Modified small interfering RNA molecules with reduced off-target effects - Patents.com

JP2024529930A5Pending Publication Date: 2025-07-30MICROBIO (SHANGHAI) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024503797
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-07-22
Filing Date
2022-07-21
Publication Date
2025-07-30

AI Technical Summary

Technical Problem

The challenges facing siRNA therapeutics include insufficient cellular uptake, rapid clearance due to nuclease cleavage, and off-target effects from deleterious protein binding or mRNA mistargeting, which hinder clinical application.

Method used

Development of modified small interfering RNA (siRNA) molecules with reduced off-target effects by incorporating phosphorothioate (PS) internucleotide bonds at specific positions within the antisense strand, particularly in the seed region, to enhance stability and specificity.

Benefits of technology

The modified siRNA molecules exhibit significantly reduced off-target effects and improved cellular uptake, leading to enhanced therapeutic efficacy by specifically silencing target genes associated with diseases such as cancer, fibrosis, metabolic disorders, and immune diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000033_0000
    Figure 00000033_0000
  • Figure 00000033_0001
    Figure 00000033_0001
  • Figure 00000034_0000
    Figure 00000034_0000
Patent Text Reader

Abstract

Modified small interfering RNA (siRNA) molecules containing phosphorothioate (PS) internucleotide linkages in the antisense strand to reduce off-target effects, and methods and uses thereof. siRNA targeting hypoxia-inducible factor 1 subunit alpha (HIF1a) with high specificity and silencing efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of the filing date of International Patent Application No. PCT / CN2021 / 107862, filed July 22, 2021, the entire contents of which are incorporated herein by reference. [Background technology]

[0002] RNA interference (RNAi) is the process of sequence-specific post-transcriptional gene silencing mediated by small interfering RNA (siRNA).In order to achieve desired therapeutic effect, considerable attention has been paid to the ability of affecting RNAi to specifically silence the expression of target genes.

[0003] The challenges faced by siRNA therapeutics are significant, because the inherent properties of siRNA, such as polyanionic nature, vulnerability to nuclease cleavage, make clinical application difficult due to poor cellular uptake and rapid clearance.In addition, off-target effects caused by harmful protein binding or mistargeting of mRNA may further limit siRNA therapy.

[0004] Therefore, there is an increasing need to develop potent siRNAs with significantly reduced off-target effects. Summary of the Invention

[0005] The present disclosure is based at least in part on the development of modified small interfering RNA (siRNA) molecules that exhibit reduced off-target effects.Therefore, the modified siRNAs with reduced off-target effects and their use for silencing target genes, for example, those related to disease or disorder, are provided herein.

[0006] In some aspects, the present disclosure provides modified small interfering RNA (siRNA) molecules, comprising a sense strand and an antisense strand. The antisense strand comprises a phosphorothioate (PS) internucleotide bond between nucleotides at positions 5 and 6 and / or between nucleotides at positions 6 and 7. The modified siRNA has reduced off-target effects compared to its siRNA counterpart that does not have a PS internucleotide bond between nucleotides at positions 5 and 6 and between nucleotides at positions 6 and 7. In some embodiments, the modified siRNA molecule may be associated with a targeting moiety.

[0007] In some embodiments, the antisense strand of the modified siRNA molecule may further comprise a PS internucleotide linkage between the nucleotide at position 1 and the nucleotide at position 2 and / or between the nucleotide at position 2 and the nucleotide at position 3. Alternatively, or in addition, the antisense strand of the modified siRNA molecule further comprises a PS internucleotide linkage between the first and the second nucleotide at the 3' end and / or between the second and the third nucleotide at the 3' end.

[0008] In some embodiments, the antisense strand of the modified siRNA molecule is 19-25 nucleotides long. For example, the antisense strand of the modified siRNA molecule is 21 nucleotides long. In this case, the antisense strand of the modified siRNA molecule may further comprise a PS internucleotide bond between the 19th and 20th nucleotides and / or between the 20th and 21st nucleotides.

[0009] In some embodiments, the modified siRNA molecule silences the expression of a pathogenic gene, which is optionally a bacterial gene, a viral gene, or a fungal gene. In other embodiments, the modified siRNA molecule silences the expression of a disease gene. Exemplary disease genes include, but are not limited to, those involved in cancer, fibrosis, metabolic disease, cardiovascular disease, immune disease, or genetic disorders.

[0010] In some examples, the disease gene may be involved in cancer. Specific examples include HIF1A, HIF2, IGF1R, VEGF, EREG, KRAS, ALK, BRAF, NRAS, STAT3, CDH2, KIFL1, PIK3CA, Src, RAS, RAF, and TP53. In some examples, the disease gene may be involved in fibrosis. Specific examples include HIF1A, HIF1B, HIF2, TGF-β1, and CTGF. In some examples, the disease gene may be involved in metabolic or cardiovascular disease. Specific examples include AGT, ApoC-III, and apoB. In some examples, the disease gene may be involved in immune disease. Specific examples include GATA-3, CCR3, TGF-α1, IL-6, TNF-α, IFN-β, IL-1β, CCL2, and CCL10. In other examples, the disease gene may be involved in a genetic disorder. Specific examples include apoB and PCSK9.

[0011] In other aspects, the disclosure features a pharmaceutical composition including any of the modified siRNA molecules disclosed herein and a pharma- ceutically acceptable carrier.

[0012] Further provided herein is a method for silencing a target gene, comprising contacting a cell expressing the target gene with a modified siRNA molecule or a pharmaceutical composition comprising the modified siRNA molecule and a pharma- ceutically acceptable carrier. In some embodiments, the contacting step can be performed by administering the modified siRNA molecule or pharmaceutical composition to a subject in need thereof.

[0013] In another aspect, provided herein is an interfering RNA (anti-HIF1a interfering RNA) that targets human hypoxia-inducible factor 1 subunit alpha (HIF1α). The interfering RNA comprises a nucleotide sequence that is complementary to a target site within HIF1α mRNA. The target site is (a) AGGCCACAUUCACGUAUAU (SEQ ID NO: 1), (b) UGAGGAAGUACCAUUAUAU (SEQ ID NO: 2), (c) CCGGUUGAAUCUUCAGAUA (SEQ ID NO: 3), (d) GCGCAAGUCCUCAAAGCAC (SEQ ID NO: 4); (e) AGGCCACAUUCACGUAUA (SEQ ID NO: 5), or (f) may comprise the nucleotide sequence of UGAGGAAGUACCAUUAUA (SEQ ID NO: 6).

[0014] In some embodiments, the target site in the HIF1α mRNA comprises the nucleotide sequence AGGCCACAUUCACGUAUA (SEQ ID NO: 5). In other embodiments, the target site in the HIF1α mRNA comprises the nucleotide sequence UGAGGAAGUACCAUUAUA (SEQ ID NO: 6).

[0015] In some embodiments, the anti-HIF1a interfering RNA is an siRNA comprising a sense strand and an antisense strand. In some cases, the antisense strand may be 19-25 nucleotides in length. In examples, the sense strand and the antisense strand comprise the following nucleotide sequences, respectively: 5'-AGGCCACAUUCACGUAUAA-3' (SEQ ID NO: 7) and 5'-UUAUACGUGAAUGUGGCCUGU-3' (SEQ ID NO: 8). In other examples, the sense strand and the antisense strand comprise the following nucleotide sequences, respectively: 5'-UGAGGAAGUACCAUUAUAA-3' (SEQ ID NO: (9) and 5'-UUAUAAUGGUACUUCCUC AAU-3' (SEQ ID NO: 10).

[0016] In some embodiments, the antisense strand of the anti-HIF1a siRNA may comprise a phosphorothioate (PS) internucleotide bond between the 5th and 6th nucleotides and / or between the 6th and 7th nucleotides. Such modified siRNAs have reduced off-target effects compared to siRNA counterparts that do not have a PS internucleotide bond between the 5th and 6th nucleotides and between the 6th and 7th nucleotides. In some cases, the antisense strand further comprises a PS internucleotide bond between the 1st and 2nd nucleotides and / or between the 2nd and 3rd nucleotides. Alternatively or in addition, the antisense strand further comprises a PS internucleotide bond between the 1st and 2nd nucleotides at the 3' end and / or between the 2nd and 3rd nucleotides at the 3' end.

[0017] Any of the anti-HIF1a interfering RNAs disclosed herein may further comprise one or more modified nucleotides. For example, the anti-HIF1a interfering RNA may comprise 2'-fluoro, 2'-O-methyl, or a combination thereof.

[0018] In addition, the disclosure features a pharmaceutical composition including any of the anti-HIF1a interfering RNAs disclosed herein and a pharma- ceutically acceptable carrier.

[0019] In yet another aspect, the disclosure features a method for suppressing the expression of human HIF1α, comprising contacting an effective amount of any of the anti-HIF1a interfering RNAs disclosed herein with a cell expressing human HIF1α. In some embodiments, the method comprises administering to a subject an effective amount of an interfering RNA or a pharmaceutical composition comprising such. In some examples, the subject is a human patient having or suspected of having a disease associated with HIF1α. Exemplary diseases associated with HIF1α include cancer (e.g., solid tumors), heart disease (e.g., ischemic heart disease or congestive heart failure), lung disease (e.g., pulmonary hypertension, pulmonary fibrosis, or chronic obstructive pulmonary disease), liver disease (e.g., acute liver failure, liver fibrosis, or cirrhosis), kidney disease (e.g., acute kidney injury or chronic kidney disease), obesity, or diabetes.

[0020] Also within the scope of the present disclosure are pharmaceutical compositions comprising any of the modified siRNAs or anti-HIF1a interfering RNAs for treating a target disease disclosed herein, as well as the use of the modified siRNAs or anti-HIF1a interfering RNAs for the manufacture of a medicament for use in treating a target disease.

[0021] The details of one or more embodiments of the disclosure are set forth in the description below. Other features and advantages of the disclosure will be apparent from the following drawings and certain detailed description, and from the appended claims. [Brief description of the drawings]

[0022] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, which may be better understood by reference to the drawings in combination with the specific detailed description presented herein.

[0023] [Figure 1]Graph showing off-target events caused by HIF1A siRNA, evaluated by genome-wide RNA sequencing.Tested siRNAs have PS internucleotide bond at various positions, as indicated by asterisk ("*").Numbers on the left side refer to down-events, and numbers on the right side refer to up-events. [Diagram 2] 1 is a graph showing knockdown efficiency of HIF1A siRNAs with phosphorothioate (PS) internucleotide linkages at various positions as indicated. [Figure 3A-3B] 3A includes graphs showing the in vivo efficacy of exemplary anti-HIF1A siRNAs: Figure 3A: Knockdown of HIF1A expression in human HepG2 xenografted mice; Figure 3B: Inhibition of tumor growth in xenografted mice. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0024] RNA interference or "RNAi" is a process in which double-stranded RNA (dsRNA) blocks gene expression when introduced into a host cell. (Fire et al. (1998) Nature 391, 806-811). One of the obstacles to RNAi therapy is off-target effects (Seok et al (2018), Cell Mol. Life Sci. 75, 797-814). Small interfering RNA molecules (siRNAs) are commonly used in RNAi to inhibit the expression of target genes.

