Methods and compositions for regulating the genome

Abstract

The disclosure provides compositions, systems and methods for targeting, editing, modifying or manipulating the genome of a host cell at one or more locations within a DNA sequence in, for example, a cell, tissue or subject.

Description

[Technical Field]

[0001] Related Applications This application claims priority to U.S. Provisional Patent Application Nos. 63 / 241,953, filed September 8, 2021, and 63 / 373,444, filed August 24, 2022, the entire contents of each of which are incorporated herein by reference.

[0002] Sequence Listing This application contains a Sequence Listing, which has been submitted electronically in XML format and is incorporated herein by reference in its entirety. October 27 The XML copy created in is named V2065-7023WO_SL.xml, 20,090,757 The size in bytes. [Background technology]

[0003] Integration of a nucleic acid of interest into a genome occurs at low frequency in the absence of specialized proteins to facilitate the insertion event and has little site specificity. Some existing methods, such as CRISPR / Cas9, are more suitable for small edits that rely on host repair pathways and are less effective at integrating long sequences. Other existing methods, such as Cre / loxP, require a first step of inserting a loxP site into the genome, followed by a second step of inserting a sequence of interest into the loxP site. There is a need in the art for improved compositions (e.g., proteins and nucleic acids) and methods for inserting, modifying, or deleting a sequence of interest in a genome. Summary of the Invention [Means for solving the problem]

[0004] The present disclosure relates to novel compositions, systems, and methods for modifying the genome of one or more locations in a host cell, tissue, or subject in vivo or in vitro. In particular, the present invention features compositions, systems, and methods for inserting, modifying, or deleting a sequence of interest into a host genome.

[0005] The composition or method configuration may include one or more of the embodiments listed below.

[0006] 1. A recombinant polypeptide comprising: A DNA binding domain (DBD) that binds to a target nucleic acid sequence and a reverse transcriptase (RT) domain of Table 1 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto (e.g., to a sequence listed for the RT domain in Table 6); a reverse transcriptase (RT) domain, wherein the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, the linker having a sequence from the same row as the RT domain in Table 1 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0007] 2. The recombinant polypeptide of embodiment 1, wherein the RT domain has a sequence with at least 90% identity to an RT domain of Table 1.

[0008] 3. The recombinant polypeptide of any of the previous embodiments, wherein the RT domain has a sequence with at least 95% identity to an RT domain of Table 1.

[0009] 4. The recombinant polypeptide of any of the previous embodiments, wherein the RT domain has a sequence with at least 98% identity to an RT domain of Table 1.

[0010] 5. The recombinant polypeptide of any of the previous embodiments, wherein the RT domain has a sequence with at least 99% identity to an RT domain of Table 1.

[0011] 6. The recombinant polypeptide of any of the previous embodiments, wherein the RT domain has a sequence with 100% identity to an RT domain of Table 1.

[0012] 7. The recombinant polypeptide of any of the previous embodiments, wherein the linker has a sequence having at least 90% identity to a linker sequence from the same row of Table 1 as the RT domain.

[0013] 8. The recombinant polypeptide of any of the previous embodiments, wherein the linker has a sequence having at least 95% identity to a linker sequence from the same row of Table 1 as the RT domain.

[0014] 9. The recombinant polypeptide of any of the previous embodiments, wherein the linker has a sequence having at least 97% identity to a linker sequence from the same row of Table 1 as the RT domain.

[0015] 10. The recombinant polypeptide of any of the previous embodiments, wherein the linker has a sequence with 100% identity to a linker sequence from the same row of Table 1 as the RT domain.

[0016] 11. The recombinant polypeptide of any of the previous embodiments, wherein the RT domain comprises a mutation listed in Table 2.

[0017] 12. The recombinant polypeptide of any of the previous embodiments, wherein the Cas domain comprises a sequence in Table 7 or 8, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity thereto.

[0018] 13. The recombinant polypeptide of any of the preceding embodiments, wherein the Cas domain is a Cas nickase domain.

[0019] 14. The recombinant polypeptide of any of the preceding embodiments, wherein the Cas domain is a Cas9 nickase domain.

[0020] 15. The recombinant polypeptide of any of the preceding embodiments, wherein the Cas domain comprises an N863A mutation.

[0021] 16. The recombinant polypeptide of any of the preceding embodiments, comprising an NLS, e.g., wherein the recombinant polypeptide comprises two NLSs.

[0022] 17. The recombinant polypeptide of any of the previous embodiments, comprising an NLS N-terminal to the Cas9 domain.

[0023] 18. An recombinant polypeptide of any of the previous embodiments, comprising an NLS C-terminal to the RT domain.

[0024] 19. The recombinant polypeptide of any of the previous embodiments, comprising a first NLS that is N-terminal to the Cas9 domain and a second NLS that is C-terminal to the RT domain.

[0025] 20. The recombinant polypeptide of any of the previous embodiments, comprising a sequence of SEQ ID NO: 4000 comprising the first NLS and the Cas domain, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity thereto.

[0026] 21. The recombinant polypeptide of any of the previous embodiments, comprising the sequence of SEQ ID NO: 4001, or a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity thereto, comprising the second NLS.

[0027] 22. The recombinant polypeptide of any of the previous embodiments, comprising a GG amino acid sequence between the Cas domain and the linker.

[0028] 23. The recombinant polypeptide of any of the previous embodiments, comprising an AG amino acid sequence between the RT domain and the second NLS.

[0029] 24. The recombinant polypeptide of any of the previous embodiments, comprising a GG amino acid sequence between the linker and the RT domain.

[0030] 25. The recombinant polypeptide of any of the previous embodiments, comprising an amino acid sequence according to any of SEQ ID NOs: 1 to 3332 in the Sequence Listing, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto.

[0031] 26. The recombinant polypeptide of any of the previous embodiments, comprising an amino acid sequence having at least 90% identity to any of SEQ ID NOs: 1 to 3332 in the Sequence Listing.

[0032] 27. The recombinant polypeptide of any of the previous embodiments, comprising an amino acid sequence having at least 95% identity to any of SEQ ID NOs: 1 to 3332 in the Sequence Listing.

[0033] 28. The recombinant polypeptide of any of the previous embodiments, comprising an amino acid sequence having at least 98% identity to any of SEQ ID NOs: 1 to 3332 in the Sequence Listing.

[0034] 29. The recombinant polypeptide of any of the previous embodiments, comprising an amino acid sequence having at least 99% identity to any of SEQ ID NOs: 1 to 3332 in the Sequence Listing.

[0035] 30. The recombinant polypeptide of any of the previous embodiments, comprising an amino acid sequence having 100% identity to any of SEQ ID NOs: 1 to 3332 in the Sequence Listing.

[0036] 31. The recombinant polypeptide of any of the preceding embodiments, which results in at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 1500%, 2000% or 2500% increase in converted GFP+ relative to non-sorted input cells in the assay of Example 2 using HEK cells (e.g., HEK293T cells) and g4 guide RNA.

[0037] 32. The recombinant polypeptide of any of the preceding embodiments, which results in at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 1500%, 2000% or 2500% increase in converted GFP+ compared to non-sorted input cells in the assay of Example 2 using U2-OS cells and g4 guide RNA.

[0038] 33. The recombinant polypeptide of any of the preceding embodiments, which results in at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 1500%, 2000% or 2500% increase in converted GFP+ relative to non-sorted input cells in the assay of Example 2 using HEK cells (e.g., HEK293T cells) and g10 guide RNA.

[0039] 34. In the assay of Example 1 using HEK cells and g4 guide RNA, in the N-terminal to C-terminal direction, a) NLS and Cas domain sequence of SEQ ID NO: 4000; b) Sequence EAAAKGSS (SEQ ID NO: 5152) a linker having c) an RT domain having the sequence PERV_Q4VFZ2_3mutA_WS; and d) NLS sequence of SEQ ID NO: 4001;

[0023] 3. The recombinant polypeptide of any of the preceding embodiments, having an activity that is at least 50%, 60%, 70%, 80% or 90% of the activity of a recombinant polypeptide comprising:

[0040] 35. The recombinant polypeptide of any of the preceding embodiments, having activity that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 1500%, 2000% or 2500% greater than the activity of an recombinant polypeptide comprising the sequence of SEQ ID NO: 4002, e.g., in the assay of Example 1 using HEK cells and g4 guide RNA.

[0041] 36. A nucleic acid (e.g., DNA or RNA, e.g., mRNA) encoding the recombinant polypeptide of any of the preceding embodiments.

[0042] 37. A cell comprising a recombinant polypeptide of any of embodiments 1 to 35 or a nucleic acid of embodiment 36.

[0043] 38. A system comprising: i) a recombinant polypeptide of any one of embodiments 1 to 35, and ii) a template RNA, a) a gRNA spacer complementary to a portion of the target nucleic acid sequence; b) gRNA scaffold binding to the Cas domain of the recombinant polypeptide; c) a heterologous sequence of interest; and d) Primer binding site sequence (PBS sequence) template RNA containing A system including:

[0044] 39. A method for modifying a target nucleic acid in a cell (e.g., a human cell), comprising contacting the cell with the system of embodiment 38 or a nucleic acid encoding same, thereby modifying the target nucleic acid.

[0045] 40. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); a reverse transcriptase (RT) domain comprising the RT domain of a reference recombinant polypeptide having any one of SEQ ID NOs: 1 to 7743, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto, wherein the reverse transcriptase (RT) domain is C-terminal to the Cas domain; and a linker disposed between the RT domain and the Cas domain, the linker comprising the linker of the reference recombinant polypeptide or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto; A recombinant polypeptide comprising:

[0046] 41. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table 1.

[0047] 42. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table A1.

[0048] 43. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table A5.

[0049] 44. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table D1.

[0050] 45. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table D2.

[0051] 46. ​​The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table D3.

[0052] 47. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table D4.

[0053] 48. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table D5.

[0054] 49. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table D6.

[0055] 50. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table D7.

[0056] 51. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table D8.

[0057] 52. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table D9.

[0058] 53. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table D10.

[0059] 54. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table D11.

[0060] 55. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table D12.

[0061] 56. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table T1.

[0062] 57. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide has an amino acid sequence of a SEQ ID NO: listed in Table T2.

[0063] 58. The recombinant polypeptide of embodiment 40, wherein the reference recombinant polypeptide is an AVIRE polypeptide (e.g., as described herein), and wherein the linker comprises the amino acid sequence listed in Figure 11.

[0064] 59. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain of Table 1 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, the linker having a sequence from the same row as the RT domain in Table 1 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0065] 60. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain of Table A1 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table A1, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0066] 61. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain of Table A5 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D1, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0067] 62. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); a reverse transcriptase (RT) domain of Table T1 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D1, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0068] 63. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); a reverse transcriptase (RT) domain of Table T2 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D1, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0069] 64. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain of Table D1 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D1, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0070] 65. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain of Table D2 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D2, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0071] 66. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); a reverse transcriptase (RT) domain of Table D3 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D3, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0072] 67. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain of Table D4 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D4, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0073] 68. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain of Table D5 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D5, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0074] 69.A recombinant polypeptide, a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain of Table D6 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D6, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0075] 70. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain of Table D7 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D7, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0076] 71. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain of Table D8 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D8, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0077] 72. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain of Table D9 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D9, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0078] 73. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain or sequence of Table D10 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D10, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0079] 74. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain of Table D11 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D11, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0080] 75. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain of Table D12 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table D12, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0081] 76. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); a reverse transcriptase (RT) domain of Table T1 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and a linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table T1, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto; A recombinant polypeptide comprising:

[0082] 77. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); a reverse transcriptase (RT) domain of Table T2 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and a linker disposed between the RT domain and the Cas domain, comprising a sequence from the same row as the RT domain of Table T2, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto; A recombinant polypeptide comprising:

[0083] 78. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); an AVIRE reverse transcriptase (RT) domain (e.g., as described herein) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto, wherein the RT domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, comprising a sequence listed in FIG. 11 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0084] 79. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of an AVIRE RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0085] 80. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of a BAEVM RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0086] 81. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of an FFV RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0087] 82. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of an FLV RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0088] 83. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of a FOAMV RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0089] 84. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of a GALV RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0090] 85. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of a KORV RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0091] 86. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises an amino acid sequence of an MLVAV RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0092] 87. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of an MLVBM RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0093] 88. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of an MLVCB RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0094] 89. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of an MLVFF RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0095] 90. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of an MLVMS RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0096] 91. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises an amino acid sequence of a PERV RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0097] 92. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of the SFV1 RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0098] 93. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of an SFV3L RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0099] 94. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of a WMSV RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0100] 95. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of an XMRV6 RT domain (e.g., as set forth in Table 6) or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0101] 96. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of an MLVAV, MLVBM, BAEVM, FLV, FOAMV, GALV, KORV, AVIRE, MLVCB, MLVFF, MLVMS, SFV3L, WMSV, or XMRV6 RT domain (e.g., as set forth in Table 6), or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0102] 97. The recombinant polypeptide of any one of embodiments 1-78, wherein the RT domain comprises the amino acid sequence of a gammaretroviral RT domain or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0103] 98. The recombinant polypeptide of embodiment 97, wherein the RT domain comprises the amino acid sequence of a GALV, MLVAV, MLVBM, BAEVM, FLV, AVIRE, KORV, MLVCB, MLVFF, WMSV, XMRV6, MLVMS, and PERV RT domain (e.g., as set forth in Table 6), or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identity thereto.

[0104] 99. The recombinant polypeptide of any embodiment 40, wherein the RT domain comprises an amino acid sequence of an RT domain listed in any one of Tables 1, A1, A5, D1-D12, T1 or T2, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0105] 100. The recombinant polypeptide of embodiment 40, wherein the linker comprises an amino acid sequence of a linker listed in any one of Tables 1, A1, A5, D1-D12, T1 or T2, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0106] 101. The RT domain comprises an amino acid sequence of an RT domain listed in any one of Table 1, A1, A5, D1-D12, T1, or T2, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto; 41. The recombinant polypeptide of embodiment 40, wherein the linker comprises an amino acid sequence of a linker listed in the same row of Table 1, A1, A5, D1-D12, T1 or T2, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0107] 102. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises one or more (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) amino acid substitutions at residues corresponding to positions 200, 603, 330, 524, 562, 583, 51, 67, 67, 197, 204, 302, 309, 313, 435, 454, 594, 671, 69, or 653 of an MLVMS RT domain sequence described herein (e.g., listed in Table 6), e.g., MLVMS_ReferenceSequence, e.g., SEQ ID NO: 8137, relative to the wild-type sequence of the RT domain.

[0108] 103. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an MLVMS RT domain sequence described herein (e.g., listed in Table 6), e.g., MLVMS_ReferenceSequence, e.g., SEQ ID NO: 8137, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0109] 104. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises one or more (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) amino acid substitutions relative to the wild-type sequence of the RT domain at residues corresponding to positions 200, 603, 330, 524, 562, 583, 51, 67, 67, 197, 204, 302, 309, 313, 435, 454, 594, 671, 69, or 653 of an MLVMS RT domain sequence described herein (e.g., listed in Table 6), e.g., the MLVMS_P03355 sequence, e.g., SEQ ID NO: 8070.

[0110] 105. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an MLVMS RT domain sequence described herein (e.g., listed in Table 6), e.g., the MLVMS_P03355 sequence, e.g., SEQ ID NO: 8070, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0111] 106. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an AVIRE RT domain sequence described herein (e.g., listed in Table 6), e.g., the AVIRE_P03360 sequence, e.g., SEQ ID NO: 8001, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0112] 107. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of a BAEVM RT domain sequence described herein (e.g., listed in Table 6), e.g., the BAEVM_P10272 sequence, e.g., SEQ ID NO: 8004, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0113] 108. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of a BLVAU RT domain sequence described herein (e.g., listed in Table 6), e.g., a BLVAU_P25059 sequence, e.g., SEQ ID NO: 8007, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0114] 109. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of a BLVJ RT domain sequence described herein (e.g., listed in Table 6), e.g., the BLVJ_P03361 sequence, e.g., SEQ ID NO: 8009, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0115] 110. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an FFV RT domain sequence described herein (e.g., listed in Table 6), such as the FFV_O93209 sequence, e.g., SEQ ID NO: 8012, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0116] 111. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an FLV RT domain sequence described herein (e.g., listed in Table 6), e.g., the FLV_P10273 sequence, e.g., SEQ ID NO: 8019, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto.

[0117] 112. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of a FOAMV RT domain sequence described herein (e.g., listed in Table 6), e.g., the FOAMV_P14350 sequence, e.g., SEQ ID NO: 8021, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0118] 113. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of a GALV RT domain sequence described herein (e.g., listed in Table 6), e.g., the GALV_P21414 sequence, e.g., SEQ ID NO: 8027, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0119] 114. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an HTL1A RT domain sequence described herein (e.g., listed in Table 6), e.g., the HTL1A_P03362 sequence, e.g., SEQ ID NO: 8030, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0120] 115. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an HTL1C RT domain sequence described herein (e.g., listed in Table 6), e.g., the HTL1C_P14078 sequence, e.g., SEQ ID NO: 8033, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0121] 116. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an HTL32 RT domain sequence described herein (e.g., listed in Table 6), e.g., the HTL32_Q0R5R2 sequence, e.g., SEQ ID NO: 8038, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0122] 117. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an HTL3P RT domain sequence described herein (e.g., listed in Table 6), e.g., the HTL3P_Q4U0X6 sequence, e.g., SEQ ID NO: 8041, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0123] 118. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of a JSRV RT domain sequence described herein (e.g., listed in Table 6), e.g., the JSRV_P31623 sequence, e.g., SEQ ID NO: 8045, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0124] 119. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of a KORV RT domain sequence described herein (e.g., listed in Table 6), e.g., the KORV_Q9TTC1 sequence, e.g., SEQ ID NO: 8047, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0125] 120. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an MLVAV RT domain sequence described herein (e.g., listed in Table 6), e.g., the MLVAV_P03356 sequence, e.g., SEQ ID NO: 8053, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto.

[0126] 121. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an MLVBM RT domain sequence described herein (e.g., listed in Table 6), e.g., the MLVBM_Q7SVK7 sequence, e.g., SEQ ID NO: 8056, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto.

[0127] 122. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an MLVCB RT domain sequence described herein (e.g., listed in Table 6), e.g., the MLVCB_P08361 sequence, e.g., SEQ ID NO: 8062, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0128] 123. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an MLVF5 RT domain sequence described herein (e.g., listed in Table 6), e.g., the MLVF5_P26810 sequence, e.g., SEQ ID NO: 8065, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0129] 124. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an MLVRD RT domain sequence described herein (e.g., listed in Table 6), such as the MLVRD_P11227 sequence, e.g., SEQ ID NO: 8078, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0130] 125. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an MMTVB RT domain sequence described herein (e.g., listed in Table 6), e.g., the MMTVB_P03365 sequence, e.g., SEQ ID NO: 8080, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0131] 126. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an MPMV RT domain sequence described herein (e.g., listed in Table 6), e.g., the MPMV_P07572 sequence, e.g., SEQ ID NO: 8097, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0132] 127. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of a PERV RT domain sequence described herein (e.g., listed in Table 6), e.g., the PERV_Q4VFZ2 sequence, e.g., SEQ ID NO: 8099, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto.

[0133] 128. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an SFV1 RT domain sequence described herein (e.g., listed in Table 6), such as the SFV1_P23074 sequence, e.g., SEQ ID NO: 8105, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0134] 129. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an SFV3L RT domain sequence described herein (e.g., listed in Table 6), such as the SFV3L_P27401 sequence, e.g., SEQ ID NO: 8111, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0135] 130. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an SFVCP RT domain sequence described herein (e.g., listed in Table 6), e.g., the SFVCP_Q87040 sequence, e.g., SEQ ID NO: 8117, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0136] 131. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an SMRV RT domain sequence described herein (e.g., listed in Table 6), e.g., the SMRVH_P03364 sequence, e.g., SEQ ID NO: 8123, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto.

[0137] 132. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an SRV2 RT domain sequence described herein (e.g., listed in Table 6), e.g., the SRV2_P51517 sequence, e.g., SEQ ID NO: 8126, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto.

[0138] 133. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of a WDSV RT domain sequence described herein (e.g., listed in Table 6), e.g., the WDSV_O92815 sequence, e.g., SEQ ID NO: 8128, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto.

[0139] 134. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of a WMSV RT domain sequence described herein (e.g., listed in Table 6), e.g., the WMSV_P03359 sequence, e.g., SEQ ID NO: 8131, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto.

