and Krt8, or preferably Dsp. Furthermore, the method of converting non-pluripotent cells to pluripotent cells, iPSCs or iNSCs can be, but is not limited to, iPSC reprogramming method, cross-differentiation method, direct cross-differentiation method or direct differentiation pro-factor mediated reprogramming method or a method of converting cell fate known in the field to which the present invention belongs. In one embodiment of the present invention, the present invention relates to a method for evaluating the efficacy or toxicity of a test substance, comprising contacting a pluripotent cell; a cell in which expression of a desmosome-associated gene or an epithelial cell differentiation-associated gene is higher than the expression level of the corresponding gene in induced pluripotent stem cells (iPSCs), or the expression level of the Spink2 gene is higher than the expression level of the gene in iPSCs and the expression level of at least one gene selected from the group consisting of Nanog, Rex1 and Esrrb is decreased compared to the expression level of the corresponding gene in iPSCs; or a differentiation-induced cell, with a test substance.

[0104] In certain embodiments of the present invention, isolated cells in a method for conversion of non-pluripotent cells to pluripotent cells, ectodermal cells, mesodermal cells, endodermal cells, iPSCs, iNSCs, iDPs, etc. of the present invention produced by differentiation of the isolated cells may be used in regenerative medicine. For example, isolated cells obtained by converting non-pluripotent cells of somatic fate obtained from an individual by a method for conversion to pluripotent cells, ectodermal cells, mesodermal cells, endodermal cells, iPSCs, iNSCs, iDPs, etc. produced by differentiation of the isolated cells may be transplanted or administered to an individual to prepare a patient-specific cell therapy product.

[0105] Furthermore, in certain embodiments of the present invention, the cells may be transplanted in an amount sufficient to cause a measurable improvement of the symptoms or markers of the condition to be treated by transplanting the cells into the patient. The actual transplantation level of the cells of the therapeutic composition may vary in order to transplant an effective amount of cells to achieve the desired therapeutic response for a particular subject. The selected transplantation level may depend on a variety of factors, including, but not limited to, the therapeutic composition, formulation, route of administration, combination with other drugs or treatments, the severity of the condition to be treated, the physical condition of the subject, the medical history of the subject to be treated, and the experience and judgment of the clinician or practitioner administering the treatment. In general, the planned amount and method of transplantation is sufficient to cause a delay, preferably inhibition, of the progression of the condition, and preferably achieve a reduction in one or more symptoms or markers of the condition.

[0106] In another aspect of the present invention, the present invention relates to a method for regenerating biological tissue by administering to an individual pluripotent cells; cells or differentiation-induced cells in which the expression of desmosome-related genes or epithelial cell differentiation-related genes is higher than the expression level of the corresponding genes in induced pluripotent stem cells (iPSCs) or the expression level of Spink2 gene is higher than the expression level of said genes in iPSCs and the expression level of at least one gene selected from the group consisting of Nanog, Rex1 and Esrrb is reduced compared to the expression level of the corresponding genes in iPSCs. The cells can be administered in a manner that allows the cells to be transplanted to the site in need of regeneration of biological tissue and reconstitute or regenerate the functionally deficient area. For example, the cells can be directly transplanted into the parenchyma or intrathecal site of the central nervous system depending on the disease to be treated. In some embodiments, the cells can be injected or deposited in the form of injection or bolus injection or continuous infusion into the patient by intravenous, intravertebral, intraventricular, intrathecal, intraarterial, intramuscular, intraperitoneal, subcutaneous, intraocular, retrobulbar space and combinations thereof, but the method is not limited thereto. Furthermore, the cells can be directly transplanted to the site in need of tissue regeneration. Furthermore, the regenerative biological tissue is the same as described above for the composition for cell transplantation or biological tissue regeneration.

[0107] As used herein, the term "individual" refers to any animal, preferably a human patient, livestock or other domestic animals.

[0108] In another aspect of the invention, the invention relates to the use of a cell for the manufacture of a medicament for the treatment of a disease in an individual or for use in the manufacture of a composition for cell transplantation or biological tissue regeneration, wherein the cell is an isolated cell in a method for converting a non-pluripotent cell into a pluripotent cell, such as an ectodermal cell, a mesodermal cell, an endodermal cell, an iPSC, an iNSC or an iDP produced by differentiation of the isolated cell.

[0109] Mode of the invention The present invention will now be described in more detail with reference to the following examples, but the scope of the present invention is not limited thereto.

[0110] On the one hand, the types of primers and the types of CRISPR sgRNAs used in the following examples are summarized in Tables 1 and 2, respectively, and the types of antibodies used for immunofluorescence staining and Western blotting are shown in Table 3.

[0111] [Table 1] [Table 2] [Table 3]

[0112] [Table 4]

[0113] [Table 5] [Table 6] EXAMPLES

[0114] Example 1. Cellular reprogramming Example 1-1. Reprogramming of fibroblasts Mouse embryonic fibroblasts (hereafter, 2° MEFs) expressing Oct4, Sox2, Klf4, and c-Myc genes (hereafter, OSKM) were prepared in the presence of doxycycline (Sigma-Aldrich, St. Louis, MO, USA).

[0115] Specifically, induced pluripotent stem cells (NG1-iPSCs) overexpressing OSKM and induced Nanog-GFP reporter by doxycycline administration were purchased from Stemgent (Beltsville, MD, USA). 2°MEFs were then obtained from NG1-iPSC-derived E13.5 mouse embryos by blastocyst injection. 2°MEFs were maintained in MEF medium (Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS, 1x Glutamax, 1x MEM-non-essential amino acids (MEM-NEAA) and 1% penicillin / streptomycin). FBS, Glutamax, MEM-NEAA and DMEM supplemented with 1% penicillin / streptomycin were all purchased from Thermo Fisher Scientific (Waltham, MA, USA). For 2°MEFs, the method described in J. Kim et al., Direct reprogramming of mouse fibroblasts to neural progenitors, Proc Natl Acad Sci USA 108, 7838-7843 (2011) was followed.

[0116] Another type of cell (4F2A MEF) expressing OSKM upon doxycycline administration was used by collecting MEFs from mice of lineage #011004 purchased from Jackson lab. The method was as described in BW Carey, et al., Single-gene transgenic mouse strains for reprogramming adult somatic cells. Nat Methods 7, 56-59 (2010).

