Salt-tolerant plants

Abstract

The present invention provides modified plants that are salt tolerant, methods for making these plants, and uses of these plants.

Description

[Technical field]

[0001] The present invention relates to plants that are engineered to be salt tolerant. [Background technology]

[0002] Soil salinity is one of the most serious problems in agriculture, except for drought. Approximately 20% of the world's cultivated land and almost half of irrigated land are affected by salinity, which poses a serious threat to agricultural production limiting plant growth and productivity worldwide [1]. Excessive salt absorption from saline soils inhibits both root and shoot growth, reduces reproductive activity, and affects plant viability. As a result, salinity is one of the main constraints in the geographical scope of crop cultivation worldwide, and although it does not prevent the growth of certain crops, it has a significant impact on crop productivity. Furthermore, salt accumulation as a result of over-irrigation, poor drainage, or use of reclaimed water, puts existing agricultural areas at risk, especially as climate change increases irrigation demand in arid / semi-arid regions.

[0003] Excessive salinity imposes two stress factors on plants: an osmotic component resulting from reduced water availability due to increased soil osmotic pressure; and a K + / Na + This causes a change in the ratio of Na + and Cl - Ionic stress due to solute imbalance, which increases the concentration of Na. + and K + This is due to similarities with plant ion transporters and enzymes. Plant cells normally have high K + / Na + ratio and relatively high K + is on the order of 100-200 mM, and low Na + is approximately 1–10 mM [1].

[0004] Natural genetic variation in food crops limits the opportunities for enhancing salt tolerance through breeding strategies. Even relatively salt-tolerant crops, such as rye and barley, have salinity thresholds (EC) that are much lower than saline water sources such as seawater. The limited repertoire of naturally salt-tolerant plants also limits the applicability of breeding strategies, since plant species to be crossed should generally be in the same genus or closely related genera.

[0005] The advent of programmable nucleases, such as Cas endonucleases (e.g., Cas9, CpfI), transcription activator-like effector nucleases (TALENs), and zinc finger nucleases (ZFNs), has improved the ability to perform precise genome editing in plant species, but the exact number and identity of genes edited to achieve salt tolerance is unclear.

[0006] Previous attempts to create salt-tolerant transgenic plants have adopted strategies to express only a few genes. For example, EP3409105 suggested inhibiting the function of PERK13 (proline-rich extensin-like receptor kinase 13) to generate salt-tolerant plants. Fan et al. suggested improving salt tolerance by introducing the SOS1 and AHA genes from Sesuvium portulacastrum into Arabidopsis [2]. Both SOS1 and AHA genes code for cell membrane proteins. Therefore, this approach focused on controlling intracellular ion concentrations using only cell membrane proteins. Khan et al. discuss various salt-tolerant transgenic plants [3], but engineered these to express only genes encoding ion transporters. A further example of generating salt-tolerant plants by altering the expression of ion transporters is provided by Hossain et al. [4], who generated transgenic tobacco plants that contained a sodium / hydrogen antiporter gene.

[0007] There is a need in the art to provide salt-tolerant plants that can grow in high salinity conditions, for example in the ocean. Summary of the Invention

[0008] The present inventors have efficiently designed and generated plants with improved salt tolerance. These plants have been modified to contain multiple different mechanisms for controlling salt stress. This enhances the plant's tolerance to salt concentrations. As a result, salt-tolerant plants are disclosed herein. The plants may be transgenic plants and / or may contain a gene of interest operably linked to an enhancer element. The transgene and / or gene of interest operably linked to an enhancer element result in improved salt tolerance by affecting multiple mechanisms as disclosed herein.

[0009] The present invention provides a modified plant comprising at least two genes of interest, the genes of interest comprising a gene encoding a protein that controls an intracellular ion concentration and a gene encoding an antioxidant, the gene encoding the protein that controls an intracellular ion concentration being operably linked to an enhancer element, and the gene encoding the antioxidant being operably linked to an enhancer element.

[0010] The present invention also provides a modified plant comprising at least two genes of interest, the genes of interest comprising a gene encoding a cell membrane protein that controls an intracellular ion concentration and a gene encoding a tonoplast protein that controls an intracellular ion concentration, the gene encoding the cell membrane protein that controls the intracellular ion concentration being operably linked to an enhancer element, and the gene encoding the tonoplast protein that controls the intracellular ion concentration being operably linked to an enhancer element.

[0011] The present invention also provides modified plants comprising at least three genes of interest, each gene of interest operably linked to an enhancer element, wherein the modified plant has increased salt tolerance compared to a plant of the same species lacking the genomic modifications.

[0012] The present invention also provides a modified plant comprising at least three genes of interest, the genes of interest comprising a gene encoding a cell membrane protein that controls an intracellular ion concentration, a gene encoding a tonoplast protein that controls an intracellular ion concentration, and a gene encoding an antioxidant, wherein the gene encoding the cell membrane protein that controls the intracellular ion concentration is operably linked to an enhancer element, the gene encoding the tonoplast protein that controls the intracellular ion concentration is operably linked to an enhancer element, and the gene encoding the antioxidant is operably linked to an enhancer element.

[0013] The present invention also provides a modified rice comprising at least four genes of interest, the genes of interest comprising a gene encoding a plasma membrane ion transporter, a gene encoding a vacuolar ion transporter, a gene encoding a potassium transporter, and a gene encoding an antioxidant, wherein the gene encoding the plasma membrane ion transporter is operably linked to an enhancer element, the gene encoding the vacuolar ion transporter is operably linked to an enhancer element, the gene encoding the potassium transporter is operably linked to an enhancer element, and the gene encoding the antioxidant is operably linked to an enhancer element.

[0014] The present invention also provides modified rice comprising at least four genes of interest, the at least four genes of interest encoding OsSOS1, OsNHX1, OsHKT1, and OsSODA1, each gene of interest being operably linked to an enhancer element.The present invention also provides modified rice comprising at least four genes of interest, the at least four genes of interest encoding OsSOS1, OsNHX1, OsHKT1, and OSAHA3, each gene of interest being operably linked to an enhancer element.

[0015] The present invention also provides a modified rice comprising at least four genes of interest, the at least four genes of interest encoding OsSOS1, OsNHX1, OsHKT1, and OsSODA1, wherein the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99; the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 92; the gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; and the gene encoding OsSODA1 is operably linked to an enhancer element.

[0016] The present invention also provides a modified rice comprising at least four genes of interest, the at least four genes of interest encoding OsSOS1, OsNHX1, OsHKT1, and OsAHA3, wherein the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99; and the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 101, wherein the gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; and the gene encoding OsAHA3 is operably linked to an enhancer element.

[0017] The present invention also provides a modified rice comprising at least eight genes of interest, wherein the at least eight genes of interest encode OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2; the gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsSOS2 is operably linked to an enhancer element; the gene encoding OsAHA3 is operably linked to an enhancer element; the gene encoding OsVHA-A is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; the gene encoding OsSODA1 is operably linked to an enhancer element; and the gene encoding OsSOD2 is operably linked to an enhancer element.

[0018] The present invention also provides a modified rice plant comprising at least eight genes of interest, the at least eight genes of interest encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2, wherein the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100; the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 101; the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; and the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99. the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:92; the OsSOD2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:93, wherein the gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsSOS2 is operably linked to an enhancer element; the gene encoding OsAHA3 is operably linked to an enhancer element; the gene encoding OsVHA-A is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; the gene encoding OsSODA1 is operably linked to an enhancer element; and the gene encoding OsSOD2 is operably linked to an enhancer element.

[0019] The present invention also provides a modified rice comprising at least eight genes of interest, wherein the at least eight genes of interest encode OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSODCC1; the gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsSOS2 is operably linked to an enhancer element; the gene encoding OsAHA3 is operably linked to an enhancer element; the gene encoding OsVHA-A is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; the gene encoding OsSODA1 is operably linked to an enhancer element; and the gene encoding OsSODCC1 is operably linked to an enhancer element.

[0020] The present invention also provides a modified rice plant comprising at least eight genes of interest, the at least eight genes of interest encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSODCC1; the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100; the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 101; the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; and the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99. the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:92; the OsSODCC1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:94; the gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsSOS2 is operably linked to an enhancer element; the gene encoding OsAHA3 is operably linked to an enhancer element; the gene encoding OsVHA-A is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; the gene encoding OsSODA1 is operably linked to an enhancer element; and the gene encoding OsSODCC1 is operably linked to an enhancer element.

[0021] The present invention also provides a modified rice plant comprising at least eight genes of interest, the eight genes of interest encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2; the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100; the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 101; the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99; and the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: the OsSOD2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:93; the OsSOS1 gene is operably linked to an enhancer element comprising SEQ ID NO:12, the OsSOS2 gene is operably linked to an enhancer element comprising SEQ ID NO:13, the OsAHA3 gene is operably linked to an enhancer element comprising SEQ ID NO:14, the OsVHA-A gene is operably linked to an enhancer element comprising SEQ ID NO:11, the OsNHX1 gene is operably linked to an enhancer element comprising SEQ ID NO:10, the OsHKT1 gene is operably linked to an enhancer element comprising SEQ ID NO:15, the OsSODA1 gene is operably linked to an enhancer element comprising SEQ ID NO:16, and the OsSOD2 gene is operably linked to an enhancer element comprising SEQ ID NO:18. Such modified rice is also provided, wherein the sequences defined in this paragraph are altered, for example, such that any or all of the identified sequences have at least 95% sequence identity with a particular SEQ ID NO.

[0022] The present invention also provides plant parts of any of the modified plants disclosed herein.

[0023] The present invention also provides a method of producing a modified plant, plant part or multicellular structure according to claims 1 to 82, the method comprising: i) introducing at least two enhancer elements as defined in the modified plant according to claims 1 to 77 into a cell of the plant, the enhancer elements being integrated into the genome of the cell of the plant in such a way that they are operably linked to a gene of interest; and ii) regenerating the cells to form a modified plant, plant part, or multicellular structure from the cells. The present invention also provides methods for producing flour, whole grain, starch, or other products from seeds of the plants disclosed herein.

[0024] The invention also provides for the use of the modified plants or plant parts disclosed herein as animal feed or to produce feed for animal consumption or food for human consumption.

[0025] The inventors have designed and generated plants with improved salt tolerance that contain multiple different mechanisms for controlling salt stress that collectively increase the plant's tolerance to salt concentrations in an efficient manner. This approach can be achieved using modified plants, as presented in the paragraph above, but also using transgenic plants, as presented in the paragraph below. These approaches can be used individually or in combination, all of which are disclosed herein. For example, the following embodiments that define a transgene may also define a corresponding gene of interest in a modified plant. A transgenic plant as defined herein may have any one or more of the transgenes defined herein replaced with a corresponding gene of interest that is operably linked to an enhancer element, also defined herein.

[0026] The present invention provides a transgenic plant comprising at least two transgenes, the at least two transgenes comprising a transgene encoding a protein that controls intracellular ion concentration and a transgene encoding an antioxidant. In some embodiments, the protein that controls intracellular ion concentration can be an ion transporter, a hydrogen transporting ATPase, a hydrogen transporting pyrophosphatase, or a protein kinase. In further embodiments, the ion transporter, the hydrogen transporting ATPase, and / or the hydrogen transporting pyrophosphatase can be a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, and / or a plasma membrane hydrogen transporting pyrophosphatase. In some embodiments, the plasma membrane ion transporter can be SOS1. The SOS1 can be OsSOS1. In some embodiments, the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 95 and / or 96. In some embodiments, the plasma membrane hydrogen transporting ATPase can be AHA3. The AHA3 can be OsAHA3. In some embodiments, the OsAHA3 transgene comprises a polynucleotide sequence that encodes a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:101.

[0027] The ion transporter, hydrogen transporting ATPase, and / or hydrogen transporting pyrophosphatase can be a tonoplast ion transporter, tonoplast hydrogen transporting ATPase, and / or tonoplast hydrogen transporting pyrophosphatase. In some embodiments, the tonoplast ion transporter can be NHX1. The NHX1 can be OsNHX1. In some embodiments, the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 97 and / or 98. The tonoplast hydrogen transporting ATPase can be VHA-A. In some embodiments, the VHA-A can be OsVHA-A. In some embodiments, the OsVHA-A transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 102.

[0028] In some embodiments, the protein kinase can be a serine / threonine kinase. In some embodiments, the serine / threonine kinase can be SOS2. The SOS2 can be OsSOS2. In some embodiments, the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:100.

[0029] In some embodiments, the antioxidant may be a mitochondrial antioxidant or a cytoplasmic antioxidant. The transgenic plant may include at least two transgenes encoding antioxidants. For example, the transgenic plant may include a mitochondrial antioxidant and a cytoplasmic antioxidant. In some embodiments, the transgenic plant includes at least three transgenes encoding antioxidants. In particular embodiments, the antioxidant(s) include SODA1, SOD2, and / or SODCC1. SODA1 may be OsSODA1. In some embodiments, the OsSODA1 transgene includes a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:92. SOD2 may be OsSOD2. In some embodiments, the OsSOD2 transgene includes a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:93. SODCC1 may be OsSODCC1. In some embodiments, the OsSODCC1 transgene comprises a polynucleotide sequence that encodes a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:94.

[0030] The present invention also provides a transgenic plant comprising at least two transgenes, the at least two transgenes comprising a transgene encoding a plasma membrane protein that controls an intracellular ion concentration and a transgene encoding a tonoplast protein that controls an intracellular ion concentration. In some embodiments, the plasma membrane protein that controls an intracellular ion concentration can be a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, or a plasma membrane hydrogen transporting pyrophosphatase. In some embodiments, the plasma membrane ion transporter can be SOS1. The SOS1 can be OsSOS1. In some embodiments, the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 95 and / or 96. In some embodiments, the plasma membrane hydrogen transporting ATPase can be AHA3. The AHA3 can be OsAHA3. In some embodiments, the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 101.

[0031] In some embodiments, the tonoplast protein that controls intracellular ion concentrations can be a tonoplast ion transporter, a tonoplast hydrogen-transporting ATPase, or a tonoplast hydrogen-transporting pyrophosphatase.

[0032] In some embodiments, the tonoplast ion transporter can be NHX1. The NHX1 can be OsNHX1. In some embodiments, the OsNHX1 transgene can comprise a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 97 and / or 98. The tonoplast hydrogen transporting ATPase can be VHA-A. In some embodiments, the VHA-A can be OsVHA-A. In some embodiments, the OsVHA-A transgene can comprise a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 102.

[0033] In some embodiments, the transgenic plant further comprises a transgene encoding a protein kinase and / or a transgene encoding an antioxidant. In some embodiments, the protein kinase can be a serine / threonine kinase. In some embodiments, the serine / threonine kinase can be SOS2. The SOS2 can be OsSOS2. In some embodiments, the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 100.

[0034] In some embodiments, the antioxidant may be a mitochondrial antioxidant or a cytoplasmic antioxidant. In certain embodiments, the antioxidant comprises any one of SODA1, SOD2, and SODCC1. SODA1 may be OsSODA1. In some embodiments, the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:92. SOD2 may be OsSOD2. In some embodiments, the OsSOD2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:93. SODCC1 may be OsSODCC1. In some embodiments, the OsSODCC1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:94.

[0035] The present invention also provides a transgenic plant comprising at least three transgenes, wherein the transgenic plant has increased salt tolerance compared to a plant of the same species lacking the genomic modification.

[0036] The present invention also provides a transgenic plant comprising at least three transgenes, the at least three transgenes comprising a transgene encoding a plasma membrane protein that controls intracellular ion concentration, a transgene encoding a tonoplast protein that controls intracellular ion concentration, and a transgene encoding an antioxidant. In some embodiments, the plasma membrane protein that controls intracellular ion concentration and / or the tonoplast protein can be an ion transporter, a hydrogen transporting ATPase, or a hydrogen transporting pyrophosphatase. In some embodiments, the transgenic plant further comprises a transgene encoding a protein kinase. The protein kinase can be a serine / threonine kinase. In some embodiments, the serine / threonine kinase can be SOS2.

[0037] The present invention provides a transgenic rice plant comprising at least four transgenes, the at least four transgenes comprising transgenes encoding OsSOS1, OsNHX1, OsHKT1 and OsSODA1. The present invention also provides a transgenic rice plant comprising at least four transgenes, the at least four transgenes comprising transgenes encoding OsSOS1, OsNHX1, OsHKT1 and OsSODA1, the OsSOS1 transgene comprising a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:95 and / or 96, the OsNHX1 transgene comprising a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:97 and / or 98, the OsHKT1 transgene comprising a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:99, and the OsSODA1 transgene comprising a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:92.

[0038] In some embodiments, the transgenic plant comprises at least seven introduced genes, including a introduced gene encoding a plasma membrane ion transporter, a introduced gene encoding a plasma membrane hydrogen transporting ATPase, a introduced gene encoding a protein kinase, a introduced gene encoding a vacuolar hydrogen transporting ATPase, a introduced gene encoding a vacuolar sodium / proton transporter, a introduced gene encoding a potassium transporter, and a introduced gene encoding an antioxidant.

[0039] In some embodiments, the transgenic plant comprises at least eight transgenes, the at least eight transgenes comprising a transgene encoding a plasma membrane ion transporter, a transgene encoding a plasma membrane hydrogen transporting ATPase, a transgene encoding a protein kinase, a transgene encoding a vacuolar hydrogen transporting ATPase, a transgene encoding a vacuolar sodium / proton transporter, a transgene encoding a potassium transporter, a transgene encoding a first antioxidant, and a transgene encoding a second antioxidant. In some embodiments, the plasma membrane ion transporter can be SOS1. In certain embodiments, the SOS1 can be OsSOS1. In more particular embodiments, the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 95 and / or 96. In some embodiments, the plasma membrane hydrogen transporting ATPase can be AHA3. In certain embodiments, the AHA3 can be OsAHA3. In more particular embodiments, the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 101. In some embodiments, the protein kinase can be SOS2. In particular embodiments, SOS2 can be OsSOS2. In more particular embodiments, the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 100. In some embodiments, the vacuolar hydrogen transport ATPase can be VHA-A. In particular embodiments, the VHA-A can be OsVHA-A. In more particular embodiments, the OsVHA-A transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 102. In some embodiments, the vacuolar ion transporter can be NHX1. In particular embodiments, the NHX1 can be OsNHX1.In further particular embodiments, the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:97 and / or 98. In some embodiments, the potassium transporter can be HKT1. In particular embodiments, the HKT1 can be OsHKT1. In further particular embodiments, the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:99. In some embodiments, the first and second antioxidants are SODA1, SOD2, and / or SODCC1. In particular embodiments, the SODA1 can be OsSODA1. In further particular embodiments, the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:92. In particular embodiments, the SOD2 can be OsSOD2. In further particular embodiments, the OsSOD2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:93. In a particular embodiment, the SODCC1 can be OsSODCC1. In a more particular embodiment, the OsSODCC1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:94.

[0040] The present invention provides transgenic rice comprising at least eight transgenes, the at least eight transgenes including transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2. In a further aspect, the present invention provides a transgenic rice comprising at least eight transgenes, the at least eight transgenes comprising transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2; the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 95 and / or 96; the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 100; the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 101; The A transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:102; the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:97 and / or 98; the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:99; the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:92; and the OsSOD2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:93.

[0041] The present invention provides transgenic rice comprising at least eight transgenes, the at least eight transgenes including transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSODCC1. In another aspect, the present invention provides a transgenic rice comprising at least eight transgenes, the at least eight transgenes comprising transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSODCC1; the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:95 and / or 96; the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:100; the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:101; The introduced gene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:102; the OsNHX1 introduced gene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:97 and / or 98; the OsHKT1 introduced gene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:99; the OsSODA1 introduced gene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:92; and the OsSODCC1 introduced gene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:94.

[0042] In some embodiments, the transgenic plant further comprises at least one additional transgene, the at least one additional transgene encoding a protein that may be a cytochrome p450 (P450), an oxygen-evolving complex, a sucrose phosphate synthase, and / or a pyrroline carboxylate synthase. In some embodiments, the oxygen-evolving complex may be formed from proteins PsbO, PsbP, and PsbQ. In other embodiments, the oxygen-evolving complex may be formed from proteins PsbO, PsbP, PsbQ, PsbU, and PsbV. In other embodiments, the sucrose phosphate synthase may be sucrose phosphate synthase 1, sucrose phosphate synthase 2, or sucrose phosphate synthase 3. In some embodiments, the pyrroline carboxylate synthase may be delta-1-pyrroline-5-carboxylate synthase 1, or delta-1-pyrroline-5-carboxylate synthase 2. In some embodiments, the transgenic plant further comprises a transgene encoding OSK1. In some embodiments, the transgenic plant does not contain a transgene encoding PERK13.

[0043] In some embodiments, at least one of the transgenes is operably linked to at least one promoter. In certain embodiments, all of the transgenes are operably linked to a promoter. In some embodiments, the at least one promoter comprises at least 10, at least 20, or at least 30 nucleotides. In some embodiments, the at least one promoter can be within 150-500 nucleotides of the 5' end of the open reading frame of the transgene. In some embodiments, the at least one promoter can be a root-specific promoter. In certain embodiments, all of the transgenes are operably linked to a root-specific promoter. In some embodiments, the at least one promoter comprises a DREB2A, gibberellin, ethylene, or auxin promoter sequence, or a combination thereof, and optionally, all of the transgenes are operably linked to a promoter comprising a DREB2A, gibberellin, ethylene, or auxin promoter sequence, or a combination thereof. In some embodiments, at least one promoter comprises at least 6 nucleotides of a promoter element derived from a DREB2A, gibberellin, ethylene, or auxin promoter sequence, or a combination thereof, and optionally, all of the transgenes are operably linked to a promoter comprising a promoter element derived from a DREB2A, gibberellin, ethylene, or auxin promoter sequence. In some embodiments, at least one promoter comprises a TAF-1, TATA, E2F, G-BOX, or CAAT promoter sequence, or a combination thereof, and optionally, all of the transgenes are operably linked to a promoter comprising a TAF-1, TATA, E2F, G-BOX, or CAAT promoter sequence. In some embodiments, at least one promoter comprises a sequence having at least 95% sequence identity to any one of SEQ ID NOs: 10-18.

[0044] In some embodiments, each transgene may encode a separate protein, i.e., each protein introduced into the transgenic plant is encoded by a separate transgene.

[0045] In some embodiments, the transgenic plant may be an angiosperm. In some embodiments, the transgenic plant may be a monocotyledonous or dicotyledonous plant. In particular embodiments, the transgenic plant may be a cereal. In more particular embodiments, the transgenic plant may be corn, rice, soybean, sugarcane, mung bean, quinoa, barley, oat, rye, sorghum, or wheat. In particular embodiments, the transgenic plant may be a transgenic rice. In some embodiments, the transgenic plant may be a vegetable crop. In some embodiments, the transgenic plant may be from the genus Brassica, Glycine, or Soja.

[0046] The present invention also provides a plant part of the transgenic plant according to the present invention. In some embodiments, the plant part can be a cell, a seed, a leaf, a shoot, a stem, or a root. In certain embodiments, the plant part can be a seed or a cell. The present invention also provides a multicellular structure comprising one or more plant cells according to the present invention. In some embodiments, the multicellular structure can be a callus.

[0047] The present invention provides a method for producing a transgenic plant, plant part, or multicellular structure according to the present invention, comprising: i) introducing at least two transgenes defined in a transgenic plant according to the present invention into a cell of the plant, the transgenes being integrated into the genome of the cell of the plant; and ii) regenerating the cell to form a transgenic plant, plant part, or multicellular structure from the cell. In some embodiments, the transgenes are introduced into the cell by particle bombardment, Agrobacterium-mediated transformation, or protoplast transfection. In some embodiments, the method comprises: (a) inducing callus formation from seeds; (b) precipitating a polynucleotide sequence, a guide RNA, and a nuclease onto a microcarrier, the polynucleotide sequence comprising at least two transgenes as described herein; (c) transforming the callus with the microcarrier using particle bombardment to produce a transformed callus, the polynucleotide sequence being integrated into the genome of the transgenic plant, plant part, or multicellular structure; and (d) recovering the transformed callus to produce a multicellular structure according to the present invention. In some embodiments, the multicellular structure is regenerated into a transgenic plant. In some embodiments, the polynucleotide sequence is stably integrated into the genome of the plant. In some embodiments, the nuclease is a Cas nuclease, a Cpf1 nuclease, a TALEN, or a zinc finger nuclease, and optionally, the nuclease is Cas9 or Cpf1. In some embodiments, the polynucleotide is an RNA, a DNA, or a plasmid, and optionally, the polynucleotide is a DNA.

[0048] In some embodiments, a transgenic plant, plant part, or multicellular structure according to the present invention is not produced by a process involving homologous recombination and / or is not produced by an essentially biological process.