[0140] 135. The recombinant polypeptide of embodiment 40, wherein the RT domain comprises an RT domain comprising the amino acid sequence of an XMRV6 RT domain sequence described herein (e.g., listed in Table 6), e.g., the XMRV6_A1Z651 sequence, e.g., SEQ ID NO: 8134, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto.

[0141] 136.RT domain is a) the amino acid asparagine (N) at position 200 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; b) the amino acid tryptophan (W) at position 603 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; c) the amino acid proline (P) at position 330 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; d) the amino acid glycine (G) at position 524 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; e) the amino acid glutamine (Q) at position 562 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; f) the amino acid asparagine (N) at position 583 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; g) the amino acid leucine (L) at position 51 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; h) the amino acid arginine (R) at position 67 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; i) the amino acid lysine (K) at position 67 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; j) the amino acid alanine (A) at position 197 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; k) the amino acid arginine (R) at position 204 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; l) the amino acid lysine (K) at position 302 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; m) the amino acid asparagine (N) at position 309 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; n) the amino acid phenylalanine (F) at position 313 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; o) the amino acid glycine (G) at position 435 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; p) the amino acid lysine (K) at position 454 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; q) the amino acid glutamine (Q) at position 594 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; r) the amino acid proline (P) at position 671 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; s) the amino acid lysine (K) at position 69 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain; or t) the amino acid asparagine (N) at position 653 of SEQ ID NO: 8137 or the corresponding position in a homologous RT domain 136. The recombinant polypeptide of any one of embodiments 40 to 135, comprising:

[0142] 137. The recombinant polypeptide of embodiment 40, wherein the RT domain has a sequence with at least 90% identity to the RT domain of a reference recombinant polypeptide.

[0143] 138. The recombinant polypeptide of any of the previous embodiments, wherein the RT domain has a sequence with at least 95% identity to the RT domain of a reference recombinant polypeptide.

[0144] 139. The recombinant polypeptide of any of the previous embodiments, wherein the RT domain has a sequence with at least 98% identity to the RT domain of a reference recombinant polypeptide.

[0145] 140. The recombinant polypeptide of any of the previous embodiments, wherein the RT domain has a sequence with at least 99% identity to the RT domain of a reference recombinant polypeptide.

[0146] 141. The recombinant polypeptide of any of the previous embodiments, wherein the RT domain has a sequence with 100% identity to the RT domain of a reference recombinant polypeptide.

[0147] 142. The recombinant polypeptide of any of the previous embodiments, wherein the linker has a sequence with at least 90% identity to the linker sequence from the reference recombinant polypeptide.

[0148] 143. The recombinant polypeptide of any of the previous embodiments, wherein the linker has a sequence with at least 95% identity to the linker sequence from the reference recombinant polypeptide.

[0149] 144. The recombinant polypeptide of any of the previous embodiments, wherein the linker has a sequence with at least 97% identity to the linker sequence from the reference recombinant polypeptide.

[0150] 145. The recombinant polypeptide of any of the previous embodiments, wherein the linker has a sequence with 100% identity to the linker sequence from the reference recombinant polypeptide.

[0151] 146. The recombinant polypeptide of any of the previous embodiments, wherein the linker has an amino acid sequence having at least 80%, 85%, 90%, 95%, 97%, or 100% identity to SEQ ID NO: 11,041.

[0152] 147. The recombinant polypeptide of any of the previous embodiments, wherein the RT domain comprises a mutation listed in Table 2.

[0153] 148. The recombinant polypeptide of any of the previous embodiments, wherein the RT domain comprises one or more (e.g., 1, 2, 3, 4, 5, or 6) mutations listed in any one row of Table 2.

[0154] 149. The recombinant polypeptide of any of the previous embodiments, wherein the RT domain comprises all of the mutations listed in any one row of Table 2.

[0155] 150. The recombinant polypeptide of any of the previous embodiments, wherein the Cas domain comprises a sequence in Table 7 or 8, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity thereto.

[0156] 151. The recombinant polypeptide of any of the preceding embodiments, wherein the Cas domain comprises the amino acid sequence of a Cas domain included in the amino acid sequence of a reference recombinant polypeptide, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity thereto.

[0157] 152. The recombinant polypeptide of any of the preceding embodiments, wherein the Cas domain does not comprise the amino acid sequence of a Cas domain contained in the amino acid sequence of the reference recombinant polypeptide, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity thereto.

[0158] 153. The recombinant polypeptide of any of the preceding embodiments, wherein the Cas domain is a Cas nickase domain.

[0159] 154. The recombinant polypeptide of any of the preceding embodiments, wherein the Cas domain is a Cas9 nickase domain.

[0160] 155. The recombinant polypeptide of any of the preceding embodiments, wherein the Cas domain comprises an N863A mutation.

[0161] 156. The recombinant polypeptide of any of the preceding embodiments, comprising an NLS, for example wherein the recombinant polypeptide comprises two NLSs.

[0162] 157. The recombinant polypeptide of any of the previous embodiments, comprising an NLS N-terminal to the Cas9 domain.

[0163] 158. The recombinant polypeptide of any of the previous embodiments, comprising an NLS C-terminal to the RT domain.

[0164] 159. The recombinant polypeptide of any of the previous embodiments, comprising a first NLS that is N-terminal to the Cas9 domain and a second NLS that is C-terminal to the RT domain.

[0165] 160. The recombinant polypeptide of any of the previous embodiments, comprising the sequence of SEQ ID NO: 4000, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity thereto, comprising the first NLS and the Cas domain.

[0166] 161. The recombinant polypeptide of any of the previous embodiments, comprising the sequence of SEQ ID NO: 4001, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity thereto, including the second NLS.

[0167] 162. The recombinant polypeptide of any of the previous embodiments, comprising a GG amino acid sequence between the Cas domain and the linker.

[0168] 163. The recombinant polypeptide of any of the previous embodiments, comprising an AG amino acid sequence between the RT domain and the second NLS.

[0169] 164. The recombinant polypeptide of any of the previous embodiments, comprising a GG amino acid sequence between the linker and the RT domain.

[0170] 165. The recombinant polypeptide of any of the preceding embodiments, which results in at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 1500%, 2000% or 2500% increase in converted GFP+ relative to non-sorted input cells in the assay of Example 2 using HEK cells and g4 guide RNA.

[0171] 166. A recombinant polypeptide, a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); A reverse transcriptase (RT) domain comprising the amino acid sequence of an RT domain set forth in any one of SEQ ID NOs: 1 to 7743, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto; and A linker disposed between the RT domain and the Cas domain, comprising the amino acid sequence of a linker listed in Table 10, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. Including, The amino acid sequences of the RT domain and the linker are represented by the same amino acid sequence of any one of SEQ ID NOs: 1 to 7743; A recombinant polypeptide that results in at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 1500%, 2000% or 2500% increase in converted GFP+ compared to unsorted input cells in the assay of Example 2 using HEK cells and g4 guide RNA.

[0172] 167. In the assay of Example 1 using HEK cells and g4 guide RNA, in the N-terminal to C-terminal direction, a) NLS and Cas domain sequence of SEQ ID NO: 4000; b) Sequence EAAAKGSS (SEQ ID NO: 5152) a linker having c) an RT domain having the sequence PERV_Q4VFZ2_3mutA_WS; and d) NLS sequence of SEQ ID NO: 4001

[0023] 3. The recombinant polypeptide of any of the preceding embodiments, having an activity that is at least 50%, 60%, 70%, 80% or 90% of the activity of a reference recombinant polypeptide comprising:

[0173] 168. The recombinant polypeptide of any of the preceding embodiments, having activity that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 1500%, 2000% or 2500% greater than the activity of a reference recombinant polypeptide comprising the sequence of SEQ ID NO: 4002, e.g., in the assay of Example 1 using HEK cells and g4 guide RNA.

[0174] 169. A nucleic acid (e.g., DNA or RNA, e.g., mRNA) encoding the recombinant polypeptide of any of the previous embodiments.

[0175] 170. A cell comprising a recombinant polypeptide of any of embodiments 40 to 68 or a nucleic acid of embodiment 169.

[0176] 171. A system comprising: i) a recombinant polypeptide of any of embodiments 40 to 68, and ii) a template RNA, a) a gRNA spacer complementary to a portion of the target nucleic acid sequence; b) gRNA scaffold binding to the Cas domain of the recombinant polypeptide; c) a heterologous sequence of interest; and d) Primer binding site sequence (PBS sequence) template RNA containing A system including:

[0177] 172. A method for modifying a target nucleic acid in a cell (e.g., a human cell), comprising contacting the cell with the system of embodiment 171 or a nucleic acid encoding same, thereby modifying the target nucleic acid.

[0178] 173. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); a reverse transcriptase (RT) domain having one or more (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) amino acid substitutions at (e.g., at residues at positions homologous thereto) corresponding to positions 200, 603, 330, 524, 562, 583, 51, 67, 67, 197, 204, 302, 309, 313, 435, 454, 594, 671, 69, or 653 of an MLVMS RT domain sequence described herein (e.g., listed in Table 6), e.g., MLVMS_Reference Sequence, e.g., SEQ ID NO: 8137, relative to a wild-type sequence of the RT domain, wherein the reverse transcriptase (RT) domain is C-terminal to the Cas domain; and A linker disposed between the RT domain and the Cas domain, the linker having a sequence from the same row as the RT domain in Table 1 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. A recombinant polypeptide comprising:

[0179] 174. A recombinant polypeptide comprising: the reverse transcriptase (RT) domain of AVIRE RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto; a Cas nickase domain, wherein the RT domain is C-terminal to the Cas domain; and a linker disposed between the Cas nickase domain and the RT domain, comprising an amino acid sequence listed in Table 10, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; A recombinant polypeptide comprising:

[0180] 175. A recombinant polypeptide comprising: Reverse transcriptase (RT) domains, selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 9, 10, 12, 13, 14, 6076, 6143, 6200, 6254, 6274, 6315, 6328, 6337, 6403, 6420, 6440, 6513, 6552, 6613, 6671, 6822, 6840, 6884, 6907, 6970, 7025, 7052, 7078, 7243, 7253, 7318, 7379, 7486, 7524, 7668, 7680, 7720, 1137, 1138, 1139, 1140, 1141, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1150, 1151, 1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1164, 1165, 1166, 1167, 6015, 6029, 6045, 6077, 6129, 6144, 6164, 6201, 6227, 6244, 6250, 6264, 6289, 6304, 6316, 6384, 6421, 6441, 6492, 6514, 6530, 6569, 6584, 6621, 6651, 6659, 6683, 6703, 6727, 6732, 6745, 6755, 6784, 6817, 6823, 6841, 6871, 6885, 6898, 6908, 6933, 6971, 7009, 7018, 7045, 7053, 7068, 7079, 7096, 7104, 7122, 7151, 7163, 7181, 7244, 7273, 7319, 7336, 7380, 7402, 7462, 7487, 7525, 7569, 7626, 7689, 7707, 7721, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394, 1395, 1396, 1397, 1398, 1399, 1400, 1401, 1402, 1403, 1404, 1405, 1406, 1407, 1408, 1409, 1410, 1411, 1412, 1413, 1414, 1415, 1416, 1417, 1418, 1419, 1420, 1421, 1422, 1423, 1424, 1425, 1426, 1427, 1428, 1429,1430, 1431, 1432, 1433, 1434, 1435, 1436, 1437, 1439, 1440, 1441, 1442, 1443, 1444, 1445, 1446, 1447, 6001, 6030, 6078, 6108, 6130, 6165, 6265, 6275, 6305, 6329, 6370, 6385, 6404, 6531, 6585, 6622, 6652, 6733, 6756, 6765, 6798, 6824, 6972, 7046, a reverse transcriptase (RT) domain comprising the RT domain of a reference recombinant polypeptide having the sequence of any one of 7054, 7069, 7080, 7105, 7123, 7143, 7152, 7204, 7320, 7351, 7381, 7403, 7438, 7488, 7500, 7526, 7588, 7612, 7627, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto; a Cas nickase domain, wherein the RT domain is C-terminal to the Cas domain; and a linker disposed between the Cas nickase domain and the RT domain, the linker comprising the linker of the reference recombinant polypeptide or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto; A recombinant polypeptide comprising:

[0181] 176. A recombinant polypeptide, a reverse transcriptase (RT) domain having the sequence of SEQ ID NO: 8001, 8002 or 8003, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto; a Cas nickase domain, wherein the RT domain is C-terminal to the Cas nickase domain; and 1. A linker disposed between an RT domain and a Cas nickase domain, comprising: SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 9, 10, 12, 13, 14, 6076, 6143, 6200, 6254, 6274, 6315, 6328, 6337, 6403, 6420, 6440, 6513, 6552, 6613, 6671, 6822, 6840, 6884, 6907, 6970, 7025, 7052, 7078, 7243, 7253, 7318, 7379, 7486, 7524, 7668, 7680, 7720, 1137, 1138, 1139, 1140, 1141, 1142, 1143, 1144, 1145, 1146, 1147, 1148, 1149, 1150, 1151, 1152, 1153, 1154, 1155, 1156, 1157, 1158, 1159, 1160, 1161, 1162, 1163, 1164, 1165, 1166, 1167, 6015, 6029, 6045, 6077, 6129, 6144, 6164, 6201, 6227, 6244, 6250, 6264, 6289, 6304, 6316, 6384, 6421, 6441, 6492, 6514, 6530, 6569, 6584, 6621, 6651, 6659, 6683, 6703, 6727, 6732, 6745, 6755, 6784, 6817, 6823, 6841, 6871, 6885, 6898, 6908, 6933, 6971, 7009, 7018, 7045, 7053, 7068, 7079, 7096, 7104, 7122, 7151, 7163, 7181, 7244, 7273, 7319, 7336, 7380, 7402, 7462, 7487, 7525, 7569, 7626, 7689, 7707, 7721, 1371, 1372, 1373, 1374, 1375, 1376, 1377, 1378, 1379, 1380, 1381, 1382, 1383, 1384, 1385, 1386, 1387, 1388, 1389, 1390, 1391, 1392, 1393, 1394, 1395, 1396, 1397, 1398, 1399, 1400, 1401, 1402, 1403, 1404, 1405, 1406, 1407, 1408, 1409, 1410, 1411, 1412, 1413, 1414, 1415, 1416, 1417, 1418, 1419, 1420, 1421, 1422, 1423, 1424,1425, 1426, 1427, 1428, 1429, 1430, 1431, 1432, 1433, 1434, 1435, 1436, 1437, 1439, 1440, 1441, 1442, 1443, 1444, 1445, 1446, 1447, 6001, 6030, 6078, 6108, 6130, 6165, 6265, 6275, 6305, 6329, 6370, 6385, 6404, 6531, 6585, 6622, 6652, 6733, 6756, 6765, 6798, 68 a linker comprising the amino acid sequence of any linker of a reference recombinant polypeptide having the sequence of any one of: 24, 6972, 7046, 7054, 7069, 7080, 7105, 7123, 7143, 7152, 7204, 7320, 7351, 7381, 7403, 7438, 7488, 7500, 7526, 7588, 7612, 7627, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto; A recombinant polypeptide comprising:

[0182] 177. The recombinant polypeptide of any of embodiments 174-176, wherein the RT domain comprises a mutation at one or more of positions 8, 51, 67, 69, 197, 200, 204, 302, 306, 309, 313, 330, 436, 455, 526, 564, 585, 596, 605, 655, 673 compared to a reference RT domain having the sequence of SEQ ID NO: 8001.

[0183] 178. The recombinant polypeptide of any of embodiments 174-177, wherein the RT domain comprises one or more of the following mutations: Q51L, T67R, E67K, E69K, T197A, D200N, N204R, E302K, Y309N, W313F, G330P, T436G, N455K, D526G, E564Q, D585N, H596Q, L605W, D655N, L673P.

[0184] 179. The recombinant polypeptide of embodiment 178, wherein the RT domain comprises the following mutations: (a) D200N, G330P, and L605W, or (b) D200N, G330P, L605W, T306K, and W313F.

[0185] 180. The recombinant polypeptide of any of embodiments 174 to 179, comprising a linker having the sequence of any one of SEQ ID NOs: 11,041 to 11,050.

[0186] 181. A recombinant polypeptide comprising: a reverse transcriptase (RT) domain having the sequence of SEQ ID NO: 8,003 or a sequence having at least 95% identity thereto; a Cas nickase domain, wherein the RT domain is C-terminal to the Cas nickase domain; and A linker disposed between the RT domain and the Cas nickase domain, the linker comprising an amino acid sequence according to SEQ ID NO: 5217 or 15,401. A recombinant polypeptide comprising:

[0187] 182. A recombinant polypeptide comprising: a reverse transcriptase (RT) domain having the sequence of SEQ ID NO: 8,020 or a sequence having at least 95% identity thereto; a Cas nickase domain, wherein the RT domain is C-terminal to the Cas nickase domain; and A linker disposed between the RT domain and the Cas nickase domain, the linker comprising an amino acid sequence according to SEQ ID NO: 5217 or 15,402. A recombinant polypeptide comprising:

[0188] 183. A recombinant polypeptide comprising: a reverse transcriptase (RT) domain having the sequence of SEQ ID NO: 8,074 or a sequence having at least 95% identity thereto; a Cas nickase domain, wherein the RT domain is C-terminal to the Cas nickase domain; and A linker disposed between the RT domain and the Cas nickase domain, the linker comprising an amino acid sequence according to SEQ ID NO: 15,403. A recombinant polypeptide comprising:

[0189] 184. A recombinant polypeptide comprising: a reverse transcriptase (RT) domain having the sequence of SEQ ID NO: 8,113 or a sequence having at least 95% identity thereto; a Cas nickase domain, wherein the RT domain is C-terminal to the Cas nickase domain; and A linker disposed between the RT domain and the Cas nickase domain, the linker comprising an amino acid sequence according to SEQ ID NO: 15,404. A recombinant polypeptide comprising:

[0190] 185. A recombinant polypeptide comprising: A reverse transcriptase (RT) domain comprising the RT domain of a reference recombinant polypeptide having the sequence of any one of SEQ ID NOs: 1 to 7743; and a Cas nickase domain, wherein the RT domain is C-terminal to the Cas nickase domain; and a linker disposed between the RT domain and the Cas nickase domain, the linker comprising the linker of the reference recombinant polypeptide; A recombinant polypeptide comprising:

[0191] 186. The recombinant polypeptide of any of embodiments 174-185, comprising a nuclear localization signal (NLS).

[0192] 187. The recombinant polypeptide of any of embodiments 174-186, comprising a first NLS that is N-terminal to the Cas nickase domain.

[0193] 188. The recombinant polypeptide of any of embodiments 174-187, comprising an NLS that is C-terminal to the RT domain.

[0194] 189. The recombinant polypeptide of any of embodiments 174-188, comprising a first NLS that is N-terminal to the Cas nickase domain and a second NLS that is C-terminal to the RT domain.

[0195] 190. The recombinant polypeptide of any of embodiments 174 to 189, comprising a first NLS that is N-terminal to the Cas nickase domain, wherein the first NLS comprises the amino acid sequence of PAAKRVKLD (SEQ ID NO: 11,095).

[0196] 191. The recombinant polypeptide of any of embodiments 174 to 190, comprising an NLS that is C-terminal to the RT domain and has the amino acid sequence KRTADGSEFE (SEQ ID NO: 4650).

[0197] 192. The recombinant polypeptide of any of embodiments 174 to 191, comprising an NLS that is C-terminal to the RT domain and has the amino acid sequence KRTADGSEFESPKKKAKVE (SEQ ID NO: 4651).

[0198] 193. The recombinant polypeptide of any of embodiments 174 to 192, comprising the sequence of SEQ ID NO: 4000, comprising the first NLS and the Cas nickase domain.

[0199] 194. The recombinant polypeptide of any of embodiments 174 to 193, comprising the sequence of SEQ ID NO: 4001, which comprises a second NLS.

[0200] 195. The recombinant polypeptide of any of embodiments 174-194, comprising a GG amino acid sequence between the Cas nickase domain and the linker.

[0201] 196. The recombinant polypeptide of any of embodiments 174-195, comprising an AG amino acid sequence between the RT domain and the second NLS.

[0202] 197. The recombinant polypeptide of any of embodiments 174-196, comprising a GG amino acid sequence between the linker and the RT domain.

[0203] 198. The recombinant polypeptide of any of embodiments 174 to 197, wherein the Cas nickase domain comprises a Cas9 nickase domain.

