Method for detecting a target polynucleotide in a sample
Patent Information
- Application Number
- JP2024516382
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-09-13
- Filing Date
- 2022-09-11
- Publication Date
- 2025-08-28
AI Technical Summary
Existing methods for detecting low-frequency genetic mutations in a mixture of target and non-target polynucleotides suffer from low sensitivity and specificity, making it difficult to accurately determine the presence of mutant DNA when it is present at very low concentrations compared to wild-type DNA.
A method involving PCR amplification using high-fidelity DNA polymerases and blocking oligonucleotides that selectively inhibit the amplification of non-target polynucleotides, resulting in a >700-fold enrichment of target polynucleotides, allowing for accurate detection even when they represent less than 0.125% of the mixture.
The method achieves high sensitivity and specificity in detecting target polynucleotides, enabling accurate diagnosis and prognosis of diseases associated with genetic modifications, such as cancer, by enriching the target polynucleotides to greater than 99% of the sequenced amplification product.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority under 35 U.S.C. §119(e) to U.S. Provisional Application No. 63 / 243,390, filed September 13, 2021, the contents of which are incorporated herein by reference in their entirety.
[0002] The field of the present invention relates to a method for detecting a target polynucleotide in a sample that comprises a mixture of target polynucleotide and non-target polynucleotide.Specifically, the field of the present invention relates to a method for detecting a target polynucleotide that comprises a genetic modification relative to a reference polynucleotide in a sample that comprises a mixture of target polynucleotide and reference polynucleotide, and the target polynucleotide represents a relatively small proportion of the mixture.The method can be applied to the diagnosis, prognosis and treatment of subjects with diseases or disorders associated with genetic modification. [Background technology]
[0003] Genetic mutations and epigenetic modifications are known to be associated with cancer and other diseases. The ability to detect genetic mutations and epigenetic modifications in cell-free DNA using minimally invasive samples can be used in many different diagnostic areas, such as companion diagnostics, minimal residual disease monitoring, cancer recurrence monitoring, or as a prospective aid in cancer diagnosis.
[0004] Specifically, early diagnosis of cancer, cancer recurrence, or treatment-resistant mutations can improve patient outcomes. Low sensitivity is important for early diagnosis because mutant DNA represents a small percentage of DNA in biological samples compared to wild-type DNA. High specificity is also important because it negatively impacts the patient's health when they undergo unnecessary cancer treatments, such as chemotherapy, based on a false-positive diagnosis.
[0005] When mutant DNA may be present at very low concentrations compared to wild-type DNA in a sample containing a mixture of mutant and wild-type DNA, one challenge to genetic diagnosis remains accurately determining the presence or absence of a mutation. There are many methods developed to detect low-frequency mutations, such as digital droplet PCR, RT-PCR with modified oligonucleotides, BEAMing, deep sequencing, and next-generation sequencing (NGS). Although these methods have been shown to have very low sensitivity, one drawback of these methods is that they cannot achieve low specificity combined with high sensitivity. Specifically, next-generation sequencing (NGS) alone cannot accurately determine the presence or absence of a low percentage of variants with NGS, in part because the error rate of single-base mutations is too high. Despite all attempts to accurately determine the presence of mutant DNA in abundant wild-type DNA, there is still a need for better methods.
[0006] Accuracy includes both specificity, which reduces false positives, and sensitivity, which reduces false negatives. A threshold is used to define the barrier between negative samples, where the mutation is absent, and positive samples, where the mutation is present. This threshold is used to calculate the specificity and sensitivity of the method used to detect the mutation. Similarly, the signal-to-noise ratio can be used to evaluate the accuracy of the method, where the signal represents the results when the mutation is present, and the noise represents the results when the mutation is absent. The greater the separation of the signal and the noise, the more accurate the method.
[0007] One approach to increase the signal-to-noise ratio is to enrich the sample for mutants. Enrichment may involve preferentially inhibiting or preventing the replication of wild-type DNA over mutant DNA during PCR. In such enrichment, each cycle of PCR results in a higher proportion of mutants being present compared to the previous cycle. However, so far, enrichment methods have not been able to achieve adequate sensitivity and specificity.
[0008] Therefore, there remains a need to accurately detect mutant DNA segments when they are present at a low rate. This would benefit patients, especially with regard to cancer diagnosis, by using liquid biopsy to determine the presence or absence of specific mutations associated with cancer. This could be applied to various cancer diagnostic areas, such as companion diagnostics, minimal residual disease, cancer recurrence, or prospective support for cancer diagnosis. Summary of the Invention [Means for solving the problem]
[0009] The inventors have discovered a method for detecting a target polynucleotide in a sample comprising a mixture of target polynucleotides and non-target polynucleotides, where the target polynucleotide represents a relatively small proportion of the mixture. The inventors' method can be utilized to selectively enrich the target polynucleotide via amplification relative to the non-target polynucleotides, and accurately detect the target polynucleotide via sequencing when the target polynucleotide is present in less than 10 copies and the target polynucleotide represents less than about 0.125% of the mixture comprising the target polynucleotides and the non-target polynucleotides. In some embodiments, the inventors' method achieves an enrichment where the target polynucleotide represents more than about 99% of the sequenced amplification products (i.e., more than about 99% of the sequencing reads) after the sample is subjected to the inventors' amplification method and sequenced, which is more than 700-fold enrichment.
[0010] In some embodiments, the disclosed method may be carried out to detect a target polynucleotide comprising a genetic modification relative to a reference polynucleotide in a sample comprising a mixture of a target polynucleotide and a reference polynucleotide, and the reference polynucleotide is a non-target polynucleotide in the disclosed method. The method may be utilized to detect a target polynucleotide with high sensitivity and high selectivity in a mixture of a target polynucleotide and a reference polynucleotide, where the target polynucleotide is present in a sample at a relatively low concentration (e.g., less than 10 copies), and the target polynucleotide represents a low proportion (e.g., less than about 0.125% of the mixture) of the mixture comprising the target polynucleotide and the reference polynucleotide. The method may be adapted to diagnose, prognose, and treat a subject with a disease or disorder associated with the detected genetic modification.
