Double-stranded oligonucleotides, compositions and complexes containing double-stranded oligonucleotides, and methods of preparation and use

Abstract

The present invention provides a double-stranded oligonucleotide capable of regulating the expression level of a target gene. The double-stranded oligonucleotide includes a sense strand and an antisense strand, and the sense strand and the antisense strand each include a nucleotide sequence I or a nucleotide sequence II consisting of 19 modified or unmodified nucleotides, and the nucleotide sequence I and the nucleotide sequence II form a double-stranded region at least partially in a reverse complementary manner, and the nucleotide sequence II is at least partially reverse complementary to one nucleotide sequence in an mRNA expressed by a target gene, and from the 5' end to the 3' end, at least one of the nucleotides at positions 3 to 6 of the nucleotide sequence II is a stabilizing modified nucleotide, and none of the nucleotides other than the nucleotides at positions 3 to 9 of the nucleotide sequence II is a stabilizing modified nucleotide. The provided double-stranded oligonucleotide, the pharmaceutical composition and the complex containing the double-stranded oligonucleotide can effectively treat and / or prevent a disease or symptom associated with the expression of a target gene, and reduce off-target effects.

Description

[Technical field]

[0001] The present disclosure relates to double-stranded oligonucleotides that reduce off-target effects, pharmaceutical compositions and oligonucleotide conjugates that include the double-stranded oligonucleotides. The present disclosure further relates to methods for preparing and using these double-stranded oligonucleotides, pharmaceutical compositions and oligonucleotide conjugates. [Background technology]

[0002] Double-stranded oligonucleotides are known as active pharmaceutical ingredients. In recent years, there has been considerable progress in the development of double-stranded oligonucleotide drugs.

[0003] In the development and research of double-stranded oligonucleotide drugs, one of the important side effects and thus toxic effects is off-target effect. On the one hand, in this field, efforts have been made to develop and synthesize double-stranded oligonucleotides that have good pharmaceutical activity and low off-target effect at the same time, but how to obtain double-stranded oligonucleotides that meet both demands still needs to be explored in this field more deeply. On the other hand, the double-stranded oligonucleotides that show excellent pharmaceutical activity in many preclinical pharmaceutical studies are difficult to use in actual drug research and development due to the toxicity caused by their off-target effect, so there is still a significant practical demand in this field for how to reduce the off-target effect of double-stranded oligonucleotides. Summary of the Invention [Problem to be solved by the invention]

[0004] In order to develop a double-stranded oligonucleotide that has good pharmaceutical activity and shows reduced off-target effect, and to develop a method for reducing the off-target effect of double-stranded oligonucleotide, the present inventors have conducted repeated research and experiments, and unexpectedly found that a double-stranded oligonucleotide that has a stabilizing modified nucleotide at a specific position in the sequence basically retains pharmaceutical activity and has a significantly lower off-target effect than a double-stranded oligonucleotide that does not have a modification at the corresponding position.Therefore, the present inventors have made the following invention. [Means for solving the problem]

[0005] In one embodiment, the present disclosure provides a double-stranded oligonucleotide, the double-stranded oligonucleotide comprising a sense strand and an antisense strand, the sense strand comprising a nucleotide sequence I, the antisense strand comprising a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II each consisting of 19 nucleotides, each nucleotide in the nucleotide sequence I and the nucleotide sequence II being a modified or unmodified nucleotide, the nucleotide sequence I and the nucleotide sequence II at least partially reverse-complementarily forming a double-stranded region, the nucleotide sequence II being at least partially reverse-complementary to a first nucleotide sequence, the first nucleotide sequence being a double-stranded region consisting of a nucleotide sequence having a length of 19 nucleotides in an mRNA expressed by a gene of interest. a nucleotide sequence in which the nucleotide sequence II is a stabilizing modified nucleotide, wherein, from the 5' end to the 3' end, at least one of the nucleotides at positions 3 to 6 of the nucleotide sequence II is a stabilizing modified nucleotide, and none of the nucleotides other than the nucleotides at positions 3 to 9 of the nucleotide sequence II is a stabilizing modified nucleotide, and the stabilizing modified nucleotide refers to a nucleotide in which the hydroxyl at the 2' position of the ribose of a nucleotide is replaced with a stabilizing modified group, and compared with a double-stranded oligonucleotide in which the nucleotide at the corresponding position is an unmodified nucleotide, a double-stranded oligonucleotide containing the stabilizing modified nucleotide has increased thermal stability and the steric hindrance of the stabilizing modified group is greater than that of 2'-O-methyl.

[0006] In another aspect, the present disclosure provides a double-stranded oligonucleotide, the double-stranded oligonucleotide comprising a sense strand and an antisense strand, each nucleotide of the sense strand and the antisense strand being a modified nucleotide, the sense strand comprising a nucleotide sequence I, the antisense strand comprising a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II each consisting of 19 nucleotides, the nucleotide sequence I and the nucleotide sequence II at least partially reverse-complementing each other to form a double-stranded region, the nucleotide sequence II being at least partially reverse-complementing each other to a first nucleotide sequence, the first nucleotide sequence being a nucleotide sequence having a length of 19 nucleotides in an mRNA expressed by a gene of interest. from the 5' to the 3' end, nucleotides at positions 7-9 of nucleotide sequence I are fluoro-modified nucleotides and each of the other nucleotides in nucleotide sequence I is independently one of non-fluoro-modified nucleotides; from the 5' to the 3' end, nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence II are fluoro-modified nucleotides and each of the other nucleotides in nucleotide sequence II is independently one of non-fluoro-modified nucleotides; and from the 5' to the 3' end, the nucleotides at positions 3 and / or 5 of nucleotide sequence II are 2'-O-methoxyethyl-modified nucleotides.

[0007] In yet another aspect, the present disclosure further provides a pharmaceutical composition, comprising a double-stranded oligonucleotide provided by the present disclosure and a pharma- ceutically acceptable carrier.

[0008] In yet another aspect, the present disclosure further provides an oligonucleotide conjugate, the oligonucleotide conjugate comprising a double-stranded oligonucleotide provided by the present disclosure and a conjugated group conjugated to the double-stranded oligonucleotide, the conjugated group comprising a linker and a pharma- ceutically acceptable targeting group and / or delivery aid group, the double-stranded oligonucleotide, the linker and the targeting group or the delivery aid group are in turn covalently or non-covalently linked, each of the targeting groups is selected from a ligand capable of binding to a cell surface receptor, and each of the delivery aid groups is selected from a group capable of improving the biocompatibility of the oligonucleotide conjugate in a delivery destination organ or tissue.

[0009] In yet another aspect, the present disclosure further provides the use of the double-stranded oligonucleotide, pharmaceutical composition and / or oligonucleotide complex of the present disclosure in the preparation of a medicament for treating and / or preventing a disease or condition associated with the mRNA level expressed by a gene of interest.

[0010] In yet another aspect, the present disclosure further provides a method for treating and / or preventing a disease or condition associated with the level of mRNA expressed by a gene of interest, comprising administering to a subject in need thereof a double-stranded oligonucleotide, pharmaceutical composition and / or oligonucleotide complex of the present disclosure.

[0011] In yet another aspect, the present disclosure further provides a method for modulating the expression level of a gene of interest in a cell, the method comprising contacting the cell with an effective amount of a double-stranded oligonucleotide, pharmaceutical composition and / or oligonucleotide complex of the present disclosure.

[0012] The present disclosure also provides a kit, the kit comprising the double-stranded oligonucleotide, pharmaceutical composition and / or oligonucleotide complex of the present disclosure.

[0013] [Incorporation by reference] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. Effect of the Invention

[0014] The double-stranded oligonucleotide, pharmaceutical composition and / or oligonucleotide complex of the present disclosure have good stability, high target gene expression regulating activity, and low off-target effect. The following is a detailed description.

[0015] First, the double-stranded oligonucleotide, pharmaceutical composition and / or oligonucleotide complex of the present disclosure can have lower off-target effects and / or toxic reactions due to off-target effects in vitro or in vivo. For example, the siRNA provided by the present disclosure always showed a suppression rate of 25% or less against the off-target sequence in an in vitro siCHECK system, and showed significantly lower off-target effects compared to a reference siRNA that does not contain a stabilized modified nucleotide. Also, for example, in the case of rats, the rats administered the siRNA complex of the present disclosure at a dose of 30 mg / kg showed almost no increase in liver weight, and showed clearly lower toxic reactions in terms of hepatic steatosis and inflammation than the reference siRNA complex. Also, for example, the siRNA complex provided by the present disclosure always showed a suppression rate of 25% or less against the off-target sequence in an in vitro siCHECK system, and showed significantly lower off-target effects compared to a reference siRNA complex that does not contain a stabilized modified nucleotide. Also, for example, in the case of mice, mice administered with the siRNA complex of the present disclosure at a dose of 30 mg / kg showed a toxic reaction with respect to hepatic steatosis close to the blank control group and significantly lower than the hepatic steatosis shown by mice administered with a reference complex not containing a stabilized modified nucleotide.Also, for example, mice administered with the siRNA complex of the present disclosure at a dose of 100 mg / kg showed a significant decrease in blood biochemical indicators, with no obvious abnormalities compared to the blank control group, and mice administered with the siRNA complex of the present disclosure showed no moderate or higher inflammatory cell infiltration and necrosis compared to the reference siRNA complex, showing a significantly lower toxic reaction in histopathology.Also, for example, even at a high dose of 300 mg / kg, serum ALT showed no obvious difference compared to the blank control group, and in the histopathological sections of six mice administered with the reference complex, all showed inflammatory cell infiltration, while only three mice administered with the complex of the present disclosure showed inflammatory cell infiltration, and the number of mice showing inflammatory cell infiltration was clearly reduced.In addition, for example, the siRNA complexes of the present disclosure have low off-target effects, and in an in vitro siCHECK system, the siRNA complexes of the present disclosure exhibit excellent on-target target sequence suppression activity, IC. 50 The values ​​were 4.50 pM to 11.3 pM, and the off-target target sequence inhibition rates within the entire range of siRNA concentrations tested were all less than 50%, indicating low off-target effects. For example, in mice administered with the siRNA complex of the present disclosure at a high dose of 300 mg / kg every week for three consecutive weeks, the serum ALT and AST concentrations were equivalent to the levels of the blank control group, and further, in pathological sections of mice administered with the siRNA complex of the present disclosure, responses in terms of hepatic steatosis and inflammation were similar to those of the blank control group, with no significant abnormalities, indicating that the siRNA complex of the present disclosure has very low hepatotoxicity. For example, compared with a reference siRNA complex not containing a stabilizing modified nucleotide, the siRNA complex of the present disclosure not only exhibited comparable or significantly higher inhibitory activity against the on-target target sequence, but also exhibited significantly lower off-target effects, and off-target IC 25 / On-Target IC 25 is at least 499, and even reaches 2100. Also, for example, compared with the mice administered with the reference siRNA complex, the mice administered with the siRNA complex of the present disclosure at a dose of 100 mg / kg showed significantly reduced blood biochemical indexes, maintaining levels close to those of the blank control group, and exhibited significantly lower histopathological toxic reactions, with most mice showing no abnormality and only some mice showing mild hepatocyte degeneration.

[0016] Secondly, the double-stranded oligonucleotide, pharmaceutical composition and / or oligonucleotide complex of the present disclosure exhibits excellent target gene expression regulating activity in an in vitro cell experiment. For example, when the double-stranded oligonucleotide of the present disclosure is an siRNA, the siRNA provided by the present disclosure exhibits very high target sequence suppression activity in an in vitro siCHECK system, and has an IC 50The HBV mRNA suppression rate is between 0.0022 and 0.0086 nM, and has a target sequence suppression activity close to that of the reference siRNA not containing stabilizing modified nucleotides. For example, the siRNA provided by the present disclosure exhibits excellent HBV mRNA suppression activity in primary hepatocytes of 44Bri mice, with an HBV mRNA suppression rate of at least 73.92% and up to 77.58% at an siRNA concentration of 50 nM, and exhibits HBV mRNA suppression activity equivalent to that of the reference siRNA not containing stabilizing modified nucleotides. For example, the siRNA complex of the present disclosure exhibits excellent HBV mRNA suppression activity in primary hepatocytes of 44Bri mice, with an HBV mRNA suppression rate of at least 81.29% and up to 93.06% at an siRNA concentration of 10 nM, and exhibits HBV mRNA suppression activity equivalent to that of the reference complex 4 not containing stabilizing modified nucleotides. Also, for example, the siRNA complex of the present disclosure shows excellent HBV mRNA suppression activity in primary hepatocytes of 44Bri mice, and at an siRNA concentration of 10 nM, the HBV mRNA suppression rate is at least 70.14% and can reach a maximum of 85.97%, and shows HBV mRNA suppression activity equivalent to a reference siRNA complex that does not contain a corresponding stabilizing modified nucleotide, and compared with a reference siRNA complex whose corresponding position is an unmodified nucleotide, both HBV mRNA suppression activities are unexpectedly significantly increased, and can be increased by up to 22.99%. Also, for example, the siRNA complex provided by the present disclosure has a very high target sequence suppression activity in an in vitro siCHECK system. At a low concentration of 0.01 nM, the expression suppression rate of the target sequence can reach at least 38.92% and a maximum of 67.54%, and at a concentration of 0.1 nM, the expression suppression rate of the target sequence can reach at least 84.73% and a maximum of 89.35%. Also, it has a target sequence suppression activity level close to that of a reference siRNA complex that does not contain a stabilizing modified nucleotide. In addition, for example, the siRNA complex of the present disclosure has extremely high target sequence suppression activity in an in vitro siCHECK system, and IC 50The IC values ​​range from 6.89 to 8.55 pM and have target sequence silencing activity similar to that of a reference complex with the same remaining sequence but without stabilizing modified nucleotides. For example, the siRNA complexes of the present disclosure also exhibit high target sequence silencing activity in an in vitro siCHECK system, with IC 50 is 49.8 pM. For example, the siRNA complex provided by the present disclosure has very high target sequence suppression activity in an in vitro siCHECK system. At a low concentration of 0.01 nM, the target sequence expression suppression rate is at least 51.56% and can reach a maximum of 58.76%, and at a concentration of 0.1 nM, the target sequence expression suppression rate can reach 87.92 to 88.84%. In addition, compared to a reference siRNA complex not containing a stabilizing modified nucleotide, it has a similar target sequence suppression activity level.

[0017] Third, the double-stranded oligonucleotide, pharmaceutical composition and / or oligonucleotide complex of the present disclosure can have higher stability and / or higher activity in vivo.For example, when the double-stranded oligonucleotide of the present disclosure is siRNA, the siRNA complex of the present disclosure shows excellent HBV mRNA suppression effect in mice in vivo, with an HBV mRNA suppression rate of at least 63.18% at a dose of 0.1 mg / kg, and an HBV mRNA suppression rate of as high as 96.31% at a dose of 1 mg / kg, and shows HBV mRNA suppression activity equivalent to the corresponding reference siRNA complex that does not contain stabilizing modified nucleotides.In addition, for example, the siRNA complex of the present disclosure shows excellent HBV mRNA suppression effect in mice in vivo, with an HBV mRNA suppression rate of at least 44.88% at a dose of 0.1 mg / kg, and an HBV mRNA suppression rate of as high as 84.25% at a dose of 1 mg / kg, and shows HBV mRNA suppression activity equivalent to the corresponding reference siRNA complex that does not contain stabilizing modified nucleotides at the same concentration. Also, for example, at different time points after administration, the siRNA complex of the present disclosure can obviously reduce the TG and CHO levels in mouse serum, and show a lipid level lowering effect close to that of the reference siRNA complex that does not contain the corresponding stabilized modified nucleotide.In particular, at a dose of 3 mg / kg, the siRNA complex of the present disclosure consistently shows a very high lipid TG lowering effect within the entire administration time of up to 50 days, and the maximum inhibition rate can reach 90.2%.Also, for example, at different time points after administration, the siRNA complex of the present disclosure can obviously reduce the TG and CHO levels in mouse serum, and show a lipid level lowering effect close to that of the reference siRNA complex that does not contain the corresponding stabilized modified nucleotide.In particular, at a dose of 3 mg / kg and 1 mg / kg, the siRNA complex of the present disclosure consistently shows a very high lipid TG lowering effect within the entire administration time of up to 50 days, and the maximum inhibition rate can reach 92.0%.Also, for example, at different time points after administration, the siRNA complex of the present disclosure at different concentrations can all reduce the TG level in mouse serum, and in particular, after a single administration at a dose of 9 mg / kg, the siRNA complex of the present disclosure can consistently maintain a TG level suppression rate of more than 50% over a long period of 64 days, and the suppression rate can reach a maximum of 89.5%, showing excellent lipid suppression ability. Also, for example, at different time points after administration, the siRNA complex of the present disclosure can obviously reduce the TG and CHO levels in mouse serum. Also, within the 43-day experimental period, it consistently maintains a high suppression effect, and in particular, the siRNA complex of the present disclosure at a dose of 3 mg / kg all show excellent lipid suppression effects on mice, with the maximum serum TG suppression rate being higher than 88% and the maximum serum CHO suppression rate being 51.18% to 57.41%. Also, for example, at different time points after administration, the siRNA complex of the present disclosure can obviously reduce the TG and CHO levels in mouse serum, and within the 22-day experimental period, it maintains a consistently high suppression effect, and shows a lipid level reducing effect close to that of the reference siRNA complex that does not contain corresponding stabilized modified nucleotide.Also, for example, the siRNA complex of the present disclosure shows an excellent target gene-expressed mRNA suppression effect in mice in vivo, and at a dose of 3mg / kg, the target gene-expressed mRNA suppression rate is at least 70%, and can even reach 95%, and shows the target gene-expressed mRNA suppression activity equivalent to or higher than that of the reference siRNA complex that does not contain corresponding stabilized modified nucleotide.

[0018] As a result, the double-stranded oligonucleotide, pharmaceutical composition, and oligonucleotide complex provided by the present disclosure can have significantly low off-target effects and toxic reactions due to off-target effects, and can effectively regulate the expression level of a target gene in vivo and in vitro, thereby having significantly high safety and being able to effectively treat and / or prevent disease symptoms associated with the mRNA level expressed by a target gene, and has bright prospects for application. [Brief description of the drawings]

[0019] [Figure 1] 1 shows a histogram of relative expression levels of HBV mRNA in primary hepatocytes from 44Bri mice after transfection with siRNAs of the present disclosure and reference siRNAs, respectively. [Diagram 2] 1 is a histogram of relative expression levels of HBV mRNA in primary hepatocytes of 44Bri mice after ad libitum intake of the siRNA complex of the present disclosure or the reference siRNA complex and reference siRNA NC, respectively. [Figure 3A-3B] FIG. 13 is a scatter plot of relative expression levels of HBV mRNA in the liver of 44Bri mice after administration of different concentrations of the siRNA complex of the present disclosure or the reference siRNA complex and PBS. [Figure 4] 1 is a histogram of relative expression levels of HBV mRNA in primary hepatocytes of 44Bri mice after ad libitum intake of the siRNA complex of the present disclosure or the reference siRNA complex and reference siRNA NC, respectively. [Diagram 5] FIG. 13 is a scatter plot of relative expression levels of HBV mRNA in the liver of 44Bri mice after administration of the siRNA complex of the present disclosure or the reference siRNA complex and PBS, respectively. [Figure 6A-6B] 1 is a scatter plot of ALT and AST concentrations in mouse serum after administration of siRNA complexes of the present disclosure or reference siRNA complexes and PBS, respectively. [Figure 7] 13 is a histogram of relative expression levels of a sequence of interest in an in vitro siCHECK system after co-transfection of a plasmid containing the sequence of interest and a siRNA complex or a reference siRNA NC. [Figure 8A-8B] 1 is a line graph showing the change in serum TG or CHO levels over time following administration of a siRNA complex of the present disclosure, a reference siRNA complex, or PBS, respectively. [Figure 9A-9B]1 is a line graph showing the change in serum TG levels or serum CHO levels over time following administration of the siRNA complex of the present disclosure or PBS, respectively. [Figure 10] 1 is a line graph showing the time course of serum TG levels after administration of different concentrations of the siRNA complex of the present disclosure or PBS. [Figure 11A-11B] 1 is a line graph showing the change in serum TG levels or serum CHO levels over time following administration of the siRNA complex of the present disclosure or PBS, respectively. [Figure 12A-12B] FIG. 13 is a scatter plot of ALT and AST concentrations in mouse serum following three consecutive weekly administrations of 300 mg / kg of siRNA complexes of the present disclosure or PBS, respectively. [Figure 13A-13B] 1 is a line graph showing the change in serum TG or CHO levels over time following administration of a siRNA complex of the present disclosure, a reference siRNA complex, or PBS, respectively. [Figure 14] 13 is a histogram of relative expression levels of a sequence of interest in an in vitro siCHECK system after co-transfection of a plasmid containing the sequence of interest and a siRNA complex or a reference siRNA NC. [Figure 15] FIG. 13 is a scatter plot of relative expression levels of mANGPTL3 mRNA in the liver of C57BL / 6 mice after administration of siRNA complexes of the present disclosure or reference siRNA complexes and PBS, respectively. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0020] Hereinafter, specific embodiments of the present disclosure will be described in detail. It should be understood that the specific embodiments described herein are merely for the purpose of explaining and interpreting the present disclosure, and are not intended to limit the present disclosure.

[0021] In this disclosure, unless otherwise specified, HBV gene refers to a viral gene of Hepatitis B virus (HBV), for example, a gene having a sequence set forth in Genbank accession number NC_003977.2, HBV mRNA refers to an mRNA transcribed by the above-mentioned HBV gene, APOC3 mRNA refers to an mRNA having a sequence set forth in Genbank accession number NM_000040.3, APOC3 gene refers to a gene that transcribes the above-mentioned APOC3 mRNA, ANGPTL3 mRNA refers to an mRNA having a sequence set forth in Genbank accession number NM_014495.4, and ANGPTL3 gene refers to a gene that transcribes the above-mentioned ANGPTL3 mRNA.

[0022] <Definition> Unless otherwise stated in the context, capital letters C, G, U, and A represent the base composition of a nucleotide, lower case letter m represents that one nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide, lower case letter f represents that one nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide, lower case letter s represents that two nucleotides adjacent to the left and right sides of the letter s are linked by a phosphorothioate, P1 represents that one nucleotide adjacent to the right side of P1 is a 5'-phosphate nucleotide or a 5'-phosphate analog-modified nucleotide, and in some embodiments, P1 is specifically modified VP, Ps, or P, the combination letter VP represents that one nucleotide adjacent to the right side of the combination letter VP is a vinyl phosphate (5'-(E)-vinylphosphonate (E-VP))-modified nucleotide, the combination letter Ps represents that one nucleotide adjacent to the right side of the combination letter Ps is a phosphorothioate-modified nucleotide, and capital letter P represents that one nucleotide adjacent to the right side of the letter P is a 5'-phosphate nucleotide.

[0023] In this context, the "fluoro-modified nucleotide" refers to a nucleotide in which the 2'-hydroxyl of the ribose of the nucleotide is replaced with fluorine, and the "non-fluoro-modified nucleotide" refers to a nucleotide or nucleotide analog in which the 2'-hydroxyl of the ribose of the nucleotide is replaced with a non-fluorine group. The "nucleotide analog" refers to a group that can replace a nucleotide in a nucleic acid but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide, such as an isonucleotide, bridged nucleotide (abbreviated as BNA), or acyclic nucleotide. The "methoxy-modified nucleotide" refers to a nucleotide in which the 2'-hydroxyl of the ribose is replaced with methoxy.

[0024] In the context of this specification, the terms "complementary" or "reverse complementary" may be used interchangeably and have the meaning well known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, bases on one strand are paired with bases on the other strand in a complementary manner. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA), and the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair contains one purine and one pyrimidine. If adenine on one strand always pairs with thymine (or uracil) on the other strand and guanine always pairs with cytosine, it is considered that both strands are complementary and that the sequence of the strand can be inferred from the sequence of the complementary strand. Accordingly, in the art, the term "mismatch" means that bases at corresponding positions in a double-stranded nucleic acid are not present in a complementary pairing.

[0025] Unless otherwise specified in context, "essentially reverse complementary" refers to no more than three base mismatches between two related nucleotide sequences, "substantially reverse complementary" refers to no more than one base mismatch between two nucleotide sequences, and "fully reverse complementary" refers to no base mismatches between two nucleotide sequences.

[0026] In the context, particularly in describing the method for preparing the double-stranded oligonucleotide, pharmaceutical composition, or oligonucleotide complex of the present disclosure, unless otherwise specified, the nucleoside monomer refers to modified or unmodified nucleoside phosphoramidite monomers (unmodified or modified RNA phosphoramidites, RNA phosphoramidites are sometimes referred to as nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis depending on the type and order of nucleotides in the double-stranded oligonucleotide or oligonucleotide complex to be prepared. Phosphoramidite solid-phase synthesis is a method used for RNA synthesis known to those skilled in the art. All of the nucleoside monomers used in the present disclosure are commercially available.

[0027] It will be understood by those of skill in the art that with respect to any group that contains one or more substituents, it is not intended that these groups introduce any substitutions or substitution patterns that are sterically impractical, synthetically impractical, and / or inherently unstable.

[0028] As used herein, "alkyl" refers to straight and branched chains having a specified number of carbon atoms, typically 1 to 20 carbon atoms, e.g., 1 to 10 carbon atoms, such as 1 to 8 or 1 to 6. For example, C1-C6 alkyl includes straight and branched chain alkyls of 1 to 6 carbon atoms. When naming an alkyl residue having a specific number of carbons, it is intended to include all branched and straight chain forms having that number of carbons. Thus, for example, "butyl" is meant to include n-butyl, sec-butyl, isobutyl, and tert-butyl, and "propyl" includes n-propyl and isopropyl. Alkylene is a subset of alkyl and refers to the same residue as alkyl but having two points of attachment.

[0029] As used herein, "alkenyl" refers to an unsaturated branched or straight chain alkyl having at least one carbon-carbon double bond, which is obtained by removing one hydrogen molecule from adjacent carbon atoms of a parent alkyl. The group may be in the cis or trans configuration of the double bond. Exemplary alkenyls include, but are not limited to, vinyl, propenyl such as prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1-yl (allyl), prop-2-en-2-yl, and butenyl such as but-1-en-1-yl, but-1-en-2-yl, 2-methylprop-1-en-1-yl, but-2-en-1-yl, but-2-en-2-yl, buta-1,3-dien-1-yl, and buta-1,3-dien-2-yl. In some embodiments, alkenyl has from 2 to 20 carbon atoms, while in other embodiments it has from 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkenylene is a subset of alkenyl, referring to residues similar to alkenyl, but having two points of attachment.

[0030] As used herein, "alkynyl" refers to an unsaturated branched or straight chain alkyl group having at least one carbon-carbon triple bond, the carbon-carbon triple bond being obtained by removing two hydrogen molecules from adjacent carbon atoms of a parent alkyl. Exemplary alkynyls include, but are not limited to, ethynyl, propynyl, such as prop-1-yn-1-yl, prop-2-yn-1-yl, and butynyl, such as but-1-yn-1-yl, but-1-yn-3-yl, but-3-yn-1-yl. In some embodiments, alkynyl has 2-20 carbon atoms, while in other embodiments, 2-10, 2-8, or 2-6 carbon atoms. Alkynylene is a subset of alkynyl and refers to a residue that is the same as alkynyl but has two points of attachment.

[0031] As used herein, "alkoxy" refers to an alkyl of the specified number of carbon atoms attached through an oxygen bridge, for example, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentyloxy, 2-pentyloxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy, 3-hexyloxy, 3-methylpentyloxy, etc. An alkoxy typically has 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms attached through an oxygen bridge.

