Primer sets, reagent compositions and methods for the detection of Neisseria meningitidis
Patent Information
- Application Number
- JP2024500678
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-07-07
- Filing Date
- 2022-07-07
- Publication Date
- 2025-07-09
AI Technical Summary
Current diagnostic methods for Neisseria meningitidis, such as real-time PCR, are labor-intensive, time-consuming, and require specialized equipment, making them unsuitable for point-of-care testing, and existing LAMP methods have high detection limits and long analysis times.
A refined primer set for LAMP targeting the FrpA gene of Neisseria meningitidis, combined with fluorescent markers, allows for rapid detection of as few as 5 copies of the bacterium within 15 minutes, suitable for point-of-care testing and using portable genetic analyzers.
The method achieves rapid, sensitive, and quantitative detection of Neisseria meningitidis with low detection limits, enabling prompt diagnosis and treatment, reducing the risk of complications and mortality.
Smart Images

Figure 00000013_0000 
Figure 00000013_0001 
Figure 00000013_0002
Abstract
Description
[Technical field]
[0001] The present invention relates to a set of primers for detecting Neisseria meningitidis (NM), a method for detecting Neisseria meningitidis using the set of primers, and the use of the set of primers for detecting Neisseria meningitidis. The present invention is applicable to medical diagnostics. [Background technology]
[0002] Neisseria meningitidis is a gram-negative bacterium. It is aerobic and has a diplococcal morphology. The bacterium has the ability to grow on a variety of agar media, including blood agar, trypticase soy agar, chocolate agar, or Mueller-Hinton agar. At least 13 different groups of Neisseria meningitidis are known, constituting serotypes. Six serotypes, A, B, C, W-135, X, and Y, are pathogenic to humans and cause life-threatening diseases such as meningitis and septicemia, as well as life-threatening organ dysfunction caused by an abnormal systemic response to infection.
[0003] Approximately 1.2 million cases of meningococcal infection are diagnosed worldwide each year, with an estimated annual mortality rate of approximately 135,000. Furthermore, meningococcal infections are characterized by a relatively high risk of developing many complications, such as hearing loss, cognitive impairment, or impaired muscular and neurological motor activity.
[0004] Because meningococcal infections are life-threatening, it is important that the diagnosis is rapid and that the diagnostic method is characterized by high sensitivity and specificity.
[0005] Laboratory diagnosis of meningococci is mainly based on detection of the bacteria in nasopharyngeal swabs (the most common reservoir in carriers) and in blood or cerebrospinal fluid taken from patients presenting with symptoms of systemic infection or encephalitis. Possible methods for detection of meningococci are bacterial culture or genetic tests, such as real-time PCR, which is the most commonly used. Despite their high sensitivity and specificity, meningococcal bacterial culture-based assays are labor-intensive and time-consuming tests, taking an average of 24 to 48 hours to confirm infection.
[0006] The methods characterized by the greatest specificity and sensitivity are those that involve the detection of meningococcal nucleic acids in a biological sample (so-called NAAT methods - nucleic acid amplification tests). The most commonly used NAAT tests are assays based on real-time PCR. Many tests using real-time PCR technology are commercially available, but despite the tough competition, these methods are still relatively expensive. Moreover, they require highly specialized personnel, expensive equipment and require the isolation of genetic material from the patient's sample. In addition, the need for repeated heating and cooling of the reaction mixture makes the method relatively time-consuming and the equipment used consumes relatively large amounts of energy for this diagnostic process.
[0007] Isothermal methods, including the LAMP (Loop-mediated isothermal amplification) technology, are methods that can accelerate the diagnostic process and reduce the costs of energy and reagents required to carry out the analysis. Moreover, according to literature data, these methods are characterized by higher sensitivity and specificity than the aforementioned real-time PCR technology and are much faster. Their isothermal course does not require special equipment.