[0049] The invention also provides a method for producing flour, wholemeal, starch or other products obtained from the seeds according to the invention.The invention also provides the use of a transgenic plant, part thereof or multicellular structure according to the invention as animal feed or for producing feed for animal consumption or food for human consumption. [Brief description of the drawings]

[0050] [Figure 1] Mechanism of Cpf1 (Cas12a), including the cleavage site and location of gene insertion. The insert contains sequences corresponding to the overhangs and the desired promoter-based sequences that direct expression of the selected gene. [Diagram 2] Callus induction rates of rice varieties TH3-5, Truong Giang, MHC2, and Ha Phat3 with different concentrations of 2,4-D and BAP. The concentrations in each treatment are summarized in Table 12. [Figure 3A] Analysis of Java long, Se Zic, Agostano, Hunan, and Dichroa rice varieties. Percentage of seeds from Java long, Se Zic, Agostano, Hunan, and Dichroa rice varieties that germinated are shown. [Figure 3B] Analysis of Java long, Se Zic, Agostano, Hunan, and Dichroa rice varieties. Callus induction rates for rice varieties with different concentrations of 2,4-D and BAP are shown. The concentrations for each treatment are summarized in Table 12. [Figure 3C] Analysis of rice varieties Java long, Se Zic, Agostano, Hunan, and Dichroa. Shoot development of rice varieties with the same treatment is shown. The order of bars, from left to right, is Java long, Se Zic, Agostano, Hunan, and Dichroa, with a space between each set. [Figure 4] Callus induction rate of rice cultivar "Hayayuki" with different concentrations of 2,4-D and BAP. The concentrations in each treatment are summarized in Table 13. [Figure 5A]FIG. 1 qRT-PCR analysis of modified plants according to the invention, showing the expression of the four genes of interest in the leaves. [Figure 5B] qRT-PCR analysis of modified plants according to the invention. Expression of four genes of interest in roots is shown. WT represents wild type plant. Genotypes 1, 6, 9, and 10 are four different modified plants according to the invention, with genes of interest NHX1, SOS1, HKT1, and SODA1. The order of the bars, from left to right, is NHX1; SOS1, HKT1, and SODA1 repeats, with spaces between each set. [Figure 6] Sequences added to the 5' and 3' ends of the DNA insert. The promoter sequence in the 5' insert is underlined. [Figure 7] Distribution of hormones throughout the plant life cycle. The presence of specific hormones is indicated by colored boxes. [Figure 8] Example of yield vs salinity (ECe) plot. [Figure 9A]1 is a bar graph showing gene expression of OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2 in modified plants according to the invention. Gene expression is relative to both the reference gene Actin-3 and wild type plants. Positive values ​​indicate upregulation of expression and negative values ​​indicate downregulation of gene expression. Normalized gene expression grouped by modified plants is shown. Data is ungrouped. The order of the bars, from left to right, is as follows: plant A (Os-VHA-A, SOS1, SOS2, OsAHA3, HKT1, SODA1, OsSOD2), space, plant B (NHX1, Os-VHA-A, SOS2, OsAHA3, HKT1, SODA1, OsSOD2), space, plant C (SOS1, SOS2, OsAHA3, HKT1, SODA1, OsSOD2). ,space,Plant D(NHX1, Os-VHA-A, SOS2, OsAHA3, HKT1, SODA1, OsSOD2),space,Plant E1(Os-VHA-A, SOS1, SOS2, OsAHA3, HKT1, SODA1, OsSOD2),space,Plant F(Os-VHA-A, SOS2, OsAHA3, HKT1, SODA1, OsSOD2,space,Plant G-Os-VHA-A, SOS2, OsAHA3, HKT1, SODA1, and OsSOD2), space, plant I (SOS1, SOS2, OsAHA3, HKT1, SODA1, and OsSOD2), space, plant 1 (Os-VHA-A, SOS1, SOS2, OsAHA3, HKT1, SODA1, and OsSOD2), space, plant 9 (Os-VHA-A, SOS2, OsAHA3, HKT1, SODA1, and OsSOD2), space, wild type (NHX1; OsVHA-A; SOS1; SOD2; OsAHA3; HKT1; SODA1; and OsSOD2). [Figure 9B]1 is a bar graph showing gene expression of OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2 in modified plants according to the invention. Gene expression is relative to both the reference gene Actin-3 and wild type plants. Positive values ​​indicate upregulation of expression and negative values ​​indicate downregulation of gene expression. Normalized gene expression grouped by modified plants is shown. Data is grouped by biological sample. The order of the bars, from left to right, is as follows: plant A (Os-VHA-A, SOS1, SOS2, OsAHA3, HKT1, SODA1, OsSOD2), space, plant B (NHX1, Os-VHA-A, SOS2, OsAHA3, HKT1, SODA1, OsSOD2), space, plant C (SOS1, SOS2, OsAHA3, HKT1, SODA1, OsSOD2). ,space,Plant D(NHX1, Os-VHA-A, SOS2, OsAHA3, HKT1, SODA1, OsSOD2),space,Plant E1(Os-VHA-A, SOS1, SOS2, OsAHA3, HKT1, SODA1, OsSOD2),space,Plant F(Os-VHA-A, SOS2, OsAHA3, HKT1, SODA1, OsSOD2,space,Plant G-Os-VHA-A, SOS2, OsAHA3, HKT1, SODA1, and OsSOD2), space, plant I (SOS1, SOS2, OsAHA3, HKT1, SODA1, and OsSOD2), space, plant 1 (Os-VHA-A, SOS1, SOS2, OsAHA3, HKT1, SODA1, and OsSOD2), space, plant 9 (Os-VHA-A, SOS2, OsAHA3, HKT1, SODA1, and OsSOD2), space, wild type (NHX1; OsVHA-A; SOS1; SOD2; OsAHA3; HKT1; SODA1; and OsSOD2). [Figure 9C]1 is a bar graph showing gene expression of OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2 in modified plants according to the invention. Gene expression is relative to both the reference gene Actin-3 and wild type plants. Positive values ​​indicate upregulation of expression and negative values ​​indicate downregulation of gene expression. Normalized gene expression grouped by gene of interest is shown. Modified plants containing the corresponding gene of interest are summarized in Table 8. The order of the bars from left to right is Plant A, Plant B, Plant C, Plant D, Plant E1, Plant F, Plant G, Plant I, Plant 1, Plant 9, and wild type repeat. [Figure 10A] Scatter plots mapping normalized gene expression of modified plants according to the invention relative to wild type plants (WT). Plot settings include a fold change threshold of 2.00 and each sample contains two replicates. Scatter plots of modified plant A. [Figure 10B] Scatter plots mapping normalized gene expression of modified plants according to the invention relative to wild type plants (WT). Plot settings include a fold change threshold of 2.00 and each sample contains two replicates. Scatter plots of modified plant B. [Figure 10C] Scatter plots mapping normalized gene expression of modified plants according to the invention against wild type plants (WT). Plot settings include a fold change threshold of 2.00 and each sample contains two replicates. Scatter plots of modified plant C. [Figure 10D] Scatter plots mapping normalized gene expression of modified plants according to the invention relative to wild type plants (WT). Plot settings include a fold change threshold of 2.00 and each sample contains two replicates. Scatter plots of modified plant D. [Figure 10E] Scatter plots mapping normalized gene expression of modified plants according to the invention relative to wild type plants (WT). Plot settings include a fold change threshold of 2.00 and each sample contains two replicates. Scatter plots of modified plant E1. [Figure 10F]Scatter plots mapping normalized gene expression of modified plants according to the invention relative to wild type plants (WT). Plot settings include a fold change threshold of 2.00 and each sample contains two replicates. Scatter plots of modified plant F. [Figure 10G] Scatter plots mapping normalized gene expression of modified plants according to the invention relative to wild type plants (WT). Plot settings include a fold change threshold of 2.00 and each sample contains two replicates. Scatter plots of modified plant I. [Figure 10H] Scatter plots mapping normalized gene expression of modified plants according to the invention against wild type plants (WT). Plot settings include a fold change threshold of 2.00 and each sample contains two replicates. Scatter plots of modified plant G. [Figure 10I] Scatter plots mapping normalized gene expression of modified plants according to the invention relative to wild type plants (WT). Plot settings include a fold change threshold of 2.00 and each sample contains two replicates. Scatter plots of modified plant 1. [Figure 10J] Scatter plots mapping normalized gene expression of modified plants according to the present invention to wild type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. Scatter plots of modified plant 9. Modified plants containing the corresponding genes of interest are summarized in Table 8. [Figure 11] Images of wild type (WT) and modified rice plants grown in saline medium. The modified plants containing the corresponding genes of interest are summarized in Table 8. [Figure 12A] Images of wild-type (WT) and engineered calli grown in saline medium. The target genes in the engineered calli are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 12B] Images of wild-type (WT) and engineered calli grown in saline medium. The target genes in the engineered calli are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 12C]Images of wild-type (WT) and engineered calli grown in saline medium. The target genes in the engineered calli are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 13] 1 is a bar graph showing gene expression of OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2 in modified calli according to the present invention. Gene expression is relative to both the reference gene actin-3 and to wild type plants. Positive values ​​indicate upregulation of expression and negative values ​​indicate downregulation of gene expression. The genes of interest in modified calli are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. The order of the bars from left to right is SOS1; SOD2; HKT1; NHX1; OsAHA3; OsVHA-A; and SODA1 repeats with spaces between each set. [Figure 14] FIG. 1 is a bar graph showing gene expression of OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2 in wild-type callus when grown in medium containing 0, 2, 4, 6, 8, 10, 12.5, and 15 g / L sodium chloride. Gene expression is relative to both the reference gene actin-3 and to wild-type plants. Positive values ​​indicate upregulation of expression and negative values ​​indicate downregulation of gene expression. The order of the bars, from left to right, is HKT1; NHX1; OsAHA3; OsVHA-A; SODA1; SOS1; and SOD2 repeats with spaces between each set. [Figure 15A] Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 15B]Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 15C] Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 15D] Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 15E] Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 15F] Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 15G] Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 15H]Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 15I] Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 15J] Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 15K] Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 15L] Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 15M] Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 15N]Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 15O] Scatter plots mapping normalized gene expression of modified callus according to the present invention against wild-type plants (WT). Plot settings include a fold change threshold of 2.00, and each sample contains two replicates. The genes of interest in modified callus are OsNHX1, OsVHA-A, OsSOS1, and OsSOS2. [Figure 16A] Images of three modified rice plants producing seeds. The modified plants contain the following genes of interest: OsNHX1, OsVHA-A, OsSOS1, OsSOS2, OsAHA3, OsHKT1, OsSODA1, and either OsSODCC1 or OsSOD2, with each gene of interest operably linked to an enhancer element. (A) The large plant on the left side of the image is a modified plant according to the invention from the Troung Giang rice variety, while the two plants on the right side are modified plants according to the invention from the Hayayuki rice variety. [Figure 16B] (B) Images of three modified rice plants producing seeds. The modified plants contain the following genes of interest: OsNHX1, OsVHA-A, OsSOS1, OsSOS2, OsAHA3, OsHKT1, OsSODA1, and either OsSODCC1 or OsSOD2, with each gene of interest operably linked to an enhancer element. (C) Detailed images of two modified rice plants of the Hayayuki rice cultivar. [Figure 16C] Images of three modified rice plants producing seeds. The modified plants contain the following genes of interest: OsNHX1, OsVHA-A, OsSOS1, OsSOS2, OsAHA3, OsHKT1, OsSODA1, and either OsSODCC1 or OsSOD2, with each gene of interest operably linked to an enhancer element. (C) Images showing panicles and seeds of modified rice of the Hayayuki rice cultivar. [Figure 16D](D) Images of three modified rice plants producing seeds. The modified plants contain the following genes of interest: OsNHX1, OsVHA-A, OsSOS1, OsSOS2, OsAHA3, OsHKT1, OsSODA1, and either OsSODCC1 or OsSOD2, with each gene of interest operably linked to an enhancer element. (E) Images of modified rice plants of the Troung Giang rice variety. [Figure 16E] Images of three modified rice plants producing seeds. The modified plants contain the following genes of interest: OsNHX1, OsVHA-A, OsSOS1, OsSOS2, OsAHA3, OsHKT1, OsSODA1, and either OsSODCC1 or OsSOD2, with each gene of interest operably linked to an enhancer element. (C) Images showing the panicles and seeds of modified rice of the Troung Giang rice variety. [Figure 17] Bar graph showing gene expression of OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, OsSODCC1 and OsSOD2 in seedlings 13 and 14. Seedlings 13 and 14 were grown from seeds taken from modified rice of the Hayayuki rice cultivar. These seedlings were grown from seeds obtained from modified plants according to the present invention normalized compared to wild type rice. [Figure 18] Scatter plot mapping normalized gene expression of seedlings 13 and 14 normalized to wild-type rice. Bars represent a 4-fold increase in gene expression. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0051] definition Unless specifically stated otherwise, all technical and scientific terms used herein should be construed to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., cell culture, molecular genetics, plant molecular biology, protein chemistry, and biochemistry).

[0052] As used herein, the term "culture medium" generally refers to a natural or artificial substance in solid, semi-solid, or liquid form that can be used to grow plants. Examples of suitable types of culture media that can be used in the present disclosure include soil, artificial or non-soil potting mixes, water (e.g., for hydroponic formats), and agar.

[0053] As used herein, "salinity" generally refers to a measure of soluble salts in soil or water. As used herein, "salt" generally refers to the concentration of cations, e.g., sodium (Na + ), potassium (K + ), Magnesium (Mg 2+ ), or calcium (Ca 2+ ) and an anion, e.g., chloride (Cl - ), bicarbonate (HCO3 - ), carbonate (CO3 2- ), or sulfate (SO4 2- ). Sodium chloride (NaCl) is the most common salt found in groundwater and soil. Salt concentration in soil (or another growing medium) can be expressed (a) as the salt concentration of the medium in grams per liter (g / L); or (b) in units of electrical conductivity (EC, deciSiemens / meter (dS / m) or equivalent units of millimohs / centimeter (mmhos / cm) or milliSiemens / centimeter (mS / cm)). For soils, salt concentration can be measured as the electrical conductivity (EC) of a saturated soil paste extract taken from the plant root zone and averaged over time and depth. e ) can be measured. A soil paste extract is a soil sample brought up to the point of water saturation (see, e.g., USDA). Diagnosis and Remediation of Saline and Alkaline Soils. Agriculture Handbook No. 60. (1954) (hereby incorporated by reference). In some embodiments, electrical conductivity is measured on a vacuum extracted and filtered water extract from the saturated soil paste extract.

[0054] According to the USDA Salinity Laboratory, "salt concentration" is the electrical conductivity (EC) of a saturated paste extract. e ) is 4 dS / m or more, and a "mild salinity" (or medium) is defined as a medium with a saturated paste extract electrical conductivity (EC e A moderate salt concentration can be defined as one in which the electrical conductivity (EC) of the saturated paste extract is between 4 and 8; e ) is between 8 and 16; severe salinity is defined as the electrical conductivity (EC e ) may be defined as greater than 16; seawater may have a salinity of 30 g / L and an EC of 50 dS / m. However, salinity levels below 4 dS / m may affect plants; so-called sensitive plants may show growth problems at 0.75-1.5 dS / m; many plants may still experience reduced growth rates at 1.5-3.0 dS / m.

[0055] Salt tolerance can be manifested by tolerance to individual physicochemical stresses that combine to cause salt stress, such as ionic stress (e.g., can be tested by increasing tolerance to LiCl concentration) and / or osmotic stress (e.g., can be tested by increasing tolerance to polyethylene glycol concentration). A common effect of salinity on plants is a reduced growth rate, resulting in smaller leaves, shorter stature, fewer leaves, and / or reduced yield. Thus, in some embodiments, salt tolerance can be assessed by reference to the yield, mass, length, or growth rate of the entire plant, or by the yield, mass, length, or growth rate of a particular part of the plant (e.g., roots, leaves, shoots, and / or seeds). For example, the salt tolerance of a plant can be described as a function of the reduction in yield over a range of salt concentrations. In other embodiments, the salt tolerance of a plant can be measured by measuring two parameters, the threshold (EC t ), maximum expected yield (Y maxThe yield versus salinity plot can be described using the electrical conductivity that is expected to cause an initial significant reduction in yield (EC), and the slope(s). Figure 8 shows an example of a yield versus salinity plot, which is based on the salinity threshold (EC t ), Y max , and the slope(s). EC t Regarding ECt, plants with an ECt of 0.9 dS / m or less can be considered salt sensitive, and EC t Plants with an EC greater than 0.9 and up to 1.4 dS / m can be considered to be moderately sensitive, t Plants with an EC greater than 1.4 and up to 2.5 dS / m can be considered moderately tolerant, t Plants with a C of greater than 2.5 dS / m can be considered to be moderately tolerant. In another embodiment, salt tolerance is measured by a 50% reduction in yield (C 50 ) Electrical conductivity of saturated paste extract (EC e ) units.

[0056] As used herein, the term "operably linked" generally means that a promoter or enhancer sequence is located relative to a transcribable or translatable polynucleotide sequence (i.e., a transgene or gene of interest) such that the regulatory elements within the promoter sequence can affect the regulatory activity of the polynucleotide sequence. For example, a promoter having transcriptional promoter activity can be located at any distance, for example, near the gene or up to several thousand nucleotides away from the gene, and upstream or downstream of the gene, which may be the minimal promoter element and the polynucleotide sequence to be transcribed, and still exert a detectable effect on the expression level of the encoded reporter molecule.

[0057] Unless otherwise indicated, the recombinant protein, cell culture, and immunological techniques utilized in the present invention are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in the following sources: J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984); J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989); TA Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991); D. M. Glover and B. D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996); and F. M. Usubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-Interscience (1988, including all updates until present); Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1999). Laboratory, (1988), and JE Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates to date).

[0058] The term "and / or," e.g., "X and / or Y," shall be understood to mean either "X and Y" or "X or Y," and shall be interpreted as explicitly supporting both meanings or either meaning.

[0059] As used herein, the term "about" refers to ±10%, ±5%, ±1%, or ±0.5% of the specified value, unless stated to the contrary.

[0060] As used herein, the verb "comprise" and its conjugations are used in an open-ended sense, meaning that the items following the word are included, but that items not specifically mentioned are excluded. Furthermore, the verb "consisting of" may be replaced with "consisting essentially of," where appropriate, meaning that the product defined herein may include additional component(s) other than those specifically identified, and that the additional component(s) do not alter the unique characteristics of the invention. Furthermore, the method defined herein may include additional step(s) other than those specifically identified, and that the additional step(s) do not alter the unique characteristics of the invention. In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that there is a plurality of elements, unless the context clearly requires that there is only one element. Thus, the indefinite article "a" or "an" generally means "at least one."

[0061] It will be understood that with respect to the defined polypeptides, higher percent identity figures than those provided above encompass further specific embodiments. Thus, where applicable, in light of the minimum percent identity figures, the polypeptide may comprise an amino acid sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 76%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9% identical, or 100% identical to the designated related SEQ ID NO.

[0062] The degree of similarity between two sequences can be based on the percent sequence identity. As used herein, "sequence identity" refers to the degree to which two polynucleotide or amino acid sequences are invariant. "Sequence alignment" refers to the process of arranging two or more sequences to obtain the highest level of identity for the purpose of assessing the degree of similarity. Numerous methods are known in the art for aligning sequences and assessing similarity / identity, such as cluster methods, and similarity is based on the MEGALIGN algorithm, as well as BLASTN, BLASTP, and FASTA. When using any of these programs, the settings that result in the highest sequence similarity can be selected.

[0063] Exemplary methods are described in section 7.7.18 of reference [5]. Alignment may be determined with the Smith-Waterman homology search algorithm using an affine gap search with a gap opening penalty of 5 or 12 and a gap extension penalty of 2, and a BLOSUM matrix of 62. The Smith-Waterman homology search algorithm is disclosed in reference [6]. In another embodiment, the percentage identity of polypeptides may be determined with GAP (Needleman and Wunsch, 1970) analysis (GCG program) with a gap creation penalty = 5 and a gap extension penalty = 0.3. The query sequence is at least 150 amino acids long, and the GAP analysis aligns the two sequences over a region of at least 150 amino acids. The query sequence may be at least 500 amino acids long, and the GAP analysis aligns the two sequences over a region of at least 500 amino acids. The query sequence may be at least 750 amino acids long, and the GAP analysis aligns the two sequences over a region of at least 750 amino acids. The query sequence may be at least 900 amino acids long, and the GAP analysis aligns the two sequences over a region of at least 900 amino acids. The GAP analysis may align the two sequences over their entire length.

[0064] The term "plant" as used herein as a noun refers to an entire plant and any member of the plant kingdom, but when used as an adjective, refers to any material present in, obtained from, derived from, or associated with a plant, such as a plant organ (e.g., leaf, stem, root, flower), single cell (e.g., pollen), seed, plant cell, etc. Seedlings and germinated seeds with roots and shoots are also included within the scope of "plant". The term "plant part" as used herein refers to one or more plant tissues or organs obtained from a plant and containing the genomic DNA of the plant. Plant parts include vegetative structures (e.g., leaves, stems), roots, floral organs / structures, seeds (including embryos, cotyledons, and seed coats), plant tissues (e.g., vascular tissue, ground tissue, etc.), cells and progeny thereof. The term "plant cell" as used herein refers to a cell obtained from or within a plant, including protoplasts or other cells derived from a plant, gametogenic cells, and cells that regenerate into whole plants. Plant cells may be cultured cells. "Plant tissue" refers to differentiated tissue within or obtained from a plant ("explant"), or undifferentiated tissue derived from immature or mature embryos, seeds, roots, shoots, fruits, tubers, pollen, raised tissues, e.g. crowns, various forms of collections of plant cells in culture, e.g. callus. Exemplary plant tissues within or derived from seeds are cotyledons, embryos, and hypocotyls. Thus, the present invention includes plants and plant parts, as well as products comprising the same.

[0065] As used herein, the term "seed" refers to a seed that is ready for or has been harvested from a plant, e.g., a "mature seed" of a plant that is typically commercially harvested in the field, or a "developing seed" that occurs on a plant after fertilization, before seed dormancy is established and before harvest.

[0066] Enhancer element is a polynucleotide sequence that comprises or consists of a regulatory element(s) that can change the expression level of a gene of interest compared to the expression level of the gene of interest in a wild-type plant. For example, enhancer element can increase the expression level of a gene of interest compared to a wild-type plant. Enhancer element can change the expression level of a gene of interest at all times or at one or more stages of the plant's life cycle, for example, when the plant germinates. Enhancer element can cause the expression of a gene of interest at a different location in a plant compared to a wild-type plant.

[0067] Enhancer element may comprise the regulatory element(s) naturally occurring in plant genome, or may contain regulatory elements that do not naturally occur in plant genome.For example, enhancer element may comprise polynucleotide sequence obtained or derived from the same species of plant cell, or another species of plant cell, or from non-plant source, or synthetic sequence.In certain embodiments, enhancer element is not the promoter sequence naturally occurring in plant genome for corresponding gene of interest.

[0068] The enhancer element is integrated into the genome of the plant by plant transformation methods including genetic engineering, i.e., the enhancer element is not integrated into the genome of the plant by essentially biological means, such as crossing, cross-breeding, or breeding.As a result of such genome modification, the modified plant differs from the related wild-type plant and has a trait that is not naturally found in the wild-type plant.In certain embodiments, the enhancer element(s) is stably integrated into the genome of the plant.

[0069] The terms "gene of interest," "gene," and "gene" refer to a polynucleotide sequence that is naturally occurring in the genome of a plant, i.e., it is an endogenous gene in the plant.

[0070] The term "transgene" refers to a polynucleotide sequence that is incorporated into the genome of a plant by plant transformation methods, including genetic engineering. That is, the transgene is not incorporated into the genome of the plant by essentially biological means, such as by breeding, crossbreeding, or breeding. As used herein, the term "transgenic" is meant to include transgenes, e.g., a "transgenic plant" refers to a plant that contains a transgene in its genome, and a "transgenic trait" refers to a characteristic or phenotype that is conveyed or conferred by the presence of a transgene incorporated into the plant genome. A transgene may include a polynucleotide sequence obtained or derived from a plant cell of the same species, or another plant cell of a different species, or from a non-plant source, or from a synthetic sequence. As a result of such genomic changes, the transgenic plant differs from the associated wild-type plant, and the transgenic trait is a trait that is not naturally found in the wild-type plant.

[0071] When the transgene of a transgenic plant is obtained or derived from a plant cell of the same species as the transgenic plant, the presence of a transgene means that an extra copy of the gene is present in the plant genome compared to the wild-type plant, i.e. the transgenic plant contains an endogenous gene and an extra copy of the gene that is the transgene. The extra copy of the gene can be operably linked to an endogenous plant promoter or an artificial promoter that is different from the endogenous promoter. The presence of an artificial promoter can result in a different expression level or expression pattern of the transgene compared to the wild-type plant. For example, the expression level of the transgene can be increased or decreased compared to the wild-type plant. The extra copy of the gene can result in an altered expression of the gene at a certain point in the plant's life cycle, for example when the plant germinates. The extra copy of the gene can result in the expression of the gene at a different location in the plant compared to the endogenous gene. In certain embodiments, the transgene is stably integrated into the genome of the plant.

[0072] In some embodiments, the transgenic plant may include a transgene and a gene of interest operably linked to an enhancer element. The transgene or gene of interest may be any transgene or gene of interest described herein. The transgene or gene of interest may encode the same protein or may encode different proteins. For example, the transgenic plant may include a transgene encoding a protein that controls intracellular ion concentration and a gene of interest encoding an antioxidant, where the gene encoding the antioxidant is operably linked to an enhancer element.

[0073] All patents and publications cited herein are hereby incorporated by reference in their entirety.

[0074] Disclosure of the Invention The improved salt tolerance disclosed herein can be achieved by a number of routes, including the creation of transgenic plants as disclosed herein and / or modified plants as disclosed herein. Improved salt tolerance can be provided by increased gene and / or transgene expression compared to the wild type, achieved as disclosed herein. For example, increased expression compared to the wild type can be achieved by using a gene of interest operably linked to a transgene(s) and / or enhancer element as disclosed herein.

[0075] Transgene and target gene The present invention provides modified plants that are specifically designed to have an enhancer element operably linked to a gene of interest such that the plant has increased salt tolerance. For example, the present invention provides modified plants that include at least two genes of interest, the genes of interest including a gene encoding a protein that controls intracellular ion concentration and a gene encoding an antioxidant, the gene encoding the protein that controls intracellular ion concentration being operably linked to an enhancer element, and the gene encoding the antioxidant being operably linked to the enhancer element.

[0076] The inventors have confirmed that it is advantageous to insert a short enhancer element into the genome of a plant so that it is operably linked to a gene of interest, rather than inserting a transgene. This method for generating modified plants according to the present invention requires less DNA to be inserted into the genome, which means that it is less invasive to the plant. Without wishing to be bound by any particular theory, the inventors believe that the improvement in salt tolerance observed in modified plants of the present invention may be due to the reduced amount of DNA inserted into the plant genome. Furthermore, plants that are gene-edited rather than inserting the entire transgene into the genome require shorter regulatory approval times.

[0077] The present invention provides transgenic plants that are specifically designed and genetically modified to contain transgenes such that the plant has increased salt tolerance. For example, the present invention provides transgenic plants that contain at least two transgenes, including a transgene that encodes a protein that controls intracellular ion concentrations and a transgene that encodes an antioxidant.

[0078] The present invention also provides modified plants that are specifically designed and genetically modified to include an enhancer element operably linked to a gene of interest, such that the plant has increased salt tolerance. For example, the present invention provides modified plants that include at least two genes of interest, the genes of interest including a gene encoding a protein that controls intracellular ion concentration and a gene encoding an antioxidant, the gene encoding the protein that controls intracellular ion concentration being operably linked to an enhancer element, and the gene encoding the antioxidant being operably linked to the enhancer element.

[0079] Both approaches using a transgene and using a gene of interest linked to an enhancer element may be routes to the same result of increasing expression of the transgene and / or gene of interest, and therefore the proteins encoded by the transgene and gene of interest disclosed herein may be the same.

[0080] Antioxidants When intracellular sodium concentration increases, sodium ions interfere with metabolic reactions, producing hydrogen peroxide, OH - , and oxygen, causing an increase in reactive oxygen species and radicals. These reactive oxygen species and radicals can have various adverse effects in cells, such as damaging DNA. Antioxidants are compounds that inhibit oxidation, which produces reactive oxygen species and radicals. Excessive levels of chloride ions can also lead to an increase in reactive oxygen species and radicals. The inventors have advantageously confirmed that expressing at least one transgene encoding an antioxidant in a transgenic plant increases the salt tolerance of the transgenic plant. The inventors have advantageously confirmed that operably linking an enhancer element to a gene of interest encoding an antioxidant in a modified plant increases the salt tolerance of the modified plant.

[0081] The antioxidant can be a mitochondrial antioxidant or a cytosolic antioxidant. In some embodiments, the antioxidant is superoxide dismutase 1 (SODA). In some embodiments, the antioxidant is superoxide dismutase 2 (SOD2). In some embodiments, the antioxidant is cytosolic superoxidase dismutase (SODCC1).

[0082] In some embodiments, the SODA1 is Oryza sativa SODA1 (OsSODA1). OsSODA1 may have a polypeptide sequence of Uniprot Accession No. Q43121 or SEQ ID NO: 92. In some embodiments, the transgene or gene of interest comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence of Q43121, or the transgene may comprise an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to Q43121. In some embodiments, the transgene or gene of interest comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence of SEQ ID NO: 92, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO: 92.

[0083] In some embodiments, the SOD2 is Oryza sativa SOD2 (OsSOD2). OsSOD2 may have a polypeptide sequence of Uniprot Accession No. Q10PW4 or SEQ ID NO: 93. In some embodiments, the transgene or gene of interest comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q10PW4, or the transgene may comprise an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to Q10PW4. In some embodiments, the transgene or gene of interest comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 93, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO: 93.

[0084] In some embodiments, the SODCC1 is Oryza sativa SODCC1 (OsSODCC1). OsSODCC1 may have the polypeptide sequence of Uniprot Accession No. Q0DRV6 or SEQ ID NO:94. In some embodiments, the transgene or gene of interest may comprise a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q0DRV6, or the transgene may comprise an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to Q0DRV6. In some embodiments, the transgene or gene of interest may comprise a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:94, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO:94.

[0085] In some embodiments, the transgenic plant may include at least two transgenes, at least three transgenes, at least four transgenes, or at least five transgenes encoding antioxidants. In certain embodiments, the transgenic plant may include at least two transgenes encoding antioxidants. The antioxidants may be mitochondrial antioxidants and cytoplasmic antioxidants. In certain embodiments, the transgenic plant may include at least two transgenes, including a transgene encoding a mitochondrial antioxidant and a transgene encoding a cytoplasmic antioxidant. In some embodiments, the antioxidants may be manganese superoxide dismutase and / or CuZn superoxide dismutase. In certain embodiments, the transgenic plant may include at least two transgenes, including a transgene encoding two antioxidants, the two antioxidants being selected from the group consisting of SODA1 and SOD2; SODA1 and SODCC1; or SOD2 and SODCC1. In some embodiments, the transgenic plant comprises at least three transgenes, including transgenes encoding SODA1, SOD2, and SODCC1. In certain embodiments, the transgenic plant comprises at least three transgenes, including transgenes encoding OsSODA1, OsSOD2, and OsSODCC1.