[0204] 199. The recombinant polypeptide of any of embodiments 174 to 198, wherein the Cas nickase domain comprises an N863A mutation.

[0205] 200. The recombinant polypeptide of any of embodiments 174 to 199, wherein the Cas nickase comprises the sequence of SEQ ID NO: 11,096.

[0206] 201. The recombinant polypeptide of any of embodiments 174-200, wherein the Cas nickase comprises any of SEQ ID NOs: 9,001-9,037, 11,096, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto.

[0207] 202. The recombinant polypeptide of any of embodiments 174-201, comprising a methionine at the N-terminal position of the RT domain.

[0208] 203. The recombinant polypeptide of any of embodiments 174-202, wherein the RT domain does not comprise a methionine at the N-terminal position.

[0209] 204. The recombinant polypeptide of any of embodiments 174-203, comprising an amino acid sequence according to any of SEQ ID NOs: 1372, 1373, or 1410, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0210] 205. The recombinant polypeptide of any of embodiments 174 to 204, comprising an amino acid sequence according to SEQ ID NO: 2784 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto.

[0211] 206. The recombinant polypeptide of any of embodiments 174-205, comprising an amino acid sequence according to SEQ ID NO: 647 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto.

[0212] 207. The recombinant polypeptide of any of embodiments 174-206, comprising an amino acid sequence according to SEQ ID NO: 1197 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto.

[0213] 208. A nucleic acid molecule encoding a recombinant polypeptide of any of embodiments 174 to 207.

[0214] 209. The nucleic acid molecule of embodiment 208, comprising RNA.

[0215] 210. The nucleic acid molecule of embodiment 209, comprising mRNA.

[0216] 211. A cell comprising a recombinant polypeptide of any of embodiments 174 to 207.

[0217] 212. A cell comprising a nucleic acid molecule of any of embodiments 208-210.

[0218] 213. A system comprising: i) a recombinant polypeptide or a nucleic acid molecule encoding the recombinant polypeptide of any of embodiments 174 to 207, and ii) a template RNA, a) a gRNA spacer complementary to a portion of the target nucleic acid sequence; b) gRNA scaffold bound to the Cas nickase domain of the recombinant polypeptide; c) a heterologous sequence of interest; and d) Primer binding site sequence template RNA containing A system including:

[0219] 214. A lipid nanoparticle formulation comprising a recombinant polypeptide of any of embodiments 174 to 207, a nucleic acid of any of embodiments 208 to 210, or a system of embodiment 213.

[0220] 215. A method for modifying a target nucleic acid molecule in a cell, comprising contacting the cell with the system of embodiment 213, thereby modifying the target nucleic acid molecule.

[0221] 216. A method for modifying a target genome by target-primed reverse transcription using the recombinant polypeptide of any of embodiments 174 to 207, the nucleic acid of any of embodiments 208 to 210, or the system of embodiment 213, comprising contacting the target genome with the recombinant polypeptide, nucleic acid, or system, thereby modifying the target nucleic acid molecule.

[0222] In one aspect, the disclosure relates to a system for modifying DNA, the system comprising: (a) a nucleic acid encoding a genetically engineered polypeptide capable of target-primed reverse transcription, the polypeptide comprising (i) a reverse transcriptase domain and (ii) a Cas9 nickase that binds to DNA and has endonuclease activity; and (b) a template RNA comprising: (i) a gRNA spacer complementary to a first portion of a human gene; (ii) a gRNA scaffold that binds to the polypeptide; (iii) a heterologous sequence of interest comprising a mutation region; and (iv) a primer binding site (PBS) sequence at the 3' end of the template RNA that comprises at least 3, 4, 5, 6, 7, or 8 bases of 100% homology to the target DNA strand.

[0223] The gRNA spacer may comprise at least 15 bases at the 5' end of the template RNA that are 100% homologous to the target DNA. The template RNA may further comprise a PBS sequence that comprises at least 5 bases that are at least 80% homologous to the target DNA strand. The template RNA may comprise one or more chemical modifications.

[0224] The domains of the recombinant polypeptide may be linked by a peptide linker. The polypeptide may contain one or more peptide linkers. The recombinant polypeptide may further contain a nuclear localization signal. The polypeptide may contain two or more nuclear localization signals, for example, multiple adjacent nuclear localization signals or one or more nuclear localization signals in different regions of the polypeptide, for example, one or more nuclear localization signals at the N-terminus of the polypeptide and one or more nuclear localization signals at the C-terminus of the polypeptide. The nucleic acid encoding the recombinant polypeptide may encode one or more intein domains.

[0225] Introduction of the system into a target cell can result in the insertion of at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 500, or 1000 base pairs of exogenous DNA. Introduction of the system into a target cell can result in a deletion, where the deletion is less than 2, 3, 4, 5, 10, 50, or 100 base pairs of genomic DNA upstream or downstream of the insertion. Introduction of the system into a target cell can result in a substitution, for example, of 1, 2, or 3 nucleotides, for example, consecutive nucleotides.

[0226] The heterologous sequence of interest can be at least 5, 10, 25, 50, 100, 150, 200, 250, 300, 400, 500, 600, or 700 base pairs.

[0227] In one aspect, the present disclosure relates to a pharmaceutical composition comprising the above-described system and a pharmaceutically acceptable excipient or carrier, wherein the pharmaceutically acceptable excipient or carrier is selected from the group consisting of a plasmid vector, a viral vector, a vesicle, and a lipid nanoparticle. In one aspect, the present disclosure relates to a pharmaceutical composition comprising the above-described system and a plurality of pharmaceutically acceptable excipients or carriers, wherein the pharmaceutically acceptable excipients or carriers are selected from the group consisting of a plasmid vector, a viral vector, a vesicle, and a lipid nanoparticle, for example, wherein the above-described system is delivered by two different excipients or carriers, for example, two lipid nanoparticles, two viral vectors, or one lipid nanoparticle and one viral vector. The viral vector may be an adeno-associated virus (AAV).

[0228] In one aspect, the present disclosure relates to a host cell (e.g., a mammalian cell, e.g., a human cell) comprising the above-described system.

[0229] The system can be introduced in vivo, in vitro, ex vivo, or in situ. The nucleic acid (a) can be integrated into the genome of the host cell. In some embodiments, the nucleic acid (a) is not integrated into the genome of the host cell. In some embodiments, the heterologous sequence of interest is inserted at only one target site within the host cell genome. The heterologous sequence of interest can be inserted at two or more target sites within the host cell genome, for example, at the same corresponding sites on two homologous chromosomes or at two different sites on the same or different chromosomes. The heterologous sequence of interest can encode a mammalian polypeptide, or a fragment or variant thereof. The components of the system can be delivered on one, two, three, four, or more different nucleic acid molecules. The system can be introduced into the host cell by electroporation or by using at least one vehicle selected from a plasmid vector, a viral vector, a vesicle, and a lipid nanoparticle.

[0230] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. [Brief explanation of the drawings]

[0231] [Figure 1]1 shows the genetic engineering system described herein. The diagram on the left shows a genetic engineering polypeptide including a Cas nickase domain (e.g., spCas9 N863A) and a reverse transcriptase domain (RT domain) connected by a linker. The diagram on the right shows a template RNA including, from 5' to 3', a gRNA spacer, a gRNA scaffold, a heterologous sequence of interest, and a primer binding site sequence (PBS sequence). The heterologous sequence of interest may include a mutation region containing one or more sequence differences compared to the target site. The heterologous sequence of interest may also include pre-editing and post-editing homology regions flanking the mutation region. Without intending to be bound by any particular theory, it is believed that the gRNA spacer of the template RNA binds to the second strand of the target site in the genome, and the gRNA scaffold of the template RNA binds to the genetic engineering polypeptide, for example, to localize the genetic engineering polypeptide to the target site in the genome. It is believed that the Cas domain of the recombinant polypeptide nicks the target site (e.g., the first strand of the target site) and, for example, binds a PBS sequence to a sequence adjacent to the site to be modified on the first strand of the target site. It is believed that the RT domain of the recombinant polypeptide polymerizes, for example, a sequence complementary to the heterologous target sequence, using the PBS sequence of the template RNA as a primer and the first strand of the target site bound to a complementary sequence containing the heterologous target sequence of the template RNA as a template. Without intending to be bound by any particular theory, it is believed that reverse transcription can then proceed through the pre-edited homology region, then the mutation region, and then the post-edited homology region to generate a DNA strand containing the mutation specified by the heterologous target sequence. [Figure 2]

[0023] Figure 2A provides a schematic diagram of a recombinant polypeptide candidate for screening libraries and an illustration of a screening method. Figure 2A is a schematic diagram of a recombinant polypeptide candidate, a fusion polypeptide comprising a nuclear localization signal (NLS), a Streptococcus pyogenes (Spy) Cas9 nickase (Cas9n) containing an N863A mutation, a peptide linker (linker) selected from Table 10, and a reverse transcriptase domain (RT) from a retrovirus selected from Table 6. Figure 2B provides a schematic diagram of a screen performed using pooled members from a library of recombinant polypeptide candidates. [Figure 3] 1 provides a schematic diagram of an assay for detecting gene editing involving a targeted reporter gene (BFP) in a test cell line and three outcomes of the assay depending on whether there is no editing, incomplete editing, or complete editing from C to T (resulting in expression and detection of GFP but not BFP). [Figure 4] Figure 4A shows the editing activity of two exemplary recombinant polypeptides, MLVMS and MMTVB. Figure 4A shows the editing activity of two exemplary recombinant polypeptides as assessed by the percent of total cells converted to GFP positive. Figure 4B shows the editing activity of two exemplary recombinant polypeptides in the screens of Examples 2 and 3. Figure 4C shows a violin diagram of the editing activity of all exemplary recombinant polypeptides containing RT domains from the MLVMS RT family and the MMTVB RT family. [Figure 5A]

[0033] Figures 5A and 5B provide violin diagrams showing enrichment of exemplary recombinant polypeptides categorized by RT family. Figure 5A shows a violin diagram of enrichment after HEK293T cells were treated with the recombinant polypeptide and exemplary template RNA g4. Figure 5B shows a violin diagram of enrichment after U2OS cells were treated with the recombinant polypeptide and exemplary template RNA g4. Figure 5C shows a violin diagram of enrichment after HEK293T cells were treated with the recombinant polypeptide and exemplary template RNA g10. Figure 5D shows a violin diagram of enrichment after U2OS cells were treated with the recombinant polypeptide and exemplary template RNA g10. Figure 5E shows data for additional replicates of the data shown in Figure 5A, in which HEK293T cells were treated with the recombinant polypeptide and exemplary template RNA g4. Figure 5F shows data for additional replicates of the data shown in Figure 5A, in which HEK293T cells were treated with the recombinant polypeptide and exemplary template RNA g4. FIG. 5G shows a violin diagram combining the data from FIGS. 5A, 5E, and 5F, in which HEK293T cells were treated with recombinant polypeptides and exemplary template RNA g4. [Figure 5B] Same as above [Figure 5C] Same as above [Figure 5D] Same as above [Figure 5E] Same as above [Figure 5F] Same as above [Figure 5G] Same as above [Figure 6]

[0023] Figure 1 shows a graph of the enrichment of exemplary recombinant polypeptides when editing activity was tested in HEK293T cells (X-axis) or U2OS cells (Y-axis). A linear regression line is plotted based on the scatter plot data. [Figure 7] 1 shows a graph of the enrichment of exemplary genetically modified polypeptides when editing activity was tested in exemplary template RNA g4 (X-axis) or exemplary template RNA g10 (Y-axis). A linear regression line is plotted based on the scatter plot data. [Figure 8-1]Violin diagrams showing the enrichment of exemplary recombinant polypeptides classified by RT family are provided (Figure 8A MLVAV, Figure 8B MLVBM, Figure 8C BAEVM, Figure 8D FLV, Figure 8E FOAMV, Figure 8F GALV), where wild-type RT family recombinant polypeptides are shown on the left, followed by recombinant polypeptides containing increasing numbers of substitution mutations on the right. [Figure 8-2] Same as above [Figure 9-1] Violin diagrams showing the enrichment of exemplary recombinant polypeptides categorized by RT family are provided (FIG. 9A KORV, FIG. 9B AVIRE, FIG. 9C MLVCB, FIG. 9D MLVFF, FIG. 9E MLVMS, FIG. 9F SFV3L, FIG. 9G WMSV, FIG. 9H XMRV6), where wild-type RT family recombinant polypeptides are shown on the left, followed by recombinant polypeptides containing increasing numbers of substitution mutations on the right. For the KORV and SFV3L RT families, mutants that deleted / disabled the protease domain of the RT domain were also evaluated. [Figure 9-2] Same as above [Figure 9-3] Same as above [Figure 10] Violin diagrams showing the enrichment of exemplary recombinant polypeptides categorized by RT family are provided (FIG. 10A PERV, FIG. 10B SFV1, FIG. 10C FFV), where wild-type RT family recombinant polypeptides are shown on the left, followed by recombinant polypeptides containing increasing numbers of substitution mutations on the right. For the SFV1 and FFV RT families, mutants that deleted / disabled the protease domain of the RT domain were also evaluated. [Figure 11]1 provides a boxplot of enrichment for a selection of exemplary recombinant polypeptides sorted by linker, where the dotted box indicates the mean enrichment of recombinant polypeptides containing the highest performing linkers, and the dash-dotted line indicates the standard error of said mean enrichment. The figure discloses SEQ ID NOs: 5217, 5130, 5006, 5129, 5128, 5124, 5112, 5220, 5136, 5219, 5118, 5143-5144, 5116, 5114-5115, 5117, and 5138, respectively, in order of appearance. [Figure 12] Graphs of the editing activity of exemplary recombinant polypeptides are shown when editing is targeted to the genomic landing pad BFP gene in U2OS cells (Figure 12A), when editing is targeted to HEK3 in U2OS cells (Figure 12B), when editing is targeted to mouse Fah in primary mouse hepatocytes (Figure 12C), and when editing is targeted to mouse Fah in the liver of Fah5981SB model mice (Figure 12D). [Figure 13] 1 shows a graph of the enrichment of a selection of exemplary recombinant polypeptides after being provided to cells as a plasmid (DNA) or mRNA. [Figure 14] 1 is a graph showing the Z-scores of a library of recombinant polypeptide candidates in each of three conditions. [Figure 15] 1 is a diagram showing a workflow for arrayed screening of recombinant polypeptides using flow cytometry. [Figure 16] 16 is a series of graphs showing the percentage of cells that have undergone successful reprogramming events and exhibit GFP fluorescence after introducing recombinant polypeptides and plasmids according to the workflow shown in FIG. 15. [Figure 17] 1 is a series of graphs showing the results of testing arrayed lead candidates compared to results from screening pooled RT candidates. DETAILED DESCRIPTION OF THE INVENTION

[0232] definition The term "expression cassette," as used herein, refers to a nucleic acid construct that contains sufficient nucleic acid elements for expression of a nucleic acid molecule of the invention.

[0233] "gRNA spacer," as used herein, refers to a portion of a nucleic acid that has complementarity to a target nucleic acid and, together with the gRNA scaffold, can target a Cas protein to the target nucleic acid.

[0234] "gRNA scaffold," as used herein, refers to a portion of a nucleic acid that can bind to a Cas protein and, together with a gRNA spacer, target the Cas protein to a target nucleic acid. In some embodiments, the gRNA scaffold comprises a crRNA sequence, a tetraloop, and a tracrRNA sequence.

[0235] "Genetically engineered polypeptide," as used herein, refers to a polypeptide comprising a retroviral reverse transcriptase or a polypeptide comprising an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence identity to a retroviral reverse transcriptase that is capable of integrating a nucleic acid sequence (e.g., a sequence provided on a template nucleic acid) into a target DNA molecule (e.g., within a mammalian host cell, such as a genomic DNA molecule within the host cell). In some embodiments, a genetically engineered polypeptide is capable of integrating a sequence substantially independent of the host machinery. In some embodiments, a genetically engineered polypeptide integrates a sequence at a random location within a genome; in some embodiments, a genetically engineered polypeptide integrates a sequence at a specific target site. In some embodiments, a genetically engineered polypeptide comprises one or more domains that collectively: 1) bind to a template nucleic acid; 2) facilitate binding to a target DNA molecule; and 3) facilitate integration of at least a portion of the template nucleic acid into the target DNA. A genetically engineered polypeptide includes both naturally occurring polypeptides and engineered variants thereof, e.g., having one or more amino acid substitutions relative to the naturally occurring sequence. Transgenic polypeptides also include heterologous constructs, for example, where one or more of the domains listed above are heterologous to one another, whether by heterologous fusion (or other conjugation) of otherwise wild-type domains as well as fusion of modified domains, for example, by substitution or fusion of heterologous subdomains or other replacement domains. Exemplary transgenic polypeptides that can be used in the methods provided herein, and systems comprising and methods of using them, are described in PCT / US2021 / 020948, incorporated herein by reference, for example, with respect to transgenic polypeptides comprising retroviral reverse transcriptase domains. In some embodiments, the transgenic polypeptide incorporates a sequence into a gene. In some embodiments, the transgenic polypeptide incorporates a sequence into a sequence outside of a gene. "Transgenic system," as used herein, refers to a system comprising a transgenic polypeptide and a template nucleic acid.

[0236] As used herein, the term "domain" refers to a structure of a biomolecule that contributes to a specific function of the biomolecule. A domain can include a continuous region (e.g., a contiguous sequence) or discrete, non-contiguous regions (e.g., non-contiguous sequences) of a biomolecule. Examples of protein domains include, but are not limited to, endonuclease domains, DNA-binding domains, and reverse transcription domains; examples of nucleic acid domains include regulatory domains, such as transcription factor binding domains. In some embodiments, a domain (e.g., a Cas domain) can include two or more smaller domains (e.g., a DNA-binding domain and an endonuclease domain).

[0237] As used herein, the term "exogenous," when used in reference to a biomolecule (e.g., a nucleic acid sequence or a polypeptide), means that the biomolecule has been introduced into a host genome, cell, or organism by human intervention. For example, a nucleic acid that is added to an existing genome, cell, tissue, or subject using recombinant DNA technology or other methods is exogenous to the existing nucleic acid sequence, cell, tissue, or subject.

[0238] As used herein, the terms "first strand" and "second strand" used to describe individual DNA strands of a target DNA distinguish between the two DNA strands upon which a reverse transcriptase domain initiates polymerization, e.g., upon which target-primed synthesis is initiated. The first strand refers to the strand of target DNA upon which a reverse transcriptase domain initiates polymerization, e.g., upon which target-primed synthesis is initiated. The second strand refers to the other strand of target DNA. The names first strand and second strand do not otherwise describe target site DNA strands; for example, in some embodiments, the first strand and second strand are nicked by the polypeptides described herein, but the names "first" and "second" strand are independent of the order in which such nicks appear.

[0239] A "genomic safe harbor site" (GSH site) is a site within a host genome that can accommodate the integration of new genetic material, such that the inserted genetic element does not cause significant alterations to the host genome that pose a risk to the host cell or organism. GSH sites generally meet one, two, three, four, five, six, seven, eight, or nine of the following criteria: (i) located >300 kb from a cancer-associated gene; (ii) located >300 kb from an miRNA / other functional small RNA; (iii) located >50 kb from the 5' gene end; (iv) located >50 kb from a replication origin; (v) located >50 kb away from an ultraconserved element; (vi) having low transcriptional activity (i.e., no mRNA + / - 25 kb); (vii) not within a variable copy number region; (viii) located within open chromatin; and / or (ix) having one copy and being unique within the human genome. Examples of GSH sites within the human genome that meet some or all of these criteria include: (i) adenovirus site 1 (AAVS1), the naturally occurring integration site of the AAV virus on chromosome 19; (ii) the chemokine (CC motif) receptor 5 (CCR5) gene, a chemokine receptor gene known as an HIV-1 co-receptor; (iii) the human orthologue of the mouse Rosa26 locus; and (iv) the ribosomal DNA ("rDNA") locus. Additional GSH sites are known and are described, for example, in Pellenz et al., epub August 20, 2018 (https: / / doi.org / 10.1101 / 396390).