[0008] The isothermal method requires less equipment and is therefore an ideal diagnostic solution for primary care units (POCT: Point-of-Care Testing), where the test can be performed by a general practitioner or specialist at the first patient-physician contact. This solution allows a rapid diagnostic test (within 15 minutes) and allows the selection of a targeted therapy at the first consultation. This is particularly important in the case of meningococcal infection, since the infection progresses rapidly and quickly becomes life-threatening within a short time. A delayed diagnosis of NM infection not only increases the patient's risk of death, but also the risk of developing severe complications. Furthermore, a rapid diagnosis and early initiation of treatment increases the chances of survival and minimizes the risk of long-term complications. On the other hand, the use of lyophilized reagents means that diagnostic test samples do not need to be frozen and can be stored at room temperature.
[0009] The use of primers in the LAMP method for the diagnosis of meningococcus is known from previously published patent applications: CN110656192A; US20130252248A1; WO2014077417A1. LAMP methods are disclosed, for example, in patent specifications WO0028082, WO0224902. In the above mentioned patent disclosures, the detection limit of the method is higher, about 100 copies. Some patent applications are based on end-point detection using agarose gel electrophoresis or detection of the end product of the reaction by turbidity measurement. Moreover, in the mentioned patent applications, the analysis time and the time to wait for a positive result is about 60 minutes. Moreover, most of the above kits developed are not applicable for POCT diagnosis and their main application is for laboratories. DISCLOSURE OF THEINVENTION
[0010] Therefore, there remains a need to provide a diagnostic method that can appropriately refine the primer sets used for the diagnosis of Neisseria meningitidis (all pathogenic serotypes) by the LAMP method intended for use in clinical point-of-care immediate testing, and detect the bacteria in a short time (≦15 min) and with a very low detection limit (≧5 copies / reaction). Unexpectedly, the above problem has been solved by the present invention. By using fluorescent markers, the detection limit could be significantly lowered (≧5 copies). Furthermore, the use of fluorescent dyes allows the detection of reaction products in real-time technology, significantly shortening the reaction time (≦15 min) and allowing quantitative measurement of pathogens.
[0011] A first subject of the invention is a primer set for amplifying a nucleotide sequence of the FrpA (iron regulatory protein) gene of Neisseria meningitidis, comprising a set of internal primers specific for a selected fragment of the iron regulatory protein (FrpA) gene of Neisseria meningitidis having the following nucleotide sequences a) and b) and a set of external primers comprising the following nucleotide sequences c) and d): a) 5'CGAGCGTATCATTGCCATTGCC3' (the nucleic acid sequence of SEQ ID NO: 3 or its reverse and complementary sequences), linked from the 3' end, preferably by a TTTT bridge, to the sequence 5'CGGGGATGACCTGCTGAA3' (the nucleic acid sequence of SEQ ID NO: 4 or its reverse and complementary sequences); b) 5'ACGACGCCCTGTACGGCTATA3' (the nucleic acid sequence of SEQ ID NO:5 or its reverse and complementary sequences), linked from the 3' end, preferably by a TTTT bridge, to the sequence 5'TACCGTCTTCGCCGTTCAA3' (the nucleic acid sequence of SEQ ID NO:6 or its reverse and complementary sequences). c) the nucleic acid sequence 5'GGGCGATGACTATCTGTACG3' of SEQ ID NO: 1 or its reverse and complementary sequences, and d) the nucleic acid sequence SEQ ID NO: 2, 5'CACCGCCGATTAGAGTGTC3' or its reverse and complementary sequences The present invention is characterized by comprising:
[0012] In a preferred embodiment of the invention, the primer set comprises a set of loop primer sequences comprising SEQ ID NO:7-5'TACTGTCGTTGCCTGCATCACC3' and SEQ ID NO:8: 5'GGTAACGATGTACTGAATGGTGG3' or their reverse and complementary sequences, which are nucleic acid sequences contained in or complementary to the FrpA gene of Neisseria meningitidis.
[0013] A second subject of the present invention is a method for detecting Neisseria meningitidis, characterized in that a selected region of the nucleotide sequence of the Neisseria meningitidis genome (a fragment of the gene for the iron regulatory protein FrpA) is amplified using a primer set as defined in the first subject of the present invention, the amplification method being the LAMP method.
[0014] In a preferred embodiment, the amplification is carried out with the following temperature profile: 68° C., 40 minutes.