[0032] As used herein, "aryl" refers to a group formed by removing a hydrogen atom from a ring carbon atom derived from an aromatic monocyclic or polycyclic hydrocarbon ring system. The aromatic monocyclic or polycyclic hydrocarbon ring system contains only hydrogen and carbon from 6 to 18 carbon atoms, and at least one of the rings in the ring system is fully unsaturated, i.e., it contains a cyclic, delocalized (4n+2) π-electron system according to the Hückel theory. Aryl includes, but is not limited to, groups such as phenyl, fluorenyl, and naphthyl. Arylene is a subset of aryl and refers to a residue that is the same as aryl but has two points of attachment.

[0033] "Heteroaryl" refers to a group derived from a 3-18 membered aromatic ring radical containing 2-17 carbon atoms and 1-6 heteroatoms selected from nitrogen, oxygen and sulfur. As used herein, a heteroaryl may be a monocyclic, bicyclic, tricyclic or tetracyclic ring system, in which at least one of the rings in the ring system is fully unsaturated, i.e., it contains a cyclic, delocalized (4n+2) π-electron system according to the Hückel theory. A heteroaryl includes fused or bridged ring systems. In some embodiments, a heteroatom in a heteroaryl is an oxidized heteroatom. In some embodiments, a heteroaryl includes one or more nitrogen atoms. In some embodiments, one or more of the nitrogen atoms in a heteroaryl is a quaternized nitrogen atom. A heteroaryl is bonded to the remainder of the molecule through any atom in the ring. Illustrative examples of heteroaryl include azepinyl, acridinyl, benzimidazolyl, benzindole, 1,3-benzodioxazolyl, benzofuryl, benzoxazolyl, benzo[d]thiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepinyl, benzo[b][1,4]oxazinyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxinyl, benzopyranyl, benzo Pyronyl, benzofuryl, benzofuranonyl, benzothiophenyl, benzothieno[3,2-d]pyrimidinyl, benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridyl, carbazolyl, cinnolinyl, cyclopenta[d]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-d]pyrimidinyl, 5,6-dihydrobenzo[h]quinazolinyl, 5,6-dihydrobenzo[h]cinnolinyl, 6,7-dihydro-5H-benzo[6,7]cyclohepta[1,2-c]pyridazinyl, dibenzofuryl, dibenzothiophenyl, furyl, furanonyl, furo[3,2-c]pyridyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyrimidinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyridazinyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyridyl, isothiazolyl, imidazolyl, indazolyl, indole, isoindole, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, iso 5,8-methano-5,6,7,8-tetrahydroquinazolinyl, naphthyridinyl, 1,6-naphthyridinonyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxiranyl, 5,6,6a,7,8,9,10,10a-octahydrobenzo[H]quinazolinyl, 1-phenyl-1H-pyrrolidinyl aryl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl, pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridyl, pyrido[3,2-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, pyrrolyl, quinazolinyl, quinoxalinyl, quinolyl, tetrahydroquinolyl, 5,6,7,8-tetrahydroquinazolinyl, 5,6,7,8-tetrahydrobenzo Examples include, but are not limited to, [4,5]thieno[2,3-d]pyrimidinyl, 6,7,8,9-tetrahydro-5H-cyclohepta[4,5]thieno[2,3-d]pyrimidinyl, 5,6,7,8-tetrahydropyrido[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, thieno[2,3-d]pyrimidinyl, thieno[3,2-d]pyrimidinyl, thieno[2,3-c]pridinyl, and thiophenyl / thienyl.

[0034] A variety of hydroxy protecting groups can be used in the present disclosure. Generally, a protecting group can render a chemical functionality insensitive to a particular reaction condition and can be added to or removed from that functional group in a molecule without substantially damaging the remainder of the molecule. Representative hydroxy protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed, John Wiley & Sons, New York, 1991, which are incorporated herein by reference in their entirety. In some embodiments, the protecting group is stable under basic conditions but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxy protecting groups that can be used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthen-9-yl (Pixyl), and 9-(p-methoxyphenyl)xanthen-9-yl (Mox). In some embodiments, non-exclusive illustrative examples of hydroxy protecting groups that can be used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxytrityl), and TMTr (4,4',4''-trimethoxytrityl).

[0035] The term "subject" as used herein refers to any animal, e.g., a mammal or marsupial. Subjects of the present disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cows, sheep, rats, and any type of poultry.

[0036] As used herein, "treatment" refers to a method of obtaining a beneficial or desired result, including, but not limited to, a therapeutic effect. A "therapeutic effect" refers to eradicating or ameliorating the underlying disorder being treated. A therapeutic effect is also obtained by observing an improvement in a subject by eradicating or ameliorating one or more physiological symptoms associated with the underlying disorder, even though the subject may still be afflicted by the underlying disorder.

[0037] As used herein, "prevention" refers to a method of obtaining a beneficial or desired result, including but not limited to a prophylactic effect. To obtain a "prophylactic effect," a double-stranded oligonucleotide, pharmaceutical composition, or oligonucleotide complex may be administered to a subject who may not have been diagnosed with a particular disease, but who is at risk of suffering from the disease, or who has reported one or more physiological symptoms of the disease.

[0038] The first type of double-stranded oligonucleotide In one embodiment, the present disclosure provides a first type of double-stranded oligonucleotide that can regulate the expression of a gene and has low off-target effects.

[0039] The first type of double-stranded oligonucleotide of the present disclosure contains a nucleotide group as a basic structural unit, and the nucleotide group contains a phosphate group, a ribose group, and a base, which is known to those skilled in the art, so further explanation is omitted here.

[0040] CN102140458B discloses an siRNA that specifically inhibits HBV genes, and various chemical modification strategies of the siRNA have been studied. The study found that different modification strategies have completely different effects on indicators such as siRNA stability, biological activity, and cytotoxicity. Seven effective modification methods have been demonstrated in the study, and compared with unmodified siRNA, the siRNA obtained by one of the modification methods has improved stability in blood and retains almost the same inhibitory activity as unmodified siRNA. However, the study does not mention the problem of off-target effects.

[0041] The double-stranded oligonucleotide of the present disclosure comprises a sense strand and an antisense strand, the sense strand comprises a nucleotide sequence I, the antisense strand comprises a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II each consist of 19 nucleotides, each nucleotide in the nucleotide sequence I and the nucleotide sequence II is a modified or unmodified nucleotide, the nucleotide sequence I and the nucleotide sequence II form a double-stranded region at least partially in a reverse complementary manner, the nucleotide sequence II is at least partially reverse complementary to a first nucleotide sequence, and the first nucleotide sequence is a double-stranded region having a length of 19 nucleotides in an mRNA expressed by a gene of interest. a nucleotide sequence in which the nucleotide sequence II is a stabilizing modified nucleotide, wherein, from the 5' end to the 3' end, at least one of the nucleotides at positions 3 to 6 of the nucleotide sequence II is a stabilizing modified nucleotide, and none of the nucleotides other than the nucleotides at positions 3 to 9 of the nucleotide sequence II is a stabilizing modified nucleotide, and the stabilizing modified nucleotide refers to a nucleotide in which the hydroxyl at the 2' position of the ribose of a nucleotide is replaced with a stabilizing modified group, and compared with a double-stranded oligonucleotide in which the nucleotide at the corresponding position is an unmodified nucleotide, a double-stranded oligonucleotide containing the stabilizing modified nucleotide has increased thermal stability and the steric hindrance of the stabilizing modified group is greater than that of 2'-O-methyl.

[0042] In some embodiments, the nucleotide at the third or fifth position in the nucleotide sequence II from the 5' end to the 3' end is the stabilizing modified nucleotide. In some embodiments, no more than two of the nucleotides at the third to ninth positions in the nucleotide sequence II from the 5' end to the 3' end are the stabilizing modified nucleotide. By limiting the number of stabilizing modified nucleotides at a particular position, the double-stranded oligonucleotide of the present disclosure can optimally balance pharmaceutical activity with low off-target effects and has excellent stability. In some embodiments, the nucleotide at the third and / or fifth position in the nucleotide sequence II from the 5' end to the 3' end is the stabilizing modified nucleotide. In some embodiments, the nucleotide at the third and / or fifth position in the nucleotide sequence II from the 5' end to the 3' end is the stabilizing modified nucleotide, and one of the nucleotides at the fourth, seventh, or ninth positions is also the stabilizing modified nucleotide.

[0043] In some embodiments, in the double-stranded oligonucleotide of the present disclosure, the nucleotides at positions 3 and 9 of nucleotide sequence II from the 5' to the 3' end are the stabilizing modified nucleotides; alternatively, the nucleotides at positions 5 and 7 of nucleotide sequence II from the 5' to the 3' end are the stabilizing modified nucleotides; alternatively, the nucleotides at positions 5 and 9 of nucleotide sequence II from the 5' to the 3' end are the stabilizing modified nucleotides.

[0044] In the double-stranded oligonucleotide of the present disclosure, from the 5' end to the 3' end, none of the nucleotides other than the nucleotides at positions 3 to 9 in the nucleotide sequence II is the stabilizing modified nucleotide. When at least one of the nucleotides at positions 3 to 6 in the nucleotide sequence II is a stabilizing modified nucleotide and a stabilizing modified nucleotide is contained other than the nucleotides at positions 3 to 9, the ability of the double-stranded oligonucleotide to regulate the expression level of the target sequence may be significantly affected.

[0045] In some embodiments, "thermal stability of double-stranded oligonucleotide is increased" refers to an increase in the thermal dissociation temperature Tm of the double-stranded oligonucleotide. In some embodiments, "thermal stability of double-stranded oligonucleotide is increased" refers to an increase in the thermal dissociation temperature Tm of the double-stranded oligonucleotide of at least 0.05°C, in some embodiments, an increase of 0.1 to 6°C, and in some embodiments, an increase of 0.5 to 4°C. Without being limited to theoretical interpretation, by including a stabilizing modified nucleotide at a specific position, the antisense strand in the double-stranded oligonucleotide of the present disclosure has little effect on the binding ability to the mRNA expressed by the target gene, and the binding to the off-target target mRNA is significantly reduced, thereby reducing or eliminating the off-target effect.

[0046] In some embodiments, each of the stabilizing modifying groups independently has the structure shown in -XR, where X is O, NR', S, or SiR'2, R is one of C2-C6 alkyl, substituted C2-C6 alkyl, C6-C8 aryl, and substituted C6-C8 aryl, and each R' is independently one of H, C1-C6 alkyl, substituted C1-C6 alkyl, C6-C8 aryl, and substituted C6-C8 aryl, where the substituted C2-C6 alkyl or substituted C6-C8 aryl refers to a group in which one or more hydrogen atoms in the C2-C6 alkyl or C6-C8 aryl are replaced with a substituent, and the substituents are each independently one or more selected from C1-C3 alkyl, C6-C8 aryl, C1-C3 alkoxy, halogen, oxy subunits, and sulfide subunits. It should be noted that the present disclosure does not intend to cover all modification groups that satisfy the above structure, but only relates to stabilizing modification groups that can realize increased thermal stability of double-stranded oligonucleotides. In some embodiments, each of the stabilizing modification groups is independently selected from 2'-O-methoxyethyl, 2'-O-allyl, 2'-C-allyl, 2'-O-2-N-methylamino-2-oxyylideneethyl, 2'-O-2-N,N-dimethylaminoethyl, 2'-O-3-aminopropyl, and 2'-O-2,4-dinitrophenyl. In some embodiments, each of the stabilizing modification groups is 2'-O-methoxyethyl.

[0047] In some embodiments, in the double-stranded oligonucleotide of the present disclosure, the nucleotide sequence II and the first nucleotide sequence are essentially reverse complementary, substantially reverse complementary, or completely reverse complementary. In some embodiments, from the 5' end to the 3' end, the nucleotides at positions 2 to 19 of the nucleotide sequence II and the nucleotides at positions 1 to 18 of the first nucleotide sequence are completely reverse complementary.

[0048] In some embodiments, in the double-stranded oligonucleotide of the present disclosure, the nucleotide sequence II and the nucleotide sequence I are essentially reverse complementary, substantially reverse complementary, or completely reverse complementary. In some embodiments, the nucleotide sequence II and the nucleotide sequence I are completely reverse complementary, or there is a base mismatch between the second nucleotide in the nucleotide sequence II from the 5' end to the 3' end and the second nucleotide in the nucleotide sequence I from the 3' end to the 5' end. By including the base mismatch, it is possible to maintain low off-target effects and further improve the target gene expression regulating activity of the double-stranded oligonucleotide of the present disclosure.

[0049] In some embodiments, in the double-stranded oligonucleotide of the present disclosure, the sense strand further comprises a nucleotide sequence III, and the antisense strand further comprises a nucleotide sequence IV, wherein each nucleotide of the nucleotide sequence III and the nucleotide sequence IV is independently one of non-fluoro-modified nucleotides and is not the stabilized modified nucleotide, the length of the nucleotide sequence III is 1, 2, 3 or 4 nucleotides, the nucleotide sequence IV and the nucleotide sequence III are equal in length and substantially reverse-complementary or completely reverse-complementary, the nucleotide sequence III is bound to the 5' end of the nucleotide sequence I, the nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II, and the nucleotide sequence IV is substantially reverse-complementary or completely reverse-complementary to a second nucleotide sequence, the second nucleotide sequence being a nucleotide sequence adjacent to the first nucleotide sequence in the mRNA expressed by the gene of interest and having the same length as the nucleotide sequence IV. Thus, the double-stranded oligonucleotide of the present disclosure can have a double-stranded complementary region having a length of 19 to 23 nucleotides.

[0050] In some embodiments, the double-stranded oligonucleotide of the present disclosure further comprises a nucleotide sequence V, wherein each nucleotide of the nucleotide sequence V is independently one of non-fluoro-modified nucleotides and is not a stabilized modified nucleotide, and the nucleotide sequence V is 1-3 nucleotides in length and is attached to the 3' end of the antisense strand to form a 3' overhang end of the antisense strand. Thus, the length ratio of the sense strand to the antisense strand of the double-stranded oligonucleotide provided by the present disclosure may be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 23 / 23, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the nucleotide sequence V is 2 nucleotides in length, and from the 5' end to the 3' end, the nucleotide sequence V is two consecutive thymine deoxyribonucleotides (dTdT), two consecutive uracil ribonucleotides (UU), or is completely reverse-complementary to a third nucleotide sequence, the third sequence being a nucleotide sequence adjacent to the 5' end of the first nucleotide sequence or the second nucleotide sequence in the mRNA expressed by the gene of interest, and having a length equal to that of the nucleotide sequence V. Thus, in some embodiments, the sense strand and the antisense strand of the double-stranded oligonucleotide of the present disclosure are 19 / 21 nucleotides or 21 / 23 nucleotides in length, respectively, and in this case, the double-stranded oligonucleotide of the present disclosure has better activity of regulating expression of a gene of interest.

[0051] As mentioned above, in the double-stranded oligonucleotide of the present disclosure, each nucleotide is a modified or unmodified nucleotide. In the context of the present disclosure, the term "modified nucleotide" refers to a nucleotide or nucleotide analog in which the hydroxyl at the 2' position of the ribose of the nucleotide is replaced with another group, or a nucleotide in which the base on the nucleotide is a modified base. The modified nucleotide does not obviously weaken or eliminate the function of the double-stranded oligonucleotide to regulate gene expression. For example, modified nucleotides disclosed in JK Watts et al., Chemically modified siRNA: tools and applications. Drug Discov Today, 2008, 13(19-20):842-55 may be selected. In some embodiments, from the 5' end to the 3' end, the nucleotides at the 2nd, 6th, 14th, and 16th positions of the nucleotide sequence II are 2'-fluoro modified nucleotides, or the nucleotides at the 2nd, 14th, and 16th positions of the nucleotide sequence II are 2'-fluoro modified nucleotides and the nucleotide at the 6th position of the nucleotide sequence II is a stabilized modified nucleotide. In some embodiments, all nucleotides in the nucleotide sequence II are modified nucleotides, and from the 5' to the 3' end, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II are 2'-fluoro modified nucleotides, and each of the other nucleotides in the nucleotide sequence II is independently one of the non-fluoro modified nucleotides. In some embodiments, from the 5' to the 3' end, the nucleotides at positions 7 to 9 of the nucleotide sequence I are 2'-fluoro modified nucleotides. In some embodiments, all nucleotides in the nucleotide sequence I are modified nucleotides, and from the 5' to the 3' end, the nucleotides at positions 7 to 9 of the nucleotide sequence I are 2'-fluoro modified nucleotides, and each of the other nucleotides in the nucleotide sequence I is independently one of the non-fluoro modified nucleotides.The double-stranded oligonucleotide of the present disclosure has the above-mentioned modifications, thereby enabling it to achieve a good balance between gene expression regulating activity and in vivo stability.

[0052] In the context of this disclosure, "fluoro-modified nucleotide" refers to a nucleotide having the structure shown in formula (7) below, in which the 2'-position hydroxyl of the ribose of the nucleotide is replaced with fluorine. "Non-fluoro-modified nucleotide" refers to a nucleotide or nucleotide analog in which the 2'-position hydroxyl of the ribose of the nucleotide is replaced with a non-fluorine group. In some embodiments, each non-fluoro-modified nucleotide is an independently selected one from nucleotides or nucleotide analogs in which the 2'-position hydroxyl of the ribose of the nucleotide is replaced with a non-fluorine group.

[0053] These nucleotides in which the hydroxyl at the 2'-position of ribose is substituted with a non-fluorine group are known to those skilled in the art, and these nucleotides may be one selected from a 2'-alkoxy modified nucleotide, a 2'-alkyl modified nucleotide, a 2'-substituted alkyl modified nucleotide, a 2'-amino modified nucleotide, a 2'-substituted amino modified nucleotide, and a 2'-deoxy nucleotide.

[0054] In some embodiments, the 2'-alkoxy modified nucleotide is a methoxy modified nucleotide (2'-OMe) as shown in formula (8). In some embodiments, the 2'-amino modified nucleotide (2'-NH2) is as shown in formula (9). In some embodiments, the 2'-deoxyribonucleotide (DNA) is as shown in formula (10).

[0055] [ka]

[0056] A nucleotide analog refers to a group that can substitute for a nucleotide in a nucleic acid, but that differs in structure from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. In some embodiments, a nucleotide analog can be an isonucleotide, a bridged nucleotide (abbreviated as BNA), or an acyclic nucleotide.

[0057] BNA refers to a constrained or inaccessible nucleotide. BNAs may include five-, six-, or seven-membered bridged structures with a "fixed" C3'-endo sugar puckering. Typically, the bridge is introduced at the 2'-, 4'-position of the ribose to provide a 2',4'-BNA nucleotide. In some embodiments, the BNA may be an LNA as shown in formula (12), an ENA as shown in formula (13), a cET BNA as shown in formula (14), or the like.

[0058] [ka]

[0059] An acyclic nucleotide is a nucleotide in which the sugar ring of the nucleotide is opened. In some embodiments, the acyclic nucleotide may be an unlocked nucleic acid (UNA) as shown in formula (15) or a glycerol nucleic acid (GNA) as shown in formula (16).

[0060] [ka]

[0061] In the above formula (15) and formula (16), R is selected from H, OH, or alkoxy (O-alkyl).

[0062] An isonucleotide refers to a compound in which the position of the base in the ribose ring in a nucleotide is changed. In some embodiments, an isonucleotide may be a compound in which the base is shifted from the 1'-position to the 2'-position or 3'-position of the ribose ring, as shown in formula (17) or (18).

[0063] In the compounds of formula (17) and formula (18) above, Base represents a nucleic acid base such as A, U, G, C or T, and R is selected from H, OH, F or the non-fluorine groups described above.

[0064] [ka]

[0065] In some embodiments, the nucleotide analog is one selected from an isonucleotide, LNA, ENA, cET, UNA, and GNA. In some embodiments, each non-fluoro modified nucleotide is a methoxy modified nucleotide, which in this context refers to a nucleotide in which the 2'-hydroxy of the ribose is replaced with methoxy.

[0066] In this context, "fluoro-modified nucleotide", "2'-fluoro-modified nucleotide", "nucleotide in which the 2'-hydroxy of the ribose group is replaced with fluorine" and "nucleotide having 2'-fluoro ribose" have the same meaning and all refer to a compound having the structure shown in formula (7) in which the 2'-hydroxy of the nucleotide is replaced with fluorine, and "methoxy-modified nucleotide", "2'-methoxy-modified nucleotide", "nucleotide in which the 2'-hydroxy of the ribose group is replaced with methoxy" and "nucleotide having 2'-methoxy ribose" have the same meaning and all refer to a compound having the structure shown in formula (8) in which the 2'-hydroxy of the ribose group of the nucleotide is replaced with methoxy.

[0067] In some embodiments, the double-stranded oligonucleotide of the present disclosure is a double-stranded oligonucleotide having the following modifications: from the 5' end to the 3' end, in the sense strand, the nucleotides at positions 7, 8, 9 or 5, 7, 8, 9 of the nucleotide sequence I are fluoro-modified nucleotides, and the nucleotides at other positions are methoxy-modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 14, 16 or 2, 6, 8, 9, 14, 16 of the nucleotide sequence II are fluoro-modified nucleotides, the nucleotides at positions 3 or 5 are stabilizing modified nucleotides, and the nucleotides at other positions are methoxy-modified nucleotides.

[0068] The double-stranded oligonucleotide having the above modification is not only low-cost, but also can make the double-stranded oligonucleotide difficult to be cut by ribonuclease in blood, thereby increasing the stability of the double-stranded oligonucleotide, and making the double-stranded oligonucleotide have the performance of strong nuclease hydrolysis resistance.In addition, the above modified double-stranded oligonucleotide has high activity of regulating the expression of target gene.

[0069] In some embodiments, at least one of the phosphate esters in the phosphate-sugar backbone of at least one of the single strands of the sense strand and the antisense strand of the double-stranded oligonucleotide provided by the present disclosure is a phosphate ester having a modified group. In some embodiments, the phosphate ester having a modified group is a thiophosphate ester in which at least one oxygen atom in the phosphodiester bond of the phosphate ester is replaced with a sulfur atom. In some embodiments, the phosphate ester having a modified group is a thiophosphate ester having the structure shown in formula (121).

[0070] [ka]

[0071] Such modifications can stabilize the double-stranded structure of the double-stranded oligonucleotide and maintain high specificity and high affinity for base pairing.

[0072] In some embodiments, in the double-stranded oligonucleotide, the phosphate ester having the modification group is Between the first and second nucleotides of the 5'-terminal end of the sense strand, Between the second and third nucleotides of the 5'-terminal end of the sense strand, Between the first and second nucleotides of the 3'-terminal end of the sense strand, Between the second and third nucleotides of the 3'-terminal end of the sense strand, Between the first and second nucleotides of the 5'-terminal end of the antisense strand, Between the second and third nucleotides of the 5'-terminal end of the antisense strand, between the first and second nucleotides of the 3'-terminal end of the antisense strand, and It is present at at least one position selected from the group consisting of between the second and third nucleotides at the 3'-terminal end of the antisense strand.

[0073] In some embodiments, the 5'-terminal nucleotide of the antisense strand is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide. The commonly used 5'-phosphate nucleotide or 5'-phosphate analog modified nucleotide are known to those skilled in the art, and for example, the 5'-phosphate nucleotide may have the following structure:

[0074] [ka]

[0075] Furthermore, for example, Anastasia Khvorova and Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotechnology, 2017, 35(3):238-48 disclose the following four types of 5'-phosphate analog modified nucleotides:

[0076] [ka]

[0077] wherein R is selected from H, OH, methoxy, and fluorine; and Base represents a nucleic acid base selected from A, U, C, G, or T.

[0078] In some embodiments, the 5'-phosphate nucleotide is a nucleotide containing a 5'-phosphate modification as shown in formula (2), and the 5'-phosphate analog modified nucleotide is a nucleotide containing a vinyl phosphate (5'-(E)-vinylphosphonate (E-VP)) modification as shown in formula (3), or a thiophosphate modified nucleotide as shown in formula (5).

[0079] The double-stranded oligonucleotide of the present disclosure may be various double-stranded oligonucleotides that regulate gene expression.In some embodiments, it may be the double-stranded oligonucleotide that suppresses or downregulates gene expression, such as siRNA, and in some embodiments, it may be the double-stranded oligonucleotide that activates or upregulates gene expression, such as saRNA.

[0080] Double-stranded oligonucleotides using the modification scheme of the present disclosure unexpectedly exhibit improved stability in blood, improved stability in lysosomes, low off-target effects, and excellent activity in modulating expression of a gene of interest.

[0081] The modified double-stranded oligonucleotide, pharmaceutical composition and oligonucleotide complex provided by the present disclosure can regulate the abnormal expression of various genes and treat various pathological conditions or diseases caused by the abnormal expression of genes. These genes can be various endogenous genes in vivo of humans or animals, or pathogen genes that reproduce in vivo of humans or animals. Based on the mRNA expressed by the target gene, a double-stranded oligonucleotide having a specific nucleotide sequence and the above-mentioned modification scheme can be designed and prepared. In some embodiments, the mRNA expressed by the gene of interest is one selected from the mRNAs transcribed by the following genes: ACE2, AGT, ANGPTL3, ApoA, ApoB, ApoC, AR, ASK1, C3, C5, Col1A1, CTGF, Ebola, FOXO1, FTO, FVII, FXI, FXII, GCGR, HBV, HCV, HSD, p53, PCSK9, PNP, PLG, PKK, KNG, RAGE, RPTOR, SARS-CoV-2, SCD1, SCNN1A, SOD1, STAT3, TIMP-1, TMPRSS6, and XO. In some embodiments, the double-stranded oligonucleotide is a siRNA, and the mRNA expressed by the gene of interest is selected from the mRNA expressed by the Hepatitis B virus gene (HBV), the mRNA expressed by the angiopoietin-like protein 3 (ANGPTL3) gene, or the mRNA expressed by the apolipoprotein C3 (ApoC3) gene.

[0082] A second type of double-stranded oligonucleotide In another embodiment, the present disclosure further provides a second type of double-stranded oligonucleotide, the double-stranded oligonucleotide comprising a sense strand and an antisense strand, each nucleotide of the sense strand and the antisense strand being a modified nucleotide, the sense strand comprising nucleotide sequence I, the antisense strand comprising nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II each consisting of 19 nucleotides, the nucleotide sequence I and the nucleotide sequence II at least partially reverse-complementarily forming a double-stranded region, the nucleotide sequence II being at least partially reverse-complementary to a first nucleotide sequence, the first nucleotide sequence being a nucleotide sequence having a length of 19 nucleotides in an mRNA expressed by a gene of interest. In some embodiments, the nucleotide sequence I is a nucleotide sequence in which, from the 5' to the 3' end, the nucleotides at positions 7-9 of the nucleotide sequence I are fluoro-modified nucleotides and each of the other nucleotides in the nucleotide sequence I is independently one of the non-fluoro-modified nucleotides, from the 5' to the 3' end, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II are fluoro-modified nucleotides and each of the other nucleotides in the nucleotide sequence II is independently one of the non-fluoro-modified nucleotides, and from the 5' to the 3' end, the nucleotide at positions 3 and / or 5 of the nucleotide sequence II is a 2'-O-methoxyethyl-modified nucleotide. In some embodiments, from the 5' to the 3' end, one of the nucleotides at positions 4, 7, and 9 of the nucleotide sequence II is also a 2'-O-methoxyethyl-modified nucleotide and each of the other non-fluoro-modified substituents in the nucleotide sequence II is less than or equal to 2'-O-methyl in steric hindrance.