[0025] siRNA is a double-stranded RNA, an antisense strand, and a sense strand, which contain complementary sequences and form a double-stranded structure. At least a portion of the antisense strand is complementary to a region in the target mRNA for blocking expression of the mRNA via RNAi. Each strand of the siRNA molecule can have 19-23 nucleotides. In some cases, each strand can have a phosphorylated 5' end and a hydroxylated 3' end. In some cases, the antisense strand can have a couple overhanging nucleotides (e.g., 1 or 2). When siRNA is transfected into a cell, it is incorporated into an RNA-induced silencing complex (RISC) that contains the core protein Argonaute (AGO). The siRNA then unwinds into single-stranded RNA. The antisense strand then remains associated with AGO to form an active RISC, while the sense strand is degraded. The antisense strand base pairs with the target transcript (mRNA), and AGO cleaves the target to silence its function (gene expression).

[0026] Off-target effect is one potential problem associated with siRNA therapy. Therefore, developing siRNA with reduced off-target effect is highly desirable for highly potent and safe RNAi therapy.

[0027] The present disclosure is based at least in part on the development of modified siRNA molecules in which common phosphodiester backbone bonds at certain nucleotide positions in the antisense strand are replaced with phosphorothioate (PS) bonds (also referred to as "PS bonds"). In this replacement, non-bridging phosphate oxygen atoms are replaced with sulfur atoms to create PS bonds between nucleotides. Specifically, the PS modification is introduced into the seed region of the antisense strand of the siRNA molecule. For example, the PS modification can be introduced between one or more nucleotides at positions 5-8 in the antisense strand of the siRNA molecule. The modified siRNAs disclosed herein are expected to have substantially reduced off-target effects and to be more resistant to nucleases compared to counterpart nucleic acids (having the same nucleotide sequence) that do not have PS bonds at defined positions.

[0028] Unless otherwise specified, the position of a nucleotide in a nucleic acid strand disclosed herein refers to the position from the 5' end of the nucleic acid strand (ie, the 5'-most nucleotide is number 1).

[0029] I. Modified siRNA molecules with reduced off-target effects In some aspects, the present disclosure relates to modified short interfering nucleic acid molecules (siRNAs) that have reduced off-target effects compared to the same siRNA molecule without the corresponding modification.

[0030] (A) siRNA molecule: The present disclosure relates to modified siRNA molecules, which are double-stranded RNA that can induce gene silencing via the RNAi pathway against target gene transcripts and have reduced off-target effects (against non-target gene transcripts).

[0031] The modified siRNA molecule includes a sense strand and an antisense strand. The antisense strand includes one or more phosphorothioate (PS) internucleotide bonds (also referred to as "PS groups" or "PS bonds") in the seed region (positions 5-8). The modified siRNA molecule has reduced off-target effects, for example, at least 30%, at least 40%, at least 50%, or more, compared to siRNA counterparts that do not have PS bonds at the respective nucleotide positions. The reduction of off-target effects can be determined via routine practice or by the methods disclosed herein.

[0032] In some embodiments, the antisense strand in the modified siRNA disclosed herein may comprise a PS internucleotide bond between the nucleotide at position 5 and the nucleotide at position 6. Alternatively, or in addition, the antisense strand in the modified siRNA may comprise a PS internucleotide bond between the nucleotide at position 6 and the nucleotide at position 7. Alternatively, or in addition, the antisense strand in the modified siRNA may comprise a PS internucleotide bond between the nucleotide at position 7 and the nucleotide at position 8. In some examples, the antisense strand in the modified siRNA may comprise a PS internucleotide bond between the nucleotide at position 5 and the nucleotide at position 6 and between the nucleotide at position 6 and the nucleotide at position 7. In some examples, the antisense strand in the modified siRNA may comprise a PS internucleotide bond between the nucleotide at position 5 and the nucleotide at position 6 and between the nucleotide at position 7 and the nucleotide at position 8. In some examples, the antisense strand in the modified siRNA may comprise a PS internucleotide bond between the nucleotide at position 6 and the nucleotide at position 7 and between the nucleotide at position 8.

[0033] In some embodiments, the antisense strand in the modified siRNA disclosed herein may further comprise one or more PS internucleotide bonds in the 5'-terminal region, for example, between the 1st and 2nd nucleotides and / or between the 2nd and 3rd nucleotides. Alternatively, or in addition, the antisense strand in the modified siRNA disclosed herein may further comprise one or more PS internucleotide bonds in the 3'-terminal region, for example, between the 1st and 2nd nucleotides at the 3'-terminal and / or between the 2nd and 3rd nucleotides at the 3'-terminal. For example, if the antisense strand comprises 21 nucleotides, the PS internucleotide bonds in the 3'-terminal region may be between the 19th and 20th nucleotides and / or between the 20th and 21st nucleotides.

[0034] In some examples, the antisense strand in the modified siRNA disclosed herein may contain PS internucleotide linkages within the seed region, for example, between the nucleotides at positions 5 and 6 and between the nucleotides at positions 6 and 7, and at the 5'-terminus (e.g., 1 or 2) and / or 3'-terminus (e.g., 1 or 2). In one specific example, the antisense strand contains (a) PS internucleotide linkages between the nucleotides at positions 5 and 6 and between the nucleotides at positions 6 and 7, (b) two PS internucleotide linkages at the 5'-terminus, and (c) two PS internucleotide linkages at the 3'-terminus.

[0035] In some examples, the antisense strand in the modified siRNA disclosed herein may contain PS internucleotide linkages within the seed region, for example, between nucleotides 5 and 6, between nucleotides 6 and 7, and between nucleotides 7 and 8, as well as at the 5' end (e.g., 1 or 2) and / or 3' end (e.g., 1 or 2). In one particular example, the antisense strand contains (a) PS internucleotide linkages between nucleotides 5 and 6, between nucleotides 6 and 7, and between nucleotides 7 and 8, (b) two PS internucleotide linkages at the 5' end, and (c) two PS internucleotide linkages at the 3' end.

[0036] In any of the modified siRNA molecules disclosed herein, the antisense strand may contain 15-30 nucleotides in length, e.g., 18-25 or 19-23 nt in length. In one example, the antisense strand comprises a 21 nt length. In another example, the antisense strand comprises a 23 nt length. The sense strand or a portion thereof is complementary (fully or partially) to the antisense strand or a portion thereof. In some cases, the sense strand has the same length as the antisense strand. In other cases, the sense strand is shorter than the antisense strand (e.g., 1-5 nt, such as 1 nt, 2 nt, 3 nt, 4 nt, or 5 nt). In that case, the antisense strand may have an overhang (e.g., 1-5 nt) at the 5' end and / or 3' end.

[0037] In one specific example, the antisense strand in the modified siRNA is 21nt long, and the sense strand in the modified siRNA is 16nt long.The 5nt overhang in the antisense strand can be located at its 3' end.In another specific example, the antisense strand in the modified siRNA is 21nt long, and the sense strand in the modified siRNA is 19nt long.The 2nt overhang in the antisense strand can be located at its 3' end.

[0038] Table 1 lists exemplary siRNAs having exemplary PS internucleotide linkages at the seed region and the 5' and / or 3' termini. siRNAs having PS internucleotide linkages at the positions indicated in the exemplary siRNAs listed in Table 1 are within the scope of the present disclosure.

[0039] (B) Other modifications In addition to the PS internucleotide bond modifications in the antisense strand of the modified siRNA disclosed herein, the antisense strand, the sense strand, or both of the modified siRNA may further comprise other modifications, such as sugar modifications, nucleobase modifications, backbone modifications, or combinations thereof. Such modifications may confer one or more desirable properties, such as enhanced cellular uptake, improved affinity to the target nucleic acid, increased in vivo stability, enhance in vivo stability (e.g., resistance to nuclease degradation), and / or reduce immunogenicity.

[0040] In one example, the modified siRNAs disclosed herein (e.g., in the sense and / or antisense strands) can have modified backbones at positions different from the PS internucleotide linkages, including those that retain a phosphorus atom (see, e.g., U.S. Pat. Nos. 3,687,808, 4,469,863, 5,321,131, 5,399,676, and 5,625,050) and those that do not have a phosphorus atom (see, e.g., U.S. Pat. Nos. 5,034,506, 5,166,315, and 5,792,608). Examples of phosphorus-containing modified backbones include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates, 5'-alkylene phosphonates, and chiral phosphonates, phosphinates, phosphoramidates, including 3'-amino phosphoramidates and aminoalkyl phosphoramidates, thionophosphoramidates, thionoalkyl phosphonates, thionoalkyl phototriesters, selenophosphates, and boranophosphates with 3'-5' or 2'-5' bonds.Such backbones also include those with reverse polarity, i.e., 3' to 3', 5' to 5', or 2' to 2' bonds. Modified backbones that do not contain phosphorus atoms are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages. Such backbones include those with morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide, and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, riboacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones with mixed N, O, S, and CH2 constituent moieties.In some examples, the modified siRNAs disclosed herein do not contain any backbone modifications, except for the PS internucleotide linkages disclosed herein.

[0041] In another example, the modified siRNA disclosed herein (e.g., in the sense and / or antisense strands) comprises one or more substituted sugar moieties. Such substituted sugar moieties can comprise one of the following groups at the 2' position of the substituted sugar moiety: OH, F, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, O-alkynyl, S-alkynyl, N-alkynyl, and O-alkyl-O-alkyl. In these groups, the alkyl, alkenyl, and alkynyl can be substituted or unsubstituted C1-C10 alkyl or C2-C10 alkenyl and alkynyl. The substituted sugar moiety can also comprise a heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, at the 2' position of the substituted sugar moiety. Preferred substituted sugar moieties include those having 2'-methoxyethoxy, 2'-dimethylaminooxyethoxy, and 2'-dimethylaminoethoxyethoxy. See Martin et al., Helv. Chim. Acta, 1995, 78, 486-504.

[0042] Alternatively or additionally, the modified siRNA disclosed herein (e.g., in sense strand and / or antisense strand) comprises one or more modified natural nucleobases (i.e., adenine, guanine, thymine, cytosine and uracil).Modified nucleobases include those described in U.S. Patent No. 3,687,808; The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859; Kroschwitz, JI, ed. John Wiley & Sons, 1990; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; and Sanghvi, YS, Chapter 15, Antisense Research and Applications, pages 289-302, CRC Press, 1993.Some of these nucleobases are particularly useful for increasing the binding affinity of interfering RNA molecules to their target site. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyl-adenine, 5-propynyluracil, and 5-propynylcytosine; see Sanghvi, et al., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278).