[0117] Then, to reprogram 2° MEFs or 4F2A MEFs into iPSCs, thaw the MEFs and plate them on Geltrex (Thermo Fisher Scientific) plates at 2 × 10 4 cells / cm 2The cells were seeded at a density of 100-200 μg / ml. In this case, doxycycline induction was started the next day. On the other hand, two methods were used for reprogramming 2°MEFs to iPSCs (i.e., iPSCR) (iPSC in FIG. 1). Specifically, 2°MEFs were further cultured in MEF medium for one day, and the culture was performed using reprogramming initiation medium (RepM-Ini: Knockout DMEM (Thermo Fisher Scientific), 10% Knockout Serum Replacement (Thermo Fisher Scientific), 5% FBS, 1× Glutamax, 1× MEM-NEAA, 1% 1× penicillin / streptomycin and 0.055 mM β-mercaptoethanol (Thermo Fisher Scientific)) as the medium until the fourth day of culture, and then the medium was replaced with iPSC reprogramming medium for pluripotent stem cells (RepM-PSC: LIF (Millipore, Billerica, MA, USA) 1,000U / mL) and the culture was performed until the end of culture or the medium was replaced with RepM-PSC and then the culture was performed until the end of culture.

[0118] On the other hand, differentiation-competent cells were prepared by reprogramming 2°MEFs or 4F2A MEFs into iNSCs or iDPs using a method in which doxycycline was induced for only a portion of the culture period (PDR in Figure 1).

[0119] RepM-Ini and iNSC reprogramming medium for neural stem cells (RepM-NSC) were used for iNSC reprogramming, and RepM-Ini and iDP reprogramming medium for dopaminergic neural progenitor cells (RepM-DP) were used for iDP reprogramming. RepM-Ini medium was the same as above. RepM-NSC medium was prepared by adding a solution containing 0.05% BSA, 1x N2 (Thermo Fisher Scientific), 1x B27 (Thermo Fisher Scientific), 1x Glutamax, 0.11 mM β-mercaptoethanol, 20 ng / mL FGF2 (Peprotech, Rocky Hill, NJ, USA), 2 ng / mL FGF4 (Peprotech) and 20 ng / mL EGF (Peprotech) in a 1:1 ratio to a solution obtained by mixing Advanced DMEM / F12 (Thermo Fisher Scientific) and Neurobasal Medium (Thermo Fisher Scientific). RepM-DP medium was prepared by adding a solution containing 0.05% BSA, 1x N2, 1x B27, 1x Glutamax, 100 ng / mL FGF8b (Peprotection), 200 ng / mL SHH (Peprotection) and 0.11 mM β-mercaptoethanol in a 1:1 ratio to a solution obtained by mixing Advanced DMEM / F12 (Thermo Fisher Scientific) and Neurobasal Medium (Thermo Fisher Scientific).

[0120] For reprogramming of MEFs into NSCs, thaw MEFs and plate them on Geltrex (Thermo Fisher Scientific) coated plates at 2 × 10 in MEF medium. 4 cells / cm 2 In this case, doxycycline induction was started the next day. MEFs were further cultured in MEF medium for 1 day, culture was performed in RepM-Ini medium until reprogramming day 4, then the medium was replaced with RepM-NSC and culture was performed in this medium until the end of reprogramming.

[0121] For reprogramming of MEFs into iDPs, thaw MEFs and plate them on Geltrex (Thermo Fisher Scientific) coated plates at 2 × 10 4 cells / cm 2 In this case, doxycycline induction was started the next day. 2°MEFs were further cultured in MEF medium for 1 day, cultures were carried out in RepM-Ini medium until culture day 4, then the medium was replaced with RepM-DP and cultures were carried out in this medium until the end of reprogramming.

[0122] Example 1-2. Cell analysis method during reprogramming process Microarray analysis and quantitative PCR For each reprogramming step shown in Figure 1, total RNA was collected from each cell every other day using an RNeasy Plus mini kit and QIAshredder (Qiagen, Hilden, Germany) according to the manufacturer's manual.

[0123] Furthermore, cells during the period when total RNA was collected were classified as shown in Figure 2. 2° MEFs themselves were named F, cells under LIF-free conditions were named C, cells in the presence of LIF throughout the entire period of iPSC reprogramming (iPSCR) were named P, cells under conditions where LIF was present only from day 5 to day 12 of iPSCR were named P', cells under iNSC reprogramming conditions were named N, and cells under iDP reprogramming conditions were named D, with the days of culture indicated as P, P', N, and D.

[0124] For microarray analysis, the RNA quality of all samples was identified with an Agilent 2100 Bioanalyzer System, and amplification, labeling, and hybridization steps were performed consecutively. Global gene expression profiles were analyzed by Agilent Mouse Whole Genome 4 × 44K Array (V2) chips (1-color platform; Agilent Technologies, Santa Clara, CA, USA), and all analyses were performed according to the manufacturer's protocol. Microarray data were processed using GeneSpring software (Agilent Technologies) and normalized via global scale normalization. Functionally grouped GO terms were analyzed using the Cytoscape software platform (v3.5.1; http: / / www.cytoscape.org / what_is_ cytoscape.tml). Functionally grouped GO term networks were visualized using the ClueGO plugin (v2.3.4; http: / / apps.cytoscape.org / apps / cluego) and CluePedia (v1.3). ClueGO analysis of the top 24 genes was performed in 5 annotation groups (group p-value <0.002). Biological process, cellular component and molecular function gene enrichment was analyzed using GSEA software (v 3.0). GSEA variables were set to 1,000 / mutation, classical enrichment statistics and signal-to-noise separation metrics for each gene set. Furthermore, groups of genes (DEGs) that were expressed more than 3-fold relative to each other were analyzed when comparing the expression levels of genes expressed on days 0 and 6 of reprogramming.

[0125] cDNA was synthesized from 1 μg of total RNA using the iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). The cDNA was then diluted to 1 / 50 concentration and mixed with iQ SYBR Green Supermix (Bio-Rad), and real-time quantitative PCR was then performed using an Applied Biosystems 7500 Fast Real-Time PCR instrument system (Thermo Fisher Scientific). In this case, the cycle threshold (Ct) of each target gene was determined using the software provided by the manufacturer, and expression data were normalized with the Ct value of Rpl7, which was used as an internal control. To compare the fold change between cell samples, gene expression values ​​of each sample were then compared and presented based on MEFs.