[0011] The disclosed methods typically involve performing a polymerase chain reaction (PCR) amplification product, which is then sequenced, to detect the target polynucleotide. The PCR reaction typically comprises: (i) a sample or a fraction of a sample; (ii) a PCR product lacking 5' to 3' nuclease activity and comprising 3' to 5' nuclease activity (i.e., 3' to 5' proofreading activity), preferably at about 10 -6 The method includes a thermostable DNA polymerase having an error rate of less than 100 ng / ml (i.e., a high fidelity DNA polymerase), (iii) a pair of primers flanking the genetic modification detected by the method, and (iv) a blocking oligonucleotide that selectively hybridizes to a reference polynucleotide that lacks the genetic modification to form a blocking duplex (the reference polynucleotide is a non-target polynucleotide), thereby enhancing the selective blocking amplification of the reference polynucleotide and the amplification of the target polynucleotide. After the amplification is performed, the amplification product thus obtained may be subjected to sequencing to detect the target polynucleotide. The disclosed method achieves a significant level of enrichment, and the target polynucleotide may represent more than 99% of the sequenced amplification products (i.e., more than about 99% of the sequencing reads), representing an enrichment of more than 700 times.
[0012] Also disclosed herein are kits for carrying out the disclosed methods. The disclosed kits include a kit for carrying out the disclosed methods, the kits comprising: (i) a 5' to 3' nuclease activity-devoid and a 3' to 5' nuclease activity (i.e., a 3' to 5' proofreading activity) that is devoid of 5' to 3' nuclease activity, and preferably has about 10 -6 The method may include one or more components selected from: (iii) a thermostable DNA polymerase having an error rate of less than 100 ng / ml (i.e., a high fidelity DNA polymerase); (iv) a pair of primers flanking the genetic modification to be detected by the method; and (iv) a blocking oligonucleotide that selectively hybridizes to a reference polynucleotide lacking the genetic modification to form a blocking duplex (the reference polynucleotide is a non-target polynucleotide), thereby selectively blocking amplification of the reference polynucleotide and increasing amplification of the target polynucleotide.
[0013] The disclosed methods and kits can be utilized for subjects in need of diagnosis, prognosis, and treatment, such as subjects having or suspected of having a disease or disorder. In particular, the disclosed methods and kits can be utilized for diagnosing, prognosing, and treating subjects having or suspected of having cancer. Subjects suitable for the disclosed methods can include cancer patients currently in remission. [Brief description of the drawings]
[0014] [Figure 1] A mixed sample containing less than 0.25% KRAS G12C DNA and more than 99.75% KRAS wild-type DNA was amplified and sequenced in the absence of blocking oligonucleotides. 174,398 reads were determined to contain the wild-type nucleotide (99.69%), 490 reads contained the KRAS G12C nucleotide (0.28%), and 52 reads contained neither the wild-type nucleotide nor the KRAS G12C nucleotide (0.03%).
[0015] [Diagram 2]A mixed sample containing less than 0.25% KRAS G12C DNA and more than 99.75% KRAS wild-type DNA was amplified and sequenced in the presence of blocking oligonucleotides. 464 reads were determined to contain wild-type nucleotides (0.6%), 76842 reads contained KRAS G12C nucleotides (99.37%), and 31 reads contained neither wild-type nor KRAS G12C nucleotides (0.04%). These results show that the presence of LNA blockers enriched the sample by about 354 times and increased raw reads by about 157 times. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0016] The invention is described herein throughout this application using several definitions, which are set forth below.
[0017] Unless otherwise specified or dictated by context, the terms "a," "an," and "the" mean "one or more." For example, "a target nucleic acid" should be interpreted as meaning "one or more target nucleic acids."
[0018] As used herein, "about," "approximately," "substantially," and "significantly" will be understood by those of ordinary skill in the art and will vary to some extent in the context in which they are used. If these terms are used in a way that is unclear to those of ordinary skill in the art in the context in which they are used, "about" and "approximately" will mean plus or minus 10% or less of the particular term, and "substantially" and "significantly" will mean plus or minus more than 10% of the particular term.
[0019] As used herein, the terms "include" and "including" have the same meaning as the terms "comprise" and "comprising." For example, "a method that includes the steps" should be interpreted to mean "a method that comprises the steps." The terms "comprise" and "comprising" should be interpreted as "open" transitional terms that allow for the inclusion of additional elements beyond those recited in the claims. The terms "consist" and "consisting of" should be interpreted as "closed" transitional terms that do not allow for the inclusion of additional elements other than those recited in the claims. The term "consisting essentially of" should be interpreted as partially closed, allowing for the inclusion of only additional elements that do not fundamentally change the nature of the claimed subject matter.
[0020] It is also to be understood that, unless expressly indicated to the contrary, in any method claimed herein that includes two or more steps or actions, the order of the method steps or actions is not necessarily limited to the order in which the method steps or actions are recited.
[0021] The action verb "may" refers to a preferred use or selection of one or more options or choices among several described embodiments or features contained therein. When no options or choices are disclosed with respect to a particular embodiment or feature contained therein, the action verb "may" refers to a positive action regarding how to make or use an aspect of the described embodiment or features contained therein, or a definitive decision to use a particular skill with respect to the described embodiment or features contained therein. In this latter context, the action verb "may" has the same meaning and connotation as the auxiliary verb "can."
[0022] As used herein, the term "subject", which may be used interchangeably with the term "patient" or "individual", refers to a person receiving medical care, treatment or therapy and may include human subjects. As used herein, the term "subject" is meant to include a person who has and / or is at risk of developing a disease or disorder characterized by a nucleic acid alteration at one or more genetic loci associated with the disease or disorder, such as a genetic mutation associated with the disease or disorder. The term "subject" is meant to include a person who has and / or is at risk of developing a cell proliferative disease or disorder, such as cancer. The term "subject" is meant to include a person who has been diagnosed with cancer and is currently in remission. It results in the methylation status of one or more genes associated with the disease or disorder or characterized by a genetic mutation associated with the disease or disorder. The "methylation status" of a gene may include, for example, the "methylation status" of the promoter of the gene relative to a control gene.