[0043] Alternatively or additionally, the modified siRNA disclosed herein (e.g., in the sense strand and / or antisense strand) can include one or more locked nucleic acids (LNA). LNA, often referred to as access-restricted RNA, is a modified RNA nucleotide in which the ribose moiety is modified with an extra bridge connecting the 2' oxygen and the 4' carbon. This bridge "locks" the ribose in the 3'-endo (north) conformation that is often found in A-form duplexes. LNA nucleotides can be used in any of the modified siRNAs disclosed herein. In some examples, up to 50% (e.g., 40%, 30%, 20%, or 10%) of the nucleotides in the interfering RNA are LNA.

[0044] In some embodiments, any of the modified siRNA molecules described herein may be conjugated to a ligand (targeting moiety) or encapsulated in a vesicle, which can facilitate the delivery of modified siRNA to desired cells / tissues and / or facilitate cellular uptake.Suitable ligands include, but are not limited to, carbohydrates, peptides, antibodies, polymers, small molecules, cholesterol, and aptamers.For example, one or more GalNAc moieties (e.g., tri-GalNAc moieties) may be used as targeting moieties to deliver modified siRNA to liver cells.

[0045] (C) Target gene The modified siRNA disclosed herein is for use in suppressing the expression of a target gene, and the transcript (mRNA) of the target gene comprises a region that is complementary to the antisense strand in the modified siRNA. Thus, the sequence of the antisense strand and the sense strand can be designed based on the mRNA sequence of the target gene. In some cases, the antisense strand can be completely complementary to the target region in the mRNA of the target gene. In other cases, the antisense strand can be partially complementary to the target region in the mRNA of the target gene (e.g., contains one or more mismatches or gaps), as long as the level of complementarity is sufficient to base pair with the target region, which is within the knowledge of those skilled in the art.

[0046] In some embodiments, the target gene of modified siRNA disclosed herein is a pathogenic gene.For example, the target gene can be a pathogenic gene, such as a virus, a bacteria, or a fungus.In other examples, the target gene is involved in disease or disorder, such as cancer, immune disorder (e.g., autoimmune disease), metabolic disorder or disease, cardiovascular disorder or disease, and other genetic disorder or disease.

[0047] In some examples, the modified siRNA silences the expression of a target gene involved in cancer.Exemplary cancer-related target genes include, but are not limited to, HIF1A, HIF2, IGF1R, VEGF, EREG, KRAS, ALK, BRAF, NRAS, STAT3, CDH2, KIFL1, PIK3CA, Src, RAS, RAF, and TP53.

[0048] In some examples, the modified siRNA silences the expression of a target gene involved in fibrosis. Exemplary fibrosis-related target genes include, but are not limited to, HIF1A, HIF1B, HIF2, TGF-β1, and CTGF.

[0049] In some examples, the modified siRNA silences the expression of a target gene involved in a metabolic disease. Exemplary metabolic target genes include, but are not limited to, AGT, ApoC-III, and ApoB.

[0050] In some examples, the modified siRNA silences the expression of a target gene involved in an immune disease (e.g., an autoimmune disease). Exemplary immune disease-related target genes include, but are not limited to, GATA-3, CCR3, TGF-β1, IL-6, TNF-α, IFN-γ, IL-1β, CCL2, and CCL10.

[0051] II. Interfering RNA targeting human hypoxia-inducible factor 1 subunit alpha (HIF1a) Hypoxia-inducible factor-1A (HIF-1A) is a major transcription factor with a key role in regulating the cellular response to hypoxia. Lyer et al., Genes Dev 1998, 12, 149-162. Under normoxic conditions, HIF-1a subunits are continuously synthesized and degraded by the ubiquitin proteasome system. Under hypoxic conditions, HIF-1A is overexpressed in various cancers and regulates various genes involved in tumor growth, angiogenesis, chemotherapy resistance, invasion and metastasis. Favaro et alGenome Med. 2011, 3:1-12 and Gonzalez et al., Nat. Rev. Endocrinol. 2018, 15, 21-32. HIF-1A is upregulated in hepatocellular carcinoma and associated with hepatic capsular invasiveness and portal vein metastasis. Feng et al., Cell Mol. Biol. Lett. 2018, 23, 26, and Yang et al., J Clin Oncol. 2014, 44(2):159-67. It is also overexpressed in various solid tumors, including bladder urothelial carcinoma, breast invasive, colon adenocarcinoma, hepatocellular carcinoma, lung adenocarcinoma, pancreatic adenocarcinoma, rectal adenocarcinoma, gastric adenocarcinoma, and thyroid carcinoma. Chen et al., Cell Oncol. 2020, 43:877-88.

[0052] Many reports suggest that HIF-1A activates or inhibits metabolic diseases. Gonzalez et al., Nat. Rev. Endocrinol. 2018, 15, 21-32, and Halberg et al., Mol Cell Biol. 2009, 16:4467-83. Obesity induces chronic hypoxia in adipose tissue and small intestine, promoting HIF-1A signaling and resulting in adverse metabolic effects including insulin resistance and nonalcoholic fatty liver disease with hepatic fibrosis. Norouzirad et al., Oxid Med Cell Longev. 2017, 2017:5350267. Inhibition of hypoxic signaling by overexpression of von Hippel-Lindau protein, an E3 ubiquitin ligase, or silencing of HIF-1A can significantly reduce liver fibrosis induced by both CCl4 and bile duct ligation. Wang et al.,Sci Rep.2017,7:41038.

[0053] Described herein are interfering RNA molecules (anti-HIF1a interfering RNAs) that target human HIF1a mRNA. Such anti-HIF1a interfering RNAs can suppress HIF1a expression via the process of RNA interference, thereby providing benefits in the treatment of diseases associated with HIF1a, such as those discussed herein. As used herein, the term "interfering RNA" refers to any RNA molecule that can be used in the inhibition of a target gene, including both mature RNA molecules (e.g., 21-23 nt dsRNAs disclosed herein) that are directly involved in RNA interference, or precursor molecules that produce mature RNA molecules.

[0054] Anti-HIF1a interfering RNA comprises a fragment that is (fully or partially) complementary to a target site in HIF1a mRNA. The fragment can be 100% complementary to the target site. Alternatively, the fragment can be partially complementary, for example, it can contain one or more mismatches or gaps, but it can be sufficiently complementary to form a duplex at the target site and mediate RNA interference.

[0055] In some embodiments, the interfering RNA disclosed herein has the nucleotide sequence: (1) AUGAAGUGUACCCUAACUA (SEQ ID NO: 11), (2) AAGUCUGCAACAUGGAAGGUA (SEQ ID NO: 12), (3) AGGCCACAUUCACGUAUAU (SEQ ID NO: 1), (4) GGCCACAUUCACGUAUAUG (SEQ ID NO: 13), (5) UGAGGAAGUACCAUUAUAU (SEQ ID NO: 2), (6) AAGUUCACCUGAGCCUAAUAG (SEQ ID NO: 14), (7) ACUUUCUUGGAAACGUGUAA (SEQ ID NO: 15), (8) CCGGUUGAAUCUUCAGAUA (SEQ ID NO: 3), (9) GCGCAAGUCCUCAAAGCAC (SEQ ID NO: 4), (10) GUCGGACAGCCUCACCAAA (SEQ ID NO: 16), and (11) Targeting the HIF1a mRNA site with one of the following: AGCGCAAGUCCUCAAAGCAC (sequence number 17).

[0056] In some examples, the anti-HIF1a interfering RNA disclosed herein targets a HIF1a mRNA site having a nucleotide sequence of AGGCCACAUUCACGUAUAU (SEQ ID NO: 1). In some examples, the anti-HIF1a interfering RNA disclosed herein targets a HIF1a mRNA site having a nucleotide sequence of UGAGGAAGUACCAUUAUAU (SEQ ID NO: 2). In other examples, the anti-HIF1a interfering RNA disclosed herein targets a HIF1a mRNA site having a nucleotide sequence of CCGGUUGAAUCUUCAGAUA (SEQ ID NO: 3). Exemplary anti-HIF1a interfering RNAs are provided in Tables 3 and 4 below.

[0057] In some embodiments, the interfering RNA is disclosed herein and can be an siRNA, i.e., a double-stranded RNA (dsRNA) containing two separate complementary RNA strands. Such an siRNA can include a sense strand having a nucleotide sequence corresponding to the target HIF1a mRNA site, and an antisense strand that is complementary to the sense strand (and the target site). It is known to those skilled in the art that the sense strand and / or antisense strand do not need to be completely identical or complementary to the target site. One or more mismatches are allowed as long as the siRNA can still target the mRNA site through base pairing to mediate the RNA interference process. In some cases, the sense strand and / or antisense strand (the entire sense strand and / or antisense strand, or a portion of the sense strand and / or antisense strand) are completely identical or complementary to the target site. Exemplary siRNAs that target HIF1a can be found in Tables 3 and 4 below.

[0058] In another example, the interfering RNA can be a small hairpin RNA (shRNA) as disclosed herein, where shRNA is an RNA molecule that forms a tight hairpin structure. Both siRNA and shRNA can be designed based on the sequence of the target mRNA site of HIF1a as disclosed herein.

[0059] In some embodiments, the anti-HIF1a interfering RNA disclosed herein can be an siRNA molecule, such as an siRNA molecule listed in Tables 3 and 4 below. In a specific example, the siRNA is one of the siRNAs listed in Table 4, such as AI3-UM4 and AT9-UM4.

[0060] In some examples, the siRNA may comprise a sense strand comprising 5'-AGGCCACAUUCACGUAUAA-3' (SEQ ID NO: 7) and an antisense strand comprising 5'-UUAUACGUGAAUGUGGCCUGU-3' (SEQ ID NO: 8). In some examples, the siRNA may comprise a sense strand comprising 5'-UGAGGAAGUACCAUUAUAA-3' (SEQ ID NO: 9) and an antisense strand comprising 5'-UUAUAAUGGUACUUCCUCAAU-3' (SEQ ID NO: 10).

[0061] In some cases, the siRNA disclosed herein may comprise the same sense strand and / or the same antisense strand as AI3-UM4 or AT9-UM4. In other cases, the siRNA disclosed herein may comprise a sense strand that is at least 80% (e.g., at least 85%, at least 90%, at least 95% or more) identical to the sense strand of AI3-UM4, and / or an antisense strand that is at least 80% (e.g., at least 85%, at least 90%, at least 95% or more) identical to the antisense strand of AI3-UM4. In other cases, the siRNA disclosed herein may comprise a sense strand that is at least 80% (e.g., at least 85%, at least 90%, at least 95% or more) identical to the sense strand of AT9-UM4, and / or an antisense strand that is at least 80% (e.g., at least 85%, at least 90%, at least 95% or more) identical to the antisense strand of AT9-UM4.