[0083] In some embodiments, in the second type of double-stranded oligonucleotide of the present disclosure, from the 5'-end to the 3'-end, the nucleotides at positions 3 and / or 5 of the nucleotide sequence II have a 2'-O-methoxyethyl modification of the ribose, from the 5'-end to the 3'-end, the nucleotides at positions 3 and 9 of the nucleotide sequence II have a 2'-O-methoxyethyl modification of the ribose, from the 5'-end to the 3'-end, the nucleotides at positions 5 and 7 of the nucleotide sequence II have a 2'-O-methoxyethyl modification of the ribose, or from the 5'-end to the 3'-end, the nucleotides at positions 5 and 9 of the nucleotide sequence II have a 2'-O-methoxyethyl modification of the ribose. In some embodiments, no other nucleotide in the nucleotide sequence II has a 2'-O-methoxyethyl modification of the ribose.

[0084] The double-stranded oligonucleotide having the above modification has low off-target effects and can exhibit excellent effects in regulating the levels of mRNA expressed by a gene of interest.

[0085] In some embodiments, in the second type of double-stranded oligonucleotide of the present disclosure, the nucleotide sequence II and the first nucleotide sequence are basically reverse complementary, substantially reverse complementary, or completely reverse complementary. In some embodiments, from the 5' end to the 3' end, the nucleotides at positions 2 to 19 of the nucleotide sequence II and the nucleotides at positions 1 to 18 of the first nucleotide sequence are completely reverse complementary.

[0086] In some embodiments, in the second type of double-stranded oligonucleotide of the present disclosure, the nucleotide sequence II and the nucleotide sequence I are essentially reverse complementary, substantially reverse complementary, or completely reverse complementary. In some embodiments, the nucleotide sequence II and the nucleotide sequence I are completely reverse complementary, or there is a base mismatch between the second nucleotide in the nucleotide sequence II from the 5' end to the 3' end and the second nucleotide in the nucleotide sequence I from the 3' end to the 5' end. By including the base mismatch, it is possible to maintain low off-target effects and further improve the target gene expression regulating activity of the double-stranded oligonucleotide of the present disclosure.

[0087] Furthermore, in the above-mentioned first type of double-stranded oligonucleotide of the present disclosure, the description of nucleotide sequences III, 4 and / or 5, and the description of the phosphate ester having a modified group and / or the 5'-terminal nucleotide of the antisense strand, etc., are similarly applicable to the second type of double-stranded oligonucleotide of the present disclosure.

[0088] In some embodiments, the double-stranded oligonucleotide of the present disclosure may be, for example, one of the siRNAs shown in Table 1.

[0089] Table 1 siRNA sequences of the present disclosure [Table 1]

[0090] where capital letters C, G, U, and A represent the base composition of the nucleotide, lower case letter m represents that one nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide, lower case letter f represents that one nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide, underlined capital letter S represents that one nucleotide adjacent to the left side of the letter S is a stabilizing modified nucleotide, lower case letter s represents that the two nucleotides on the left and right sides of the letter are linked by a phosphorothioate, and P1 represents that one nucleotide adjacent to the right side of P1 is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide. In some embodiments, S represents a specific stabilizing modification, such as moe, and underlined combination letter moe represents that one nucleotide adjacent to the left side of the combination letter moe is a nucleotide having a 2'-O-methoxyethyl modification. In some embodiments, P1 represents that the specific modification is VP, Ps, or P, the combination letter VP represents that one nucleotide adjacent to the right side of the combination letter VP is a vinyl phosphate (5'-(E)-vinylphosphonate, E-VP) modified nucleotide, the combination letter Ps represents that one nucleotide adjacent to the right side of the combination letter Ps is a thiophosphate modified nucleotide, and the capital letter P represents that one nucleotide adjacent to the right side of the letter P is a 5'-phosphate nucleotide. In addition, each U in the above sequence may be replaced with T, and the replacement does not significantly reduce the gene expression regulating activity and / or off-target effect suppression ability of the double-stranded oligonucleotide.

[0091] In the double-stranded oligonucleotides described in the present disclosure and the pharmaceutical compositions or oligonucleotide complexes described below, adjacent nucleotides are bound by a phosphodiester bond or a thiophosphodiester bond, and the non-bridging oxygen or sulfur atom in the phosphodiester bond or the thiophosphodiester bond may be negatively charged and exist as a hydroxyl or sulfanyl, and the hydrogen ions in the hydroxyl or sulfanyl may be partially or completely replaced by a cation. The cation may be any cation, for example, a metal cation, an ammonium ion NH4 + , or an organic ammonium cation. In consideration of improving solubility, in one embodiment, the cation is one or more selected from an alkali metal ion, an ammonium cation formed by a tertiary amine, and a quaternary ammonium cation. The alkali metal ion is K + And / or Na + and the cation formed by the tertiary amine may be an ammonium ion formed by triethylamine and / or an ammonium ion formed by N,N-diisopropylethylamine. Thus, the double-stranded oligonucleotide or oligonucleotide complex described in the present disclosure may exist at least partially as a salt. In one embodiment, the non-bridging oxygen or sulfur atom in the phosphodiester or thiophosphodiester bond is at least partially bound to a sodium ion, and the double-stranded oligonucleotide or oligonucleotide complex described in the present disclosure exists as a sodium salt or partial sodium salt.

[0092] The double-stranded oligonucleotide provided by the present disclosure can be obtained by a general method for preparing double-stranded oligonucleotide in the field (for example, solid-phase synthesis method and liquid-phase synthesis method). Here, solid-phase synthesis is already available as a commercial customization service. Modified nucleotide groups can be introduced into the double-stranded oligonucleotide described in the present disclosure by using nucleoside monomers having corresponding modifications, and the methods for preparing nucleoside monomers having corresponding modifications and the methods for introducing modified nucleotide groups into double-stranded oligonucleotides are also well known to those skilled in the art.

[0093] As those skilled in the art will be aware, modified nucleotide groups can be introduced into the double-stranded oligonucleotides described in the present disclosure by using nucleoside monomers with corresponding modifications.The methods of preparing nucleoside monomers with corresponding modifications and introducing modified nucleotide groups into double-stranded oligonucleotides are also well known to those skilled in the art.All modified nucleoside monomers can be purchased commercially or prepared by known methods.

[0094] The modified double-stranded oligonucleotide provided by the present disclosure may be used alone, may form a pharmaceutical composition with a pharma- ceutical acceptable carrier, may be bound to a conjugate molecule to form an oligonucleotide complex, or may be in other forms. An effective amount of the double-stranded oligonucleotide, the pharmaceutical composition, or the oligonucleotide complex is contacted with a cell to regulate the expression of a gene of interest, or the double-stranded oligonucleotide, the pharmaceutical composition, or the complex is administered to a subject to regulate the expression of a gene of interest, thereby achieving the purpose of treating a pathological condition or disease associated with the expression level of a gene of interest.

[0095] By forming a pharmaceutical composition with a suitable carrier or forming an oligonucleotide complex with a suitable complex molecule, the stability of the double-stranded oligonucleotide of the present disclosure in blood can be further improved, its targeting can be improved, and the in vivo delivery problem of the double-stranded oligonucleotide of the present disclosure can be solved. A carrier or complex molecule that can impart or improve targeting to a double-stranded oligonucleotide is very advantageous, thereby greatly improving the efficiency of the double-stranded oligonucleotide in regulating the expression of a target gene and reducing potential side effects. In addition, after the introduction of a targeting carrier or complex molecule, the double-stranded oligonucleotide must also be able to function at the on-target site, i.e., the coating / complexation of the carrier or complex molecule cannot affect the activity of the double-stranded oligonucleotide itself (for example, if the double-stranded oligonucleotide is an siRNA, it cannot affect the RNAi machinery that loads the siRNA into cells, i.e., the RISC complex). In addition, it is also required that these targeting carriers or complex molecules have good biocompatibility and as low toxicity as possible.

[0096] Said pharmaceutical composition can be distributed systematically in various parts of the body, or can be targeted and concentrated in a specific part of the body.Said complex generally has targeting property, and the type of complex molecule can be adaptively changed according to the expression distribution of target gene in human or animal in vivo, thereby achieving the purpose of delivering said double-stranded oligonucleotide to relevant part, for example, complex molecule can be a complex molecule that targets liver, lung, kidney or cancer cell.

[0097] Methods for reducing off-target effects In another aspect, the present disclosure further provides a method for reducing an off-target effect of a double-stranded oligonucleotide, the double-stranded oligonucleotide comprising a sense strand and an antisense strand, the off-target effect being an effect of the double-stranded oligonucleotide regulating an expression level of an mRNA other than an mRNA expressed by a gene of interest, the method comprising substituting at least one of nucleotides at positions 3 to 6 in the 5'-3' direction of the antisense strand with a stabilizing modified nucleotide as described in the present disclosure.

[0098] By carrying out the substitution, the method of the present disclosure can significantly reduce the off-target effect of the double-stranded oligonucleotide. In some embodiments, the method of the present disclosure maintains the ability of the double-stranded oligonucleotide to regulate expression of a target gene and significantly reduces the off-target effect of the double-stranded oligonucleotide. In some embodiments, the nucleotide at the third or fifth position in the antisense strand is substituted from the 5'-end toward the 3'-end. In some embodiments, two or less nucleotides among the nucleotides at the third to ninth positions in the antisense strand are substituted from the 5'-end toward the 3'-end. By limiting the number of stabilizing modified nucleotides at a particular position, the double-stranded oligonucleotide obtained by the method of the present disclosure can achieve an optimal balance between pharmaceutical activity and low off-target effect. In some embodiments, the nucleotide at the third and / or fifth position in the antisense strand is substituted from the 5'-end toward the 3'-end. In some embodiments, one of the nucleotides at the fourth, seventh, or ninth positions in the antisense strand is further substituted.

[0099] In the methods of the present disclosure, the definitions and selection ranges of the stabilizing modified nucleotides and stabilizing modification groups are as described above.

[0100] In some embodiments, the method of the disclosure comprises, on the antisense strand, from the 5' end to the 3' end: Substituting a stabilizing modified nucleotide at the third and / or fifth nucleotide position; Substituting stabilizing modified nucleotides at positions 3 and 9; Substituting stabilizing modified nucleotides at positions 5 and 7; and The method includes one of substituting stabilizing modified nucleotides for the nucleotides at positions 5 and 9.

[0101] In some embodiments, the substitution is not made to any nucleotide other than nucleotides 3 to 9 in the antisense strand from the 5' end to the 3' end.

[0102] In some embodiments, the method of the present disclosure further comprises substituting a nucleotide in the sense strand of the double-stranded oligonucleotide corresponding to the second nucleotide position from the 5' end to the 3' end in the antisense strand with a nucleotide mismatched with the second nucleotide in the antisense strand. In this case, the double-stranded oligonucleotide obtained by the method of the present disclosure has reduced off-target effects and further exhibits improved target gene expression regulating activity.

[0103] Pharmaceutical Compositions In another aspect, the present disclosure provides a pharmaceutical composition, comprising a double-stranded oligonucleotide provided by the present disclosure or obtained by the method of the present disclosure, and a pharma- ceutically acceptable carrier.

[0104] The pharma- ceutically acceptable carrier may be a carrier commonly used in the field of double-stranded oligonucleotide administration, such as magnetic nanoparticles (e.g., nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), poly(2-aminoethyl ethylene phosphate ester ... and poly(2-dimethylaminoethyl methacrylate) (PDMAEMA), and derivatives thereof.

[0105] In some embodiments, there is no particular requirement for the content of the double-stranded oligonucleotide and the pharma- ceutically acceptable carrier in the pharmaceutical composition, and in some embodiments, the weight ratio of the double-stranded oligonucleotide to the pharma- ceutically acceptable carrier may be 1:(1 to 500). In some embodiments, the weight ratio is 1:(1 to 50).

[0106] In some embodiments, the pharmaceutical composition may include other pharma- ceutically acceptable additives, which may be one or more of various agents or compounds commonly used in the art. For example, the other pharma-ceutically acceptable additives may include at least one of a pH buffer, a protectant, and an osmolality regulator.

[0107] The pH buffer solution may be a trishydroxymethylaminomethane hydrochloride buffer solution having a pH of 7.5 to 8.5 and / or a phosphate buffer solution having a pH of 5.5 to 8.5, for example, a phosphate buffer solution having a pH of 5.5 to 8.5.

[0108] The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose. The content of the protective agent may be 0.01 to 30% by weight based on the total weight of the pharmaceutical composition.

[0109] The osmotic pressure regulator may be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator is determined so that the osmotic pressure of the pharmaceutical composition is 200 to 700 milliosmoles per kilogram (mOsm / kg). Depending on the desired osmotic pressure, a person skilled in the art can easily determine the content of the osmotic pressure regulator. In some embodiments, the dosage during the administration of the formulation produced from the pharmaceutical composition is adjusted according to the administration method.

[0110] In some embodiments, the pharmaceutical composition may be a liquid formulation such as an injection solution, or may be a lyophilized powder injection that is mixed with a liquid additive at the time of administration to form a liquid formulation. The liquid formulation may be used for subcutaneous, intramuscular, or intravenous administration, but is not limited thereto, and may be administered to the lungs by aerosolization, or administered to other organ tissues (e.g., the liver) through the lungs by aerosolization, or the pharmaceutical composition may be delivered by a method such as oral inhalation or nasal administration, but is not limited thereto. In some embodiments, the pharmaceutical composition is administered by aerosolization.

[0111] In some embodiments, the pharmaceutical composition may be in the form of a liposome formulation. In some embodiments, the pharma- ceutical acceptable carrier used in the liposome formulation comprises an amine-containing transfection compound (hereinafter also referred to as organic amine), an auxiliary lipid, and / or a polyethylene glycolated lipid. Here, the organic amine, the auxiliary lipid, and the polyethylene glycolated lipid may be one or more selected from the amine-containing transfection compound or its pharma- ceutical acceptable salt or derivative, the auxiliary lipid, and the polyethylene glycolated lipid, respectively, described in Chinese Patent Publication No. 103380113 (incorporated herein by reference in its entirety).

[0112] In some embodiments, the organic amine may be a compound represented by formula (201) or a pharma- ceutically acceptable salt thereof, as described in Chinese Patent Publication No. 103380113:

[0113] [ka]

[0114] however, X 101 and X 102 are each independently O, S, NA, or CA, and A is hydrogen or C1-C 20 is a hydrocarbon chain, Y 101 and Z 101 are each independently C=O, C=S, S=O, CH-OH or SO2; R 101 , R 102 , R 103 , R 104 , R 105 , R 106 and R 107are each independently hydrogen, a cyclic or acyclic, substituted or unsubstituted, branched or straight chain aliphatic group, a cyclic or acyclic, substituted or unsubstituted, branched or straight chain heteroaliphatic group, a substituted or unsubstituted, branched or straight chain acyl, a substituted or unsubstituted, branched or straight chain aryl, or a substituted or unsubstituted, branched or straight chain heteroaryl; x is an integer from 1 to 10; n is an integer of 1 to 3, m is an integer of 0 to 20, and p is 0 or 1, where m=p=0, R 102 is hydrogen, When at least one of n and m is 2, R 103 and the nitrogen in formula (201) form a structure represented by formula (202) or formula (203).

[0115] [ka]

[0116] In the above, g, e, and f are each independently an integer of 1 to 6, and "HCC" represents a hydrocarbon chain. * N represents a nitrogen atom in formula (201).

[0117] In some embodiments, R 103 is a polyamine. In other embodiments, R 103 In some embodiments, R in formula (201) is a ketal. 101 and R 102 is independently any substituted or unsubstituted, branched or straight chain alkyl or alkenyl, said alkyl or alkenyl having 3 to about 20 carbon atoms, e.g., 8 to about 18 carbon atoms, and 0 to 4 double bonds, e.g., 0 to 2 double bonds.

[0118] In some embodiments, when each of n and m is independently a value of 1 or 3, R 103 may be any one of the following formulas (204) to (213).

[0119] [ka]

[0120] In formulae (204) to (213), g, e, and f each independently represent an integer of 1 to 6, each "HCC" represents a hydrocarbon chain, * is R 103 and the nitrogen atom in formula (201), and * Each H on position may be substituted to provide a bond with the nitrogen atom in formula (201).

[0121] Those skilled in the art can obtain the compound of formula (201) by any reasonable method. In some embodiments, the compound of formula (201) can be prepared according to the description in Chinese Patent Publication No. 103380113.

[0122] In some embodiments, the organic amine is an organic amine represented by formula (214) and / or an organic amine represented by formula (215).

[0123] [ka]

[0124] the co-lipid is cholesterol, a cholesterol analogue and / or a cholesterol derivative; The polyethylene glycolated lipid is 1,2-dipalmitoyl-sn-glycero-3-phosphatidylethanolamine-N-[methoxy(polyethylene glycol)]-2000.

[0125] In some embodiments, the molar ratio of the organic amine, the colipid, and the polyethylene glycolated lipid in the pharmaceutical composition is (19.7 to 80):(19.7 to 80):(0.3 to 50), and may be, for example, (50 to 70):(20 to 40):(3 to 20).

[0126] In some embodiments, the pharmaceutical composition particles formed by the double-stranded oligonucleotides of the present disclosure and the amine-containing transfection reagent have an average diameter of about 30 nm to about 200 nm, typically about 40 nm to about 135 nm, and more typically, the average diameter of the liposome particles is about 50 nm to about 120 nm, about 50 nm to about 100 nm, about 60 nm to about 90 nm, or about 70 nm to about 90 nm, e.g., the average diameter of the liposome particles is about 30, 40, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 140, 150, or 160 nm.

[0127] In some embodiments, in the pharmaceutical composition formed by the double-stranded oligonucleotide of the present disclosure and the amine-containing transfection reagent, the weight ratio (weight / weight ratio) of the double-stranded oligonucleotide to the total lipid (e.g., organic amine, auxiliary lipid, and / or PEGylated lipid) is within the range of about 1:1 to about 1:50, about 1:1 to about 1:30, about 1:3 to about 1:20, about 1:4 to about 1:18, about 1:5 to about 1:17, about 1:5 to about 1:15, about 1:5 to about 1:12, about 1:6 to about 1:12, or about 1:6 to about 1:10, for example, the weight ratio of the double-stranded oligonucleotide of the present disclosure to the total lipid is about 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, or 1:18.

[0128] In some embodiments, the pharmaceutical composition may be marketed with each component being independent, or may be in the form of a liquid formulation when used. In some embodiments, the pharmaceutical composition formed by the double-stranded oligonucleotide provided by the present disclosure and the above-mentioned pharmaceutical acceptable carrier may be prepared according to various known methods, and the double-stranded oligonucleotide provided by the present disclosure may be used instead of the conventional double-stranded oligonucleotide. In some embodiments, it may be prepared according to the following method.

[0129] The organic amine, auxiliary lipid and polyethylene glycolated lipid are suspended in alcohol in the above molar ratio and mixed uniformly to obtain a lipid solution. The amount of alcohol is determined so that the total mass concentration of the obtained lipid solution is 2 to 25 mg / mL, for example, 8 to 18 mg / mL. The alcohol is one or more selected from pharma- ceutically acceptable alcohols, such as ethanol, propylene glycol, benzyl alcohol, glycerin, polyethylene glycol 200, polyethylene glycol 300, polyethylene glycol 400, and other alcohols that are liquid at around room temperature, and may be, for example, ethanol.

[0130] The double-stranded oligonucleotide provided by the present disclosure is dissolved in a buffer salt solution to obtain a double-stranded oligonucleotide aqueous solution. The concentration of the buffer salt solution is 0.05 to 0.5 M, and may be, for example, 0.1 to 0.2 M, and the pH of the buffer salt solution is adjusted to 4.0 to 5.5, and may be, for example, 5.0 to 5.2, and the amount of the buffer salt solution is determined so that the concentration of the double-stranded oligonucleotide is 0.6 mg / mL or less, and may be, for example, 0.2 to 0.4 mg / mL. The buffer salt is one or more selected from soluble acetates and soluble citrates, and may be, for example, sodium acetate and / or potassium acetate.

[0131] After mixing the lipid solution and the double-stranded oligonucleotide aqueous solution, the resulting product is incubated at 40-60°C for at least 2 minutes, for example, 5-30 minutes, to obtain an incubated liposome formulation. The volume ratio of the lipid solution to the double-stranded oligonucleotide aqueous solution is 1:(2-5), and may be, for example, 1:4.

[0132] The incubated liposome preparation is concentrated or diluted, impurities are removed, and bacteria are sterilized to obtain a pharmaceutical composition provided by the present disclosure, whose physicochemical parameters are pH 6.5-8, encapsulation efficiency 80% or more, particle size 40-200 nm, polydispersity index 0.30 or less, and osmotic pressure 250-400 mOsm / kg, and for example, the physicochemical parameters may be pH 7.2-7.6, encapsulation efficiency 90% or more, particle size 60-100 nm, polydispersity index 0.20 or less, and osmotic pressure 300-400 mOsm / kg.

[0133] Here, the concentration or dilution may be performed before removing impurities, after removing impurities, or simultaneously. As a method for removing impurities, various conventional methods may be used, for example, ultrafiltration may be performed under conditions of 100K Da using a tangential flow system and a hollow fiber column, and the ultrafiltration exchange solution may be a phosphate buffer solution (PBS) of pH 7.4. As a method for sterilization, various conventional methods may be used, for example, sterilization may be performed by filtering through a 0.22 μm filter.

[0134] Oligonucleotide Conjugates In another aspect, the present disclosure provides an oligonucleotide conjugate. The oligonucleotide conjugate comprises a double-stranded oligonucleotide provided by the present disclosure or obtained by the method of the present disclosure, and a conjugated group conjugated to the double-stranded oligonucleotide. In some embodiments, the conjugated group comprises a linker and a pharma- ceutically acceptable targeting group and / or delivery aid group, and the double-stranded oligonucleotide, the linker, the targeting group or the delivery aid group may be covalently or non-covalently linked in turn, and each of the targeting groups is selected from a ligand capable of binding to a cell surface receptor, and each of the delivery aid groups is selected from a group capable of improving the biocompatibility of the oligonucleotide conjugate in a delivery destination organ or tissue.

[0135] In the context of the present disclosure, unless otherwise specified, "conjugate" refers to two or more chemical moieties each having a specific function being covalently bonded to each other, and accordingly, "conjugate" refers to a compound formed by covalently bonding the respective chemical moieties. Furthermore, "oligonucleotide conjugate" refers to a compound formed by covalently bonding one or more chemical moieties having a specific function to an oligonucleotide. Depending on the context, the oligonucleotide conjugate should be understood as a general term for multiple oligonucleotide conjugates, or an oligonucleotide conjugate represented by a certain chemical formula. In the context of the present disclosure, a "conjugate molecule" should be understood as a specific compound that can be conjugated to an oligonucleotide by reacting to ultimately form the oligonucleotide conjugate of the present disclosure.

[0136] In general, the conjugated group includes at least one pharma- ceutically acceptable targeting group and an optional linker, and the double-stranded oligonucleotide, the linker, and the targeting group are sequentially bound. In one embodiment, the number of targeting groups is 1 to 6. In one embodiment, the number of targeting groups is 2 to 4. The double-stranded oligonucleotide A1 may be non-covalently or covalently conjugated to the conjugated group, for example, may be covalently conjugated to the conjugated group. The conjugation site between the double-stranded oligonucleotide and the conjugated group may be at the 3' or 5' end of the sense strand of the double-stranded oligonucleotide, at the 5' end of the antisense strand, or in an internal sequence of the double-stranded oligonucleotide. In some specific embodiments, the conjugation site between the double-stranded oligonucleotide and the conjugated group is at the 3' end of the sense strand of the double-stranded oligonucleotide.

[0137] In some embodiments, the conjugated group may be attached to the phosphate group, 2'-hydroxyl or base of the nucleotide. In some embodiments, the conjugated group may be attached to the 3'-hydroxyl, in which case the nucleotides are linked by a 2'-5' phosphodiester bond. When the conjugated group is attached to the end of a double-stranded oligonucleotide, it is usually attached to the phosphate group of the nucleotide, and when the conjugated group is attached to an internal sequence of a double-stranded oligonucleotide, it is usually attached to the ribose sugar ring or base. For various binding methods, see Muthiah Manoharan et.al. siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo in hepatocytes. ACS Chemical biology,2015,10 (5):1181-7.

[0138] In some embodiments, the double-stranded oligonucleotide and the conjugation group can be linked by acid-labile or reducible chemical bond, and in the acidic environment of cell endosome, these chemical bonds can be degraded, thereby making the double-stranded oligonucleotide free.For non-degradable conjugation method, the conjugation group is bound to the sense strand of the double-stranded oligonucleotide, so that the influence of conjugation on the activity of the double-stranded oligonucleotide can be minimized.

[0139] The targeting group may be linked to the double-stranded oligonucleotide molecule via a suitable linker, and those skilled in the art can select a suitable linker according to the specific type of the targeting group. For these linkers, the types of targeting groups and the method of linking to the double-stranded oligonucleotide, reference may be made to the disclosure of WO2015006740, the contents of which are incorporated herein by reference in their entirety.

[0140] In some embodiments, the targeting group may be a ligand commonly used in the field of double-stranded oligonucleotide administration, such as various ligands described in WO2009082607, the disclosure of which is incorporated herein by reference in its entirety.

[0141] In some embodiments, the or each targeting group is selected from a ligand capable of binding to a cell surface receptor expressing said gene of interest.

[0142] In some embodiments, at least one or each of the targeting groups is selected from a ligand capable of binding to a receptor on the surface of mammalian liver parenchymal cells. In some embodiments, each of the targeting groups is independently a ligand having affinity for an asialoglycoprotein receptor on the surface of mammalian liver cells. In some embodiments, each of the targeting groups is independently an asialoglycoprotein or a sugar. In some embodiments, each of the targeting groups is independently an asialoglycoprotein or a sugar. In some embodiments, each of the targeting groups is selected from D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-gluc ... Glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-butyrylgalactosamine, N-isopropyl ... Sobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formylamino-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl ethyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucoheptopyranoside, 2,5-anhydro-D-allonitrile, ribose, D-ribose, D-4-thioribose, L-ribose, and L-4-thioribose.In some embodiments, at least one or each said targeting group is galactose or N-acetylgalactosamine.

[0143] In some embodiments, at least one or each of the targeting groups is selected from a ligand capable of binding to a pulmonary epithelial cell surface receptor. In some embodiments, each of the targeting groups is selected from a group that targets integrin αvβ6 or a group that targets integrin αvβ3. In some embodiments, each of the targeting groups is independently a polypeptide or a small molecule ligand.

[0144] In some embodiments, the or each delivery-promoting group is selected from groups capable of enhancing the biocompatibility of the oligonucleotide complex in the central nervous system. In some embodiments, the or each delivery-promoting group is selected from lipophilic molecules. In some embodiments, each delivery-promoting group is selected from C5-C 18 It is a straight chain hydrocarbon group or a steroid compound.

[0145] In some embodiments, the linker in an oligonucleotide conjugate of the present disclosure has the structure shown in formula (301):

[0146] [ka]

[0147] where k is an integer from 1 to 3, L A has a structure containing an amide bond as shown in formula (302), and L B has a structure containing an N-acylpyrrolidine represented by formula (303), contains a carbonyl and an oxygen atom, and L C is a linking group based on hydroxymethylaminomethane, dihydroxymethylaminomethane or trihydroxymethylaminomethane.

[0148] [ka]

[0149] However, n 302 , q 302 and p 302 are each independently an integer of 2 to 6, and preferably, 302 , q 302 and p 302 are each independently 2 or 3; n 303 is an integer from 4 to 16, preferably, 303 is an integer between 8 and 12, JPEG2024528634000016.jpg5124 represents the site to which the group is covalently attached.

[0150] In the linker, L A each is linked to one of the targeting groups by an ether bond; C The oxygen atom of the hydroxyl in the moiety L C The L moiety is linked by forming an ether bond. B In formula (303), the carbonyl is L C The oxygen atom in formula (303) is bonded to the double-stranded oligonucleotide by forming a phosphate bond or a thiophosphate bond through the oxygen atom in the formula (303).