[0023] As used herein, a subject in need thereof may include a subject having or at risk of developing a disease or disorder, including, but not limited to, a cell proliferative disease or disorder (e.g., cancer such as breast cancer, prostate cancer, colon cancer, lung cancer, gallbladder cancer, brain cancer, uterine cancer, ovarian cancer, head and neck cancer, gastric cancer, liver cancer, leukemia, and lymphoma), a neurodegenerative disease or disorder (e.g., Alzheimer's disease, Parkinson's disease, and Huntington's disease), a psychiatric disease or disorder (e.g., schizophrenia and depression), a metabolic disease or disorder (e.g., type 1 or type 2 diabetes), a cardiovascular disease or disorder (e.g., myocardial infarction or stroke), an inflammatory disease or disorder (e.g., arthritis), and an immune disease or disorder. In some embodiments, the subject has been diagnosed with cancer and is currently in remission.
[0024] The disclosed method can be utilized to perform a diagnosis or prognosis on a subject in need of such a diagnosis or prognosis based on detecting changes in one or more genetic loci associated with a disease or disorder in a sample obtained from the subject.As used herein, the term "diagnose", "diagnosis" or "diagnosing" refers to distinguishing or identifying a disease, syndrome, or condition, or distinguishing or identifying a subject who has or is at risk of developing a particular disease, syndrome, or condition.As used herein, the term "prognosis" or "prognosis" or "prognosis" refers to predicting the outcome of a disease, syndrome, condition, or treatment regimen in a subject.
[0025] The disclosed method can be used to treat the subject in need thereof.For example, the disclosed method can be used to make a diagnosis or prognosis for the subject in need thereof based on the methylation state of the promoter region of one or more genes that are associated with disease or disorder or characterized by one or more mutations associated with disease or disorder.Following the diagnosis or prognosis, the subject can be administered appropriate treatment based on the diagnosis or prognosis of disease or disorder.
[0026] The disclosed method can be utilized to characterize nucleic acids in a subject sample. The term "sample" or "subject sample" is intended to include biological samples such as tissue (e.g., tissue obtained from a biopsy) and bodily fluids. "Body fluids" can include, but are not limited to, blood, serum, plasma, saliva, cerebrospinal fluid, pleural fluid, tears, mammary gland fluid, lymphatic fluid, sputum, and semen. The sample can include nucleic acids, proteins, or both.
[0027] The method disclosed herein may be applied when performing DNA amplification of a nucleotide sample. Specifically, the method disclosed herein may be applied when performing DNA amplification of a sample that includes a mixture of a target polynucleotide that includes a genetic modification and a reference polynucleotide that lacks a genetic modification (when the reference polynucleotide is a non-target polynucleotide). The sample analyzed by the disclosed amplification method may include a mixture that includes a target polynucleotide that has one or more genetic modifications at one or more positions compared to a wild-type polynucleotide (i.e., a mutant polynucleotide) and a wild-type polynucleotide (wherein the wild-type polynucleotide is a non-target polynucleotide).
[0028] The method disclosed herein may be applied when performing DNA sequence analysis of a nucleotide sample. Specifically, the method disclosed herein may be applied when performing DNA sequence analysis of a sample that includes a mixture of a target polynucleotide that includes a genetic modification and a reference polynucleotide that lacks a genetic modification (when the reference polynucleotide is a non-target polynucleotide). The sample analyzed by the disclosed amplification method may include a mixture that includes a target polynucleotide that has one or more genetic modifications at one or more positions compared to a wild-type polynucleotide (i.e., a mutant polynucleotide) and a wild-type polynucleotide (wherein the wild-type polynucleotide is a non-target polynucleotide).
[0029] The methods disclosed herein may be applied when performing methylation analysis. For example, the methods disclosed herein may be applied when amplifying and sequencing a polynucleotide sample after the sample has been treated with an agent, such as a bisulfite agent, that selectively modifies unmethylated cytosine residues but not methylated cytosine residues. Bisulfite treatment is generally performed to convert unmethylated cytosine residues in the polynucleotide sample to uracil residues. The treated polynucleotide sample can then be utilized as a template (e.g., in a PCR amplification or sequencing reaction) for DNA synthesis in which the uracil residues are ultimately converted to thymidine residues. By performing sequencing of the treated polynucleotide sample, detection of a thymidine residue at a given position relative to a cytosine residue will indicate an unmethylated cytosine in the original sample or a methylated cytosine in the original sample, respectively. Thus, a sample analyzed with the disclosed amplification method may include a mixture including target polynucleotides with C or T / U at one or more positions, respectively, compared to non-target polynucleotides with T / U or C at one or more positions.
[0030] The methods disclosed herein can be applied to a wide variety of sequencing methods. Sequencing methods can include high-throughput or ultra-high-throughput sequencing methods. DNA sequencing processes suitable or adaptable to the disclosed methods can include, but are not limited to, sequencing by synthesis, single molecule real-time sequencing, ion semiconductor sequencing, pyrosequencing, sequencing by ligation, chain termination sequencing, massively parallel signature sequencing, polony sequencing, DNA nanoball sequencing, heliscope single molecule sequencing, Nanopore DNA sequencing, sequencing by hybridization, sequencing by mass spectrometry, microfluidic Sanger sequencing, and microscope-based sequencing techniques. Thus, the disclosed methods can be applied to conventional DNA sequencing methods based on the so-called "first generation" DNA sequencing techniques, Sanger sequencing or Maxam and Gilbert sequencing, as well as the so-called "second generation" and "third generation DNA sequencing techniques", which are more compatible with high-throughput analysis. (See, e.g., Mardis, Ann. Rev. Genomics and Human Genetics, Vol. 9:387-402 (2008); Metzker, Genome Research, (2005) 15:1767-1776; Moorthie et al., Hugo Jv5(1-4), Dec. (2011); and Schadt et al., Human Molecular, Genetics, Vol. 19, No. R2, pp. R227-2490, September 21, 2010; and Shendure et al., Nature Biotechnology 26, 1135-1145 (2008).
[0031] The disclosed technology relates to nucleic acids and the use of nucleic acids to diagnose, prognose, and / or treat diseases and disorders. The terms "nucleic acid" and "oligonucleotide" and "polynucleotide" as used herein refer to polydeoxyribonucleotides (containing 2-deoxy-ribose), polyribonucleotides (containing ribose), and any other type of polynucleotide that is an N-glycoside of a purine or pyrimidine base. As used herein, the terms "A", "T", "C", "G", and "U" refer to adenine, thymine, cytosine, guanine, and uracil, respectively, as the nucleotide bases. There is no intended distinction in length between the terms "nucleic acid", "oligonucleotide", and "polynucleotide", and these terms are used interchangeably. These terms refer only to the primary structure of the molecule. Thus, these terms include double-stranded and single-stranded DNA, as well as double-stranded and single-stranded RNA. For use in the present invention, oligonucleotides can also include nucleotide analogs in which the base, sugar, or phosphate backbone is modified, as well as non-purine or non-pyrimidine nucleotide analogs.