[0062] The "percent identity" of two nucleic acids is determined using the algorithm of Karlin and Altschul Proc. Natl. Acad. Sci. USA 87:2264-68, 1990, modified as in Karlin and Altschul Proc. Natl. Acad. Sci. USA 90:5873-77, 1993. Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. J. Mol. Biol. 215:403-10, 1990. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength-12, to obtain nucleotide sequences homologous to the nucleic acid molecules of the present invention. When gaps exist between the two sequences, gapped BLAST can be used as described in Altschul et al., Nucleic Acids Res. 25(17):3389-3402, 1997. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (eg, XBLAST and NBLAST) can be used.

[0063] In other embodiments, the anti-HIF1a siRNAs described herein may contain up to six (e.g., up to 6, 5, 4, 3, or 2) nucleotide mutations compared to the sense and antisense strands (together or separately) of a reference siRNA, such as those listed in Table 3 or Table 4 (e.g., AI3-UM4 or AT9-UM4).

[0064] In some embodiments, any of the anti-HIF1a interfering RNAs described herein (e.g., siRNAs such as AI3-UM4 or AT9-UM4) may contain non-naturally occurring nucleobases, sugars, or covalent internucleoside linkages (backbones). Such modified oligonucleotides may confer desirable properties, such as enhanced cellular uptake, improved affinity for target nucleic acids, increased in vivo stability, enhanced in vivo stability (e.g., resistance to nuclease degradation), and / or reduced immunogenicity.

[0065] In one example, the anti-HIF1a interfering RNA described herein (e.g., siRNA such as AI3-UM4 or AT9-UM4) has a modified backbone, including those that retain a phosphorus atom (see, e.g., U.S. Pat. Nos. 3,687,808, 4,469,863, 5,321,131, 5,399,676, and 5,625,050) and those that do not have a phosphorus atom (see, e.g., U.S. Pat. Nos. 5,034,506, 5,166,315, and 5,792,608). Examples of phosphorus-containing modified backbones include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates, 5'-alkylene phosphonates, and chiral phosphonates, phosphinates, phosphoramidates, including 3'-amino phosphoramidates and aminoalkyl phosphoramidates, thionophosphoramidates, thionoalkyl phosphonates, thionoalkyl phototriesters, selenophosphates, and boranophosphates with 3'-5' or 2'-5' bonds.Such backbones also include those with reverse polarity, i.e., 3' to 3', 5' to 5', or 2' to 2' bonds. Modified backbones that do not contain phosphorus atoms are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatom or heterocyclic internucleoside linkages. Such backbones include those with morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide, and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, riboacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones with mixed N, O, S, and CH2 constituent moieties.

[0066] In some examples, the anti-HIF1a interfering RNA described herein (e.g., siRNA such as AI3-UM4 or AT9-UM4) may contain a PS internucleotide linkage at a position disclosed herein (e.g., between positions 5-8, e.g., positions 5-6 and / or 6-7 within the seed region). Alternatively or in addition, the anti-HIF1a interfering RNA described herein (e.g., siRNA such as AI3-UM4 or AT9-UM4) may also contain one or more additional modifications, such as modified sugars, modified bases, modified nucleotides, including those disclosed herein. The anti-HIF1a interfering RNA may also be conjugated to a targeting moiety, such as those disclosed herein. For example, the anti-HIF1a interfering RNA may be conjugated to a ligand (targeting moiety) or encapsulated in a vesicle, which can facilitate delivery of the siRNA to the desired cell / tissue and / or facilitate cellular uptake. Suitable ligands include, but are not limited to, carbohydrates, peptides, antibodies, polymers, small molecules, and cholesterol. For example, one or more GalNAc moieties (eg, tri-GalNAc moieties) may be used as targeting moieties to deliver anti-HIF1a interfering RNA to liver cells.

[0067] Unless explicitly stated (e.g., PS linkages indicated by the symbol "*"), the unmodified nucleotide sequences provided herein are intended to encompass both unmodified RNA molecules and RNA molecules bearing any suitable modifications.

[0068] Any of the anti-HIF1a interfering RNA molecules (and modified siRNA molecules) described herein can be prepared by conventional methods, such as chemical synthesis or in vitro transcription. The intended biological activity described herein can be verified, for example, by the following examples. In some cases, the modified siRNA molecule or anti-HIF1a interfering RNA disclosed herein can suppress the expression of target gene by at least 50%, for example, at least 65%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or more.

[0069] Vectors for expressing any of the anti-HIF1a interfering RNAs are also within the scope of this disclosure.The expression vectors can include control elements (promoter / enhancer) operably linked to the sequence encoding the anti-HIF1a interfering RNA.Typically, these sequences can encode both the sense and antisense strands of the anti-HIF1a interfering RNA.

[0070] III. Pharmaceutical Compositions Any of the modified siRNA molecules or anti-HIF1a interfering RNA disclosed herein can be formulated into suitable pharmaceutical compositions.The pharmaceutical compositions described herein can further comprise pharmaceutically acceptable carriers, excipients, or stabilizers in the form of lyophilized formulations or aqueous solutions.Remington: The Science and Practice of Pharmacy 20th Ed.(2000) Lippincott Williams and Wilkins,Ed.KE Hoover.Such carriers, excipients, or stabilizers can enhance one or more properties of the active ingredients in the compositions described herein, such as biological activity, stability, bioavailability, and other pharmacokinetics and / or biological activity.

[0071] Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed and include buffers such as phosphates, citrates, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol, benzoate, sorbate, and m-cresol); low molecular weight (less than about 10 residues) polypeptides; serum albumin, gelatin, or immunoglobulins. The surfactant may include proteins such as riboflavin; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, serine, alanine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextran; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or non-ionic surfactants such as TWEEN™ (polysorbates), PLURONICS™ (non-ionic surfactants), or polyethylene glycol (PEG).

[0072] In some examples, the pharmaceutical compositions described herein may contain any of the following: trichloromono-fluoromethane, dichloro-difluoromethane, dichloro-tetrafluoroethane, chloropenta-fluoroethane, monochloro-difluoroethane, difluoroethane, tetrafluoroethane, heptafluoropropane, octafluoro-cyclobutane, purified water, ethanol, propylene glycol, glycerin, PEG (e.g., PEG400, PEG600, PEG800, and PEG1000), sorbitan trioleate, soy lecithin, lecithin, oleic acid, polysorbate 80, magnesium stearate and sodium lauryl sulfate, methylparaben, proline. Excipients that may include, but are not limited to, paraben, chlorobutanol, benzalkonium chloride, cetylpyridinium chloride, thymol, ascorbic acid, sodium bisulfite, sodium metabisulfite, EDTA, sodium hydroxide, tromethamine, ammonia, HCl, H2SO4, HNO3, citric acid, CaCl2, CaCO3, sodium citrate, sodium chloride, disodium EDTA, saccharin, menthol, ascorbic acid, glycine, lysine, gelatin, povidone K25, silicon dioxide, titanium dioxide, zinc oxide, lactose, lactose monohydrate, lactose anhydrous, mannitol, and dextrose.

[0073] In other examples, the pharmaceutical compositions described herein can be formulated in sustained release form.Suitable examples of sustained release preparations include semipermeable matrices of solid hydrophobic polymers in the form of shaped articles, such as films or microcapsules.Examples of sustained release matrices include polyesters, hydrogels (e.g., poly(2-hydroxyethyl-methacrylate) or poly(vinyl alcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and 7-ethyl-L-glutamate, non-degradable ethylene vinyl acetate, degradable lactic acid-glycolic acid copolymers such as LUPRON DEPOT™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), sucrose acetate isobutyrate, and poly-D-(-)-3-hydroxybutyric acid.

[0074] Pharmaceutical compositions used for in vivo administration must be sterile. This is easily accomplished, for example, by filtration through sterile filtration membranes. Therapeutic compositions are generally placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle, or a manually accessed sealed container.

[0075] The pharmaceutical compositions described herein may be in unit dosage form, e.g., a solid, solution or suspension, or a suppository, for administration by inhalation or insufflation, by intrathecal, intrapulmonary, or intracerebral routes, oral, parenteral, or rectal administration.

[0076] To prepare solid compositions, the main active ingredient can be mixed with pharmaceutical carriers, such as conventional tableting ingredients, such as cornstarch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dicalcium phosphate, or gums, and other pharmaceutical diluents, such as water, to form a solid preformulation composition containing a homogeneous mixture of the compound of the present disclosure or a non-toxic pharma-ceutically acceptable salt thereof.When these preformulation compositions are referred to as homogeneous, this means that the active ingredient is evenly distributed throughout the composition, and thus the composition can be easily subdivided into equally effective unit dosage forms, such as powder collections, tablets, pills, and capsules.These solid preformulation compositions are then subdivided into the above-mentioned types of unit dosage forms that contain a suitable amount of active ingredient in the composition.

[0077] Suitable surfactants include, inter alia, non-ionic agents such as polyoxyethylene sorbitan (e.g., TWEEN® 20, 40, 60, 80, or 85) and other sorbitans (e.g., SPAN® 20, 40, 60, 80, or 85). Compositions having a surfactant conveniently contain 0.05 to 5% surfactant, and may be 0.1 to 2.5%. It will be appreciated that other ingredients, such as mannitol or other pharma- ceutically acceptable vehicles, may be added as required.

[0078] Suitable emulsions can be prepared using commercially available fat emulsions, such as INTRALIPIDS™, LIPOSYN™, INFONUTROL™, LIPOFUNDIN™, and LIPIPHYSAN™. The active ingredient may be dissolved in a premixed emulsion composition, or alternatively, the active ingredient may be dissolved in oil (e.g., soybean oil, safflower oil, cottonseed oil, sesame oil, corn oil, or almond oil) and in an emulsion formed when mixed with phospholipids (e.g., egg phospholipids, soybean phospholipids, or soybean lecithin) and water. It will be appreciated that other ingredients, such as glycerol or glucose, may be added to adjust the osmolality of the emulsion. Suitable emulsions typically contain up to 20% oil, e.g., 5-20% oil.

[0079] Pharmaceutical compositions for inhalation or insufflation include solutions and suspensions in pharma- ceutically acceptable aqueous or organic solvents or mixtures thereof, as well as powders. Liquid or solid compositions may contain suitable pharma- ceutically acceptable excipients as described above. In some embodiments, the compositions are administered by the oral or nasal respiratory route for local or systemic effect. In some embodiments, the compositions are composed of particles ranging in size from 10 nm to 100 mm.