[0086] In some embodiments, the modified plant may include at least two genes of interest encoding antioxidants, at least three genes of interest, at least four genes of interest, or at least five genes of interest. In certain embodiments, the modified plant may include at least two genes of interest encoding antioxidants. The antioxidants may be mitochondrial antioxidants and cytoplasmic antioxidants. In certain embodiments, the modified plant may include at least two genes of interest, including a gene of interest encoding a mitochondrial antioxidant and a gene of interest encoding a cytoplasmic antioxidant. In some embodiments, the antioxidants may be manganese superoxide dismutase and / or CuZn superoxide dismutase. In certain embodiments, the modified plant may include at least two genes of interest, including a gene of interest encoding two antioxidants, the two antioxidants being selected from the group consisting of SODA1 and SOD2; SODA1 and SODCC1; or SOD2 and SODCC1. In some embodiments, the modified plant includes at least three genes of interest, including genes of interest encoding SODA1, SOD2, and SODCC1. In certain embodiments, the modified plant comprises at least three genes of interest, including genes of interest encoding OsSODA1, OsSOD2, and OsSODCC1. In each embodiment of this paragraph, the genes of interest are operably linked to an enhancer element disclosed herein.

[0087] Proteins that can regulate intracellular ion concentrations Proteins that can regulate intracellular ion concentrations include ion transporters (eg, sodium or potassium transporters), hydrogen-transporting ATPases, hydrogen-transporting pyrophosphatases, or protein kinases.

[0088] Plants use two strategies to maintain low cytoplasmic sodium concentrations. Sodium can be excluded from the cytoplasm to the apoplast or extracellular space. Alternatively, sodium can be transported to the vacuole and stored there, known as sodium compartmentalization. The inventors have determined that exploiting both the cell membrane and the tonoplast mechanisms to reduce cytoplasmic sodium concentration can advantageously increase the stress tolerance of modified plants. The present invention provides modified plants comprising at least two genes of interest, the genes of interest comprising a gene encoding a cell membrane protein that controls an intracellular ion concentration and a gene encoding a tonoplast protein that controls an intracellular ion concentration, the gene encoding the cell membrane protein that controls an intracellular ion concentration being operably linked to an enhancer element, and the gene encoding the tonoplast protein that controls an intracellular ion concentration being operably linked to an enhancer element.

[0089] The invention also provides transgenic plants that contain at least two transgenes, including a transgene encoding a plasma membrane protein that controls intracellular ion concentrations and a tonoplast protein that controls intracellular ion concentrations.

[0090] Ion Transporters Ion transporters can transport ions, such as sodium or potassium, across membranes via ion gradients or actively using energy from various sources, including adenosine triphosphate (ATP), sunlight, and other redox reactions. The ion transporters used in the present invention can be active ion transporters. Active ion transporters are capable of removing ions from the cytoplasm of plant cells against a concentration gradient.

[0091] Membrane-bound sodium / hydrogen antiporters act to exclude sodium from cells. SOS1 (salt hypersensitivity 1) is a plasma membrane sodium / hydrogen antiporter that extrudes excess sodium from the cytoplasm. Now, studies of several species have shown that SOS1 is conserved in higher plants, including both monocots and dicots[7]. SOS1 has also previously been identified as essential for plant salt tolerance[8].

[0092] Sodium compartmentalization can occur in the vacuole or the apoplast. Plant vacuoles play a central role in plant stress responses. The central vacuole, which can occupy more than 80% of the total volume of a plant cell, is separated from the surrounding cytoplasm by a tonoplast, which controls the passage of inorganic and organic solutes to and from the cytoplasm through a wide range of pumps, carriers, ion channels, and receptors [1]. NHX1 (Na+ / H+ antiporter 1) is a sodium / hydrogen ion exchanger of the tonoplast (vacuole).

[0093] In some embodiments, the ion transporter is a sodium / hydrogen antiporter. In some embodiments, the ion transporter is a plasma membrane sodium / hydrogen antiporter, such as SOS1. In some embodiments, the ion transporter is a sodium / hydrogen ion exchanger. In some embodiments, the ion transporter is a tonoplast sodium / hydrogen ion exchanger, such as NHX1. The inventors have determined that altering the expression of a tonoplast ion transporter in combination with a plasma membrane ion transporter using an enhancer element can advantageously increase salt tolerance, since sodium can be excluded from the cytoplasm and compartmentalized.

[0094] Thus, in certain embodiments, the modified plant may comprise at least two genes of interest, including a gene encoding a plasma membrane sodium / hydrogen antiporter and a gene encoding a tonoplast sodium / hydrogen ion exchanger, the gene encoding the plasma membrane sodium / hydrogen antiporter being operably linked to an enhancer element, and the gene encoding the tonoplast sodium / hydrogen ion exchanger being operably linked to an enhancer element. For example, the modified plant may comprise genes encoding SOS1 and NHX1.

[0095] In certain embodiments, the transgenic plant may comprise at least two transgenes, including a transgene encoding a plasma membrane sodium / hydrogen antiporter and a transgene encoding a tonoplast sodium / hydrogen ion exchanger, for example, the transgenic plant may comprise transgenes encoding SOS1 and NHX1.

[0096] In some embodiments, the SOS1 is Oryza sativa SOS1 (OsSOS1). OsSOS1 can have the polypeptide sequence of Uniprot Accession No. Q5ICN3; Uniprot Accession No. Q7XBF9; SEQ ID NO: 95; and / or SEQ ID NO: 96. In some embodiments, the transgene or gene of interest can comprise a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q5ICN3 and / or Q7XBF9, or the transgene can comprise an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to Q5ICN3 and / or Q7XBF9. In some embodiments, the transgene comprises a polynucleotide sequence that encodes a polypeptide comprising an amino acid sequence of SEQ ID NO: 95 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO: 95. In some embodiments, the transgene comprises a polynucleotide sequence that encodes a polypeptide comprising an amino acid sequence of SEQ ID NO: 96 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO: 96.

[0097] In some embodiments, the NHX1 is Oryza sativa NHX1 (OsNHX1). OsNHX1 can have the polypeptide sequence of Uniprot Accession No. Q9SXJ8; Uniprot Accession No. Q6VVA7; SEQ ID NO: 97; and / or SEQ ID NO: 98. In some embodiments, the transgene or gene of interest can comprise a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q9SXJ8 and / or Q6VVA7, or the transgene can comprise an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to Q9SXJ8 and / or Q6VVA7. In some embodiments, the transgene comprises a polynucleotide sequence that encodes a polypeptide comprising an amino acid sequence of SEQ ID NO: 97 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO: 97. In some embodiments, the transgene comprises a polynucleotide sequence that encodes a polypeptide comprising an amino acid sequence of SEQ ID NO: 98 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO: 98.

[0098] High affinity potassium transporters (HKT) belong to an important class of integral membrane proteins that facilitate cation transport across the plasma membrane of plant cells. HKT1 (high affinity potassium transporter 1) transports potassium and sodium out of the plant xylem and back into the cytoplasm of the cell. HKT1 has a slightly larger active site, which makes it more suitable for transporting sodium. HKT1 can be a transgene or gene of interest, since it is a strong sodium transporter. Its inclusion in the modified or transgenic plants of the present invention is to fix significant salt levels in the roots and prevent salts from entering the plant's transport system and therefore the rest of the plant. In some embodiments, the ion transporter is a high affinity potassium transporter. In certain embodiments, the ion transporter is a plasma membrane high affinity potassium transporter, such as HKT1.

[0099] In some embodiments, the HKT1 is Oryza sativa HKT1 (OsHKT1). OsHKT1 may have a polypeptide sequence of Uniprot Accession No. Q0D9S3 or SEQ ID NO:99. In some embodiments, the transgene or gene of interest may comprise a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence of Q0D9S3, or the transgene may comprise an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to Q0D9S3. In some embodiments, the transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence of SEQ ID NO:99, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO:99.

[0100] Protein kinases The function of SOS1 is regulated by SOS2 (salt hypersensitivity 2). SOS2 is a serine / threonine protein kinase. Constitutive expression of SOS2 has been shown to constitutively activate SOS1, allowing for continuous salt transport out of the cell and enhancing salt tolerance [9]. The inventors have determined that it may be advantageous to alter the expression of a protein kinase using an enhancer element in combination with altering the expression of at least one ion transporter, such as a plasma membrane ion transporter, using an enhancer element, since protein kinases can activate ion transporters, resulting in improved salt tolerance. In some embodiments, the protein kinase is a serine / threonine protein kinase, e.g., SOS2. In some embodiments, the SOS2 is Oryza sativa SOS2 (OsSOS2). OsSOS2 may have the polypeptide sequence of Uniprot Accession No. Q69Q47 or SEQ ID NO: 100. In some embodiments, the transgene or gene of interest comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q69Q47, or the transgene may comprise an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to Q69Q47. In some embodiments, the transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO: 100. In certain embodiments, the transgenic plant comprises at least two transgenes encoding SOS1 and SOS2.

[0101] Hydrogen-transporting ATPase and pyrophosphatase The inventors have confirmed that altering the expression of sodium / hydrogen antiporters and hydrogen transport ATPases and pyrophosphatases in engineered or transgenic plants is advantageous because it ensures that a pH gradient exists across the cell membrane and tonoplast membrane. The sodium / hydrogen transporters utilize the pH gradient generated by the hydrogen transport ATPase and pyrophosphatase to transport sodium out of the cytoplasm. This pH gradient therefore facilitates sodium transport out of the cytoplasm, thereby helping to improve the salt tolerance of engineered or transgenic plants. For example, the AHA family is a cell membrane-bound hydrogen transport ATPase (H+-ATPase), which includes AHA1, AHA2, and AHA3. Their main function is to transport hydrogen ions across the cell membrane and out of the cell. This generates an electrochemical proton gradient, and ultimately, a proton motive force. This proton motive force works like a battery - hydrogen ions are forced out of the cell, creating an electrochemical gradient that provides energy to easily exchange hydrogen ions outside the cell for sodium ions inside the cell.

[0102] Hydrogen-transporting ATPases and pyrophosphatases are major components of the tonoplast membrane of plant cells [1]. VHA-A (vacuolar H+-ATPase subunit A1) is a vacuolar ATPase that breaks down ATP and transports hydrogen ions into the vacuole. This generates a strong proton motive force across the tonoplast membrane similar to the SOS1 and AHA3 cycles by increasing the abundance of hydrogen ions in the vacuole that can be exchanged for sodium ions. This is thought to advantageously increase salt tolerance in plants.

[0103] In some embodiments, the protein that can control intracellular ion concentration is hydrogen transport ATPase or hydrogen transport pyrophosphatase. In some embodiments, the protein that can control intracellular ion concentration is hydrogen transport ATPase. In some embodiments, the hydrogen transport ATPase is tonoplast hydrogen transport ATPase or plasma membrane hydrogen transport ATPase.

[0104] In certain embodiments, the plasma membrane hydrogen transport ATPase is AHA3. In some embodiments, the AHA3 is Oryza sativa AHA3 (OsAHA3). OsAHA3 can have the polypeptide sequence of Uniprot Accession No. Q8L6I3 or SEQ ID NO: 101. In some embodiments, the transgene or gene of interest can include a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q8L6I3, or the transgene can include an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to Q8L6I3. In some embodiments, the transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:101 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO:101.

[0105] In certain embodiments, the tonoplast hydrogen transport ATPase is VHA-A. In some embodiments, the VHA-A is Oryza sativa VHA-A (OsVHA-A). OsVHA-A can have the polypeptide sequence of Uniprot Accession No. Q651T8 or SEQ ID NO: 102. In some embodiments, the transgene or gene of interest can comprise a polynucleotide sequence encoding a polypeptide comprising the sequence of Q651T8, or the transgene can comprise an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to Q651T8. In some embodiments, the transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:102 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO:102.

[0106] In other embodiments, the tonoplast hydrogen transport ATPase is VHA-B. In some embodiments, the VHA-B is Oryza sativa VHA-B (OsVHA-B). OsVHA-B can have the polypeptide sequence of Uniprot Accession No. Q7FV25 or SEQ ID NO: 103. In some embodiments, the transgene or gene of interest can comprise a polynucleotide sequence encoding a polypeptide comprising the sequence of Q7FV25, or the transgene can comprise an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to Q7FV25. In some embodiments, the transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:103 or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO:103.

[0107] In certain embodiments, the modified plant comprises at least two genes of interest, the at least two genes of interest comprising a gene encoding a hydrogen transporting ATPase and a gene encoding an ion transporter (e.g., a sodium or potassium transporter). In some embodiments, the at least two genes of interest comprise a gene encoding a plasma membrane hydrogen transporting ATPase and a gene encoding a plasma membrane ion transporter (e.g., a sodium or potassium transporter). For example, the genes of interest may encode SOS1 and AHA3. In some embodiments, the genes encode a tonoplast hydrogen transporting ATPase and a tonoplast ion transporter (e.g., a sodium or potassium transporter). For example, the genes of interest may encode NHX1 and VHA-A. In further embodiments, the modified plant comprises at least four genes of interest, the at least four genes of interest comprising a gene encoding a plasma membrane hydrogen transporting ATPase, a gene encoding a plasma membrane ion transporter, a gene encoding a tonoplast hydrogen transporting ATPase, and a gene encoding a tonoplast ion transporter. For example, the genes of interest may encode SOS1, AHA3, NHX1, and VHA-A. In each embodiment of this paragraph, the gene of interest is operably linked to an enhancer element disclosed herein.

[0108] In certain embodiments, the transgenic plant comprises at least two transgenes, the at least two transgenes comprising a transgene encoding a hydrogen transporting ATPase and a transgene encoding an ion transporter (e.g., a sodium or potassium transporter). In some embodiments, the at least two transgenes comprise a transgene encoding a plasma membrane hydrogen transporting ATPase and a transgene encoding a plasma membrane ion transporter (e.g., a sodium or potassium transporter). For example, the transgenes may encode SOS1 and AHA3. In some embodiments, the transgenes encode a tonoplast hydrogen transporting ATPase and a tonoplast ion transporter (e.g., a sodium or potassium transporter). For example, the transgenes may encode NHX1 and VHA-A. In further embodiments, the transgenic plant comprises at least four transgenes, the at least four transgenes comprising a transgene encoding a plasma membrane hydrogen transporting ATPase, a transgene encoding a plasma membrane ion transporter, a transgene encoding a tonoplast hydrogen transporting ATPase, and a transgene encoding a tonoplast ion transporter. For example, the transgenes may encode SOS1, AHA3, NHX1, and VHA-A.

[0109] Exemplary Modified and Transgenic Plants of the Invention The present invention provides modified plants comprising at least two genes of interest, the genes of interest comprising a gene encoding a protein that controls intracellular ion concentration and a gene encoding an antioxidant, the gene encoding the protein that controls intracellular ion concentration being operably linked to an enhancer element, and the gene encoding the antioxidant being operably linked to an enhancer element.The present invention also provides transgenic plants comprising at least two transgenes, the at least two transgenes comprising a transgene encoding a protein that controls intracellular ion concentration and a transgene encoding an antioxidant.

[0110] In some embodiments, the protein that controls the intracellular ion concentration can be an ion transporter (e.g., a sodium or potassium transporter), a hydrogen-transporting ATPase, a hydrogen-transporting pyrophosphatase, or a protein kinase. In some embodiments, the protein that controls the intracellular ion concentration is a cell membrane protein, a cytoplasmic protein, or a tonoplast protein.

[0111] In some embodiments, the modified plant comprises two or more, three or more, four or more, five or more, six or more, or seven or more, eight or more, nine or more, or ten or more genes of interest, including genes encoding proteins that control intracellular ion concentrations. In certain embodiments, the modified plant comprises eight or more genes of interest, including six or more genes of interest that encode proteins that control intracellular ion concentrations and two or more genes of interest that encode antioxidants. In each of the embodiments in this paragraph and throughout this section, the genes of interest are operably linked to an enhancer element as disclosed herein.

[0112] In some embodiments, the transgenic plant contains two or more, three or more, four or more, five or more, six or more, or seven or more, eight or more, nine or more, or ten or more transgenes, including a transgene encoding a protein that controls intracellular ion concentration. In certain embodiments, the transgenic plant contains eight or more transgenes, including six or more transgenes encoding proteins that control intracellular ion concentration and two or more transgenes encoding antioxidants.

[0113] In some embodiments, the modified plant comprises two or more genes of interest encoding proteins that control intracellular ion concentrations, the genes of interest being operably linked to enhancer elements as disclosed herein. In some embodiments, the transgenic plant comprises two or more transgenes encoding proteins that control intracellular ion concentrations. In some embodiments, the transgenes or genes of interest encode (a) an ion transporter and a hydrogen transporting ATPase; (b) an ion transporter and a hydrogen transporting pyrophosphatase; (c) an ion transporter and a protein kinase; (d) a hydrogen transporting ATPase and a protein kinase; (e) a hydrogen transporting pyrophosphatase and a protein kinase; (f) two ion transporters. In certain embodiments, the transgenes or genes of interest encode an ion transporter and a hydrogen transporting ATPase, or an ion transporter and a protein kinase. For example, the transgenes or genes of interest encode SOS1 and AHA3; SOS1 and SOS2; or NHX1 and VHA-A. In particular embodiments, the transgene or gene of interest encodes OsSOS1 and OsAHA3; OsSOS1 and OsSOS2; or OsNHX1 and OsVHA-A.

[0114] In some embodiments, the modified plant comprises two or more genes of interest, including genes encoding two cell membrane proteins that control intracellular ion concentrations. In other embodiments, the modified plant comprises two or more genes of interest, including genes encoding two vacuolar membrane proteins that control intracellular ion concentrations. In each embodiment of this paragraph, the gene of interest is operably linked to an enhancer element disclosed herein.

[0115] In some embodiments, the transgenic plant comprises two or more transgenes, including transgenes encoding two plasma membrane proteins that control intracellular ion concentrations. In other embodiments, the transgenic plant comprises two or more transgenes, including transgenes encoding two vacuolar membrane proteins that control intracellular ion concentrations.

[0116] The present inventors have determined that using both the plasma membrane and the tonoplast mechanisms to reduce cytoplasmic sodium concentration can advantageously enhance the salt tolerance of plants. Thus, the present invention provides modified and transgenic plants comprising at least two transgenes or genes of interest, the transgene or gene of interest encoding a plasma membrane protein that controls intracellular ion concentration, and the transgene or gene of interest encoding a tonoplast protein that controls intracellular ion concentration. In each embodiment of this paragraph, the gene of interest is operably linked to an enhancer element as disclosed herein.

[0117] For example, the modified plant comprises two or more genes of interest, including genes encoding a plasma membrane ion transporter and a tonoplast ion transporter. In some embodiments, the modified plant comprises two or more genes of interest, including genes encoding a plasma membrane ion transporter and a tonoplast hydrogen transporting ATPase. In some embodiments, the modified plant comprises two or more genes of interest, including genes encoding a plasma membrane hydrogen transporting ATPase and a tonoplast ion transporter. In some embodiments, the modified plant comprises two or more genes of interest, including genes encoding a plasma membrane hydrogen transporting ATPase and a tonoplast hydrogen transporting ATPase. For example, the genes of interest encode SOS1 and NHX1; AHA3 and VHA-A; SOS1 and AHA3; or NHX1 and AHA3. In certain embodiments, the genes encode OsSOS1 and OsNHX1; OsAHA3 and OsVHA-A; OsSOS1 and OsAHA3; or OsNHX1 and OsAHA3. In each embodiment of this paragraph, the genes of interest are operably linked to an enhancer element as disclosed herein.

[0118] For example, the transgenic plant comprises two or more transgenes, including a transgene encoding a plasma membrane ion transporter and a tonoplast ion transporter. In some embodiments, the transgenic plant comprises two or more transgenes, including a transgene encoding a plasma membrane ion transporter and a tonoplast hydrogen transporting ATPase. In some embodiments, the transgenic plant comprises two or more transgenes, including a transgene encoding a plasma membrane hydrogen transporting ATPase and a tonoplast ion transporter. In some embodiments, the transgenic plant comprises two or more transgenes, including a transgene encoding a plasma membrane hydrogen transporting ATPase and a tonoplast ion transporter. In some embodiments, the transgenic plant comprises two or more transgenes, including a transgene encoding a plasma membrane hydrogen transporting ATPase and a tonoplast hydrogen transporting ATPase. For example, the transgenes encode SOS1 and NHX1; AHA3 and VHA-A; SOS1 and AHA3, or NHX1 and AHA3. In certain embodiments, the transgenes encode OsSOS1 and OsNHX1; OsAHA3 and OsVHA-A; OsSOS1 and OsAHA3; or OsNHX1 and OsAHA3.

[0119] In some embodiments, the modified plant may comprise at least three genes of interest that increase the salt tolerance of the modified plant compared to the same plant without the genome modification, and each gene of interest is operably linked to an enhancer element. In some embodiments, the transgenic plant may comprise at least three transgenes that increase the salt tolerance of the transgenic plant compared to the same plant without the genome modification.

[0120] The modified or transgenic plant may comprise at least three genes or transgenes of interest, the at least three genes or transgenes of interest comprising genes or transgenes encoding proteins that may be independently selected from the group consisting of a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, and at least one antioxidant. In some embodiments, the transgenes encode a tonoplast ion transporter, a tonoplast hydrogen transporting ATPase, and an antioxidant. In some embodiments, the genes or transgenes encode a plasma membrane ion transporter, a tonoplast ion transporter, and a tonoplast hydrogen transporting ATPase. In some embodiments, the genes or transgenes encode a plasma membrane hydrogen transporting ATPase, a tonoplast ion transporter, and a tonoplast ATPase. In some embodiments, the genes or transgenes encode a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, and a tonoplast ion transporter. In some embodiments, the genes or transgenes encode a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, and a tonoplast ion transporter. In some embodiments, the gene or transgene encodes a plasma membrane sodium transporter, a tonoplast sodium transporter, and a potassium transporter. In some embodiments, the gene or transgene encodes a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, and a protein kinase. In some embodiments, the gene or transgene encodes a tonoplast ion transporter, a tonoplast hydrogen transporting ATPase, and a protein kinase. In each embodiment of this paragraph, the gene of interest is operably linked to an enhancer element as disclosed herein.

[0121] The modified plant may comprise at least three genes of interest. In certain embodiments, the modified plant comprises at least three genes of interest, the at least three genes of interest comprising a gene encoding a plasma membrane protein that controls intracellular ion concentration; a gene encoding a tonoplast protein that controls intracellular ion concentration; and a gene encoding an antioxidant. For example, the modified plant may comprise at least three genes of interest, the at least three genes of interest comprising a gene encoding a plasma membrane ion transporter; a gene encoding a tonoplast ion transporter; and a gene encoding an antioxidant. In each embodiment of this paragraph, the gene of interest is operably linked to an enhancer element as disclosed herein.

[0122] A transgenic plant may comprise at least three transgenes. In certain embodiments, a transgenic plant comprises at least three transgenes, the at least three transgenes comprising a transgene encoding a cell membrane protein that controls intracellular ion concentration; a transgene encoding a tonoplast protein that controls intracellular ion concentration, and a transgene encoding an antioxidant. For example, a transgenic plant may comprise at least three transgenes, the at least three transgenes comprising a transgene encoding a cell membrane ion transporter; a transgene encoding a tonoplast ion transporter; and a transgene encoding an antioxidant.

[0123] The engineered or transgenic plant can include at least four genes of interest or transgenes, where the at least four genes of interest or transgenes include genes or transgenes encoding proteins that can be independently selected from the group consisting of an ion transporter (e.g., a sodium or potassium transporter), a hydrogen transporting ATPase, a hydrogen transporting pyrophosphatase, a protein kinase, and at least one antioxidant.

[0124] In some embodiments, the gene of interest or transgene encodes a plasma membrane ion transporter, a plasma membrane ATPase, a protein kinase, and an antioxidant. In some embodiments, the gene of interest or transgene encodes a tonoplast ion transporter, a tonoplast ATPase, a protein kinase, and an antioxidant. In some embodiments, the gene of interest or transgene encodes a plasma membrane ion transporter, a tonoplast ion transporter, a protein kinase, and an antioxidant. In some embodiments, the gene of interest or transgene encodes a plasma membrane hydrogen transporting ATPase, a tonoplast hydrogen transporting ATPase, a protein kinase, and an antioxidant. In some embodiments, the gene of interest or transgene encodes a plasma membrane hydrogen transporting ATPase, a tonoplast ion transporter, a protein kinase, and an antioxidant. In some embodiments, the gene of interest or transgene encodes a plasma membrane ion transporter, a tonoplast hydrogen transporting ATPase ... each embodiment of this paragraph, the gene of interest is operably linked to an enhancer element as disclosed herein.

[0125] In some embodiments, the gene of interest or transgene encodes a plasma membrane ion transporter, a plasma membrane ATPase, a potassium transporter, and an antioxidant. In some embodiments, the gene of interest or transgene encodes a tonoplast ion transporter, a tonoplast hydrogen transporting ATPase, a potassium transporter, and an antioxidant. In some embodiments, the gene of interest or transgene encodes a plasma membrane hydrogen transporting ATPase, a tonoplast hydrogen transporting ATPase, a potassium transporter, and an antioxidant. In some embodiments, the gene of interest or transgene encodes a plasma membrane hydrogen transporting ATPase, a tonoplast ion transporter, a potassium transporter, and an antioxidant. In some embodiments, the gene of interest or transgene encodes a plasma membrane ion transporter, a tonoplast hydrogen transporting ATPase, a potassium transporter, and an antioxidant. In some embodiments, the gene of interest or transgene encodes a plasma membrane ion transporter, a tonoplast hydrogen transporting ATPase, a potassium transporter, and an antioxidant. In each embodiment of this paragraph, the gene of interest is operably linked to an enhancer element as disclosed herein.

[0126] In certain embodiments, the modified plant comprises at least four genes of interest, the at least four genes of interest comprising genes encoding a plasma membrane ion transporter, a tonoplast ion transporter, a potassium transporter, and an antioxidant. In certain embodiments, the plant genes of interest comprise at least four genes of interest, the at least four genes of interest comprising genes encoding SOS1 (a plasma membrane ion transporter), NHX1 (a tonoplast ion transporter), HKT1 (a potassium transporter), and SODA1 (an antioxidant). In some embodiments, the present invention provides a rice genes of interest comprising at least four genes of interest, the at least four genes of interest encoding OsSOS1, OsNHX1, OsHKT1, and OsSODA1. In each embodiment of this paragraph, the genes of interest are operably linked to an enhancer element as disclosed herein.

[0127] In certain embodiments, the modified plant comprises at least four genes of interest, the at least four genes of interest comprising genes encoding a plasma membrane ion transporter, a tonoplast ion transporter, a potassium transporter, and a plasma membrane hydrogen transporting ATPase. In certain embodiments, the plant genes of interest comprise at least four genes of interest, the at least four genes of interest comprising genes encoding SOS1 (a plasma membrane ion transporter), NHX1 (a tonoplast ion transporter), HKT1 (a potassium transporter), and AHA3 (a plasma membrane hydrogen transporting ATPase). In some embodiments, the present invention provides a rice genes of interest comprising at least four genes of interest, the at least four genes of interest encoding OsSOS1, OsNHX1, OsHKT1, and OsAHA3. In each embodiment of this paragraph, the genes of interest are operably linked to an enhancer element as disclosed herein.

[0128] In certain embodiments, the modified plant comprises at least four genes of interest, the at least four genes of interest comprising genes encoding a plasma membrane ion transporter, a tonoplast ion transporter, a serine kinase, and a tonoplast hydrogen transporting ATPase. In certain embodiments, the plant genes of interest comprise at least four genes of interest, the at least four genes of interest comprising genes encoding SOS1 (a plasma membrane ion transporter), NHX1 (a tonoplast ion transporter), SOS2 (a serine kinase), and VHA-A (a tonoplast hydrogen transporting ATPase). In some embodiments, the present invention provides a rice genes of interest comprising at least four genes of interest, the at least four genes of interest encoding OsSOS1, OsNHX1, OsSOS2, and OsVHA-A. In each embodiment of this paragraph, the genes of interest are operably linked to an enhancer element as disclosed herein.