[0126] Single-cell RNA sequencing (scRNA-seq) methods Single-cell RNA sequencing (scRNA-seq) was performed on a total of 33,966 cells, including starting fibroblasts obtained during the iPSCR and iNSCR, iPSCs, and iNSCs, and cells obtained on each culture day.

[0127] scRNA-seq libraries were generated using the Chromium Single Cell 3' Reagent Kit v2 (PN-120267, 10X Genomics), Chromium Single Cell A Chip Kit (PN-120236, 10X Genomics) and Chromium Single Cell i7 Multiplex Kit (PN-120262, 10X Genomics) according to the manufacturer's manual. Cell viability was estimated to be greater than 90% as confirmed by trypan blue staining under a microscope. Cells were cultured at 2 × 10 in DPBS containing 0.04% BSA. 5 ~2×10 6The libraries were diluted to cells / mL and loaded into a Chromium microfluidic platform, capturing 3,000 cells / channel. The libraries were sequenced on an Illumina HiSeq 4000 platform (2 × 100 bp).

[0128] Raw FASTQ files were processed using default arguments and Cell Ranger software (v2.1.0). Reads were aligned to the mouse reference genome (GRCm38) and Ensembl GRCm38.92 annotations. Cell-per-gene unique molecular identifier (UMI) count matrices for each condition were created with “expected-cells=3,000” and merged into a single count matrix. Empty droplets were removed using the emptyDrops function in the DropletUtils (v0.99) R package under FDR ≤ 0.05. Outliers were visually inspected in a principal component analysis (PCA) plot on the quality control matrix using the scater (v1.7.18) R package to remove low-quality cells with less than 1,000 UMIs, less than 102.5 detected genes (103 detected genes for iNSCs), and more than 10% UMIs mapped to mitochondrial genes. The raw count matrix was normalized by cell-specific size coefficients estimated by scran (v1.14.6) R package and then log2 transformed with pseudocounts of 1. Highly variable genes (HVGs) across all cells were identified using the R package. All cells were visualized in a uniform manifold approximation and projection plot (UMAP plot) using the RunUMAP function of the Seurat (v3.2.2) R package with the first 50 PCs and n.neighbors=10. Cells between days 5 and 7 of reprogramming were visualized in a UMAP plot from the first 25 PCs. Cells were clustered using the FindClusters function of the R package with the first 30 PCs and resolution=0.6. Gene set signature scores were calculated using the AddModuleScore function of Seurat and commonly known marker genes. Blast-specific markers described in W. Wang et al., Changes in regeneration-responsive enhancers shape regenerative capacities in vertebrates. Science 369, (2020) were used to calculate the blastema signature score. Desmosome (GO:CC) and epithelial cell differentiation (EMT, hallmark) gene lists were obtained from MSigDB.

[0129] Pathways in UMAP space were analyzed using the Slingshot function in the Slingshot (v1.4.0) R package with predefined starting clusters (days 5-7: 1, days 2-8: 3, zebrafish: 6, axolotl: 7). Signature scores along the pathways were rounded by regression regression and in the WOT analysis, route mapping was performed on the HVG-expression data using the wot (v1.0.8) python package with optimal_transport command line interface and default arguments.

[0130] Alkaline phosphatase (AP) staining and immunofluorescence staining methods For AP staining, each cell was washed once with Dulbecco's phosphate-buffered saline (DPBS, WELGENE, Daegu, Korea) and fixed with 10% formalin solution (Sigma-Aldrich) for 30 seconds. AP staining was performed using a leukocyte AP kit (Sigma-Aldrich) according to the Sigma-Aldrich manual. The fixed samples were washed once and placed in P substrate solution for 20 minutes in the dark.

[0131] For immunofluorescence staining, cells were washed with DPBS, fixed, blocked with 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA, USA) and 0.15% picric acid (Sigma-Aldrich) in DPBS for 15 min, and permeabilized with 3% BSA (Thermo Fisher Scientific) and 0.3% Triton X-100 (Sigma-Aldrich) in DPBS for 1 h at room temperature. Primary antibodies were diluted in 1% BSA and incubated overnight at 4°C. After repeated washing with 1% BSA in DPBS, all samples were incubated with Alexa-594 or Alexa-488 conjugated secondary antibodies (Thermo Fisher Scientific) for 1 h at room temperature. All fluorescent images were obtained with an Axio Vert. A1 microscope (Carl Zeiss, Oberkochen, Germany) and an Evos FL auto 2 imaging system (Thermo Fisher Scientific).

[0132] Transmission electron microscope imaging To elucidate desmosome formation, reprogramming was performed on geltrex-coated coverslips (Electron Microscopy Sciences, Hatfield, PA, USA). Cells were fixed with 2.5% glutaraldehyde in 0.1 M cacodylic acid solution (pH 7.0) for 1 h. Cells were then treated with 2% osmium tetroxide for 2 h at 4°C. Cells were dehydrated with graded acetone and then embedded in SpurrMedia (Electron Microscopy Services). Each sample was cut at 60 nm with an ultramicrotome (RMC MTXL; Boeckeler Instruments, Tuscon, AZ, USA), stained with 2% uranyl acetate for 20 min, and stained with lead citrate for 10 min. Each section was observed with a H-7600 (HITACHI, Tokyo, Japan) transmission electron microscope at 80 kV.

[0133] Examples 1-3. Changes in cells during each reprogramming method and each reprogramming period Immunostaining image analysis of the iPSC-specific markers Nanog and SSEA-1, the iNSC-specific markers Pax6 and PLZF, and the iDP-specific marker FoxA2 on day 12 of reprogramming showed that cells on day 12 of reprogramming showed proper conversion from cells to iPSCs, iNSCs, and iDPs (Figure 3).

[0134] Furthermore, the results of AP staining on day 12 of iPSC reprogramming confirmed that the presence or absence of LIF had no effect on the process of reprogramming 2° MEFs to iPSCs ( Figure 4 ).