[0015] In a further preferred embodiment of the invention, the end-point reaction is carried out after the amplification step with a temperature profile of 80° C. for 5 minutes.
[0016] A third subject of the invention is a method for detecting an infection caused by Neisseria meningitidis, characterized in that it comprises a detection method as defined in the second subject of the invention.
[0017] A fourth subject of the invention is a kit for detecting an infection caused by Neisseria meningitidis, characterized in that it comprises a set of primers as defined in the first subject of the invention.
[0018] In a preferred embodiment of the present invention, the infection detection kit comprises 5.0 μl of WarmStart LAMP Master Mix.
[0019] In a further preferred embodiment of the invention, the individual amplification primers as defined in the first subject of the invention are used, the primers having the following concentrations: 0.13 μM F3, 0.13 μM B3, 1.06 μM FIP, 1.06 μM BIP, 0.26 μM Loop F, 0.26 μM Loop B; D-(+)-Trehalose dihydrate-6%; Mannitol-1.25%; a fluorescent marker that interacts with double-stranded DNA-EvaGreen≦1X (Biotium) or a fluorescent dye in a volume of ≦1 μl (New England Biolabs) or Syto-13≦16 μM (ThermoFisher Scientific) or SYTO-82≦16 μM (ThermoFisher Scientific) or another fluorescent dye that interacts with double-stranded DNA in a concentration that does not inhibit the amplification reaction.
[0020] The advantage of the primer set for detecting meningococcus of the present invention as well as the method for detecting meningococcal infection and the method for detecting the amplification product is their possible use in medical diagnostics at the point of care (POCT) in targeted applications using portable genetic analyzers. Lyophilization of the reaction mixture of the present invention allows the diagnostic kit to be stored at room temperature without compromising the diagnostic parameters of the test. Furthermore, the use of fluorescent dyes to detect the amplification product increases the sensitivity of the test method, allowing the detection limit to be reduced (down to 5 genome copies / reaction) while still allowing quantitative measurement of bacteria in the test sample.
[0021] Exemplary embodiments of the invention are illustrated in the drawings. [Brief description of the drawings]
[0022] [Figure 1]Figure 1 shows the sensitivity characteristic of the method, with template: Neisseria meningitidis quantitative DNA (ATCC® 700532DQ™) giving a specific signal in the range of 1000-5 copies / μl, whereas no product was seen with NTC. (Figure 1: Lane 1: molecular weight marker (Quick-Load® Purple 100 bp DNA ladder, New England Biolabs); Lane 2: 1000 copies NM; Lane 3: 100 copies NM; Lane 4: 50 copies NM; Lane 5: 25 copies NM; Lane 6: 20 copies NM; Lane 7: 10 copies NM; Lane 8: 5 copies NM; Lane 9: NTC). [Diagram 2] Figure 2 shows the sensitivity of the method of the invention as measured by testing serial dilutions of Neisseria meningitidis quantitative DNA (ATCC® 700532DQ™) standard at 1000-5 copies / DNA standard reaction, with the amplification product measured in real time. The results of real-time Neisseria meningitidis detection are shown in Table 1, indicating the minimum time required to detect a fluorescent signal. [Diagram 3] FIG. 3 shows the specificity of the products obtained after detection of N. meningitidis as measured by melting curves of the amplification products using N. meningitidis Quantitative DNA (ATCC® 700532DQ™) standard at 1000-5 copies / reaction, with the specific reaction products measured by real-time fluorescence measurements at a target melting temperature (Tm) of 88.5° C. [Figure 4-5]Figures 4 and 5 show the specificity of