[0129] In certain embodiments, the transgenic plant comprises at least four transgenes, the at least four transgenes comprising transgenes encoding a plasma membrane ion transporter, a tonoplast ion transporter, a potassium transporter, and an antioxidant. In certain embodiments, the transgenic plant comprises at least four transgenes, the at least four transgenes comprising transgenes encoding SOS1 (plasma membrane ion transporter), NHX1 (tonoplast ion transporter), HKT1 (potassium transporter), and SODA1 (antioxidant). In some embodiments, the invention provides transgenic rice comprising at least four transgenes, the at least four transgenes comprising transgenes encoding OsSOS1, OsNHX1, OsHKT1, and OsSODA1.

[0130] In some embodiments, the gene of interest or transgene encodes a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, a tonoplast hydrogen transporting ATPase, and an antioxidant. In some embodiments, the modified or transgenic plant comprises a gene of interest or transgene, wherein the gene of interest or transgene encodes a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, a tonoplast ion transporter, and an antioxidant. In some embodiments, the modified or transgenic plant comprises a gene of interest or transgene, wherein the gene of interest or transgene encodes a plasma membrane ion transporter, a tonoplast ion transporter, a tonoplast hydrogen transporting ATPase, and an antioxidant. In some embodiments, the modified or transgenic plant comprises a gene of interest or transgene, wherein the gene of interest or transgene encodes a plasma membrane hydrogen transporting ATPase, a tonoplast ion transporter, a tonoplast hydrogen transporting ATPase, and an antioxidant.

[0131] In some embodiments, the engineered or transgenic plant comprises at least four genes of interest or transgenes, the at least four genes of interest or transgenes comprising genes or transgenes encoding a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, a tonoplast ion transporter, and a tonoplast hydrogen transporting ATPase.

[0132] In some embodiments, the engineered or transgenic plant may comprise at least five genes or transgenes of interest, the at least five genes or transgenes of interest comprising genes or transgenes encoding proteins that may be independently selected from the group consisting of an ion transporter (e.g., a sodium or potassium transporter), a hydrogen transporting ATPase, a hydrogen transporting pyrophosphatase, a protein kinase, and at least one antioxidant. These encoded proteins may be plasma membrane proteins, cytoplasmic proteins, or tonoplast proteins.

[0133] In some embodiments, the gene or transgene encodes a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, a tonoplast hydrogen transporting ATPase, a tonoplast ion transporter, and at least one antioxidant. For example, the gene or transgene may encode SOS1, AHA-3, NHX1, VHA-A, and SODA1. In some embodiments, the gene or transgene encodes a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, a protein kinase, a tonoplast ion transporter, and an antioxidant. For example, the gene or transgene may encode SOS1, AHA-3, NHX1, SOS2, and SODA1. In some embodiments, the gene or transgene encodes a plasma membrane ion transporter, a potassium transporter, a protein kinase, a tonoplast ion transporter, and an antioxidant. For example, the gene or transgene may encode SOS1, HKT1, NHX1, SOS2, and SODA1.

[0134] In some embodiments, the engineered or transgenic plant may include at least six genes of interest or transgenes, where the at least six genes of interest or transgenes include genes or transgenes encoding proteins that may be independently selected from the group consisting of an ion transporter (e.g., a sodium or potassium transporter), a hydrogen transporting ATPase, a hydrogen transporting pyrophosphatase, a protein kinase, and at least one antioxidant. These encoded proteins may be plasma membrane proteins, cytoplasmic proteins, or tonoplast proteins. In some embodiments, the transgenes encode a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, a protein kinase, a tonoplast hydrogen transporting ATPase, a tonoplast ion transporter, and an antioxidant. For example, the genes of interest or transgenes encode SOS1, AHA-3, NHX1, VHA-A, SOS2, and SODA1. In some embodiments, the genes of interest or transgenes encode a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, a potassium transporter, a tonoplast ion transporter, a protein kinase, and an antioxidant. For example, the at least six genes of interest or transgenes encode SOS1, AHA-3, HKT1, NHX1, SOS2, and SODA1.

[0135] In some embodiments, the gene of interest or transgene may encode an ion transporter (e.g., a sodium or potassium transporter), a hydrogen transporting ATPase, a hydrogen transporting pyrophosphatase, a protein kinase, and at least one antioxidant. These encoded proteins may be plasma membrane proteins, cytoplasmic proteins, or tonoplast proteins. In some embodiments, the gene of interest or transgene encodes a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, a protein kinase, a tonoplast hydrogen transporting ATPase, a tonoplast ion transporter, and an antioxidant.

[0136] In some embodiments, the gene of interest or transgene encodes a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, a tonoplast hydrogen transporting ATPase, a tonoplast ion transporter, a protein kinase, and an antioxidant. For example, the gene of interest or transgene encodes SOS1, AHA-3, NHX1, VHA-A, SOS2, and SODA1. In some embodiments, the gene of interest or transgene encodes a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, a potassium transporter, a tonoplast ion transporter, a protein kinase, and an antioxidant. For example, six genes of interest or transgenes may encode SOS1, AHA-3, HKT1, NHX1, SOS2, and SODA1.

[0137] In some embodiments, the engineered or transgenic plant may include at least seven genes or transgenes of interest, the at least seven genes or transgenes of interest including genes or transgenes encoding proteins that may be independently selected from the group consisting of an ion transporter (e.g., a sodium or potassium transporter), a hydrogen transporting ATPase, a hydrogen transporting pyrophosphatase, a protein kinase, and at least one antioxidant. These encoded proteins may be plasma membrane proteins, cytoplasmic proteins, or tonoplast proteins. In some embodiments, the transgenes encode a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, a tonoplast hydrogen transporting ATPase, a tonoplast ion transporter, a potassium transporter, a protein kinase, and an antioxidant. For example, the seven genes of interest or transgenes may encode: (a) SOS1, AHA-3, NHX1, VHA-A, HKT1, SOS2, and SODA1; (b) SOS1, AHA-3, NHX1, VHA-A, HKT1, SOS2, and SODCC1; or (c) SOS1, AHA-3, NHX1, VHA-A, HKT1, SOS2, and SOD2.

[0138] In some embodiments, the modified plant may include at least eight genes of interest, where the at least eight genes of interest independently encode proteins that may be independently selected from the group consisting of an ion transporter (e.g., a sodium or potassium transporter), a hydrogen transporting ATPase, a hydrogen transporting pyrophosphatase, a protein kinase, and at least one antioxidant. These encoded proteins may be plasma membrane proteins, cytoplasmic proteins, or tonoplast proteins. In certain embodiments, the genes of interest encode a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, a tonoplast hydrogen transporting ATPase, a tonoplast ion transporter, a potassium transporter, a protein kinase, and two antioxidants. In certain embodiments, the genes of interest encode SOS1, AHA-3, NHX1, VHA-A, HKT1, SOS2, SODA1, and SODCC1. In more particular embodiments, the gene of interest encodes OsSOS1, OsAHA-3, OsNHX1, OsVHA-A, OsHKT1, OsSOS2, OsSODA1, and OsSODCC1. In alternative particular embodiments, the gene of interest encodes SOS1, AHA-3, NHX1, VHA-A, HKT1, SOS2, SODA1, and SOD2. In more particular embodiments, the gene of interest encodes OsSOS1, OsAHA-3, OsNHX1, OsVHA-A, OsHKT1, OsSOS2, OsSODA1, and OsSOD2. In each embodiment of this paragraph, the gene of interest is operably linked to an enhancer element as disclosed herein.

[0139] In some embodiments, the transgenic plant may include at least eight transgenes, the at least eight transgenes including transgenes encoding proteins that may be independently selected from the group consisting of an ion transporter (e.g., a sodium or potassium transporter), a hydrogen transporting ATPase, a hydrogen transporting pyrophosphatase, a protein kinase, and at least one antioxidant. These encoded proteins may be plasma membrane proteins, cytoplasmic proteins, or tonoplast proteins. In certain embodiments, the transgenes encode a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, a tonoplast hydrogen transporting ATPase, a tonoplast ion transporter, a potassium transporter, a protein kinase, and two antioxidants. In certain embodiments, the transgenes encode SOS1, AHA-3, NHX1, VHA-A, HKT1, SOS2, SODA1, and SODCC1. In more particular embodiments, the transgenes encode OsSOS1, OsAHA-3, OsNHX1, OsVHA-A, OsHKT1, OsSOS2, OsSODA1, and OsSODCC1. In alternative particular embodiments, the transgenes encode SOS1, AHA-3, NHX1, VHA-A, HKT1, SOS2, SODA1, and SOD2. In more particular embodiments, OsSOS1, OsAHA-3, OsNHX1, OsVHA-A, OsHKT1, OsSOS2, OsSODA1, and OsSOD2.

[0140] In some embodiments, the engineered or transgenic plant may include at least nine genes or transgenes of interest, the at least nine genes or transgenes of interest including genes or transgenes that may encode proteins that may be independently selected from the group consisting of an ion transporter (e.g., a sodium or potassium transporter), a hydrogen transporting ATPase, a hydrogen transporting pyrophosphatase, a protein kinase, and at least one antioxidant. These encoded proteins may be plasma membrane proteins, cytoplasmic proteins, or tonoplast proteins. In certain embodiments, the genes or transgenes of interest encode a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, a tonoplast hydrogen transporting ATPase, a tonoplast ion transporter, a potassium transporter, a protein kinase, and three antioxidants. In certain embodiments, the genes or transgenes of interest encode SOS1, AHA-3, NHX1, VHA-A, HKT1, SOS2, SODA1, SODCC1, and SOD2.

[0141] Additional genes of interest and transgenes In some embodiments, the engineered or transgenic plant further comprises a gene of interest or a transgene encoding a cytochrome P450 (P450), an oxygen evolving complex, a sucrose phosphate synthase, and / or a pyrroline synthase. In each of the embodiments in the following section, the gene of interest is operably linked to an enhancer element, as disclosed herein.

[0142] Cytochrome P450 Cytochrome P450 is an enzyme that catalyzes the rate-limiting step in leaf wax production. Increasing expression of this enzyme can increase the level of wax in the leaf. This increase in wax prevents water loss between the mesophyll cells of the plant leaf and the air. There is an osmotic pressure difference between the saline ocean air and the water potential in the mesophyll air pocket. Therefore, by including a transgene encoding a cytochrome P450 or targeting a gene of interest that is a cytochrome P450, modified or transgenic plants may be able to grow advantageously in highly saline regions such as the ocean. Therefore, in some embodiments, modified or transgenic plants further include a gene of interest or a transgene encoding a cytochrome P450 (P450). In some embodiments, the P450 is Oryza sativa P450 (OsP450). In some embodiments, the P450 is Arabidopsis thaliana P450 having UniProt accession number Q9FVS9 or SEQ ID NO: 112. In some embodiments, the transgene or gene of interest comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:112, or the transgene comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5% or 99.9% sequence identity to SEQ ID NO:112.

[0143] In some embodiments, the modified or transgenic plant comprises a gene of interest or a transgene encoding SOS1, SOS2, AHA3, VHA-A, NHX1, HKT1, SODA1, SODCC1, and P450. In some embodiments, the modified or transgenic plant comprises a gene of interest or a transgene encoding SOS1, SOS2, AHA3, VHA-A, NHX1, HKT1, SODA1, SOD2, and P450.

[0144] Oxygen Evolving Complex The process of pumping hydrogen ions to many locations within the cell can be energy-intensive. Constitutive production of three subunits from the Photosystem 2 hydrolase: PsbO, PsbP, and PsbQ, can help improve salt tolerance in transgenic plants by increasing the amount of energy available to the plant cell. When combined to form a complete enzyme unit, these subunits split water molecules to produce hydrogen ions, electrons, and oxygen. PsbU and PsbV can also be used in this system to only allow the reduction of water by the complete enzyme.

[0145] In some embodiments, the modified or transgenic plant further comprises a gene of interest or a transgene encoding an oxygen-evolving complex. In some embodiments, the oxygen-evolving complex is formed from the proteins PsbO, PsbP, and PsbQ. In some embodiments, the oxygen-evolving complex is formed from the proteins PsbO, PsbP, PsbQ, PsbU, and PsbV. In some embodiments, the modified or transgenic plant comprises a gene of interest or a transgene encoding SOS1, SOS2, AHA3, VHA-A, NHX1, HKT1, SODA1, SODCC1, PsbO, PsbP, and PsbQ. In some embodiments, the modified or transgenic plant comprises a gene of interest or a transgene encoding SOS1, SOS2, AHA3, VHA-A, NHX1, HKT1, SODA1, SOD2, PsbO, PsbP, PsbQ, PsbU, and PsbV.

[0146] In some embodiments, the PsbO is Oryza sativa PsbO (OsPsbO). OsPsbO can have the polypeptide sequence of Uniprot Accession No. A5JV93 or SEQ ID NO: 104. In some embodiments, the gene of interest or transgene can comprise a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of A5JV93 and / or SEQ ID NO: 104, or the transgene can comprise an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to A5JV93 and / or SEQ ID NO: 104.

[0147] In some embodiments, the PsbP is Oryza sativa PsbP (OsPsbP). OsPsbP can have a polypeptide sequence of Uniprot Accession No. XP_002876377.1;Q0KIW5;SEQ ID NO: 105. In some embodiments, the gene of interest or transgene can comprise a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of XP_002876377.1;Q0KIW5;SEQ ID NO: 105, or the transgene can comprise an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to XP_002876377.1;Q0KIW5;SEQ ID NO: 105.

[0148] In some embodiments, the PsbQ is Oryza sativa PsbQ (OsPsbQ). OsPsbQ can have the polypeptide sequence of Uniprot Accession No. P83646 or SEQ ID NO: 106. In some embodiments, the gene of interest or transgene can comprise a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of P83646 and / or SEQ ID NO: 106, or the transgene can comprise an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to P83646 and / or SEQ ID NO: 106. In some embodiments, the PsbU is Oryza sativa PsbU (OsPsbU).

[0149] Sucrose phosphate synthase The accumulation of osmoprotective compounds such as sucrose and proline is important for plants to adapt to high salinity. Sucrose is derived from hexose phosphates through the combined activity of UDP-glucose pyrophosphorylase, sucrose phosphate synthase, and sucrose phosphatase. Sucrose phosphate synthase appears to be the main control point for sucrose production

[10] . Therefore, it may be advantageous to express sucrose phosphate synthase in engineered or transgenic plants to protect against high levels of salt.

[0150] In some embodiments, the modified or transgenic plant further comprises a gene of interest or a transgene encoding a sucrose phosphate synthase. In some embodiments, the sucrose phosphate synthase is sucrose phosphate synthase 1, sucrose phosphate synthase 2, or sucrose phosphate synthase 3. In some embodiments, the modified or transgenic plant further comprises a gene of interest or a transgene encoding SOS1, SOS2, AHA3, VHA-A, NHX1, HKT1, SODA1, SODCC1, and sucrose phosphate synthase 1. In some embodiments, the modified or transgenic plant further comprises a gene of interest or a transgene encoding SOS1, SOS2, AHA3, VHA-A, NHX1, HKT1, SODA1, SODCC1, and sucrose phosphate synthase 2. In some embodiments, the engineered or transgenic plant comprises a gene of interest or a transgene encoding SOS1, SOS2, AHA3, VHA-A, NHX1, HKT1, SODA1, SODCC1, and sucrose phosphate synthase 3.

[0151] In some embodiments, the sucrose phosphate synthase 1 is Oryza sativa sucrose phosphate synthase 1 having UniProt Accession No. Q0JGK4 or SEQ ID NO: 113. In some embodiments, the transgene or gene of interest comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q0JGK4 and / or SEQ ID NO: 113, or the transgene comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO: 113.

[0152] In some embodiments, the sucrose phosphate synthase 1 is Oryza sativa sucrose phosphate synthase 1. In some embodiments, the sucrose phosphate synthase 2 is Oryza sativa sucrose phosphate synthase 2. In some embodiments, the sucrose phosphate synthase 3 is Oryza sativa sucrose phosphate synthase 3.

[0153] Pyrroline synthase Some plants accumulate high levels of proline in response to high salt concentrations. Proline is thought to act as an osmoprotectant, by providing an energy sink for regulating redox potential, or as a solute that protects macromolecules from denaturation. Under stress conditions, proline accumulation is mainly due to de novo synthesis. In plants, proline can be synthesized from either glutamate or ornithine, but under salt stress, the glutamate pathway is the predominant pathway

[11] . Delta-1-pyrroline-5-carboxylate synthase catalyzes the rate-limiting step in the biosynthesis of proline. There are two forms of this enzyme, delta-1-pyrroline-5-carboxylate synthase 1 or delta-1-pyrroline-5-carboxylate synthase 2, which exist in different cells and / or at different subcellular locations. Therefore, it may be advantageous to express delta-1-pyrroline-5-carboxylate synthase in engineered or transgenic plants to protect against high levels of salt.

[0154] In some embodiments, the modified or transgenic plant further comprises a gene of interest or a transgene encoding a pyrroline carboxylate synthase. In some embodiments, the pyrroline carboxylate synthase is delta-1-pyrroline-5-carboxylate synthase 1 or delta-1-pyrroline-5-carboxylate synthase 2. In some embodiments, the modified or transgenic plant comprises a gene of interest or a transgene encoding SOS1, SOS2, AHA3, VHA-A, NHX1, HKT1, SODA1, SODCC1, and delta-1-pyrroline-5-carboxylate synthase 1. In some embodiments, the modified or transgenic plant comprises a gene of interest or a transgene encoding SOS1, SOS2, AHA3, VHA-A, NHX1, HKT1, SODA1, SODCC1, and delta-1-pyrroline-5-carboxylate synthase 2.

[0155] In some embodiments, the delta-1-pyrroline-5-carboxylate synthase 1 is Oryza sativa delta-1-pyrroline-5-carboxylate synthase 1. In some embodiments, the delta-1-pyrroline-5-carboxylate synthase 2 is Oryza sativa delta-1-pyrroline-5-carboxylate synthase 2. In some embodiments, the Oryza sativa delta-1-pyrroline-5-carboxylate synthase 1 has UniProt Accession No. O04226 or SEQ ID NO: 114. In some embodiments, the transgene or gene of interest comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of O04226 and / or SEQ ID NO: 114, or the transgene comprises an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO: 114.

[0156] OSK1 OSK1 regulates the expression of superoxide dismutases (e.g., SODCC1, SOD2, and SODA1). Therefore, it may be advantageous to express OSK1 in combination with superoxide dismutases in engineered or transgenic plants to protect against high levels of salt. In some embodiments, the engineered or transgenic plants further comprise a gene of interest or transgene encoding OSK1. In certain embodiments, the engineered or transgenic plants comprise a gene of interest or transgene encoding OSK1 in combination with a gene of interest or transgene encoding a superoxide dismutase, e.g., SODCC1, SOD2, or SODA1. In some embodiments, the engineered or transgenic plants comprise a gene of interest or transgene encoding SOS1, SOS2, AHA3, VHA-A, NHX1, HKT1, SODA1, SODCC1, and OSK1. In some embodiments, the modified or transgenic plant comprises a gene of interest or a transgene encoding SOS1, SOS2, AHA3, VHA-A, NHX1, HKT1, SODA1, SOD2, and OSK1. In some embodiments, the modified or transgenic plant comprises a gene of interest or a transgene encoding SOS1, SOS2, AHA3, VHA-A, NHX1, HKT1, SODCC1, SOD2, and OSK1. In some embodiments, the modified or transgenic plant comprises a gene of interest or a transgene encoding SOS1, SOS2, AHA3, VHA-A, NHX1, HKT1, SODA1, SODCC1, SOD2, and OSK1. In some embodiments, the OSK1 is Oryza sativa OSK1 (OsOSK1), which can have the polypeptide sequence of Uniprot Accession Nos. Q9ZRJ1, Q0DGI1, Q9ZTF6, and / or Q852Q2.In some embodiments, the gene of interest or transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q9ZRJ1, Q0DGI1, Q9ZTF6, or Q852Q2, or the transgene may comprise an amino acid sequence with at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to Q9ZRJ1, Q0DGI1, Q9ZTF6, and / or Q852Q2.

[0157] In some embodiments, OsPsbQ may have the polypeptide sequence of SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, and / or SEQ ID NO: 110. In some embodiments, a gene of interest or a transgene may comprise a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, and / or SEQ ID NO: 110, or a transgene may comprise an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, and / or SEQ ID NO: 110.

[0158] In some embodiments, the transgenic plant does not contain a transgene encoding PERK13. In some embodiments, the gene of interest in the modified plant is not PERK13.

[0159] Promoter and enhancer elements The promoter can be operably linked to the transgene to control its expression in the transgenic plant. The promoter can include at least 6, at least 7, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20, at least 30, at least 40, or at least 50 nucleotides. The promoter can be located within at least about 50, at least about 75, at least about 100, at least about 125, at least about 150, at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, or at least about 1000 nucleotides from the 5' end of the open reading frame of the transgene.

[0160] The promoter operably linked to the transgene may comprise a promoter sequence naturally occurring in the plant genome of the corresponding gene - i.e., if the transgene is OsSOS1, the promoter may comprise a promoter sequence naturally occurring in the rice genome for OsSOS1. Alternatively, the promoter may be a specifically designed promoter and / or an artificial promoter. The promoter may control the expression level of the transgene both spatially and temporally within the plant. For example, the promoter may be designed to specifically express the transgene in the shoot, leaf, seed, or root of the plant. In some embodiments, the promoter is a shoot-specific promoter, a leaf-specific promoter, a seed-specific promoter, or a root-specific promoter. In certain embodiments, the promoter may be a root-specific promoter.

[0161] Promoters can be designed to direct the transgene specifically in seeds, during plant germination, during plant maturity, during plant flowering, and during plant seeding.

[0162] The present inventors have confirmed that plants can be modified to alter the expression of endogenous salt tolerance genes by operably linking the enhancer element described herein to the endogenous salt tolerance genes. This can be achieved by inserting an enhancer element at the 5' end of the open reading frame of the salt tolerance gene or by inserting an enhancer element downstream of the 5' end of the open reading frame in an intron of the endogenous salt tolerance gene. An enhancer element is operably linked to each gene of interest to control its expression in the modified plant. The enhancer element can include at least 6, at least 7, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleotides, at least 30 nucleotides, at least 40 nucleotides, or at least 50 nucleotides.

[0163] The enhancer element may be located within at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 125 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 250 nucleotides, at least about 300 nucleotides, at least about 350 nucleotides, at least about 400 nucleotides, at least about 450 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, or at least about 1000 nucleotides from the 5' end of the open reading frame of the salt tolerance gene. The salt tolerance gene may be SOS1, AHA-3, NHX1, VHA-A, HKT1, SOS1, SODCC, and / or SOD2. These examples show that altering the expression of these endogenous salt tolerance genes can improve salt tolerance in plants. In some embodiments, operably linking an enhancer element to an endogenous salt tolerance gene may include (a) inducing callus formation from a seed of the plant; (b) transforming the callus with a microcarrier using particle bombardment; (c) generating a transformed callus, the microcarrier having absorbed therein at least two different DNA sequences such that at least two genes of interest whose genomes contain enhancer element sequences are operably linked to the enhancer element sequences. In some cases, the DNA sequences may include (i) 5' and 3' flanking homology arms or adapters corresponding to the 5' regions of each of the at least three salt tolerance genes; an internal sequence including an enhancer element (or at least 5, 6, 7, 8, 9, or 10 nucleotides from an enhancer element) including a DREB2A, or ETH or AUX promoter sequence. Such a procedure may then include (c) recovering the transformed callus in a growth medium to generate a multicellular structure including a plurality of modified plant cells with improved salt tolerance.

[0164] In some embodiments, the microcarriers have absorbed thereon a programmable nuclease having specificity for the 5' upstream region or the intron region proximal to the 5' end of the open reading frame of the gene of interest. The programmable nuclease may comprise a class II, type II or class II, type VCas nuclease complexed with a guide RNA for the 5' upstream region of the gene of interest or the intron region proximal to the 5' end of the open reading frame of the gene of interest. The programmable nuclease may comprise a transcription activator-like (TAL) effector and nuclease (TALEN) having specificity for the 5' region of at least three salt tolerance genes or the intron region proximal to the 5' end of the open reading frame of the gene of interest. The programmable nuclease may comprise a zinc finger nuclease (ZFN) having specificity for the 5' region of at least three salt tolerance genes or the intron region proximal to the 5' end of the open reading frame of the gene of interest.

[0165] Plant hormones (also known as phytohormones) are signaling molecules that can regulate plant growth and development. Plants produce a wide variety of hormones, including auxins, gibberellins, abscisic acid, cytokinins, salicylic acid, ethylene, jasmonates, brassinosteroids, and peptides. In some embodiments, the enhancer element is hormone responsive. In some embodiments, the gene of interest encodes an ion transporter (e.g., a sodium or potassium transporter), and the gene of interest is operably linked to a hormone responsive enhancer element. In some embodiments, the gene of interest encodes a hydrogen transporting ATPase, and the gene of interest is operably linked to a hormone responsive enhancer element. In some embodiments, the gene of interest encodes a hydrogen transporting pyrophosphatase, and the gene of interest is operably linked to a hormone responsive enhancer element. In some embodiments, the gene of interest encodes a protein kinase, and the gene of interest is operably linked to a hormone responsive enhancer element. In some embodiments, the gene of interest encodes an antioxidant and the gene of interest is operably linked to a hormone responsive enhancer element.

[0166] In some embodiments, the promoter is a hormone responsive promoter. In some embodiments, the transgene encodes an ion transporter (e.g., a sodium or potassium transporter), and the transgene is operably linked to a hormone responsive promoter. In some embodiments, the transgene encodes a hydrogen transporting ATPase, and the transgene is operably linked to a hormone responsive promoter. In some embodiments, the transgene encodes a hydrogen transporting pyrophosphatase, and the transgene is operably linked to a hormone responsive promoter. In some embodiments, the transgene encodes a protein kinase, and the transgene is operably linked to a hormone responsive promoter. In some embodiments, the transgene encodes an antioxidant, and the transgene is operably linked to a hormone responsive promoter.

[0167] The hormone-responsive enhancer element or promoter may be responsive to abscisic acid (ABA), ethylene (ETH), gibberellin (GA), and auxin (AUX), or any combination thereof. In some embodiments, the enhancer element or promoter may include a DREB2A, ETH, or AUX promoter, or any combination thereof. The enhancer element or promoter may include at least 6 nucleotides from a DREB2A, ETH, or AUX promoter. The sequences of DREB2A, ETH, and AUX are shown in Table 1.

[0168] In some embodiments, the gene of interest encodes an ion transporter, and the gene of interest is operably linked to an enhancer element that responds to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In some embodiments, the gene of interest encodes a hydrogen transporting ATPase, and the gene of interest is operably linked to an enhancer element that responds to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In some embodiments, the gene of interest encodes a hydrogen transporting pyrophosphatase, and the gene of interest is operably linked to an enhancer element that responds to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In some embodiments, the gene of interest encodes a protein kinase, and the gene of interest is operably linked to an enhancer element that responds to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In some embodiments, the gene of interest encodes an antioxidant, and the gene of interest is operably linked to an enhancer element that responds to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof.

[0169] In certain embodiments, the gene of interest encodes SOS1, and the gene of interest is operably linked to an enhancer element responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the gene of interest encodes SOS2, and the gene of interest is operably linked to an enhancer element responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the gene of interest encodes NHK1, and the gene of interest is operably linked to an enhancer element responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the gene of interest encodes AHA3, and the gene of interest is operably linked to an enhancer element responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the gene of interest encodes HKT1, and the gene of interest is operably linked to an enhancer element responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the gene of interest encodes VHA-A, and the gene of interest is operably linked to an enhancer element responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the gene of interest encodes SODA1, and the gene of interest is operably linked to an enhancer element responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the gene of interest encodes SOD2, and the gene of interest is operably linked to an enhancer element responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In a particular embodiment, the gene of interest encodes SODCC1, and the gene of interest is operably linked to an enhancer element that responds to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof.