[0032] The oligonucleotides utilized in the disclosed methods may contain one or more modified nucleotides. The nucleotide modifications may include, but are not limited to, locked nucleic acid (LNA) or bridged nucleic acid (BNA), peptide nucleic acid, glycol nucleic acid, and threose nucleic acid.
[0033] As used herein, a "fragment" of a polynucleotide is a portion of a polynucleotide sequence that is identical in sequence to a reference sequence, but is shorter in length. A fragment can contain up to the full length of the reference sequence minus at least one nucleotide. For example, a fragment can contain 5 to 1000 contiguous nucleotides of a reference polynucleotide. In some embodiments, a fragment may comprise at least 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous nucleotides of a reference polynucleotide; in other embodiments, a fragment may comprise no more than 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 250, or 500 contiguous nucleotides of a reference polynucleotide; in further embodiments, a fragment may comprise a range of contiguous nucleotides of a reference polynucleotide bounded by any of the aforementioned values (e.g., a fragment comprising 20-50 contiguous nucleotides of a reference polynucleotide). Fragments may be preferentially selected from a particular region of a molecule. The term "at least one fragment" encompasses a full-length polynucleotide. A "variant," "mutant," or "derivative" of a reference polynucleotide sequence may include a fragment of a reference polynucleotide sequence.
[0034] Fragments of target polynucleotides and / or non-target polynucleotides (i.e., reference polynucleotides) can be generated via a PCR amplification reaction. The amplification products can include amplified fragments of the target polynucleotides and / or non-target polynucleotides (i.e., reference polynucleotides). The amplification products can include a mixture of amplified fragments of the target polynucleotides and / or non-target polynucleotides (i.e., reference polynucleotides).
[0035] With respect to a polynucleotide sequence, a "modification," "variant," "mutant," or "derivative" may be defined as a nucleic acid sequence that has a different nucleic acid sequence relative to a reference sequence, which may include a wild-type sequence. A "modification," "variant," "mutant," or "derivative" may include a substitution of one or more nucleotides (e.g., a G→t transversion), a deletion of one or more nucleotides, and / or an insertion of one or more nucleotides.
[0036] The target polynucleotide may contain a change relative to a reference sequence that is a non-target polynucleotide. For example, the target polynucleotide may contain a mutation relative to a wild-type reference sequence. In the disclosed method, the target polynucleotide is selectively amplified and detected relative to the non-target polynucleotide, which may be a wild-type reference polynucleotide.
[0037] The nucleic acids disclosed herein may be "substantially isolated or purified." The term "substantially isolated or purified" refers to a nucleic acid that has been removed from its natural environment and is at least 60% free, preferably at least 75% free, more preferably at least 90% free, and even more preferably at least 95% free from other components with which it is naturally associated. In some embodiments, a sample utilized in the disclosed methods may comprise a substantially isolated or purified nucleic acid sample.
[0038] The disclosed methods may utilize samples containing nucleic acids from any source, including animal and / or environmental sources. In some embodiments, the polynucleotide sample comprises genomic DNA. In further embodiments, the genomic DNA is treated with a reagent prior to sequencing that selectively modifies unmethylated cytosine residues in the DNA to produce detectable modified residues, but does not modify methylated cytosine residues. In yet further embodiments, the nucleotide at the nucleotide position of the polynucleotide sample is a methylated cytosine or modified residue, and the set of polynucleotide fragments comprises two or more different polynucleotide fragments having a cytosine or a thymine at the nucleotide position of the polynucleotide sample.
[0039] The disclosed method may utilize a primer that is complementary to a target polynucleotide and / or a non-target polynucleotide (i.e., a reference polynucleotide). The disclosed method may also utilize a blocking oligonucleotide that is complementary to a non-target polynucleotide and not complementary to a target polynucleotide at one or more nucleotide positions. As used herein, the term "complementary" in relation to a first polynucleotide sequence and a second polynucleotide sequence means that the first polynucleotide sequence exactly base pairs with the second polynucleotide sequence through a stretch of nucleotides without mismatches. The term "cognate" in relation to a first polynucleotide sequence and a second polynucleotide sequence means that the first polynucleotide sequence base pairs with the second polynucleotide sequence through a stretch of nucleotides, but may contain one or more mismatches within the stretch of nucleotides. As used herein, the term "complementary" may refer to the ability of a first polynucleotide to hybridize to a second polynucleotide through base pair interactions between nucleotide pairs (e.g., A:T, A:U, C:G, G:C, G:U, T:A, U:A, and U:G) of the first and second polynucleotides.
[0040] The term "hybridization" as used herein refers to the formation of a double-stranded structure by two single-stranded nucleic acids through complementary base pairing. Hybridization can occur between completely complementary nucleic acid strands, or between "substantially complementary" nucleic acid strands that contain a small amount of mismatched regions. Conditions under which the hybridization of completely complementary nucleic acid strands is strongly favored are referred to as "stringent hybridization conditions" or "sequence-specific hybridization conditions". Stable duplexes of substantially complementary sequences can be achieved under less stringent hybridization conditions, and the degree of mismatch allowed can be controlled by appropriate adjustment of hybridization conditions. Those skilled in the art of nucleic acid technology can determine duplex stability empirically, following guidance provided by the art, taking into account several variables, including, for example, the length and base pair composition of the oligonucleotide, ionic strength, and the occurrence of mismatched base pairs (see, for example, Sambrook et al., 1989, Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York; Wetmur, 1991, Critical Review in Biochem.and Mol.Biol.26(3 / 4):227-259; and Owczarzy et al., 2008, Biochemistry,47:5336-5353, which are incorporated herein by reference). Those skilled in the art of nucleic acid technology can determine the melting temperature of a duplex.