[0151] In some embodiments, the oligonucleotide conjugate provided by the present disclosure has the structure shown in formula (305):

[0152] [ka]

[0153] Here, Nu represents a double-stranded oligonucleotide provided by the present disclosure or obtained by the method of the present disclosure.

[0154] In some embodiments, the linker in an oligonucleotide conjugate of the present disclosure has the structure shown in formula (306):

[0155] [ka]

[0156] However, n 306 is an integer from 0 to 3, and each p 306 are independently an integer from 1 to 6, JPEG2024528634000019.jpg5139 represents a site to which a group is covalently attached, said linking group being * The oxygen atom indicated by # is linked to the targeting group by forming an ether bond, and the linking group is linked to the double-stranded oligonucleotide by forming a phosphate bond or a thiophosphate bond with at least one of the oxygen atoms indicated by #, and the other oxygen atom indicated by # is linked to a hydrogen atom to form a hydroxyl or to a C1-C3 alkyl to form a C1-C3 alkoxy.

[0157] In some embodiments, the oligonucleotide conjugate of the present disclosure has the structure shown in formula (307).

[0158] [ka]

[0159] Here, Nu represents a double-stranded oligonucleotide provided by the present disclosure or obtained by the method of the present disclosure.

[0160] In some embodiments, the oligonucleotide conjugate of the present disclosure has the structure shown in formula (308).

[0161] [ka]

[0162] however, n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4, m1, m2, and m3 each independently represent an integer selected from 2 to 10; R 10 , R 11 , R 12 , R 13 , R 14 or R 15 are each independently H or C1-C 10 Alkyl, C1-C 10 Alkyl halides and C1-C 10 alkoxy; R3 has the structure shown in formula A59.

[0163] [ka]

[0164] wherein E1 is OH, SH, or BH2, and Nu represents a double-stranded oligonucleotide provided by the present disclosure or obtained by the method of the present disclosure.

[0165] R2 is a straight chain alkylene of 1 to 20 carbon atoms in length, where one or more of the carbon atoms is selected from the group consisting of C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenylene, C2-C 10 Alkynylene, C6-C 10 Arylene, C3-C 18 Heterocyclylene and C5-C 10 heteroarylene, and R2 is C1-C 10 Alkyl, C6-C 10 Aryl, C5-C 10 Heteroaryl, C1-C 10 Alkyl halides, -OC1-C 10 Alkyl, -OC1-C 10 Alkylphenyl, -C1-C10 Alkyl-OH, -OC1-C 10 Alkyl halides, -SC1-C 10 Alkyl, -SC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-SH, -SC1-C 10 Alkyl halides, halogen substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2, -N(C1-C 10 Alkyl)(C1-C 10 alkyl), -NH(C1-C 10 Alkyl), -N(C1-C 10 Alkyl)(C1-C 10 alkylphenyl), -NH(C1-C 10 alkylphenyl), cyano, nitro, -CO2H, -C(O)O(C1-C 10 alkyl), -CON(C1-C 10 Alkyl)(C1-C 10 alkyl), -CONH(C1-C 10 alkyl), -CONH2, -NHC(O)(C1-C 10 alkyl), -NHC(O)(phenyl), -N(C1-C 10 Alkyl)C(O)(C1-C 10 Alkyl), -N(C1-C 10 alkyl)C(O)(phenyl), -C(O)C1-C 10 Alkyl, -C(O)C1-C 10 Alkylphenyl, -C(O)C1-C 10 Haloalkyl, -OC(O)C1-C 10 Alkyl, -SO2(C1-C 10 alkyl), -SO2(phenyl), -SO2(C1-C 10 Alkyl halides), -SO2NH2, -SO2NH(C1-C 10 alkyl), -SO2NH(phenyl), -NHSO2(C1-C 10 alkyl), -NHSO2(phenyl) and -NHSO2(C1-C 10 and optionally having one or more substituents selected from the group consisting of alkyl halide, Each L1 is independently a straight chain alkylene having a length of 1 to 70 carbon atoms, wherein one or more of the carbon atoms is selected from the group consisting of C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenylene, C2-C 10 Alkynylene, C6-C 10 Arylene, C3-C 18 Heterocyclylene and C5-C 10 heteroarylene, and L1 is C1-C 10 Alkyl, C6-C 10 Aryl, C5-C 10 Heteroaryl, C1-C 10 Alkyl halides, -OC1-C 10 Alkyl, -OC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-OH, -OC1-C 10 Alkyl halides, -SC1-C 10 Alkyl, -SC1-C 10 Alkylphenyl, -C1-C 10 Alkyl-SH, -SC1-C 10 Alkyl halides, halogen substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2, -N(C1-C 10 Alkyl)(C1-C 10 alkyl), -NH(C1-C 10 Alkyl), -N(C1-C 10 Alkyl)(C1-C 10 alkylphenyl), -NH(C1-C 10 alkylphenyl), cyano, nitro, -CO2H, -C(O)O(C1-C 10 alkyl), -CON(C1-C 10 Alkyl)(C1-C 10 alkyl), -CONH(C1-C 10 alkyl), -CONH2, -NHC(O)(C1-C 10 alkyl), -NHC(O)(phenyl), -N(C1-C 10 Alkyl)C(O)(C1-C 10 Alkyl), -N(C1-C 10alkyl)C(O)(phenyl), -C(O)C1-C 10 Alkyl, -C(O)C1-C 10 Alkylphenyl, -C(O)C1-C 10 Haloalkyl, -OC(O)C1-C 10 Alkyl, -SO2(C1-C 10 alkyl), -SO2(phenyl), -SO2(C1-C 10 Alkyl halides), -SO2NH2, -SO2NH(C1-C 10 alkyl), -SO2NH(phenyl), -NHSO2(C1-C 10 alkyl), -NHSO2(phenyl) and -NHSO2(C1-C 10 and optionally having one or more substituents selected from the group consisting of alkyl halide, JPEG2024528634000023.jpg5138 represents the site to which the group is covalently attached, M1 represents a targeting group, and its definition and selectable range are the same as those described above. In some embodiments, each M1 is an independently selected one from ligands having affinity for the asialoglycoprotein receptor on the surface of mammalian hepatocytes.

[0166] For convenience, L1 is defined as a linear alkyl, but it will be understood by those skilled in the art that it may be, for example, an amino or alkenyl resulting from the above replacement and / or substitution, which may not be a linear group or may have a different name. For purposes of this disclosure, the length of L1 is the number of atoms in the chain connecting the two attachment points. For this purpose, the ring (e.g., heterocyclylene or heteroarylene) obtained by substituting the carbon atoms of the linear alkylene is considered to be one atom.

[0167] When M1 is a ligand having affinity for the asialoglycoprotein receptor on the surface of mammalian hepatocytes, in some embodiments, n1 may be an integer of 1-3, and n3 may be an integer of 0-4, ensuring that the number of M1 ligands in the complex is at least 2. In some embodiments, n1+n3≧2, so that the number of M1 ligands is at least 3, which allows the M1 ligand to bind more easily to the asialoglycoprotein receptor on the surface of the liver, and further promotes the complex to be taken up into cells by intracellular uptake. As can be seen from experiments, when the number of M1 ligands is 3 or more, the ease of binding between the M1 ligand and the asialoglycoprotein receptor on the surface of the liver is not clearly improved. Therefore, in consideration of various aspects such as ease of synthesis, structure / process cost, and delivery efficiency, in some embodiments, n1 is an integer of 1-2, n3 is an integer of 0-1, and n1+n3=2-3.

[0168] In some embodiments, the spatial positions between the M1 ligands can be adapted for binding of the M1 ligand to the asialoglycoprotein receptor on the liver surface when m1, m2, and m3 are independently integers selected from 2 to 10. To simplify, facilitate synthesis, and / or reduce costs of the conjugates provided by the present disclosure, in some embodiments, m1, m2, and m3 are each independently an integer from 2 to 5, and in some embodiments, m1=m2=m3.

[0169] R 10 , R 11 , R 12 , R 13 , R 14 and R 15 are H, C1-C, respectively. 10 Alkyl, C1-C 10 Alkyl halides and C1-C 10 It will be understood by those skilled in the art that when R is one independently selected from alkoxy, any of them can achieve the objectives of the present disclosure without changing the properties of the conjugates of the present disclosure.10 , R 11 , R 12 , R 13 , R 14 and R 15 Each is independently selected from H, methyl, and ethyl. 10 , R 11 , R 12 , R 13 , R 14 and R 15 are both H.

[0170] According to the oligonucleotide conjugates provided by the present disclosure, R3 is a group having the structure shown in formula A59, wherein E1 is OH, SH or BH2, and in some embodiments, E1 is OH or SH, taking into consideration the availability of preparation raw materials.

[0171] In some embodiments, R2 is selected to provide a bond between N on the nitrogen-containing backbone and A59. In the context of this disclosure, a "nitrogen-containing backbone" refers to R 10 , R 11 , R 12 , R 13 , R 14 and R 15 A59 refers to a chain structure in which the carbon atom to which A59 is bonded and N are bonded to each other. Thus, R2 may be any linking group capable of linking the group of A59 to the N on the nitrogen-containing backbone in an appropriate manner. In some embodiments, when preparing the oligonucleotide conjugate of the present disclosure by a solid phase synthesis process, the R2 group must include both a linking site that is linked to the N on the nitrogen-containing backbone and a linking site that is linked to P in R3. In some embodiments, the site that is linked to the N on the nitrogen-containing backbone in R2 forms an amide bond with N, and the site that is linked to P on R3 forms a phosphate ester bond with P. In some embodiments, R2 is B5, B6, B5', or B6'.

[0172] [ka]

[0173] however, JPEG2024528634000025.jpg5136 represents the site to which the group is covalently attached.

[0174] The value of q2 may range from 1-10, and in some embodiments, q2 is an integer from 1-5.

[0175] L1 serves to link the M1 ligand to the N on the nitrogen-containing backbone and provide targeting functionality to the oligonucleotide conjugates of the present disclosure. In some embodiments, L1 is a combination of one or more bonds selected from the groups of formulae A1-A26. In some embodiments, L1 is a combination of one or more bonds selected from A1, A4, A5, A6, A8, A10, A11, and A13, in some embodiments, L1 is a combination of at least two bonds selected from A1, A4, A8, A10, and A11, in some embodiments, L1 is a combination of at least two bonds selected from A1, A8, A10.

[0176] [ka]

[0177] In some embodiments, the length of L1 can be 3 to 25 atoms, 3 to 20 atoms, 4 to 15 atoms, or 5 to 12 atoms. In some embodiments, the length of L1 is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, or 60 atoms.

[0178] In some embodiments, j1 is an integer from 2 to 10, and in some embodiments, j1 is an integer from 3 to 5. In some embodiments, j2 is an integer from 2 to 10, and in some embodiments, j2 is an integer from 3 to 5. R' is a C1-C4 alkyl, and in some embodiments, R' is one of methyl, ethyl, and isopropyl. Ra is one of A27, A28, A29, A30, and A31, and in some embodiments, Ra is A27 or A28. Rb is a C1-C5 alkyl, and in some embodiments, Rb is one of methyl, ethyl, isopropyl, and butyl. In some embodiments, j1, j2, R', Ra, and Rb are each selected in formulae A1 to A26 to realize the binding of the M1 ligand to N on the nitrogen-containing backbone, and the spatial position between the M1 ligands is more suitable for the binding of the M1 ligand to the asialoglycoprotein receptor on the liver surface.

[0179] [ka]

[0180] In some embodiments, the oligonucleotide conjugate of the present disclosure has a structure as shown in formula (403), (404), (405), (406), (407), (408), (409), (410), (411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421) or (422).

[0181] [ka] JPEG2024528634000029.jpg205154JPEG2024528634000030.jpg206148JPEG2024528634000031.jpg134167JPEG20245286340 00032.jpg122152JPEG2024528634000033.jpg222157JPEG2024528634000034.jpg222148JPEG2024528634000035.jpg231137

[0182] In some embodiments, P in formula A59 may be attached to any possible position in the double-stranded oligonucleotide sequence, for example, P in formula A59 may be attached to any one nucleotide of the sense strand or antisense strand of the double-stranded oligonucleotide, and in some embodiments, P in formula A59 is attached to any one nucleotide of the sense strand of the double-stranded oligonucleotide. In some embodiments, P in formula A59 is attached to the end of the sense strand or antisense strand of the double-stranded oligonucleotide, and in some embodiments, P in formula A59 is attached to the end of the sense strand of the double-stranded oligonucleotide. The end refers to the first four nucleotides from the end of the sense strand or the antisense strand. In some embodiments, P in formula A59 is attached to the end of the sense strand or the antisense strand of the double-stranded oligonucleotide, and in some embodiments, P in formula A59 is attached to the 3' end of the sense strand of the double-stranded oligonucleotide. When bound to the above-mentioned position of the sense strand of a double-stranded oligonucleotide, the complex provided by the present disclosure can, upon unwinding after entering a cell, release the antisense strand of the single double-stranded oligonucleotide to regulate the expression of a target gene.

[0183] P in formula A59 may be attached to any available position on a nucleotide in a double-stranded oligonucleotide, such as the 5' position of a nucleotide, the 2' position of a nucleotide, the 3' position of a nucleotide, or the base of a nucleotide. In some embodiments, P in formula A59 may be attached to the 2', 3', or 5' position of a nucleotide in the double-stranded oligonucleotide by forming a phosphodiester bond. In some embodiments, P in formula A59 is attached to the oxygen atom of the dehydrogenated 3' hydroxyl of the 3'-terminal nucleotide of the sense strand of the double-stranded oligonucleotide, or P in formula A59 is attached to a nucleotide by replacing the hydrogen in the 2'-hydroxyl of one nucleotide in the sense strand of the double-stranded oligonucleotide, or P in formula A59 is attached to a nucleotide by replacing the hydrogen in the 5' hydroxyl of the 5'-terminal nucleotide of the sense strand of the double-stranded oligonucleotide.

[0184] In some embodiments, the double-stranded oligonucleotide contained in the oligonucleotide complex of the present disclosure may be siRNA, and in this case, the oligonucleotide complex of the present disclosure is also called siRNA complex.In some embodiments, the double-stranded oligonucleotide contained in the oligonucleotide complex of the present disclosure may be, for example, the siRNA shown in Table 1.The oligonucleotide complex containing these siRNAs shows low off-target effect and high suppression activity against the mRNA expressed by the target gene.

[0185] Preparation of the Oligonucleotide Conjugates of the Disclosure The oligonucleotide complex may be synthesized by a method already described in detail in the prior art. For example, WO 2015006740 describes in detail the preparation method of several siRNA complexes. When the double-stranded oligonucleotide is siRNA, the oligonucleotide complex of the present disclosure can also be obtained by a method well known to those skilled in the art. For example, WO 2014025805 describes the preparation method of the structure shown in formula (305), and Rajeev et al. described the preparation method of the structure shown in formula (307) in ChemBioChem 2015, 16, 903-908. China Patent Publication No. 110959011 also discloses in detail the preparation method of the oligonucleotide complex shown in formula (308). The above literature contents are incorporated herein in their entirety by reference.

[0186] The oligonucleotide complex of the present disclosure may be used in combination with other pharma- ceutically acceptable additives, which may be one or more of various preparations or compounds commonly used in the art, and for details, please refer to the description of the pharmaceutical composition of the present disclosure above.

[0187] Uses of the disclosed double-stranded oligonucleotides, pharmaceutical compositions and oligonucleotide conjugates In some embodiments, the present disclosure provides a use of the double-stranded oligonucleotide provided by the present disclosure, the double-stranded oligonucleotide obtained by the method of the present disclosure, the pharmaceutical composition and / or the oligonucleotide complex in a drug for treating and / or preventing a disease or condition related to the mRNA level expressed by a gene of interest. In some embodiments, the specific gene is a gene abnormally expressed in liver cells. In some embodiments, the specific gene is an endogenous gene expressed in the liver. In some embodiments, the specific gene is a pathogen gene that grows in the liver. In some embodiments, the specific gene is a gene expressed in lung epithelial cells. In some embodiments, the specific gene is a gene expressed in the central nervous system. In some embodiments, the specific gene is a gene expressed in tumor cells. In some embodiments, the mRNA expressed by the gene of interest is one selected from the mRNAs transcribed by the genes ACE2, AGT, ANGPTL3, ApoA, ApoB, ApoC, AR, ASK1, C3, C5, Col1A1, CTGF, Ebola, FOXO1, FTO, FVII, FXI, FXII, GCGR, HBV, HCV, HSD, p53, PCSK9, PNP, PLG, PKK, KNG, RAGE, RPTOR, SARS-CoV-2, SCD1, SCNN1A, SOD1, STAT3, TIMP-1, TMPRSS6, and XO. In some embodiments, the mRNA expressed by the gene of interest is selected from the mRNAs expressed by the hepatitis B virus gene (HBV), the mRNAs expressed by the angiopoietin-like protein 3 (ANGPTL3) gene, or the mRNAs expressed by the apolipoprotein C3 (ApoC3) gene. In some embodiments, the disease or condition associated with the mRNA level expressed by the gene of interest is chronic liver disease, hepatitis, liver fibrosis, liver proliferative disease, and / or dyslipidemia. In some embodiments, the disease or condition associated with the mRNA level expressed by the gene of interest is hepatitis B or dyslipidemia.In some embodiments, the dyslipidemia is hypercholesterolemia, hypertriglyceridemia, or atherosclerosis.

[0188] In some embodiments, the present disclosure provides a method for treating and / or preventing a disease or condition associated with an mRNA level expressed by a gene of interest. The method includes administering an effective amount of a double-stranded oligonucleotide provided by the present disclosure, a double-stranded oligonucleotide obtained by the method of the present disclosure, a pharmaceutical composition and / or an oligonucleotide complex to a subject in need thereof. In some embodiments, the mRNA expressed by the gene of interest is one selected from the mRNAs transcribed by the following genes: ACE2, AGT, ANGPTL3, ApoA, ApoB, ApoC, AR, ASK1, C3, C5, Col1A1, CTGF, Ebola, FOXO1, FTO, FVII, FXI, FXII, GCGR, HBV, HCV, HSD, p53, PCSK9, PNP, PLG, PKK, KNG, RAGE, RPTOR, SARS-CoV-2, SCD1, SCNN1A, SOD1, STAT3, TIMP-1, TMPRSS6, XO. In some embodiments, the mRNA expressed by the gene of interest is selected from the mRNA expressed by the Hepatitis B Virus gene (HBV), the mRNA expressed by the Angiopoietin-like protein 3 (ANGPTL3) gene, or the mRNA expressed by the Apolipoprotein C3 (ApoC3) gene. In some embodiments, the disease or condition associated with the mRNA level expressed by the gene of interest is chronic liver disease, hepatitis, liver fibrosis, liver proliferative disease, and / or dyslipidemia. In some embodiments, the disease or condition associated with the mRNA level expressed by the gene of interest is hepatitis B or dyslipidemia. In some embodiments, the dyslipidemia is hypercholesterolemia, hypertriglyceridemia, or atherosclerosis.

[0189] In some embodiments, the conjugates provided by the present disclosure can also be used to treat other liver diseases, including diseases characterized by unwanted cell proliferation, hematological diseases, metabolic diseases, and diseases characterized by inflammation. The liver proliferative disease can be a benign or malignant disease, such as cancer, hepatocellular carcinoma (HCC), liver metastasis, or hepatoblastoma. The liver hematological or inflammatory disease can be a disease related to blood coagulation factors, complement-mediated inflammation, or fibrosis. The liver metabolic disease includes dyslipidemia and glucose regulation irregularities. In one embodiment, the disease is treated by administering one or more double-stranded oligonucleotides having a sequence highly homologous to a gene sequence involved in the disease.

[0190] In some embodiments, the present disclosure provides a method for regulating the expression level of a gene of interest in a cell. The method includes contacting the cell with an effective amount of a double-stranded oligonucleotide provided by the present disclosure, a double-stranded oligonucleotide obtained by the method of the present disclosure, a pharmaceutical composition and / or an oligonucleotide complex. In some embodiments, the mRNA expressed by the gene of interest is one selected from the mRNAs transcribed by the following genes: ACE2, AGT, ANGPTL3, ApoA, ApoB, ApoC, AR, ASK1, C3, C5, Col1A1, CTGF, Ebola, FOXO1, FTO, FVII, FXI, FXII, GCGR, HBV, HCV, HSD, p53, PCSK9, PNP, PLG, PKK, KNG, RAGE, RPTOR, SARS-CoV-2, SCD1, SCNN1A, SOD1, STAT3, TIMP-1, TMPRSS6, XO. In some embodiments, the regulation refers to suppressing the expression of a gene of interest in a cell, and the mRNA expressed by the gene of interest is selected from the mRNA expressed by the Hepatitis B virus gene (HBV), the mRNA expressed by the angiopoietin-like protein 3 (ANGPTL3) gene, or the mRNA expressed by the apolipoprotein C3 (ApoC3) gene.

[0191] The double-stranded oligonucleotide provided by the present disclosure, the double-stranded oligonucleotide obtained by the method of the present disclosure, the pharmaceutical composition and / or the oligonucleotide complex can be administered to a subject in need thereof to achieve the purpose of preventing and / or treating a pathological condition or disease caused by the expression of a specific gene in a cell by a mechanism of regulating gene expression. Therefore, the double-stranded oligonucleotide provided by the present disclosure, the double-stranded oligonucleotide obtained by the method of the present disclosure, the pharmaceutical composition and / or the oligonucleotide complex can be used for the prevention and / or treatment of the pathological condition or disease, and can be used for the preparation of a drug for preventing and / or treating the pathological condition or disease described herein.

[0192] The term "pharmaceutical administration / administration" as used herein refers to placing a double-stranded oligonucleotide, pharmaceutical composition, and / or oligonucleotide complex into the body of a subject by a method or route that at least partially localizes the double-stranded oligonucleotide, pharmaceutical composition, and / or oligonucleotide complex to a desired site to produce a desired effect. Routes of administration suitable for the methods of the present disclosure include local administration and systemic administration. Generally, local administration delivers more of the double-stranded oligonucleotide, pharmaceutical composition, and / or oligonucleotide complex to a specific site than to the entire body of the subject, while systemic administration delivers the double-stranded oligonucleotide, pharmaceutical composition, and / or oligonucleotide complex to substantially the entire body of the subject.

[0193] Administration to a subject may be by any suitable route known in the art, including, but not limited to, oral or parenteral routes, such as intravenous, intramuscular, subcutaneous, transdermal, intratracheal (aerosol), pulmonary, nasal, rectal, and topical (including buccal and sublingual) administration. The frequency of administration may be once or more per day, week, biweekly, triweekly, monthly, or yearly.

[0194] The dose of the double-stranded oligonucleotide, pharmaceutical composition and / or oligonucleotide complex described in the present disclosure may be a dose common in the art, and the dose may be determined according to various parameters, in particular the age, weight and sex of the subject. Toxicity and therapeutic efficacy are measured by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., LD 50 (the dose that kills 50% of the colony) and ED 50 (For a quantitative response, this refers to the dose which produces 50% of the maximum response strength; for a qualitative response, this refers to the dose at which a positive response occurs in 50% of experimental subjects) may be determined. A range of human dosages can be derived based on data obtained from cell culture assays and animal studies.

[0195] When administering the double-stranded oligonucleotide, pharmaceutical composition, and / or oligonucleotide complex described in the present disclosure to, for example, male or female, 6-12 weeks old, weighing 18-25 g C57BL / 6J or C3H / HeNCrlVr mice, the amount of double-stranded oligonucleotide in the double-stranded oligonucleotide, pharmaceutical composition, and / or oligonucleotide complex may be 0.001-100 mg / kg body weight for an oligonucleotide complex formed with a double-stranded oligonucleotide and a pharma- ceutical acceptable conjugate molecule, and in some embodiments, it is 0.01-50 mg / kg body weight, in further embodiments, it is 0.05-20 mg / kg body weight, in still further embodiments, it is 0.1-15 mg / kg body weight, and in still further embodiments, it is 0.1-10 mg / kg body weight. When administering the double-stranded oligonucleotide, pharmaceutical composition, and / or oligonucleotide complex described in the present disclosure, the above dose is preferred.

[0196] In addition, the double-stranded oligonucleotide, pharmaceutical composition, and / or oligonucleotide complex of the present disclosure can be introduced into a cell in which a specific gene is abnormally expressed, thereby achieving the purpose of suppressing the expression of the specific gene in the cell by a mechanism of regulating gene expression. In some embodiments, the cell is a hepatocyte. In some embodiments, the hepatocyte may be a cell selected from a hepatoma cell line such as Hep3B, HepG2, Huh7, or an isolated primary hepatocyte, and in some embodiments, the primary hepatocyte.

[0197] The method provided by the present disclosure suppresses the expression of a specific gene in a cell, and the dose of the double-stranded oligonucleotide in the double-stranded oligonucleotide, pharmaceutical composition, and / or oligonucleotide complex provided is easily determined by a person skilled in the art based on the effect to be obtained. For example, in some embodiments, the double-stranded oligonucleotide, pharmaceutical composition, and / or oligonucleotide complex is a siRNA complex, and the dose of the siRNA in the siRNA complex provided is generally an amount that can reduce the expression of the target gene and results in an extracellular concentration of 1 pM to 1 μM, 0.01 nM to 100 nM, 0.05 nM to 50 nM, or 0.05 nM to about 5 nM at the surface of the target cell. The amount required to achieve the local concentration varies depending on various factors, including the delivery method, the delivery site, the number of cell layers between the delivery site and the target cell or tissue, whether the delivery is local or systemic, etc. The concentration at the delivery site may be significantly higher than the concentration at the surface of the target cell or tissue.

[0198] kit The present disclosure provides a kit, which includes a double-stranded oligonucleotide provided by the present disclosure, a double-stranded oligonucleotide obtained by the method of the present disclosure, a pharmaceutical composition and / or an oligonucleotide complex.

[0199] In some embodiments, the kits described herein may provide the double-stranded oligonucleotide, pharmaceutical composition, and / or complex in one container. In some embodiments, the kits described herein may include a container providing a pharma- ceutically acceptable excipient. In some embodiments, the kits may include other components, such as stabilizers or preservatives. In some embodiments, the kits described herein may include at least one other therapeutic agent in a container separate from the container providing the double-stranded oligonucleotide, pharmaceutical composition, and / or complex described herein. In some embodiments, the kits may include instructions for mixing the double-stranded oligonucleotide, pharmaceutical composition, and / or complex with a pharma- ceutically acceptable carrier and / or excipient or other components, if present.

[0200] In the kit of the present disclosure, the double-stranded oligonucleotide, the pharma- ceutically acceptable carrier and / or additive, and the pharmaceutical composition and / or complex, and / or the pharma- ceutically acceptable additive can be provided in any form, such as liquid form, dry form, or lyophilized form. In some embodiments, the double-stranded oligonucleotide and the pharma- ceutically acceptable carrier and / or additive, and the pharmaceutical composition and / or complex, and any pharma- ceutically acceptable additive are essentially clean and / or sterile. In some embodiments, sterile water can be provided in the kit of the present disclosure.

[0201] The present disclosure will be further described below with reference to examples, but the present disclosure is not limited thereto in any way.