[0135] Furthermore, phase contrast and immunofluorescence staining image analysis from days 0 to 12 of reprogramming revealed that there was little difference between cells by reprogramming method until day 6 of reprogramming (Figure 5). Furthermore, transcriptome similarity analyzed by principal component analysis (PCA) showed that all cells were divided into the same group until day 6 of reprogramming (cluster I in Figure 6). Hierarchical clustering was used to diffract the microarray data of each cell shown in Figure 2, confirming that iPSCR and PDR are reprogramming methods distinct from each other, but reprogram cells through a common biological pathway until day 6 of reprogramming (Figures 7 and 8). Furthermore, because all cells on day 6 of reprogramming lost their somatic characteristics and pluripotency-related genes had not yet been activated, day 6 of reprogramming was classified as a kind of "intermediate phase" (Figure 9).

[0136] Genes contributing to the intermediate stage on day 6 of reprogramming were analyzed through the DEG analysis of Examples 1-2. DEGs were classified into 4 groups through k-means clustering, and the classification criteria are shown in FIG. 10 (lower part of FIG. 10). Among these, genes corresponding to group IV showed intermediate stage-specific expression in more than 70% of the analyzed genes (upper part of FIG. 8 and FIG. 10).

[0137] Furthermore, network-based gene ontology analysis was performed using ClueGO of 244 genes common to iPSCR group IV and PDR group IV. These 244 genes were found to be poorly expressed in fibroblasts, iPSCs, iNSCs and iDPs, but had high expression levels on day 6 of reprogramming (Figures 11 and 12). The top-ranked GO terms in the GO analysis of these genes are shown in Figure 13.

[0138] On the other hand, when the cells at the 6th day of culture were analyzed for the cells where reprogramming started and the final cells where reprogramming was completed, the highest ranked gene set was found to be related to desmosomes and further to epithelial cell differentiation (Figure 14). Therefore, it was confirmed that epithelial-related genes have characteristics related to desmosomes and epithelial cell differentiation that are specific to the "intermediate stage" in both iPSCR and PDR.

[0139] When desmosome formation was confirmed by transmission electron microscopy, mature desmosomes were formed only in cells on day 6 of reprogramming (Figures 15 and 16).

[0140] Example 1-4. Correlation between desmosomes and reprogramming methods Mesenchymal-epithelial transition (MET) is an essential process in the early stage of reprogramming. Therefore, we confirmed whether mesenchymal- and epithelial-related genes were expressed (Figure 17). Among epithelial genes, increased expression of genes unrelated to desmosomes (Cdh1, Ep-cam, and Cldn6) was observed in cells at day 6 of reprogramming and in iPSCs. On the other hand, decreased expression of mesenchymal genes (Snail, Slug, Zeb1, Twist1, Twist2, Cdh2, and Fn) was shown in all cells. However, expression of desmosome component genes (Dsp and Pkp1) and cytokeratins (Krt8 and Krt19) was found to be increased in cells at day 6 of culture, whereas it was decreased in iPSCs. This suggests that desmosome-related epithelial genes are regulated differently from epithelial genes involved in MET (e.g., Cdh1).

[0141] Furthermore, we found that certain desmosomal proteins were specifically expressed in cells on day 6 of reprogramming, except for desmoglein 2 (Dsg2), which is predominantly expressed in iPSCs (Figures 18A-18C). Most desmosomal proteins are transiently increased during reprogramming and decreased in iPSCs.

[0142] Examples 1-5. Correlation of reprogrammed cells, reprogramming methods, and desmosomes It was found that the programming method and the cell type being reprogrammed did not affect the expression pattern of desmosomal proteins on day 6 of reprogramming.

[0143] To determine whether expression patterns of desmosomal proteins change during the conversion of human bronchial epithelial cells (NHBEs) and prostate epithelial cells (PrECs) to iPSCs, normalized microarray matrices of accession number GSE50206 were obtained from the NCBI Gene Expression Omnibus (GEO) and analyzed using the GEO function in the GEOquery (v.2.58.0) R package.

[0144] Furthermore, to determine whether the expression patterns of desmosomal proteins are altered during the conversion of 2° B cells to iPSCs by treating 2° B cells with OSKM, we analyzed microarray data provided by B. Di Stefano et al., C / EBPalpha poises B cells for rapid reprogramming into induced pluripotent stem cells, Nature 506, 235-239 (2014).

[0145] Analysis of data related to 2° B cell reprogramming revealed transient desmosome component activation during conversion of non-pluripotent 2° B cells to iPSCs (Figure 19A). Furthermore, similar results were obtained during NHBE and PrEC reprogramming (Figure 19B). This indicates that desmosome formation is a key event in the "middle stage" of OSKM-associated reprogramming, and occurs independently of the type of cells being reprogrammed and the reprogramming method.

[0146] Example 1-6. Role of Dsp in reprogramming (I) DSP protein is an essential factor in the formation of mature desmosomes, linking intermediate filaments to desmosomal plaques. To determine whether mature desmosome formation is essential for reprogramming by OSKM, we used β-D-1-thiogalactopyranoside (IPTG)-inducible short hairpin RNA for dsp (shDsp) during iPSCR and iNSCR to inhibit Dsp expression (Figure 20A).

[0147] The pLKO-GFP-IPTG-3xLacO lentiviral vector containing shRNA for mouse Dsp gene (SEQ ID NO: 85: GCCTACAAGAAAGGTCTCATT) was prepared by requesting Sigma-Aldrich. In this case, an off-target shRNA-containing plasmid vector, shCTRL (Sigma Aldrich, SCH332), was used as a control group. The lentiviral vector was produced using HEK 293T cells, and the cells were transfected with the prepared lentiviral vector together with vesicular stomatitis virus coat protein plasmid (pMD2.G; Addgene, Watertown, MA, USA) and packaging plasmid (psPAX2; Addgene) using TransIT-2020 transfection agent (Mirus Bio, Madison, WI, USA). After 8-16 h, the transfected HEK 293T cells were washed with DPBS and then further cultured in MEF medium for another 48 h. After 48 h, culture medium supernatants were harvested and viral supernatants from HEK293T cells were removed by centrifugation and filtration. The harvested viral supernatants were then used to transfect 2° MEFs with 6 μg / mL polybrene (Sigma-Aldrich).

[0148] Transfected 2° MEFs were detached with 0.05% trypsin-EDTA for 5 min, washed with DPBS, then resuspended in FACS buffer (DPBS containing 0.5% BSA) and isolated using a FACSaria cell sorter (BD Biosciences). Selected transfected 2° MEFs were plated at 2 × 10 4 cells / cm 2 For knockdown of the Dsp gene, cells were treated with 1 mM IPTG (Sigma-Aldrich) for 6 days starting from the day after transfection.