[0041] Method for detecting target polynucleotides in a mixed sample
[0042] The disclosed subject matter relates to a method for detecting a target polynucleotide that comprises a genetic modification in a sample that comprises a mixture of a target polynucleotide and a reference polynucleotide, where the reference polynucleotide is a non-target polynucleotide in the sample, compared to a reference polynucleotide that lacks the genetic modification. This method can be used to detect a target polynucleotide with high sensitivity and high selectivity in a mixture of a reference polynucleotide and a target polynucleotide, where the target polynucleotide is present in low copy number (e.g., less than about 10 copies) and the target polynucleotide represents a low proportion (e.g., less than about 0.125%) of the mixture of the target polynucleotide and the reference polynucleotide. This method can be adapted to diagnose, prognose, and treat a subject with a disease or disorder associated with the detected genetic modification.
[0043] The disclosed method typically includes an amplification step, such as polymerase chain reaction (PCR) amplification, to produce an amplification product. The PCR amplification is typically configured to selectively amplify the genetic modification present in the target polynucleotide relative to a reference polynucleotide that lacks the genetic modification, and the reference polynucleotide is a non-target polynucleotide. The disclosed method also typically includes a sequencing step, in which the amplification product is sequenced to identify the genetic modification of the target polynucleotide.
[0044] In some embodiments, the disclosed methods include (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising (i) a sample or a fraction of a sample, (ii) a high-fidelity polymerase (e.g., about 10 -6(ii) a primer pair flanking the genetic modification, and (iii) a blocking oligonucleotide that selectively hybridizes to a reference polynucleotide lacking the genetic modification to form a blocking duplex to obtain an amplified fragment sample, and (b) sequencing the amplified product to detect the genetic modification in the amplified product, thereby detecting the target polynucleotide containing the genetic modification in the sample. The reaction mixture may further include additional components (e.g., buffer, NTP, divalent cations, etc.) for performing PCR amplification.
[0045] The disclosed methods may be performed to detect target polynucleotides that represent about 3%, 2%, 1%, 0.5%, 0.25%, 0.125% or less of the mixture of target polynucleotides and reference polynucleotides in a sample. In some embodiments of the disclosed methods, the target polynucleotide represents about 0.125% or less of the mixture of target polynucleotides and reference polynucleotides in a sample.
[0046] The disclosed methods may utilize polymerases that have a relatively low error rate. In some embodiments, the polymerase has a relatively low error rate of about 10 -5 , 10 -6、 or 10 -7 has an error rate of less than
[0047] The disclosed methods typically include an amplification step that includes several amplification cycles. In some embodiments of the disclosed methods, the methods include a PCR amplification step in which the PCR amplification is performed for no more than 60, 50, 40, or 30 cycles.
[0048] In the disclosed method, the genetic modification of the target nucleotide is selectively amplified or enriched.In some embodiments of the disclosed method, the genetic modification is detected in at least about 90%, 95%, 96%, 97%, 98% or 99% of the sequenced amplification products.In some embodiments of the disclosed method, the amplification products are sequenced from multiple reads, and the genetic modification is detected in at least about 90%, 95%, 96%, 97%, 98% or 99% of the multiple reads.
[0049] In the disclosed method, the genetic modification of the target polynucleotide is selectively enriched and detected.In some embodiments of the disclosed method, the target polynucleotide containing genetic modification in the sample represents about 0.125% or less of the mixture of the target polynucleotide and the reference polynucleotide lacking generic modification.After the disclosed method is carried out, in some embodiments, the amplification product is sequenced from multiple reads, and the genetic modification is detected in at least about 90%, 95%, 96%, 97%, 98%, or 99% of the multiple reads, representing an enrichment of at least about 720 times (i.e., 90% / 0.125%=720).
[0050] The disclosed methods typically include sequencing the amplification products. In some embodiments of the disclosed methods, the blocking oligonucleotides are removed from the amplification products prior to sequencing the amplification products.
[0051] The disclosed method typically detects target nucleotide present in a mixture sample that includes target nucleotide and reference polynucleotide. In some embodiments, the disclosed method includes determining the minimum number of PCR cycles required to detect target polynucleotide when target polynucleotide is present in the mixture at a relatively low ratio (e.g., when target polynucleotide is present in the mixture at a ratio of 0.1%, 0.05%, 0.02%, or 0.01% or less).
[0052] In the disclosed method, target polynucleotide can be present in sample at relatively low concentration.In some embodiments, target nucleotide can be present in sample at about 10000, 1000, 100, 10 or less copy number.In some embodiments, the disclosed method comprises determining the minimum number of PCR cycles required to detect target polynucleotide when target polynucleotide is present in sample at about 10000, 1000, 100, 10 or less copy number.
[0053] In the disclosed method, genetic modifications of target nucleotides are selectively amplified or enriched. Genetic modifications may be selectively amplified or enriched by configuring a PCR amplification reaction to include a blocking oligonucleotide that selectively hybridizes to a reference polynucleotide to form a blocking duplex, the reference polynucleotide lacking generic alterations and the reference polynucleotide being a non-target polynucleotide. In some embodiments, the blocking oligonucleotide includes one or more modified nucleotides that enhance the stability of the duplex formed by the blocking oligonucleotide and the reference polynucleotide. In some embodiments, the blocking oligonucleotide includes one or more modified nucleotides that enhance the selectivity of the blocking oligonucleotide for hybridizing to the reference polynucleotide compared to the target polynucleotide.
[0054] The blocking oligonucleotide can form a first duplex with a reference polynucleotide that lacks genetic modification (i.e., the reference polynucleotide is a non-target polynucleotide), and the first duplex has a first melting temperature T1. The blocking oligonucleotide can form a second duplex with a target polynucleotide that contains genetic modification, and the second duplex has a first melting temperature T2. Preferably, T1>T2. In some embodiments, the blocking oligonucleotide is configured such that T1 is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15°C higher than T2 (i.e., T1-T2 is higher than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15°C).
[0055] In the disclosed method, the blocking oligonucleotide may comprise or consist of modified nucleotides. Modified nucleotides may include, but are not limited to, locked nucleic acid (LNA) or bridged nucleic acid (BNA), peptide nucleic acid, glycol nucleic acid, and threose nucleic acid. The presence of modified nucleotides in the blocking oligonucleotide may change T1 or T2. Preferably, the presence of modified nucleotides in the blocking oligonucleotide increases T1. Preferably, the presence of modified nucleotides in the blocking oligonucleotide increases the difference between T1 and T2.