[0240] The term "heterologous," when used to refer to a first element with respect to a second element, means that the first and second elements do not naturally exist in the arrangement described. For example, a heterologous polypeptide, nucleic acid molecule, construct, or sequence refers to (a) a polypeptide, nucleic acid molecule, or portion of a polypeptide or nucleic acid molecule sequence that is not native to the cell in which it is expressed; (b) a polypeptide or nucleic acid molecule or portion of a polypeptide or nucleic acid molecule that has been modified or mutated relative to its natural state; or (c) a polypeptide or nucleic acid molecule that has altered expression compared to native expression levels under similar conditions. For example, heterologous regulatory sequences (e.g., promoters, enhancers) can be used to regulate expression of a gene or nucleic acid molecule in a manner different from that in which the gene or nucleic acid molecule is normally expressed in nature. In another example, a heterologous domain of a polypeptide or nucleic acid sequence (e.g., a DNA-binding domain of a polypeptide, or a nucleic acid encoding a DNA-binding domain of a polypeptide) can be positioned relative to other domains or can be of a different sequence or derived from a different source compared to other domains or portions of a polypeptide or its encoding nucleic acid. In certain embodiments, a heterologous nucleic acid molecule may be present in the native host cell genome, but may have an altered expression level or a different sequence, or both. In other embodiments, a heterologous nucleic acid molecule may not be endogenous to the host cell or host genome, but instead may be introduced into the host cell by transformation (e.g., transfection, electroporation), where the added molecule may be integrated into the host genome or may exist as extrachromosomal genetic material, either transiently (e.g., mRNA) or semi-stable for more than one generation (e.g., episomal viral vectors, plasmids, or other self-replicating vectors).

[0241] As used herein, "insertion" of a sequence into a target site refers to the net addition of a DNA sequence at the target site, e.g., where there is a new nucleotide in the heterologous sequence of interest that does not have a cognate position in the unedited target site. In some embodiments, nucleotide alignment of the PBS sequence and the heterologous sequence of interest to the target nucleic acid sequence will result in an alignment gap in the target nucleic acid sequence.

[0242] As used herein, a "deletion" generated by a heterologous sequence of interest at a target site refers to the net deletion of DNA sequence at the target site, e.g., where there is a nucleotide in the unedited target site that does not have a cognate position in the heterologous sequence of interest. In some embodiments, nucleotide alignment of the PBS sequence and heterologous sequence of interest to the target nucleic acid sequence will result in an alignment gap in the molecule comprising the PBS sequence and the heterologous sequence of interest.

[0243] As used herein, the term "inverted terminal repeat" or "ITR" refers to an AAV viral cis element, so named because of its symmetry, which facilitates efficient propagation of the AAV genome. The minimum elements for ITR function are a Rep binding site (RBS; for AAV2, 5'-GCGCGCTCGCTCGCTC-3'; SEQ ID NO: 4601) and a terminal separation site (TRS; for AAV2, 5'-AGTTGG-3'; SEQ ID NO: 4602). ’)It is hypothesized that the ITR comprises at least these three elements (RBS, TRS, and a sequence that allows hairpin formation). In accordance with the present invention, an ITR comprises at least these three elements (RBS, TRS, and a sequence that allows hairpin formation). In addition, in the present invention, the term "ITR" refers to the ITRs of known natural AAV serotypes (e.g., ITRs of serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 AAV), chimeric ITRs formed by fusing ITR elements from different serotypes, and functional variants thereof. A "functional variant" refers to a sequence that exhibits at least 80%, 85%, 90%, and preferably at least 95% sequence identity with a known ITR and allows for the growth of sequences containing the ITR in the presence of Rep proteins.

[0244] The term "mutation region," as used herein, refers to a region in a template RNA that has one or more sequence differences compared to the corresponding sequence in a target nucleic acid. Sequence differences can include, for example, substitutions, insertions, frameshifts, or deletions.

[0245] The term "mutant," when applied to a nucleic acid sequence, means that nucleotides within a nucleic acid sequence have been inserted, deleted, or changed relative to a reference (e.g., naturally occurring) nucleic acid sequence. A single alteration may be made at a single locus (point mutation), or multiple nucleotides may be inserted, deleted, or changed at a single locus. In addition, one or more alterations may be made at any number of loci within a nucleic acid sequence. Nucleic acid sequences can be mutated by any method known in the art.

[0246] "Nucleic acid molecule" refers to both RNA and DNA molecules, including, but not limited to, complementary DNA ("cDNA"), genomic DNA ("gDNA"), and messenger RNA ("mRNA"), and also includes synthetic nucleic acid molecules, such as those chemically synthesized or recombinantly produced, such as RNA templates, as described herein. Nucleic acid molecules can be double-stranded or single-stranded, circular or linear. If single-stranded, the nucleic acid molecule can be the sense or antisense strand. Unless otherwise specified, and as an example of all sequences described herein in the general format "SEQ ID NO:1," a nucleic acid containing "SEQ ID NO:1" refers to a nucleic acid having, at least a portion thereof, either (i) the sequence of SEQ ID NO:1, or (ii) a sequence complementary to SEQ ID NO:1. The choice between the two is determined by the context in which SEQ ID NO:1 is used. For example, if the nucleic acid is used as a probe, the choice between the two is determined by the requirement that the probe be complementary to the desired target. The nucleic acid sequences of the present disclosure may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily understood by those skilled in the art. Such modifications include, for example, labels, methylation, substitution of one or more naturally occurring nucleotides with analogs, internucleotide modifications such as uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), pendant moieties (e.g., polypeptides), intercalating agents (e.g., acridines, psoralens, etc.), chelators, alkylating agents, and modified linkages (e.g., α-anomeric nucleic acids, etc.). Chemically modified bases (e.g., see Table 13 below), backbones (e.g., see Table 14 below), and modified caps (e.g., see Table 15 below) are also included. Synthetic molecules that mimic polynucleotides in their ability to bind to designated sequences through hydrogen bonding and other chemical interactions are also included. Such molecules are known in the art and include, for example, those that substitute peptide linkages for phosphate linkages in the backbone of the molecule, eg, peptide nucleic acids (PNAs).Other modifications can include, for example, analogs in which the ribose ring contains a bridging moiety or other structures, such as modifications found in "locked" nucleic acids (LNA). In various embodiments, the nucleic acid is operatively associated with additional genetic elements, such as tissue-specific expression-controlling sequences (e.g., tissue-specific promoters and tissue-specific microRNA recognition sequences), as well as additional elements, such as inverted repeats (e.g., inverted terminal repeats, e.g., elements derived from viruses (e.g., AAV ITRs)) and tandem repeats, inverted / direct repeats, homologous regions (segments with varying degrees of homology to the target DNA), untranslated regions (UTRs) (5', 3', or both 5' and 3' UTRs), and various combinations of the foregoing. Nucleic acid elements of the systems provided by the present invention can be provided in various topologies, including single-stranded, double-stranded, circular, linear, open-ended linear, closed-ended linear, and specific versions thereof, e.g., doggybone DNA (dbDNA), closed-ended DNA (ceDNA).

[0247] As used herein, a "gene expression unit" is a nucleic acid sequence comprising at least one regulatory nucleic acid sequence operably linked to at least one effector sequence. A first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if the promoter or enhancer affects the transcription or expression of the coding sequence. Operably linked DNA sequences can be contiguous or non-contiguous. Where necessary to link two protein coding regions, operably linked sequences can be in the same reading frame.

[0248] The term "host genome" or "host cell," as used herein, refers to a cell and / or its genome into which proteins and / or genetic material have been introduced. These terms refer not only to the particular subject cell and / or genome, but also to the progeny of such a cell and / or the genomes of the progeny of such a cell. Because certain modifications may occur in subsequent generations due to mutations or environmental influences, it is understood that such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term "host cell" as used herein. A host genome or host cell may be an isolated cell or cell line grown in culture, or genomic material isolated from such a cell or cell line, or may be a host cell or host genome comprising a living tissue or organism. In some cases, the host cell may be an animal cell or a plant cell, e.g., as described herein. In certain examples, the host cell may be a mammalian cell, a human cell, an avian cell, a reptilian cell, a bovine cell, an equine cell, a porcine cell, a caprine cell, a ovine cell, a chicken cell, or a turkey cell. In particular examples, the host cell can be a corn cell, a soybean cell, a wheat cell, or a rice cell.

[0249] As used herein, "operably associated" describes the functional relationship between two nucleic acid sequences, e.g., 1) a promoter and 2) a heterologous sequence of interest, and in such instances means that the promoter and heterologous sequence of interest (e.g., a gene of interest) are oriented such that, under appropriate conditions, the promoter drives expression of the heterologous sequence of interest. For example, a template nucleic acid bearing a promoter and a heterologous sequence of interest can be, for example, single-stranded in either a (+) or (-) orientation. The "operably associated" relationship between the promoter and heterologous sequence of interest in this template means that the template nucleic acid will be correctly transcribed when under appropriate conditions (e.g., in the (+) orientation, in the presence of required catalytic factors, NTPs, etc.), regardless of whether the template nucleic acid will be transcribed under a particular condition. Operative association applies similarly to other pairs of nucleic acids, including sequences encoding other tissue-specific expression control sequences (e.g., enhancers, repressors, and microRNA recognition sequences), IR / DR, ITR, UTR, or homologous regions, and a heterologous sequence of interest, or a retroviral RT domain.

[0250] As used herein, a "stem-loop sequence" refers to a nucleic acid sequence (e.g., an RNA sequence) having a stem containing sufficient self-complementarity to form a stem-loop, e.g., at least 2 (e.g., 3, 4, 5, 6, 7, 8, 9, or 10) base pairs, and a loop having at least 3 (e.g., 4) base pairs. The stem may contain mismatches or bulges.

[0251] As used herein, "tissue-specific expression-control sequence" refers to a nucleic acid element that increases or decreases the level of a transcript containing a heterologous sequence of interest in a target tissue in a tissue-specific manner, e.g., preferentially in on-target tissue compared to off-target tissue. In some embodiments, the tissue-specific expression-control sequence preferentially drives or represses the transcription, activity, or half-life of a transcript containing a heterologous sequence of interest in a target tissue in a tissue-specific manner, e.g., preferentially in on-target tissue compared to off-target tissue. Exemplary tissue-specific expression-control sequences include tissue-specific promoters, repressors, enhancers, or combinations thereof, and tissue-specific microRNA recognition sequences. Tissue specificity refers to on-target (tissues in which expression or activity of the template nucleic acid is desired or acceptable) and off-target (tissues in which expression or activity of the template nucleic acid is undesirable or unacceptable). For example, a tissue-specific promoter preferentially drives expression in on-target tissue compared to off-target tissue. In contrast, microRNAs that bind to tissue-specific microRNA recognition sequences are preferentially expressed in off-target tissues compared to on-target tissues, thereby reducing the expression of the template nucleic acid in the off-target tissue. Thus, promoters and microRNA recognition sequences specific to the same tissue, such as target tissues, have contrasting functions with respect to the transcription, activity, or half-life of the associated sequence in the tissue (i.e., matching expression levels, i.e., promoting and suppressing high levels of the microRNA in off-target tissues and low levels in on-target tissues, respectively, while the promoter drives high expression in on-target tissues and low expression in off-target tissues).

[0252] List of Headlines 1) Introduction 2) Genetic recombination system a) Polypeptide components of the genetic engineering system i) Lighting Domain ii) Endonuclease domain and DNA binding domain (1) A recombinant polypeptide containing a Cas domain (2) TAL effectors and zinc finger nucleases iii) Linker iv) Localization sequences for recombinant DNA systems v) Evolved variants of genetically engineered polypeptides and systems vi) Intein vii) Further domains b) Template nucleic acid i) gRNA spacer and gRNA scaffold ii) Heterologous sequence of interest iii) PBS sequence iv) Exemplary template sequences c) gRNA with inducible activity d) Circular RNA and ribozymes in recombinant DNA systems e) Target nucleic acid site f) Second Strand Nicking 3) Preparation of compositions and systems 4) Therapeutic use 5) Administration and Delivery a) Tissue-specific activity / administration i) Promoter ii) microRNA b) Viral vectors and their components c) AAV administration d) Lipid nanoparticles 6) Kits, Products, and Pharmaceutical Compositions 7) Chemistry, Manufacturing, and Controls (CMC)

[0253] introduction The present disclosure relates to methods, compositions, and methods for targeting, editing, modifying, or manipulating DNA sequences (e.g., inserting a heterologous sequence of interest at a target site in a mammalian genome) at one or more locations within a DNA sequence in a cell, tissue, or subject, e.g., in vivo or in vitro. The heterologous DNA sequence of interest may include, for example, substitutions, deletions, insertions, e.g., of a coding sequence, a regulatory sequence, or a gene expression unit.

[0254] The present disclosure also provides methods for treating disease using a reverse transcriptase-based system for modifying a genomic DNA sequence of interest, for example, by inserting, deleting, or substituting one or more nucleotides into / from the sequence of interest.

[0255] The present disclosure provides, in part, methods for treating disease using a genetic engineering system comprising a genetically engineered polypeptide component and a template nucleic acid (e.g., template RNA) component. In some embodiments, the genetic engineering system can be used to introduce modifications into a target site in a genome. In some embodiments, the genetically engineered polypeptide component comprises a writing domain (e.g., a reverse transcriptase domain), a DNA-binding domain, and an endonuclease domain (e.g., a nickase domain). In some embodiments, the template nucleic acid (e.g., template RNA) comprises a sequence (e.g., a gRNA spacer) that binds to the target site in the genome (e.g., binds to the second strand of the target site), a sequence that binds to the genetically engineered polypeptide component (e.g., a gRNA scaffold), a heterologous sequence of interest, and a PBS sequence. Without wishing to be bound by theory, it is believed that the template nucleic acid (e.g., template RNA) binds to the second strand of the target site in the genome and binds to the genetically engineered polypeptide component (e.g., localizes the polypeptide component to the target site in the genome). The endonuclease (e.g., nickase) of the recombinant polypeptide component may cleave the target site (e.g., the first strand of the target site) and, for example, a PBS sequence may bind to the sequence adjacent to the site to be modified on the first strand of the target site. The writing domain (e.g., reverse transcriptase domain) of the polypeptide component may polymerize, for example, a sequence complementary to the heterologous target sequence, using the first strand of the target site bound to a complementary sequence comprising the PBS sequence of the template nucleic acid as a primer and the heterologous target sequence of the template nucleic acid as a template. Without wishing to be bound by theory, it is believed that selection of an appropriate heterologous target sequence may result in the substitution, deletion, and / or insertion of one or more nucleotides at the target site.

[0256] Genetic engineering system In some embodiments, the genetic engineering systems described herein include (A) a genetically engineered polypeptide or a nucleic acid encoding a genetically engineered polypeptide, where the genetically engineered polypeptide includes (i) a reverse transcriptase domain and either (x) an endonuclease domain comprising DNA-binding functionality or (y) an endonuclease domain and a separate DNA-binding domain; and (B) a template RNA. In some embodiments, the genetically engineered polypeptide acts as a substantially autonomous protein machinery capable of integrating a template nucleic acid sequence into a target DNA molecule (e.g., within a mammalian host cell, such as a genomic DNA molecule within the host cell) substantially independent of the host machinery. For example, the genetically engineered protein may include a DNA-binding domain, a reverse transcriptase domain, and an endonuclease domain. In some embodiments, the DNA-binding functionality may include an RNA component, e.g., a gRNA spacer, that guides the protein to the DNA sequence. In other embodiments, the genetically engineered polypeptide may include a reverse transcriptase domain and an endonuclease domain. The RNA template element of the genetic engineering system is typically heterologous to the genetically engineered polypeptide element and provides the sequence of interest to be inserted (reverse transcribed) into the host genome. In some embodiments, the engineered polypeptide is capable of target-primed reverse transcription. In some embodiments, the engineered polypeptide is capable of second strand synthesis.

[0257] In some embodiments, the genetic recombination system is combined with a second polypeptide. In some embodiments, the second polypeptide may include an endonuclease domain. In some embodiments, the second polypeptide may include a polymerase domain, such as a reverse transcriptase domain. In some embodiments, the second polypeptide may include a DNA-dependent DNA polymerase domain. In some embodiments, the second polypeptide assists in completing genome editing, for example, by contributing to second strand synthesis or DNA repair recovery.

[0258] A functional recombinant polypeptide can be composed of unrelated DNA-binding, reverse transcription, and endonuclease domains. This modular structure allows for the combination of functional domains, such as dCas9 (DNA binding), MMLV reverse transcriptase (reverse transcription), and FokI (endonuclease). In some embodiments, multiple functional domains can occur from a single protein, such as Cas9 or Cas9 nickase (DNA binding, endonuclease).

[0259] In some embodiments, the engineered polypeptide comprises one or more domains that collectively: 1) bind to a template nucleic acid; 2) facilitate binding to a target DNA molecule; and 3) facilitate integration of at least a portion of the template nucleic acid into the target DNA. In some embodiments, the engineered polypeptide is a modified polypeptide comprising one or more amino acid substitutions relative to the corresponding native sequence. In some embodiments, the engineered polypeptide comprises two or more domains that are heterologous to each other, e.g., by heterologous fusion (or other conjugate) of otherwise wild-type domains as well as fusion of modified domains, e.g., by substitution or fusion of heterologous subdomains or other replacement domains. For example, in some embodiments, one or more of the RT domain is heterologous to the DBD; the DBD is heterologous to the endonuclease domain; or the RT domain is heterologous to the endonuclease domain.

[0260] In some embodiments, a template RNA molecule for use in the system comprises, from 5' to 3', (1) a gRNA spacer; (2) a gRNA scaffold; (3) a heterologous sequence of interest; and (4) a primer binding site (PBS) sequence. (1) a gRNA spacer of about 18 to 22 nt, for example, 20 nt; (2) A gRNA scaffold comprising one or more hairpin loops, e.g., one, two, or three loops for associating a template with a Cas domain, e.g., a nickase Cas9 domain. In some embodiments, the gRNA scaffold comprises, from 5' to 3', the sequence GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGGACCGAGTCGGTCC (SEQ ID NO: 5008). (3) In some embodiments, the heterologous sequence of interest is, for example, 7 to 74, e.g., 10 to 20, 20 to 30, 30 to 40, 40 to 50, 50 to 60, 60 to 70, or 70 to 80 or 80 to 90 nt in length. In some embodiments, the first (usually 5') base of the sequence is not C. (4) In some embodiments, the PBS sequence that binds to the target priming sequence after nicking is, for example, 3 to 20 nt, for example, 7 to 15 nt, for example, 12 to 14 nt, and has a GC content of 40 to 60%.

[0261] In some embodiments, a second gRNA associated with the system can help drive complete integration. In some embodiments, the second gRNA can target a position 0-200 nt away from the first strand nick, e.g., 0-50, 50-100, or 100-200 nt away from the first strand nick. In some embodiments, the second gRNA can only bind to its target sequence after editing has occurred, e.g., the gRNA binds to a sequence present in the heterologous sequence of interest but not in the initial target sequence.

[0262] In some embodiments, the genetic engineering systems described herein are used to perform editing in HEK293, K562, U2OS, or HeLa cells. In some embodiments, the genetic engineering systems are used to perform editing in primary cells, such as primary cortical neurons from E18.5 mice.

[0263] In some embodiments, the recombinant polypeptides described herein comprise a reverse transcriptase or RT domain (e.g., as described herein) comprising a MoMLV RT sequence or a variant thereof. In embodiments, the MoMLV RT sequence comprises one or more mutations selected from D200N, L603W, T330P, T306K, W313F, D524G, E562Q, D583N, P51L, S67R, E67K, T197A, H204R, E302K, F309N, L435G, N454K, H594Q, D653N, R110S, and K103L. In some embodiments, the MoMLV RT sequence comprises a combination of mutations, such as D200N, L603W, and T330P, optionally further comprising T306K and / or W313F.

[0264] In some embodiments, the endonuclease domain (e.g., as described herein) comprises nCAS9, e.g., comprising an H840A mutation.

[0265] In some embodiments, a heterologous sequence of interest (e.g., in a system described herein) is about 1-50, 50-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-900, 900-1000, or more nucleotides in length.

[0266] In some embodiments, the RT and endonuclease domains are linked by a flexible linker, for example, comprising the amino acid sequence SGGSSGGSSGSETPGTSESATPESSGGSSGGSS (SEQ ID NO: 5006).

[0267] In some embodiments, the endonuclease domain is N-terminal to the RT domain. In some embodiments, the endonuclease domain is C-terminal to the RT domain.

[0268] In some embodiments, the system incorporates a heterologous sequence of interest into a target site by TPRT, for example, as described herein.