the method of the invention using a standard matrix of numerous pathogens potentially present in the test biological material as natural physiological flora, pathogens that may result from co-infections, or pathogens that share similar genomic sequences; Figure 4: Lane 1: molecular weight marker (Quick-Load® Purple 100 bp DNA ladder, New England Biolabs); Lanes 2 and 3: Methicillin-sensitive Staphylococcus aureus (MSSA); Lanes 4 and 5: Pseudomonas aeruginosa; Lanes 6 and 7: Borrelia afzelii; Lanes 8 and 9: Influenza B virus; Lanes 10 and 11: Moraxella catarrhalis; Lanes 12 and 13: Campylobacter jejuni. jejuni; lanes 14 and 15: influenza A H1N1 virus; lanes 16 and 17: Acinetobacter baumannii; lanes 18 and 19: HBV; lanes 20 and 21: influenza A H3N2 virus; lanes 22 and 23: Listeria monocytogenes; lanes 24 and 25: HHV-1; lanes 26 and 27: Borrelia burgdorferi; lanes 28 and 29: Legionella pneumoniae; lanes 30 and 31: Homo sapiens; lanes 32 and 33: Klebsiella pneumoniae; lanes 34 and 35: Haemophilus ducreyi; lanes 36 and 37: Bordetella pertussis pertussis); lanes 38 and 39: HHV-5; lanes 40 and 41: Neisseria gonorrhoeae; lanes 42 and 43: Lactobacillus gasseri; lanes 44, 45: Streptococcus pyogenes;46, 47: Lactobacillus jensenii; 48, 49: Methicillin-resistant Staphylococcus aureus (MRSA); 50, 51: Bacteroides fragilis; 52, 53: Enterococcus faecalis; 54, 55: Escherichia coli; 56, 57: Enterococcus faecium; 58, 59: Mobiluncus Mulieris; Figure 5: Lane 1: molecular weight marker (Quick-Load® Purple 100bp DNA ladder, New England Biolabs); Lanes 2 and 3: Neisseria meningitidis; Lanes 4, 5: NTC; in order; [Figure 6] Figure 6 shows the specificity of the method for the other serotypes pathogenic to humans, A, C and E. The method detects all serotypes tested, including those responsible for infections caused by Neisseria meningitidis, especially those with a life-threatening course; Figure 6: Lane 1: molecular weight marker (Quick-Load® Purple 100bp DNA ladder, New England Biolabs); Lanes 2 and 3: Neisseria meningitidis serotype C; Lanes 4 and 5: Neisseria meningitidis serotype E; Lanes 6 and 7: Neisseria meningitidis serotype A; Lanes 8 and 9: Neisseria meningitidis serotype C; Lanes 10 and 11: NTC. EXAMPLES
[0023] Example 1. Primer sequences The sequences of the specific oligonucleotides used for detection of meningococcal genetic material using the LAMP technique are presented and characterized below.
[0024] 1. NM FrpAF3 oligonucleotide sequence: 5'GGGCGATGACTATCTGTACG3' is a sequence identical to the meningococcal FrpA gene (5'-3' strand). 2. NM FrpAB3 oligonucleotide sequence: 5'CACCGCCGATTAGAGTGTC3' is the complementary fragment of the FrpA gene (5'-3' strand) of Neisseria meningitidis located 176 nucleotides from the 3' end of oligonucleotide 1. 3. NM Frp1F2 oligonucleotide sequence: 5'CGGGGATGACCTGCTGAA3' is a sequence identical to the FrpA gene of Neisseria meningitidis (5'-3' strand) 7 nucleotides away from the 3' end of oligonucleotide 1. 4. NM FrpAB2 oligonucleotide sequence: 5'TACCGTCTTCGCCGTTCAA3' is the complementary fragment of the FrpA gene (5'-3' strand) of Neisseria meningitidis located 155 nucleotides from the 3' end of oligonucleotide 1. 5. NM FrpAF1c oligonucleotide sequence: 5'CGAGCGTATCATTGCCATTGCC3' is the complementary fragment of the FrpA gene (5'-3' strand) of Neisseria meningitidis 56 nucleotides away from the 3' end of oligonucleotide 1. 6. NM FrpAB1c oligonucleotide sequence: 5'ACGACGCCCTGTACGGCTATA3' is a sequence identical to the FrpA gene of Neisseria meningitidis (5'-3' strand) 93 nucleotides away from the 3' end of oligonucleotide 1. 7. NM FrpA Loop F oligonucleotide sequence: 5'TACTGTCGTTGCCTGCATCACC3'. 8.NM FrpA Loop B oligonucleotide sequence: 5'GGTAACGATGTACTGAATGGTGG3'.