[0056] In the disclosed method, the temperature of the PCR reaction mixture may be increased to melt the target polynucleotide and the reference polynucleotide to form single-stranded DNA. The temperature may then be reduced to a point where the blocking oligonucleotide selectively hybridizes to the reference polynucleotide since the blocking oligonucleotide is configured to have a lower melting temperature when hybridized to the target polynucleotide. Thus, a higher proportion of the reference polynucleotide is hybridized to the blocking oligonucleotide compared to a proportion of the target polynucleotide. The target oligonucleotide and the reference oligonucleotide are then amplified using a primer oligonucleotide adjacent to the position where the blocking oligonucleotide hybridizes. During PCR amplification, the hybridization of the blocking oligonucleotide to the reference polynucleotide inhibits the extension of the polymerase. As a result, if the target polynucleotide is present, the target polynucleotide is amplified to a higher extent compared to the reference polynucleotide. As a result, after each PCR cycle, the amplification product of the target polynucleotide is enriched. To detect genetic alterations in the target polynucleotide, multiple PCR cycles may be performed to increase the total number of copies of the amplification product of the target polynucleotide to a point where sequencing can be performed.
[0057] Preferably, in the disclosed method, the extension during amplification is performed at a temperature at which the blocking oligonucleotide hybridizes to a relatively high percentage of the reference polynucleotides (non-target polynucleotides) in the sample, for example, at a temperature at which the blocking oligonucleotide hybridizes to more than about 50%, 60%, 70%, 80%, 90%, 95% or more of the reference polynucleotides (non-target polynucleotides) in the sample. Preferably, in the disclosed method, the extension during amplification is performed at a temperature at which the blocking oligonucleotide hybridizes to a relatively low percentage of the target polynucleotides in the sample, for example, at a temperature at which the blocking oligonucleotide hybridizes to less than about 50%, 40%, 30%, 30% or less of the target polynucleotides in the sample.
[0058] Blocking oligonucleotides may include locked nucleic acids (LNAs), also known as bridged nucleic acids (BNAs). LNAs are modified nucleotides in which the sugar moiety (e.g., ribose) is modified with a bridge connecting the 2' oxygen and 4' carbon (i.e., the 2'-O and 4'-C are conjugated via the bridge moiety). This bridge "locks" the sugar moiety in the 3'-endo(North) conformation commonly found in A-form duplexes. This structure provides improved stability against enzymatic degradation and also provides improved specificity and affinity in base pairing as a component of an oligonucleotide. LNA nucleotides can be mixed with DNA or RNA residues in an oligonucleotide. The bridge moiety of an LNA may include an alkylene moiety (e.g., a methylene bridge moiety) and an amino alkylene moiety (e.g., an amino methylene bridge moiety). LNAs may be referred to as +A, +G, +C, or +T. In some embodiments of blocking oligonucleotides, all of the nucleotides of the blocking oligonucleotide are LNAs.
[0059] The disclosed methods may utilize blocking oligonucleotides of relatively short length, hi some embodiments, the blocking oligonucleotides have a length of about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides or less.
[0060] The disclosed method can be carried out to detect target polynucleotides that contain genetic modification relative to reference polynucleotides, and the reference polynucleotide is a non-target polynucleotide.The genetic modification can include mutations relative to wild-type sequences, for example, target polynucleotides contain mutations, reference polynucleotides contain wild-type sequences, and the reference polynucleotide is a non-target wild-type polynucleotide.The genetic modification detected by the disclosed method can include substitutions, deletions, insertions, or combinations thereof.
[0061] The genetic alterations detected by the disclosed methods may be present at selected loci. In some embodiments, the genetic alterations are present at loci selected from one or more of PIK3CA, KRAS, APC, FAT4, KMT2D, KMT2C, and BRAF.
[0062] In some embodiments of the disclosed methods, the methods utilize an additional primer pair that amplifies a control sequence as an internal control that can be used to indicate that the steps of the disclosed methods are occurring as intended and / or when a blocking oligonucleotide is blocking exponential amplification of a reference polynucleotide as intended.
[0063] The disclosed methods can be configured to detect multiple target polynucleotides that contain different genetic modifications relative to a reference polynucleotide. In some embodiments, the disclosed methods are configured to perform multiplex analysis.
[0064] In some embodiments, the disclosed methods are configured to detect two or more target polynucleotides, each of which comprises a genetic modification that differs from a reference polynucleotide lacking the genetic modification (the reference polynucleotide is a non-target polynucleotide in the sample), in a sample comprising a mixture of two or more target polynucleotides and a reference polynucleotide. The disclosed methods include (a) performing a polymerase chain reaction (PCR) amplification to detect (i) the sample or a fraction of the sample, (ii) a DNA polymerase lacking 5' to 3' nuclease activity and 3' to 5' nuclease activity (e.g., a thermostable polymerase comprising 3' to 5' nuclease activity), preferably a high fidelity polymerase (e.g., about 10 -6 (iii) two or more primer pairs, each primer pair flanking one of the different genetic modifications, and (iv) two or more blocking oligonucleotides, each configured to selectively hybridize to a reference polynucleotide lacking the different genetic modifications to form two or more blocking duplexes; and (b) sequencing the amplification products to detect the different genetic modifications in the amplification products, thereby detecting two or more target polynucleotides containing different genetic modifications in the sample. The reaction mixture may further include additional components (e.g., buffer, NTP, divalent cations, etc.) for performing PCR amplification.
[0065] The disclosed methods can be performed to detect a target polynucleotide in a sample. Suitable samples can include, but are not limited to, biological samples or environmental samples.
[0066] In some embodiments, the sample is a blood sample or a blood product sample (e.g., plasma or serum). In some embodiments, the sample is an acellular sample, such as an acellular blood sample, e.g., the blood sample has been treated to remove cells prior to performing the disclosed methods.