[0170] In some embodiments, the transgene encodes an ion transporter, and the transgene is operably linked to a promoter responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In some embodiments, the transgene encodes a hydrogen transporting ATPase, and the transgene is operably linked to a promoter responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In some embodiments, the transgene encodes a hydrogen transporting pyrophosphatase, and the transgene is operably linked to a promoter responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In some embodiments, the transgene encodes a protein kinase, and the transgene is operably linked to a promoter responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In some embodiments, the transgene encodes an antioxidant, and the transgene is operably linked to a promoter that responds to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof.

[0171] In certain embodiments, the transgene encodes SOS1, and the transgene is operably linked to a promoter responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the transgene encodes SOS2, and the transgene is operably linked to a promoter responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the transgene encodes NHK1, and the transgene is operably linked to a promoter responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the transgene encodes AHA3, and the transgene is operably linked to a promoter responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the transgene encodes HKT1, and the transgene is operably linked to a promoter responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the transgene encodes VHA-A, and the transgene is operably linked to a promoter responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the transgene encodes SODA1, and the transgene is operably linked to a promoter responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the transgene encodes SOD2, and the transgene is operably linked to a promoter responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof. In certain embodiments, the transgene encodes SODCC1, and the transgene is operably linked to a promoter responsive to abscisic acid, ethylene, gibberellin, and auxin, or any combination thereof.

[0172] In some embodiments, the hormone-responsive enhancer element or promoter is proximal to a general transcription-enhancing element (e.g., less than 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide away from it). Such general transcription-enhancing elements include, but are not limited to, TAF-1, TATA, E2F, G-BOX, or CAAT sequences. General transcription-enhancing elements may include any of the sequences outlined in Table 1, or any combination thereof.

[0173] In some embodiments, the enhancer element or promoter may comprise one or more of the promoter elements selected from the group: DREB2A, GA, TAF-1, TATATA, TATA, ETH, ARE, E2F-1, CAAT, TGA, G-BOX, or AUXCOMP. The sequences of these elements are shown in Table 1. Other possible promoter elements that can be used in the enhancer element or promoter are described in the PLACE database

[12] and in references

[13] ,

[14] ,

[15] ,

[16] ,

[17] ,

[18] ,

[19] ,

[20] ,

[21] ,

[22] ,

[23] ,

[24] ,

[25] , and

[26] , which are incorporated herein by reference. [Table 1]

[0174] The distribution of hormones varies spatially throughout the plant over time. Figure 7 shows how the distribution of certain hormones changes throughout the plant's life cycle. The inventors have found that the changes in the distribution of hormones within a plant can be exploited to control the expression of a gene of interest or a transgene. For example, it may be advantageous to express a gene of interest or a transgene in the roots instead of the whole plant, especially when the plant is exposed to salt stress. This is because unnecessary expression of the gene of interest or a transgene in the rest of the plant, or in non-salt exposed parts of the plant, will have a negative energy cost.

[0175] For example, auxin is very strongly expressed at the root tip, but expression decreases further towards the root. Auxin is also more expressed at the outer edge of the root compared to the center of the root. Using this auxin distribution, we have found that we can induce the expression of the SOS1 machinery (SOS1, SOS2, and AHA3) to be most active at the root tip. This leads us to find that when the root detects salt water, most SOS1 is produced, and that with salt water immersion, SOS1 is consistently present. As we move along the SOS1 distribution to the root tip and away from the center of the plant / stem, it also creates a path for salts to move down. In some embodiments, the SOS1 gene, SOS2 gene, and / or AHA3 gene are operably linked to an enhancer element that includes an auxin-responsive promoter element. In some embodiments, the SOS1 transgene, SOS2 transgene, and / or AHA3 transgene are operably linked to a promoter that includes an auxin-responsive promoter element.

[0176] The change in distribution of hormones throughout the plant life cycle can be utilized to conserve energy when certain enzymes are not needed. For example, if antioxidant enzymes are operably linked to a gibberellin promoter, they will be expressed from germination through the vegetative and flowering parts of plant growth. This provides protection to the plant from the early stages of plant development until a salt management system is established.

[0177] Multiple genes of interest, transgenes can be operably linked to the same or similar enhancer elements or promoters to ensure simultaneous expression. For example, if a modified plant contains multiple genes of interest encoding antioxidants, each antioxidant can be operably linked to the same or similar enhancer elements to ensure their expression is ubiquitous. In certain embodiments, the genes of interest or transgenes encoding antioxidants are operably linked to the same enhancer element or promoter that includes GA, TATA, DREB2A, and ETH elements or includes the sequences of SEQ ID NOs: 16-18.

[0178] SOS1, SOS2, and AHA3 function together as a synergistic group. Thus, in a particular embodiment, the modified plant comprises genes of interest encoding SOS1, SOS2, and AHA3, which are operably linked to similar enhancer elements to ensure that they are expressed simultaneously. Thus, in a particular embodiment, the transgenic plant comprises transgenes encoding SOS1, SOS2, and AHA3, which are operably linked to similar promoters to ensure that they are expressed simultaneously. These three genes act in a synergistic group, and therefore it is advantageous to use similar enhancer elements or promoters. In a particular embodiment, the modified plant comprises genes of interest encoding OsSOS1, OsSOS2, and OsAHA3; the OsSOS1 gene is operably linked to an enhancer element comprising SEQ ID NO:12, the OsSOS2 gene is operably linked to an enhancer element comprising SEQ ID NO:13, and the OsAHA3 gene is operably linked to an enhancer element comprising SEQ ID NO:14. In a particular embodiment, the transgenic plant comprises transgenes encoding OsSOS1, OsSOS2, and OsAHA3; the OsSOS1 transgene is operably linked to a promoter comprising SEQ ID NO:12, the OsSOS2 transgene is operably linked to a promoter comprising SEQ ID NO:13, and the OsAHA3 transgene is operably linked to a promoter comprising SEQ ID NO:14.

[0179] In some embodiments, the enhancer element may comprise a sequence having at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 99% identity, or a sequence substantially identical to any one of SEQ ID NOs: 10-18. In some embodiments, when the transgenic plant is Oryza sativa, the promoter may have a sequence having at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 99% identity, or a sequence substantially identical to any one of SEQ ID NOs: 10-18. In certain embodiments, when the plant cell is Oryza sativa, the promoter has a sequence of SEQ ID NOs: 10-18.

[0180] In a particular embodiment, the OsSOS1 gene is operably linked to an enhancer element comprising SEQ ID NO:12, the OsSOS2 gene is operably linked to an enhancer element comprising SEQ ID NO:13, the OsAHA3 gene is operably linked to an enhancer element comprising SEQ ID NO:14, the OsVHA-A gene is operably linked to an enhancer element comprising SEQ ID NO:11, the OsNHX1 gene is operably linked to an enhancer element comprising SEQ ID NO:10, the OsHKT1 gene is operably linked to an enhancer element comprising SEQ ID NO:15, the OsSODA1 gene is operably linked to an enhancer element comprising SEQ ID NO:16, and / or the OsSOD2 gene is operably linked to an enhancer element comprising SEQ ID NO:18.

[0181] In a particular embodiment, the OsSOS1 transgene is operably linked to a promoter comprising SEQ ID NO: 12, the OsSOS2 transgene is operably linked to a promoter comprising SEQ ID NO: 13, the OsAHA3 transgene is operably linked to a promoter comprising SEQ ID NO: 14, the OsVHA-A transgene is operably linked to a promoter comprising SEQ ID NO: 11, the OsNHX1 transgene is operably linked to a promoter comprising SEQ ID NO: 10, the OsHKT1 transgene is operably linked to a promoter comprising SEQ ID NO: 15, the OsSODA1 transgene is operably linked to a promoter comprising SEQ ID NO: 16, and / or the OsSOD2 transgene is operably linked to a promoter comprising SEQ ID NO: 18.

[0182] In some embodiments, the enhancer element may comprise a sequence having at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 99% identity, or substantially identical to any one of SEQ ID NOs: 82-91 listed in Table 2. In some embodiments, when the transgenic plant is a Brassica species, the promoter may comprise a sequence having at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, at least 95% identity, at least 99% identity, or substantially identical to any one of SEQ ID NOs: 82-91 listed in Table 2.

[0183] In certain embodiments, the BoSOS1 gene is operably linked to an enhancer element comprising SEQ ID NO:84, the BoSOS2 gene is operably linked to an enhancer element comprising SEQ ID NO:85, the BoAHA3 gene is operably linked to an enhancer element comprising SEQ ID NO:86, the BoVHA-A gene is operably linked to an enhancer element comprising SEQ ID NO:83, the BoNHX1 gene is operably linked to an enhancer element comprising SEQ ID NO:82, the BoHKT1 gene is operably linked to an enhancer element comprising SEQ ID NO:87, the BoSODA1 gene is operably linked to an enhancer element comprising SEQ ID NO:89, the BoSOD2 gene is operably linked to an enhancer element comprising SEQ ID NO:88, the BoCuZn SOD gene is operably linked to an enhancer element comprising SEQ ID NO:90, and / or the BoOSK1 gene is operably linked to an enhancer element comprising SEQ ID NO:91.

[0184] In certain embodiments, the BoSOS1 transgene is operably linked to a promoter comprising SEQ ID NO:84, the BoSOS2 transgene is operably linked to a promoter comprising SEQ ID NO:85, the BoAHA3 transgene is operably linked to a promoter comprising SEQ ID NO:86, the BoVHA-A transgene is operably linked to a promoter comprising SEQ ID NO:83, the BoNHX1 transgene is operably linked to a promoter comprising SEQ ID NO:82, the BoHKT1 transgene is operably linked to a promoter comprising SEQ ID NO:87, the BoSODA1 transgene is operably linked to a promoter comprising SEQ ID NO:89, the BoSOD2 transgene is operably linked to a promoter comprising SEQ ID NO:88, the BoCuZn SOD transgene is operably linked to a promoter comprising SEQ ID NO:90, and / or the BoOSK1 transgene is operably linked to a promoter comprising SEQ ID NO:91. [Table 2-1] [Table 2-2]

[0185] In a particular embodiment, the present invention provides a modified rice plant comprising at least eight genes of interest, wherein the genes of interest encode OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2; the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q5ICN3 or Q7XBF9; the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q69Q47; the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q8L6I3; the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q651T8; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q9SXJ8 or Q6VVA7; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q0D9S3; the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q43121; the OsSOD2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q10PW4, The OsSOS1 gene is operably linked to a promoter comprising SEQ ID NO: 12, the OsSOS2 gene is operably linked to a promoter comprising SEQ ID NO: 13, the OsAHA3 gene is operably linked to a promoter comprising SEQ ID NO: 14, the OsVHA-A gene is operably linked to a promoter comprising SEQ ID NO: 11, the OsNHX1 gene is operably linked to a promoter comprising SEQ ID NO: 10, the OsHKT1 gene is operably linked to a promoter comprising SEQ ID NO: 15, the OsSODA1 gene is operably linked to a promoter comprising SEQ ID NO: 16, and the OsSOD2 gene is operably linked to a promoter comprising SEQ ID NO: 18.

[0186] In a particular embodiment, the present invention provides a transgenic rice plant comprising at least eight transgenes, the transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2; the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q5ICN3 or Q7XBF9; the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q69Q47; the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q8L6I3; the OsVHA-A transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q651T8; the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q9SXJ8 or Q6VVA7; the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q0D9S3; the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q43121; the OsSOD2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q10PW4, The OsSOS1 transgene is operably linked to a promoter comprising SEQ ID NO:12, the OsSOS2 transgene is operably linked to a promoter comprising SEQ ID NO:13, the OsAHA3 transgene is operably linked to a promoter comprising SEQ ID NO:14, the OsVHA-A transgene is operably linked to a promoter comprising SEQ ID NO:11, the OsNHX1 transgene is operably linked to a promoter comprising SEQ ID NO:10, the OsHKT1 transgene is operably linked to a promoter comprising SEQ ID NO:15, the OsSODA1 transgene is operably linked to a promoter comprising SEQ ID NO:16 and the OsSOD2 transgene is operably linked to a promoter comprising SEQ ID NO:18.

[0187] In a particular embodiment, the present invention provides a modified rice plant comprising at least eight genes of interest, wherein the genes of interest encode OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSODCC1; the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q5ICN3 or Q7XBF9; the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q69Q47; the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q8L6I3; the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q651T8; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q9SXJ8 or Q6VVA7; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q0D9S3; the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q43121; the OsSODCC1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q0DRV6, The OsSOS1 gene is operably linked to a promoter comprising SEQ ID NO: 12, the OsSOS2 gene is operably linked to a promoter comprising SEQ ID NO: 13, the OsAHA3 gene is operably linked to a promoter comprising SEQ ID NO: 14, the OsVHA-A gene is operably linked to a promoter comprising SEQ ID NO: 11, the OsNHX1 gene is operably linked to a promoter comprising SEQ ID NO: 10, the OsHKT1 gene is operably linked to a promoter comprising SEQ ID NO: 15, the OsSODA1 gene is operably linked to a promoter comprising SEQ ID NO: 16, and the OsSODCC1 gene is operably linked to a promoter comprising SEQ ID NO: 17.

[0188] In a particular embodiment, the present invention provides a transgenic rice comprising at least eight transgenes, the transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSODCC1; the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q5ICN3 or Q7XBF9; the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q69Q47; the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q8L6I3; the OsVHA-A transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q651T8; the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q9SXJ8 or Q6VVA7; the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q0D9S3; the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q43121; the OsSODCC1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of Q0DRV6, The OsSOS1 transgene is operably linked to a promoter comprising SEQ ID NO:12, the OsSOS2 transgene is operably linked to a promoter comprising SEQ ID NO:13, the OsAHA3 transgene is operably linked to a promoter comprising SEQ ID NO:14, the OsVHA-A transgene is operably linked to a promoter comprising SEQ ID NO:11, the OsNHX1 transgene is operably linked to a promoter comprising SEQ ID NO:10, the OsHKT1 transgene is operably linked to a promoter comprising SEQ ID NO:15, the OsSODA1 transgene is operably linked to a promoter comprising SEQ ID NO:16 and the OsSODCC1 transgene is operably linked to a promoter comprising SEQ ID NO:17.

[0189] In a particular embodiment, the present invention provides a modified rice plant comprising at least eight genes of interest, wherein the genes of interest encode OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2; the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100; the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 101; the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99; the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 92; the OsSOD2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 93, The OsSOS1 gene is operably linked to a promoter comprising SEQ ID NO: 12, the OsSOS2 gene is operably linked to a promoter comprising SEQ ID NO: 13, the OsAHA3 gene is operably linked to a promoter comprising SEQ ID NO: 14, the OsVHA-A gene is operably linked to a promoter comprising SEQ ID NO: 11, the OsNHX1 gene is operably linked to a promoter comprising SEQ ID NO: 10, the OsHKT1 gene is operably linked to a promoter comprising SEQ ID NO: 15, the OsSODA1 gene is operably linked to a promoter comprising SEQ ID NO: 16, and the OsSOD2 gene is operably linked to a promoter comprising SEQ ID NO: 18.

[0190] In a particular embodiment, the present invention provides a transgenic rice plant comprising at least eight transgenes, the transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2; The OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:95 and / or 96; the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:100; the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:101; the OsVHA-A transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:102. the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:97 and / or 98; the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:99; the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:92; the OsSOD2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:93, The OsSOS1 transgene is operably linked to a promoter comprising SEQ ID NO:12, the OsSOS2 transgene is operably linked to a promoter comprising SEQ ID NO:13, the OsAHA3 transgene is operably linked to a promoter comprising SEQ ID NO:14, the OsVHA-A transgene is operably linked to a promoter comprising SEQ ID NO:11, the OsNHX1 transgene is operably linked to a promoter comprising SEQ ID NO:10, the OsHKT1 transgene is operably linked to a promoter comprising SEQ ID NO:15, the OsSODA1 transgene is operably linked to a promoter comprising SEQ ID NO:16 and the OsSOD2 transgene is operably linked to a promoter comprising SEQ ID NO:18.

[0191] Modified plants, modified plant parts, and modified multicellular structures, transgenic plants, transgenic plant parts, and transgenic multicellular structures Modified and transgenic plants In some embodiments, the modified or transgenic plant can be an angiosperm. Angiosperms include both monocotyledonous and dicotyledonous angiosperms. Monocotyledonous angiosperms include, but are not limited to, cereals such as Zea mays (corn), Oryza sativa (rice), Saccharum spp. (sugarcane), Hordeum vulgare (barley), millet, Avena sativa, Secale cereale (rye), Sorghum spp. (corn), Triticum spp. (wheat), or any combination thereof. Dicotyledonous angiosperms include vegetable crops such as Brassica (e.g., Brassica oleracea, kale), Glycine (e.g., Glycine max - soybean), Vigna radiata (mung bean), Chenopodium quinoa (quinoa), Soja, or Solanum (e.g., Solanum tuberosum - tomato).

[0192] In certain embodiments, the modified plant is modified rice. In certain embodiments, the transgenic plant is transgenic rice. Possible rice varieties that can be used in the present invention include: Agostano, Dichroa, Early Sutarsar, Hunan Early Dwarf, Java, Kendzo, Konosu#2, Kurumiwase, Kwanto Wase, Novelli Gigante, Okuro Mochi, Primanychskij, Sensho Tane, Venere Italian Black Rice, Zhe733, Cho Seun Zo Saeng, Se Zic, Daido, Mamoriaka, Duborskian, Yukihikari, Hayayuki, Truong Giang, MHC-2, TH3-5, Ho Phat3. In some embodiments, the modified or transgenic plants are rice cultivars Hayayuki, TH3-5, Truong Giang, MHC2, and Ha Phat3, Java long, Se Zic, Agostano, Hunan, and Dichroa. In particular embodiments, the modified rice is a rice cultivar Hayayuki modified plant. In particular embodiments, the transgenic rice is a rice cultivar Hayayuki transgenic plant.

[0193] The gene of interest or transgene may be from any plant species. For example, the gene of interest or transgene may be a rice gene, a corn gene, a sugarcane gene, a barley gene, a millet gene, an oat gene, a rye gene, a sorghum gene, a wheat gene, a kale gene, a soybean gene, a mung bean gene, a quinoa gene, or a tomato gene.

[0194] In some embodiments, the transgenic plant contains a transgene from the same species as the transgenic plant. In other embodiments, the transgenic plant contains a transgene from a different species than the transgenic plant, such as an ortholog of the transgene present in the transgenic plant. If the transgene is from the same species as the transgenic plant, its insertion as a transgene allows for additional copies of the gene to be present in the plant and / or the transgene is inserted under the control of a promoter different from the endogenous promoter allowing the expression level or pattern to be different from the expression pattern or level of the endogenous gene.

[0195] In certain embodiments, the transgenic plant is a transgenic rice plant that includes a transgene that is a rice gene. In some embodiments, the transgenic plant is a transgenic corn plant that includes a transgene that is a corn gene. In some embodiments, the transgenic plant is a transgenic sugarcane plant that includes a transgene that is a sugarcane gene. In some embodiments, the transgenic plant is a transgenic barley plant that includes a transgene that is a barley gene. In some embodiments, the transgenic plant is a transgenic millet plant that includes a transgene that is a millet gene. In some embodiments, the transgenic plant is a transgenic oat plant that includes a transgene that is an oat gene. In some embodiments, the transgenic plant is a transgenic rye plant that includes a transgene that is a rye gene. In some embodiments, the transgenic plant is a transgenic sorghum plant that includes a transgene that is a sorghum gene. In some embodiments, the transgenic plant is a transgenic wheat plant that includes a transgene that is a wheat gene. In some embodiments, the transgenic plant is a transgenic kale plant that includes a transgene that is a kale gene. In some embodiments, the transgenic plant is a transgenic soybean plant that includes a transgene that is a soybean gene. In some embodiments, the transgenic plant is a transgenic mung bean plant that includes a transgene that is a mung bean gene. In some embodiments, the transgenic plant is a transgenic quinoa plant that includes a transgene that is a quinoa gene. In some embodiments, the transgenic plant is a transgenic tomato plant that includes a transgene that is a tomato gene.

[0196] The modified plants, plant parts, and multicellular structures are not produced by a process involving homologous recombination. The modified plants, plant parts, and multicellular structures, as well as seeds, according to the present invention are not produced by an essentially biological process. The transgenic plants, plant parts, and multicellular structures are not produced by a process involving homologous recombination. The transgenic plants, plant parts, and multicellular structures, as well as seeds, according to the present invention are not produced by an essentially biological process.

[0197] In some embodiments, the engineered or transgenic plant has an acid content of about 1 gram per liter (g / L), about 2 g / L, about 3 g / L, about 4 g / L, about 5 g / L, about 6 g / L, about 7 g / L, about 8 g / L, about 9 g / L, about 10 g / L, about 11 g / L, about 12 g / L, about 13 g / L, about 14 g / L, about 15 g / L, about 16 g / L, about 17 g / L, about 18 g / L, about 19 g / L, about 20 g / L, about 21 g / L, about 22 g / L, about 23 g / L, about 24 g / L, about 25 g / L, about 26 g / L, about 27 g / L, about 28 g / L, about 29 g / L, about 30 g / L, about 31 g / L, about 32 g / L, about 33 g / L, about 34 g / L, about 35 g / L, about 36 g / L, about 37 g / L, about 38 g / L, about 39 g / L, about 40 g / L, about 41 g / L, about 42 g / L, about 43 g / L, about 44 g / L, about 45 g / L, about 46 g / L, about 47 g / L, about 48 g / L, about 49 g / L, about 50 g / L, about 51 g / L, about 52 g / L, about 53 g / L, about 54 g / L, about 55 g / L, about 56 g / L, about 57 g / L, about 58 g / L, about 59 g / L, about 60 g / L, about 61 g / L, about 62 g / L, about In certain embodiments, the modified or transgenic plants can be grown in a medium having a salt concentration of greater than about 10 g / L, 20 g / L, or 35 g / L. In further certain embodiments, the modified or transgenic plants can be grown in a medium having a salt concentration of greater than about 35 g / L, because it is greater than the marine salt concentration.

[0198] The modified and transgenic plants of the present invention may have increased salt tolerance compared to wild-type plants of the same species. In some embodiments, the modified or transgenic plants have a higher growth rate in a medium with a particular salt concentration or ECe compared to the growth rate of the wild-type plant. The medium in which the modified or transgenic plants may be grown may be selected from the group consisting of a medium having a salt concentration of 0.01% or more, and ... e) or an electrical conductivity (EC) of at least about 1.7 deciSiemens / meter (dS / m), at least about 2 dS / m, at least about 4 dS / m, at least about 6 dS / m, at least about 8 dS / m, at least about 10 dS / m, at least about 12 dS / m, at least about 14 dS / m, at least about 16 dS / m, at least about 18 dS / m, at least about 20 dS / m, at least about 22 dS / m, at least about The viscosity may be at least about 24 dS / m, at least about 26 dS / m, at least about 28 dS / m, at least about 30 dS / m, at least about 32 dS / m, at least about 34 dS / m, at least about 36 dS / m, at least about 38 dS / m, at least about 40 dS / m, at least about 42 dS / m, at least about 44 dS / m, at least about 46 dS / m, at least about 48 dS / m, or at least about 50 dS / m. In some embodiments, the medium is liquid (e.g., in the case of a hydroponic growing strategy). In some embodiments, the medium is solid (e.g., soil, sand). In some embodiments, the medium is semi-solid.

[0199] In some embodiments, engineered or transgenic plants have a growth rate in saline medium that is equal to or exceeds the growth rate in non-salt medium. e ) or liquid EC with an electrical conductivity of 4-8 dS / m), "moderate salt concentration" (e.g., saturated paste extract (EC e ) or liquid EC between 8 and 16 dS / m), or "severe salinity" (electrical conductivity of saturated paste extract (EC e ) or liquid EC greater than 16 dS / m. Non-salt media can be defined as having an electrical conductivity (EC) of a saturated paste extract. e ) or liquid EC can be less than 4 dS / m, less than 3 dS / m, less than 2 dS / m, less than 1.7 dS / m, or less than 1.5 dS / m. In some embodiments, the growth rate in salt medium is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 100%, 150%, 200% or more.

[0200] In some embodiments, the engineered or transgenic plant has a particular threshold salt concentration (ECt), or a high threshold salt concentration. In some embodiments, the engineered or transgenic plant has a threshold salt concentration of at least about 6 dS / m, at least about 6.5 dS / m, at least about 6.7 dS / m, at least about 7 dS / m, at least about 7.5 dS / m, at least about 8 dS / m, at least about 8.5 dS / m, at least about 9 dS / m, at least about 9.5 dS / m, at least about 10 dS / m, at least about 10.5 dS / m, at least about 11 dS / m, at least about 11.5 dS / m, at least about 12 dS / m, at least about 12.5 dS / m, at least about 13 dS / m, at least about 13.5 dS / m, at least about 14 dS / m, at least about 14.5 ... / m, at least about 15 dS / m, at least about 15.5 dS / m, at least about 16 dS / m, at least about 16.5 dS / m, at least about 17 dS / m, at least about 17.5 dS / m, at least about 18 dS / m, at least about 18.5 dS / m; at least about 19 dS / m, at least about 19.5 dS / m, at least about 20 dS / m, at least about 21 dS / m, at least about 22 dS / m, at least about 23 dS / m, at least about 24 dS / m, at least about 25 dS / m, at least about 26 dS / m, at least about 27 dS / m, at least about 28 dS / m, at least about 29 dS / m, or at least about 30 dS / m or more. In some embodiments, the elevated threshold salt concentration is assessed relative to the same plant species or cultivar without genome editing. In some embodiments, the threshold salt concentration is increased by at least about 1 dS / m, at least about 2 dS / m, at least about 3 dS / m, at least about 4 dS / m, at least about 5 dS / m, at least about 6 dS / m, at least about 7 dS / m, at least about 8 dS / m, at least about 9 dS / m, at least about 10 dS / m, at least about 11 dS / m, at least about 12 dS / m, at least about 13 dS / m, at least about 14 dS / m, or at least about 15 dS / m or more.

[0201] In some embodiments, the engineered or transgenic plant has a particular slope(s) of a yield vs. salinity (ECe) plot, or a reduced slope(s) of a yield vs. salinity (ECe) plot. In some embodiments, the reduced slope is evaluated in comparison to the same plant species or cultivar without genome editing. In some embodiments, the slope is reduced by at least about 1% per dS / m, at least about 1.5% per dS / m, at least about 2.0% per dS / m, at least about 2.5% per dS / m, at least about 3.0% per dS / m, at least about 3.5% per dS / m, at least about 4.0% per dS / m, at least about 4.5% per dS / m, at least about 5.0% per dS / m, at least about 5.5% per dS / m, at least about 6.0% per dS / m, at least about 8% per dS / m, or at least about 10% per dS / m or more. An example of a yield versus salinity (ECe) plot can be seen in FIG.

[0202] In some embodiments, modified or transgenic plants may have a particular starch content as mature plants, or the seeds or roots of mature plants may have a particular starch content.In some embodiments, the plants, roots, fruits, or seeds of mature plants may have at least about 20% starch by weight, at least about 25% starch by weight, at least about 30% starch by weight, at least about 35% starch by weight, at least about 40% starch by weight, at least about 45% starch by weight, at least about 50% starch by weight, at least about 56% starch by weight, at least about 60% starch by weight, at least about 65% starch by weight, at least about 70% starch by weight, at least about 75% starch by weight, or at least about 80% starch by weight, or more.The starch may be amylose or its derivatives.