[0202] Without wishing to be limited thereto, the present invention will be described in further detail in the following embodiments and in the examples of exemplary embodiments relating to the case where the double-stranded oligonucleotide in the pharmaceutical composition and / or oligonucleotide complex of the present disclosure is a small interfering RNA (siRNA). In this case, the double-stranded oligonucleotide, pharmaceutical composition and oligonucleotide complex of the present disclosure are siRNA, pharmaceutical composition containing siRNA and siRNA complex, respectively. In the context of the present disclosure, for convenience of explanation, the siRNA, pharmaceutical composition containing siRNA and siRNA complex in these embodiments are also referred to as the siRNA of the present disclosure, the pharmaceutical composition of the present disclosure and the siRNA complex of the present disclosure. This does not mean that the double-stranded oligonucleotide of the present disclosure is only siRNA, but on the contrary, the double-stranded oligonucleotide may be other variants disclosed herein or known to those skilled in the art, such as small activating RNA (saRNA). Based on the detailed description of the siRNA, pharmaceutical composition containing siRNA and siRNA complex, it is assumed that other double-stranded oligonucleotides will function similarly when used alone or when forming the pharmaceutical composition and / or oligonucleotide complex described in the present disclosure. EXAMPLES

[0203] Unless otherwise specified, all reagents and media used in the following examples are commercially available products, and all operations such as nucleic acid electrophoresis and real-time PCR are performed with reference to the methods described in Molecular Cloning (Cold Spring Harbor Laboratory Press (1989)).

[0204] Preparation Examples 1 to 4: Synthesis of siRNAs provided by the present disclosure The siRNA sequences shown in Table 2 were each synthesized by solid-phase synthesis using the method described in Preparation Example 1 of WO 2019105418, except that the complementary sense and antisense strands in Table 2 were dissolved in equimolar amounts using DEPC water, and then annealed to obtain siRNA1 to siRNA4 provided by the present disclosure, whose sequences are shown in Table 2.

[0205] Table 2 siRNA sequences [Table 2]

[0206] Here, capital letters C, G, U, A, and T represent nucleotide base compositions, lower case letter m represents that one nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide, lower case letter f represents that one nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide, the underlined lower case combination letter moe represents that one nucleotide adjacent to the left side of the combination letter is a ribose 2'-O-methoxyethyl-modified nucleotide, and lower case letter s represents that the two nucleotides on the left and right of the letter s are linked by a thiophosphate ester.

[0207] Comparative Preparation Examples 1-3: Synthesis of reference siRNA The sense and antisense strands corresponding to the siRNAs numbered Reference siRNA1, Reference siRNA2, and NC in Table 2 were synthesized by solid-phase synthesis according to the method described in Preparation Example 1 of WO2019105418. The resulting equimolar sense and antisense strands were dissolved in DEPC water, and then annealed to obtain the reference siRNA numbered NC.

[0208] Preparation Examples 5-23: Synthesis of siRNA complexes provided by the present disclosure Complexes 6 to 24 in Table 3 below were prepared by the preparation method described in Preparation Example 1 of CN110959011A, except that the sense strand and antisense strand of the siRNA contained in each siRNA complex are shown in Table 3, respectively, and the sense strand and antisense strand of the siRNA were synthesized according to the nucleic acid sequences of the siRNAs numbered Complex 5 to Complex 23 in Table 3 below. Ultrapure water (Milli-Q ultrapure water device, resistivity 18.2 MΩ) was used. * Each siRNA complex was diluted to a concentration of 0.2 mg / mL (as siRNA) using a 500 sq. cm (25°C) and then the molecular weight was detected using a liquid chromatography mass spectrometer (LC-MS, Liquid Chromatography-Mass Spectrometry, purchased from Waters, model number: LCT Premier). The measured values ​​were consistent with the theoretical values, indicating that the synthesized complexes 5 to 23 were double-stranded nucleic acid sequences of the intended design. Each siRNA complex has a structure shown in formula (403), and the siRNA contained in the siRNA complex has the siRNA sequence corresponding to complexes 5 to 23 in Table 3, respectively.

[0209] Table 3 siRNA sequences in siRNA complexes [Table 3] JPEG2024528634000038.jpg137145

[0210] Here, capital letters C, G, U, A, and T represent the base composition of nucleotides, lower case letter m represents that one nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide, lower case letter f represents that one nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide, the underlined combination letter moe represents that one nucleotide adjacent to the left side of the combination letter moe is a ribose 2'-O-methoxyethyl-modified nucleotide, lower case letter s represents that the two nucleotides on the left and right of the letter s are linked by a thiophosphate ester, VP represents that one nucleotide on the right side of the letter VP is a 5'-vinyl phosphate-modified nucleotide, and P represents that one nucleotide on the right side of the letter P is a 5'-phosphate nucleotide.

[0211] Comparative Preparation Examples 4-15: Synthesis of reference siRNA complexes Reference siRNA complexes numbered Reference Complexes 4 to 15 in Table 3 below were prepared by the preparation method described in Preparation Example 1 of CN110959011A, except that the sense strand and antisense strand of the siRNA contained in each reference siRNA complex are shown in Table 3, respectively, and the sense strand and antisense strand of the siRNA were each synthesized according to the nucleic acid sequence of the siRNA numbered Reference Complexes 4 to 15 in Table 3 below. Ultrapure water (Milli-Q ultrapure water system, resistivity 18.2 MΩ) was used. * Each reference siRNA complex was diluted to a concentration of 0.2 mg / mL (as siRNA) using a 500 sq. cm (25°C) and then the molecular weight was detected using a liquid chromatography mass spectrometer (LC-MS, Liquid Chromatography-Mass Spectrometry, purchased from Waters, model number: LCT Premier). The measured values ​​were consistent with the theoretical values, indicating that the synthesized reference complexes 4 to 15 each had a double-stranded nucleic acid sequence of the intended design. Each reference siRNA complex has a structure shown in formula (403), and the siRNA contained therein has an siRNA sequence corresponding to reference complexes 4 to 15 in Table 3, respectively.

[0212] Experimental Example 1: Measurement of double-stranded thermal dissociation temperature (Tm) Using 1×PBS buffer, the above-prepared complex 5, complex 19, reference complex 10 and reference complex 11 were each prepared into a 0.02 mg / mL solution to be used as the test solution. The test solution was added to a quartz cuvette with a 10 mm path length in an Agilent cary300 UV spectrophotometer with a heating program stored therein, and the temperature-absorbance curve was monitored at a wavelength of 260 nm, with a heating rate of 0.5° C. / min, and the temperature was raised from 20.0° C. to 95° C. The double-stranded thermal dissociation temperature Tm was calculated from the first derivative of the temperature-absorbance curve according to the spectrophotometer's instructions. The results of the Tm and ΔTm values ​​are shown in Table 4 below.

[0213] Table 4 Double-stranded thermal dissociation temperature Tm [Table 4]

[0214] For complex 5 and reference complex 10, ΔTm value (complex under test)=Tm (complex under test)−Tm (reference complex 10), For complex 19 and reference complex 11, ΔTm value(complex under test)=Tm(complex under test)−Tm(reference complex 11).

[0215] As can be seen from the results in Table 4, the double-stranded oligonucleotides and complexes thereof containing the stabilizing modified nucleotides of the present disclosure have higher double-stranded thermal dissociation temperatures compared to the cases where the same positions are unmodified nucleotides.

[0216] Experimental Example 2: Inhibitory activity of siRNA in the in vitro siCHECK system Based on the method described in Kumico Ui-Tei et al., Functional dissection of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalian gene silencing with significantly reduced off-target effect. Nucleic Acids Research, 2008.36(7),2136-2151, construct a detection plasmid, co-transfect the detection plasmid with the siRNA to be tested into HEK293A cells, and reflect the target sequence suppression activity of siRNA by the expression level of dual luciferase reporter gene. The specific steps are as follows:

[0217] [1] Construction of detection plasmid psiCHECK TM -2(Promega TM ) plasmid was used to construct a detection plasmid, which contains one target sequence 1, i.e., the siRNA target sequence. For the siRNA to be tested, target sequence 1 is shown below.

[0218] GACCTTGAGGCATACTTCAAA (SEQ ID NO:123)

[0219] The target sequence 1 is a sequence that is completely complementary to the antisense strand of the detected siRNA, so the inhibitory effect of each siRNA on the target sequence 1 can reflect the ability of the detected siRNA to inhibit the expression of a target gene. TM The fragment was cloned into the Xho I / Not I sites of the -2 plasmid.

[0220] [2] Transfection HEK293A cells (purchased from Nanjing Kebai Biotechnology Co., Ltd.) were cultured in DMEM complete medium (Hyclone) supplemented with 20% fetal bovine serum (FBS, Hyclone) and 0.2% by volume of penicillin-streptomycin (Gibco, Invitrogen) in a 5% CO2 / 95% air-containing incubator at 37°C.

[0221] 8 × 10 HEK293A cells 3 Cells were seeded into a 96-well plate at 10 cells / well. After 16 hours, when the cell proliferation density reached 70-80%, the complete H-DMEM medium in the culture wells was aspirated, and 80 μL of Opti-MEM medium (GIBCO) was added to each well and the culture was continued for 1.5 hours.

[0222] The above detection plasmid was diluted using DEPC water to obtain a detection plasmid diluted standard solution of 200 ng / μL, and each of the following siRNAs was prepared using DEPC water to obtain 11 different concentrations of siRNA diluted standard solutions, namely 4000 nM, 1000 nM, 250 nM, 62.5 nM, 15.625 nM, 3.91 nM, 0.977 nM, 0.244 nM, 0.061 nM, 0.0153 nM, and 0.0038 nM, respectively. The siRNAs used were siRNA1, siRNA2, siRNA3, siRNA4 obtained by the above preparation, and reference siRNA1 and reference siRNA2, respectively.

[0223] For each siRNA, 2A1 to 2A11 solutions were prepared, each of which contained 1 μL of the 11 concentrations of siRNA dilution standard solution, 0.05 μL of detection plasmid dilution standard solution (containing 10 ng of detection plasmid), and 10 μL of Opti-MEM medium, in that order.

[0224] Prepare 2B solution: 1 part 2B solution contains 0.2 µL Lipofectamine TM 2000 and 10 μL of Opti-MEM medium.

[0225] A 2C solution is prepared, with one part of the 2C solution containing 0.05 μL of detection plasmid working solution (containing 10 ng of detection plasmid) and 10 μL of Opti-MEM medium.

[0226] One part of each of the 2B solutions was mixed with one part of each of the obtained 2A1 to 2A11 solutions of each of the siRNAs, and each was incubated at room temperature for 20 minutes to obtain 2X1 to 2X11 solutions of each of the siRNA transfection complexes.

[0227] One part of solution 2B was mixed with one part of solution 2C and incubated at room temperature for 20 min to obtain blank transfection complex 2X12.

[0228] Each siRNA transfection complex 2X1 to 2X11 was added to the culture wells at an addition amount of 20 μL / well and mixed uniformly to obtain transfection complexes of each siRNA with final concentrations of approximately 40 nM, 10 nM, 2.5 nM, 0.625 nM, 0.15625 nM, 0.0391 nM, 0.00977 nM, 0.00244 nM, 0.00061 nM, 0.000153 nM and 0.000038 nM, respectively. Each siRNA transfection complex 2X1 to 2X11 was transfected into three culture wells, respectively, to obtain co-transfection mixtures containing siRNA, which were used as test groups.

[0229] For each siRNA, the transfection complex 2X12 was added to the other three culture wells at an addition volume of 20 μL / well, respectively, to obtain a transfection mixture without siRNA, which served as a blank control group.

[0230] After the co-transfection mixtures with and without siRNA were transfected into the culture wells for 4 h, 100 μL of H-DMEM complete medium containing 20% ​​FBS was added to each well. The 96-well plate was placed in a CO2 incubator and cultured for 24 h.

[0231] [3] Detection The medium in the culture wells was aspirated, and 150 μL of Dual-Glo (registered trademark) Luciferase reagent and H-DMEM mixed solution (volume ratio 1:1) was added to each well, mixed thoroughly and uniformly, and incubated at room temperature for 10 min. Then, 120 μL of the mixed solution was transferred to a 96-well microplate, and the Firefly chemiluminescence value (Fir) in each culture well of the 96-well microplate was read using a Synergy II multifunction microplate reader (BioTek). Furthermore, 60 μL of Dual-Glo (registered trademark) Stop & Glo (registered trademark) reagent was added to each well of the 96-well microplate, mixed thoroughly and uniformly, and incubated at room temperature for 10 min. Then, the Renilla chemiluminescence value (Ren) in each culture well of the 96-well microplate was read using a microplate reader according to the order of reading Fir.

[0232] The emission ratio Ratio = Ren / Fir of each well of the 96-well microplate was calculated, and the emission ratio Ratio (test) or Ratio (control) of each test group or control group was the average value of the Ratio of three culture wells. The emission ratio of each test group was normalized based on the emission ratio of the control group to obtain the relative expression level of the Renilla reporter gene, i.e., the ratio R of Ratio (test) / Ratio (control) to indicate the residual activity. The inhibition rate of the target sequence of siRNA = (1-R) ​​× 100%.

[0233] Based on the relative residual activity of Renilla in HEK293A cells after transfection with different concentrations of the tested siRNAs, a log(inhibitor) vs. response-Variable slope (four parameters) dose-effect curve was fitted using the nonlinear regression analysis function of Graphpad 5.0 software.

[0234] Based on the function corresponding to the fitted dose-effect curve, the IC of the siRNA targeting the sequence of interest under test was calculated. 50 The value is calculated as follows:

number

[0235] From the dose-effect curve and the corresponding function, X corresponding to Y=50% is 50 Determine IC values ​​for each siRNA 50 Value=10^X 50 Calculate the IC (nM) 50 The values ​​are summarized in Table 5.

[0236] Table 5. IC of siRNA 50 [Table 5]

[0237] As can be seen from the results in Table 5 above, the siRNAs provided by the present disclosure have extremely high target sequence suppression activity in the in vitro siCHECK system, and IC 50 The IC values ​​of siRNA1, siRNA3, and siRNA4 are in the range of 0.0022 to 0.0086 nM. In addition, they have target sequence suppression activity close to that of reference siRNA1 that does not contain stabilizing modified nucleotides. In particular, the IC values ​​of siRNA1, siRNA3, and siRNA4 are 50 The IC value was lower than that of reference siRNA1, indicating a higher inhibitory effect on the target sequence. In contrast, reference siRNA2, which has a stabilizing modified nucleotide only at position 2 of the antisense strand from the 5' to the 3' end, showed a significantly reduced inhibitory activity on the target sequence, with its IC 50 The values ​​are nearly 33-fold higher than the reference siRNA1 and the siRNAs of the present disclosure, and thus more than 100-fold higher.

[0238] Experimental Example 3: Off-target sequence suppression activity of siRNA in the in vitro siCHECK system The off-target sequence suppression activity of siRNA3 and reference siRNA1 in an in vitro siCHECK system was detected by the method of Experimental Example 2. The only difference was that the target sequence used was target sequence 2 shown below.

[0239] TCAAGGTCTTACGACTTCAAA (SEQ ID NO:124)

[0240] Since only a portion of the target sequence 2 is complementary to the antisense strand of the siRNA to be tested, the inhibitory effect of each siRNA on the target sequence 2 can reflect the degree of off-target effect. That is, the higher the inhibitory effect, the higher the possibility that the siRNA will cause off-target effects.

[0241] From the dose-effect curve and the corresponding function, the corresponding X when Y=75% 75 Determine the off-target IC value for each siRNA 25 Value=10^X 75 (nM) was calculated. Through measurement and calculation, the off-target effect IC 25 The Y value is 1.6255 nM, but siRNA3 does not cause any off-target effects within the entire range of detected concentrations, and Y is always higher than 75%. As can be seen from the above, the siRNA of the present disclosure exhibits significantly lower off-target effects than the reference siRNA.

[0242] Experimental Example 4: Target mRNA silencing activity of siRNA in primary mouse hepatocytes HBV transgenic mice C57BL / 6J-Tg(A1b1HBV)44Bri / J were purchased from the Department of Experimental Animal Science, School of Medicine, Peking University. Mice with S / COV>10 were selected and tested before the experiment, hereafter abbreviated as 44Bri mice.

[0243] Primary mouse hepatocytes were extracted from fresh liver tissue of 44Bri mice and cultured in Opti-MEM (1X) medium (GIBCO, product number 31985-070) at a density of 2 × 10 5 The primary mouse hepatocyte suspension was adjusted to 1 × 10 cells / mL to obtain a primary mouse hepatocyte suspension. The primary mouse hepatocyte suspension obtained was then added to different culture wells of a 12-well plate to inoculate the primary mouse hepatocytes into the culture wells. The volume of the primary mouse hepatocyte suspension added was 0.5 mL / well, and the number of primary mouse hepatocytes was 1 × 10 5 cells / well.

[0244] Each of the following siRNAs was prepared using DEPC water to give a 20 μM siRNA dilution standard solution, and the siRNAs used were siRNA1, siRNA2, siRNA3, siRNA4, reference siRNA1, reference siRNA2, and reference siRNA NC, respectively.

[0245] A 4A solution was prepared. For each siRNA, a 4A solution was prepared, with one portion of the 4A solution containing, in order, 1.5 μL of the above siRNA dilution standard solution and 50 μL of Opti-MEM medium.

[0246] Prepare 4B solution: 1 part 4B solution contains 1 µL Lipofectamine TM 2000 and 50 μL of Opti-MEM medium.

[0247] One part of each of the 4B solutions was mixed with the 4A solutions of each of the obtained siRNAs, and each was incubated at room temperature for 20 minutes to obtain 4X transfection complexes of each of the siRNAs.

[0248] One part of the 4B solution was mixed with 50 μL of Opti-MEM medium and incubated at room temperature for 20 min to obtain the transfection complex 4X′.

[0249] The 4X transfection complex of each siRNA was added to the culture wells at an addition volume of 98 μL / well and mixed evenly to obtain a transfection complex with a final concentration of each siRNA of approximately 50 nM. The 4X transfection complex of each siRNA was transfected into three culture wells to obtain a transfection mixture containing siRNA, which was used as the test group.

[0250] To another three culture wells, transfection complex 4X' was added at an addition volume of 98 μL / well, respectively, to obtain a transfection mixture without siRNA, which served as a blank control group.

[0251] After the transfection mixtures with and without siRNA were transfected into different culture wells for 4 h, 1 ml of H-DMEM complete medium supplemented with 20% FBS was added to each well. The 24-well plate was placed in a CO2 incubator and cultured at 37°C for 24 h.

[0252] Subsequently, total RNA was extracted from the cells in each well using TRIZOL (purchased from SIGMA, product number T9424) according to the method described in the instruction manual, to obtain an aqueous solution of total RNA.

[0253] For each well, a total RNA solution containing 1 μg of total RNA was taken and transfected using the Goldenstar Reverse Transcription Kit. TM The reagents provided by the RT6 cDNA Synthesis Kit (purchased from Beijing Keike Xinye Biotechnology Co., Ltd., product number TSK301M) were used. TM Oligo(dT) 17was selected as a primer, and 20μL of reverse transcription reaction system was prepared according to the reverse transcription operation steps in the kit's manual, and the total RNA of the cells in each well was reverse transcribed. The reverse transcription conditions were as follows: for each reverse transcription reaction system, the reverse transcription reaction system was incubated at 50℃ for 50min, then incubated at 85℃ for 5min, and finally incubated at 4℃ for 5min. After the reaction was completed, 80μL of DEPC water was added to each reverse transcription reaction system to obtain a solution containing cDNA.

[0254] For each reverse transcription reaction system, 5 μL of the solution containing the above cDNA was used as a template, and 15 μL of qPCR reaction system was prepared using the reagents provided by NovoStart® SYBR qPCR SuperMix Plus Kit (purchased from Kinki Protein Technology Co., Ltd., product number E096-01B). The PCR primer sequences for amplifying the target gene HBV X and the endogenous reference gene mGAPDH were as shown in Table 6, and the final concentration of each primer was 0.25 μM. Each qPCR reaction system was placed in an ABI StepOnePlus Real-Time PCR device and amplified using a three-step method, and the amplification process was performed by pre-denaturing at 95°C for 10 min, then denaturing at 95°C for 30 s, annealing at 60°C for 30 s, and elongating at 72°C for 30 s. The above denaturation, annealing, and elongation steps were repeated a total of 40 times to obtain the product W of the target gene HBV X and the endogenous reference gene mGAPDH. The product W was immediately incubated at 95°C for 1 min, at 55°C for 30 s, and at 95°C for 30 s, and the melting curves of the target gene HBV X and the endogenous reference gene mGAPDH in the product W were collected by a quantitative real-time PCR device, and the Ct values ​​of the target gene HBV X and the endogenous reference gene mGAPDH were obtained.

[0255] Table 6 Primer sequence information [Table 6]

[0256] The comparative Ct (ΔΔCt) method was used to relatively and quantitatively calculate the relative expression level and inhibition rate of the target gene HBV in each test group, and the calculation method is as follows:

[0257] ΔCt(test group)=Ct(target gene in test group)-Ct(endogenous reference gene in test group) ΔCt(control group)=Ct(gene of interest in control group)-Ct(endogenous reference gene in control group) ΔΔCt(test group)=ΔCt(test group)-ΔCt(average value of control group) ΔΔCt(control group) = ΔCt(control group) - ΔCt(mean value of the control group)

[0258] ΔCt(control mean) is the arithmetic mean of the ΔCt(control) of each of the three culture wells of the control group, so that each culture well of the test and control groups corresponds to one ΔΔCt value.

[0259] The expression level of HBV mRNA in the test group was normalized based on the control group, and the expression level of HBV mRNA in the blank control group was defined as 100%. Relative expression level of HBV mRNA in the test group = 2 -ΔΔCt(試験群) ×100% Inhibition rate of HBV mRNA in the test group = (1 - relative expression level of HBV mRNA in the test group) x 100% Figure 1 shows the histogram of the relative expression level of HBV mRNA in primary hepatocytes of 44Bri mice after transfection with siRNA1, siRNA2, siRNA3, siRNA4, Reference siRNA1, Reference siRNA2, and Reference siRNA NC, respectively. Furthermore, the HBV mRNA suppression rate of each siRNA is summarized in Table 7.

[0260] Table 7. Inhibition of HBV mRNA in primary mouse hepatocytes [Table 7]

[0261] As can be seen from the results in Figure 1 and Table 7, the siRNA of the present disclosure exhibited excellent HBV mRNA suppression activity in primary hepatocytes of 44Bri mice, with an HBV mRNA suppression rate of at least 73.92% and up to 77.58% at an siRNA concentration of 50 nM, and exhibited HBV mRNA suppression activity equivalent to that of reference siRNA 1 that does not contain a corresponding stabilizing modified nucleotide. In contrast, reference siRNA 2, which has a stabilizing modified nucleotide only at position 2 of the antisense strand from the 5' to 3' end, has a significantly reduced activity of suppressing the target sequence, with an HBV mRNA suppression rate of only 36.31%.

[0262] Experimental Example 5: Target mRNA silencing activity of siRNA complexes in mouse primary hepatocytes HBV transgenic mice C57BL / 6J-Tg(A1b1HBV)44Bri / J were purchased from the Department of Experimental Animal Science, School of Medicine, Peking University. Mice with S / COV>10 were selected and tested before the experiment, hereafter abbreviated as 44Bri mice.

[0263] Primary mouse hepatocytes were extracted from fresh liver tissue of 44Bri mice and cultured in Opti-MEM (1X) medium (GIBCO, product number 31985-070) at a density of 1 × 10 5 The primary mouse hepatocyte suspension was adjusted to 1 × 10 cells / mL to obtain a primary mouse hepatocyte suspension. The primary mouse hepatocyte suspension obtained was then added to different culture wells of a 12-well plate, and the primary mouse hepatocytes were inoculated into the culture wells. The volume of the primary mouse hepatocyte suspension added was 1 mL / well, and the number of primary mouse hepatocytes was 1 × 10 5 cells / well.

[0264] The following siRNA complexes were prepared using DEPC water to give 4 μM (as siRNA) siRNA complex working solutions, and the siRNA complexes used were Complex 5, Complex 6, or Reference Complex 4. Reference siRNA NC was prepared to give 4 μM Reference siRNA NC working solution.

[0265] The siRNA complex dilution standard solution of each complex or the reference siRNA NC dilution standard solution was added to the culture wells containing the different primary mouse hepatocyte suspensions at an amount of 2.5 μL / well, respectively, and mixed uniformly. Each siRNA complex or the reference siRNA NC was transfected into three culture wells, respectively, to obtain a transfection mixture containing siRNA (final concentration of 10 nM as siRNA), which was used as the test group. The primary mouse hepatocyte suspensions in the other three culture wells were used as the blank control group.

[0266] The transfection mixture containing each siRNA and the blank control group were placed in a 5% CO2-containing incubator and cultured at 37°C for 24 hours.

[0267] Subsequently, total RNA was extracted from the cells in each well using TRIZOL (purchased from SIGMA, product number T9424) according to the method described in the instruction manual, to obtain an aqueous solution of total RNA.

[0268] For each well, a total RNA solution containing 1 μg of total RNA was taken and transfected using the Goldenstar Reverse Transcription Kit. TM The reagents provided by the RT6 cDNA Synthesis Kit (purchased from Beijing Keike Xinye Biotechnology Co., Ltd., product number TSK301M) were used. TM Oligo(dT) 17 was selected as a primer, and 20μL of reverse transcription reaction system was prepared according to the reverse transcription operation steps in the kit's manual, and the total RNA of the cells in each well was reverse transcribed. The reverse transcription conditions were as follows: for each reverse transcription reaction system, the reverse transcription reaction system was incubated at 50℃ for 50min, then incubated at 85℃ for 5min, and finally incubated at 4℃ for 5min. After the reaction was completed, 80μL of DEPC water was added to each reverse transcription reaction system to obtain a solution containing cDNA.

[0269] For each reverse transcription reaction system, 5 μL of the solution containing the above cDNA was used as a template, and 15 μL of qPCR reaction system was prepared using the reagents provided by NovoStart® SYBR qPCR SuperMix Plus kit (purchased from Kinki Protein Technology Co., Ltd., product number E096-01B). The PCR primer sequences for amplifying the target gene HBV X and the endogenous reference gene GAPDH were as shown in Table 6, and the final concentration of each primer was 0.25 μM. Each qPCR reaction system was placed in an ABI StepOnePlus Real-Time PCR device and amplified using a three-step method, and the amplification process was performed by pre-denaturing at 95°C for 10 min, then denaturing at 95°C for 30 s, annealing at 60°C for 25 s, and elongating at 72°C for 25 s. The above denaturation, annealing, and elongation steps were repeated a total of 40 times to obtain the product W of the target gene HBV X and the endogenous reference gene GAPDH. The product W was immediately incubated at 95°C for 1 min, at 55°C for 30 s, and at 95°C for 30 s, and the melting curves of the target gene HBV X and the endogenous reference gene GAPDH in the product W were collected by a quantitative real-time PCR device, and the Ct values ​​of the target gene HBV X and the endogenous reference gene GAPDH were obtained.

[0270] The relative expression level and inhibition rate of HBV mRNA in primary mouse hepatocytes after ad libitum administration of each siRNA complex were calculated from the Ct value according to the method described in Experimental Example 4. The results are shown in Figure 2.

[0271] Figure 2 shows the histogram of the relative expression level of HBV mRNA in primary hepatocytes of 44Bri mice after ad libitum administration of Complex 5, Complex 6, or Reference Complex 4 and Reference siRNA NC, respectively. Furthermore, the HBV mRNA suppression rate of each siRNA complex or Reference siRNA NC is summarized in Table 8.

[0272] Table 8. Inhibition of HBV mRNA in primary mouse hepatocytes [Table 8]

[0273] As can be seen from the results in Figure 2 and Table 8, the siRNA complex disclosed herein showed excellent HBV mRNA suppression activity in primary hepatocytes of 44Bri mice, with the HBV mRNA suppression rate being at least 91.77% at an siRNA concentration of 10 nM. In particular, the HBV mRNA suppression rate of complex 5 in primary mouse hepatocytes could reach 93.06%, showing HBV mRNA suppression activity almost equivalent to that of the reference complex 4 which did not contain the corresponding stabilizing modified nucleotide.