[0269] In some embodiments, the genetically engineered polypeptide comprises a DNA-binding domain. In some embodiments, the genetically engineered polypeptide comprises an RNA-binding domain. In some embodiments, the RNA-binding domain comprises an RNA-binding domain of a B-box protein, an MS2 coat protein, dCas, or an element of a sequence in a table herein. In some embodiments, the RNA-binding domain can bind to a template RNA with higher affinity than a standard RNA-binding domain.

[0270] In some embodiments, the genetic recombination system is capable of generating insertions at a target site of at least 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides (and optionally up to 500, 400, 300, 200, or 100 nucleotides). In some embodiments, the genetic recombination system is capable of generating insertions at a target site of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides (and optionally up to 500, 400, 300, 200, or 100 nucleotides). In some embodiments, the genetic recombination system is capable of generating insertions at target sites of at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 kilobases (and optionally up to 1, 5, 10, or 20 kilobases). In some embodiments, the genetic recombination system is capable of generating deletions of at least 81, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides (and optionally up to 500, 400, 300, or 200 nucleotides). In some embodiments, the genetic engineering system is capable of generating deletions of at least 81, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides (and optionally up to 500, 400, 300, or 200 nucleotides). In some embodiments, the genetic engineering system is capable of generating deletions of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 nucleotides (and optionally up to 500, 400, 300, or 200 nucleotides).In some embodiments, the genetic engineering system is capable of generating deletions of at least 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, or 10 kilobases (and optionally up to 1, 5, 10, or 20 kilobases). In some embodiments, the genetic engineering system is capable of generating substitutions at the target site of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 or more nucleotides. In some embodiments, the genetic recombination system can generate substitutions at 1-2, 2-3, 3-4, 4-5, 5-10, 10-15, 15-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 nucleotides in the target site.

[0271] In some embodiments, the substitution is a transition mutation. In some embodiments, the substitution is a transversion mutation. In some embodiments, the substitution converts adenine to thymine, adenine to guanine, adenine to cytosine, guanine to thymine, guanine to cytosine, guanine to adenine, thymine to cytosine, thymine to adenine, thymine to guanine, cytosine to adenine, cytosine to guanine, or cytosine to thymine.

[0272] In some embodiments, the insertion, deletion, substitution, or a combination thereof increases or decreases expression (e.g., transcription or translation) of a gene. In some embodiments, the insertion, deletion, substitution, or a combination thereof increases or decreases expression (e.g., transcription or translation) of a gene by modifying, adding, or deleting sequences in a promoter or enhancer, such as sequences that bind transcription factors. In some embodiments, the insertion, deletion, substitution, or a combination thereof alters the translation of a gene (e.g., alters the amino acid sequence), inserts or deletes start or stop codons, alters or restores the translation frame of a gene. In some embodiments, the insertion, deletion, substitution, or a combination thereof alters the splicing of a gene, for example, by inserting, deleting, or modifying a splice acceptor or donor site. In some embodiments, the insertion, deletion, substitution, or a combination thereof alters the half-life of a transcript or protein. In some embodiments, the insertion, deletion, substitution, or combination thereof alters protein localization in a cell (e.g., from the cytoplasm to mitochondria, from the cytoplasm to the extracellular space (e.g., adding a secretion tag)). In some embodiments, the insertion, deletion, substitution, or combination thereof alters (e.g., improves) protein folding (e.g., to prevent the accumulation of misfolded proteins). In some embodiments, the insertion, deletion, substitution, or combination thereof alters, increases, decreases the activity of a gene, e.g., a protein encoded by the gene.

[0273] Exemplary recombinant polypeptides, and systems comprising and methods of using them, are described in PCT / US2021 / 020948, which is incorporated herein by reference, for example, with respect to retroviral RT domains, including amino acid and nucleic acid sequences therein.

[0274] Exemplary recombinant polypeptide and retroviral RT domain sequences are also described, for example, in International Patent Application No. PCT / US21 / 20948, filed March 4, 2021, e.g., Tables 30, 31, and 44 therein; this application is incorporated herein by reference in its entirety, e.g., with respect to the retroviral RT sequences and tables. Thus, the recombinant polypeptides described herein can comprise an amino acid sequence according to any of the tables described in this paragraph, or a domain thereof (e.g., a retroviral RT domain), or a functional fragment or variant thereof of any of the above, or an amino acid sequence having at least 70%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0275] In some embodiments, a polypeptide for use in any of the systems described herein can be a molecular or ancestral reconstructor based on aligned polypeptide sequences of multiple homologous proteins. In some embodiments, a reverse transcriptase domain for use in any of the systems described herein can be a molecular or ancestral reconstructor, or can be modified at specific residues based on alignment of reverse transcriptase domains from the same or different sources. Those skilled in the art can align polypeptide or nucleic acid sequences based on the accession numbers provided herein, for example, by using routine sequence analysis tools such as the Basic Local Alignment Search Tool (BLAST) or CD-Search for conserved domain analysis. Molecular reconstructors can be generated based on sequence consensus, for example, using techniques described in Ivics et al., Cell 1997, 501-510; Wagstaff et al., Molecular Biology and Evolution 2013, 88-99.

[0276] Polypeptide components of recombinant systems In some embodiments, the genetically engineered polypeptide has the functions of DNA target site binding, template nucleic acid (e.g., RNA) binding, DNA target site cleavage, and template nucleic acid (e.g., RNA) writing, e.g., reverse transcription. In some embodiments, each function is contained within a different domain. In some embodiments, a function can be attributed to two or more domains (e.g., two or more domains together exhibit functionality). In some embodiments, two or more domains can have the same or similar function (e.g., two or more domains each independently possess DNA binding functionality, e.g., in two different DNA sequences). In other embodiments, one or more domains can perform one or more functions; for example, a Cas9 domain can perform both DNA binding and target site cleavage. In some embodiments, the domains are all located within a single polypeptide. In some embodiments, the first domain is present in a first polypeptide and the second domain is present in a second polypeptide. For example, in some embodiments, the sequence may be split between a first polypeptide and a second polypeptide, e.g., the first polypeptide comprises a reverse transcriptase (RT) domain and the second polypeptide comprises a DNA-binding domain and an endonuclease domain, e.g., a nickase domain. By way of further example, in some embodiments, the first polypeptide and the second polypeptide each comprise a DNA-binding domain (e.g., a first DNA-binding domain and a second DNA-binding domain). In some embodiments, the first and second polypeptides may be post-translationally joined via a split intein to form a single recombinant polypeptide.

[0277] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of AVIRE RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto; and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0278] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of BAEVM RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0279] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of FFV RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0280] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of FLV RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0281] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of FOAMV RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0282] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of GALV RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0283] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of KORV RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0284] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of MLVAV RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto; and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0285] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of MLVBM RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto; and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0286] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of MLVCB RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0287] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of MLVFF RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0288] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of MLVMS RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0289] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of a PERV RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto; and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0290] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of SFV1 RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0291] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of SFV3L RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0292] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of WMSV RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto; and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0293] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of XMRV6 RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto; and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0294] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of BLVAU RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0295] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of BLVJ RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0296] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of HTL1A RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0297] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of HTL1C RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto; and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0298] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of HTL1L RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0299] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of HTL32 RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0300] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of HTL3P RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0301] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of HTLV2 RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0302] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of JSRV RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0303] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of MLVF5 RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0304] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of MLVRD RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto; and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0305] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of MMTVB RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0306] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of MPMV RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0307] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of SFVCP RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto; and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0308] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of SMRVH RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0309] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of SRV1 RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto; and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0310] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of SRV2 RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto; and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0311] In one aspect, the present disclosure provides a recombinant polypeptide comprising: a DNA binding domain (DBD) that binds to a target nucleic acid sequence; the RT domain of WDSV RT or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto, and a linker disposed between the DBD and the RT domain (e.g., a linker comprising an amino acid sequence listed in Table 10 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto); Includes; An engineered polypeptide is provided in which the DBD is heterologous to the RT domain (e.g., a Cas domain, e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); optionally, the RT domain is C-terminal to the Cas domain.

[0312] Recombinant domain (RT domain) In certain aspects of the present invention, the genetic recombination domain of the genetic recombination system has reverse transcriptase activity and is also referred to as a reverse transcriptase domain (RT domain). In some embodiments, the RT domain includes an RT catalytic portion and an RNA-binding region (e.g., a region that binds to a template RNA).

[0313] In some embodiments, the nucleic acid encoding the reverse transcriptase is modified from its native sequence to have altered codon usage, e.g., improved for human cells. In some embodiments, the reverse transcriptase domain is a heterologous reverse transcriptase from a retrovirus. In some embodiments, the RT domain comprising the recombinant polypeptide has been mutated from its original amino acid sequence, e.g., has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 substitutions. In some embodiments, the RT domain is derived from a retroviral RT, e.g., HIV-1 RT, Moloney Murine Leukemia Virus (MMLV) RT, avian myeloblastosis virus (AMV) RT, or Rous Sarcoma Virus (RSV) RT.

[0314] In some embodiments, the retroviral reverse transcriptase (RT) domain exhibits increased stringency for target-primed reverse transcription (TPRT) initiation, e.g., compared to the endogenous RT domain. In some embodiments, the RT domain initiates TPRT when 3 nt within the target site immediately upstream of the first-strand nick, e.g., the genomic DNA priming the RNA template, are at least 66% or 100% complementary to the 3 nt of homology in the RNA template. In some embodiments, the RT domain initiates TPRT when there is less than a 5 nt mismatch (e.g., less than a 1, 2, 3, 4, or 5 nt mismatch) between the template RNA and the target DNA primed reverse transcription. In some embodiments, the RT domain is modified to increase the stringency of mismatches in priming the TPRT reaction, e.g., the RT domain tolerates no mismatches or tolerates fewer mismatches within the priming region compared to a wild-type (e.g., unmodified) RT domain. In some embodiments, the RT domain comprises an HIV-1 RT domain. In embodiments, the HIV-1 RT domain initiates synthesis at a lower level, even with three nucleotide mismatches, compared to alternative RT domains (e.g., as described by Jamburuthugoda and Eickbush J Mol Biol 407(5):661-672 (2011), which is incorporated herein by reference in its entirety).

[0315] In some embodiments, the RT domain forms a dimer (e.g., a heterodimer or a homodimer). In some embodiments, the RT domain is a monomer. In some embodiments, the RT domain naturally functions as a monomer or a dimer (e.g., a heterodimer or a homodimer). In some embodiments, the RT domain naturally functions as a monomer, e.g., is derived from a virus that functions as a monomer. In some embodiments, the RT domain is selected from the group consisting of murine leukemia virus (MLV; sometimes referred to as MoMLV) (e.g., P03355), porcine endogenous retrovirus (PERV) (e.g., UniProt Q4VFZ2), mouse mammary tumor virus (MMTV) (e.g., UniProt P03365), Mason-Pfizer monkey virus (MPMV) (e.g., UniProt P07572), bovine leukemia virus (BLV) (e.g., UniProt P03361), human T-cell leukemia virus-1 (HTLV-1) (e.g., UniProt P03362), human foamy virus (HFV) (e.g., UniProt P03363), and / or porcine endogenous retrovirus (PERV) (e.g., UniProt Q4VFZ2). In some embodiments, the RT domain is selected from the RT domains of simian foamy virus (SFV) (e.g., UniProt P23074), bovine foamy / syncytial virus (BFV / BSV) (e.g., UniProt O41894), or functional fragments or variants thereof (e.g., amino acid sequences having at least 70%, 80%, 90%, 95%, or 99% identity thereto). In some embodiments, the RT domain is dimeric in its native functionality. In some embodiments, the RT domain is derived from a virus that functions as a dimer.In embodiments, the RT domain is selected from the group consisting of avian sarcoma / leukemia virus (ASLV) (e.g., UniProt A0A142BKH1), Rous sarcoma virus (RSV) (e.g., UniProt P03354), avian myeloblastosis virus (AMV) (e.g., UniProt Q83133), human immunodeficiency virus type I (HIV-1) (e.g., UniProt P03369), human immunodeficiency virus type II (HIV-2) (e.g., UniProt P15833), simian immunodeficiency virus (SIV) (e.g., UniProt P05896), bovine immunodeficiency virus (BIV) (e.g., UniProt P19560), equine infectious anemia virus (EIAV) (e.g., UniProt P03371), or feline immunodeficiency virus (FIV) (e.g., UniProt P16088) (Herschhorn and Hizi Cell Mol Life Sci 67(16):2717-2747 (2010)), or a functional fragment or variant thereof (e.g., an amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% identity thereto). Naturally, heterodimeric RT domains may, in some embodiments, also be functional as homodimers. In some embodiments, the dimeric RT domain is expressed as a fusion protein, e.g., as a homodimeric fusion protein or a heterodimeric fusion protein. In some embodiments, the RT function of the system is fulfilled by multiple RT domains (e.g., as described herein).In further embodiments, the multiple RT domains can be fused or separate, for example, on the same polypeptide or on different polypeptides.

[0316] In some embodiments, the genetic recombination systems described herein include an integrase domain, e.g., the integrase domain can be part of an RT domain. In some embodiments, the RT domain (e.g., as described herein) includes an integrase domain. In some embodiments, the RT domain (e.g., as described herein) lacks an integrase domain or includes an integrase domain that has been inactivated by mutation or deletion. In some embodiments, the genetic recombination systems described herein include an RNase H domain, e.g., the RNase H domain can be part of the RT domain. In some embodiments, the RNase H domain is not part of the RT domain but is covalently linked via a flexible linker. In some embodiments, the RT domain (e.g., as described herein) includes an RNase H domain, e.g., an endogenous RNase H domain or a heterologous RNase H domain. In some embodiments, the RT domain (e.g., as described herein) lacks an RNase H domain. In some embodiments, an RT domain (e.g., as described herein) comprises an RNase H domain that has been added, deleted, mutated, or exchanged for a heterologous RNase H domain. In some embodiments, the polypeptide comprises an inactivated endogenous RNase H domain. In some embodiments, an endogenous RNase H domain from one of the polypeptide's other domains is genetically removed such that it is not included in the polypeptide, e.g., the endogenous RNase H domain is partially or completely truncated from the polypeptide that comprises the domain. In some embodiments, mutation of the RNase H domain produces a polypeptide that exhibits reduced RNase activity, e.g., by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% less, compared to an otherwise similar domain without the mutation, e.g., as measured by the method in Kotewicz et al. Nucleic Acids Res 16(1):265-277 (1988), incorporated herein by reference in its entirety.In some embodiments, RNase H activity is abolished.

[0317] In some embodiments, the RT domain is mutated to increase fidelity relative to other similar domains that do not have the mutation. For example, in some embodiments, the YADD (SEQ ID NO: 15461) or YMDD motif (SEQ ID NO: 15462) is YVDD (SEQ ID NO: 15463) In some embodiments, YADD (SEQ ID NO: 15461) , or YMDD (SEQ ID NO: 15462) , or YVDD (SEQ ID NO: 15463) Substitution of results in greater fidelity in retroviral reverse transcriptase activity (e.g., as described in Jamburuthugoda and Eickbush J Mol Biol 2011; incorporated herein by reference in its entirety).

[0318] In some embodiments, an engineered polypeptide described herein comprises an RT domain having an amino acid sequence according to Table 6, or a sequence with at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto. In some embodiments, a nucleic acid described herein encodes an RT domain having an amino acid sequence according to Table 6, or a sequence with at least 70%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto.

[0319] [Table 6-1]

[0320] [Table 6-2]

[0321] [Table 6-3]

[0322]

Table 6-4

[0323]

Table 6-5

[0324]

Table 6-6

[0325]

Table 6-7

[0326]

Table 6-8

[0327]

Table 6-9

[0328]

Table 6-10

[0329]

Table 6-11

[0330]

Table 6-12

[0331]

Table 6-13

[0332]

Table 6-14

[0333] [Table 6-15]

[0334] In some embodiments, the reverse transcriptase domain is modified, for example, by site-directed mutagenesis. In some embodiments, the reverse transcriptase domain is engineered to have improved properties, such as the SuperScript IV (SSIV) reverse transcriptase from MMLV RT. In some embodiments, the reverse transcriptase domain may be engineered to have a lower error rate, for example, as described in International Publication No. WO2001068895, incorporated herein by reference. In some embodiments, the reverse transcriptase domain may be engineered to have increased thermostability. In some embodiments, the reverse transcriptase domain may be engineered to have increased processivity. In some embodiments, the reverse transcriptase domain may be engineered to be resistant to inhibitors. In some embodiments, the reverse transcriptase domain may be engineered to be faster. In some embodiments, the reverse transcriptase domain may be engineered to have increased tolerance to modified nucleotides in the RNA template. In some embodiments, the reverse transcriptase domain may be engineered to insert modified DNA nucleotides. In some embodiments, the reverse transcriptase domain is engineered to bind to the template RNA. In some embodiments, the one or more mutations are selected from D200N, L603W, T330P, D524G, E562Q, D583N, P51L, S67R, E67K, T197A, H204R, E302K, F309N, W313F, L435G, N454K, H594Q, L671P, E69K, H8Y, T306K, or D653N in the RT domain of murine leukemia virus reverse transcriptase, or a corresponding mutation at a corresponding position in another RT domain.

[0335] In some embodiments, an RT domain (e.g., listed in Table 6) comprises one or more mutations listed in Table 2 below. In some embodiments, an RT domain listed in Table 6 comprises 1, 2, 3, 4, 5, or 6 of the mutations listed in the corresponding row of Table 2 below.

[0336] [Table 2-1]

[0337] [Table 2-2]

[0338] [Table 2-3]

[0339] [Table 2-4]

[0340] In some embodiments, the recombinant polypeptide comprises an RT domain from a retroviral reverse transcriptase, such as, for example, wild-type M-MLV RT, comprising the sequence: M-MLV(WT): [ka]

[0341] In some embodiments, the recombinant polypeptide comprises an RT domain from a retroviral reverse transcriptase, such as, for example, M-MLV RT, which comprises the following sequence: [ka]

[0342] In some embodiments, the recombinant polypeptide comprises an RT domain from a retroviral reverse transcriptase comprising the sequence of amino acids 659 to 1329 of NP_057933. In embodiments, the recombinant polypeptide further comprises one additional amino acid at the N-terminus of the sequence of amino acids 659 to 1329 of NP_057933, for example, as shown below. [ka] Core RT (bold), annotations above RNAseH (underlined), annotation as above

[0343] In embodiments, the recombinant polypeptide further comprises one additional amino acid at the C-terminus of the sequence of amino acids 659 to 1329 of NP_057933. In embodiments, the recombinant polypeptide comprises an RNase H1 domain (e.g., amino acids 1178 to 1318 of NP_057933).

[0344] In some embodiments, a retroviral reverse transcriptase domain, e.g., M-MLV RT, can contain one or more mutations from the wild-type sequence that can improve characteristics of the RT, such as thermostability, processivity, and / or template binding. In some embodiments, the M-MLV RT domain comprises one or more mutations selected from D200N, L603W, T330P, T306K, W313F, D524G, E562Q, D583N, P51L, S67R, E67K, T197A, H204R, E302K, F309N, L435G, N454K, H594Q, D653N, R110S, K103L relative to the M-MLV(WT) sequence above, e.g., a combination of mutations such as D200N, L603W, and T330P, optionally further comprising T306K and W313F. In some embodiments, an M-MLV RT as used herein comprises the mutations D200N, L603W, T330P, T306K, and W313F. In embodiments, the mutant M-MLV RT comprises the following amino acid sequence: M-MLV(PE2): [ka]

[0345] In some embodiments, the writing domain (e.g., the RT domain) comprises an RNA-binding domain that specifically binds to, for example, an RNA sequence. In some embodiments, the template RNA comprises an RNA sequence that is specifically bound by the RNA-binding domain of the writing domain.

[0346] In some embodiments, the reverse transcription domain simply recognizes and reverse transcribes a specific template of the system, e.g., a template RNA. In some embodiments, the template comprises a sequence or structure that allows recognition and reverse transcription by the reverse transcription domain. In some embodiments, the template comprises a sequence or structure that allows association with an RNA-binding domain of a polypeptide component of a genome modification system described herein. In some embodiments, the genome modification system preferentially reverse transcribes a template that includes an association sequence over a template that lacks the association sequence.