[0203] Modified and transgenic plant parts The present invention also provides a part of the modified or transgenic plant of the present invention. For example, the plant part can be a cell, a seed, a leaf, a shoot, a stem, or a root. In certain embodiments, the plant part is a seed or a cell. Thus, the plant part, such as a seed, can contain any combination of genes of interest or transgenes, as described above for modified or transgenic plants. For example, the seed contains at least two genes of interest, a first gene encoding a protein that controls intracellular ion concentration, and a second gene encoding an antioxidant, the gene encoding the protein that controls intracellular ion concentration is operably linked to an enhancer element, and the gene encoding the antioxidant is operably linked to an enhancer element. In another embodiment, the seed comprises at least two genes of interest, a first and a second gene of interest encoding proteins that control an intracellular ion concentration, the first gene of interest encoding a cell membrane protein that controls an intracellular ion concentration, and the second gene of interest encoding a tonoplast protein that controls an intracellular ion concentration, the gene encoding the cell membrane protein that controls an intracellular ion concentration being operably linked to an enhancer element, and the gene encoding the tonoplast protein being operably linked to an enhancer element.

[0204] In another embodiment, the seed comprises at least four genes of interest, wherein the seed is a rice seed, and the genes of interest encode OsSOS1, OsNHX1, OsHKT1, and OsSODA1, wherein the gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; and the gene encoding OsSODA1 is operably linked to an enhancer element. In another embodiment, the seed comprises at least four genes of interest, wherein the seed is a rice seed, and the genes of interest encode OsSOS1, OsNHX1, OsHKT1, and OsAHA3, wherein the gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; and the gene encoding OsAHA3 is operably linked to an enhancer element.

[0205] For example, the seed comprises at least two transgenes, a first transgene encoding a protein that controls an intracellular ion concentration and a second transgene encoding an antioxidant. In another embodiment, the seed comprises at least two transgenes, a first and a second transgene encoding a protein that controls an intracellular ion concentration, a first transgene encoding a cell membrane protein that controls an intracellular ion concentration and a second transgene encoding a tonoplast protein that controls an intracellular ion concentration. In another embodiment, the seed comprises at least four transgenes, the seed being a rice seed and the transgenes encoding OsSOS1, OsNHX1, OsHKT1 and OsSODA1.

[0206] In some embodiments, the modified rice seed comprises at least four genes of interest, the genes of interest encoding OsSOS1, OsNHX1, OsHKT1, and OsSODA1; the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99; the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 92; The gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; and the gene encoding OsSODA1 is operably linked to an enhancer element.

[0207] In some embodiments, the modified rice seed comprises at least four genes of interest, the genes of interest encoding OsSOS1, OsNHX1, OsHKT1, and OsAHA3; the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99; and the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 101. The gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; and the gene encoding OsAHA3 is operably linked to an enhancer element.

[0208] In some embodiments, the modified rice seed comprises at least four genes of interest, wherein the genes of interest encode OsSOS1, OsNHX1, OsSOS2, and OsVHA-A, wherein the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100; the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102, wherein the gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsSOS2 is operably linked to an enhancer element; and the gene encoding OsVHA-A is operably linked to an enhancer element.

[0209] In some embodiments, the rice seed comprises at least four transgenes, the transgenes encoding OsSOS1, OsNHX1, OsHKT1, and OsSODA1, wherein the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 95 and / or 96; the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 97 and / or 98; the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 99; and the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 92.

[0210] In a particular embodiment, the modified rice seed comprises at least eight genes of interest, the at least eight genes of interest encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2; the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100; the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 101; the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; and the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99. the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:92; the OsSOD2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:93; the gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsSOS2 is operably linked to an enhancer element; the gene encoding OsAHA3 is operably linked to an enhancer element; the gene encoding OsVHA-A is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; the gene encoding OsSODA1 is operably linked to an enhancer element; and the gene encoding OsSOD2 is operably linked to an enhancer element.

[0211] In a particular embodiment, the rice seed comprises at least eight transgenes, the transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2; the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:95 and / or 96; the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:100; the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:101; and the OsVHA-A transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:102. the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:97 and / or 98; the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:99; the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:92; and the OsSOD2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:93.

[0212] In a particular embodiment, the modified rice seed comprises at least eight genes of interest, wherein the at least eight genes of interest encode OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSODCC1; the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96, the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100; the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 101; the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99; the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 92; the OsSODCC1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 94, The gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsSOS2 is operably linked to an enhancer element; the gene encoding OsAHA3 is operably linked to an enhancer element; the gene encoding OsVHA-A is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; the gene encoding OsSODA1 is operably linked to an enhancer element; and the gene encoding OsSODCC1 is operably linked to an enhancer element.

[0213] In another embodiment, the rice seed comprises at least eight transgenes, the transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSODCC1, the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 95 and / or 96, the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 100, and the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 101, The OsVHA-A transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:102, the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:97 and / or 98, the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:99, the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:92, and the OsSODCC1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:94.

[0214] In some embodiments, the seeds are at about 1 gram per liter (g / L), about 2 g / L, about 3 g / L, about 4 g / L, about 5 g / L, about 6 g / L, about 7 g / L, about 8 g / L, about 9 g / L, about 10 g / L, about 11 g / L, about 12 g / L, about 13 g / L, about 14 g / L, about 15 g / L, about 16 g / L, about 17 g / L, about 18 g / L, about 19 g / L, about 20 g / L, about 21 g / L, The modified or transgenic plants can be grown in a medium having a salt concentration of greater than about 22 g / L, about 23 g / L, about 24 g / L, about 25 g / L, about 26 g / L, about 27 g / L, about 28 g / L, about 29 g / L, or about 30 g / L, about 32 g / L, about 34 g / L, about 36 g / L, about 38 g / L, about 40 g / L, about 42 g / L, about 44 g / L, about 46 g / L, about 48 g / L, about 50 g / L. In particular embodiments, the modified or transgenic plants can be grown in a medium having a salt concentration of greater than about 10 g / L, 20 g / L, or 35 g / L. In more specific embodiments, the modified or transgenic plants can be grown in a medium having a salt concentration of greater than about 35 g / L, because it is higher than the marine salt concentration. The medium can be grown in a medium having a salt concentration of greater than about 10 g / L, 20 g / L, or 35 g / L. e) or an electrical conductivity (EC) of at least about 1.7 deciSiemens / meter (dS / m), at least about 2 dS / m, at least about 4 dS / m, at least about 6 dS / m, at least about 8 dS / m, at least about 10 dS / m, at least about 12 dS / m, at least about 14 dS / m, at least about 16 dS / m, at least about 18 dS / m, at least about 20 dS / m, at least about 22 dS / m, at least about The viscosity may be at least about 24 dS / m, at least about 26 dS / m, at least about 28 dS / m, at least about 30 dS / m, at least about 32 dS / m, at least about 34 dS / m, at least about 36 dS / m, at least about 38 dS / m, at least about 40 dS / m, at least about 42 dS / m, at least about 44 dS / m, at least about 46 dS / m, at least about 48 dS / m, or at least about 50 dS / m. In some embodiments, the medium is liquid (e.g., in the case of a hydroponic growing strategy). In some embodiments, the medium is solid (e.g., soil, sand). In some embodiments, the medium is semi-solid. In some embodiments, the seeds may have at least about 20% by weight starch, at least about 25% by weight starch, at least about 30% by weight starch, at least about 35% by weight starch, at least about 40% by weight starch, at least about 45% by weight starch, at least about 50% by weight starch, at least about 56% by weight starch, at least about 60% by weight starch, at least about 65% by weight starch, at least about 70% by weight starch, at least about 75% by weight starch, or at least about 80% by weight starch, or more. The starch may be amylose or a derivative thereof.

[0215] multicellular structure The present invention provides a multicellular structure comprising one or more plant cells of the present invention (i.e., the multicellular structure comprises one or more plant cells that may have any combination of genes of interest or transgenes as described above for modified or transgenic plants). The multicellular structure may be a whole plant, plant tissue, plant organ, plant part, plant reproductive material, or cultured plant tissue that comprises one or more plant cells described herein. The multicellular structure may be a leaf, shoot, seed, callus, seedling, flower, or in vitro cultured shoot that comprises one or more plant cells described herein. As used herein, the term "callus" is generally intended to include regenerable plant tissues such as embryogenic callus. As used herein, "seedling" generally includes young or small plants that are used as propagules. Seedlings may be generated asexually in tissue culture or cell culture. As used herein, "in vitro cultured shoots" generally includes apical and axillary shoots propagated in vitro. Apical and axillary buds of plants are small terminal or lateral projections on the stems of vascular plants that can develop into flowers, leaves, or shoots. Plant buds arise from meristems and can consist of overlapping immature leaves or petals. The multicellular structure can be a leaf, shoot, seed, callus, seedling, flower, or in vitro cultured bud from a plant described herein. The multicellular structure can be a whole plant, plant tissue, plant organ, plant part, plant reproductive material, or cultured plant tissue from a plant described herein.

[0216] In some embodiments, the multicellular structure comprises one or more plant cells, the one or more plant cells comprising at least four genes of interest, the genes of interest encoding OsSOS1, OsNHX1, OsHKT1, and OsSODA1, wherein the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99; the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 92, wherein the gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; and the gene encoding OsSODA1 is operably linked to an enhancer element.

[0217] In some embodiments, the multicellular structure comprises one or more plant cells, the one or more plant cells comprising at least four genes of interest, the genes of interest encoding OsSOS1, OsNHX1, OsHKT1, and OsAHA3, wherein the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99; the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 101, wherein the gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; and the gene encoding OsAHA3 is operably linked to an enhancer element.

[0218] In some embodiments, the multicellular structure comprises one or more plant cells, wherein the one or more plant cells comprise at least four genes of interest, wherein the genes of interest encode OsSOS1, OsNHX1, OsSOS2, and OsVHA-A, wherein the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100; the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102; the gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsSOS2 is operably linked to an enhancer element; and the gene encoding OsVHA-A is operably linked to an enhancer element.

[0219] In some embodiments, the multicellular structure comprises one or more plant cells, wherein the one or more plant cells comprise at least four transgenes, the transgenes encoding OsSOS1, OsNHX1, OsHKT1, and OsSODA1, wherein the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 95 and / or 96, the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 97 and / or 98, the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 99, and the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 92.

[0220] In certain embodiments, the multicellular structure comprises one or more plant cells, wherein the one or more plant cells comprise at least eight genes of interest, wherein the genes of interest encode OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2; the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100; the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 101; the OsVHA-A gene is a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99; the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 92; the OsSOD2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 93, The gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; the gene encoding OsSODA1 is operably linked to an enhancer element, the gene encoding OsSOS2 is operably linked to an enhancer element; the gene encoding OsVHA-A is operably linked to an enhancer element; the gene encoding OsAHA3 is operably linked to an enhancer element; and the gene encoding OsSOD2 is operably linked to an enhancer element.

[0221] In certain embodiments, the multicellular structure comprises one or more plant cells, wherein the one or more plant cells comprise at least eight transgenes, the transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2; the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 95 and / or 96, the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 100, and the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 101; The OsVHA-A transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:102, the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:97 and / or 98, the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:99, the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:92, and the OsSOD2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:93.

[0222] In certain embodiments, the multicellular structure comprises one or more plant cells, wherein the one or more plant cells comprise at least eight genes of interest, wherein the genes of interest encode OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSODCC1; the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100; the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 101; the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99; the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 92; the OsSODCC1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 94, The gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; the gene encoding OsSODA1 is operably linked to an enhancer element, the gene encoding OsSOS2 is operably linked to an enhancer element; the gene encoding OsVHA-A is operably linked to an enhancer element; the gene encoding OsAHA3 is operably linked to an enhancer element; and the gene encoding OsSODCC1 is operably linked to an enhancer element.

[0223] In another embodiment, the multicellular structure comprises one or more plant cells, wherein the one or more plant cells comprise at least eight transgenes, the transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSODCC1; The OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:95 and / or 96; the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:100; the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:101; the OsVHA-A transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:102. ; the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 97 and / or 98; the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 99; the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 92; the OsSODCC1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 94.

[0224] Methods for generating modified plants The present invention provides a method of making a modified plant, plant part, or multicellular structure according to the present invention, comprising the steps of: i) introducing at least two enhancer elements described herein into a cell of a plant, wherein the enhancer elements are integrated into the genome of the cell of the plant such that the enhancer elements are operably linked to a gene of interest, and ii) regenerating the cell to form a modified plant, plant part, or multicellular structure from the cell. In some embodiments, the enhancer elements are introduced into the cell by particle bombardment, Agrobacterium-mediated transformation, or protoplast transfection. In certain embodiments, the enhancer elements are introduced into the cell by particle bombardment.

[0225] Programmable nucleases, such as Cas endonucleases (e.g., Cas9, CpfI), transcription activator-like effector nucleases (TALENs), and zinc finger nucleases (ZFNs), allow precise genome editing to be performed. Thus, in certain embodiments, a method of making a modified plant, plant part, or multicellular structure according to the invention comprises: (a) inducing callus formation from seeds; (b) precipitating on a microcarrier an enhancer element, a guide RNA, and one or more nuclease(s) as described herein; (c) transforming the callus with the microcarrier using particle bombardment to produce a transformed callus, wherein the enhancer element is integrated into the genome of the modified plant, plant part, or multicellular structure such that the enhancer element is operably linked to a gene of interest; (d) recovering the transformed callus to produce a multicellular structure comprising at least two genes of interest, each gene of interest being operably linked to an enhancer element. .

[0226] In some embodiments, the multicellular structure is regenerated into a modified plant, plant tissue, plant organ, plant part, plant reproductive material, or cultured plant tissue, comprising one or more plant cells as described herein. In certain embodiments, the multicellular structure is regenerated into a modified plant. In some embodiments, the enhancer element is stably integrated into the genome of the plant.

[0227] In some embodiments, the enhancer element is RNA, DNA, or a plasmid. In certain embodiments, the enhancer element is DNA. DNA may be used rather than RNA because DNA is more stable both outside the cell and in the cytoplasm and nucleus, less prone to errors during production, and less prone to errors during repair of Cas cleavage sites. DNA may be used rather than a plasmid because DNA provides stable integration into the genome. DNA can often be integrated with smaller insertions that remain undetected for many generations, thereby allowing it to become a permanent feature of the new organism and subsequent generations. When combined with CRISPR-associated (Cas) enzymes, DNA insertions safely integrate the insertion into the host genome, conspicuously absent of any vehicle DNA, integration of plasmid DNA, or any sign that cleavage has been made in the genome. The safety of using these small DNA insertions, as opposed to much larger plasmid structures, results in precise and precise insertions that produce the exact intended output of the inserted / affected gene, compared to some of the unpredictable outcomes of introducing plasmid DNA into cells.

[0228] In some embodiments, the nuclease is a Cas nuclease, a Cpf1 nuclease, a TALEN, or a zinc finger nuclease. In certain embodiments, the nuclease is Cpf1.

[0229] In some embodiments, the modified plant, plant part, or multicellular structure is not produced by a process involving homologous recombination or is not produced by an essentially biological process.

[0230] Methods for generating transgenic plants The invention provides a method of making a transgenic plant, plant part, or multicellular structure according to the invention, comprising the steps of: i) introducing at least two transgenes as described herein into a cell of a plant, wherein the transgenes are stably integrated into the genome of the cell of the plant, and ii) regenerating the cell to form a transgenic plant, plant part, or multicellular structure from the cell. In some embodiments, the transgenes are introduced into the cell by particle bombardment, Agrobacterium-mediated transformation, or protoplast transfection. In certain embodiments, the transgenes are introduced into the cell by particle bombardment.

[0231] Programmable nucleases, such as Cas endonucleases (e.g., Cas9, CpfI), transcription activator-like effector nucleases (TALENs), and zinc finger nucleases (ZFNs), allow precise genome editing to be performed. Thus, in certain embodiments, a method of making a transgenic plant, plant part, or multicellular structure according to the present invention comprises: (a) inducing callus formation from seeds; (b) precipitating a polynucleotide sequence, a guide RNA, and a nuclease onto a microcarrier, wherein the polynucleotide sequence comprises at least two transgenes as described herein; (c) transforming the callus with the microcarrier using particle bombardment to produce transformed callus, wherein the polynucleotide sequence is integrated into the genome of the transgenic plant, plant part, or multicellular structure; (d) recovering the transformed callus to produce a multicellular structure containing at least two transgenes.

[0232] In some embodiments, the multicellular structure is regenerated into a transgenic plant, plant tissue, plant organ, plant part, plant reproductive material, or cultured plant tissue comprising one or more plant cells described herein. In certain embodiments, the multicellular structure is regenerated into a transgenic plant. In some embodiments, the polynucleotide sequence is stably integrated into the genome of the plant.

[0233] In some embodiments, the polynucleotide is RNA, DNA, or a plasmid. In certain embodiments, the polynucleotide is DNA. DNA may be used rather than RNA because DNA is more stable both outside the cell and in the cytoplasm and nucleus, less prone to errors during manufacture, and less prone to errors during repair of Cas cleavage sites. DNA may be used rather than a plasmid because DNA provides stable integration into the genome. DNA can often be integrated with smaller insertions that remain undetected for many generations, thereby allowing it to become a permanent feature of the new organism and subsequent generations. When combined with CRISPR-associated (Cas) enzymes, DNA insertions safely integrate the insertion into the host genome, conspicuously absent of any vehicle DNA, integration of plasmid DNA, or any sign that cleavage has been made in the genome. The safety of using these small DNA insertions, as opposed to much larger plasmid structures, results in precise and precise insertions that produce the exact intended output of the inserted / affected gene, compared to some of the unpredictable outcomes of introducing plasmid DNA into cells.

[0234] In some embodiments, the nuclease is a Cas nuclease, a Cpf1 nuclease, a TALEN, or a zinc finger nuclease. In certain embodiments, the nuclease is Cas9 or Cpf1.

[0235] In some embodiments, the transgenic plant, plant part, or multicellular structure is not produced by a process involving homologous recombination or is not produced by an essentially biological process.

[0236] Uses of modified and transgenic plants In another embodiment, the present invention provides a method for producing flour, whole grain, starch, or other product from a seed, the method comprising the steps of a) obtaining a seed of the present invention, and b) extracting the flour, whole grain, starch, or other product.

[0237] In another embodiment, the present invention provides a method of processing rice, the method comprising the steps of a) obtaining a seed of the present invention, b) removing the husk, and c) milling the dehulled rice to remove the bran layer. In some embodiments, the method comprises whitening the rice. In some embodiments, the method comprises milling the rice.

[0238] In another embodiment, the present invention provides the use of a modified plant of the present invention, or a part thereof, as an animal feed or to produce a feed for animal consumption or a food for human consumption.In another embodiment, the present invention provides the use of a transgenic plant of the present invention, or a part thereof, as an animal feed or to produce a feed for animal consumption or a food for human consumption.

[0239] Modes for carrying out the invention The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention in any way.

[0240] Example 1 - Generation of genetic inserts in modified rice Using Cas9 and Cpf1 nuclease, gene inserts were designed to stably introduce enhancer elements into the rice genome in operably linked relation to genes of interest encoding various proteins with different functions, including plasma membrane ion transporters, plasma membrane hydrogen transporting ATPases, tonoplast hydrogen transporting ATPases, tonoplast ion transporters, potassium transporters, protein kinases, and antioxidants.

[0241] The guide RNA (gRNA) used for each gene of interest is shown in Table 3. An overview of the enhancer elements and the corresponding genes of interest is shown in Table 4. Cas9 homology arms were added to the 5' and 3' ends of some inserts, as summarized in Table 5. The enhancer elements were designed to have two purposes: first, to increase expression of the gene of interest to immediately relieve salt stress. Second, to attenuate gene expression of other stress-induced genes. The stress-induced genes that are attenuated are a collective group that impede plant growth and prevent the plant metabolism from fully functioning when under stress. Without being bound to any particular theory, by attenuating the effective expression of the stress-induced genes, which weakens its initial effect, an equitable and beneficial salt distribution should be established due to the increased expression of the gene of interest to the plant.

[0242] Genes of interest encoding antioxidants were operably linked to enhancer elements with the same polynucleotide sequence to ensure simultaneous expression. The antioxidant enhancer elements were designed to ensure expression of antioxidants at key moments in plant development to "clean" reactive oxygen species while also providing elevated baseline levels throughout the plant's lifespan and tissues. Baseline expression of the antioxidants was achieved by the presence of a TATA box in the enhancer element, a constitutively and ubiquitously expressed motif that promotes expression throughout the plant. The antioxidant enhancer element also contains a gibberellic acid responsive element. Gibberellic acid (GA) promotes expression during early developmental stages and focuses expression of antioxidant genes in the epidermal root. The presence of an ethylene responsive element in the enhancer element results in expression of antioxidant genes throughout later plant developmental stages, with specific expression during flowering and fruit development. The antioxidant enhancer element also contained the DREB2A element, a stress-induced promoter element that responds to ethylene.

[0243] Auxin begins to be expressed after initial germination, primarily in axial locations (root cap and central root) in both stems and roots. It continues to be expressed throughout the plant life cycle, supported by ethylene during flowering and fruit development (see Figure 7). The auxin element was used with enhancer elements from the SOS1 / SOS2 / AHA group rather than gibberellins, because auxin is more expressed at the root tip, particularly where the root begins to grow. This can be used to generate consistent production of these important proteins, which can then be introduced into the root cell membrane as it grows. Over time, the growth of these roots will slow and the strength of expression will develop a gradient from the tip to the back along the root. This can establish a gradient that moves salts to the root tip and pushes them out of the root. [Table 3] [Table 4] [Table 5-1] [Table 5-2]

[0244] Example 2 - Generation of modified plants Step 1 - Callus Induction The seed shells were removed by hand or using tweezers. The seeds were then surface sterilized with 75% ethanol for 1 minute, followed by 2.5% sodium hypochlorite for 15 minutes, and then washed 8 times with distilled water. The seed shells were then autoclaved. The seeds were then placed on rice callus induction medium. The components of this medium are shown in Table 6 below. The seeds were incubated in the dark at 25° C. for 14 hours. This produced embryogenic calli with a white or yellowish, compact, nodular structure. [Table 6]

[0245] After 14 days, the embryogenic calli were excised from the seeds and further divided into equal pieces of approximately 5 mm in diameter. These calli were transferred to fresh rice callus induction medium and incubated under the same conditions (25°C, 24 h in the dark) for 4 days.

[0246] Step 2 - Microparticle Bombardment The DNA inserts designed in Example 1 were transformed into rice using microprojectile bombardment. Each microprojectile is composed of up to four DNA inserts per bombardment. Therefore, multiple sets of bombardments were required to bombard the embryonic callus with eight DNA inserts. The embryogenic callus was bombarded with the following sets of DNA inserts, which contain the sequences listed in Table 5 to generate modified plants as summarized in the table below. The rice varieties used to generate the embryogenic callus are also listed in the table.

[0247] Experiment 1 [Table 7]

[0248] Experiment 2 Set 1: NHX1, SOS1, AHA3, and HKT1 Set 2: VHA-A, SOS2, SODA1, and SOD2 Table 8 - Combinations of genes of interest targeted in each rice. The rice cultivars used are also shown. [Table 8]

[0249] For the DNA insert to stably integrate into the genome, a programmable nuclease (Cas9 or Cpf1) and at least one RNA guide must be combined and collided as shown in Table 3. Cas9 requires two RNA guides, crRNA and tracrRNA, to stably insert DNA inserts containing enhancer elements into the plant genome, whereas Cpf1 requires only a single guide RNA. The ratio of nuclease enzyme to RNA guide to gene DNA insert was 1:1:2 per gene. The DNA / enzyme mixture was made as outlined below. [Table 9]

[0250] The DNA / enzyme mixture was precipitated onto the gold particles by mixing the gold particles with the DNA / enzyme mixture, spermidine, and calcium chloride. The resulting mixture was incubated on ice for 10 minutes. The DNA-coated particles were centrifuged, the supernatant removed and replaced with 75% ethanol, and the gold particles were resuspended.

[0251] Embryogenic calli were placed on petri dishes containing rice osmotic medium for 4 hours before bombardment. The components of rice osmotic medium are summarized in Table 9 below. Alternatively, calli were transferred to Whatman™ filter paper and dried in the dark at 25° C. for 24 hours. Calli were then transferred to the gene gun system and 10 μl of prepared DNA-coated gold particles were baked at at least 1100 psi under a vacuum pressure of at least −5 Hg.

[0252] After bombardment, the calli were placed on rice osmotic medium in the dark for 16-20 hours at 26° C. The calli were then transferred to rice callus induction medium and incubated in the dark at 25° C. for 7-14 days. [Table 10]

[0253] Step 3 - Embryogenic callus regeneration The calli were then transferred to Rice Regeneration Medium I (RRMI) and incubated under light conditions (25°C, 16 hours light, 8 hours dark) for 1-3 weeks. After about 7 days, some of the calli began to show green spots and developed, growing shoots and roots to form seedlings. After 3 weeks, or before the seedlings became too large to transplant, the seedlings and remaining calli were transplanted to Rice Regeneration Medium II (listed in Table 10 below) and incubated under light conditions (25°C, 16 hours light: 8 hours dark). [Table 11]

[0254] To induce more root tissue growth, the seedlings were transferred to Rice Root Proliferation Medium (RRPM) (described in Table 11) and incubated under light conditions (25°C, 16 hours light:8 hours dark) until the root mass was sufficient to ensure healthy plant growth. [Table 12]

[0255] Example 3 - Optimization of callus induction rate The callus induction rate of different rice varieties was examined using the method described in Example 3. The effects of various concentrations of the hormones 2,4-dichlorophenoxyacetic acid (2,4-D) and 6-benzylaminopurine (BAP) on callus induction rate were investigated.

[0256] Four different rice varieties were tested: TH3-5, Truong Giang, MHC2, and Ha Phat3. Callus was induced as described in step 1 of Example 3. The concentrations of 2,4-D and BAP tested in rice callus induction medium are summarized in Table 12 below. Callus was efficiently generated from all four rice varieties, as shown in Figure 2. Medium containing 2 mg / L 2,4-D and 0.1 mg / L BAP produced the highest induction rate. [Table 13]

[0257] Additionally, callus induction rates in five rice cultivars (Java long, Se Zic, Agostano, Hunan, and Dichroa) were tested. Figure 3a shows the germination rate for each rice cultivar, and Figure 3b shows the percentage of callus induction. These data indicate that callus can be generated from all cultivars tested. Figure 3c shows that shoot development from these induced calli can also occur in all cultivars tested. These data indicate the utility of the callus induction method for a variety of plant cultivars.

[0258] Callus induction rates were also measured for rice cultivar "Hayayuki." Callus was induced as described in step 1 of Example 3. The concentrations of 2,4-D and BAP tested in rice callus induction medium are summarized in Table 13 below. Figure 4 shows that all of the treatments tested resulted in callus induction of Hayayuki. The combination of 3 mg / L 2,4-D and 0.1 mg / L BAP produced the highest induction rate. [Table 14]

[0259] Example 4 - Analysis of regenerated modified plants The modified plants generated in Example 2 were analyzed using qRT-PCT to determine the expression levels of specific genes compared to wild-type plants.

[0260] RNA extraction Root (5-10 mg) and shoot (approximately 15 mg) tissues were collected from plants regenerated from experiment 1 of Example 2, flash frozen in liquid nitrogen, and stored at -80°C until required. In addition, samples were collected that contained tissue from whole modified plants regenerated from experiment 2 of Example 2. These samples contained primarily leaf tissue.

[0261] These samples were then ground in a mortar and pestle using liquid nitrogen. Total RNA was extracted using the GeneJet Plant RNA Purification Kit or the Qiagen Plant RNEasy Kit according to the manufacturer's protocol. The concentration of RNA was analyzed using a NanoDrop OneC microvolume UV-Visible spectrophotometer. All extracted RNA with a 260 / 230 ratio greater than 2.0 (2.01-2.14) was used for downstream processing. DNA was removed from the samples by treatment with RQ1 RNase-free DNase at 37°C for 30 min. DNase was then inactivated by incubating the mixture at 65°C for 10 min.