[0274] Experimental Example 6: Inhibition of siRNA complexes against HBV mRNA in mice in vivo Using a Hepatitis B virus surface antigen diagnostic kit (enzyme-linked immunosorbent assay) (Shanghai Kehua Biology), the serum HbsAg content of 44Bri mice was detected according to the method described in the instruction manual. Mice with S / COV>10 were selected and randomly divided into groups (all males), with 5 mice per group, each numbered. Each mouse was subcutaneously injected with Complex 5, Complex 6 or Reference Complex 4 at a dose of 1 mg / kg or 0.1 mg / kg mouse body weight (as siRNA); the siRNA complex was provided in the form of a 1×PBS solution containing 0.2 mg / ml or 0.02 mg / ml (as siRNA) of siRNA complex, respectively, at a dose volume of 5 ml / kg; the other two groups of mice were each administered with 1×PBS at a dose volume of 5 ml / kg, serving as a blank control group.

[0275] The administration time was calculated as the first day, and the animals were sacrificed on the eighth day. The liver tissue of each mouse was collected and preserved in RNA later (Sigma Aldrich). 1 mL of Trizol (Sigma) was added to each liver tissue, and the tissue was homogenized three times, 30 s each time, using a Tissuelyset II type fully automatic tissue homogenizer to obtain a liver tissue homogenate. 0.2 mL of chloroform was added to the homogenate and allowed to stand for 3 min. The tissue was centrifuged at 12000 rpm at 4 ° C for 10 min, and 0.4 mL of the supernatant was taken. 0.5 mL of isopropanol was added to the supernatant and allowed to stand at room temperature for 10 min. The tissue was centrifuged at 12000 rpm at 4 ° C for 10 min, and the supernatant was discarded. 1 mL of ethanol was added to the precipitate to wash the precipitate, and the precipitate was centrifuged at 12000 rpm at 4 ° C for 5 min, and the supernatant was discarded. 70 μL of DEPC water was added to the precipitate to obtain an extracted total RNA solution.

[0276] For each mouse liver tissue total RNA, 10.5μL of total RNA solution containing 1μg of total RNA was taken, and a reverse transcription kit Reverse Transcription System (purchased from Promega, product number A3500) was used to prepare 20μL of reverse transcription reaction system according to the reverse transcription operation steps in the kit's instructions, and the total RNA was reverse transcribed. The reverse transcription conditions are as follows: For each reverse transcription reaction system, the reverse transcription reaction system was incubated at 42℃ for 30min, then incubated at 95℃ for 5min, and finally incubated at 4℃ for 5min. After the reaction was completed, 80μL of DEPC water was added to each reverse transcription reaction system to obtain a solution containing cDNA.

[0277] For each reverse transcription reaction system, 5 μL of the solution containing the above cDNA was used as a template, and 20 μL of qPCR reaction system was prepared using the reagents provided by SYBR select Master Mix kit (Applied biosystem). The PCR primer sequences for amplifying the target gene HBV X and the internal reference gene GAPDH were as shown in Table 6, and the final concentration of each primer was 0.25 μM. Each qPCR reaction system was placed in an ABI StepOnePlus Real-Time PCR device and amplified using a three-step method. The amplification process included pre-denaturation at 95 ° C for 10 min, followed by denaturation at 95 ° C for 30 s, annealing at 60 ° C for 30 s, and extension at 72 ° C for 30 s. The above denaturation, annealing, and extension steps were repeated a total of 40 times to obtain the product W of the target gene HBV X and the endogenous reference gene GAPDH. The product W was immediately incubated at 95°C for 1 min, at 55°C for 30 s, and at 95°C for 30 s, and the melting curves of the target gene HBV X and the endogenous reference gene GAPDH in the product W were collected by a quantitative real-time PCR device, and the Ct values ​​of the target gene HBV X and the endogenous reference gene GAPDH were obtained.

[0278] According to the method described in Experimental Example 4, the relative expression level and inhibition rate of HBV mRNA in the in vivo liver tissue of mice after administration of each siRNA complex were calculated from the Ct value. The results are shown in Figures 3A and 3B.

[0279] Figures 3A and 3B are scatter plots of the relative expression levels of HBV mRNA in the liver of 44Bri mice after administration of 1 mg / kg or 0.1 mg / kg (as siRNA) of complex 5, complex 6, or reference complex 4 and PBS, respectively. In Figures 3A and 3B, PBS represents the blank control group. Furthermore, the HBV mRNA suppression rate of each siRNA complex is summarized in Table 9.

[0280] Table 9. In vivo suppression of HBV mRNA in mice [Table 9]

[0281] As can be seen from Figures 3A, 3B and Table 9, the siRNA complex of the present disclosure showed excellent HBV mRNA suppression effect in vivo in mice, with an HBV mRNA suppression rate of at least 63.18% at a dose of 0.1 mg / kg, and an HBV mRNA suppression rate of as high as 96.31% at a dose of 1 mg / kg, and showed HBV mRNA suppression activity equivalent to that of the reference complex 4 which did not contain the corresponding stabilizing modified nucleotide.

[0282] Experimental Example 7: Toxic effects of siRNA complexes in rats Complex 5, Complex 6, Reference Complex 4 and Reference Complex 14 were dissolved in PBS to a solution of 6 mg / ml (as siRNA complex). SD rats (all male, weighing 0.22-0.28 kg, aged 5-7 weeks, purchased from Weitong Lihua Company) were randomly divided into groups, with 5 rats per group, and each group was numbered. Each rat was administered the above siRNA complex solution at a dose volume of 5 mL / kg by subcutaneous injection into the neck, which served as the test group, and each rat in the group was administered PBS at a dose volume of 5 mL / kg, which served as the blank control group.

[0283] The administration time point was calculated as day 1, and on day 15, each rat in the test group and the blank control group was sacrificed and autopsied, and the liver was weighed and normalized based on the blank control group, and preserved in 10% neutral buffered formalin fixative to prepare pathological sections, and the results of gross autopsy and liver weight are shown in Table 10. The severity of hepatic steatosis and inflammation in the pathological sections was evaluated, graded, and compared.

[0284] Table 10. Toxic effects of siRNA complexes in rats [Table 10]

[0285] In Table 10, the % and the number before it represent the percentage of the difference from the blank control group for the corresponding indicator relative to the blank control group. "↑" represents an increase. For example, ↑5.43% indicates that liver weight increased by 5.43% compared to the blank control group.

[0286] As can be seen from the results in Table 10, the rats administered Reference Complex 4 and Reference Complex 14, which do not contain any complex, increased by 81.31% and 84.03%, respectively, showing a clear increase in liver weight. Furthermore, the rats showed obvious yellowing and swelling of the liver in the macroscopic autopsy. The liver weights of the rats administered Complex 5 and Complex 6 increased by 5.45% and 3.45%, respectively, but no obvious abnormalities were observed in the macroscopic autopsy compared with the blank control group.

[0287] As can be seen from the pathological section results, three rats administered Reference Complex 4 showed severe or more severe hepatic steatosis and mild or moderate hepatic inflammation, with specific symptoms including extensive and severe hepatic steatosis in the tissue, various numbers and sizes of round vacuoles in the cytoplasm, severe swelling of a few hepatic cells, lightly stained cytoplasm, and a small amount of inflammatory cell infiltration around the veins. All rats administered Reference Complex 14, which contains a stabilizing modified nucleotide only at position 7 in the 5'-3' end direction of the antisense strand, showed extremely severe hepatic steatosis and mild or moderate hepatic inflammation, with specific symptoms including extensive and severe hepatic steatosis in the tissue, various numbers and sizes of round vacuoles in the cytoplasm, a few foci of inflammatory cell infiltration in the lobules, or rare inflammatory cell infiltration around the portal vein, severe swelling of a few hepatic cells, lightly stained cytoplasm.

[0288] Of the rats administered with complex 5, 4 rats showed only mild fatty degeneration, with specific symptoms of tightly arranged hepatocytes and clear margins, a small number of hepatocytes showing mild fatty degeneration, and small round vacuoles in the cytoplasm, while the other rat showed no fatty degeneration, and none of the rats showed significant liver inflammation. Of the rats administered with complex 6, 2 rats showed mild fatty degeneration, with specific symptoms of tightly arranged hepatocytes and clear margins, some hepatocytes showing mild fatty degeneration, and small round vacuoles in the cytoplasm, while 3 rats showed moderate fatty degeneration, with specific symptoms of tightly arranged hepatocytes and clear margins, many mild fatty degeneration of hepatocytes, and small round vacuoles in the cytoplasm, and none of the rats showed significant liver inflammation.

[0289] As is evident from the above results, compared with the reference complex, the siRNA complex of the present disclosure can effectively reduce hepatotoxic reactions caused by off-target effects, and therefore exhibits significantly higher safety and has excellent development prospects in the preparation of drugs for the treatment and / or prevention of HBV diseases or symptoms.

[0290] Experimental Example 8: Off-target sequence suppression activity of siRNA complexes in an in vitro siCHECK system The off-target sequence suppression activity of the siRNA complexes in the in vitro siCHECK system was measured using the method described in Experimental Example 2, except that instead of the tested siRNA, Complex 5, Complex 6, Complex 7, Complex 8, Complex 22, Complex 23, Reference Complex 4, Reference Complex 10, Reference Complex 12 or Reference Complex 13 was used, and the target sequence used was Target Sequence 3 shown below.

[0291] GGCCGCATTGAAGTTACTGATCCTTCCAAATTGAAGTTACTGATCCTTCCAAATTGAAGTTACTGATCCTTCCAAATTGAAGTTACTGATCCTTCCAAATTGAAGTTACTGATCCTTC (SEQ ID NO:129)

[0292] Since the multiple sequence fragments in the target sequence 3 are partially complementary to the antisense strand of the siRNA in the siRNA complex to be tested, the inhibitory effect of each siRNA complex on the target sequence 3 can reflect the degree of off-target effect. That is, the higher the inhibitory effect, the higher the possibility that the siRNA complex will cause off-target effects.

[0293] From the dose-effect curve and the corresponding function, the corresponding X when Y=50% 50 Determine the off-target IC value for each siRNA complex. 50 Value=10^X 50 (nM) was calculated.

[0294] As a result, the off-target IC of reference complex 4 50 value of 218.085 pM, and the off-target IC 50 The IC value was 202.581 pM, i.e., the two reference siRNA complexes had the same off-target IC 50 At concentrations above this threshold, significant off-target activity was observed. In contrast, the off-target IC 50 The value was 555.240 pM, significantly higher than that of the reference siRNA complex, and in particular, the remaining siRNA complexes had a relative residual activity of Renilla always higher than 50% in the entire range of concentrations tested, among which the lowest relative residual activity of Renilla of complex 5, complex 6, complex 7, complex 8 and complex 23 was 55.65%, 71.42%, 71.38%, 65.47%, and 67.84%, respectively, that is, none of the above siRNA complexes had off-target effects. As can be seen from the above, compared with reference complex 4 and reference complex 10 that did not contain stabilizing modified nucleotides, each siRNA complex containing stabilizing modified nucleotides showed significantly lower off-target effects.

[0295] Experimental Example 9: Target mRNA silencing activity of siRNA complexes in mouse primary hepatocytes The target mRNA silencing activity of the siRNA complexes in primary mouse hepatocytes was measured by the method described in Experimental Example 5, except that instead of the tested siRNA complexes, Complex 5, Complex 6, Complex 22, Complex 23, Reference Complex 4, Reference Complex 10, Reference Complex 12, Reference Complex 13 or Reference siRNA NC were used, and each complex, reference complex or reference siRNA NC was tested in two culture wells. The results are shown in Figure 4.

[0296] 4 shows the histogram of the relative expression level of HBV mRNA in primary hepatocytes of 44Bri mice after ad libitum administration of Complex 5, Complex 6, Complex 22, Complex 23, Reference Complex 4, Reference Complex 10, Reference Complex 12, Reference Complex 13 or Reference siRNA NC. Furthermore, the HBV mRNA suppression rate of each siRNA complex or Reference siRNA NC is summarized in Table 11.

[0297] Table 11. Inhibition of HBV mRNA in primary mouse hepatocytes [Table 11]

[0298] As can be seen from the results in Figure 4 and Table 11, siRNA complexes 5, 6, 22 and 23 of the present disclosure exhibit excellent HBV mRNA suppression activity in primary hepatocytes of 44Bri mice, and at an siRNA concentration of 10 nM, the HBV mRNA suppression rate is at least 78.47% and can reach up to 85.97%, which is equivalent to reference complex 4 and obviously higher than reference complexes 10, 12 and 13. The corresponding positions in reference complex 4 are non-stabilizing modified nucleotides, the corresponding positions in reference complex 10 are unmodified nucleotides, and reference complexes 12 and 13 further contain stabilizing modified nucleotides other than positions 3 to 9 in the 5'-3' end direction of the antisense strand.

[0299] Experimental Example 10: Inhibition of siRNA complexes against HBV mRNA in mice in vivo The inhibitory effect of the siRNA complexes on HBV mRNA in vivo in mice was tested by the method described in Experimental Example 6, except that instead of the siRNA complex used, the measurements were performed using complex 10 or reference complex 5. The results are shown in Figure 5.

[0300] Figure 5 is a scatter plot of the relative expression level of HBV mRNA in the liver of 44Bri mice after administration of 1 mg / kg or 0.1 mg / kg (as siRNA) of complex 10 or reference complex 5 and PBS, respectively. In the figure, PBS represents the blank control group. Furthermore, the HBV mRNA suppression rate of each siRNA complex is summarized in Table 12.

[0301] Table 12. In vivo suppression of HBV mRNA in mice [Table 12]

[0302] As can be seen from Figure 5 and Table 12, the siRNA complex of the present disclosure showed excellent HBV mRNA suppression effect in vivo in mice, with an HBV mRNA suppression rate of at least 46.26% at a dose of 0.1 mg / kg. In particular, at a dose of 1 mg / kg, the HBV mRNA suppression rate of complex 10 in vivo in mice could reach 84.25%, showing HBV mRNA suppression activity close to that of the reference complex 5 which does not contain the corresponding stabilizing modified nucleotide at the same concentration.

[0303] Experimental Example 11: Toxic effects of siRNA complexes in mice Complex 9, Complex 10, Reference Complex 5 and Reference Complex 15 were dissolved in PBS to a solution of 3 mg / ml (as siRNA complex). ICR mice (half male and half female, weighing 18-22 g, 5-6 weeks old, purchased from Sigma Co., Ltd.) were randomly divided into groups, with 6 mice (half male and half female) per group, and each group was numbered. The above siRNA complex solution was administered to each mouse by subcutaneous injection at the neck in a dose volume of 10 mL / kg, which was used as the test group, and PBS was administered to each mouse in one group in a dose volume of 10 mL / kg, which was used as the blank control group.

[0304] The administration time was set to day 1, and on day 15, 0.6 mL of blood was collected from each mouse in the test group and blank control group via the orbit. After blood collection, the mice were incubated at 37°C for 60 min, and then centrifuged at 4°C and 3000 rpm for 15 min to obtain serum. In addition, the concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the serum were detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy). The results are shown in Figure 6A and Figure 6B. In the figures, PBS represents the blank control group.

[0305] 6A and 6B are scatter plots of ALT and AST concentrations in mouse serum after administration of 30 mg / kg of complex 9, complex 10, reference complex 5, reference complex 15, or PBS, respectively. As can be seen from FIG. 6A and FIG. 6B, compared with the blank control group, the serum ALT and AST concentrations increased after administration of reference complex 5 that does not contain stabilizing modified nucleotides, while the serum ALT and AST concentrations were equivalent to the blank control group levels after administration of the siRNA complex of the present disclosure, indicating that the siRNA complex of the present disclosure has low hepatotoxicity. Meanwhile, after administration of reference complex 15 that contains stabilizing modified nucleotides only at position 7 in the 5'-3' end direction of the antisense strand, the serum ALT and AST concentrations of mice increased significantly, indicating that the reference complex may cause higher hepatotoxicity.

[0306] Furthermore, after blood sampling on day 15, the mice were sacrificed and autopsied, and then preserved in 10% neutral buffered formalin fixative to prepare pathological sections. The severity of hepatic steatosis in the pathological sections was evaluated, graded, and compared.

[0307] As can be seen from the pathological section results, compared with the blank control, among the mice administered with reference complex 5 without stabilized modified nucleotide, 4 mice showed severe hepatocyte degeneration, specifically symptoms of extensive loosening of the cytoplasm of hepatocytes in the tissue, more hepatocytes showed balloon-like degeneration, swollen cells, and air-bubbly cytoplasm; 1 mouse showed moderate hepatocyte degeneration, specifically symptoms of loosening and lightly stained cytoplasm of many hepatocytes, some hepatocytes accompanied by air-bubble degeneration, with tiny round air bubbles in the cytoplasm, a small number of hepatocytes locally necrotic, and condensed or collapsed cell nuclei; 1 mouse showed mild hepatocyte degeneration, specifically symptoms of loosening and lightly stained cytoplasm of many hepatocytes, and showed more severe hepatic fatty degeneration than the blank control group.

[0308] Compared with the blank control, of the mice administered reference complex 15, which contains a stabilizing modified nucleotide only at position 7 in the 5'-3' end direction of the antisense strand, two mice showed severe hepatic steatosis and four mice showed moderate hepatic steatosis, which was more severe than that of the mice in the blank control group.

[0309] Of the mice administered with the siRNA complex 9 of the present disclosure, two mice showed moderate hepatic steatosis, three mice showed mild hepatic steatosis, and no severe or severe hepatocyte degeneration was observed.Of the mice administered with the siRNA complex 10 of the present disclosure, three mice showed moderate hepatic steatosis, two mice showed mild hepatic steatosis, and no severe or severe hepatocyte degeneration was observed.Compared to the reference complex, the mice administered with the complex of the present disclosure showed a lower degree of hepatic steatosis.

[0310] As is evident from the above results, compared with the reference complex, the siRNA complex of the present disclosure can effectively reduce hepatotoxic reactions caused by off-target effects, and therefore exhibits significantly higher safety and has excellent development prospects in the preparation of drugs for the treatment and / or prevention of HBV diseases or symptoms.

[0311] Experimental Example 12: Inhibitory activity of siRNA complexes in an in vitro siCHECK system In this experimental example, the in vitro siCHECK system was used to detect the target sequence suppression activity of Complex 11, Complex 12, Complex 13, Complex 14, Complex 15, Complex 16, Reference Complex 6, Reference Complex 7, Reference Complex 8 or Reference siRNA NC in the in vitro siCHECK system.

[0312] [1] Construction of detection plasmid psiCHECK TM -2(Promega TM ) plasmid was used to construct a detection plasmid, which contains one target sequence 4, i.e., the siRNA target sequence. For the siRNA complexes to be tested, target sequence 4 is shown below.

[0313] TGCTCAGTTCATCCCTAGGGCAGCTGCTCCAGGAACAGAGGTGCCATGCAGCCCCGGGTACTCCTTGTTGTTGCCCTCCTGGCGCTCCTGGCCTCTGCCCGAGCTTCAGAGGCCGAGGATGCCTCCCTTCTC AGCTTCATGCAGGGTTACATGAAGCACGCCACCAAGACCGCCAAGGATGCACTGAGCAGGCGTGCAGGAGTCCCAGGTGGCCCAGCAGGCCAGGGGCTGGGTGACCGATGGCTTCAGTTCCCTGAAAGACTACT GGAGCACCGTTAAGGACAAGTTCTCTGAGTTCTGGGATTTGGACCCTGAGGTCAGACCAACTTCAGCCGTGGCTGCCTGAGACCTCAATACCCCAAGTCCACCTGCCTATCCATCCTGCGAGCTCCTTGGGTC CTGCAATCTCCAGGGCTGCCCCTGTAGGTTGCTTAAAAGGGACAGTATTCTCAGTGCTCTCCTACCCCACCTCATGCCTGGCCCCTCCAGGCATGCTGGCCTCCCAATAAAGCTGGACAAGAAGCTGCTATG (SEQ ID NO:130)

[0314] The target sequence 4 is a nucleotide sequence in the mRNA expressed by the human ApoC3 gene, which is the target of the detected siRNA, so the inhibitory effect of each siRNA complex on the target sequence 4 can reflect the ability of the siRNA in the detected siRNA complex to inhibit the expression of the target gene. The target sequence 4 and its complementary sequence are listed in psiCHECK. TM The fragment was cloned into the Xho I / Not I sites of the -2 plasmid.

[0315] [2] Transfection HEK293A cells (purchased from Nanjing Kebai Biotechnology Co., Ltd.) were cultured in DMEM complete medium (Hyclone) supplemented with 20% fetal bovine serum (FBS, Hyclone) and 0.2% by volume of penicillin-streptomycin (Gibco, Invitrogen) in a 5% CO2 / 95% air-containing incubator at 37°C.

[0316] 8 × 10 HEK293A cells 3 Cells were seeded into a 96-well plate at 10 cells / well. After 16 hours, when the cell proliferation density reached 70-80%, the complete H-DMEM medium in the culture wells was aspirated, and 80 μL of Opti-MEM medium (GIBCO) was added to each well and the culture was continued for 1.5 hours.

[0317] The above detection plasmid was diluted using DEPC water to obtain a detection plasmid diluted standard solution of 200 ng / μL, and each of the following siRNA complexes or reference siRNA NC was prepared using DEPC water to obtain siRNA complex diluted standard solutions or reference siRNA NC diluted standard solutions of three different concentrations (as siRNA), namely 10 nM, 3 nM, and 1 nM, respectively. The siRNA complexes used were Complex 11, Complex 12, Complex 13, Complex 14, Complex 15, Complex 16, Reference Complex 6, Reference Complex 7, and Reference Complex 8, each of which was prepared as described above.

[0318] For each siRNA complex or reference siRNA NC, 12A1 to 12A3 solutions were prepared, respectively. Each 12A1 to 12A3 solution contained, in order, 1 μL of the siRNA complex dilution standard solution or reference siRNA NC dilution standard solution of the above three concentrations, 0.05 μL of detection plasmid dilution standard solution (containing 10 ng of detection plasmid), and 10 μL of Opti-MEM medium.

[0319] Prepare 12B solution: 1 part 12B solution contains 0.2 μL of Lipofectamine TM 2000 and 10 μL of Opti-MEM medium.

[0320] A 12C solution was prepared, with one part of the 12C solution containing 0.05 μL of detection plasmid working solution (containing 10 ng of detection plasmid) and 10 μL of Opti-MEM medium.

[0321] One part of each of the 12B solutions was mixed with one part of each of the obtained siRNA complexes or reference siRNA NC 12A1 to 12A3 solutions, and incubated at room temperature for 20 minutes to obtain transfection complexes 12X1 to 12X3 solutions of each of the siRNA complexes and reference siRNA NC.

[0322] One part of 12B solution was mixed with one part of 12C solution and incubated at room temperature for 20 min to obtain blank transfection complex 12X4.

[0323] Each siRNA complex or reference siRNA NC transfection complex 12X1 to 12X3 was added to the culture wells at an addition amount of 20 μL / well and mixed uniformly to obtain transfection complexes of each siRNA complex or reference siRNA NC with final concentrations of approximately 0.1 nM, 0.03 nM and 0.01 nM (as siRNA), respectively. Each siRNA complex or reference siRNA NC transfection complex 12X1 to 12X3 was transfected into three culture wells to obtain co-transfection mixtures containing siRNA complex or reference siRNA NC as test groups.

[0324] For each siRNA complex or reference siRNA NC, the transfection complex 12X4 was added to the other three culture wells at a loading volume of 20 μL / well, respectively, to obtain a transfection mixture without siRNA, which served as a blank control group.

[0325] After the co-transfection mixtures with and without siRNA were transfected into the culture wells for 4 h, 100 μL of H-DMEM complete medium containing 20% ​​FBS was added to each well. The 96-well plate was placed in a CO2 incubator and cultured for 24 h.

[0326] [3] Detection The medium in the culture wells was aspirated, and 150 μL of Dual-Glo (registered trademark) Luciferase reagent and H-DMEM mixed solution (volume ratio 1:1) was added to each well, mixed thoroughly and uniformly, and incubated at room temperature for 10 min. Then, 120 μL of the mixed solution was transferred to a 96-well microplate, and the Firefly chemiluminescence value (Fir) in each culture well of the 96-well microplate was read using a Synergy II multifunction microplate reader (BioTek). Furthermore, 60 μL of Dual-Glo (registered trademark) Stop & Glo (registered trademark) reagent was added to each well of the 96-well microplate, mixed thoroughly and uniformly, and incubated at room temperature for 10 min. Then, the Renilla chemiluminescence value (Ren) in each culture well of the 96-well microplate was read using a microplate reader according to the order of reading Fir.

[0327] The emission ratio Ratio = Ren / Fir of each well of the 96-well microplate was calculated, and the emission ratio Ratio (test) or Ratio (control) of each test group or control group was the average value of the Ratio of three culture wells. The emission ratio of each test group was normalized based on the emission ratio of the control group, and the relative expression level of the Renilla reporter gene, that is, the ratio R of Ratio (test) / Ratio (control) was obtained to indicate the residual activity. The inhibition rate of each siRNA complex or reference siRNA NC against the target sequence 4 = (1-R) ​​× 100%.

[0328] The inhibitory effect of each siRNA complex or reference siRNA NC against target sequence 4 is shown in Figure 7. Figure 7 is a histogram of the relative expression level of target sequence 4 in an in vitro siCHECK system after co-transfection of a plasmid containing target sequence 4 with a test siRNA complex or reference siRNA NC. Furthermore, the expression inhibitory rate of each siRNA complex or reference siRNA NC against target sequence 4 is summarized in Table 13.

[0329] Table 13. Expression inhibition rate of target sequence 4 in in vitro siCHECK system [Table 13]

[0330] As can be seen from the results of Figure 7 and Table 13, the siRNA complex provided by the present disclosure has a very high target sequence suppression activity in the in vitro siCHECK system. At a low concentration of 0.01 nM, the expression suppression rate of target sequence 4 is at least 38.92% and can reach a maximum of 67.54%, and at a concentration of 0.1 nM, the expression suppression rate of target sequence 4 is at least 84.73% and can reach a maximum of 89.35%. In addition, the siRNA complex has a target sequence suppression activity level close to that of Reference Complex 6, Reference Complex 7, or Reference Complex 8, which does not contain stabilizing modified nucleotides.

[0331] Experimental Example 13: Inhibitory activity of siRNA complexes in an in vitro siCHECK system The inhibitory activities of Complex 11, Complex 12 and Reference Complex 6 in an in vitro siCHECK system were tested using the method of Experimental Example 2, with the only difference being that instead of the tested siRNA, Complex 11, Complex 12 or Reference Complex 6 were used for detection, the target sequence used in the detection plasmid was the following target sequence 5, and each siRNA complex was prepared using DEPC water to give siRNA complex diluted standard solutions of 11 different concentrations (all as siRNA), namely 1.00 μM, 0.330 μM, 0.110 μM, 0.0370 μM, 0.0123 μM, 0.00412 μM, 0.00137 μM, 0.000457 μM, 0.000152 μM, 0.0000508 μM and 0.0000169 μM.

[0332] Target sequence 5: TTGCTTAAAAGGGACAGTATTCTCAGTGCTCTCCTACC (SEQ ID NO:131)

[0333] The target sequence 5 is a sequence that is completely complementary to the antisense strand of the siRNA in each of the tested complexes.

[0334] Measured IC 50 The values ​​are summarized in Table 14.

[0335] Table 14 IC of siRNA complexes in the pscheck system 50 [Table 14]

[0336] As can be seen from the results in Table 14, the siRNA complex of the present disclosure has extremely high target sequence suppression activity in the in vitro siCHECK system, and has an IC 50 between 6.89 and 8.55 pM, and has target sequence silencing activity close to that of reference complex 6, which has the same remaining sequence but does not contain stabilizing modified nucleotides.