[0080] Compositions in pharma- ceutically acceptable solvents, preferably sterile, can be nebulized by the use of gases. Nebulized solutions can be breathed directly from the nebulizing device, or the nebulizing device can be attached to a face mask, tent, endotracheal tube, and / or intermittent positive pressure breathing machine (ventilator). Solution, suspension, or powder compositions can be administered, preferably orally or nasally, from devices that deliver the formulation in an appropriate manner.

[0081] In some embodiments, either the modified siRNA molecule or the anti-HIF1a interfering RNA may be encapsulated or attached to liposomes, which may be prepared by methods known in the art, such as those described in Epstein, et al., Proc. Natl. Acad. Sci. USA 82:3688 (1985), Hwang, et al., Proc. Natl. Acad. Sci. USA 77:4030 (1980), and U.S. Patent Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed in U.S. Patent No. 5,013,556. Particularly useful liposomes may be produced by reverse phase evaporation with a lipid composition comprising phosphatidylcholine, cholesterol, and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to obtain liposomes with desired diameter.

[0082] In some embodiments, either modified siRNA molecule or anti-HIF1a interfering RNA can also be encapsulated in microcapsules, for example, hydroxymethylcellulose or gelatin microcapsules and poly(methyl methacrylate) microcapsules, respectively, prepared by coacervation technique or by interfacial polymerization, can be encapsulated in colloid drug delivery system (for example, liposome, albumin microsphere, microemulsion, nanoparticle and nanocapsule), or can be encapsulated in macroemulsion. Such techniques are known in the art, for example, see Remington, The Science and Practice of Pharmacy 20th Ed.Mack Publishing (2000).

[0083] Any of the pharmaceutical compositions comprising the modified siRNA molecules disclosed herein may further comprise a component that enhances transport of the composition from endosomes and / or lysosomes to the cytoplasm. Examples include pH-sensitive agents (e.g., pH-sensitive peptides).

[0084] In some embodiments, any of the pharmaceutical compositions herein may further comprise a second therapeutic agent, based on the intended therapeutic use of the composition.

[0085] IV. Inhibition of Target Gene Expression Any of the modified siRNA molecules or anti-HIF1a interfering RNA molecules disclosed herein can be used to inhibit expression of a target gene (eg, HIF1a) either in vivo or in vitro.

[0086] To carry out the methods disclosed herein, an effective amount of the pharmaceutical composition described herein, including modified siRNA molecules, can be administered to a subject (e.g., human) in need of treatment via a suitable route, for example, intravenous administration, for example, as a bolus, or by continuous infusion over a period of time by intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intraarticular, intrasynovial, intratracheal, intratumoral, oral, inhalation, or topical routes. Commercially available nebulizers for liquid formulations, including jet nebulizers and ultrasonic nebulizers, are useful for administration. Liquid formulations can be directly nebulized, and lyophilized powders can be nebulized after reconstitution.

[0087] As used herein, "effective amount" refers to the amount of each active agent required to provide a therapeutic effect to a subject, either alone or in combination with one or more other active agents. Effective amounts will vary, as recognized by those skilled in the art, depending on the specific condition being treated, the severity of the condition, individual patient parameters including age, health, size, sex, and weight, duration of treatment, the nature of concurrent therapy (if any), the specific route of administration, and similar factors within the knowledge and expertise of medical practitioners. These factors are well known to those skilled in the art and can be addressed with only routine experimentation. In general, it is preferred to use the maximum dose of each component or combination thereof, i.e., the highest safe dose according to sound medical judgment.

[0088] Empirical considerations such as half-life generally contribute to the determination of dosage.Dosage frequency can be determined and adjusted over the course of therapy, generally, but not necessarily, based on the treatment and / or suppression and / or remission and / or delay of target disease / disorder.Alternatively, the sustained continuous release formulation of modified siRNA or anti-HIF1a interfering RNA may be appropriate.Various formulations and devices for achieving sustained release are known in the art.

[0089] In general, for administration of any of the modified siRNA molecules or any of the anti-HIF1a interfering RNAs described herein, the initial candidate dosage can be about 2 mg / kg. For purposes of this disclosure, a typical daily dosage can range anywhere from about 0.1 μg / kg to 3 μg / kg to 30 μg / kg to 300 μg / kg to 3 mg / kg to 30 mg / kg to 100 mg / kg or more, depending on the factors mentioned above. For repeated administration over several days or more, depending on the condition, treatment is continued until a desired suppression of symptoms occurs or until a sufficient therapeutic level is achieved to alleviate the target disease or disorder or its symptoms. An exemplary dosing regimen includes administering an initial dose of about 2 mg / kg, followed by a weekly maintenance dose of about 1 mg / kg of anti-siRNA, or followed by a biweekly maintenance dose of about 1 mg / kg. However, other dosing regimens may be useful depending on the pattern of pharmacokinetic decay the practitioner wishes to achieve. For example, administration 1 to 4 times per week is contemplated. In some embodiments, a dose ranging from about 3 μg / mg to about 2 mg / kg (e.g., about 3 μg / mg, about 10 μg / mg, about 30 μg / mg, about 100 μg / mg, about 300 μg / mg, about 1 mg / kg, and about 2 mg / kg) may be used. In some embodiments, the dosing frequency is once every week, every 2 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, or every 10 weeks, or once every month, every 2 months, or every 3 months or more. The progress of this therapy is easily monitored by conventional techniques and assays. Dosage regimens may vary over time.

[0090] In some embodiments, for a normal weight adult patient, a dose ranging from about 0.3 to 5.00 mg / kg may be administered. The particular dosing regimen, i.e., dose, timing, and repetition, will depend on the particular individual and that individual's medical history, as well as the characteristics of the individual drug (e.g., drug half-life, and other considerations well known in the art).

[0091] For the purposes of this disclosure, the appropriate dosage of the modified siRNA or anti-HIF1a interfering RNA molecules described herein depends on the type and severity of the disease / disorder, whether the modified siRNA or anti-HIF1a interfering RNA is administered for prevention or treatment, previous therapy, the patient's clinical history and the patient's response to the antagonist, and the discretion of the attending physician. The clinician may administer the modified siRNA molecule or anti-HIF1a interfering RNA until a dosage is reached that achieves the desired result. In some embodiments, the desired result is a reduction in tumor burden, a reduction in cancer cells, or an increase in immune activity.

[0092] The method of determining whether the dosage has produced desired results is clear to those skilled in the art.The administration of one or more modified siRNA molecules or anti-HIF1a interfering RNA can be continuous or intermittent, for example, depending on the physiological state of recipient, whether the purpose of administration is therapeutic or preventive, and other factors known to skilled practitioners.The administration of modified siRNA molecules or anti-HIF1a interfering RNA can be essentially continuous over a preselected period of time, or can be a series of spaced doses, for example, either before, during, or after the onset of target disease or disorder.

[0093] As used herein, the term "treating" refers to the application or administration of a composition comprising one or more active agents to a subject having a target disease or disorder, a symptom of a disease / disorder, or a predisposition to a disease / disorder, for the purpose of curing, curing, alleviating, mitigating, altering, remediating, ameliorating, improving, or affecting the disorder, the symptom of the disease, or the predisposition to the disease or disorder.

[0094] Alleviating the target disease / disorder includes delaying the onset or progression of the disease or reducing disease severity. Alleviating the disease does not necessarily require a curative outcome. As used herein, "delaying" the onset of the target disease or disorder means to postpone, prevent, slow, retard, stabilize, and / or prolong the progression of the disease. This delay can be of various lengths of time, depending on the disease history and / or the individual being treated. A method of "delaying" or alleviating the onset of a disease or delaying the onset of a disease is a method that reduces the probability of developing one or more symptoms of the disease within a given time frame and / or reduces the severity of symptoms within a given time frame when compared to not using the method. Such comparisons are typically based on clinical studies using a sufficient number of subjects to obtain statistically significant results.

[0095] "Onset" or "progression" of a disease refers to early signs and / or subsequent progression of the disease. Onset of a disease can be detectable and can be assessed using standard clinical techniques well known in the art. However, onset also refers to progression, which can be undetectable. For purposes of this disclosure, onset or progression refers to the biological course of a symptom. "Onset" includes onset, recurrence, and onset. As used herein, "onset" or "onset" of a target disease or disorder includes initial onset and / or recurrence.

[0096] Conventional methods known to those skilled in the medical arts can be used to administer the pharmaceutical composition to a subject, depending on the type of disease or site of disease being treated. The composition can also be administered via other conventional routes, for example, orally, parenterally, by inhalation spray, topically, rectally, nasally, bucally, intravaginally, or via an implanted reservoir. As used herein, the term "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intraarterial, intratumoral, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques. In addition, the composition can be administered to a subject via an injectable depot administration route, for example, using 1, 3, or 6 month depot injectable or biodegradable materials and methods. In some embodiments, the composition can be administered via the nasal route, for example, via intranasal spray, nasal spray, or nasal drops.

[0097] Injectable compositions may contain various carriers, such as vegetable oils, dimethylactamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, and polyols, such as glycerol, propylene glycol, and liquid polyethylene glycol. For intravenous injection, modified siRNAs can be administered by drip infusion, whereby a pharmaceutical formulation containing interfering RNA and a physiologically acceptable excipient is injected. Physiologically acceptable excipients can include, for example, 5% dextrose, 0.9% saline, Ringer's solution, or other suitable excipients. For intramuscular preparations, for example, a sterile formulation of a suitable soluble salt form of modified siRNA disclosed herein can be administered dissolved in a pharmaceutical excipient, such as water for injection, 0.9% saline, or 5% glucose solution.

[0098] In one embodiment, modified siRNA molecule can be administered by site-specific or targeted local delivery technique.Examples of site-specific or targeted local delivery technique include various implanted depot sources of therapeutic RNA molecules or local delivery catheters, such as injection catheters, indwelling catheters or needle catheters, synthetic grafts, adventitial wraps, shunts and stents or other implanted devices, site-specific carriers, direct injection or direct application.See, for example, WO 00 / 53211 and US Patent No. 5,981,568.

[0099] Targeted delivery of therapeutic compositions containing polynucleotides, expression vectors, or subgenomic polynucleotides can also be used. Receptor-mediated DNA delivery techniques are described, for example, in Findeis et al., Trends Biotechnol. (1993) 11:202; Chiou et al., Gene Therapeutics: Methods And Applications Of Direct Gene Transfer (JA Wolff, ed.) (1994); Wu et al., J. Biol. Chem. (1988) 263:621; Wu et al., J. Biol. Chem. (1994) 269:542; Zenke et al., Proc. Natl. Acad. Sci. USA (1990) 87:3655; Wu et al., J. Biol. Chem. (1991) 266:338.