[0025] The sequences of the F1c and F2 oligonucleotides are preferably linked by a TTTT bridge and used as an FIP. The sequences of the B1c and B2 oligonucleotides are preferably linked by a TTTT bridge and used as an BIP.
[0026] Example 2 The oligonucleotides characterized in Example 1 were synthesized using the LAMP technique and a reaction mixture of the following composition: 5.0μl WarmStart LAMP 2X Master Mix 0.13μM F3 0.13μM B3 1.06μM FIP 1.06μM BIP 0.26μM Loop F 0.26μM Loop B D-(+)-Trehalose dihydrate-6% Mannitol-1.25%
[0027] Fluorescent marker that interacts with double-stranded DNA - EvaGreen (Biotium) ≤ 1X or Fluorescent dye 50X (New England Biolabs) in a volume of ≤ 1 μl or Green fluorescent dye (Lucigen) in a volume of ≤ 1 μl or Syto-13 ≤ 16 μM or SYTO-82 ≤ 16 μM or another fluorescent dye that interacts with double-stranded DNA at a concentration that does not inhibit the amplification reaction. DNA template ≥ 5 copies / reaction A method for amplifying the FrpA gene of Neisseria meningitidis using
[0028] The total reaction volume was adjusted to 10 μl with DNase- and RNase-free water.
[0029] Example 3 The oligonucleotides characterized in Examples 1 and 2 were used with the LAMP technique and the composition of the reaction mixture characterized in Example 3, following the following temperature profile: 1) 68℃, 40 minutes 2) Preferably, for the end point reaction, 80°C, 5 min. A method for amplifying the FrpA gene of Neisseria meningitidis using
[0030] Example 4 A method for the amplification and detection of the FrpA gene of Neisseria meningitidis using the oligonucleotides characterized in Examples 1 and 2, together with the LAMP technique and the composition of the reaction mixture characterized in Example 2, with the temperature profile characterized in Example 3 and the detection method described below.
[0031] Fluorescent dyes capable of interacting with double-stranded DNA are used, and 0.5 μl EvaGreen 20X; 0.5 μl or ≦1X concentration; ≦16 μM green fluorescent dye (Lucigen); SYTO-13 and SYTO-82 are added to the reaction mixture before initiating the reaction, before real-time measurements and / or before end-point measurements, respectively. EvaGreen; fluorescent dye 50X (New England Biolabs), green fluorescent dye (Lucigen); excitation wavelength in the same range as FAM dye for SYTO-13 dye - 490 to 500 nm (optimum 494 nm) and for SYTO-82 dye 535 nm (optimum 541 nm); EvaGreen; green fluorescent dye (Lucigen); emission wavelength in the range 509 to 530 nm (optimum 518 nm) for SYTO-13 dye and 556 nm (optimum 560 nm) for SYTO-82 dye; detection method, change recording time starting 15 minutes after the start of the meningococcal and negative control reactions.
[0032] Example 5 A method for preparation and lyophilization of reagents for detecting the amplification and detection of the FrpA gene of Neisseria meningitidis using the oligonucleotides characterized in Examples 1 and 2, with the LAMP technique and the composition of the reaction mixture characterized in Example 2, with the temperature profile characterized in Example 3 and the detection method characterized in Example 4.
[0033] Example 6. Description of the freeze-drying process The template DNA was removed and the reaction components were mixed to a total volume of 10 μl according to the composition described in Example 2. The mixture was transferred to a 0.2 ml test tube and a lyophilization step was carried out according to the following parameters:
[0034] The mixture in the test tube was precooled to -80°C for 2 hours. Then, the freeze-drying process was repeated for 5 minutes. -2 The reaction was carried out at a pressure of 100 mBar and at a temperature of -80°C for 3 hours.
[0035] Example 7. Sensitivity of the method Sensitivity was determined by assaying serial dilutions of Neisseria meningitidis quantitative DNA (ATCC® 700532DQ™) standard with a minimum of 5 copies of bacteria per reaction mixture and product amplification was measured in real time - Figure 2 (real-time LAMP of serial dilutions) with recording of the dissociation temperature of 88.5°C (Figure 3).
[0036] The time required to detect the emission fluorescence of each sample is shown in Table 1.