[0149] Dsp knockdown (Dsp KD) reduced the efficiency of iPSC generation, with a significant reduction in the number of colonies expressing pluripotency biomarkers (alkaline phosphatase and Nanog) in cells (Figures 20B and 20C). Dsp KD also significantly reduced the number of iNSCs obtained (Figure 20D).

[0150] As a result, as shown in Figure 20, Dsp knockdown reduced gIC formation (Figures 20E and 20F). Therefore, expression of the Dsp gene was confirmed to be an important factor involved in gIC formation. Furthermore, Dsp knockdown was found to disrupt Akt signaling (Figure 21).

[0151] Example 1-7. Role of Dsp in reprogramming (II) During the process of reprogramming human fibroblasts by means of the iPSCR or iNSCR method used in Example 1-1, DSP was overexpressed.

[0152] CRL-2097 (American Type Culture Collection, Manassas, VA, USA), human fibroblasts, were cultured in 24-well plates at 30,000 cells / cm. 2 and inoculated with a Sendai virus (SeV) mixture (CytoTune) according to the manufacturer's manual. TM The cells were transformed with SeV using the iPS 2.0 Sendai reprogramming kit (Thermo Fisher Scientific). The next day, the SeV mixture was washed with DPBS.

[0153] For human iPSC reprogramming, cells were cultured in fibroblast medium (MEM medium (Thermo Fisher Scientific) supplemented with 10% FBS, 1x sodium pyruvate (Thermo Fisher Scientific) and 1x MEM-NEAA) for an additional 2 days. On day 3 after transformation, fibroblast medium was replaced with iPSC reprogramming medium (mTeSR-1 (STEMCELL Technologies, Vancouver, Canada) medium supplemented with 3.0 μM CHIR99021 (Tocris Bioscience, Bristol, UK), 0.5 μM A83-01 (Tokris) and 0.2 mM NaB (Sigma-Aldrich)).

[0154] For human iNSC reprogramming, the SeV mixture was washed with DPBS, and the medium was replaced with human neural reprogramming medium supplemented with 3.0 μM CHIR99021, 0.5 μM A83-01, and 10 ng / mL hLIF (Peprotection), and the human neural reprogramming medium was changed every other day.

[0155] On the fourth day after transformation, the cells were transfected with 1 μg of DSP plasmid (Addgene, Cat. 32227) and empty plasmid (pEGFP-N1; Takara Bio, Shiga, Japan).

[0156] Overexpression of DSP significantly increased the efficiency of iPSC and iNSC production (Figures 22A-22E), indicating that Dsp is a key factor affecting the progression and intermediate stages of reprogramming by OSKM.

[0157] Example 2. Dsp gene expression inhibition experiment (in vivo) Reptiles and fish can regenerate damaged areas of the body by dedifferentiating cells at the damaged site to form a blastema. The blastema is a dedifferentiated multipotent cell population that redifferentiates into lineage-specific cells that constitute the damaged tissue or organ while maintaining the memory of the tissue from which it originated. On the other hand, a transient increase in Oct4, Sox2, Klf4 and c-Myc was observed during the development of blastema cells, so it was expected that the reprogramming in Example 1 and tissue regeneration in reptiles and fish share a common mechanism.

[0158] Therefore, experiments were performed in zebrafish to confirm the role of Dsp genes. Zebrafish (Danio rerio, AB wild type) were acclimated at 28.5°C under standard conditions. Zebrafish were fed dry food and brine shrimp daily and kept on a 14-h light and 10-h dark schedule. Zebrafish husbandry and animal care were performed in accordance with KRIBB guidelines and KRIBB-IACUC approval (Approval No.: KRIBB-AEC-17073, KRIBB-AEC-20056).

[0159] Example 2-1. Confirmation of reduction in blastema cells by inhibition of Dsp gene expression Wild-type zebrafish embryos were maintained at 28.5°C in E3 egg saltwater (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl2, 0.33 mM MgSO4) in a petri dish. One nL of 0.4 mM control morpholino solution (ctrlMO) or 0.4 mM mixed morpholino solution of dspa and dspb (dsp mixed MO) was injected into single-cell eggs. Two-day post-fertilization (dpf) zebrafish larvae were anesthetized with tricaine in the egg saltwater, and then the tail fin was cut with a surgical razor. The same site was cut just posterior to the notochord as the fin cut site. After 21 hours, the fin cut site was fixed, and the blastema cell marker gene junbb gene was confirmed by whole-mount in situ hybridization (WISH).

[0160] Specifically, first, to form an in situ probe, PCR was used to amplify the DNA template for the blastema cell marker gene junbb gene in the cDNA of wild-type zebrafish. The probes used in this example are shown in Table 4 below. [Table 7]

[0161] The PCR products were then isolated and purified on an agarose gel, and the PCR products were TM The dig-labeled antisense probes were in vitro transcribed with SP6 or T7 RNA polymerase kits (Roche) and purified with NucAway spin columns (Thermo Fisher Scientific).

[0162] Adult and larval zebrafish fins for WISH were fixed in 4% paraformaldehyde in 1x PBS and dehydrated using methanol. They were then prepared by storing at -20°C for 30 min and successively rehydrating with 1x PBST solutions. Rehydrated embryos were treated with proteinase K in 1x PBS and then fixed with 4% paraformaldehyde. Antisense probes were hybridized with fixed embryos at each developmental stage in hybridization solution (5mg / mL Torula yeast RNA type VI, 50μg / mL heparin, 50% formamide, 5x SSC, 0.1% Tween-20, pH adjusted to 6.0 using 1M citric acid) overnight at 70°C. The probe was washed successively with 2x SSCT-F (2x SSCT, 50% formamide, 0.1% Tween 20), 2x SSCT (2x SSCT, 0.1% Tween 20), 0.2x SSCT (0.2x SSCT, 0.1% Tween 20) at 70°C and with 1x PBST at room temperature.

[0163] Then, non-specific binding was blocked with blocking solution (5% horse serum, 1x PBST) at room temperature, and alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche) was added to it and reacted overnight at 4°C. NBT / BCIP solution (Roche) was used as alkaline phosphatase (AP) substrate to detect the expression signal of the transcriptome. The expression pattern of the transcriptome was observed using an Olympus SZX16 microscope and imaged with a TUCSEN Dhyana 400DC49. Quantification of WISH was performed according to the AP activity of the fin membrane. For gene expression calculation, the data was pixelated using Photoshop (Adobe Systems Inc., San Jose, CA, USA), and the number of AP-positive (blue) pixels was calculated using Image J software. In this case, Hpf means "hours after fertilization" and Hpa means "hours after cleavage".