[0100] In some embodiments, any of the modified siRNA molecules, any of the anti-HIF1a interfering RNA, or pharmaceutical compositions comprising such can be administered by pulmonary delivery system, i.e., the active pharmaceutical ingredient is administered into the lungs.The pulmonary delivery system can be an inhaler system.In some embodiments, the inhaler system is a pressurized metered dose inhaler, a dry powder inhaler, or a nebulizer.In some embodiments, the inhaler system is with a spacer.

[0101] In some embodiments, the pressurized metered dose inhaler comprises a propellant, a co-solvent, and / or a surfactant. In some embodiments, the propellant is selected from the group comprising fluorinated hydrocarbons, such as trichloromono-fluoromethane, dichloro-difluoromethane, dichloro-tetrafluoroethane, chloropenta-fluoroethane, monochloro-difluoroethane, difluoroethane, tetrafluoroethane, heptafluoropropane, octafluoro-cyclobutane. In some embodiments, the co-solvent is selected from the group comprising purified water, ethanol, propylene glycol, glycerin, PEG400, PEG600, PEG800, and PEG1000. In some embodiments, the surfactant or lubricant is selected from the group comprising sorbitan trioleate, soy lecithin, lecithin, oleic acid, polysorbate 80, magnesium stearate, and sodium lauryl sulfate. In some embodiments, the preservative or antioxidant is selected from the group including methylparaben, propyparaben, chlorobutanol, benzalkonium chloride, cetylpyridinium chloride, thymol, ascorbic acid, sodium bisulfite, sodium metabisulfite, sodium hydrogen sulfate, EDTA. In some embodiments, the pH or tonicity adjustment is selected from the group including sodium oxide, tromethamine, ammonia, HCl, H2SO4, HNO3, citric acid, CaCl2, CaCO3.

[0102] In some embodiments, the dry powder inhaler comprises a dispersant, hi some embodiments, the dispersant or carrier particles are selected from the group including lactose, lactose monohydrate, lactose anhydrous, mannitol, dextrose, and have a particle size of about 1-100 μm.

[0103] In some embodiments, the nebulizer may include a co-solvent, a surfactant, a lubricant, a preservative, and / or an antioxidant. In some embodiments, the co-solvent is selected from the group including purified water, ethanol, propylene glycol, glycerin, PEG (e.g., PEG400, PEG600, PEG800, and / or PEG1000). In some examples, the surfactant or lubricant is selected from the group including sorbitan trioleate, soy lecithin, lecithin, oleic acid, magnesium stearate, and sodium lauryl sulfate. In some examples, the preservative or antioxidant is selected from the group including methylparaben, propyparaben, chlorobutanol, benzalkonium chloride, cetylpyridinium chloride, thymol, ascorbic acid, sodium bisulfite, sodium metabisulfite, sodium bisulfate, and EDTA. In some examples, the nebulizer further comprises a pH adjuster or an osmolarity adjuster selected from the group including sodium oxide, tromethamine, ammonia, HCl, H2SO4, HNO3, citric acid, CaCl2, CaCO3.

[0104] In some embodiments, DNA molecules capable of producing anti-HIF1a interfering RNA, or pharmaceutical compositions containing such, may be used to silence HIF1a expression. Pharmaceutical compositions containing such DNA molecules (e.g., vectors) may be administered to a subject in need of treatment in the range of about 100 ng to about 200 mg of DNA for local administration in gene therapy protocols. In some embodiments, concentration ranges of about 500 ng to about 50 mg, about 1 μg to about 2 mg, about 5 μg to about 500 μg, and about 20 μg to about 100 μg or more of DNA may also be used in gene therapy protocols.

[0105] The term "about" or "approximately" as used herein means within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within an acceptable standard deviation, according to practice in the art. Alternatively, "about" can mean a range of up to ±20%, preferably up to ±10%, more preferably up to ±5%, and even more preferably up to ±1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 2-fold, of a value. When a particular value is described in the present specification and claims, unless otherwise stated, the term "about" is implicit and in this context means within an acceptable error range for the particular value.

[0106] The subject to be treated by either the modified siRNA molecule or the anti-HIF1a interfering RNA may have or be suspected to have a disease associated with the target gene, the inhibition of which may be achieved by the modified siRNA molecule (see "Target Gene" disclosed above) or the anti-HIF1a interfering RNA (HIF1a). The terms "subject", "individual" and "patient" are used interchangeably herein and refer to a mammal being evaluated for treatment and / or being treated. The subject may be a human, but also includes other mammals, particularly mammals useful as experimental models for human disease, such as mice, rats, rabbits, dogs, monkeys, etc. The human subject in need of treatment may be a human patient having, at risk of, or suspected of having a target disease / disorder, such as a tumor.

[0107] Any of the modified siRNA molecules disclosed herein can be used to treat disease or disorder associated with the target gene.Exemplary diseases include, but are not limited to, cancer, fibrosis, metabolic disease, cardiovascular disease, immune disease, or genetic disorder.

[0108] Any of the anti-HIF1a interfering RNAs disclosed herein can be used to treat HIF1a-related diseases or disorders, including but not limited to solid tumors, cancer, ischemic heart disease, congestive heart failure, acute lung injury, pulmonary hypertension, pulmonary fibrosis, chronic obstructive pulmonary disease, acute liver failure, liver fibrosis and cirrhosis, acute kidney injury, chronic kidney disease, obesity, and diabetes.

[0109] Any of the modified siRNA or anti-HIF1a interfering RNA disclosed herein may be used in combination therapy with one or more additional therapeutic agents to treat a target disease. As used herein, the term "combination therapy" includes administration of these agents (e.g., modified siRNA molecules, anti-HIF1a interfering RNA, and additional therapeutic agents) in a sequential manner, i.e., each therapeutic agent is administered at a different time, and administration of at least two of these therapeutic agents, or agents, in a substantially simultaneous manner. The sequential or substantially simultaneous administration of each agent may be effected by any suitable route, including, but not limited to, oral, intravenous, intramuscular, intratumoral, subcutaneous, direct absorption through mucosal tissue, and pulmonary delivery route. The agents may be administered by the same route or by different routes. For example, a first agent may be administered by a pulmonary delivery route, and a second agent may be administered intravenously.

[0110] As used herein, the term "sequential" means that, unless otherwise specified, the agents are characterized by a regular order or sequence, e.g., if a dosing regimen includes administration of a composition and an antiviral agent, a sequential dosing regimen may include administering the composition before, at the same time, substantially at the same time, or after administration of the antiviral agent, but both agents are administered in a regular order or sequence. The term "separate" means spaced apart from one another, unless otherwise specified. The term "concurrently" means occurring or taking place at the same time, i.e., the agents of the present invention are administered at the same time, unless otherwise specified. The term "substantially simultaneously" means that the agents are administered within minutes of each other (e.g., within 10 minutes of each other), and is intended to encompass both conjoint administration and sequential administration, but when administration is sequential, the administration is separated in time by only a short period of time (e.g., the time it takes a medical professional to administer two compounds separately). As used herein, simultaneous administration and substantially simultaneous administration are used interchangeably. Sequential administration refers to the administration of the agents described herein separated in time.

[0111] Combination therapy can also include administering the agents described herein in further combination with other biologically active ingredients and non-pharmaceutical therapies. It is understood that any combination of the compositions described herein with a second therapeutic agent can be used in any order to treat the target disease.

[0112] Efficacy of treatment for a target disease / disorder can be assessed by methods well known in the art.

[0113] In some embodiments, either the modified siRNA or the anti-HIF1a interfering RNA can be used to suppress expression of a target gene in vitro. To carry out such a method, the modified siRNA or the anti-HIF1a interfering RNA (e.g., via an encoding nucleic acid, such as a vector) can be contacted with cells cultured in vitro for research purposes, such as, for example, studying disease mechanisms and / or validating drug candidates.

[0114] V.Kit The present disclosure may be used alone or as a component of a kit having at least one of the reagents necessary to perform in vitro or in vivo introduction of siRNA for testing samples and / or subjects.

[0115] For example, preferred components of the kit include the modified siRNA molecules of the present disclosure and a vehicle that facilitates introduction of the siRNA into a cell of interest as described herein (e.g., using lipid and other transfection methods known in the art, see, e.g., Beigelman et al., U.S. Patent No. 6,395,713).

[0116] The kits may also be used for determining gene function and / or activity, or for target validation in drug optimization, drug discovery, and the like (see, e.g., Usman et al., U.S. Application No. 60 / 402,996). Such kits may also include instructions that enable a user of the kit to practice the present disclosure. Such kits may optionally include one or more of the second therapeutic agents also described herein.

[0117] In some embodiments, the kit can include instructions for use with any of the methods described herein. The kit can further include instructions for selecting an individual suitable for treatment based on identifying the individual as having or at risk for a disease.

[0118] The instruction for using modified siRNA molecule to achieve intended therapeutic effect generally includes information on dosage, administration schedule and administration route for intended treatment.Container can be unit dose, bulk package (e.g., multi-dose package), or sub-unit dose.The instruction provided in the kit of the present disclosure is typically written instruction on label or package insert (e.g., paper sheet included in the kit), but machine-readable instruction (e.g., instruction carried on magnetic or optical memory disk or QR code) is also acceptable.

[0119] The label or package insert may indicate that the composition is used for its intended therapeutic utility. Instructions for practicing any of the methods described herein may be provided.

[0120] The kit of the present disclosure is in suitable packaging. Suitable packaging includes, but is not limited to, chambers, vials, bottles, jars, and flexible packaging (e.g., sealed Mylar or plastic bags), etc. Also contemplated are packages for use in combination with certain devices, such as inhalers, nebulizers, ventilators, nasal administration devices (e.g., atomizers), or injection devices, such as mini-pumps. The kit may have a sterile access port (e.g., the container may be an intravenous solution bag or vial with a stopper that can be pierced by a hypodermic needle). The container may also have a sterile access port (e.g., the container may be an intravenous solution bag or vial with a stopper that can be pierced by a hypodermic needle).

[0121] The kit may optionally provide additional components such as buffers and interpretive information. Typically, the kit comprises a container and a label or package insert on or associated with the container. In some embodiments, the disclosure provides an article of manufacture comprising the contents of the kit described above.