[0037] The characterized primers allow for the detection of N. meningitidis by detecting the FrpA gene fragment with a minimum of 5 copies per reaction mixture.
[0038] [Table 1]
[0039] Example 8. Specificity of the method The advantages of the amplification method and oligonucleotides described herein over tests based on real-time LAMP technology are due to the much higher sensitivity shown in FIG. 1 and the reduced analysis time shown in FIG. 2.
[0040] Sequence Listing [Table 2] JPEG2024526317000003.jpg232161 JPEG2024526317000004.jpg227162 JPEG2024526317000005.jpg224161 JPEG2024526317000006.jpg31160
Claims
**Claim 1** A set of primers for amplifying the nucleotide sequence of the FrpA gene of Neisseria meningitidis, comprising a set of internal primers having the following nucleotide sequences a) and b), and a set of external primers comprising the following nucleotide sequences c) and d): a) 5′CGAGCGTATCATTCGCCATTGCC3′ (the nucleic acid sequence of SEQ ID NO: 3 or its reverse and complementary sequence), linked from the 3′ end, preferably by a TTTT bridge, to the sequence 5′CGGGGGATGACCTGCTGAA3′ (the nucleic acid sequence of SEQ ID NO: 4 or its reverse and complementary sequence); b) 5′ACGACGCCCCGTACGGCTATA3′ (the nucleic acid sequence of SEQ ID NO: 5 or its reverse and complementary sequence), linked from the 3′ end, preferably by a TTTT bridge, to the sequence 5′TACCGTCTTCGCCGTTCA A3′ (the nucleic acid sequence of SEQ ID NO: 6 or its reverse and complementary sequence); c) the nucleic acid sequence 5′GGGCGATGACTATCTGTACG3′ of SEQ ID NO: 1 or its reverse and complementary sequence, and d) the nucleic acid sequence 5′CACC GCCCGA TTAGAGTGT C3′ of SEQ ID NO: 2 or its reverse and complementary sequence A set of primers, characterized by comprising the above. **Claim 2** The set of primers according to claim 1, comprising a loop primer sequence set comprising the nucleic acid sequence contained in the FrpA gene of Neisseria meningitidis or a nucleic acid sequence complementary thereto, SEQ ID NO: 7 - 5′TACTGT CGT TGCCTGCATCACC3′ and SEQ ID NO: 8: 5′GGTAACGATGTACTGAATGG TGG3′, or their reverse and complementary sequences. **Claim 3** A method for detecting Neisseria meningitidis, wherein a selected region of the nucleic acid sequence of the bacterial genome is amplified using the set of primers defined in claim 1 or 2, and the amplification method is the LAMP method. **Claim 4** The method for detecting bacteria according to claim 3, wherein the amplification is performed at a temperature profile of 68°C for 40 minutes. **Claim 5** The method according to claim 4, wherein the end point reaction is performed at a temperature profile of 80°C for 5 minutes after the amplification stage. **Claim 6** A method for detecting an infection caused by Neisseria meningitidis, comprising the detection method defined in claim 3. **Claim 7** A kit for detecting an infection caused by Neisseria meningitidis, comprising the set of primers defined in claim 1 or 2. **Claim 8** A kit for detecting infection according to claim 7, comprising 5.0 μl of WarmStart LAMP master mix (NEB). **Claim 9** The primer has the following concentrations: 0.13 μM F3, 0.13 μM B3, 1.06 μM FIP, 1.06 μM BIP, 0.26 μM loop F, 0.26 μM loop B; comprising D-(+)-trehalose dihydrate - 6%; comprising mannitol - 1.25%; a fluorescent marker interacting with double-stranded DNA - EvaGreen (Biotium) ≤ 1X, or a fluorescent dye (New England Biolabs) in an amount ≤ 0.5 μl, or a green fluorescent dye (Lucigen) in an amount ≤ 1 μl, or SYTO-13 (ThermoFisher Scientific) ≤ 16 μM, or SYTO-82 (ThermoFisher Scientific) ≤ 16 μM, or another fluorescent dye interacting with double-stranded DNA at a concentration that does not inhibit the amplification reaction, a kit for detecting infection according to claim 7.