[0164] The results showed that junbb marked blastema cells by forming junbb(+) cells at the amputation site when ctrlMO was injected, whereas junbb(+) cell formation was reduced when dsp-mixed MO was injected, thus confirming that inhibition of Dsp gene expression inhibited blastema formation (Fig. 23B).

[0165] Example 2-2. Confirmation of decrease in expression of blastema cell marker genes by inhibition of Dsp gene expression Wild-type zebrafish embryos were maintained in E3 egg saltwater (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl2, 0.33 mM MgSO4) at 28.5°C in a Petri dish. 1 nL of 0.4 mM control morpholino solution (ctrlMO) or 0.4 mM mixed morpholino solution of dspa and dspb (dsp mixed MO) was injected into single-cell eggs. Zebrafish larvae at 2 dpf were anesthetized with tricaine in egg saltwater, and then the caudal fin was cut using a surgical razor. The same site was cut just posterior to the notochord for the fin cut site.

[0166] Zebrafish embryos at each stage were obtained using TRI reagent (Thermo Fisher Scientific), then total RNA was extracted with Direct-zol RNA miniprep kit (Zymo Research, Irvine, CA, USA), and cDNA was synthesized using SuperScript III First-Strand Synthesis System (Thermo Fisher Scientific). The synthesized cDNA was amplified via semi-quantitative PCR using the primers shown in Table 2 above.

[0167] As a result, it was confirmed that the msx1b, fgf20a, her6 and hspd1 genes were expressed in wild-type zebrafish, whereas the expression of these genes was significantly decreased in zebrafish in which the dsp gene was knocked down (Figure 24). Therefore, it was confirmed that the expression of blastema cell marker genes, which are important for fin regeneration in zebrafish, was decreased when the dsp gene was knocked down.

[0168] Example 2-3. Confirmation of decreased fin regeneration ability due to decreased blastema cell formation In Example 2-1, it was confirmed that inhibition of Dsp gene expression reduces blastema cells. Blastoma cells are important cells involved in cell regeneration. To confirm whether the ability of fins to regenerate is reduced by the reduction in blastema cell formation, the regeneration ability of fins was confirmed after inhibition of Dsp gene expression. Caudal fin regeneration experiments were performed on adult zebrafish aged 6 to 9 months. Adult zebrafish were acclimated at 33°C before the experiment. Zebrafish were anesthetized with tricaine before amputation of the caudal fin, and the caudal fin was amputated at seven bony parts distal to the fin girdle. After amputation of the tail, the zebrafish was returned to a 33°C tank. For knockdown of the Dsp gene, the morpholino oligonucleotides (Gene Tools Inc., Philomath, OR, USA, hereafter referred to as morpholino) in Table 5 below were used. [Table 8]

[0169] Each morpholino contains a 3-fluorescein tag and is resuspended in water. The dspa and dspb morpholinos were mixed in a 1:1 ratio to knock down both desmoplakin genes simultaneously. 48 hours after amputation, 1 mM morpholino was injected into each zebrafish tail fin into the dorsal regenerating tissue using a PV380 pneumatic picopump (World Precision Instruments, Sarasota, FL, USA). Each morpholino injection targeted each bone regenerating tissue, injecting approximately 70 nL of morpholino solution.

[0170] Immediately after injection of the morpholino solution, electroporation was performed on both the dorsal and ventral (to control for non-specific electroporation effects) sides of the fin using a NEPA21 Electroporator (Nepa Gene Co., Ltd., Chiba, Japan). In this case, the electroporation parameters used were three consecutive 15V 50msec pulses with 50msec pauses between pulses using a CUY647 15mm diameter platinum clay electrode (Protech International Inc., Cornelius, NC, USA). To increase the efficiency of electroporation, electroporation was performed twice using the same parameters. The zebrafish were then returned to a 33°C aquarium. 72 hours after amputation, each fin was photographed using an Olympus SZX16 microscope equipped with a TUCSEN Dhyana 400DC digital camera.

[0171] The regenerated areas of the dorsal and ventral fins were calculated using Image J software (National Institutes of Health, Bethesda, MD, USA), where the percentage of regeneration was calculated by ((D3dpa-D2dpa) / (v3dpa-V2dpa)) x 100, and the statistical significance of morpholinos on regeneration was analyzed using Student's t-test.

[0172] As a result, as shown in FIG. 23, it was confirmed that when the Dsp gene was knocked down, the fin regeneration ability of zebrafish was reduced.

[0173] Example 3. Identification of pluripotent cells and their characteristics Example 3-1. Identification and analysis of cell aggregates formed during the reprogramming "intermediate phase" On day 6 of reprogramming, cell aggregates formed (FIGS. 5 and 20), and the number of these cell aggregates was reduced when Dsp expression was suppressed (FIGS. 20E and 20F).

[0174] The cells were separated using Accutase (MilliporeSigma, Billerica, MA, United States) for 1 hour to isolate the cells from the plate on day 6 of reprogramming. After separating the supernatant on day 6 of reprogramming, the separated supernatant was centrifuged at 300 × g for 3 minutes and washed with DPBS (WELGENE, Daegu, Korea) to isolate gICs.

[0175] The cell aggregates were stained with antibodies against Dsp and Dsc3 (Fig. 25A and 25B). The analysis revealed that the cell aggregates formed on day 6 of culture were classified into two cell populations by Dsp and Dsc3: "desmosomal component-expressing intermediate cells (dICs)," a cell population in which both Dsp and Dsc3 were expressed, and "granular intermediate cells (gICs)," a cell population that showed a granular morphology without expression of Dsp and Dsc3. The two types of cell populations were observed together in one-cell aggregates, and gICs did not express Dsp, but gICs were not formed during Dsp KD (Fig. 20E, 20F, 25A, and 25B). Furthermore, retrospective tracing of established colonies by iPSC and iNPCR supported the same hierarchical relationship between dICs and gICs (Fig. 26), thus confirming that Dsp expression was a necessary condition for gIC formation.