[0122] Common techniques The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of those in the art. Such techniques are described in Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press, Oligonucleotide Synthesis (MJ Gait, ed. 1984), Methods in Molecular Biology, Humana Press, Cell Biology: A Laboratory Notebook (JECellis, ed., 1989) Academic Press, Animal Cell Culture (RIFreshney, ed. 1987), Introuction to Cell and Tissue Culture (JP Mather and PE Roberts, 1998) Plenum Press, Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JBGriffiths, and DG Newell, eds. 1993-8) J. Wiley and Sons, Methods in Enzymology (Academic Press, Inc.), Handbook of Experimental Immunology (DMWeir and CCBlackwell, eds.), Gene Transfer Vectors for Mammalian Cells (JMMiller and MP Calos, eds., 1987), Current Protocols in Molecular Biology (FMAusubel, et al. eds. 1987), PCR: The Polymerase Chain Reaction, (Mullis, et al., eds. 1994), Current Protocols in Immunology (JEColigan et al., eds., 1991), Short Protocols in Molecular Biology (Wiley and Sons, 1999), Immunobiology (C.A. Janeway and P. Travers, 1997), Antibodies (P. Finch, 1997), Antibodies: a practice approach (D. Catty., ed., IRL Press, 1988 - 1989), Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000), Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999), The Antibodies (M. Zanetti and J.D. Capra, eds. Harwood Academic Publishers, 1995), DNA Cloning: A practical Approach, Volumes I and II (D.N. Glover ed. 1985), Nucleic Acid Hybridization (B.D. Hames & S.J. Higgins eds. (1985.

Number

Number

Number

Number

[0123] Without further elaboration, it is believed that one skilled in the art can utilize the present disclosure to its fullest extent based on the above description. Accordingly, the following specific embodiments are to be construed as merely illustrative, and not limiting of the remainder of the disclosure in any way. All publications mentioned herein are incorporated by reference for the purpose or subject matter referred to herein. EXAMPLES

[0124] Example 1: Investigation of off-target effects of modified siRNA molecules Seven siRNA candidates, listed in Table 1, were synthesized and screened for assessment of transcriptome-wide off-target effects. In addition to PS linkages introduced at the 5' and / or 3' ends of the antisense strand to resist enzymatic degradation, PS linkages were also incorporated into the seed region of the antisense strand, as shown in Table 1. [Table 1]

[0125] Human hepatocyte HL-7702 cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum. Human hepatocellular carcinoma (HepG2) cells were cultured in Minimum Essential Medium (Gibco, ThermoFisher Scientific) containing 10% fetal bovine serum (Gibco, ThermoFisher Scientific).

[0126] Briefly, the siRNA candidates listed in Table 1 were transfected into human hepatocellular carcinoma HepG2 cell line or human hepatocyte HL-7702 cell line to compare the off-target effects caused by these siRNAs. HepG2 cells were seeded in 24-well culture plates and transfected with siRNA candidates for 24 hours. After 24 hours of transfection, total RNA was isolated from the siRNA-transfected cells to evaluate the knockdown efficiency of HIF1A mRNA using RT-qPCR.

[0127] For off-target analysis, HL-7702 cells were seeded in 6-well culture plates and transfected with siRNA for 24 h. Total RNA was then isolated and genome-wide RNA sequencing was performed to assess off-target effects across the transcriptome.

[0128] For RNA-seq experiments, HL-7702 cells were cultured at 2 × 10 5 Cells / well were seeded in 6-well culture plates and incubated for 18 hours. Each siRNA candidate (10 nM) was then transfected into HL-7702 cells using Lipofectamine RNAiMAX (9ul / well, Thermo Fisher Scientific) according to the manufacturer's protocol. After 24 hours of transfection, cells were washed twice with 1x dPBS and solubilized in TRIzol reagent (Thermo Fisher Scientific). Total RNA was extracted according to the manufacturer's instructions. Total RNA was extracted and treated with DNase to avoid genomic DNA contamination.

[0129] The purity (A260 / A280 and A260 / A230 ratios) and quality (RIN ≥ 8.0) of extracted RNA were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific) and an Agilent Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA). The quality of all extracted RNA samples was A260 / A280 ≥ 1.9, A260 / A230 ≥ 2, and RIN = 10.0. RNA-seq libraries were prepared using Truseq Stranded Total RNA Library Prep Gold (Illumina) and sequenced on a NovaSeq6000 sequencer (Illumina) according to the manufacturer's instructions. An average of 84.5 million reads per sample were obtained from 2 × 150 bp paired-end sequencing. Raw RNA reads were sorted using SeqPrep and Sickle with a minimum average quality score of 20. Sorted reads were aligned to the human genome (GRCh.38.p13) using HISAT2 and then assembled using StringTie. Gene expression levels were qualified by RSEM and normalized by fragments per kilobase per million mapped reads (FPKM). Differential gene expression analysis was performed by DEGseq. Genes with a false discovery rate (FDR) ≦ 0.001 and a fold change ≧ 2 were identified as differentially expressed genes (DEGs).

[0130] Genome-wide RNA sequencing comparing non-siRNA-treated (untreated) and HIF1A siRNA-treated cells was performed to determine whether the PS linkage at positions 5–8 of the siRNA antisense strand had any major effect on off-target events.

[0131] As shown in Figure 1, 34 to 74 down-regulated genes were observed between treated and untreated cells. The number of down-regulated genes caused by AI3-A-PS6 (34 genes) was reduced by 47% compared with that caused by AI3-A-PS1 (64 genes), which does not contain PS bonds at positions 5 to 8 of the antisense strand.

[0132] Example 2: Investigation of target gene knockdown efficiency by RT-qPCR The knockdown efficiency of the siRNA candidates listed in Table 1 was determined by RT-qPCR. Briefly, HepG2 cells were cultured at 5×10 5 Cells / well were seeded in 24-well culture plates. Each siRNA candidate (10 nM) was then transfected into HepG2 cells using Lipofectamine RNAiMAX (3 ul / well). After 24 hours of transfection, total RNA was isolated using the RNeasy kit (Qiagen) according to the manufacturer's protocol.

[0133] HIF1A mRNA levels were quantified using one-step real-time quantitative PCR with the iTaq Universal Probes One-Step Kit (Bio-Rad) performed on a LightCycler 480 (Roche Diagnostics). Primers and probes for HIF1A were from predesigned PrimeTime qPCR assays (Integrated DNA Technologies). Each sample was assayed in triplicate to determine the mean threshold cycle (Ct) value. Gene expression fold change was calculated using the ΔΔCt method. HIF1A mRNA was normalized to constitutively expressed GAPDH mRNA as shown in Figure 2.

[0134] As shown in Figure 2, the knockdown efficiency of siRNA AI3-A-PS2 to siRNA AI3-A-PS7 was similar after normalization with siRNA AI3-A-PS1-treated cells. PS bonds at positions 5-8 of the siRNA antisense strand do not affect the knockdown efficiency of siRNA.

[0135] Example 3: Development of anti-HIF1A siRNA with high knockdown efficiency This example reports the identification of anti-HIF1A siRNAs that are highly efficient at interfering with HIF1A expression.

[0136] Design of candidate anti-HIF1A siRNA siRNA candidates (anti-HIF1A siRNAs) targeting human HIF1A mRNA sequence (GenBank No. NM_001530.4) were designed and then selected with low off-target potential based on: (1) low cross-reactivity to human mRNA database, and (2) low number of essential genes predicted to be targeted by the siRNA candidates. A first set of siRNAs was synthesized and duplexed as shown in Table 3 below. A first set of HIF1A siRNAs (Table 3 below) was screened for HIF1A mRNA suppression in HepG2 cells. HepG2 cells were transfected with these siRNAs for 24 hours. HIF1A expression was then measured using real-time qPCR.

[0137] Cultivation of HepG2 cells Human hepatocellular carcinoma (HepG2) cell line was cultured in minimum essential medium (Gibco, ThermoFisher Scientific, USA) containing 10% fetal bovine serum (Gibco, ThermoFisher Scientific, USA), 200 units / mL penicillin + 200 units / mL streptomycin at 37°C and 5% CO2.

[0138] siRNA transfection HepG2 cells were cultured in a 24-well culture plate at 5 × 105 Cells / well were seeded. After 18 hours of incubation, the medium was replaced with 500 μl of fresh growth medium. The siRNA and RNAiMax complex composition for each well was prepared as follows: (1) 1 ul of siRNA was added to 50 ul of Opti-MEM, (2) 1.5 ul of RNAiMax was added to 50 ul of Opti-MEM, and (3) (1) and (2) were mixed gently and incubated at room temperature for 10 minutes. Transfection was performed by adding 100 ul of siRNA / RNAiMax complex to each well. The cells were then incubated for 24 hours before RNA purification.

[0139] RT-qPCR Total RNA was isolated using the RNeasy kit (Qiagen) according to the manufacturer's protocol. HIF1A mRNA levels were quantified using one-step real-time quantitative PCR with the iTaq Universal Probes One-Step Kit (Bio-Rad) run on a LightCycler 480 (Roche Diagnostics). RT-qPCR was run in triplicate in a 384-well plate with 50 ng total RNA, 500 nM of each forward primer, reverse primer and probe, 0.25 ul of reverse transcriptase, and 2× iTaq Master Mix in a total volume of 10 ul. Primers and probes for HIF1A and GAPDH (Table 2) were synthesized from Integrated DNA Technologies. Cycling conditions followed the manufacturer's recommended cycling parameters: 50°C for 10 min, 95°C for 2 min, and 40 cycles of 95°C for 15 s and 60°C for 1 min. Gene expression fold changes were calculated using the ΔΔCt method. HIF1A mRNA was normalized to constitutively expressed GAPDH mRNA. [Table 2]

[0140] result In the first round of screening, HepG2 cells were treated with 30 nM of HIF1A siRNA. The results are shown in Table 3. The relative expression rate of HIF1A mRNA in HepG2 cells treated with siRNA is expressed as %HIF1A mRNA compared to the control treated with RNAiMax only but not with siRNA. [Table 3]

[0141] Duplexes No. 3, 7, and 10 were further modified as listed in Table 4. The second round of screening was performed in HepG2 cells treated with 1 nM siRNA. siRNA transfection and RT-qPCR were performed as described above. The HIF1A expression levels induced by each siRNA duplex are shown in Table 4. [Table 4]

[0142] Example 4: Effect of anti-siRNA in human HepG2 xenograft mice The knockdown effect of an exemplary anti-HIF1A siRNA (AI3-UM4, also known as AI3) in a xenograft animal model was investigated as follows: HepG2 cells were subcutaneously inoculated into 4-week-old female M-NSG mice. 3 When the tumor reached an average volume of 100 μg / kg, the mice were randomly divided into two groups according to tumor size (n=3 in each group), and then subcutaneously injected with PBS (vehicle) or HIF1A siRNA (10 mg / Kg) on ​​days 1, 3, 7, and 14. AI3-UM4 (AI3) was used in this study as an example.

[0143] After 21 days, mice were sacrificed and total RNA was extracted from tumor xenografts using the RNeasy kit (Qiagen) according to the manufacturer's protocol. Relative expression of HIF1A mRNA was quantified by RT-qPCR as previously described. Expression levels of HIF1A in human HepG2 tumor xenografts are presented in Figure 3A. After normalization with the control (treated with vehicle), HIF1A mRNA levels treated with HIF1A siRNA (10 mg / Kg AI3) were reduced by 52% in human hepatocellular carcinoma cells.