[0347] The writing domain may also comprise DNA-dependent DNA polymerase activity, e.g., an enzymatic activity capable of writing DNA into a genome from a template DNA sequence. In some embodiments, DNA-dependent DNA polymerization is used to complete second strand synthesis of target site editing. In some embodiments, the DNA-dependent DNA polymerase activity is provided by a DNA polymerase domain in the polypeptide. In some embodiments, the DNA-dependent DNA polymerase activity is provided by a reverse transcriptase domain that is also capable of DNA-dependent DNA polymerization, e.g., second strand synthesis. In some embodiments, the DNA-dependent DNA polymerase activity is provided by a second polypeptide of the system. In some embodiments, the DNA-dependent DNA polymerase activity is optionally provided by an endogenous host cell polymerase recruited to the target site by a component of the genome modification system.

[0348] In some embodiments, the reverse transcriptase domain exhibits a lower probability of poor termination (P) in vitro compared to a reference reverse transcriptase domain. off In some embodiments, the reference reverse transcriptase domain is a viral reverse transcriptase domain, for example, the RT domain from M-MLV.

[0349] In some embodiments, the reverse transcriptase domain has a nucleotide sequence of about 5×10 in vitro, e.g., as measured on 1094 nt RNA. -3 / nt, 5 × 10 -4 / nt, or 5 x 10 -6 A lower probability of insufficient termination (P off In some embodiments, insufficient termination rates in vitro are determined as described in Bibillo and Eickbush (2002) J Biol Chem 277(38):34836-34845, which is incorporated herein by reference in its entirety.

[0350] In some embodiments, the reverse transcriptase domain can complete at least about 30% or 50% of integrations in the cell. The percentage of complete integrations can be measured by dividing the number of substantially full-length integration events (e.g., genomic sites containing at least 98% of the expected integration sequence) by the number of total integration events (including substantially full-length and partial) in the cell population. In some embodiments, integration in the cell is determined (e.g., through the integration site) using long-read amplicon sequencing, as described, for example, in Karst et al. (2020) bioRxiv doi.org / 10.1101 / 645903 (incorporated herein by reference in its entirety).

[0351] In embodiments, quantifying integration in a cell comprises counting the percentage of integrations that comprise at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the DNA sequence corresponding to the template RNA (e.g., a template RNA having a length of at least 0.05, 0.1, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.5, 2, 3, 4, or 5 kb, e.g., 0.5-0.6, 0.6-0.7, 0.7-0.8, 0.8-0.9, 1.0-1.2, 1.2-1.4, 1.4-1.6, 1.6-1.8, 1.8-2.0, 2-3, 3-4, or 4-5 kb).

[0352] In some embodiments, the reverse transcriptase domain is capable of polymerizing dNTPs in vitro. In embodiments, the reverse transcriptase domain is capable of polymerizing dNTPs in vitro at a rate of 0.1 to 50 nt / sec (e.g., 0.1 to 1, 1 to 10, or 10 to 50 nt / sec). In embodiments, polymerization of dNTPs by the reverse transcriptase domain is measured by a single-molecule assay, e.g., as described in Schwartz and Quake (2009) PNAS 106(48):20294-20299, which is incorporated by reference in its entirety.

[0353] In some embodiments, the reverse transcriptase domain is at least 1×10, e.g., as described in Yasukawa et al. (2017) Biochem Biophys Res Commun 492(2):147-153, which is incorporated herein by reference in its entirety. -3 ~1×10 -4 or 1 x 10 -4 ~1×10 -5 In some embodiments, the reverse transcriptase domain has an in vitro error rate (e.g., nucleotide misincorporation) of 1×10 substitutions / nt. In some embodiments, the reverse transcriptase domain is sequenced at 1×10 nucleotides per nucleotide in cells (e.g., HEK293T cells), e.g., by long-read amplicon sequencing, as described, e.g., in Karst et al. (2020) bioRxiv doi.org / 10.1101 / 645903 (incorporated herein by reference in its entirety). -3~1×10 -4 or 1 x 10 -4 ~1×10 -5 It has an error rate (e.g., nucleotide misincorporation) of substitutions / nt.

[0354] In some embodiments, the reverse transcriptase domain is capable of performing reverse transcription of the target RNA in vitro. In some embodiments, the reverse transcriptase requires a primer of at least 3 nucleotides to initiate reverse transcription of the template. In some embodiments, reverse transcription of the target RNA is determined by detecting cDNA from the target RNA (e.g., when an ssDNA primer is provided that anneals to the target with at least 3, 4, 5, 6, 7, 8, 9, or 10 nt at the 3' end), e.g., as described in Bibillo and Eickbush (2002) J Biol Chem 277(38):34836-34845 (incorporated herein by reference in its entirety).

[0355] In some embodiments, the reverse transcriptase domain performs reverse transcription (e.g., by generating cDNA) at least 5-fold or 10-fold more efficiently, e.g., when converting its RNA template to cDNA, compared to, e.g., an RNA template lacking a protein-binding motif (e.g., a 3'UTR). In embodiments, the efficiency of reverse transcription is measured as described in Yasukawa et al. (2017) Biochem Biophys Res Commun 492(2):147-153, which is incorporated herein by reference in its entirety.

[0356] In some embodiments, the reverse transcriptase domain specifically binds to a particular RNA template at a higher frequency (e.g., about 5-fold or 10-fold higher frequency) than any endogenous cellular RNA, e.g., when expressed in a cell (e.g., HEK293T cell). In embodiments, the frequency of specific binding between the reverse transcriptase domain and the template RNA is measured by CLIP-seq, e.g., as described in Lin and Miles (2019) Nucleic Acids Res 47(11):5490-5501, which is incorporated herein by reference in its entirety.

[0357] template nucleic acid binding domain The recombinant polypeptide typically has a region capable of associating with a template nucleic acid (e.g., template RNA). In some embodiments, the template nucleic acid binding domain is an RNA binding domain. In some embodiments, the RNA binding domain is a modular domain that can associate with RNA molecules containing a particular signature, e.g., a structural motif. In other embodiments, the template nucleic acid binding domain (e.g., RNA binding domain) is contained within a reverse transcription domain, e.g., a component derived from a reverse transcriptase enzyme, which has a known signature for RNA preference.

[0358] In other embodiments, the template nucleic acid binding domain (e.g., RNA binding domain) is contained within the target DNA binding domain. For example, in some embodiments, the DNA binding domain is a CRISPR-associated protein that recognizes the structure of a template nucleic acid (e.g., template RNA) that includes a gRNA. In some embodiments, the genetically engineered polypeptide comprises a DNA binding domain that includes a CRISPR-associated protein that associates with a gRNA scaffold, allowing the DNA binding domain to bind to a target genomic DNA sequence. In some embodiments, the gRNA scaffold and gRNA spacer are contained within the template nucleic acid (e.g., template RNA), such that the DNA binding domain is also the template nucleic acid binding domain. In some embodiments, the polypeptide has RNA binding function in multiple domains, e.g., it may bind to a gRNA structure within the CRISPR-associated DNA binding domain and an additional sequence or structure within the reverse transcriptase domain.

[0359] In some embodiments, the RNA-binding domain can bind to the template RNA with higher affinity than a standard RNA-binding domain. In some embodiments, the standard RNA-binding domain is an RNA-binding domain from S. pyogenes Cas9. In some embodiments, the RNA-binding domain can bind to the template RNA with an affinity of 100 pM to 10 nM (e.g., 100 pM to 1 nM or 1 nM to 10 nM). In some embodiments, the affinity of the RNA-binding domain for its template RNA is measured in vitro, e.g., by thermophoresis, as described, e.g., in Asmari et al. Methods 146:107-119 (2018), which is incorporated herein by reference in its entirety. In some embodiments, the affinity of the RNA-binding domain for its template RNA is measured in a cell (e.g., by FRET or CLIP-Seq).

[0360] In some embodiments, the RNA-binding domain associates with the template RNA in vitro at least about 5-fold or 10-fold more frequently than scrambled RNA. In some embodiments, the frequency of association between the RNA-binding domain and the template RNA or scrambled RNA is measured by CLIP-seq, e.g., as described in Lin and Miles (2019) Nucleic Acids Res 47(11):5490-5501, incorporated herein by reference in its entirety. In some embodiments, the RNA-binding domain associates with the template RNA in cells (e.g., HEK293T cells) at least about 5-fold or 10-fold more frequently than scrambled RNA. In some embodiments, the frequency of association between the RNA-binding domain and the template RNA or scrambled RNA is measured by CLIP-seq, e.g., as described in Lin and Miles (2019) supra.

[0361] Endonuclease domain and DNA binding domain In some embodiments, the genetically engineered polypeptide functions to cleave a DNA target site via an endonuclease domain. In some embodiments, the genetically engineered polypeptide comprises, for example, a DNA-binding domain for binding to a target nucleic acid. In some embodiments, a domain of the genetically engineered polypeptide (e.g., a Cas domain) comprises two or more smaller domains, for example, a DNA-binding domain and an endonuclease domain. When a DNA-binding domain (e.g., a Cas domain) is described as binding to a target nucleic acid sequence, it is understood that in some embodiments, binding is mediated by a gRNA.

[0362] In some embodiments, the domain has two functions. For example, in some embodiments, the endonuclease domain is also a DNA-binding domain. In some embodiments, the endonuclease domain is also a template nucleic acid (e.g., template RNA)-binding domain. For example, in some embodiments, the polypeptide comprises a CRISPR-associated endonuclease domain that binds to a template RNA, including a gRNA, binds to a target DNA sequence (e.g., having complementarity to a portion of the gRNA), and cleaves the target DNA sequence. In some embodiments, an endonuclease domain or endonuclease / DNA-binding domain derived from a heterologous source can be used or modified (e.g., by inserting, deleting, or substituting one or more residues) in the genetic engineering systems described herein.

[0363] In some embodiments, the nucleic acid encoding the endonuclease domain or endonuclease / DNA-binding domain is modified from its native sequence to have modified codon usage, e.g., improved for human cells. In some embodiments, the endonuclease element is a heterologous endonuclease element, such as a Cas endonuclease (e.g., Cas9), a Type II restriction endonuclease (e.g., Fok1), a meganuclease (e.g., I-SceI), or other endonuclease domain.

[0364] In certain aspects, the DNA-binding domain of a genetically engineered polypeptide described herein is selected, designed, or engineered for binding to a desired host DNA target sequence. In certain embodiments, the DNA-binding domain of the polypeptide is a heterologous DNA-binding factor. In some embodiments, the heterologous DNA-binding factor is a zinc finger factor or TAL effector factor, e.g., a zinc finger or TAL polypeptide or a functional fragment thereof. In some embodiments, the heterologous DNA-binding factor is a sequence-guided DNA-binding factor, such as Cas9, Cpfl, or other CRISPR-associated protein, that has been modified to lack endonuclease activity. In some embodiments, the heterologous DNA-binding factor retains endonuclease activity. In some embodiments, the heterologous DNA-binding factor retains partial endonuclease activity, such as cleaving ssDNA, e.g., has nickase activity. In certain embodiments, the heterologous DNA-binding domain can be any one or more of Cas9, a TAL domain, a ZF domain, a Myb domain, a combination thereof, or a complex thereof.

[0365] In some embodiments, the DNA-binding domain is modified, e.g., by site-directed mutagenesis, to increase or decrease DNA-binding factors (e.g., the number and / or specificity of zinc fingers), etc., to alter DNA-binding specificity and affinity. In some embodiments, the nucleic acid sequence encoding the DNA-binding domain is modified from its native sequence to have altered codon usage, e.g., improved for human cells. In several embodiments, the DNA-binding domain includes one or more modifications relative to the wild-type DNA-binding domain, e.g., modifications by directed evolution, e.g., phage-assisted continuous evolution (PACE).

[0366] In some embodiments, the DNA-binding domain comprises a meganuclease domain (e.g., an endonuclease domain portion, e.g., as described herein), or a functional fragment thereof. In some embodiments, the meganuclease domain has endonuclease activity, e.g., double-strand cleavage and / or nickase activity. In other embodiments, the meganuclease domain has reduced activity, e.g., lacks endonuclease activity, e.g., the meganuclease is catalytically inactive. In some embodiments, a catalytically inactive meganuclease is used as the DNA-binding domain, e.g., as described in Fonfara et al. Nucleic Acids Res 40(2):847-860 (2012), which is incorporated herein by reference in its entirety.

[0367] In some embodiments, the recombinant polypeptide comprises modifications to the DNA-binding domain, e.g., compared to the wild-type polypeptide. In some embodiments, the DNA-binding domain comprises additions, deletions, substitutions, or modifications to the amino acid sequence of the original DNA-binding domain. In some embodiments, the DNA-binding domain is modified to comprise a heterologous functional domain that specifically binds to a target nucleic acid (e.g., DNA) sequence of interest. In some embodiments, the functional domain replaces at least a portion (e.g., the entirety) of a previous DNA-binding domain of the polypeptide. In some embodiments, the functional domain comprises a zinc finger (e.g., a zinc finger that specifically binds to a target nucleic acid (e.g., DNA) sequence of interest. In some embodiments, the functional domain comprises a Cas domain (e.g., a Cas domain that specifically binds to a target nucleic acid (e.g., DNA) sequence of interest. In some embodiments, the Cas domain comprises Cas9 or a mutant or variant thereof (e.g., as described herein). In embodiments, the Cas domain is associated with a guide RNA (gRNA), e.g., as described herein. In embodiments, the Cas domain is guided to the target nucleic acid (e.g., DNA) sequence of interest by the gRNA. In some embodiments, the Cas domain is encoded in the same nucleic acid (e.g., RNA) molecule as the gRNA. In some embodiments, the Cas domain is encoded in a different nucleic acid (e.g., RNA) molecule than the gRNA.

[0368] In some embodiments, the DNA-binding domain can bind to a target sequence (e.g., a dsDNA target sequence) with higher affinity than a standard DNA-binding domain. In some embodiments, the standard DNA-binding domain is a DNA-binding domain from S. pyogenes Cas9. In some embodiments, the DNA-binding domain can bind to a target sequence (e.g., a dsDNA target sequence) with an affinity of 100 pM to 10 nM (e.g., 100 pM to 1 nM or 1 nM to 10 nM).

[0369] In some embodiments, the affinity of a DNA binding domain for its target sequence (e.g., a dsDNA target sequence) is measured in vitro, e.g., by thermophoresis, as described, e.g., in Asmari et al. Methods 146:107-119 (2018), which is incorporated herein by reference in its entirety.

[0370] In embodiments, the DNA-binding domain can bind to its target sequence (e.g., a dsDNA target sequence) with an affinity of, for example, 100 pM to 10 nM (e.g., 100 pM to 1 nM or 1 nM to 10 nM) in the presence of a molar excess, e.g., about a 100-fold molar excess, of scrambled sequence competitor dsDNA.

[0371] In some embodiments, the DNA-binding domain is found to bind to its target sequence (e.g., a dsDNA target sequence) at a higher frequency than any other sequence in the genome of the target cell, e.g., a human target cell, as measured by, e.g., ChIP-seq (e.g., in HEK293T cells), e.g., as described in He and Pu (2010) Curr. Protoc Mol Biol Chapter 21, which is incorporated herein by reference in its entirety. In some embodiments, the DNA-binding domain is found to bind to its target sequence (e.g., a dsDNA target sequence) at a frequency at least about 5-fold or 10-fold higher than any other sequence in the genome of the target cell, as measured by, e.g., ChIP-seq (e.g., in HEK293T cells), e.g., as described in He and Pu (2010) supra.

[0372] In some embodiments, the endonuclease domain has nickase activity and cleaves one strand of the target DNA. In some embodiments, the nickase activity reduces the formation of double-strand breaks at the target site. In some embodiments, the endonuclease domain generates staggered nicks in the first and second strands of the target DNA. In some embodiments, the staggered nicks generate free 3' overhangs at the target site. In some embodiments, the free 3' overhangs at the target site improve editing efficiency, for example, by enhancing access and annealing of the 3' homologous region of the template nucleic acid. In some embodiments, the staggered nicks reduce the formation of double-strand breaks at the target site.

[0373] In some embodiments, the endonuclease domain cleaves both strands of the target DNA, e.g., resulting in a blunt-end cleavage of the target with no ssDNA overhangs on either side of the cleavage site. The amino acid sequence of the endonuclease domain of the genetic recombination systems described herein can be at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the amino acid sequence of an endonuclease domain described herein, e.g., an endonuclease domain described herein.

[0374] In certain embodiments, the heterologous endonuclease is Fok1 or a functional fragment thereof. In certain embodiments, the heterologous endonuclease is a Holliday junction resolvase or a homolog thereof, such as the Holliday junction cleavage enzyme (Ssol Hje) from Sulfolobus solfataricus (Govindaraju et al., Nucleic Acids Research 44:7, 2016). In certain embodiments, the heterologous endonuclease is a large fragment endonuclease of a spliceosomal protein, such as Prp8 (Mahbub et al., Mobile DNA 8:16, 2017). In certain embodiments, the heterologous endonuclease is derived from a CRISPR-associated protein, such as Cas9. In certain embodiments, the heterologous endonuclease is modified to have only ssDNA cleavage activity, e.g., only nickase activity, e.g., a Cas9 nickase, e.g., SpCas9 with a D10A, H840A, or N863A mutation. Table 8 lists exemplary Cas proteins and mutations associated with nickase activity. In yet other embodiments, the homologous endonuclease domain is modified, e.g., by site-directed mutagenesis, to alter DNA endonuclease activity. In yet other embodiments, the endonuclease domain is modified to reduce DNA sequence specificity, e.g., by truncation to remove a domain that confers DNA sequence specificity or mutations to inactivate the region that confers DNA sequence specificity.

[0375] In some embodiments, the endonuclease domain has nickase activity and does not form double-stranded breaks. In some embodiments, the endonuclease domain forms single-stranded breaks more frequently than double-stranded breaks, for example, at least 90%, 95%, 96%, 97%, 98%, or 99% of the cuts are single-stranded breaks, or less than 10%, 5%, 4%, 3%, 2%, or 1% of the cuts are double-stranded breaks. In some embodiments, the endonuclease does not substantially form double-stranded breaks. In some embodiments, the endonuclease does not form detectable levels of double-stranded breaks.

[0376] In some embodiments, the endonuclease domain has a nickase activity that nicks the target site DNA of the first strand; for example, in some embodiments, the endonuclease domain cleaves the genomic DNA of the target site near the modification site on the strand that will be extended by the writing domain. In some embodiments, the endonuclease domain has a nickase activity that nicks the target site DNA of the first strand but does not nick the target site DNA of the second strand. For example, when a polypeptide comprises a CRISPR-associated endonuclease domain with nickase activity, in some embodiments, the CRISPR-associated endonuclease domain nicks the target site DNA strand that contains the PAM site (e.g., does not nick the target site DNA strand that does not contain the PAM site). By way of further example, when a polypeptide comprises a CRISPR-associated endonuclease domain with nickase activity, in some embodiments, the CRISPR-associated endonuclease domain nicks the target site DNA strand that does not contain a PAM site (e.g., and does not nick the target site DNA strand that contains a PAM site).

[0377] In some other embodiments, the endonuclease domain has nickase activity, which creates nicks in the first and second strands of target site DNA. Without intending to be bound by theory, after the writing domain (e.g., RT domain) of a polypeptide described herein polymerizes (e.g., reverse transcribes) from a heterologous target sequence of a template nucleic acid (e.g., template RNA), the cellular DNA repair machinery must repair the nick on the first DNA strand. The target site DNA here contains two distinct sequences relative to the first DNA strand: one corresponding to the original genomic DNA (e.g., with a free 5' end) and the second corresponding to that polymerized from the heterologous target sequence (e.g., with a free 3' end). It is believed that the two distinct sequences equilibrate with each other, with first one hybridizing to the second strand, followed by the other, and the order of incorporation of the cellular DNA repair machinery into its repair target site is a stochastic process. Without intending to be bound by any particular theory, it is believed that the introduction of an additional nick into the second strand can bias cellular DNA repair mechanisms to use sequences based on the heterologous target sequence more frequently than the original genomic sequence (Anzalone et al. Nature 576:149-157 (2019)). In some embodiments, the additional nick is positioned at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides 5' or 3' of the target site modification (e.g., insertion, deletion, or substitution) or relative to the nick on the first strand.

[0378] Alternatively or additionally, without intending to be bound by any particular theory, it is believed that an additional nick in the second strand may facilitate second strand synthesis. In some embodiments, when the genetic engineering system inserts or replaces a portion of the first strand, synthesis of a new sequence corresponding to the insertion / substitution in the second strand is required.