[0337] Experimental Example 14: Lipid-lowering effect of siRNA complexes in vivo in mice Human APOC3 transgenic mice Tg(APOC3)3707Bres (purchased from Jackson Laboratory, USA) with serum TG content >2mmol / L were randomly divided into groups, with 6 mice per group, and half of each sex. Mice in each group were administered with complex 12, reference complex 6, and PBS blank control, respectively. All animals were administered with a single dose by subcutaneous injection, with the dose (as the amount of siRNA) of each siRNA complex being 3mg / kg and 1mg / kg mouse body weight, and the administration volume being 5ml / kg. Each siRNA complex was provided in a PBS aqueous solution, and the concentration of the complex to be prepared was calculated based on the dose and administration volume. Another group of mice was administered with 1xPBS at a dose volume of 5ml / kg, which served as the blank control group.

[0338] The administration time was set as day 1, and 100 μL of blood was collected from the orbital venous plexus of the mice on days 1, 9, 15, 22, 29, 36, and 50. After blood collection, the blood was left at room temperature for 30 min, and then centrifuged at 4°C and 3000 rpm for 15 min to obtain serum. In addition, the contents of total cholesterol (CHO) and triglyceride (TG) in the serum were detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy).

[0339] Standardized lipid level = (lipid content in test group after drug administration / lipid content in test group before drug administration) x 100%.

[0340] Inhibition rate of lipid level = (1 - lipid content in the test group after drug administration / lipid content in the test group before drug administration) x 100%.

[0341] Lipid refers to total cholesterol (CHO) or triglycerides (TG).

[0342] Figures 8A and 8B are line graphs showing the time course of serum TG levels or serum CHO levels after administration of the siRNA complex of the present disclosure, the reference siRNA complex, or PBS, respectively. Furthermore, the serum TG suppression rate and serum CHO suppression rate at each time point are summarized in Tables 15A and 15B below.

[0343] Table 15A Serum TG suppression rate of siRNA complex in transgenic mice [Table 15]

[0344] Table 15B Serum CHO suppression rate of siRNA complexes in transgenic mice [Table 16]

[0345] As can be seen from the results of Figures 8A, 8B and Tables 15A and 15B, at different time points after administration, complex 12 can obviously reduce TG and CHO levels in mouse serum, and showed lipid level lowering effect close to that of reference complex 6 that does not contain the corresponding stabilized modified nucleotide. In particular, at a dose of 3 mg / kg, complex 12 consistently showed a very high lipid TG lowering effect within the entire administration time of up to 50 days, and the maximum inhibition rate can reach 90.2%.

[0346] Experimental Example 15: Toxic effects of siRNA complexes in mice Complex 11, complex 12 and reference complex 6 were dissolved in PBS to 10mg / ml and 30mg / ml solutions (as siRNA complexes), respectively. ICR mice (half male and half female, weighing 18-22g, 5-6 weeks old, purchased from Speifuku Co., Ltd.) were randomly divided into groups and numbered. For each concentration of each complex, animals were divided into two groups, a 2-week group and a 4-week group, with 6 mice (half male and half female) per group. The above siRNA complex solution was administered to each mouse by subcutaneous injection at the neck in a dose volume of 10mL / kg, which was the test group, and each mouse in the two groups was administered PBS in a dose volume of 10mL / kg, which was the blank control group for the 2-week group and the 4-week group, respectively.

[0347] The administration time was set as day 1, and on day 15, blood was taken from the orbit of six mice in the two-week test group and the blank control group, and on day 29, blood was taken from the orbit of six mice in the four-week test group and the blank control group, with a blood volume of 0.6 mL. After blood was taken, the mice were incubated at 37°C for 60 min, and centrifuged at 4°C and 3000 rpm for 15 min to obtain serum. In addition, the concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum were detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy), and compared with the blank control group, and the results are shown in Table 16. In addition, after blood was taken on day 15, six mice in the two-week group of the 300 mg / kg complex were killed and autopsied, and each was preserved in 10% neutral buffered formalin fixative to prepare pathological sections. The severity of inflammatory cell infiltration and hepatocellular necrosis in pathological sections were evaluated, graded, and compared.

[0348] ALT:M:37% represents that the average value of alanine aminotransferase in male mouse serum is 37% higher than that of the blank control group, (M:first level, 1 / 3) represents that one of all three male mice showed a mild reaction, (F:third level, 3 / 3) represents that all three female mice showed a severe reaction, and so on. "-" represents no obvious abnormality, and "N / A" represents not tested.

[0349] Table 16. Blood biochemistry and liver histopathology results in mice administered siRNA complexes [Table 17]

[0350] In Table 16, F represents female mice, and % and the number before it represent the percentage of the difference between the concentration of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) in mouse serum and the concentration in the serum of the blank control group, relative to the concentration in the serum of the blank control group.For example, F:212% in Table 16 represents that the in vivo concentration of alanine aminotransferase in female mice administered with 300mg / Kg of reference complex 6 is 212% higher than that of the blank control group.

[0351] As can be seen from the results in Table 16, compared with the blank control, mice administered with reference complex 6 that does not contain stabilized modified nucleotides showed obvious changes in blood biochemical indicators, and at a high dose of 300 mg / Kg, the in vivo ALT and AST concentrations of female mice increased by 212% and 36%, respectively. At the same dose, the in vivo ALT and AST concentrations of female mice administered with complex 12 of the present disclosure increased by 130% and 32%, respectively, and compared with reference complex 6, the ALT concentration was obviously reduced; mice administered with complex 11 of the present disclosure did not show any increase in the in vivo ALT and AST concentrations, but compared with reference complex 6, the degree of change in blood biochemical indicators was obviously reduced.

[0352] As can be seen from the results of the pathological sections, compared with the blank control, the mice administered with the reference complex 6 that does not contain stabilized modified nucleotides showed obvious hepatic inflammatory response, and all six mice showed inflammatory cell infiltration. Of the mice administered with complex 11, only three mice showed inflammatory cell infiltration. Of the mice administered with complex 12, only three mice showed inflammatory cell infiltration. Compared with the reference complex, the number of mice showing inflammatory cell infiltration was also significantly reduced histopathologically in the case of the complex of the present disclosure.

[0353] As is evident from the above results, compared with the reference complex, the siRNA complex of the present disclosure can effectively reduce hepatotoxic responses caused by off-target effects, and therefore exhibits significantly higher safety and has excellent development prospects in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0354] Experimental Example 16: Inhibitory activity of siRNA complexes in an in vitro siCHECK system The off-target sequence suppression activity of complex 11 and complex 13 in an in vitro siCHECK system was tested by the method of Experimental Example 13. Instead of the tested siRNA complex, complex 11 or complex 13 was used for detection, the only difference being that for complex 11, the target sequence used was target sequence 5, or target sequences 6 to 8 shown below were used instead of target sequence 5, and for complex 13, the target sequence used was target sequence 5, or target sequences 9 to 11 shown below were used instead of target sequence 5,

[0355] Target sequence 6: TAGGCCCCTTTCAAGTATTCT (SEQ ID NO:132) Target sequence 7: AGAATACTGTCCCTTTTAAGC (SEQ ID NO:133) Target sequence 8: CTCCGCAGTGAAATTTTAAGC (SEQ ID NO:134) Target sequence 9: CTTTCACTGCGGATCAGTGCT (SEQ ID NO:135) Target sequence 10: AGCACTGAGAATACTGTCCCT (SEQ ID NO:136) Target sequence 11: CTACAGTCTCCGCCTGTCCCT (SEQ ID NO:137)

[0356] Since the target sequence 5 contains a sequence that is completely complementary to the antisense strand of the siRNA in the complex 11 and the complex 13, the inhibitory effect of the complex 11 or 13 on the target sequence 5 can reflect the ApoC3 mRNA inhibitory activity of the complex 11 or 13, the target sequence 6 contains a sequence that is partially complementary to the antisense strand of the siRNA in the complex 11, the target sequence 7 contains a sequence that is completely complementary to the sense strand of the siRNA in the complex 11, and the target sequence 8 contains a sequence that is partially complementary to the sense strand of the siRNA in the complex 11, so that the inhibitory effect of the complex 11 on the target sequences 6, 7 or 8 can reflect the degree of off-target effect. That is, the higher the inhibitory effect, the higher the possibility that the complex 11 will cause off-target. Similarly, target sequence 9 contains a sequence partially complementary to the antisense strand of the siRNA in complex 13, target sequence 10 contains a sequence completely complementary to the sense strand of the siRNA in complex 13, and target sequence 11 contains a sequence partially complementary to the sense strand of the siRNA in complex 13, so that the inhibitory effect of complex 13 on target sequence 9, target sequence 10, or target sequence 11 can reflect the degree of off-target effect. That is, the higher the inhibitory effect, the higher the possibility that complex 13 will cause off-target.

[0357] As a result, in the in vitro siCHECK system, the inhibitory IC 50 The IC value of the complex 13 for target sequence 5 was 11.3 pM, and the inhibition rate for target sequences 6, 7, and 8 was less than 50% in the entire range of siRNA concentrations tested, i.e., no off-target activity was observed in any of the sequences. 50The inhibition rate for the target sequences 9, 10, and 11 was less than 50% within the entire range of siRNA concentrations tested, that is, no off-target activity occurred.

[0358] As can be seen from the above, in the in vitro siCHECK system, the siRNA complex of the present disclosure exhibited excellent on-target sequence suppression activity and IC 50 The values ​​range from 4.50 pM to 11.3 pM, and the siRNA complexes of the present disclosure have low off-target effects.

[0359] Experimental Example 17: Lipid-lowering effect of siRNA complexes in vivo in mice The lipid-lowering effect of the siRNA complex in vivo in mice was detected by the method of Experimental Example 14, except that the siRNA complex used was Complex 13 or Complex 14. The results are shown in Figures 9A and 9B.

[0360] 9A and 9B are line graphs showing the time course of serum TG levels or serum CHO levels after administration of the siRNA complex of the present disclosure or PBS, respectively. Furthermore, the serum TG suppression rate and serum CHO suppression rate at each time point are summarized in Tables 17A and 17B below.

[0361] Table 17A Serum TG suppression rate of siRNA complex in transgenic mice [Table 18]

[0362] Table 17B Serum CHO suppression rate of siRNA complexes in transgenic mice [Table 19]

[0363] As can be seen from the results of Figures 9A, 9B and Tables 17A and 17B, at different time points after administration, complex 13 and complex 14 can obviously reduce TG and CHO levels in mouse serum. In particular, at doses of 3mg / kg and 1mg / kg, complex 14 consistently shows a very high lipid TG lowering effect within the entire administration period up to 50 days, and the maximum inhibition rate can reach 92.0%.

[0364] Experimental Example 18: Toxic effects of siRNA complexes in mice The toxicity effect of siRNA complex in mice was verified by the method of Experimental Example 15, except that complex 13 and reference complex 7 were used for the test. Each complex was dissolved in PBS at 10 mg / ml (as siRNA complex), and divided into 2-week and 4-week groups (referred to as D15 and D29 groups in Table 18, respectively), with 3 mice per group, all male. That is, the toxicity effect of complex 13 and reference complex 7 in mice was tested at a dose of 100 mg / kg. The results are shown in Table 18.

[0365] Table 18. Blood biochemistry results of mice administered siRNA complexes [Table 20]

[0366] In Table 18, the % and the number preceding it represent the percentage of the difference between the concentration of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) in mouse serum and the concentration in serum of the blank control group relative to the concentration in serum of the blank control group.

[0367] As can be seen from the results in Table 18, compared with the blank control, mice administered with reference complex 7 that does not contain stabilized modified nucleotides showed obvious changes in blood biochemical indicators, and on the 15th day after administration, the serum ALT and AST concentrations increased by 71% and 54%, respectively, and on the 29th day after administration, the serum ALT and AST concentrations increased by 118% and 94%, respectively. In mice administered with the same dose of complex 13, no increase in serum ALT and AST concentrations was observed. Complex 13 of the present disclosure shows significantly lower blood biochemical indicators.

[0368] As is evident from the above results, compared with the reference complex, the siRNA complex of the present disclosure can effectively reduce hepatotoxic responses caused by off-target effects, and therefore exhibits significantly higher safety and has excellent development prospects in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0369] Experimental Example 19: Lipid-lowering effect of siRNA complexes in vivo in mice The lipid-lowering effect of the siRNA complex in vivo in mice was detected by the method of Experimental Example 14, except that the siRNA complex used was complex 13, the dosage (as the amount of siRNA) of each siRNA complex was 9 mg / kg, 3 mg / kg, 1 mg / kg, 0.5 mg / kg, 0.25 mg / kg, 0.1 mg / kg, or 0.05 mg / kg of mouse body weight, and the administration volume was 5 ml / kg. Each siRNA complex was provided in a PBS aqueous solution, and the concentration of the complex to be prepared was calculated based on the dosage and administration volume. The administration time was set to the first day, and blood was collected from the orbital venous plexus of the mouse on the first, eighth, fifteenth, twenty-second, twenty-ninth, thirty-sixth, forty-third, fifty-seventh, and sixty-fourth days to detect the TG level in serum. The results are shown in FIG. 10.

[0370] 10 is a line graph showing the time course of serum TG levels after administration of different concentrations of complex 13 or PBS. Furthermore, the serum TG suppression rates at each time point are summarized in Table 19 below.

[0371] Table 19. Serum TG suppression rate of siRNA complex in transgenic mice [Table 21]

[0372] As can be seen from the results in FIG. 10 and Table 19, at different time points after administration, different concentrations of complex 13 could all reduce the TG levels in mouse serum. In particular, after a single administration at a dose of 9 mg / kg, the siRNA complex of the present disclosure could consistently maintain a TG level inhibition rate of more than 50% for a long period of 64 days, and the inhibition rate could reach a maximum of 89.5%, demonstrating excellent lipid inhibition ability.

[0373] Experimental Example 20: Inhibitory activity of siRNA complexes in an in vitro siCHECK system The inhibitory activity of complex 17 in an in vitro siCHECK system was tested according to the method of Experimental Example 13, except that complex 17 was used instead of the siRNA complex tested. As a result, complex 17 showed high inhibitory activity against the target sequence in the in vitro siCHECK system, and IC 50 is 49.8 pM.

[0374] Experimental Example 21: Lipid-lowering effect of siRNA complexes in vivo in mice Human APOC3 transgenic mice Tg(APOC3)3707Bres (purchased from Jackson Laboratory, USA) with serum TG content >2mmol / L were randomly divided into groups, with 8 mice per group, and half of each sex. Mice in each group were administered with complex 13, complex 17, and PBS blank control, respectively. All animals were administered with a single dose by subcutaneous injection, with the dose (as the amount of siRNA) of each siRNA complex being 3mg / kg and 1mg / kg mouse body weight, and the administration volume being 5ml / kg. Each siRNA complex was provided in a PBS aqueous solution, and the concentration of the complex to be prepared was calculated based on the dose and administration volume. Another group of mice was administered with 1xPBS at a dose volume of 5ml / kg, which served as the blank control group.

[0375] The administration time was set as day 1, and 100 μL of blood was collected from the orbital venous plexus of the mice on days 1, 8, 15, 22, 29, 36, and 43. After blood collection, the blood was left at room temperature for 30 min, and then centrifuged at 4°C and 3000 rpm for 15 min to obtain serum. In addition, the total cholesterol (CHO) and triglyceride (TG) contents in the serum were detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy).

[0376] Standardized lipid level = (lipid content in test group after drug administration / lipid content in test group before drug administration) x 100%.

[0377] Inhibition rate of lipid level = (1 - lipid content in the test group after drug administration / lipid content in the test group before drug administration) x 100%.

[0378] Lipid refers to total cholesterol (CHO) or triglycerides (TG).

[0379] Figures 11A and 11B are line graphs showing the time course of serum TG levels or serum CHO levels after administration of the siRNA complex of the present disclosure or PBS, respectively. Furthermore, the mouse serum TG suppression rate and serum CHO suppression rate at each time point after administration of the siRNA complex of the present disclosure are summarized in Tables 20A and 20B below.

[0380] Table 20A Serum TG suppression rate of siRNA complex in transgenic mice [Table 22]

[0381] Table 20B Serum CHO suppression rate of siRNA complexes in transgenic mice [Table 23]

[0382] As can be seen from the analysis of the results of Figures 11A, 11B and Tables 20A and 20B, at different time points after administration, complex 13 and complex 17 can obviously reduce the TG and CHO levels in mouse serum. In addition, they maintained a consistently high inhibitory effect within the 43-day experimental period. In particular, complex 13 and complex 17 at a dose of 3 mg / kg both showed excellent lipid inhibitory effect in mice, with the maximum inhibitory rate of serum TG being higher than 88% and the maximum inhibitory rate of serum CHO being 51.18% and 57.41%, respectively. As can be seen from the above results, the siRNA complex of the present disclosure can effectively reduce lipid levels for a long period of time, showing good development prospects in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0383] Experimental Example 22: Toxic effects of siRNA complexes in mice Complex 13 and complex 17 were dissolved in PBS to a solution of 30 mg / ml (as siRNA complex). ICR mice (half male and half female, weighing 18-22 g, 5-6 weeks old, purchased from Sigma Co., Ltd.) were randomly divided into groups, with 10 mice (half male and half female) per group, and each was numbered. The above siRNA complex solution was administered to each mouse by subcutaneous injection at the neck in a volume of 10 mL / kg to serve as the test group, and PBS was administered to each mouse in one group in a volume of 10 mL / kg to serve as the blank control group.

[0384] The first administration was on day 1, and the mice were repeatedly administered on days 8 and 15, respectively. The siRNA complex solution (or PBS) concentration and administration volume used were the same as those of the first administration. On day 16, 0.6 mL of blood was collected from the orbit of each mouse in the test group and blank control group. After blood collection, the blood was incubated at 37°C for 60 min, and then centrifuged at 4°C and 3000 rpm for 15 min to obtain serum. In addition, the concentrations of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum were detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy). The results are shown in Figure 12A and Figure 12B.

[0385] Figures 12A and 12B are scatter plots of ALT and AST concentrations in mouse serum after 300mg / kg weekly administration of the siRNA complex of the present disclosure or PBS for 3 consecutive weeks. As can be seen from Figures 12A and 12B, compared with the blank control group, after administration of the siRNA complex of the present disclosure, the ALT and AST concentrations in serum are equivalent to the levels of the blank control group, indicating that the siRNA complex of the present disclosure has very low hepatotoxicity.

[0386] Furthermore, after blood collection, the mice were killed and autopsied, and preserved in 10% neutral buffered formalin fixative to prepare pathological sections. As can be seen from the pathological sections, the mice administered with siRNA complex 3 or complex 5 of the present disclosure showed similar responses to the blank control group in terms of both hepatic steatosis and inflammation, and had no significant abnormalities. Similarly, the siRNA complex of the present disclosure was shown to have very low hepatotoxicity.

[0387] As is evident from the above results, the siRNA complex of the present disclosure can effectively reduce hepatotoxic reactions caused by off-target effects, and therefore exhibits remarkably high safety and has excellent development prospects in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0388] Experimental Example 23: Lipid-lowering effect of siRNA complexes in vivo in mice Human APOC3 transgenic mice Tg(APOC3)3707Bres (purchased from Jackson Laboratory, USA) with serum TG content >2mmol / L were randomly divided into groups, with 6 mice per group, and half of each sex. Mice in each group were administered with Complex 15, Complex 16, Reference Complex 8, and PBS blank control, respectively. All animals were administered with a single dose by subcutaneous injection, with the dose (as the amount of siRNA) of each siRNA complex being 3mg / kg and 1mg / kg mouse body weight, and the administration volume being 5ml / kg. Each siRNA complex was provided in a PBS aqueous solution, and the concentration of the complex to be prepared was calculated based on the dose and administration volume. Another group of mice was administered with 1xPBS at a dose volume of 5ml / kg, which served as the blank control group.

[0389] The administration time was set to day 1, and 100 μL of blood was collected from the orbital venous plexus of the mice on days 1, 8, 15, and 22. After blood collection, the blood was left at room temperature for 30 min, and then centrifuged at 3000 rpm for 15 min at 4°C to obtain serum. In addition, the total cholesterol (CHO) and triglyceride (TG) contents in the serum were detected using a PM1P000 / 3 fully automated serum biochemistry analyzer (SABA, Italy).

[0390] Standardized lipid level = (lipid content in test group after drug administration / lipid content in test group before drug administration) x 100%.

[0391] Inhibition rate of lipid level = (1 - lipid content in the test group after drug administration / lipid content in the test group before drug administration) x 100%.

[0392] Lipid refers to total cholesterol (CHO) or triglycerides (TG).

[0393] Figures 13A and 13B are line graphs showing the time course of serum TG levels or serum CHO levels after administration of the siRNA complex of the present disclosure, the reference siRNA complex, or PBS, respectively. Furthermore, the mouse serum TG suppression rate and serum CHO suppression rate at each time point after administration of the siRNA complex of the present disclosure are summarized in Tables 21A and 21B below.

[0394] Table 21A Serum TG suppression rate of siRNA complex in transgenic mice [Table 24]

[0395] Table 21B Serum CHO suppression rate of siRNA complexes in transgenic mice [Table 25]

[0396] As can be seen from the results in Figures 13A, 13B and Tables 21A and 21B, at different time points after administration, conjugates 15 and 16 can obviously reduce TG and CHO levels in mouse serum, and within the 22-day experimental period, they maintained consistently high inhibitory effects and showed lipid level-reducing effects close to those of the reference conjugate 8 that does not contain the corresponding stabilizing modified nucleotide.

[0397] In particular, complex 15 and complex 16 at a dose of 3 mg / kg both showed excellent lipid suppression effects in mice, with the maximum serum TG suppression rates both being higher than 92%, and the maximum serum CHO suppression rates being 57.5% and 54.9%, respectively. As is evident from the above results, the siRNA complex of the present disclosure can effectively reduce lipid levels over a long period of time, and shows excellent development prospects in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0398] Experimental Example 24: Toxic effects of siRNA complexes in mice The toxicity of siRNA complexes in mice was verified by the method of Experimental Example 11, except that complexes 15, 16 and reference complex 8 were used for the test, and each complex was dissolved in PBS at 10 mg / ml (as siRNA complex). All mice were autopsied with serum taken on the 8th day. That is, the toxicity of complexes 15, 16 and reference complex 8 were tested in mice at a dose of 100 mg / kg. The results are shown in Table 22.

[0399] Table 22. Blood biochemistry results of mice administered siRNA complexes [Table 26]

[0400] In Table 22, the % and the number before it represent the percentage of the difference between the concentration of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) in mouse serum and the concentration in the serum of the blank control group, relative to the concentration in the serum of the blank control group. For example, 420% in Table 22 represents that the in vivo concentration of alanine aminotransferase in mice administered with 100 mg / Kg of reference complex 8 is 420% higher than that of the blank control group.

[0401] As can be seen from the results in Table 22, compared with the blank control, mice administered with reference complex 8 without stabilized modified nucleotides showed obvious changes in blood biochemical indicators, with ALT levels increasing by 420% and AST levels increasing by 126%. In mice administered with siRNA complexes 15 or 16 of the present disclosure, ALT levels increased by 116% and 118%, respectively, and AST levels increased by 32%, showing significantly reduced blood biochemical indicators.

[0402] As can be seen from the results of the pathological sections, compared with the blank control, one of the six mice administered with reference complex 8 without stabilized modified nucleotides showed a moderate hepatocyte inflammatory response, with specific symptoms of a small amount of diffuse inflammatory cell infiltration in the liver lobule and diffuse proliferation of fibrocytes in the liver sinus, three mice showed a mild hepatocyte inflammatory response, with focal infiltration of inflammatory cells in the localized liver lobule, and one mouse showed localized hepatocyte inflammatory necrosis and punctate necrosis of individual liver cells. Of the mice administered with complex 15 of the present disclosure, only two mice showed a mild hepatocyte inflammatory response, with a small amount of inflammatory cell infiltration, and no moderate or higher inflammatory response and necrosis. Of the mice administered with complex 16 of the present disclosure, only one mouse showed a mild hepatocyte inflammatory response, with no moderate or higher inflammatory response and necrosis. Compared with reference complex 8, complexes 15 and 16 showed significantly lower toxic responses.

[0403] As is evident from the above results, compared with the reference complex, the siRNA complex of the present disclosure can effectively reduce hepatotoxic responses caused by off-target effects, and therefore exhibits significantly higher safety and has excellent development prospects in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0404] Experimental Example 25: Inhibitory activity of siRNA complexes in an in vitro siCHECK system The inhibitory activity of the siRNA complex in an in vitro siCHECK system was detected by the method of Experimental Example 12, except that instead of the siRNA complex tested in Experimental Example 12, Complex 18, Complex 19 or Reference Complex 9 was used for the test, and the target sequence used was Target Sequence 12 below.

[0405] Target sequence 12: AGCCAAGAGCACCAAGAACTA (SEQ ID NO:138)

[0406] The target sequence 12 is a nucleotide sequence in the mRNA expressed by the human AMGPTL3 gene, which is the target of the detected siRNA, so the inhibitory effect of each siRNA complex on the target sequence 12 can reflect the ability of the siRNA in the detected siRNA complex to inhibit the expression of the target gene. The target sequence 12 and its complementary sequence are identified by psiCHECK. TM The fragment was cloned into the Xho I / Not I sites of the -2 plasmid.

[0407] The inhibitory effect of each siRNA complex or reference siRNA NC against target sequence 12 is shown in Figure 14. Figure 14 is a histogram of the relative expression level of target sequence 12 in an in vitro siCHECK system after co-transfection of a plasmid containing target sequence 12 with a test siRNA complex or reference siRNA NC. Furthermore, the expression inhibitory rate of each siRNA complex or reference siRNA NC against target sequence 12 is summarized in Table 23.

[0408] Table 23. Expression inhibition rate of target sequence 12 in in vitro siCHECK system [Table 27]

[0409] As can be seen from the results of FIG. 14 and Table 23, the siRNA complex provided by the present disclosure has very high target sequence suppression activity in the in vitro siCHECK system. At a low concentration of 0.01 nM, the target sequence expression suppression rate is at least 51.56% and can reach a maximum of 58.76%, and at a concentration of 0.1 nM, the target sequence expression suppression rate can reach 87.92-88.84%. In addition, compared to the reference complex 9 that does not contain stabilizing modified nucleotides, it has a similar target sequence suppression activity level.

[0410] Experimental Example 26: Off-target sequence suppression activity of siRNA complexes in an in vitro siCHECK system The off-target sequence suppression activity of the siRNA complexes in an in vitro siCHECK system was measured by the method described in Experimental Example 2, except that instead of the tested siRNA complexes, Complex 18, Complex 19, Complex 20, Complex 21, Reference Complex 9 or Reference Complex 11 were used and the target sequence used was Target Sequence 12 or Target Sequence 13 shown below.

[0411] CTAACCTCTACAAAAGAACTA (SEQ ID NO:139)

[0412] Since the target sequence 13 contains a nucleotide sequence that is partially complementary to the antisense strand of the siRNA in the siRNA complex to be tested, the inhibitory effect of each siRNA complex on the target sequence 13 can reflect the degree of off-target effect. That is, the higher the inhibitory effect, the higher the possibility of the siRNA complex causing off-target. Meanwhile, the ratio between the inhibitory effect of each siRNA complex on the target sequence 12 and the inhibitory effect of each siRNA complex on the target sequence 13 can reflect the relative off-target tendency of the siRNA complex, and the higher the ratio, the less likely the siRNA complex is to cause off-target, and the lower the possibility of off-target toxicity when the same level of efficacy is obtained.

[0413] For the target sequence 12, from the dose-effect curve and the corresponding function, the corresponding X when Y=75% is obtained. 75 Determine the on-target IC value for each siRNA complex 25 Value=10^X 25 (nM) was calculated.