[0176] Example 3-2. Analysis of dIC and gIC As dICs and gICs were observed on day 6 of reprogramming, cells on day 5 of reprogramming and day 7 of reprogramming were analyzed (Figures 27A and 28B). Although both iPSCRs and iNSCRs showed similar cellular characteristics up to day 6 of reprogramming, Shisa8, a marker of successful MET during iPSC reprogramming, was observed in a subpopulation of cell populations on days 5 and 7 of reprogramming (Figures 27A and 27B). Furthermore, cells considered to be Shisa8+ / Dsp+ by UMAP were dICs, and cells considered to be Shisa8+ / Dsp- by UMAP were gICs (Figures 27B and 27C).

[0177] Indeed, in isolated gICs, Dsp expression remained low, whereas Shisa8 and Cdk1 were highly expressed (FIG. 27E).

[0178] Furthermore, when the iPSC process was resumed after reattachment, gICs easily detached from the culture dish and formed iPSC-like colonies (Figure 27D). Although gICs have the ability to become iPSCs, they hardly expressed pluripotency markers (Nanog, Rex1, and Esrrb), thus confirming that gICs are different cells from iPSCs (Figures 27E and 27C).

[0179] Furthermore, it was confirmed that the Spink2 gene was not expressed in iPSCs, whereas its expression was at a comparable level in gICs (Figure 29). Therefore, it was confirmed that gICs are cells with characteristics different from iPSCs.

[0180] To investigate the lineage correlation between dICs and gICs, we performed Slingshot analysis (K. Street et al., Slingshot: cell lineage and pseudotime inference for single-cell transcriptomics. BMC Genomics 19, 477 (2018)). The analysis revealed that dIC populations (clusters 1, 4, and 8; Shisa8+ / Dsp+) were bifurcated into two trajectories by Shisa8 expression (Figures 27F and 28D). Shisa8-negative pathway cells (clusters 2, 6, 7, and 11) expressed stromal signatures such as MEF identity and senescence, suggesting that these cells were resistant to reprogramming (Figures 27C, 25E, and 28A).

[0181] As Shisa8-positive pathway, dIs in the successful reprogramming pathway were converted to gIC population (clusters 0, 3 and 12; Shisa8+ / Dsp-). Waddington optimal transport (WOT) analysis (analysis method disclosed in G. Schiebinger et al., Optimal-Transport Analysis of Single-Cell Gene Expression Identifies Developmental Trajectories in Reprogramming. Cell 176, 928-943 e922 (2019)) showed the same results, confirming that gICs were derived from dICs (Figures 28E and 28F). Thus, it was confirmed that Shisa8-positive successful reprogramming pathway, Dsp expression is required for the establishment of dICs, and then Dsp expression is reduced to establish gICs.

[0182] Furthermore, when the Akt signaling inhibitor MK2206 was used to disrupt reprogramming, the number of cell aggregates was significantly reduced, but MK2206 was found to have no effect on the self-renewal of iPSCs and iNSCs (Figures 30A-30I). Thus, Dsp-Akt signaling was confirmed to be a specific and essential factor for dIC and gIC production.

[0183] Furthermore, even when MK2206 was used, iPSCs were not established at intermediate phases, and analysis of scRNA-seq data did not detect cells expressing pluripotency genes expressed by iPSCs at intermediate phases, confirming that cell aggregates that may be transiently at intermediate phases in the reprogramming process do not contain iPSCs, as MK2206 does not interfere with iPSC self-renewal.

[0184] As a result, dICs and gICs were confirmed to be essential cells for the progression of cell reprogramming.

[0185] Example 3-3. Real-time PCR analysis gIC-specific marker gene expression analysis was carried out using the real-time PCR analysis used in Example 1-2, and the primers used are shown in Table 1 above.

[0186] As a result, it was confirmed that Shisa3, Foxo4, Ptp4a3, Blvra, Mbnl3, Mthfd2 and Dctpp1 genes were expressed at a significant level in gICs, whereas the expression of these genes was extremely low in iPSCs (Figure 31). Therefore, it was also confirmed that gICs are cells with different characteristics from iPSCs.

[0187] Example 3-4. Differentiation ability of gIC into blastema cells gICs were seeded in ultra-low attachment 96-well plates (Corning Incorporated, Kennebunk, ME, United States) and then cultured in doxycycline-containing RepM-Ini medium for 24-48 h. The gIC aggregates were then transferred to 35 mm Petri dishes and cultured in suspension in doxycycline-free RepM-Ini medium for 7 days. The aggregates were then attached to geltrex-coated culture plates and then cultured for an additional 7 days. Immunofluorescence staining was performed by the immunofluorescence staining method described in Example 1-2 to confirm the differentiation ability of gICs into the three germ layers. In this case, the primary and secondary antibodies used are shown in Table 3 above.

[0188] As a result, as shown in FIG. 32, it was confirmed that gICs could naturally differentiate into various cells constituting the three germ layers without specific differentiation conditions.

[0189] Example 3-5. Conversion of gICs to iPSCs and iNSCs 2 x 10 gICs on geltrex-coated plates 4 cells / cm 2 The cells were seeded at 100°C and cultured in doxycycline-containing RepM-Ini medium for 2 days, after which the culture medium was replaced with doxycycline-containing RepM-PSCs or doxycycline-free RepM-NSCs and cultured for 4 days.

[0190] The cultured cells were then washed once with DPBS. The cells were fixed with 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA, USA) containing 0.15% picric acid (Sigma-Aldrich) for 15 minutes. After that, the cells were washed three times with DPBS, followed by incubation at room temperature for 1 hour in 3% BSA (Thermo Fisher Scientific) containing 0.3% Triton X-100 (Sigma-Aldrich). The cells were treated with primary antibodies diluted in 1% BSA and incubated overnight at 4°C. The next day, the cells were washed three times with DPBS, and then incubated at room temperature for 1 hour with Alexa-594 or Alexa-488-labeled secondary antibodies (Thermo Fisher Scientific). After washing three times with DPBS, fluorescent images were captured using an Axio Vert.A1 microscope (Carl Zeiss, Oberkochen, Germany) and an Evos FL auto 2 imaging system (Thermo Fisher Scientific). In this case, the primary antibodies used are shown in Table 3 above.

[0191] As a result, as shown in Figures 26 and 33, it was confirmed that iPSCs and neural stem cells (iNSCs) were formed from gICs.