[0379] In some embodiments, the polypeptide comprises a single domain having endonuclease activity (e.g., a single endonuclease domain), which nicks both the first strand and the second strand. For example, in such embodiments, the endonuclease domain can be a CRISPR-associated endonuclease domain, and the template nucleic acid (e.g., template RNA) comprises a gRNA spacer that directs nicking of the first strand and an additional gRNA spacer that directs nicking of the second strand. In some embodiments, the polypeptide comprises multiple domains having endonuclease activity, wherein a first endonuclease domain nicks the first strand and a second endonuclease domain nicks the second strand (optionally, the first endonuclease domain does not (e.g., is unable to) nick the second strand and the second endonuclease domain does not (e.g., is unable to) nick the first strand).

[0380] In some embodiments, the endonuclease domain can nick the first and second strands. In some embodiments, the first and second strand nicks occur at the same position in the target site, but not on opposite strands. In some embodiments, the second strand nick occurs at a staggered position, e.g., upstream or downstream from the first nick. In some embodiments, the endonuclease domain generates a deletion of the target site when the second strand nick is upstream of the first strand nick. In some embodiments, the endonuclease domain generates a duplication of the target site when the second strand nick is downstream of the first strand nick. In some embodiments, the endonuclease domain does not generate a duplication and / or deletion when the first and second strand nicks occur at the same position in the target site. In some embodiments, the endonuclease domain has altered activity depending on the protein conformation or RNA binding state, for example, to promote first strand or second strand nicking (e.g., as described in Christensen et al. PNAS 2006; incorporated herein by reference in its entirety).

[0381] In some embodiments, the endonuclease domain comprises a meganuclease, or a functional fragment thereof. In some embodiments, the endonuclease domain comprises a homing endonuclease, or a functional fragment thereof. In some embodiments, the endonuclease domain comprises a homing endonuclease, e.g., ... (SEQ ID NO: 15464 ), GIY-YIG, HNH, His-Cys Box, or PD-(D / E)XK family, or a functional fragment or variant thereof. In some embodiments, the endonuclease domain comprises a meganuclease selected from, for example, I-SmaMI (Uniprot F7WD42), I-SceI (Uniprot P03882), I-AniI (Uniprot P03880), I-DmoI (Uniprot P21505), I-CreI (Uniprot P05725), I-TevI ​​(Uniprot P13299), I-OnuI (Uniprot Q4VWW5), or I-BmoI (Uniprot Q9ANR6), or a fragment thereof. In some embodiments, the meganuclease is naturally a monomer, e.g., I-SceI, I-TevI, or a dimer, e.g., I-CreI, in its functional form. (SEQ ID NO: 15464) LAGLIDADG meganuclease with a single copy of ("LAGLIDADG" disclosed as SEQ ID NO: 15464) generally form homodimers, while the LAGLIDADG motif (SEQ ID NO: 15464)Members with two copies of are generally found as monomers. In some embodiments, meganucleases that normally form as dimers are expressed as fusions, e.g., the two subunits are expressed as a single ORF, optionally linked by a linker, e.g., an I-CreI dimer fusion (Rodriguez-Fornes et al. Gene Therapy 2020; incorporated herein by reference in its entirety). In some embodiments, meganucleases, or functional fragments thereof, are engineered to preferentially exhibit nickase activity in one strand of a double-stranded DNA molecule, e.g., I-SceI (K122I and / or K223I) (Niu et al. J Mol Biol 2008), I-AniI (K227M) (McConnell Smith et al. PNAS 2009), I-DmoI (Q42A and / or K120M) (Molina et al. J Biol Chem 2015). In some embodiments, meganucleases or functional fragments thereof with this preference for single-strand cleavage are used, for example, as endonuclease domains with nickase activity. In some embodiments, the endonuclease domain comprises a meganuclease, or a functional fragment thereof, that naturally targets or has been engineered to target a safe harbor site, e.g., an SH6 site that targets I-CreI (Rodriguez-Fornes et al., supra). In some embodiments, the endonuclease domain comprises a meganuclease, or a functional fragment thereof, with a sequence-tolerant catalytic domain, e.g., I-TevI, which recognizes the minimal motif CNNNG (Kleinstiver et al. PNAS 2012).In some embodiments, the target sequence-resistant catalytic domain is fused to a DNA-binding domain, e.g., fusion of I-TevI ​​to (i) a Zn finger to create Tev-ZFE (Kleinstiver et al. PNAS 2012), (ii) another meganuclease to create MegaTev (Wolfs et al. Nucleic Acids Res 2014), and / or (iii) Cas9 to create TevCas9 (Wolfs et al. PNAS 2016) induces activity.

[0382] In some embodiments, the endonuclease domain comprises a restriction enzyme, e.g., a Type IIS or Type IIP restriction enzyme. In some embodiments, the endonuclease domain comprises a Type IIS restriction enzyme, e.g., FokI, or a fragment or variant thereof. In some embodiments, the endonuclease domain comprises a Type IIP restriction enzyme, e.g., PvuII, or a fragment or variant thereof. In some embodiments, the dimeric restriction enzyme is expressed as a fusion, e.g., a FokI dimer fusion, such that it functions as a single strand (Minczuk et al. Nucleic Acids Res 36(12):3926-3938 (2008)).

[0383] The use of additional endonuclease domains is described, for example, in Guha and Edgell Int J Mol Sci 18(22):2565 (2017), which is incorporated herein by reference in its entirety.

[0384] In some embodiments, the recombinant polypeptide comprises a modification to the endonuclease domain, e.g., compared to a wild-type Cas protein. In some embodiments, the endonuclease domain comprises an addition, deletion, substitution, or modification to the amino acid sequence of a wild-type Cas protein. In some embodiments, the endonuclease domain is modified to comprise a heterologous functional domain that specifically binds to and / or directs endonucleolytic cleavage of a target nucleic acid (e.g., DNA) sequence of interest. In some embodiments, the endonuclease domain comprises a zinc finger. In several embodiments, the endonuclease domain, including a Cas domain, associates with a guide RNA (gRNA), e.g., as described herein. In some embodiments, the endonuclease domain is modified to comprise a functional domain that does not target a specific target nucleic acid (e.g., DNA) sequence. In several embodiments, the endonuclease domain comprises a Fok1 domain.

[0385] In some embodiments, the endonuclease domain associates with the target dsDNA at least about 5-fold or 10-fold more frequently than scrambled dsDNA in vitro. In some embodiments, the endonuclease domain associates with the target dsDNA at least about 5-fold or 10-fold more frequently than scrambled dsDNA in vitro, e.g., in a cell (e.g., HEK293T cell). In some embodiments, the frequency of association between the endonuclease domain and the target DNA or scrambled DNA is measured by ChIP-seq, e.g., as described in He and Pu (2010) Curr. Protoc Mol Biol Chapter 21, incorporated herein by reference in its entirety.

[0386] In some embodiments, the endonuclease domain may catalyze the formation of nicks at the target sequence, e.g., by at least about a 5-fold or 10-fold increase, relative to a non-target sequence (e.g., relative to any other genomic sequence in the genome of the target cell). In some embodiments, the level of nicking is measured using Nick-Seq, e.g., as described in Elacqua et al. (2019) bioRxiv doi.org / 10.1101 / 867937, which is incorporated by reference in its entirety.

[0387] In some embodiments, the endonuclease domain is capable of nicking DNA in vitro. In embodiments, the nick results in an exposed base. In embodiments, the exposed base can be detected using a nuclease sensitivity assay, e.g., as described in Chaudhry and Weinfeld (1995) Nucleic Acids Res 23(19):3805-3809, incorporated herein by reference in its entirety. In embodiments, the level of exposed bases (e.g., as detected by the nuclease sensitivity assay) is increased by at least 10%, 50%, or more compared to the reference endonuclease domain. In some embodiments, the reference endonuclease domain is an endonuclease domain from Cas9 of Streptococcus pyogenes (S. pyogenes).

[0388] In some embodiments, the endonuclease domain is capable of nicking DNA in a cell. In embodiments, the endonuclease domain is capable of nicking DNA in a HEK293T cell. In embodiments, unrepaired nicks that undergo replication in the absence of Rad51 result in an increased rate of NHEJ at the site of the nick, detectable, for example, by using a Rad51 inhibition assay, e.g., as described in Bothmer et al. (2017) Nat Commun 8:13905 (incorporated herein by reference in its entirety). In embodiments, the NHEJ rate is increased by more than 0-5%. In embodiments, the NHEJ rate is increased, for example, by 20-70% (e.g., 30%-60% or 40-50%) upon Rad51 inhibition.

[0389] In some embodiments, the endonuclease domain releases the target after cleavage. In some embodiments, target release is indicated indirectly by assessing multiple enzymatic turnover, e.g., as described in Yourik at al. RNA 25(1):35-44 (2019) (incorporated herein by reference in its entirety) and as shown in Figure 2. In some embodiments, the k of the endonuclease domain exp is measured by this method and is 1×10 -3 ~1×10 -5 Minute -1.

[0390] In some embodiments, the endonuclease domain is capable of binding to about 1 x 10 8 s -1 M -1 Catalytic efficiency (k cat / K m In some embodiments, the endonuclease domain has a nucleotide sequence of about 1 x 10 in vitro. 5 , 1×10 6 , 1×10 7 , or 1 × 10 8 s -1 M -1In some embodiments, the catalytic efficiency is determined as described in Chen et al. (2018) Science 360(6387):436-439, which is incorporated herein by reference in its entirety. In some embodiments, the endonuclease domain has a catalytic efficiency of greater than about 1×10 in a cell. 8 s -1 M -1 Catalytic efficiency (k cat / K m In some embodiments, the endonuclease domain has a denaturing activity of about 1×10 5 , 1×10 6 , 1×10 7 , or 1 × 10 8 s -1 M -1 It has a catalytic efficiency of more than

[0391] Engineered polypeptide containing a Cas domain In some embodiments, the transgenic polypeptides described herein comprise a Cas domain. In some embodiments, the Cas domain can guide the transgenic polypeptide to a target site specified by a gRNA spacer, thereby modifying a target nucleic acid sequence in "cis." In some embodiments, the transgenic polypeptide is fused to a Cas domain. In some embodiments, the transgenic polypeptide comprises a CRISPR / Cas domain (also referred to herein as a CRISPR-associated protein). In some embodiments, the CRISPR / Cas domain comprises a protein involved in the clustered regularly interspaced short palindromic repeats (CRISPR) system, e.g., a Cas protein, and optionally binds to a guide RNA, e.g., a single guide RNA (sgRNA).

[0392] The CRISPR system is an adaptive defense system first discovered in bacteria and archaea. CRISPR systems use RNA-guided nucleases called CRISPR-associated or "Cas" endonucleases (e.g., Cas9 or Cpf1) to cleave foreign DNA. For example, in a typical CRISPR-Cas system, the endonuclease is guided to a target nucleotide sequence (e.g., a site in the genome to be sequence-edited) by a sequence-specific, non-coding "guide RNA" that targets single- or double-stranded DNA sequences. Three classes of CRISPR systems (I-III) have been identified. Class II CRISPR systems use a single Cas endonuclease (rather than multiple Cas proteins). One Class II CRISPR system includes a type II Cas endonuclease, such as Cas9, a CRISPR RNA ("crRNA"), and a trans-activating crRNA ("tracrRNA"). The crRNA typically contains a "spacer" sequence (protospacer), an approximately 20-nucleotide RNA sequence that corresponds to the target DNA sequence. In wild-type systems, and in some engineered systems, the crRNA binds to the tracrRNA, forming a partially double-stranded structure that is cleaved by RNase III. c The crRNA / tracrRNA hybrid then guides the Cas endonuclease to recognize and cleave the target DNA sequence. The target DNA sequence is generally flanked by a "protospacer adjacent motif" ("PAM") that is specific to a given Cas endonuclease and required for cleavage activity at the target site matching the spacer of the crRNA. CRISPR endonucleases identified from various prokaryotic species have unique PAM sequence requirements, for example, as listed for exemplary Cas enzymes in Table 7; an example of a PAM sequence is 5'-NGG (5'-NGG) for Streptococcus pyogenes (Streptococcus pyogenes). )) , 5'-NNAGAA (Streptococcus thermophilus CRISPR 1), 5'-NGGNG (Streptococcus thermophilus CRISPR 3) , and 5'-NNNGATT (Neisseria meningitidis )) Some endonucleases, such as the Cas9 endonuclease, target G-rich PAM sites, such as 5'-NG. G and The Cpf1 endonuclease associates with the target DNA and performs a blunt-end cleavage of the target DNA three nucleotides upstream (5') from the PAM site. Another class II CRISPR system includes a V-type endonuclease, Cpf1, which is smaller than Cas9; examples include AsCpf1 (from Acidaminococcus sp.) and LbCpf1 (from Lachnospiraceae sp.). Cpf1-associated CRISPR arrays do not require tracrRNA and are processed into mature crRNA; in other words, the Cpf1 system, in some embodiments, exclusively comprises Cpf1 nuclease and crRNA to cleave the target DNA sequence. Cpf1 endonuclease typically associates with T-rich PAM sites, such as 5'-TTN. Cpf1 can also recognize the 5'-CTA PAM motif. Cpf1 typically cleaves target DNA by introducing an offset or staggered double-stranded break into a 4- or 5-nucleotide 5' overhang, e.g., cleaving the target DNA with a 5-nucleotide offset or staggered break located 18 nucleotides downstream (3') from the PAM site on the coding strand and 23 nucleotides downstream from the PAM site on the complementary strand; the 5-nucleotide overhang resulting from such an offset break allows for more precise genome editing by DNA insertion via homologous recombination rather than insertion with blunt-ended cut DNA. See, e.g., Zetsche et al. (2015) Cell, 163:759-771.

[0393] Various CRISPR-associated (Cas) genes or proteins can be used in the techniques provided by the present disclosure, and the choice of Cas protein will depend on the specific requirements of the method. Specific examples of Cas proteins include Class II systems, including Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cpf1, C2C1, or C2C3. In some embodiments, the Cas protein, e.g., the Cas9 protein, can be derived from any of a variety of prokaryotic species. In some embodiments, a particular Cas protein, e.g., a particular Cas9 protein, is selected to recognize a particular protospacer adjacent motif (PAM) sequence. In some embodiments, the DNA-binding domain or endonuclease domain comprises a sequence-targeting polypeptide, such as a Cas protein, e.g., Cas9. In certain embodiments, the Cas protein, e.g., the Cas9 protein, can be obtained from bacteria or archaea, or can be synthesized using known methods. In certain embodiments, the Cas protein can be derived from Gram-positive or Gram-negative bacteria. In certain embodiments, the Cas protein is selected from the group consisting of Streptococcus (e.g., S. pyogenes or S. thermophilus), Francisella (e.g., F. novicida), Staphylococcus (e.g., S. aureus), Acidaminococcus (e.g., Acidaminococcus sp. BV3L6), and the like. sp. BV3L6), Neisseria (e.g., N. meningitidis), Cryptococcus, Corynebacterium, Haemophilus, Eubacterium, Pasteurella, Prevotella, Veillonella, or Marinobacter.

[0394] In some embodiments, the recombinant polypeptide may comprise the amino acid sequence of SEQ ID NO: 4000, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity thereto. In embodiments, the amino acid sequence of SEQ ID NO: 4000, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity thereto, is located at the N-terminus of the recombinant polypeptide. In embodiments, the amino acid sequence of SEQ ID NO: 4000, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity thereto, is located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 amino acids of the N-terminus of the recombinant polypeptide. Exemplary N-terminal NLS-Cas9 domains [ka]

[0395] In some embodiments, the recombinant polypeptide may comprise the amino acid sequence of SEQ ID NO: 4001, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity thereto. In embodiments, the amino acid sequence of SEQ ID NO: 4001, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity thereto, is located at the C-terminus of the recombinant polypeptide. In embodiments, the amino acid sequence of SEQ ID NO: 4001 below, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity thereto, is located within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 amino acids of the C-terminus of the recombinant polypeptide. Exemplary C-terminal sequences containing an NLS AGKRTADGSEFEKRTADGSEFESPKKKAKVE (SEQ ID NO: 4001) Example benchmark sequence [ka]

[0396] In some embodiments, the recombinant polypeptide may comprise a Cas domain listed in Tables 7 or 8, or a functional fragment thereof, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity thereto.

[0397] [Table 7]

[0398] [Table 8-1]

[0399] [Table 8-2]

[0400] [Table 8-3]

[0401] [Table 8-4]

[0402] [Table 8-5]

[0403] [Table 8-6]

[0404] [Table 8-7]

[0405]

Table 8-8

[0406]

Table 8-9

[0407]

Table 8-10

[0408]

Table 8-11

[0409]

Table 8-12

[0410]

Table 8-13

[0411]

Table 8-14

[0412]

Table 8-15

[0413]

Table 8-16

[0414] In some embodiments, Cas proteins require that a protospacer adjacent motif (PAM) be present within or adjacent to the target DNA sequence to which the Cas protein binds and / or functions. In some embodiments, the PAM comprises, from 5' to 3', G、 Y G、 NNGRR T、 NNNRR T、 NG A、 TYC V、 TAT V、 NTT N、 or NNNGAT At T In some embodiments, the Cas protein is or comprises a nucleotide, where N represents any nucleotide, Y represents C or T, R represents A or G, and V represents A, C, or G. In some embodiments, the Cas protein is a protein listed in Table 7 or 8. In some embodiments, the Cas protein comprises one or more mutations that modify its PAM. In some embodiments, the Cas protein comprises E1369R, E1449H, and R1556A mutations or analogous substitutions for the amino acids corresponding to said positions. In some embodiments, the Cas protein comprises E782K, N968K, and R1015H mutations or analogous substitutions for the amino acids corresponding to said positions. In some embodiments, the Cas protein comprises D1135V, R1335Q, and T1337R mutations or analogous substitutions for the amino acids corresponding to said positions. In some embodiments, the Cas protein comprises S542R and K607R mutations or analogous substitutions for the amino acids corresponding to said positions. In some embodiments, the Cas protein contains the following mutations: S542R, K548V, and N552R, or similar substitutions for the amino acids corresponding to said positions. Exemplary advances in modifying Cas enzymes to recognize modified PAM sequences are reviewed in Collias et al. Nature Communications 12:555 (2021), which is incorporated herein by reference in its entirety.

[0415] In some embodiments, the Cas protein is catalytically active and cleaves one or both strands of the target DNA site, and in some embodiments, following cleavage of the target DNA site, a modification, e.g., an insertion or deletion, is formed, e.g., by cellular repair mechanisms.

[0416] In some embodiments, the Cas protein is modified to inactivate or partially inactivate the nuclease, e.g., nuclease-deficient Cas9. While wild-type Cas9 generates double-strand breaks (DSBs) at specific DNA sequences targeted by gRNAs, several CRISPR endonucleases with modified functionality are available, e.g., partially inactivated "nickase" versions of Cas9 generate only single-strand breaks; catalytically inactive Cas9 ("dCas9") does not cleave target DNA. In some embodiments, binding of dCas9 to a DNA sequence can interfere with transcription at that site due to steric hindrance. In some embodiments, binding of dCas9 to an anchor sequence can interfere with (e.g., reduce or prevent) the formation and / or maintenance of a genome complex (e.g., ASMC). In some embodiments, the DNA-binding domain comprises a catalytically inactive Cas9, e.g., dCas9. Numerous catalytically inactive Cas9 proteins are known in the art. In some embodiments, dCas9 comprises mutations, e.g., D10A and H840A or N863A mutations, within each endonuclease domain of the Cas protein. In some embodiments, a catalytically inactive or partially inactive CRISPR / Cas domain comprises a Cas protein comprising one or more mutations, e.g., one or more of the mutations listed in Table 7. In some embodiments, a Cas protein listed in a given row of Table 7 comprises one, two, three, or all of the mutations listed in the same row of Table 7. In some embodiments, for example, a Cas protein not listed in Table 7 comprises one, two, three, or all of the mutations listed in a row of Table 7, or corresponding mutations at corresponding sites in the Cas protein.