[0067] The disclosed methods may be performed to detect genetic alterations of a target polynucleotide relative to a reference polynucleotide. In some embodiments, the disclosed methods may be performed to detect methylation of a target polynucleotide relative to a reference polynucleotide. In some embodiments of the disclosed methods, before the method is performed, the sample is treated with a reagent, such as a bisulfite reagent, which selectively modifies unmethylated cytosine residues to generate detectable modified residues (e.g., uracil residues) but does not modify methylated cytosine residues. In some methods, the target polynucleotide and the reference polynucleotide may differ based on the presence of detectable modified residues (e.g., uracil or thymidine) and methylated cytosine residues.
[0068] The disclosed method can be carried out to detect genetic alterations of target polynucleotides relative to reference polynucleotides. In some embodiments, the genetic alterations are associated with cancer in a subject, for example, mutations associated with cancer in a subject. In some embodiments, before carrying out the first step of the disclosed method, the method includes sequencing a cancer sample from a subject, detecting genetic alterations in the cancer sample, and determining that the cancer is associated with genetic alterations. The disclosed method can then be carried out to monitor the presence of genetic alterations in a subject, and the presence of genetic alterations indicates the progression of cancer in the subject.
[0069] In some embodiments of the disclosed method, the sample is obtained from a subject who has cancer or is at risk of developing cancer.In some embodiments of the disclosed method, the subject is diagnosed with cancer and is currently in remission, for example, after the subject is treated for the cancer that was diagnosed.The disclosed method can be carried out to monitor the recurrence of cancer in the subject, and the detection of genetic alteration in the subject indicates that the cancer has recurred.
[0070] Also disclosed herein are kits for carrying out the disclosed methods. The disclosed kits may include one or more components for carrying out the disclosed methods. In some embodiments, the kits include a kit that (i) lacks 5' to 3' nuclease activity and has 3' to 5' nuclease activity, preferably where the DNA polymerase is a high fidelity polymerase (e.g., about 10 -6 (ii) one or more primer pairs flanking the genetic modification; and / or (iii) one or more blocking oligonucleotides that selectively hybridize to a reference polynucleotide lacking the genetic modification to form a blocking duplex. In some embodiments, the kit comprises one or more of: (i) a DNA polymerase lacking 5'→3' nuclease activity and having 3'→5' nuclease activity; (ii) one or more primer pairs flanking a genetic alteration at a locus selected from PIK3CA, KRAS, APC, FAT4, KMT2D, KMT2C, and BRAF; and / or (iii) one or more blocking oligonucleotides selectively hybridizing to a reference polynucleotide lacking the genetic alteration to form a blocking duplex and obtain an amplified fragment sample (i.e., a blocking oligonucleotide hybridizing to one or more of wild-type PIK3CA, KRAS, APC, FAT4, KMT2D, KMT2C, and BRAF at the position of the corresponding genetic alteration). The disclosed kit may comprise a blocking oligonucleotide consisting of LNA, and the blocking oligonucleotide may be 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides or less.
[0071] The disclosed methods and kits can be utilized to diagnose, prognose, and treat a subject in need thereof, such as a subject having or suspected of having a disease or disorder. The disclosed methods can include diagnosing and / or prognosing a subject in need thereof, and can further include subsequently administering a treatment to the subject in need thereof after diagnosing and / or prognosing the subject. The methods contemplated herein can include (a) requesting an analysis to detect a target polynucleotide that contains a genetic alteration, and (2) subsequently administering a treatment to the subject based on the results of the analysis. EXAMPLES
[0072] The following examples are illustrative and should not be construed as limiting the scope of the claimed subject matter.
[0073] Example 1
[0074] This example describes how a low frequency variant was enriched and detected. In this example, the low frequency variant is the KRAS G12C mutation, which is known to be associated with or present in several cancers.
[0075] KRAS wild type (cat HD710) and KRAS G12C (cat HD269) DNA were purchased from Horizon Discovery. Oligonucleotides including primers and blockers were purchased from Integrated DNA Technologies. Q5 High-Fidelity 2X Master Mix (cat M0492S) and Monarch PCR and DNA Cleanup Kit (T1030S) were purchased from New England Biolabs.
[0076] The wild type sequence of KRAS is SEQ ID NO:1:
[0077] (SEQ ID NO:1)
[0078] [ka] Offered by.
[0079] The KRAS G12C sequence is provided by SEQ ID NO:2 and contains a G to t transversion:
[0080] (SEQ ID NO:2)
[0081] [ka] Includes.
[0082] The primers were designed as follows:
[0083] Forward primer (SEQ ID NO: 3): CTTATGTGTGACATGTTC
[0084] Reverse primer (SEQ ID NO: 4) GATTCTGAATTAGCTGTATC
[0085] Oligonucleotide blockers consist of LNAs (designated +A, +G, +C, or +T) as follows:
[0086] Oligonucleotide blocker (SEQ ID NO:5) [ka]
[0087] A total reaction volume of 100 μl was prepared as follows: Forward primer: 0.1μM working concentration (1μl of 10uM stock) Reverse primer: 0.1 μM working concentration (1 μl of 10 μM stock) Wild type: 50ng (14,500 copies) (50ng / ul in 1μl) Heterozygous KRAS G12C: 0.25ng (36 copies, 18 mutant and 18 wild type) (0.5μl of 0.5ng / ul) Blocker: 0.2 μM (working concentration (1 μl of 20 μM stock) 2x Q5 Master Mix: 1x working concentration (50uL of 2x Master Mix) ·Water (45.5μl)
[0088] The forward primer (SEQ ID NO:3) and reverse primer (SEQ ID NO:4) were at a final concentration of 0.1 μM. The blocker (SEQ ID NO:5) was at a concentration of 0.2 μM. The Q5 High-Fidelity 2X Master Mix was at a 1× concentration. 50 ng of KRAS wild-type DNA was added and 0.25 ng of KRAS G12C DNA was added to make a mixture. The KRAS G12C DNA was heterozygous, so that DNA with the KRAS G12C mutation represented less than 0.25% of the mixture (i.e., 0.25 ng / 2=0.125 ng KRAS G12C DNA / (50 ng+0.25 ng)<0.25%). The amount of KRAS wild-type NA contained 14500 copies, and the amount of KRAS G12C DNA contained 36 copies, of which 18 were mutant DNA and 18 were wild-type DNA due to the heterozygosity of KRAS G12C DNA. The working solution was vortexed briefly and 25 μl was aliquoted into thin-walled PCR tubes, so that each tube contained 9 copies of KRAS G12C mutant DNA.