[0192] Examples 3 to 6. Carcinogenicity experiments of gIC (in vivo) Mice were reared and cared for in accordance with the KRIBB guidelines and with KRIBB-IACUC approval (Approval No.: KRIBB-AEC-20062).

[0193] To confirm the carcinogenicity of gIC, 5 × 10 3 , 5×10 4 or 2×10 5 gIC and 5 × 10 cells 3 or 5×10 4 The iPSCs were subcutaneously injected into mice with severe combined immune deficiency (Jackson Laboratory, 12 mice in total), which causes obesity and diabetes. The mice were then monitored for 4 to 8 weeks. In this case, tumorigenic iPSCs were used as a positive control.

[0194] As a result, as shown in FIG. 34, in the case of the iPSC-administered mice, tumor formation was confirmed by the naked eye 4 weeks after transplantation. On the other hand, in the case of the gIC-administered mice, tumor formation was confirmed by the naked eye 4 weeks after transplantation. 5 It was confirmed by the naked eye that almost no tumors were formed except in one mouse to which the largest number of cells, iPSCs, was added. Furthermore, as a result of measuring the extent of tumor formation in the mice, in the case of the iPSC-administered mice (D, E), all tumors were formed by the fourth week, while in the case of the iPSC-administered mice (D, E), only 2 × 10 5 In mice receiving gIC of cells (A), only about 20% of tumors formed, with 5 × 10 3 and 5×10 4 No tumors were formed in mice administered gIC of cells (B, C). When the gIC-administered mice were subsequently observed for 8 weeks, approximately 50% of the tumors were 2 × 10 5 observed in mice receiving gIC of cells (A), 5 × 10 4 In mice receiving gIC of cells (B), the percentage was approximately 20%, compared with 5 × 10 3 No tumors were formed in mice that received gIC (C), confirming that gIC are pluripotent cells with significantly lower tumorigenicity than iPSCs.

[0195] Example 4. Tissue regeneration effect of gIC By treating the skin of a wounded mouse model with gIC, it was confirmed whether gIC actually exerted a tissue regenerative effect.

[0196] After intraperitoneal injection of 80 μL of 3% Avatin into one healthy 30-week-old ICR mouse and anesthetizing the mouse, the hair on the back of the spine was shaved with an electric clipper, and two circular wounds with a radius of 5 mm were made at a certain depth to the fascia, one without treatment (control wound) and the other with gIC (experimental wound). In the experimental group, the wound surface was 4.5 × 10 4 Following treatment with gIC, the cross-sectional area of ​​the wounds was determined 3, 6, 13 and 16 days after wounding (i.e., 3 days post-injury (dpi), 6 d.pi, 13 d.pi and 16 d.pi) to determine how well the wounds had healed. For each time period, the area where the circular wound still remains versus the cross-sectional area of ​​the original circular wound (remaining wound ratio) and the wound healing ratio as the remaining wound ratio / wound healing ratio are shown in Table 6 below. [Table 9]

[0197] As shown in Table 6, the wounds treated with gIC showed rapid wound healing effects and significantly excellent effects on skin tissue regeneration, confirming that gIC has excellent effects on tissue regeneration.

Claims

1. A method for converting non-pluripotent cells into pluripotent cells, comprising: inducing non-pluripotent cells to express reprogramming factors, thereby overexpressing desmosome-related genes or epithelial cell differentiation-related genes; A method comprising the steps of:

2. The method according to claim 1, further comprising overexpression and subsequent decrease of desmosome-related genes or epithelial cell differentiation-related genes.

3. (i) The reprogramming factor is one or more factors selected from the group consisting of Oct4, Sox2, Klf4, and c-Myc, and / or The method according to claim 1, wherein (ii) the desmosome-related gene or the epithelial cell differentiation-related gene is at least one gene selected from the group consisting of Dsg3, Dsg4, Dsp, Evpl, Jup, Perp, and Pkp1.

4. The method according to claim 1, comprising restricting the expression of reprogramming factors.

5. The method according to claim 1, wherein inducing non-pluripotent cells to express reprogramming factors is achieved by introducing a gene encoding the reprogramming factor into the non-pluripotent cells or treating the non-pluripotent cells with the reprogramming factor by an external method.

6. The method according to claim 1, wherein the reprogramming factors are Oct4, Sox2, Klf4, and c-Myc.

7. The method according to claim 2, wherein the expression of desmosome-related genes or epithelial cell differentiation-related genes decreases.

8. The method according to claim 2, wherein the method for converting non-pluripotent cells into pluripotent cells further comprises isolating cells during a period when desmosome-related genes or epithelial cell differentiation-related genes rapidly decrease.

9. Pluripotent cells produced by the method for converting non-pluripotent cells into pluripotent cells according to claim 1.

10. The pluripotent cells are characterized in that: The pluripotent cells show a decrease in the expression of at least one gene selected from the group consisting of Nanog, Rex1, and Esrrb as compared to the corresponding genes in induced pluripotent stem cells (iPSCs), Can differentiate into cells constituting ectoderm, mesoderm, or endoderm, and / or The pluripotent cells according to claim 9, which have a reduced carcinogenicity as compared to iPSCs.

11. The pluripotent cells according to claim 10, wherein at least one gene selected from the group consisting of Nanog, Rex1, and Esrrb shows a decrease in expression of at least 10-fold as compared to the corresponding genes in iPSCs.

12. The pluripotent cell according to claim 9, wherein the expression of Spink2 is increased by at least 10-fold compared to iPSCs, or further expresses at least one marker gene selected from the group consisting of Shisa3, Foxo4, Ptp4a3, Blvra, Mbnl3, Mthfd2, and Dctpp1.

13. The expression of Dsp and Dsc3 is decreased; or The expression level of the Spink2 gene is higher than the expression level of the gene in iPSCs; and The expression level of at least one gene selected from the group consisting of Nanog, Rex1, and Esrrb is decreased compared to the expression level of the corresponding gene in iPSCs, Cell.

14. A method for producing a cell, comprising inducing the differentiation of the pluripotent cell according to any one of claims 9 to 13.

15. A composition for use in cell transplantation or biological tissue regeneration, comprising, as an active ingredient: The pluripotent cell according to any one of claims 9 to 13; or A cell produced by a method for producing a cell, comprising inducing the differentiation of the pluripotent cell according to any one of claims 9 to 13 Comprising a composition.