[0262] qRT-PCR analysis qRT-PCR was used to analyze gene expression of various salt tolerance genes in the engineered plants. Two sets of probe / dye sets were tested. Both sets contained a fifth primer / probe for the housekeeping gene actin to serve as a control. Set 1: NHX1, SOS1, AHA3, and HKT1 Set 2: VHA-A, SOS2, SODA1, and SOD2 / SODCC1

[0263] The probes bound to each gene were: FAM: NHX1 and VHA-A; SUN: SOS1 and SOS2; ROX: AHA3 and SODA1; and Cy5': HKT1, SODCC1, and SOD2. 12.5 μl of iTaq reaction mixture, 0.5 μl of iScript reverse, 5×1 μl of each of the forward and reverse primers for each gene of interest (as presented in Table X), 5×0.8 μl of fluorescent probe, and 1 μl of RNA were placed in the PCR machine for the following cycles: 1 cycle of 50° C. for 30 minutes, 1 cycle of 94° C. for 2 minutes, 40 cycles of 94° C. for 15 seconds, 59° C. for 15 seconds, 68° C. for 15 seconds, and 1 cycle of 68° C. for 5 minutes. The primers used for each gene of interest were: NHX1 TGCAATTGGAGCCATCTTTTCTGCG (SEQ ID NO: 50) VHA-A AATGCCTGCGGATAGTGGTTACCC (SEQ ID NO:51) SOS1 TGTTACATTCCCTCAGGTGCTTCGTG (SEQ ID NO: 52) SOS2 TGTCACCAGCAACCTTTCGAACATCA (SEQ ID NO: 53) AHA3 TGGCAATTGGAAAAGAAACAGGGCG (SEQ ID NO:54) HKT1 TGGGAATGTAGGGCTATCCACTGGT (SEQ ID NO: 55) SODA1 CCAAAATCCTCATCAATGGCCCAGC (SEQ ID NO: 56) SODCC1 ACTGGGCCACACTACAATCCTGC (SEQ ID NO: 57) SOD2 ACTACAACTCACAGGATGCAGCAGC (SEQ ID NO: 58)

[0264] The fluorescence of the probes was analyzed using Bio-Rad CFX Maestro software. The relative transcript abundance of genes in regenerated independent event rice plants was analyzed compared to Cq values ​​in wild type plants. All reactions were performed using two technical replicates per sample. First, transcript levels were analyzed relative to actin and / or 25S ribosomal RNA (25S rRNA) housekeeping genes with a design based on the rice genome sequence to obtain ΔCt values. Then, the relative fold change gene expression in regenerated independent event rice was analyzed compared to wild type by calculating ΔΔCt values.

[0265] Figures 5a and 5b show that the RNA expression levels of NHX1, SOS1, HKT1, and SODA1 in either shoots or roots of modified rice were significantly higher than that of wild-type rice. These data indicate that the RNA expression levels of NHX1, SOS1, HKT1, and SODA1 are increased compared to wild-type plants. The expression levels of the genes of interest differed between roots and shoots. For example, NHX1 had a higher level of expression in leaves compared to roots.

[0266] Figures 9a, 9b, and 9c show RNA expression levels of NHX1, SOS1, AHA3, HKT1, VHA-A, SOS2, SODA1, SOD2, and SODCC1 in tissues obtained from whole modified plants. These data show that these genes were differentially expressed in modified plants compared to wild-type plants. This difference is further evaluated in the scatter plots of Figures 10a-10j. The change in expression of these genes between different modified plants seen in Figures 9 and 10 may be due to differences in the types of tissues collected from each modified plant. As mentioned above, expression of the gene of interest may vary spatially throughout the plant. For example, HKT1 is expressed only within the vascular structures of the plant, and therefore, if the sample collected does not contain vascular structures, little to no HKT1 expression will be observed. In many modified plants tested, expression of SOD2 is reduced. A possible reason for this reduced expression may be that the wild-type plants used as controls were of different ages compared to the modified plants.

[0267] Example 5 - Salt tolerance of modified plants The salt tolerance of the modified plants of Example 2 was tested by initially partially immersing the roots of seedlings or plants in hydroponic medium containing 0 g salts. [Table 15]

[0268] The salt concentration of the hydroponic medium was then increased stepwise up to 45 g / L, a full marine salt concentration. The stepwise changes in salt concentration and the intervals between each change could be subject to modification depending on the performance of the cultivar. The growth rate of both shoots and roots was monitored, and the overall health of the plants and leaf color were analyzed. [Table 16]

[0269] Example 6 - Salt tolerance of modified plants The salt tolerance of the modified plants of Example 2 was tested by growing the plants in a medium supplemented with sodium chloride. The modified plants A, B, C, D, E1, F, G, H, and I of Example 2 were directly placed on RRMII medium supplemented with 8 g / L NaCl, which was then increased to 16 g / L. The modified plants continued to grow under such high salt conditions. Wild-type plants were placed on MS medium supplemented with 2 g / L NaCl, which was initially. The salt concentration was increased by 2 g / L every 2 days until 10 g / L NaCl was reached. [Table 17]

[0270] Figure 11 presents images of modified and wild-type plants on the last day of the experiment. The images in Figure 11 show that all wild-type plants show significant yellowing of at least half of the leaves, starting at the tip of the leaf and often spreading throughout the entire length of the leaf. This yellowing is not observed in modified plants. Inserting an enhancer element operably linked to the gene of interest allows the modified plants to tolerate higher concentrations of salt without showing signs of physical stress. The data show that modified plants according to the invention have increased salt tolerance compared to wild-type plants.

[0271] Some of the modified plants appear white (A&H). These plants display this color throughout their life cycle after regeneration. Without wishing to be bound by any particular theory, we hypothesize that this is due to a substantial increase in gene expression that causes a reduction in chlorophyll production. These plants still behave similarly to their green counterparts.

[0272] The wild-type control shows a significant reduction in the amount of roots and leaves. These structures are also thin and unable to support the weight of the plant on their own. These characteristics indicate that increased salinity is affecting the health of the wild-type plants. In contrast, the modified plants do not show these characteristics, further suggesting that the edits made to the genome not only allow the plants to survive, but also to survive in highly saline environments where wild-type rice cannot grow. This improvement is seen in multiple rice varieties, indicating that the inventors' design can be applied to a variety of rice varieties.

[0273] Overall, these data indicate that plants that have been engineered to have an enhancer element operably linked to a specific gene of interest are capable of growing in high salinity, thereby exhibiting improved salt tolerance compared to wild-type plants.

[0274] Example 7 - Improved design of gene inserts To improve editing efficiency and minimize the amount of DNA needed to make a good edit, the design of the gene insert was modified. The main focus of this improved design is to use Cpf1 (Cas12a) to make a nick within the genomic sequence where Cas9 was previously used. Cas9 makes a blunt-end cut that requires a large homology arm (~125 bases including the gene insert) to efficiently edit and insert any amount of DNA into the genomic sequence, and this entire section of DNA is incorporated into the plant, resulting in an edit of ~120 base pairs per gene. In comparison, Cpf1 uses a staggered cut to make a nick 19 base pairs after the PAM site on the sense strand and 23 base pairs after the PAM site on the antisense strand, as shown in Figure 1. Cpf1 editing does not require homology arms, instead relying on a 4-5 base pair overhang, which can be seen in bold in Figure 1.

[0275] These overhangs were included at the ends of the gene inserts to allow for smaller pieces of DNA to be integrated into the genome using the sequences in Figure 6. Editing sites were designed to change only the expression intensity and location pattern so that the normal function of the genes is not altered. In this updated design, the genes of interest VHA-A, SOS2, AHA3, and SODA1 have all been converted to accommodate Cpf1 instead of Cas9. The updated guide RNAs (gRNAs), and the updated forward and reverse insert sequences with associated overhang sequences are shown in Table 14 and Figure 6.

[0276] These data, combined with Example 1, show that a variety of nucleases can be used to integrate enhancer elements into the genome of plants. Cpf1 nuclease can be used to integrate enhancer elements into the genome, resulting in a more efficient method of generating modified plants. [Table 18]

[0277] Example 8 - Generation of modified callus Calli were generated as described in Example 3. These calli were bombarded with DNA inserts as described in Example 7 using Cpf1 nuclease only to make nicks in the genomic sequence. The four genes of interest (OsNHX1, OsVHA-A, OsSOS1 and OsSOS2) and DNA inserts targeting their sequences are provided in Figure 6. The OsSOS1 gene is operably linked to an enhancer element comprising SEQ ID NO: 12, the OsSOS2 gene is operably linked to an enhancer element comprising SEQ ID NO: 13, the OsVHA-A gene is operably linked to an enhancer element comprising SEQ ID NO: 11 and the OsNHX1 gene is operably linked to an enhancer element comprising SEQ ID NO: 10.

[0278] These four genes of interest were selected because they are most likely to be expressed in the callus, taking into account differences in physiology, hormones, and transcription factor abundance compared to the regenerated plant. This set of genes of interest was also selected so that they function synergistically to promote salt exclusion and partitioning within any plant cell, promoting salt tolerance.

[0279] Example 9 - Salt tolerance of callus The salt tolerance of the modified callus of Example 8 was tested by transferring the callus to rice callus induction medium supplemented with 2 g / L sodium chloride. Every two days, the callus was transferred to higher concentrations of salts. The concentrations tested are shown below. [Table 19]

[0280] The maximum sodium chloride concentration of 15 g / L is slightly less than 50% of the ocean salinity, so callus is not expected to perform optimally compared to the whole plant. However, callus that can grow at 15 g / L will have very high salt tolerance, far exceeding the tolerance of currently commercially used rice varieties and far exceeding the salinity of Mekong River rice paddies. Overall callus health, including growth rate; color; texture; and structural integrity, will also be recorded.

[0281] Figures 12a-c show that the modified calli were able to grow in medium that contained up to 15 g / L sodium chloride, whereas wild-type calli were unable to grow under the same conditions. Indicators of callus health included color (white / yellowish instead of black) and texture (brittle and not soft). The images in Figures 12a-c show that the modified calli generally appear whiter and have more defined edges than the WT, indicating that they are more resistant.

[0282] q-RT-PCR was performed on the modified calli as described in Example 4. Figure 13 shows gene expression of SOS1, SOS2, HKT1, NHX1, AHA-3, VHA-A, and SODA1 in the modified calli. Figure 13 shows that the majority of the modified calli have increased expression of SOS1, SOS2, HKT1, NHX1, AHA-3, VHA-A, and SODA1 when grown in 15 g / L sodium chloride, compared to wild-type calli. This difference is further evaluated in the scatter plots of Figures 15a-15o. These data indicate that the collision process efficiently incorporated enhancer elements into the plant genome, operably linked to the gene of interest, allowing the modified calli to grow under increased salt stress compared to the wild type.

[0283] In a previous study, rice callus was observed to show a sharp decrease in fresh weight at 8.7 g / L NaCl

[27] , and our transformed callus shows continued growth up to 15 g / L NaCl, thus observing a significant increase in callus salt tolerance. qRT PCR analysis was performed on wild-type callus harvested at 0, 2, 4, 6, 8, 10, 12.5, and 15 g / L NaCl. As seen in Figure 14, in the interval between 8 g / L and 10 g / L, there is a dramatic change in the expression of NHX1, OsAHA3, OsVHA-A, SODA1, SOS1, and SOS2, indicating a similar shift in the callus's inability to tolerate such high concentrations of NaCl. Overall, the data are similar to the physical characteristics observed in the literature for callus grown in saline.

[0284] Example 10 - Generation of genetic inserts in modified kale (Brassica oleracea) Gene inserts were designed to stably introduce enhancer elements into the kale genome using Cpf1 nuclease. These genes of interest encode various proteins with different functions, including plasma membrane ion transporters, plasma membrane hydrogen transporting ATPase, tonoplast hydrogen transporting ATPase, tonoplast ion transporters, potassium transporters, protein kinases, and antioxidants. [Table 20-1] [Table 20-2]

[0285] Example 11 - Genome sequencing of modified plants To determine whether the gene of interest was efficiently introduced into the plant after bombardment, the genomic DNA of the modified plants generated in Example 2 was sequenced.

[0286] Genomic DNA was isolated and purified using the Wizard® Genomic DNA Purification Kit. Briefly, 40 mg of primary material was harvested from the target plants. Leaf tissue was frozen in liquid nitrogen and ground to a fine powder using a pestle and mortar. 600 μl of Nuclei Lysis Solution was added to the sample and vortexed for 1-3 seconds. The sample was then incubated at 65°C for 15 minutes. 3 μl of RNase solution was added to the cell lysate and mixed by inverting the tube 2-5 times. The mixture was incubated at 37°C for 15 minutes. The sample was cooled at room temperature for 5 minutes, after which 200 μl of Protein Precipitation Solution was added. The sample was vortexed vigorously at high speed for 20 seconds and centrifuged at 13,000-16,000xg for 3 minutes. The precipitated proteins formed a tight pellet. The supernatant was transferred to a tube containing 600 μl of room temperature isopropanol. The samples were mixed by inverting the tubes and then centrifuged at 13,000–16,000 × g for 1 min at room temperature. 600 μl of room temperature 70% ethanol was added and the tubes were gently inverted several times to wash the DNA. The samples were then centrifuged at 13,000–16,000 × g for 1 min at room temperature. The ethanol was removed and the pellet containing the DNA was air-dried for 15 min. 100 μl of DNA rehydration solution was added and the samples were incubated at 65 °C for 1 h. The concentration of each DNA sample was measured using a Nanodrop spectrophotometer. The resulting DNA was sequenced at Eurofins Genomics lab.

[0287] Example 12 - Stable inheritance of salt tolerance in engineering plants Modified rice varieties Hayayuki and Truong Giang were generated as described in Example 2. These modified rice plants contained the following genes of interest: OsNHX1, OsVHA-A, OsSOS1, OsSOS2, OsAHA3, OsHKT1, and either OsSODA1 or OsSOD2, each gene of interest operably linked to an enhancer element. These modified rice plants were grown to maturity to produce seeds. Figures 16a-e are images of these modified rice plants showing the panicles and seeds.

[0288] Seeds were collected from these three plants (Hayayuki 1, Hayyuki 2, and Truong Giang) and germinated into seedlings. As performed in Example 4, gene expression in the leaves of the progeny plants was analyzed using qRT-PCR to observe whether salt tolerance was efficiently inherited.

[0289] Seedlings 13 and 14 are two seedlings grown from seeds collected from Hayayuki plant 1. Figure 17 shows that the RNA expression levels of OsNHX1, OsVHA-A, OsSOS1, OsSOS2, OsAHA3, OsSODA1, SODCC1, and OsSOD2 in these seedlings were significantly higher compared to wild-type rice. These data indicate that these genes were differentially expressed in the progeny compared to wild-type plants. This difference is further evaluated in the scatter plot presented in Figure 18. The gene expression observed in the two seedlings is similar to that observed in the parent plant (Hayayuki 1) and other modified rice plants according to the present invention. These data indicate that the salt tolerance trait transformed into the modified plants of the present invention is efficiently inherited.

[0290] The present invention provides the following numbered embodiments:

[0291] 1. A transgenic plant comprising at least two introduced genes, the at least two introduced genes comprising a introduced gene encoding a protein that controls intracellular ion concentrations and a introduced gene encoding an antioxidant.

[0292] 2. The transgenic plant according to embodiment 1, wherein the protein that controls intracellular ion concentrations is an ion transporter, a hydrogen-transporting ATPase, a hydrogen-transporting pyrophosphatase, or a protein kinase.

[0293] 3. The transgenic plant of embodiment 2, wherein the ion transporter, hydrogen transporting ATPase, and / or hydrogen transporting pyrophosphatase is a plasma membrane ion transporter, plasma membrane hydrogen transporting ATPase, and / or plasma membrane hydrogen transporting pyrophosphatase.

[0294] 4. The transgenic plant according to embodiment 3, wherein the plasma membrane ion transporter is SOS1 and / or the plasma membrane hydrogen transporting ATPase is AHA3.

[0295] 5. (a) SOS1 is OsSOS1, and optionally the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 95 and / or 96; and / or (b) The transgenic plant of embodiment 4, wherein AHA3 is OsAHA3, and optionally, the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:101.

[0296] 6. The transgenic plant of embodiment 2, wherein the ion transporter, hydrogen transporting ATPase, and / or hydrogen transporting pyrophosphatase is a tonoplast ion transporter, tonoplast hydrogen transporting ATPase, and / or tonoplast hydrogen transporting pyrophosphatase. 7. (a) the vacuolar membrane ion transporter is NHX1, and / or (b) The transgenic plant of embodiment 6, wherein the tonoplast hydrogen transport ATPase is VHA-A.

[0297] 8. (a) NHX1 is OsNHX1, and optionally, the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 97 and / or 98; and / or (b) The transgenic plant of embodiment 7, wherein VHA-A is OsVHA-A, and optionally, the OsVHA-A transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 102.

[0298] 9. The transgenic plant of any one of embodiments 2 to 8, wherein the protein kinase is a serine / threonine kinase, optionally, the serine / threonine kinase is SOS2.

[0299] 10. The transgenic plant of embodiment 9, wherein SOS2 is OsSOS2, and optionally, the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:100.

[0300] 11. A transgenic plant according to any one of embodiments 1 to 10, wherein the antioxidant is a mitochondrial antioxidant or a cytoplasmic antioxidant.

[0301] 12. A transgenic plant according to any one of the preceding embodiments, wherein the transgenic plant comprises at least two transgenes encoding antioxidants.

[0302] 13. The transgenic plant of embodiment 12, wherein the antioxidants include mitochondrial antioxidants and cytoplasmic antioxidants.

[0303] 14. A transgenic plant according to any one of the preceding embodiments, wherein the transgenic plant comprises at least three transgenes encoding antioxidants.

[0304] 15. The transgenic plant of any one of embodiments 1 to 14, wherein the antioxidant(s) comprises SODA1, SOD2, and / or SODCC1.

[0305] 16. (a) SODA1 is OsSODA1, and optionally, the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 92; and / or (b) the SOD2 is OsSOD2, and optionally the OsSOD2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:93; and / or (c) The transgenic plant of embodiment 15, wherein SODCC1 is OsSODCC1, and optionally, the OsSODCC1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:94.

[0306] 17. A transgenic plant comprising at least two introduced genes, the at least two introduced genes comprising a introduced gene encoding a cell membrane protein that controls intracellular ion concentrations, and a introduced gene encoding a tonoplast protein that controls intracellular ion concentrations.

[0307] 18. A transgenic plant according to embodiment 17, wherein the plasma membrane protein that controls intracellular ion concentrations is a plasma membrane ion transporter, a plasma membrane hydrogen transporting ATPase, or a plasma membrane hydrogen transporting pyrophosphatase, and optionally, the plasma membrane ion transporter is SOS1 and / or the plasma membrane hydrogen transporting ATPase is AHA3.

[0308] 19. (a) SOS1 is OsSOS1, and optionally the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 95 and / or 96; and / or (b) The transgenic plant of embodiment 18, wherein AHA3 is OsAHA3, and optionally, the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 101.

[0309] 20. A transgenic plant according to any one of embodiments 17 to 19, wherein the tonoplast protein that controls the intracellular ion concentration is a tonoplast ion transporter, a tonoplast hydrogen transport ATPase, or a tonoplast hydrogen transport pyrophosphatase.

[0310] 21. The transgenic plant according to embodiment 20, wherein the tonoplast ion transporter is NHX1 and / or the tonoplast hydrogen transporting ATPase is VHA-A.

[0311] 22. (a) NHX1 is OsNHX1, and optionally, the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 97 and / or 98; and / or (b) The transgenic plant of embodiment 21, wherein VHA-A is OsVHA-A, and optionally, the OsVHA-A transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 102.

[0312] 23. A transgenic plant according to any one of embodiments 17 to 22, wherein the transgenic plant further comprises a transgene encoding a protein kinase and / or a transgene encoding an antioxidant.

[0313] 24. The transgenic plant of embodiment 23, wherein the protein kinase is a phospho / threonine kinase, and optionally, the serine / threonine kinase is SOS2.

[0314] 25. The transgenic plant of embodiment 24, wherein SOS2 is OsSOS2, and optionally, the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 100.

[0315] 26. A transgenic plant according to any one of embodiments 23 to 25, wherein the antioxidant is a mitochondrial antioxidant or a cytoplasmic antioxidant.

[0316] 27. A transgenic plant according to any one of embodiments 23 to 26, wherein the antioxidant comprises any one of SODA1, SOD2, and SODCC1.

[0317] 28. (a) SODA1 is OsSODA1, and optionally, the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 92; and / or (b) the SOD2 is OsSOD2, and optionally the OsSOD2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:93; and / or (c) The transgenic plant of embodiment 27, wherein SODCC1 is OsSODCC1, and optionally, the OsSODCC1 introduced gene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:94.

[0318] 29. A transgenic plant, comprising at least three introduced genes, wherein the transgenic plant has increased salt tolerance compared to a plant of the same species lacking said genomic modification.

[0319] 30. A transgenic plant comprising at least three introduced genes, the at least three introduced genes comprising a introduced gene encoding a cell membrane protein that controls intracellular ion concentrations, a introduced gene encoding a tonoplast protein that controls intracellular ion concentrations, and a introduced gene encoding an antioxidant.

[0320] 31. A transgenic plant according to embodiment 30, wherein the plasma membrane protein and / or vacuolar membrane protein that controls intracellular ion concentrations is an ion transporter, a hydrogen-transporting ATPase, or a hydrogen-transporting pyrophosphatase.

[0321] 32. The transgenic plant of embodiment 30 or embodiment 31, wherein the transgenic plant further comprises a transgene encoding a protein kinase.

[0322] 33. The transgenic plant of embodiment 32, wherein the protein kinase is a phospho / threonine kinase, and optionally the serine / threonine kinase is SOS2.

[0323] 34. A transgenic rice plant, comprising at least four transgenes, the at least four transgenes comprising transgenes encoding OsSOS1, OsNHX1, OsHKT1, and OsSODA1.

[0324] 35. A transgenic rice plant comprising at least four transgenes, the at least four transgenes comprising transgenes encoding OsSOS1, OsNHX1, OsHKT1, and OsSODA1, wherein the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 95 and / or 96; the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 97 and / or 98; the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 99; and the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 92.

[0325] 36. The transgenic plant comprises at least seven transgenes, and the at least seven transgenes are (a) a transgene encoding a plasma membrane ion transporter; (b) a transgene encoding a plasma membrane hydrogen transport ATPase; (c) a transgene encoding a protein kinase (d) A transgene encoding a vacuolar hydrogen transport ATPase (e) A transgene encoding a vacuolar sodium / proton transporter (f) a transgene encoding a potassium transporter, and (g) a transgene encoding an antioxidant; 36. A transgenic plant according to any one of embodiments 1 to 35, comprising:

[0326] 37. The transgenic plant comprises at least eight transgenes, and the at least eight transgenes are (a) a transgene encoding a plasma membrane ion transporter; (b) a transgene encoding a plasma membrane hydrogen transport ATPase; (c) a transgene encoding a protein kinase (d) A transgene encoding a vacuolar hydrogen transport ATPase (e) A transgene encoding a vacuolar sodium / proton transporter (f) a transgene encoding a potassium transporter, and (g) a transgene encoding a first antioxidant and a second antioxidant; 37. A transgenic plant according to any one of embodiments 1 to 36, comprising:

[0327] 38.(a) the cell membrane ion transporter is SOS1; and / or (b) the plasma membrane hydrogen transport ATPase is AHA3; and / or (c) the protein kinase is SOS2; and / or (d) the vacuolar hydrogen transport ATPase is VHA-A; and / or (e) the vacuolar ion transporter is NHX1; and / or (f) the potassium transporter is HKT1, and / or (g) A transgenic plant according to any one of embodiments 36 to 37, wherein the first and second antioxidants are SODA1, SOD2, and / or SODCC1.

[0328] 39. (a) SOS1 is OsSOS1, and optionally the OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 95 and / or 96; and / or (b) AHA3 is OsAHA3, and optionally, the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 101; and / or (c) SOS2 is OsSOS2, and optionally the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 100; and / or (d) the VHA-A is OsVHA-A, and optionally the OsVHA-A transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 102; and / or (e) NHX1 is OsNHX1, and optionally the OsNHX1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 97 and / or 98; and / or (f) HKT1 is OsHKT1, and optionally the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:99; (g) SODA1 is OsSODA1, and optionally, the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:92; and / or (h) the SOD2 is OsSOD2, and optionally the OsSOD2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:93; and / or (i) The transgenic plant described in embodiment 38, wherein SODCC1 is OsSODCC1, and optionally, the OsSODCC1 introduced gene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:94.

[0329] 40. A transgenic rice plant, comprising at least eight transgenes, the at least eight transgenes comprising transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2.

[0330] 41. A transgenic rice plant, comprising at least eight transgenes, the at least eight transgenes comprising transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2; The OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:95 and / or 96; the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:100; the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:101; the OsVHA-A transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:102; the OsNH A transgenic rice plant, wherein the X1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:97 and / or 98; the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:99; the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:92; and the OsSOD2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:93.

[0331] 42. A transgenic rice plant, comprising at least eight transgenes, the at least eight transgenes comprising transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSODCC1.

[0332] 43. A transgenic rice plant, comprising at least eight transgenes, the at least eight transgenes comprising transgenes encoding OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSODCC1; The OsSOS1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:95 and / or 96; the OsSOS2 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:100; the OsAHA3 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:101; the OsVHA-A transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:102; the OsNHX A transgenic rice plant, wherein: the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:97 and / or 98; the OsHKT1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:99; the OsSODA1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:92; and the OsSODCC1 transgene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:94.

[0333] 44. The transgenic plant further comprises at least one additional transgene, wherein the at least one additional transgene is (a) cytochrome p450 (P450), and / or (b) an oxygen-evolving complex, and / or (c) sucrose phosphate synthase, and / or (d) pyrroline carboxylate synthase 3. The transgenic animal of any one of the preceding embodiments, wherein the transgenic animal encodes a protein which is

[0334] 45. A transgenic plant according to embodiment 44, wherein the oxygen-evolving complex is formed from the proteins PsbO, PsbP and PsbQ.

[0335] 46. ​​A transgenic plant according to embodiment 44 or embodiment 45, wherein the oxygen-evolving complex is formed from the proteins PsbO, PsbP, PsbQ, PsbU and PsbV.

[0336] 47. The transgenic plant of any one of embodiments 44-46, wherein the sucrose phosphate synthase is sucrose phosphate synthase 1, sucrose phosphate synthase 2, or sucrose phosphate synthase 3.

[0337] 48. A transgenic plant according to any one of embodiments 44 to 47, wherein the pyrroline carboxylate synthase is delta-1-pyrroline-5-carboxylate synthase 1 or delta-1-pyrroline-5-carboxylate synthase 2.

[0338] 49. The transgenic plant of any one of the preceding embodiments, wherein the transgenic plant further comprises a transgene encoding OSK1.

[0339] 50. The transgenic plant of any one of the preceding embodiments, wherein the transgenic plant does not contain a transgene encoding PERK13.

[0340] 51. A transgenic plant according to any one of the preceding embodiments, wherein at least one of the transgenes is operably linked to at least one promoter, and optionally, all of the transgenes are operably linked to at least one promoter.

[0341] 52. The transgenic plant of embodiment 51, wherein at least one promoter comprises at least 10, at least 20, or at least 30 nucleotides.

[0342] 53. A transgenic plant according to embodiment 51 or embodiment 52, wherein at least one promoter is within 150 to 500 nucleotides of the 5' end of the open reading frame of the transgene.

[0343] 54. A transgenic plant according to any one of embodiments 51 to 53, wherein at least one promoter is a root-specific promoter, and optionally, all of the transgenes are operably linked to a root-specific promoter.

[0344] 55. A transgenic plant according to any one of embodiments 51 to 54, wherein at least one promoter comprises a DREB2A, gibberellin, ethylene, or auxin promoter sequence, or a combination thereof, and optionally, all of the transgenes are operably linked to a promoter comprising a DREB2A, gibberellin, ethylene, or auxin promoter sequence, or a combination thereof.

[0345] 56. A transgenic plant according to any one of embodiments 51 to 55, wherein at least one promoter comprises at least 6 nucleotides of a promoter element derived from a DREB2A, gibberellin, ethylene, or auxin promoter sequence, or a combination thereof, and optionally, all of the transgenes are operably linked to a promoter comprising a promoter element derived from a DREB2A, gibberellin, ethylene, or auxin promoter sequence.