[0414] For the target sequence 13, from the dose-effect curve and the corresponding function, the corresponding X when Y=75% is obtained. 75 Determine the off-target IC value for each siRNA complex. 25 Value=10^X 25 (nM) was calculated.

[0415] In addition, the off-target IC of each siRNA complex 25 / On-Target IC 25 The ratio was calculated. The results are summarized in Table 24.

[0416] Table 24. Off-target sequence suppression activity of siRNA complexes in the siCHECK system [Table 28]

[0417] As can be seen from the results in Table 24, compared with reference complex 9 and reference complex 11, which do not contain stabilizing modified nucleotides, each siRNA complex containing the stabilizing modified nucleotides of the present disclosure not only has comparable or significantly higher inhibitory activity against the on-target sequence of interest 12, but also exhibits significantly lower off-target effects and off-target IC 25 / On-Target IC 25 is at least 499, and even reaches 2100, while obtaining the same or similar desired efficacy, indicating that the siRNA complex of the present disclosure has lower off-target effects than the reference complex, thereby indicating good application potential in the preparation of drugs for inhibiting ANGPTL3, which are more effective and have less toxicity due to off-target effects.

[0418] Experimental Example 27: Effect of siRNA complexes on ANGPTL3 mRNA reduction in mice in vivo C57BL / 6 mice (6-8 weeks old, purchased from Speifuku Co., Ltd.) with serum TG content >2mmol / L were randomly divided into groups, with 5 mice per group, all female. Mice in each group were administered with Complex 18, Complex 19, Reference Complex 9, and PBS blank control, respectively. All animals were administered with a single dose by subcutaneous injection, with the dosage (as siRNA amount) of each siRNA complex being 3mg / kg mouse body weight, and the administration volume being 5ml / kg. Each siRNA complex was provided in a PBS aqueous solution, and the concentration of the complex to be prepared was calculated based on the dosage and administration volume. Another group of mice was administered with 1xPBS at a dosage volume of 5ml / kg, which served as the blank control group.

[0419] The administration time was set to the first day, and the animals were sacrificed on the 15th day. The liver tissue of each mouse was collected and preserved in RNA later (Sigma Aldrich). 1 mL of Trizol (Sigma) was added to each liver tissue, and the tissue was homogenized three times, 30 s each time, using a Tissuelyset II type fully automatic tissue homogenizer to obtain a liver tissue homogenate. 0.2 mL of chloroform was added to this, mixed uniformly, and left to stand for 10 min. The mixture was centrifuged at 12000 rpm at 4 ° C for 10 min, and 0.4 mL of supernatant was taken. 0.5 mL of isopropanol was added to the supernatant and left to stand at room temperature for 10 min. The mixture was centrifuged at 12000 rpm at 4 ° C for 10 min, and the supernatant was discarded. 1 mL of 75% ethanol was added to the precipitate to wash the precipitate, and the precipitate was centrifuged at 12000 rpm at 4 ° C for 5 min, and the supernatant was discarded. 70 μL of DEPC water was added to the precipitate to obtain an extracted total RNA solution. The RNA concentration was measured using NANO DROP 2000 (Thermo) according to the method described in the instructions.

[0420] For the total RNA of each mouse liver tissue, a total RNA aqueous solution containing 1μg of total RNA was taken, the solution volume was 1000μL / RNA concentration (ng / μL), and a reverse transcription kit Reverse Transcription System (purchased from TSINGKE) was used to prepare a 20μL reverse transcription reaction system according to the reverse transcription operation steps in the kit's instructions, and the total RNA was reverse transcribed. The reverse transcription conditions are as follows: For each reverse transcription reaction system, the reverse transcription reaction system was incubated at 42℃ for 30min, then incubated at 95℃ for 5min, and finally incubated at 4℃ for 5min. After the reaction was completed, 80μL of DEPC water was added to each reverse transcription reaction system to obtain a solution containing cDNA.

[0421] For each reverse transcription reaction system, 5μL of the solution containing the above cDNA was used as template, and 20μL of qPCR reaction system was prepared using the reagents provided by 2×Ultra SYBR Mixture (with ROX) kit (purchased from Beijing Kangwei Century Co., Ltd.), and the PCR primer sequences for amplifying the target gene mANGPTL3 and the internal reference gene mGAPDH were as shown in Table 25, and the final concentration of each primer was 0.25μM. Each qPCR reaction system was placed in an ABI StepOnePlus Real-Time PCR machine and amplified using a three-step method, and the amplification process was performed by pre-denaturing at 95℃ for 10min, then denaturing at 95℃ for 30s, annealing at 60℃ for 30s, and elongating at 72℃ for 30s. The above denaturation, annealing, and elongation steps were repeated a total of 40 times to obtain the product W of the target gene mANGPTL3 and the endogenous reference gene mGAPDH. The product W was immediately incubated at 95°C for 1 min, 55°C for 30 s, and 95°C for 30 s, respectively, and the melting curves of the target gene mANGPTL3 and the endogenous reference gene mGAPDH in the product W were collected using a quantitative real-time PCR device, and the Ct values ​​of the target gene mANGPTL3 and the endogenous reference gene mGAPDH were obtained.

[0422] Table 25 Primer sequence information [Table 29]

[0423] The comparative Ct (ΔΔCt) method was used to relatively and quantitatively calculate the relative expression level and inhibition rate of the target gene mANGPTL3 in each test group. The calculation method is as follows:

[0424] ΔCt(test group)=Ct(target gene in test group)-Ct(endogenous reference gene in test group) ΔCt(control group)=Ct(gene of interest in control group)-Ct(endogenous reference gene in control group) ΔΔCt(test group)=ΔCt(test group)-ΔCt(average value of control group) ΔΔCt(control group) = ΔCt(control group) - ΔCt(mean value of the control group) ΔCt (mean value of control group) was the arithmetic mean of the ΔCt (control group) of each of the five mice in the control group, so that each mouse in the test and control groups corresponded to one ΔΔCt value.

[0425] The expression level of mANGPTL3 mRNA in the test group was normalized based on the control group, and the expression level of mANGPTL3 mRNA in the blank control group was defined as 100%. Test group mANGPTL3 mRNA relative expression level = 2 -ΔΔCt(試験群) ×100% Inhibition rate of mANGPTL3 mRNA in the test group = (1 - relative expression level of mANGPTL3 mRNA in the test group) x 100% The results are shown in Figure 15. Figure 15 is a scatter plot of the relative expression levels of mANGPTL3 mRNA in the liver of C57BL / 6 mice after administration of 3 mg / kg (as siRNA) of complex 18, complex 19, or reference complex 9 and PBS. Furthermore, the mANGPTL3 mRNA suppression rate of each siRNA complex is summarized in Table 26.

[0426] Table 26. Inhibition of mANGPTL3 mRNA in mice in vivo [Table 30]

[0427] As can be seen from the results in Figure 15 and Table 26, the siRNA complex of the present disclosure shows excellent mANGPTL3 mRNA suppression effect in vivo in mice, with an mANGPTL3 mRNA suppression rate of at least 70% and even reaching 95% at a dose of 3 mg / kg, and exhibits mANGPTL3 mRNA suppression activity equivalent to or higher than that of the reference complex 9 which does not contain the corresponding stabilizing modified nucleotide.

[0428] Experimental Example 28: Toxic effects of siRNA complexes in mice The toxicity effect of siRNA complex in mice was verified by the method of Experimental Example 11, except that complex 18 and reference complex 9 were used for the test, and each complex was dissolved in PBS at 10 mg / ml solution (as siRNA complex). That is, the toxicity effect of complex 18 and reference complex 9 in mice was tested at a dose of 100 mg / kg. The results are shown in Table 27.

[0429] Table 27. Blood biochemistry results of mice administered siRNA complexes [Table 31]

[0430] In Table 27, the % and the number preceding it represent the percentage of the difference between the concentration of alanine aminotransferase (ALT) or aspartate aminotransferase (AST) in mouse serum and the concentration in serum of the blank control group relative to the concentration in serum of the blank control group.

[0431] As can be seen from the results in Table 27, compared to the blank control, the serum ALT concentration of male and female mice administered with reference complex 9 that does not contain stabilized modified nucleotides increased by 630% and 840%, respectively, and the serum AST concentration increased by 114% and 145%, respectively. The serum ALT concentration of male and female mice administered with complex 18 of the present disclosure increased by 25.6% and 101%, respectively, and the serum AST concentration increased by 10.8% and 37.0%, respectively. Compared to reference complex 9, the changes in blood biochemical indicators were significantly reduced.

[0432] As can be seen from the pathological section results, among the mice administered with reference complex 9, 4 mice showed severe hepatocyte degeneration, with specific symptoms of a relatively large number of hepatocyte ballooning in the tissue, swollen cells, intermediate nuclei, and hollow cytoplasm, and 2 mice showed extremely severe hepatocyte degeneration, with specific symptoms of extensive hepatocyte ballooning in the tissue, swollen cells, intermediate nuclei, and hollow cytoplasm. Among the mice administered with complex 18 of the present disclosure, 3 mice showed mild hepatocyte degeneration, with specific symptoms of intact lobule structure in the tissue, tight arrangement of hepatocytes, loose cytoplasm of a few hepatocytes, and no severe or extremely severe hepatocyte degeneration.

[0433] As is evident from the above results, compared with the reference complex, the siRNA complex of the present disclosure can effectively reduce hepatotoxic responses caused by off-target effects, and therefore exhibits significantly higher safety and has excellent development prospects in the preparation of drugs for the treatment and / or prevention of dyslipidemia-related diseases or symptoms.

[0434] Although several embodiments of the present disclosure have been described in detail above, the present disclosure is not limited to the specific details of the above embodiments, and within the scope of the technical idea of ​​the present disclosure, several simple modifications may be made to the technical solutions of the present disclosure, and all of these simple modifications fall within the protection scope of the present disclosure.

[0435] It should be noted that the specific technical features described in the above embodiments may be combined in any suitable manner if not contradictory, and in order to avoid unnecessary duplication, the present disclosure does not separately describe all possible combination manners.

[0436] Furthermore, the various embodiments of the present disclosure can be combined in any manner and should be considered as being disclosed in the present disclosure unless they deviate from the spirit of the present disclosure.

Claims

**Claim 1** A double-stranded oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence I, the antisense strand comprises a nucleotide sequence II, both the nucleotide sequence I and the nucleotide sequence II consist of 19 nucleotides, each nucleotide in the nucleotide sequence I and the nucleotide sequence II is a modified or unmodified nucleotide, the nucleotide sequence I and the nucleotide sequence II form a double-stranded region at least partially in reverse complementarity, the nucleotide sequence II is at least partially reverse complementary to a first nucleotide sequence, the first nucleotide sequence is a nucleotide sequence 19 nucleotides in length in the mRNA expressed by a target gene, and at least one of the nucleotides at positions 3 to 6 of the nucleotide sequence II, when going from the 5'-end to the 3'-end, is a stabilized modified nucleotide, and the nucleotides other than the nucleotides at positions 3 to 9 of the nucleotide sequence II are not stabilized modified nucleotides. The stabilized modified nucleotide refers to a nucleotide in which the hydroxy at the 2'-position of the ribose of the nucleotide is substituted with a stabilized modifying group. Compared with a double-stranded oligonucleotide in which the corresponding position nucleotides are unmodified nucleotides, the double-stranded oligonucleotide containing the stabilized modified nucleotide has increased thermal stability, and the steric hindrance of the stabilized modifying group is greater than that of 2'-O-methyl. A double-stranded oligonucleotide. **Claim 2** When going from the 5'-end to the 3'-end, the nucleotide at position 3 or 5 in the nucleotide sequence II is the stabilized modified nucleotide, or When going from the 5'-end to the 3'-end, two or fewer of the nucleotides at positions 3 to 9 in the nucleotide sequence II are the stabilized modified nucleotides, or When going from the 5'-end to the 3'-end, the nucleotide at position 3 and / or 5 in the nucleotide sequence II is the stabilized modified nucleotide. Preferably, one of the nucleotides at positions 4, 7 or 9 is also the stabilized modified nucleotide, or When going from the 5'-end to the 3'-end, the nucleotides at positions 3 and 9 of the nucleotide sequence II are the stabilized modified nucleotides, or From the 5'-end towards the 3'-end, the nucleotides at the 5th and 7th positions of the nucleotide sequence II are the stabilized modified nucleotides, or The double-stranded oligonucleotide according to claim 1, wherein from the 5'-end towards the 3'-end, the nucleotides at the 5th and 9th positions of the nucleotide sequence II are the stabilized modified nucleotides. **Claim 3** That the thermal stability of the double-stranded oligonucleotide increases means that the melting temperature Tm of the double-stranded oligonucleotide increases, or That the thermal stability of the double-stranded oligonucleotide increases means that the melting temperature Tm of the double-stranded oligonucleotide increases by at least 0.05 °C, or That the thermal stability of the double-stranded oligonucleotide increases means that the melting temperature Tm of the double-stranded oligonucleotide increases by at least 0.1 - 6 °C, or The double-stranded oligonucleotide according to claim 1, wherein that the thermal stability of the double-stranded oligonucleotide increases means that the melting temperature Tm of the double-stranded oligonucleotide increases by at least 0.5 - 4 °C. **Claim 4** Each of the stabilizing modifying groups independently has a structure represented by -X-R, where X is O, NR', S, or SiR' ２ and R is C ２ -C ６ alkyl, substituted C ２ -C ６ alkyl, C ６ -C ８ aryl, substituted C ６ -C ８ aryl, and each R' is independently H, C １ -C ６ alkyl, substituted C １ -C ６ alkyl, C ６ -C ８ aryl, substituted C ６ -C ８ aryl, and the substituted C ２ -C ６ alkyl or substituted C ６ -C ８ aryl refers to a group in which one or more hydrogen atoms in C ２ -C ６ alkyl or C ６ -C ８ aryl are substituted with substituents, and the substituents are each independently selected from C １ -C ３ alkyl, C ６ -C ８ aryl, C １ -C ３ alkoxy, halogen, an oxy subunit, and a sulfide subunit, or Each of the stabilized modifying groups is independently selected from 2'-O-methoxyethyl, 2'-O-allyl, 2'-C-allyl, 2'-O-2-N-methylamino-2-oxyethylideneethyl, 2'-O-2-N,N-dimethylaminoethyl, 2'-O-3-aminopropyl, and 2'-O-2,4-dinitrophenyl, or The double-stranded oligonucleotide according to claim 1, wherein each of the stabilized modifying groups is 2'-O-methoxyethyl. **Claim 5** The nucleotide sequence II and the first nucleotide sequence are basically reverse complementary, substantially reverse complementary or completely reverse complementary, or The double-stranded oligonucleotide according to claim 1, wherein from the 5'-end towards the 3'-end, the nucleotides at the 2nd to 19th positions of the nucleotide sequence II and the nucleotides at the 1st to 18th positions of the first nucleotide sequence are completely reverse complementary. **Claim 6** From the 5'-end towards the 3'-end, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II are 2'-fluoro-modified nucleotides, or the nucleotides at positions 2, 14, and 16 of the nucleotide sequence II are 2'-fluoro-modified nucleotides, and the nucleotide at position 6 of the nucleotide sequence II is a stabilized modified nucleotide, or All nucleotides in the nucleotide sequence II are modified nucleotides. From the 5'-end towards the 3'-end, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II are 2'-fluoro-modified nucleotides, and the other nucleotides in the nucleotide sequence II are each independently one of the non-fluoro-modified nucleotides, or From the 5'-end towards the 3'-end, the nucleotides at positions 7 to 9 of the nucleotide sequence I are 2'-fluoro-modified nucleotides, or All nucleotides in the nucleotide sequence I are modified nucleotides. From the 5'-end towards the 3'-end, the nucleotides at positions 7 to 9 of the nucleotide sequence I are 2'-fluoro-modified nucleotides, and the other nucleotides in the nucleotide sequence I are each independently one of the non-fluoro-modified nucleotides. The double-stranded oligonucleotide according to claim 1. Claim 7 The sense strand further comprises nucleotide sequence III, the antisense strand further comprises nucleotide sequence IV, each nucleotide of the nucleotide sequence III and the nucleotide sequence IV is independently one of the non-fluoro-modified nucleotides and is not the stabilized modified nucleotide, the length of the nucleotide sequence III is 1, 2, 3 or 4 nucleotides, the nucleotide sequence IV and the nucleotide sequence III are of equal length and are substantially reverse complementary or completely reverse complementary, the nucleotide sequence III is bound to the 5'-end of the nucleotide sequence I, the nucleotide sequence IV is bound to the 3'-end of the nucleotide sequence II, and the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to a second nucleotide sequence, where the second nucleotide sequence refers to a nucleotide sequence adjacent to the first nucleotide sequence and of the same length as the nucleotide sequence IV in the mRNA expressed by the target gene, or The double-stranded oligonucleotide further comprises nucleotide sequence V, each nucleotide of the nucleotide sequence V is independently one of the non-fluoro-modified nucleotides and is not the stabilized modified nucleotide, the nucleotide sequence V is 1 to 3 nucleotides in length, and is bound to the 3'-end of the antisense strand to form the 3'-overhang end of the antisense strand, or The nucleotide sequence V is 2 nucleotides in length, and from the 5'-end to the 3'-end, the nucleotide sequence V is two consecutive thymidine deoxyribonucleotides, two consecutive uracil ribonucleotides, or is completely reverse complementary to a third nucleotide sequence, where the third sequence refers to a nucleotide sequence adjacent to the first nucleotide sequence or the second nucleotide sequence and of the same length as the nucleotide sequence V in the mRNA expressed by the target gene. The double-stranded oligonucleotide according to claim 1. **Claim 8** Each non-fluoro-modified nucleotide is a methoxy-modified nucleotide, and the methoxy-modified nucleotide refers to a nucleotide in which the 2'-hydroxy of ribose is substituted by methoxy, or At least one of the phosphate esters in the phosphate-sugar backbone of at least one single strand of the sense strand and the antisense strand is a phosphate ester having a modifying group, and the phosphate ester having the modifying group is between the first nucleotide and the second nucleotide at the 5'-terminal end of the sense strand, between the second nucleotide and the third nucleotide at the 5'-terminal end of the sense strand, between the first nucleotide and the second nucleotide at the 3'-terminal end of the sense strand, between the second nucleotide and the third nucleotide at the 3'-terminal end of the sense strand, between the first nucleotide and the second nucleotide at the 5'-terminal end of the antisense strand, between the second nucleotide and the third nucleotide at the 5'-terminal end of the antisense strand, present in at least one selected from the group consisting of between the first nucleotide and the second nucleotide at the 3'-terminal end of the antisense strand and between the second nucleotide and the third nucleotide at the 3'-terminal end of the antisense strand, or the nucleotide at the 5'-end of the antisense strand is a 5'-phosphate nucleotide or a 5'-phosphate analog-modified nucleotide. The double-stranded oligonucleotide according to claim 6.

9. The double-stranded oligonucleotide is saRNA or siRNA, or the mRNA expressed by the target gene is one selected from the mRNAs transcribed by the genes ACE2, AGT, ANGPTL3, ApoA, ApoB, ApoC, AR, ASK1, C3, C5, Col1A1, CTGF, Ebola, FOXO1, FTO, FVII, FIX, FXII, GCG-R, HBV, HCV, HSD, p53, PCSK9, PNP, PLG, PKK, KNG, RAGE, RPTOR, SARS-CoV-2, SCD1, SCNN1A, SOD1, STAT3, TIMP-1, TMPRSS6, XO, or The double-stranded oligonucleotide according to claim 1, which is one of siRNAs such as siRNAa1, siRNAa2, siRNAa3, siRNAa4, siRNAa5, siRNAa6, siRNAa7, siRNAa8, siRNAa9, siRNAa10, siRNAb11, siRNAb12, siRNAb13, siRNAb14, siRNAb15, siRNAb16, siRNAc17, siRNAc18, siRNAc19, siRNAc20, siRNAc21, siRNAa22, siRNAa23.

10. A double-stranded oligonucleotide comprising a sense strand and an antisense strand, wherein each nucleotide of the sense strand and the antisense strand is a modified nucleotide, the sense strand contains a nucleotide sequence I, the antisense strand contains a nucleotide sequence II, both the nucleotide sequence I and the nucleotide sequence II consist of 19 nucleotides, the nucleotide sequence I and the nucleotide sequence II form a double-stranded region that is at least partially reverse complementary, the nucleotide sequence II is at least partially reverse complementary to a first nucleotide sequence, and the first nucleotide sequence is a nucleotide sequence that is 19 nucleotides in length in the mRNA expressed by the target gene. From the 5'-end to the 3'-end, the nucleotides at positions 7-9 of the nucleotide sequence I are fluorine-modified nucleotides, and each nucleotide at other positions of the nucleotide sequence I is independently one of non-fluorine-modified nucleotides. From the 5'-end to the 3'-end, the nucleotides at positions 2, 6, 14, and 16 of the nucleotide sequence II are fluorine-modified nucleotides, and each nucleotide at other positions of the nucleotide sequence II is independently one of non-fluorine-modified nucleotides. A double-stranded oligonucleotide, wherein from the 5'-end to the 3'-end, the nucleotide at position 3 and / or position 5 of the nucleotide sequence II is a 2'-O-methoxyethyl-modified nucleotide.

11. From the 5'-end towards the 3'-end, one of the nucleotides at the 4th, 7th, and 9th positions of the nucleotide sequence II is a 2'-O-methoxyethyl modified nucleotide, and the steric hindrance of each other non-fluoro modified substituent in the nucleotide sequence II is not more than 2'-O-methyl, or From the 5'-end towards the 3'-end, the nucleotides at the 3rd and / or 5th positions of the nucleotide sequence II have a 2'-O-methoxyethyl modification of ribose, From the 5'-end towards the 3'-end, the nucleotides at the 3rd and 9th positions of the nucleotide sequence II have a 2'-O-methoxyethyl modification of ribose, From the 5'-end towards the 3'-end, the nucleotides at the 5th and 7th positions of the nucleotide sequence II have a 2'-O-methoxyethyl modification of ribose, or From the 5'-end towards the 3'-end, the nucleotides at the 5th and 9th positions of the nucleotide sequence II have a 2'-O-methoxyethyl modification of ribose, the double-stranded oligonucleotide according to claim 10.

12. The nucleotide sequence II and the first nucleotide sequence are basically reverse complementary, substantially reverse complementary or completely reverse complementary, or From the 5'-end towards the 3'-end, the nucleotides at the 2nd to 19th positions of the nucleotide sequence II and the nucleotides at the 1st to 18th positions of the first nucleotide sequence are completely reverse complementary, the double-stranded oligonucleotide according to claim 10.

13. The sense strand further comprises nucleotide sequence III, the antisense strand further comprises nucleotide sequence IV, each nucleotide of the nucleotide sequence III and the nucleotide sequence IV is independently one of the non-fluoro-modified nucleotides and is not the stabilized modified nucleotide, the length of the nucleotide sequence III is 1, 2, 3 or 4 nucleotides, the nucleotide sequence IV and the nucleotide sequence III are of equal length and are substantially reverse complementary or completely reverse complementary, the nucleotide sequence III is linked to the 5'-end of the nucleotide sequence I, the nucleotide sequence IV is linked to the 3'-end of the nucleotide sequence II, and the nucleotide sequence IV is substantially reverse complementary or completely reverse complementary to a second nucleotide sequence, where the second nucleotide sequence refers to a nucleotide sequence adjacent to the first nucleotide sequence and of the same length as the nucleotide sequence IV in the mRNA expressed by the target gene, or The double-stranded oligonucleotide further comprises nucleotide sequence V, each nucleotide of the nucleotide sequence V is independently one of the non-fluoro-modified nucleotides and is not the stabilized modified nucleotide, the nucleotide sequence V is 1 to 3 nucleotides in length and is linked to the 3'-end of the antisense strand to form the 3'-overhang end of the antisense strand, or The nucleotide sequence V is 2 nucleotides in length, and from the 5'-end to the 3'-end, the nucleotide sequence V is two consecutive thymidine deoxyribonucleotides, two consecutive uracil ribonucleotides, or is completely reverse complementary to a third nucleotide sequence, where the third sequence refers to a nucleotide sequence adjacent to the first nucleotide sequence or the second nucleotide sequence and of the same length as the nucleotide sequence V in the mRNA expressed by the target gene. The double-stranded oligonucleotide according to claim 10.

14. Each of the non-fluoro-modified nucleotides is a methoxy-modified nucleotide, and the methoxy-modified nucleotide refers to a nucleotide in which the 2'-hydroxy of ribose is replaced by methoxy, or At least one of the phosphate esters in the phosphate-sugar backbone of at least one single-stranded sense strand and antisense strand is a phosphate ester having a modifying group, and the phosphate ester having the modifying group is between the first nucleotide and the second nucleotide at the 5'-terminal end of the sense strand, between the second nucleotide and the third nucleotide at the 5'-terminal end of the sense strand, between the first nucleotide and the second nucleotide at the 3'-terminal end of the sense strand, between the second nucleotide and the third nucleotide at the 3'-terminal end of the sense strand, between the first nucleotide and the second nucleotide at the 5'-terminal end of the antisense strand, between the second nucleotide and the third nucleotide at the 5'-terminal end of the antisense strand, present in at least one selected from the group consisting of between the first nucleotide and the second nucleotide at the 3'-terminal end of the antisense strand and between the second nucleotide and the third nucleotide at the 3'-terminal end of the antisense strand, or The double-stranded oligonucleotide according to claim 10, wherein the nucleotide at the 5'-end of the antisense strand is a 5'-phosphate nucleotide or a 5'-phosphate analog-modified nucleotide.

15. The double-stranded oligonucleotide is saRNA or siRNA, or The double-stranded oligonucleotide according to claim 10, wherein the mRNA expressed by the target gene is one selected from the mRNAs transcribed by the genes ACE2, AGT, ANGPTL3, ApoA, ApoB, ApoC, AR, ASK1, C3, C5, Col1A1, CTGF, Ebola, FOXO1, FTO, FVII, FIX, FXII, GCG-R, HBV, HCV, HSD, p53, PCSK9, PNP, PLG, PKK, KNG, RAGE, RPTOR, SARS-CoV-2, SCD1, SCNN1A, SOD1, STAT3, TIMP-1, TMPRSS6, XO.

16. A pharmaceutical composition comprising the double-stranded oligonucleotide according to claim 1 or 10 and a pharmaceutically acceptable carrier.

17. An oligonucleotide complex comprising the double-stranded oligonucleotide according to claim 1 or 10, and a complex group that is complexed and bound to the double-stranded oligonucleotide, wherein the complex group includes a linker and a pharmaceutically acceptable target group and / or delivery assisting group, and the double-stranded oligonucleotide, the linker, and the target group or the delivery assisting group are sequentially covalently or non-covalently bound, each of the target groups is selected from ligands that can bind to cell surface receptors, and each delivery assisting group is selected from groups that can improve the biocompatibility of the oligonucleotide complex in the target organ or tissue to be delivered.

18. A composition comprising the double-stranded oligonucleotide according to claim 1 or 10, and / or a pharmaceutical composition containing the same, and / or an oligonucleotide complex containing the same, for treating and / or preventing a disease or condition related to the mRNA level expressed by a target gene.

19. The mRNA expressed by the target gene is one selected from the mRNAs transcribed by the genes ACE2, AGT, ANGPTL3, ApoA, ApoB, ApoC, AR, ASK1, C3, C5, Col1A1, CTGF, Ebola, FOXO1, FTO, FVII, FXI, FXII, GCG-R, HBV, HCV, HSD, p53, PCSK9, PNP, PLG, PKK, KNG, RAGE, RPTOR, SARS-CoV-2, SCD1, SCNN1A, SOD1, STAT3, TIMP-1, TMPRSS6, XO, or The composition according to claim 18, wherein the disease or condition related to the mRNA level expressed by the target gene is hepatitis B or dyslipidemia.

Images