[0144] Furthermore, the anti-tumor growth effect of the exemplary anti-HIF1A siRNA was investigated in a xenograft mouse model. 3 ) were prepared and divided into two groups as described above. Vehicle and HIF1A siRNA were subcutaneously injected into the mice on days 1, 3, 7, and 14. The length and width of the tumor in each mouse were measured twice a week for 3 weeks. The tumor volume was calculated as L×W2×0.5. Relative tumor volume (%) is defined as the percentage of the tumor volume at each time point to the initial tumor volume of each mouse (at the initial time point of administration). In Figure 3BA, administration of HIF1A siRNA (10 mg / Kg AI3) significantly reduced the tumor volume in human hepatocellular carcinoma cells by 49%.

[0145] Other embodiments All of the features disclosed herein may be combined in any combination. Each feature disclosed herein may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar functionality.

[0146] From the above description, those skilled in the art can easily ascertain the essential features of the present disclosure, and can make various changes and modifications to the present disclosure to adapt the present invention to various uses and conditions without departing from the spirit and scope of the present invention. Accordingly, other embodiments are also within the scope of the claims.

[0147] Equivalent While several inventive embodiments have been described and illustrated herein, various other means and / or structures for performing the functions described herein and / or obtaining one or more of the results and / or advantages described herein will readily occur to those skilled in the art, and each such variation and / or modification is intended to be within the scope of the inventive embodiments described herein. In general, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are intended to be exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the specific application or applications in which the inventive teachings are used. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific inventive embodiments described herein. Thus, it is understood that the above-described embodiments are presented by way of example only, and that within the scope of the appended claims and their equivalents, inventive embodiments may be practiced otherwise than as specifically described and claimed. Inventive embodiments of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods is included within the inventive scope of the present disclosure, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent.

[0148] As defined and used herein, all definitions should be understood to take precedence over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0149] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may include the entire document.

[0150] As used in the specification and claims, the indefinite articles "a" and "an" should be understood to mean "at least one," unless clearly indicated to the contrary.

[0151] As used in the present specification and claims, the phrase "and / or" should be understood to mean "either or both" of the elements so conjoined, i.e., the elements are present conjunctively in some cases and non-conjunctively in other cases. Multiple elements listed with "and / or" should be interpreted in the same manner, i.e., "one or more" of the elements are so conjoined. Other elements other than the elements specifically identified by the "and / or" phrase may optionally be present, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, a reference to "A and / or B," when used in conjunction with open-ended language such as "comprising," may refer in one embodiment to only A (optionally including elements other than B), in another embodiment to only B (optionally including elements other than A), in yet another embodiment to both A and B (optionally including other elements), and so forth.

[0152] As used herein and in the claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" is interpreted as being inclusive, i.e., including at least one of, but also including two or more of, some elements or lists of elements, and optionally including additional items not listed. Only terms clearly indicated to the contrary, e.g., "only one of," or "exactly one of," or when used in the claims, "consisting of" refers to including exactly one element of, some elements or lists of elements. In general, as used herein, the term "or" is only interpreted as indicating exclusive alternatives (i.e., "one or the other, but not both") when preceded by a term of exclusivity, e.g., "either," "one of," "only one of," or "exactly one of." When used in the claims, "consisting essentially of" has its ordinary meaning as used in the field of patent law.

[0153] As used in this specification and claims, the phrase "at least one," in reference to a list of one or more elements, should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily including at least one of each and every element specifically listed in the list of elements, and not excluding any combination of elements in the list of elements. This definition also allows for elements other than the elements specifically identified in the list of elements and referred to by the phrase "at least one," whether related or unrelated to the elements specifically identified, may optionally be present. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B" or, equivalently, "at least one of A and / or B") can refer to, in one embodiment, at least one, optionally, two or more As, and no B (optionally including elements other than B); in another embodiment, at least one, optionally, two or more Bs, and no A (optionally including elements other than A); in yet another embodiment, at least one, optionally, two or more As, and at least one, optionally, two or more Bs (optionally including other elements); etc.

[0154] Also, unless expressly stated to the contrary, in any method claimed herein that includes two or more steps or actions, it should be understood that the order of the method steps or actions is not necessarily limited to the order in which the method steps or actions are recited.

Claims

**Claim 1** A modified small interfering RNA (siRNA) molecule comprising a sense strand and an antisense strand, wherein the antisense strand contains phosphorothioate (PS) internucleotide linkages between the nucleotide at position 5 and the nucleotide at position 6 and / or between the nucleotide at position 6 and the nucleotide at position 7, and the modified siRNA has a reduced off-target effect compared to a siRNA counterpart that does not have PS internucleotide linkages between the nucleotide at position 5 and the nucleotide at position 6 and between the nucleotide at position 6 and the nucleotide at position 7. A modified siRNA molecule. **Claim 2** The modified siRNA molecule according to claim 1, wherein the antisense strand further contains PS internucleotide linkages between the nucleotide at position 1 and the nucleotide at position 2 and / or between the nucleotide at position 2 and the nucleotide at position 3. **Claim 3** The modified siRNA molecule according to claim 1, wherein the antisense strand is 19-25 nucleotides in length. **Claim 4** The modified siRNA molecule according to claim 1, wherein the antisense strand further contains PS internucleotide linkages between the first nucleotide and the second nucleotide at the 3'-end and / or between the second nucleotide and the third nucleotide at the 3'-end. **Claim 5** The modified siRNA molecule according to claim 3, wherein the antisense strand is 21 nucleotides in length. **Claim 6** The modified siRNA according to claim 5, wherein the antisense strand further contains PS internucleotide linkages between the nucleotide at position 19 and the nucleotide at position 20 and / or between the nucleotide at position 20 and the nucleotide at position 21. **Claim 7** The modified siRNA molecule according to any one of claims 1-6, wherein the modified siRNA molecule silences the expression of a pathogenic gene or a disease gene. **Claim 8** The pathogenic gene is a bacterial gene, a viral gene, or a fungal gene; or The disease gene is involved in cancer, fibrosis, metabolic diseases, cardiovascular diseases, immune diseases, or genetic disorders; The modified siRNA molecule according to claim 7. **Claim 9** The modified siRNA molecule silences the expression of a disease gene, The disease gene is a gene involved in cancer selected from the group consisting of HIF1A, HIF2, IGF1R, VEGF, EREG, KRAS, ALK, BRAF, NRAS, STAT3, CDH2, KIFL1, PIK3CA, Src, RAS, RAF, and TP53; a gene involved in fibrosis selected from the group consisting of HIF1A, HIF1B, HIF2, TGF-β1, and CTGF; a gene involved in a metabolic disease or a cardiovascular disease selected from the group consisting of AGT, ApoC-III, and apoB; a gene involved in an immune disease selected from the group consisting of GATA-3, CCR3, TGF-β1, IL-6, TNF-α, IFN-γ, IL-1β, CCL2, and CCL10; or a gene involved in a genetic disorder, which is apoB or PCSK9; which is the modified siRNA molecule according to claim 8.

10. The modified siRNA molecule according to any one of claims 1 to 6, which is associated with a targeting moiety.

11. A pharmaceutical composition comprising the modified siRNA molecule according to any one of claims 1 to 6 and a pharmaceutically acceptable carrier.

12. A pharmaceutical composition for use in the treatment of a target disease, which comprises the modified siRNA molecule according to claim 8, wherein the target disease is selected from the group consisting of a bacterial infection, a viral infection, a fungal infection, cancer, fibrosis, a metabolic disease, a cardiovascular disease, an immune disease, and a genetic disorder. Pharmaceutical composition.

13. An in vitro method for silencing a target gene in a cell, which comprises contacting the cell expressing the target gene with the modified siRNA molecule according to any one of claims 1 to 6 or a pharmaceutical composition comprising the modified siRNA molecule.

14. An interfering RNA targeting human hypoxia-inducible factor 1 subunit alpha (HIF1α), wherein the interfering RNA comprises a nucleotide sequence complementary to a target site in HIF1α mRNA, and the target site in the HIF1α mRNA is a) AGGCCACAUUCAACGUAUAU (SEQ ID NO: 1), b) UGAGGAACUACCAAUUAUAU (SEQ ID NO: 2), c) CCGGUUGAAUCUUCAGAU (SEQ ID NO: 3), d) GCGCAAGUCCUCAAAGCAC (SEQ ID NO: 4), e) AGGCCACAUUCAACGUAU (SEQ ID NO: 5), or An interfering RNA comprising the nucleotide sequence of (f) UGAGGAAGUACC AUUAUA (SEQ ID NO: 6). An interfering RNA comprising the nucleotide sequence of. **Claim 15** The interfering RNA according to claim 14, wherein the interfering RNA is a small interfering RNA (siRNA) comprising a sense strand and an antisense strand. **Claim 16** The sense strand and the antisense strand each have the following nucleotide sequences: (a) 5'-AGGC CACAUU CACGUAUAA-3' (SEQ ID NO: 7) and 5'-UU AUA CGU GAA UGU GGC CUGU-3' (SEQ ID NO: 8); or (b) 5'-UGAGGAAGUACC AUUAUA A-3' (SEQ ID NO: 9) and 5'-UU AUA AAU GGU ACU UCC UCA AU-3' (SEQ ID NO: 10); The interfering RNA according to claim 14, comprising. **Claim 17** The interfering RNA according to any one of claims 14 to 16, wherein the interfering RNA comprises one or more modified nucleotides. **Claim 18** The interfering RNA according to any one of claims 14 to 16, wherein the one or more modified nucleotides comprise 2'-fluoro, 2'-O-methyl, or a combination thereof. **Claim 19** The interfering RNA according to claim 14, having the modification pattern described in any one of claims 1 to 6. **Claim 20** The interfering RNA according to claim 16, having the modification pattern described in any one of claims 1 to 6. **Claim 21** A pharmaceutical composition comprising the interfering RNA targeting human HIF1α according to any one of claims 14 to 16 and a pharmaceutically acceptable carrier. **Claim 22** A pharmaceutical composition for use in the treatment of a disease associated with HIF1α, comprising the interfering RNA targeting human HIF1α according to any one of claims 14 to 16 and a pharmaceutically acceptable carrier, wherein the disease associated with HIF1α is cancer, heart disease, lung disease, liver disease, kidney disease, obesity, or diabetes. A pharmaceutical composition. **Claim 23** An in vitro method for suppressing the expression of human HIF1α in cells, comprising contacting a cell expressing human HIF1α with an effective amount of the interfering RNA according to any one of claims 14 to 16.