[0346] 57. A transgenic plant according to any one of embodiments 51 to 56, wherein at least one promoter comprises a TAF-1, TATA, E2F, G-BOX, or CAAT promoter sequence, or a combination thereof, and optionally, all of the transgenes are operably linked to a promoter comprising a TAF-1, TATA, E2F, G-BOX, or CAAT promoter sequence.

[0347] 58. A transgenic plant according to any one of embodiments 51 to 57, wherein at least one promoter comprises a sequence having at least 95% sequence identity with any one of SEQ ID NOs: 10 to 18.

[0348] 59. A transgenic plant according to any one of the preceding embodiments, wherein each transgene encodes a distinct protein.

[0349] 60. The transgenic plant of any one of the preceding embodiments, wherein the transgenic plant is an angiosperm.

[0350] 61. The transgenic plant of embodiment 60, wherein the transgenic plant is a monocotyledonous or dicotyledonous plant.

[0351] 62. The transgenic plant of embodiment 60 or embodiment 61, wherein the transgenic plant is a cereal.

[0352] 63. The transgenic plant of embodiment 62, wherein the transgenic plant is corn, rice, soybean, sugarcane, mung bean, quinoa, barley, oat, rye, sorghum, or wheat.

[0353] 64. A transgenic plant according to any one of embodiments 60 to 63, wherein the transgenic plant is a transgenic rice.

[0354] 65. The transgenic plant of embodiment 60 or embodiment 61, wherein the transgenic plant is a vegetable crop.

[0355] 66. The transgenic plant of embodiment 65, wherein the transgenic plant is from the genus Brassica, Glycine, or Soja.

[0356] 67. A plant part of a transgenic plant according to any one of embodiments 1 to 66.

[0357] 68. The plant part of embodiment 67, wherein the plant part is a cell, a seed, a leaf, a shoot, a stem, or a root.

[0358] 69. The plant part of embodiment 68, wherein the plant part is a seed.

[0359] 70. The plant part of embodiment 68, wherein the plant part is a cell.

[0360] 71. A multicellular structure comprising one or more plant cells according to embodiment 70.

[0361] 72. The multicellular structure of embodiment 71, wherein the multicellular structure is a callus.

[0362] 73. A method for producing a transgenic plant, plant part, or multicellular structure according to any one of embodiments 1 to 72, comprising: i) introducing at least two transgenes as defined in the transgenic plant according to embodiments 1 to 66 into a cell of the plant (the transgenes are integrated into the genome of the cell of the plant); and ii) regenerating the cells to form a transgenic plant, plant part, or multicellular structure from the cells. A method comprising:

[0363] 74. The method of embodiment 73, wherein the transgene is introduced into the cell by particle bombardment, Agrobacterium-mediated transformation, or protoplast transfection.

[0364] 75. The method according to any one of embodiments 73-74, wherein the method comprises: (a) inducing callus formation from seeds; (b) precipitating a polynucleotide sequence, a guide RNA, and a nuclease onto a microcarrier, wherein the polynucleotide sequence comprises at least two transgenes defined according to any one of embodiments 1 to 72; (c) transforming the callus with the microcarrier using particle bombardment to produce transformed callus, wherein the polynucleotide sequence is integrated into the genome of the transgenic plant, plant part, or multicellular structure; (d) harvesting the transformed callus to produce a multicellular structure according to embodiment 71 or embodiment 72. A method comprising:

[0365] 76. The method of embodiment 75, wherein the multicellular structure is regenerated into a transgenic plant.

[0366] 77. The method of embodiment 75 or embodiment 76, wherein the polynucleotide sequence is stably integrated into the genome of the plant.

[0367] 78. The method of any one of embodiments 75 to 77, wherein the nuclease is a Cas nuclease, a Cpf1 nuclease, a TALEN, or a zinc finger nuclease, optionally wherein the nuclease is Cas9 or Cpf1.

[0368] 79. The method of any one of embodiments 75 to 78, wherein the polynucleotide is RNA, DNA, or a plasmid, optionally, the polynucleotide is DNA.

[0369] 80. The transgenic plant, plant part, or multicellular structure of any one of embodiments 1 to 72, wherein the transgenic plant, plant part, or multicellular structure is not produced by a process involving homologous recombination and / or is not produced by an essentially biological process.

[0370] 81. A method for producing flour, whole grain, starch, or other products obtained from seeds according to embodiment 69.

[0371] 82. Use of a transgenic plant according to any one of embodiments 1 to 66, a plant part according to any one of embodiments 67 to 70, or a multicellular structure according to embodiment 71 or embodiment 72 as animal feed or for producing feed for animal consumption or food for human consumption.

[0372] 83. A transgenic plant as defined in any preceding embodiment, wherein one or more of the introduced genes is replaced with a corresponding gene of interest operably linked to an enhancer element as disclosed herein, and optionally, as disclosed in any of the following embodiments.

[0373] The invention also provides the following numbered embodiments:

[0374] 1. A modified plant comprising at least two genes of interest, the genes of interest comprising a gene encoding a protein that controls an intracellular ion concentration and a gene encoding an antioxidant, the gene encoding the protein that controls an intracellular ion concentration being operably linked to an enhancer element, and the gene encoding the antioxidant being operably linked to an enhancer element.

[0375] 2. The modified plant according to embodiment 1, wherein the protein that controls the intracellular ion concentration is an ion transporter, a hydrogen-transporting ATPase, a hydrogen-transporting pyrophosphatase, or a protein kinase.

[0376] 3. The modified plant of embodiment 2, wherein the ion transporter, hydrogen transporting ATPase, and / or hydrogen transporting pyrophosphatase is a plasma membrane ion transporter, plasma membrane hydrogen transporting ATPase, and / or plasma membrane hydrogen transporting pyrophosphatase.

[0377] 4. The modified plant according to embodiment 3, wherein the plasma membrane ion transporter is SOS1 and / or the plasma membrane hydrogen transporting ATPase is AHA3.

[0378] 5. (a) SOS1 is OsSOS1, and optionally the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; and / or (b) The modified plant of embodiment 4, wherein AHA3 is OsAHA3, and optionally, the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 101.

[0379] 6. The modified plant of embodiment 2, wherein the ion transporter, hydrogen transporting ATPase, and / or hydrogen transporting pyrophosphatase is a tonoplast ion transporter, tonoplast hydrogen transporting ATPase, and / or tonoplast hydrogen transporting pyrophosphatase.

[0380] 7. (a) the vacuolar membrane ion transporter is NHX1, and / or (b) The modified plant of embodiment 6, wherein the tonoplast hydrogen transport ATPase is VHA-A.

[0381] 8. (a) NHX1 is OsNHX1, and optionally, the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; and / or (b) The modified plant of embodiment 7, wherein VHA-A is OsVHA-A, and optionally, the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102.

[0382] 9. The modified plant of any one of embodiments 2 to 8, wherein the protein kinase is a serine / threonine kinase, and optionally, the serine / threonine kinase is SOS2.

[0383] 10. The modified plant of embodiment 9, wherein SOS2 is OsSOS2, and optionally, the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100.

[0384] 11. The modified plant of any one of embodiments 1 to 10, wherein the antioxidant is a mitochondrial antioxidant or a cytoplasmic antioxidant.

[0385] 12. The modified plant of any one of embodiments 1 to 11, wherein the modified plant comprises at least two genes of interest encoding antioxidants.

[0386] 13. The modified plant of embodiment 12, wherein the antioxidants comprise mitochondrial antioxidants and cytoplasmic antioxidants.

[0387] 14. The modified plant of any one of embodiments 1 to 13, wherein the modified plant comprises at least three genes encoding antioxidants.

[0388] 15. The modified plant of any one of embodiments 1-14, wherein the antioxidant(s) comprises SODA1, SOD2, and / or SODCC1.

[0389] 16. (a) SODA1 is OsSODA1, and optionally, the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 92; and / or (b) the SOD2 is OsSOD2, and optionally the OsSOD2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:93; and / or (c) The modified plant of embodiment 15, wherein the SODCC1 is OsSODCC1, and optionally, the OsSODCC1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:94.

[0390] 17. A modified plant comprising at least two genes of interest, the genes of interest comprising a gene encoding a cell membrane protein that controls an intracellular ion concentration and a gene encoding a tonoplast protein that controls an intracellular ion concentration, the gene encoding the cell membrane protein that controls the intracellular ion concentration being operably linked to an enhancer element, and the gene encoding the tonoplast protein that controls the intracellular ion concentration being operably linked to an enhancer element.

[0391] 18. The modified plant of embodiment 17, wherein the cell membrane protein that controls the intracellular ion concentration is a cell membrane ion transporter, a cell membrane hydrogen transporting ATPase, or a cell membrane hydrogen transporting pyrophosphatase, and optionally, the cell membrane ion transporter is SOS1 and / or the cell membrane hydrogen transporting ATPase is AHA3.

[0392] 19. (a) SOS1 is OsSOS1, and optionally, the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; and / or (b) The modified plant of embodiment 18, wherein AHA3 is OsAHA3, and optionally, the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 101.

[0393] 20. A modified plant according to any one of embodiments 17 to 19, wherein the tonoplast protein that controls the intracellular ion concentration is a tonoplast ion transporter, a tonoplast hydrogen transport ATPase, or a tonoplast hydrogen transport pyrophosphatase.

[0394] 21. The modified plant according to embodiment 20, wherein the tonoplast ion transporter is NHX1 and / or the tonoplast hydrogen transporting ATPase is VHA-A.

[0395] 22. (a) NHX1 is OsNHX1, and optionally, the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; and / or (b) The modified plant of embodiment 21, wherein VHA-A is OsVHA-A, and optionally, the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102.

[0396] 23. The modified plant according to any one of embodiments 17 to 22, wherein the modified plant further comprises a gene encoding a protein kinase and / or a gene encoding an antioxidant.

[0397] 24. The modified plant of embodiment 23, wherein the protein kinase is a phospho / threonine kinase, and optionally the serine / threonine kinase is SOS2.

[0398] 25. The modified plant of embodiment 24, wherein SOS2 is OsSOS2, and optionally, the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100.

[0399] 26. The modified plant of any one of embodiments 23 to 25, wherein the antioxidant is a mitochondrial antioxidant or a cytoplasmic antioxidant.

[0400] 27. A modified plant according to any one of embodiments 23 to 26, wherein the antioxidant comprises any one of SODA1, SOD2, and SODCC1. 28. (a) SODA1 is OsSODA1, and optionally, the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 92; and / or (b) the SOD2 is OsSOD2, and optionally the OsSOD2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:93; and / or (c) The modified plant of embodiment 27, wherein the SODCC1 is OsSODCC1, and optionally, the OsSODCC1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:94.

[0401] 29. A modified plant, comprising at least three genes of interest, each gene of interest operably linked to an enhancer element, wherein the modified plant has increased salt tolerance compared to a plant of the same species lacking the genomic modification.

[0402] 30. A modified plant, comprising at least three genes of interest, the genes of interest comprising a gene encoding a cell membrane protein that controls an intracellular ion concentration, a gene encoding a tonoplast protein that controls an intracellular ion concentration, and a gene encoding an antioxidant; A modified plant, in which a gene encoding a cell membrane protein that controls intracellular ion concentrations is operably linked to an enhancer element, a gene encoding a tonoplast protein that controls intracellular ion concentrations is operably linked to an enhancer element, and a gene encoding an antioxidant is operably linked to an enhancer element.

[0403] 31. The modified plant according to embodiment 30, wherein the plasma membrane protein and / or vacuolar membrane protein that controls intracellular ion concentrations is an ion transporter, a hydrogen-transporting ATPase, or a hydrogen-transporting pyrophosphatase.

[0404] 32. The modified plant of embodiment 30 or embodiment 31, wherein the modified plant further comprises a gene encoding a protein kinase.

[0405] 33. The modified plant of embodiment 32, wherein the protein kinase is a phospho / threonine kinase, and optionally the serine / threonine kinase is SOS2.

[0406] 34. A modified rice comprising at least four genes of interest, the at least four genes of interest encoding OsSOS1, OsNHX1, OsHKT1, and OsSODA1, each gene of interest being operably linked to an enhancer element.

[0407] 35. A modified rice plant, comprising at least four genes of interest, the at least four genes of interest encoding OsSOS1, OsNHX1, OsHKT1, and OsSODA1, wherein the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99; and the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 92, A modified rice plant, wherein a gene encoding OsSOS1 is operably linked to an enhancer element; a gene encoding OsNHX1 is operably linked to an enhancer element; a gene encoding OsHKT1 is operably linked to an enhancer element; and a gene encoding OsSODA1 is operably linked to an enhancer element.

[0408] 36. The modified plant comprises at least seven genes of interest, wherein the at least seven genes of interest are (a) a gene encoding a plasma membrane ion transporter, the gene encoding the plasma membrane ion transporter being operably linked to an enhancer element; (b) a gene encoding a plasma membrane hydrogen transport ATPase, the gene encoding the plasma membrane hydrogen transport ATPase being operably linked to an enhancer element; (c) a gene encoding a protein kinase, wherein the gene encoding the protein kinase is operably linked to an enhancer element; (d) a gene encoding a vacuolar hydrogen transport ATPase, the gene encoding the vacuolar hydrogen transport ATPase being operably linked to an enhancer element; (e) a gene encoding a vacuolar sodium / proton transporter, the gene encoding a vacuolar sodium / proton transporter being operably linked to an enhancer element; (f) a gene encoding a potassium transporter, the gene encoding the potassium transporter being operably linked to an enhancer element; and (g) a gene encoding an antioxidant, wherein the gene encoding the antioxidant is operably linked to an enhancer element. 36. The modified plant of any one of embodiments 1 to 35, comprising:

[0409] 37. The modified plant comprises at least eight genes of interest, and the at least eight genes of interest are (a) a gene encoding a plasma membrane ion transporter, the gene encoding the plasma membrane ion transporter being operably linked to an enhancer element; (b) a gene encoding a plasma membrane hydrogen transport ATPase, the gene encoding the plasma membrane hydrogen transport ATPase being operably linked to an enhancer element; (c) a gene encoding a protein kinase, wherein the gene encoding the protein kinase is operably linked to an enhancer element; (d) a gene encoding a vacuolar hydrogen transport ATPase, the gene encoding the vacuolar hydrogen transport ATPase being operably linked to an enhancer element; (e) a gene encoding a vacuolar sodium / proton transporter, the gene encoding a vacuolar sodium / proton transporter being operably linked to an enhancer element; (f) a gene encoding a potassium transporter, wherein the gene encoding the potassium transporter is operably linked to an enhancer element; (g) a gene encoding a first antioxidant, wherein the gene encoding the first antioxidant is operably linked to an enhancer element; and (h) a gene encoding a second antioxidant, wherein the gene encoding the second antioxidant is operably linked to an enhancer element; 37. The modified plant of any one of embodiments 1 to 36, comprising:

[0410] 38.(a) the cell membrane ion transporter is SOS1; and / or (b) the plasma membrane hydrogen transport ATPase is AHA3; and / or (c) the protein kinase is SOS2; and / or (d) the vacuolar hydrogen transport ATPase is VHA-A; and / or (e) the vacuolar ion transporter is NHX1; and / or (f) the potassium transporter is HKT1, and / or (g) The modified plant of any one of embodiments 36 to 37, wherein the first and second antioxidants are SODA1, SOD2, and / or SODCC1.

[0411] 39. (a) SOS1 is OsSOS1, and optionally, the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; and / or (b) AHA3 is OsAHA3, and optionally, the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 101; and / or (c) SOS2 is OsSOS2, and optionally, the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100; and / or (d) VHA-A is OsVHA-A, and optionally the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102; and / or (e) NHX1 is OsNHX1, and optionally, the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; and / or (f) HKT1 is OsHKT1, and optionally, the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:99; (g) SODA1 is OsSODA1, and optionally, the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:92; and / or (h) SOD2 is OsSOD2, and optionally the OsSOD2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:93; and / or The modified plant of embodiment 38, wherein (i) the SODCC1 is OsSODCC1, and optionally the OsSODCC1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:94.

[0412] 40. A modified rice plant, comprising at least eight genes of interest...

Claims

1. A modified plant comprising at least four genes of interest, the genes of interest including a gene encoding a plasma membrane ion transporter and a gene encoding a vacuolar ion transporter, and the genes of interest further including two genes selected from the group consisting of genes encoding potassium transporters, hydrogen-transporting ATPases, protein kinases and / or antioxidants, each gene of interest being operably linked to an enhancer element, the enhancer element altering the expression level of the gene of interest compared to the expression level of the gene of interest in a wild-type plant.

2. (a) the at least four target genes encode OsSOS1, OsNHX1, OsHKT1, and OsSODA1, and optionally, the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:95 and / or 96, the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:97 and / or 98, the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:99, and the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO:92; or (b) the at least four genes of interest encode OsSOS1, OsNHX1, OsHKT1, and OsAHA3, and optionally, the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96, the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98, the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 99, and the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 101; or (c) the at least four genes of interest encode OsSOS1, OsNHX1, OsSOS2, and OsVHA-A, and optionally, the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96, the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98, the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100, and the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102; The modified plant of claim 1 .

3. The modified plant comprises at least seven genes of interest, and the at least seven genes of interest are (a) a gene encoding a plasma membrane ion transporter, wherein the gene encoding the plasma membrane ion transporter is operably linked to an enhancer element; (b) a gene encoding a plasma membrane hydrogen transport ATPase, wherein the gene encoding the plasma membrane hydrogen transport ATPase is operably linked to an enhancer element; (c) a gene encoding a protein kinase, wherein the gene encoding the protein kinase is operably linked to an enhancer element; (d) a gene encoding a vacuolar hydrogen transport ATPase, wherein the gene encoding the vacuolar hydrogen transport ATPase is operably linked to an enhancer element; (e) a gene encoding a vacuolar sodium / proton transporter, wherein the gene encoding the vacuolar sodium / proton transporter is operably linked to an enhancer element; (f) a gene encoding a potassium transporter, wherein the gene encoding the potassium transporter is operably linked to an enhancer element; and (g) a gene encoding an antioxidant, wherein the gene encoding the antioxidant is operably linked to an enhancer element; The modified plant of claim 1 .

4. The modified plant comprises at least eight genes of interest, and the at least eight genes of interest are (a) a gene encoding a plasma membrane ion transporter, wherein the gene encoding the plasma membrane ion transporter is operably linked to an enhancer element; (b) a gene encoding a plasma membrane hydrogen transport ATPase, wherein the gene encoding the plasma membrane hydrogen transport ATPase is operably linked to an enhancer element; (c) a gene encoding a protein kinase, wherein the gene encoding the protein kinase is operably linked to an enhancer element; (d) a gene encoding a vacuolar hydrogen transport ATPase, wherein the gene encoding the vacuolar hydrogen transport ATPase is operably linked to an enhancer element; (e) a gene encoding a vacuolar sodium / proton transporter, wherein the gene encoding the vacuolar sodium / proton transporter is operably linked to an enhancer element; (f) a gene encoding a potassium transporter, wherein the gene encoding the potassium transporter is operably linked to an enhancer element; (g) a gene encoding a first antioxidant, wherein the gene encoding the first antioxidant is operably linked to an enhancer element; (h) a gene encoding a second antioxidant, wherein the gene encoding the second antioxidant is operably linked to an enhancer element; The modified plant of claim 1 .

5. (a) the cell membrane ion transporter is SOS1, and / or (b) the plasma membrane hydrogen transport ATPase is AHA3, and / or (c) the protein kinase is SOS2, and / or (d) the vacuolar hydrogen transport ATPase is VHA-A, and / or (e) the vacuolar ion transporter is NHX1, and / or (f) the potassium transporter is HKT1, and / or (g) the antioxidant is SODA1, SOD2, and / or SODCC1; Optionally, (a) the SOS1 is OsSOS1, and optionally the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 95 and / or 96; and / or (b) the AHA3 is OsAHA3, and optionally, the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 101; and / or (c) the SOS2 is OsSOS2, and optionally the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 100; and / or (d) the VHA-A is OsVHA-A, and optionally, the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 102; and / or (e) the NHX1 is OsNHX1, and optionally, the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 97 and / or 98; and / or (f) the HKT1 is OsHKT1, and optionally, the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:99; (g) the SODA1 is OsSODA1, and optionally, the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:92; and / or (h) the SOD2 is OsSOD2, and optionally, the OsSOD2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:93; and / or (i) the SODCC1 is OsSODCC1, and optionally, the OsSODCC1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:94; The modified plant of claim 3 .

6. A modified rice plant, comprising at least eight genes of interest, wherein the at least eight genes of interest encode OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2 / OsSODCC1; the gene encoding OsSOS1 is operably linked to an enhancer element; the gene encoding OsSOS2 is operably linked to an enhancer element; the gene encoding OsAHA3 is operably linked to an enhancer element; the gene encoding OsVHA-A is operably linked to an enhancer element; the gene encoding OsNHX1 is operably linked to an enhancer element; the gene encoding OsHKT1 is operably linked to an enhancer element; the gene encoding OsSODA1 is operably linked to an enhancer element; and the genes encoding OsSOD2 / OsSODCC1 are operably linked to enhancer elements, Optionally, the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:95 and / or 96; the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:100; the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:101; the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:102; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:97 and / or 98; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:99; the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:92; and the OsSOD2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:93, or the OsSODCC1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:

94. The modified rice plant. (a) the enhancer elements have the same polynucleotide sequence, or the enhancer elements have different polynucleotide sequences; (b) in at least a portion of the plant during at least one developmental stage of the plant, the enhancer element increases or decreases the expression level of the gene of interest compared to the expression level of the gene of interest in a wild-type plant, and optionally, the enhancer element increases the expression level of the gene of interest compared to the expression level of the gene of interest in a wild-type plant; (c) the enhancer element alters the expression level of the gene of interest in roots, shoots, leaves, seeds, or stems, and optionally, the enhancer element alters the expression level of the gene of interest in roots; (d) the enhancer element alters the expression level of the gene of interest during germination, during plant growth, during plant flowering, and / or during plant fruiting; (e) the enhancer element comprises at least 10, at least 20, or at least 30 nucleotides; (f) the enhancer element is within 150 to 500 nucleotides of the 5' end of the open reading frame of the gene of interest; (g) the enhancer element comprises a root-specific promoter; (h) all of the genes of interest are operably linked to an enhancer element comprising a root-specific promoter; (i) the enhancer element comprises a promoter sequence of DREB2A, gibberellin, ethylene, or auxin, or a combination thereof, and optionally, all of the genes of interest are operably linked to an enhancer element comprising a promoter sequence of DREB2A, gibberellin, ethylene, or auxin, or a combination thereof; (j) the enhancer element comprises at least 6 nucleotides of a promoter element derived from a DREB2A, gibberellin, ethylene, or auxin promoter sequence, or a combination thereof, and optionally, all of the genes of interest are operably linked to an enhancer element comprising a promoter element derived from a DREB2A, gibberellin, ethylene, or auxin promoter sequence; (k) the enhancer element comprises a promoter sequence of TAF-1, TATA, E2F, G-BOX, or CAAT, or a combination thereof; (l) all of the target genes are operably linked to an enhancer element containing a promoter sequence of TAF-1, TATA, E2F, G-BOX, or CAAT; (m) the enhancer element comprises a sequence having at least 95% sequence identity to any one of SEQ ID NOs: 10-18; (n) each gene of interest encodes a distinct protein; and / or (o) the modified plant is an angiosperm, optionally, the modified plant is a monocotyledonous or dicotyledonous plant, and further optionally, (i) the modified plant is a cereal, optionally the modified plant is corn, rice, soybean, sugarcane, mung bean, quinoa, barley, oat, rye, sorghum, or wheat, and further optionally the modified plant is a modified rice plant; or (ii) the modified plant is a vegetable crop, and optionally the modified plant is from the genus Brassica, Glycine, or Soja; The modified plant of claim 1 .

8. (a) the OsSOS1 gene is operably linked to an enhancer element comprising SEQ ID NO: 12, and / or (b) the OsSOS2 gene is operably linked to an enhancer element comprising SEQ ID NO: 13, and / or (c) the OsAHA3 gene is operably linked to an enhancer element comprising SEQ ID NO: 14; and / or (d) the OsVHA-A gene is operably linked to an enhancer element comprising SEQ ID NO: 11; and / or (e) the OsNHX1 gene is operably linked to an enhancer element comprising SEQ ID NO: 10; and / or (f) the OsHKT1 gene is operably linked to an enhancer element comprising SEQ ID NO: 15; and / or (g) the OsSODA1 gene is operably linked to an enhancer element comprising SEQ ID NO: 16; and / or (h) the OsSODCC1 gene is operably linked to an enhancer element comprising SEQ ID NO: 17; and / or The modified plant of claim 6, wherein (i) the OsSOD2 gene is operably linked to an enhancer element comprising SEQ ID NO:

18.

9. A modified rice plant, comprising at least eight genes of interest, wherein the eight genes of interest encode OsSOS1, OsSOS2, OsAHA3, OsVHA-A, OsNHX1, OsHKT1, OsSODA1, and OsSOD2; the OsSOS1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:95 and / or 96; the OsSOS2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:100; the OsAHA3 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:101; the OsVHA-A gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:102; the OsNHX1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:97 and / or 98; the OsHKT1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:99; the OsSODA1 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:92; the OsSOD2 gene comprises a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:93, the OsSOS1 gene is operably linked to an enhancer element comprising SEQ ID NO: 12, the OsSOS2 gene is operably linked to an enhancer element comprising SEQ ID NO: 13, the OsAHA3 gene is operably linked to an enhancer element comprising SEQ ID NO: 14, the OsVHA-A gene is operably linked to an enhancer element comprising SEQ ID NO: 11, the OsNHX1 gene is operably linked to an enhancer element comprising SEQ ID NO: 10, the OsHKT1 gene is operably linked to an enhancer element comprising SEQ ID NO: 15, the OsSODA1 gene is operably linked to an enhancer element comprising SEQ ID NO: 16, and the OsSOD2 gene is operably linked to an enhancer element comprising SEQ ID NO:

18.

10. 10. A plant part of the modified plant of claim 1, which is optionally a cell, seed, leaf, shoot, stem, or root, and optionally is a seed or cell.

11. 11. A multicellular structure comprising one or more plant cells that are the plant part of claim 10, optionally a callus.

12. A method for producing a modified plant, plant part, or multicellular structure according to claims 1 to 11, said method comprising: i) introducing at least two enhancer elements as defined in the modified plant of claim 1 into a cell of the plant, wherein the enhancer elements are integrated into the genome of the cell of the plant so as to be operably linked to the gene of interest; and ii) regenerating the cells to form a modified plant, plant part, or multicellular structure from the cells. Including, Optionally, the enhancer element is introduced into the cell by particle bombardment, Agrobacterium-mediated transformation, or protoplast transfection. The method.

13. The method comprises: (a) inducing callus formation from seeds; (b) precipitating the enhancer element defined in the modified plant of claim 1, two or more guide RNAs, and one or more nucleases onto a microcarrier; (c) transforming the callus with the microcarriers using particle bombardment to produce transformed callus, wherein the enhancer element is integrated into the genome of the modified plant, plant part, or multicellular structure such that the enhancer element is operably linked to the gene of interest; (d) harvesting the transformed callus to produce the multicellular structure of claim 11. Including, Optionally, (i) the multicellular structure is regenerated into a modified plant; (ii) the polynucleotide sequence is stably integrated into the genome of the plant; and / or (iii) the nuclease is a Cas nuclease, a Cpf1 nuclease, a TALEN, or a zinc finger nuclease, and optionally, the nuclease is Cas9 or Cpf1; The method of claim 12.

14. 12. The modified plant, plant part, or multicellular structure of claims 1 to 11, wherein the modified plant, plant part, or multicellular structure is not produced by a process involving homologous recombination and / or is not produced by an essentially biological process.

15. 12. Use of the modified plant of any one of claims 1 to 9, the plant part of claim 10, or the multicellular structure of claim 11 as animal feed or to produce feed for animal consumption or food for human consumption.

Images