[0089] The PCR protocol was performed as follows: 95°C for 60 seconds, 55 cycles (95°C for 10 seconds, 70°C for 5 seconds, 55°C for 25 seconds), 70°C for 60 seconds. PCR products were purified using the Monarch PCR cleanup protocol. Purified products were diluted to 20ng / ul and sequenced using Azenta Genewiz Amplicon EZ service.
[0090] Raw sequence reads were aligned to mutant and wild-type sequences. Reads were separated into three categories: wild-type nucleotide (G), KRAS G12C nucleotide (t), or other nucleotide, with or without additional mutations present in the reads outside the KRAS G12C mutation. The starting mixture had <0.25% mutant KRAS G12C DNA. After enrichment, reads containing the KRAS G12C mutation represented more than 95% of the quality reads.
[0091] Figure 1 shows the results of the control reaction. A mixed sample containing less than 0.25% KRAS G12C DNA and more than 99.75% KRAS wild-type DNA was amplified and sequenced in the absence of blocking oligonucleotides. 174398 reads were determined to contain wild-type nucleotides (99.69%), 490 reads contained KRAS G12C nucleotides (0.28%), and 52 reads contained neither wild-type nor KRAS G12C nucleotides (0.03%).
[0092] Figure 2 shows the results of a test reaction with blocking oligonucleotide. A mixed sample containing less than 0.25% KRAS G12C DNA and more than 99.75% KRAS wild-type DNA was amplified and sequenced in the presence of blocking oligonucleotide (SEQ ID NO: 5). 464 reads were determined to contain wild-type nucleotides (0.6%), 76842 reads contained KRAS G12C nucleotides (99.37%), and 31 reads contained neither wild-type nor KRAS G12C nucleotides (0.04%).
[0093] In the above description, it will be readily apparent to those skilled in the art that various substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The invention illustratively described herein may be practiced in the absence of any element or elements, limitation or limitations not specifically disclosed herein. The terms and expressions used are used as terms of description, not of limitation, and in the use of such terms and expressions, it is not intended to exclude any equivalents of the features shown and described, or portions thereof, and it is recognized that various modifications are possible within the scope of the invention. Thus, although the invention is illustrated by specific embodiments and optional features, it should be understood that modifications and / or variations of the concepts disclosed herein may be made by those skilled in the art, and such modifications and variations are considered to be within the scope of the invention.
[0094] Citations to several patent and non-patent references are made herein. The cited references are incorporated herein by reference in their entirety. In the event of a discrepancy between the definition of a term in this specification as compared to the definition of a term in a cited reference, the term shall be interpreted in accordance with the definition in this specification. Sequence Listing <110> NexGen Cancer Detection LLC <120> METHODS FOR DETECTING A TARGET POLYNUCLEOTIDE IN A MIXED SAMPLE <130> NG.2021-09-13.PCT <150> US63 / 243,390 <151> 2021-09-13 <160> 5 <170> PatentIn version 3.5 <210> 1 <211> 143 <212> DNA <213> Homo sapiens <400> 1 [ka] <210> 2 <211> 143 <212> DNA <213> Homo sapiens <400> 2 [ka] <210> 3 <211> 18 <212> DNA <213> artificial <220> <223> Human KRAS forward primer <400> 3 [ka] <210> 4 <211> 20 <212> DNA <213> artificial <220> <223> KRAS reverse primer <400> 4 [ka] <210> 5 <211> 10 <212> DNA <213> artificial <220> <223> KRAS blocking oligonucleotides <400> 5 [ka]
Claims
1. A method for concentrating double-stranded target polynucleotides in a sample to obtain an amplification product, said method comprising: (a) (i) the sample, the sample comprising a double-stranded reference polynucleotide and the double-stranded target polynucleotide, wherein the target polynucleotide comprises a genetic modification and the reference polynucleotide lacks the genetic modification, and the genetic modification is a substitution of one or more nucleotides, a deletion of one or more nucleotides, and / or an insertion of one or more nucleotides; (iii) a blocking oligonucleotide; (iv) a pair of oligonucleotide primers flanking the genetic modification, wherein the forward primer of the primer pair is capable of hybridizing to a first strand of the double-stranded reference polynucleotide and to a first strand of the double-stranded target polynucleotide, and the reverse primer of the primer pair is capable of hybridizing to a second strand of the double-stranded reference polynucleotide and to a second strand of the double-stranded target polynucleotide, wherein the forward and reverse primers of the primer pair flank the genetic modification in the target polynucleotide, and the forward and reverse primers of the primer pair do not overlap with a sequence complementary to the blocking oligonucleotide. preparing a reaction mixture comprising: (b) heating the reaction mixture above a temperature that melts the double-stranded reference polynucleotide and the double-stranded target polynucleotide; (c) cooling the reaction mixture to a temperature at which the blocking oligonucleotide hybridizes to the reference polynucleotide to form a blocking duplex, but at which the blocking oligonucleotide does not hybridize to the target polynucleotide and at which the forward and reverse primers of the primer pair do not hybridize to either the reference polynucleotide or the target polynucleotide; (d) cooling the reaction mixture, wherein the forward primer hybridizes to the reference polynucleotide, the reverse primer hybridizes to the reference polynucleotide, the forward primer hybridizes to the target polynucleotide, and the reverse primer hybridizes to the target polynucleotide; (e) extending the primer hybridized to the target polynucleotide or to the reference polynucleotide; (f) repeating steps (b) through (e) for two or more cycles to form the amplification products containing the target polynucleotide, thereby enriching the amount of target polynucleotide relative to the reference polynucleotide in the amplification products compared to the sample; A method comprising:
2. 2. The method of claim 1, wherein the DNA polymerase has an error rate of less than 10-5.
3. 2. The method of claim 1, wherein the blocking oligonucleotide comprises one or more modified nucleotides that increase the selectivity of the blocking oligonucleotide for hybridizing to the reference polynucleotide compared to the target polynucleotide.
4. The method of claim 1, wherein a DNA-binding fluorescent dye is added to the mixture.
5. The method of claim 1, wherein an oligonucleotide probe is added to the mixture.
6. The method of claim 1, further comprising the step of (g) sequencing the amplification product containing the target polynucleotide.