[0417] In some embodiments, Cas9 derivatives with enhanced activity can be used in recombinant polypeptides. In some embodiments, Cas9 derivatives can include mutations that improve the activity of the HNH endonuclease domain, such as SpyCas9 R221K, N394K, or mutations that improve R-loop formation, such as SpyCas9 L1245V, or combinations of such mutations, such as SpyCas9 R221K / N394K, SpyCas9 N394K / L1245V, SpyCas9 R221K / L1245V, or SpyCas9 R221K / N394K / L1245V (see, e.g., Spencer and Zhang Sci Rep 7:16836 (2017)). The Cas9 derivatives and mutations contained therein are incorporated herein by reference). In some embodiments, Cas9 derivatives can include one or more types of mutations described herein, such as PAM-modifying mutations, protein-stabilizing mutations, activity-enhancing mutations, and / or mutations that partially or completely inactivate one or two endonuclease domains compared to the parent enzyme (e.g., one or more mutations that abolish endonuclease activity on one or both strands of target DNA, e.g., a nickase or catalytically inactive enzyme). In some embodiments, the Cas9 enzymes used in the systems described herein can include mutations that confer nickase activity to the enzyme (e.g., SpyCas9 N863A or H840A) in addition to mutations that improve catalytic efficiency (e.g., SpyCas9 R221K, N394K, and / or L1245V). In some embodiments, the Cas9 enzymes used in the systems described herein are SpyCas9 enzymes or derivatives that further include the N863A mutation, which confers nickase activity, in addition to the R221K and N394K mutations, which improve catalytic efficiency.

[0418] In some embodiments, catalytically inactive, e.g., dCas9, or partially inactivated Cas9 proteins comprise a D11 mutation (e.g., a D11A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, catalytically inactive Cas9 proteins, e.g., dCas9, or partially inactivated Cas9 proteins comprise a H969 mutation (e.g., a H969A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, catalytically inactive Cas9 proteins, e.g., dCas9, or partially inactivated Cas9 proteins comprise a N995 mutation (e.g., a N995A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, catalytically inactive Cas9 proteins, e.g., dCas9, comprise mutations at one, two, or three of positions D11, H969, and N995 (e.g., a D11A, H969A, and N995A mutations) or an analogous substitution for the amino acid corresponding to said positions.

[0419] In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, or a partially inactivated Cas9 protein, comprises a D10 mutation (e.g., a D10A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, or a partially inactivated Cas9 protein, comprises a H557 mutation (e.g., a H557A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, comprises a D10 mutation (e.g., a D10A mutation) and a H557 mutation (e.g., a H557A mutation) or an analogous substitution for the amino acid corresponding to said position.

[0420] In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, or a partially inactivated Cas9 protein, comprises a D839 mutation (e.g., a D839A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, or a partially inactivated Cas9 protein, comprises a H840 mutation (e.g., a H840A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, or a partially inactivated Cas9 protein, comprises a N863 mutation (e.g., a N863A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, the catalytically inactive Cas9 protein, e.g., dCas9, comprises a D10 mutation (e.g., D10A), a D839 mutation (e.g., D839A), an H840 mutation (e.g., H840A), and an N863 mutation (e.g., N863A) or an analogous substitution for the amino acids corresponding to the positions.

[0421] In some embodiments, the catalytically inactive Cas9 protein, e.g., dCas9, or partially inactivated Cas9 protein, comprises an E993 mutation (e.g., an E993A mutation) or an analogous substitution for the amino acid corresponding to said position.

[0422] In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, or a partially inactivated Cas9 protein, comprises a D917 mutation (e.g., a D917A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, or a partially inactivated Cas9 protein, comprises an E1006 mutation (e.g., an E1006A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, or a partially inactivated Cas9 protein, comprises a D1255 mutation (e.g., a D1255A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, a catalytically inactive Cas9 protein, e.g., dCas9, comprises a D917 mutation (e.g., D917A), an E1006 mutation (e.g., E1006A), and a D1255 mutation (e.g., D1255A) or an analogous substitution for the amino acid corresponding to said position.

[0423] In some embodiments, the catalytically inactive Cas9 protein, e.g., dCas9, or partially inactivated Cas9 protein, comprises a D16 mutation (e.g., a D16A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, the catalytically inactive Cas9 protein, e.g., dCas9, or partially inactivated Cas9 protein, comprises a D587 mutation (e.g., a D587A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, the partially inactivated Cas domain has nickase activity. In some embodiments, the partially inactivated Cas9 domain is a Cas9 nickase domain. In some embodiments, the catalytically inactive Cas domain or inactive Cas domain does not form a detectable double-stranded break. In some embodiments, the catalytically inactive Cas9 protein, e.g., dCas9, or partially inactivated Cas9 protein, comprises a H588 mutation (e.g., a H588A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, the catalytically inactive Cas9 protein, e.g., dCas9, or partially inactivated Cas9 protein, comprises an N611 mutation (e.g., an N611A mutation) or an analogous substitution for the amino acid corresponding to said position. In some embodiments, the catalytically inactive Cas9 protein, e.g., dCas9, comprises a D16 mutation (e.g., D16A), a D587 mutation (e.g., D587A), an H588 mutation (e.g., H588A), and an N611 mutation (e.g., N611A) or an analogous substitution for the amino acid corresponding to said position.

[0424] In some embodiments, the DNA binding domain or endonuclease domain can comprise a Cas molecule that includes or is linked (e.g., covalently) to a gRNA (e.g., a template nucleic acid that includes the gRNA, e.g., a template RNA).

[0425] In some embodiments, the endonuclease domain or DNA-binding domain comprises Streptococcus pyogenes Cas9 (SpCas9) or a functional fragment or variant thereof. In some embodiments, the endonuclease domain or DNA-binding domain comprises a modified SpCas9. In several embodiments, the modified SpCas9 comprises a modification that alters protospacer adjacent motif (PAM) specificity. In several embodiments, the PAM has specificity for the nucleic acid sequence 5'-NGT-3'. In several embodiments, the modified SpCas9 comprises one or more amino acid substitutions, e.g., at one or more of the following positions: L1111, D1135, G1218, E1219, A1322, or R1335, e.g., selected from the following: L1111R, D1135V, G1218R, E1219F, A1322R, R1335V. In some embodiments, the modified SpCas9 comprises the amino acid substitution T1337R and one or more additional amino acid substitutions selected from the following: L1111, D1135L, S1136R, G1218S, E1219V, D1332A, D1332S, D1332T, D1332V, D1332L, D1332K, D1332R, R1335Q, T1337, T1337L, T1337Q, T1337I, T1337V, T1337F, T1337S, T1337N, T1337K, T1337H, T1337Q, and T1337M, or a corresponding amino acid substitution thereof. In some embodiments, the modified SpCas9 comprises: (i) one or more amino acid substitutions selected from the following: D1135L, S1136R, G1218S, E1219V, A1322R, R1335Q, and T1337; and (ii) one or more additional amino acid substitutions selected from the following: L1111R, G1218R, E1219F, D1332A, D1332S, D1332T, D1332V, D1332L, D1332K, D1332R, T1337L, T1337I, T1337V, T1337F, T1337S, T1337N, T1337K, T1337R, T1337H, T1337Q, and T1337M, or a corresponding amino acid substitution thereof.

[0426] In some embodiments, the endonuclease domain or DNA-binding domain comprises a Cas domain, such as a Cas9 domain. In several embodiments, the endonuclease domain or DNA-binding domain comprises a nuclease-active Cas domain, a Cas nickase (nCas) domain, or a nuclease-inactive Cas (dCas). In several embodiments, the endonuclease domain or DNA-binding domain comprises a nuclease-active Cas9 domain, a Cas9 nickase (nCas9) domain, or a nuclease-inactive Cas9 (dCas). In some embodiments, the endonuclease domain or DNA-binding domain comprises a Cas9 domain of Cas9 (e.g., dCas9 and nCas9), Cas12a / Cpfl, Cas12b / C2cl, Cas12c / C2c3, Cas12d / CasY, Cas12e / CasX, Cas12g, Cas12h, or Cas12i. In some embodiments, the endonuclease domain or DNA-binding domain comprises Cas9 (e.g., dCas9 and nCas9), Cas12a / Cpfl, Cas12b / C2cl, Cas12c / C2c3, Cas12d / CasY, Cas12e / CasX, Cas12g, Cas12h, or Cas12i. In some embodiments, the endonuclease domain or DNA-binding domain comprises S. pyogenes or S. thermophilus Cas9, or a functional fragment thereof. In some embodiments, the endonuclease domain or DNA-binding domain comprises a Cas9 sequence, e.g., as described in Chylinski, Rhun, and Charpentier (2013) RNA Biology 10:5, 726-737 (incorporated herein by reference). In some embodiments, the endonuclease domain or DNA binding domain comprises the HNH nuclease subdomain and / or RuvC1 subdomain of a Cas, e.g., Cas9, or a variant thereof, as described herein.In some embodiments, the endonuclease domain or DNA-binding domain comprises Cas12a / Cpfl, Cas12b / C2cl, Cas12c / C2c3, Cas12d / CasY, Cas12e / CasX, Cas12g, Cas12h, or Cas12i. In some embodiments, the endonuclease domain or DNA-binding domain comprises a Cas polypeptide (e.g., an enzyme), or a functional fragment thereof. In several embodiments, the Cas polypeptide (e.g., an enzyme) is selected from the following: Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5d, Cas5t, Cas5h, Cas5a, Cas6, Cas7, Cas8, Cas8a, Cas8b, Cas8c, Cas9 (e.g., Csn1 or Csx12), Cas10, Cas10d, Cas12a / Cpf l, Cas12b / C2cl, Cas12c / C2c3, Cas12d / CasY, Cas12e / CasX, Cas12g, Cas12h, Cas12i, Csy1, Csy2, Cs y3, Csy4, Cse1, Cse2, Cse3, Cse4, Cse5e, Csc1, Csc2, Csa5, Csn1, Csn2, Csm1, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1 , Csx1S, Csx11, Csf1, Csf2, CsO, Csf4, Csd1, Csd2, Cst1, Cst2, Csh1, Csh2, Csa1, Csa2, Csa3, Csa4, C The Cas9 effector protein is selected from sa5, a type II Cas effector protein, a type V Cas effector protein, a type VI Cas effector protein, CARF, DinG, Cpf1, Cas12b / C2c1, Cas12c / C2c3, Cas12b / C2c1, Cas12c / C2c3, SpCas9(K855A), eSpCas9(1.1), SpCas9-HF1, a hyper accurate Cas9 mutant (HypaCas9), a homologue thereof, a modified or engineered version thereof, and / or a functional fragment thereof.In some embodiments, the Cas9 comprises one or more substitutions selected from the following: H840A, D10A, P475A, W476A, N477A, ​​D1125A, W1126A, and D1127A. In some embodiments, the Cas9 comprises one or more mutations at a position selected from the following: D10, G12, G17, E762, H840, N854, N863, H982, H983, A984, D986, and / or A987, for example, one or more substitutions selected from the following: D10A, G12A, G17A, E762A, H840A, N854A, N863A, H982A, H983A, A984A, and / or D986A. In some embodiments, the endonuclease domain or DNA binding domain is selected from the group consisting of Corynebacterium ulcerans, Corynebacterium diphtheria, Spiroplasma syrphidicola, Prevotella intermedia, Spiroplasma taiwanense, Streptococcus iniae, Belliella baltica, Psychroflexus torquis, Staphylococcus thermophilus, Listeria innocua, Campylobacter jejuni, Neisseria meningitidis, and Escherichia coli. meningitidis, Streptococcus pyogenes, or Staphylococcus aureus, or functional fragments or variants thereof.

[0427] In some embodiments, the endonuclease domain or DNA binding domain comprises a Cpf1 domain comprising one or more substitutions, e.g., at positions D917, E1006A, D1255, or any combination thereof, selected from the following: D917A, E1006A, D1255A, D917A / E1006A, D917A / D1255A, E1006A / D1255A, and D917A / E1006A / D1255A.

[0428] In some embodiments, the endonuclease domain or DNA binding domain is spCas9, spCas9-VRQ R、 spCas9-VRE R、 xCas9(sp), saCas9, saCas9-KKH, spCas9-MQKSE R、 spCas9-LRKIQ K、 or spCas9-LRVSQ L include.

[0429] In some embodiments, the engineered polypeptide has an endonuclease domain that includes a Cas9 nickase, e.g., Cas9 H840A. In embodiments, Cas9 H840A has the following amino acid sequence: Cas9 Nickase (H840A): [ka]

[0430] In some embodiments, the recombinant polypeptide comprises a dCas9 sequence comprising a D10A and / or H840A mutation, for example, the sequence: [ka]

[0431] TAL effectors and zinc finger nucleases In some embodiments, the endonuclease domain or DNA-binding domain comprises a TAL effector molecule. A TAL effector molecule, for example, a TAL effector molecule that specifically binds to a DNA sequence, typically comprises multiple TAL effector domains or fragments thereof, and optionally one or more additional portions of a naturally occurring TAL effector (for example, the N-terminus and / or C-terminus of multiple TAL effector domains). Many TAL effectors are known to those skilled in the art and are commercially available, for example, from Thermo Fisher Scientific.

[0432] Naturally occurring TALEs are natural effector proteins secreted by numerous species of bacterial pathogens, including the plant pathogen Xanthomonas, that regulate gene expression in host plants and promote bacterial colonization and survival. The specific binding of TAL effectors is typically based on a central repeat domain (repeated variable dinucleotide, RVD domain) of tandemly arranged, nearly identical repeats of 33 or 34 amino acids.

[0433] Members of the TAL effector family differ primarily in the number and order of their repeats. The number of repeats typically ranges from 1.5 to 33.5 repeats, with the C-terminal repeats usually being shorter in length (e.g., approximately 20 amino acids) and commonly referred to as "half-repeats." Each repeat in a TAL effector is generally characterized by a one-repeat-to-one base-pair correlation (one repeat recognizes one base pair in the target gene sequence), with different repeat types exhibiting different base-pair specificities. Generally, a decrease in the number of repeats weakens the protein-DNA interaction. It has been shown that several 6.5 repeats are sufficient to activate transcription of a reporter gene (Scholze et al., 2010).

[0434] The variation between repeats occurs primarily at amino acid positions 12 and 13, which are therefore termed "hypervariable" and are responsible for the specificity of the interaction with the target DNA promoter sequence, as shown in Table 9, which lists exemplary repeat variable dinucleotides (RVDs) and their correspondence to nucleobase targets.

[0435] [Table 9]

[0436] Therefore, it is possible to modify the repeats of TAL effectors to target specific DNA sequences. Furthermore, studies have shown that RVD NK can target G. Furthermore, the target sites of TAL effectors tend to contain a T adjacent to the 5' base targeted by the first repeat, although the exact mechanism of this recognition is unknown. Over 113 TAL effector sequences are known to date. Non-limiting examples of TAL effectors from Xanthomonas include Hax2, Hax3, Hax4, AvrXa7, AvrXa10, and AvrBs3.

[0437] Thus, the TAL effector domain of the TAL effector molecules described herein can be derived from a TAL effector from any bacterial species (e.g., Xanthomonas species, such as African strains of Xanthomonas oryzae pv. oryzae (Yu et al. 2011), Xanthomonas campestris pv. raphani strain 756C, and Xanthomonas oryzae pv. oryzicola BLS256 (Bogdanove et al. 2011)). In some embodiments, the TAL effector domain also comprises an RVD domain and flanking sequences (sequences N- and / or C-terminal to the RVD domain) from a naturally occurring TAL effector. It may contain more or fewer RVD repeats than the naturally occurring TAL effector. TAL effector molecules can be designed to target a given DNA sequence based on the above codes or others known in the art. The number of TAL effector domains (e.g., repeats (monomers or modules)) and their specific sequences can be selected based on the desired DNA target sequence. For example, TAL effector domains, e.g., repeats, can be removed or added as appropriate for a particular target sequence. In some embodiments, a TAL effector molecule of the invention comprises between 6.5 and 33.5 TAL effector domains, e.g., repeats. In some embodiments, a TAL effector molecule of the invention comprises between 8 and 33.5 TAL effector domains, e.g., repeats, for example, between 10 and 25 TAL effector domains, e.g., repeats, for example, between 10 and 14 TAL effector domains, e.g., repeats.

[0438] In some embodiments, a TAL effector molecule comprises a TAL effector domain that corresponds to a perfect match with the DNA target sequence. In some embodiments, mismatches between repeats and target base pairs on the DNA target sequence are tolerated as long as they allow the polypeptide comprising the TAL effector molecule to function. Generally, TALE binding is inversely correlated with the number of mismatches. In some embodiments, a TAL effector molecule of a polypeptide of the present invention comprises at most seven mismatches, six mismatches, five mismatches, four mismatches, three mismatches, two mismatches, or one mismatch with the target DNA sequence, and optionally no mismatches. While not intending to be bound by a particular theory, generally, as the number of TAL effector domains in a TAL effector molecule decreases, a reduced number of mismatches is not only tolerated but also allows the polypeptide comprising the TAL effector molecule to function. Binding affinity is thought to depend on the sum of matching repeat-DNA combinations. For example, a TAL effector molecule with 25 or more TAL effector domains may be able to tolerate up to seven mismatches.

[0439] In addition to the TAL effector domain, the TAL effector molecules of the present invention may contain additional sequences derived from naturally occurring TAL effectors. The length of the C-terminal and / or N-terminal sequences included on either side of the TAL effector domain portion of the TAL effector molecule can vary and can be selected by those skilled in the art based on, for example, the study of Zhang et al. (2011). Zhang et al. characterized several C-terminal and N-terminal truncation mutants in proteins based on Hax3-derived TAL effectors and identified key elements that contribute to optimal binding to target sequences and, therefore, transcriptional activation. Generally, transcriptional activity was found to be inversely correlated with the length of the N-terminus. Regarding the C-terminus, key elements in the DNA-binding residues within the first 68 amino acids of the Hax3 sequence were identified. Thus, in some embodiments, the first 68 amino acids on the C-terminal side of the TAL effector domain of a naturally occurring TAL effector are included in the TAL effector molecule. Thus, in one embodiment, a TAL effector molecule comprises: 1) one or more TAL effector domains derived from a naturally occurring TAL effector; 2) at least 70, 80, 90, 100, 110, 120, 130, 140, 150, 170, 180, 190, 200, 220, 230, 240, 250, 260, 270, 280 or more amino acids from a naturally occurring TAL effector N-terminal to the TAL effector domain; and / or 3) at least 68, 80, 90, 100, 110, 120, 130, 140, 150, 170, 180, 190, 200, 220, 230, 240, 250, 260 or more amino acids from a naturally occurring TAL effector C-terminal to the TAL effector domain.

[0440] In some embodiments, the endonuclease domain or DNA-binding domain is or comprises a zinc finger molecule. The zinc finger molecule comprises a zinc finger protein, such as a naturally occurring zinc finger protein or a modified zinc finger protein, or a fragment thereof. Many zinc finger proteins are known to those skilled in the art and are commercially available, for example, from Sigma-Aldrich.

[0441] In some embodiments, the zinc finger molecule comprises a non-naturally occurring zinc finger protein engineered to bind to a selected target DNA sequence (see, e.g., Beerli, et al. (2002) Nature Biotechnol. 20:135-141; Pabo, et al. (2001) Ann. Rev. Biochem. 70:313-340; Isalan, et al. (2001) Nature Biotechnol. 19:656-660; Segal, et al. (2001) Curr. Opin. Biotechnol. 12:632-637; Choo, et al. al. (2000) Curr. Opin. Struct. Biol. 10:411-416; U.S. Patent Nos. 6,453,242; 6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,030,215; 6,794,136; 7,067,317 Nos. 7,262,054; 7,070,934; 7,361,635; 7,253,273; and U.S. Patent Application Publication Nos. 2005 / 0064474; 2007 / 0218528; and 2005 / 0267061 (all of which are incorporated by reference in their entirety).

[0442] The engineered zinc finger proteins may have novel binding specificities compared to naturally occurring zinc finger proteins. Engineering methods include, but are not limited to, rational design and various types of selection. Rational design, for example, involves the use of a database containing triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, where each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers that bind to a particular triplet or quadruplet sequence. See, for example, U.S. Patent Nos. 6,453,242 and 6,534,261 (incorporated herein by reference in their entireties).

[0443] Exemplary selection methods, including phage display and two-hybrid systems, are disclosed in U.S. Patent Nos. 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,410,248; 6,140,466; 6,200,759; and 6,242,568; as well as International Patent Publications WO 98 / 37186; WO 98 / 53057; WO 00 / 27878; and WO 01 / 88197 and GB 2,338,237. Furthermore, increased binding specificity in zinc finger proteins is described, for example, in International Patent Publication WO 02 / 077227.

[0444] Furthermore, as disclosed in these and other references, zinc finger domains and / or multi-fingered zinc finger proteins can be linked together using any suitable linker sequence, including, for example, linkers of five or more amino acids in length. For exemplary linker sequences of six or more amino acids in length, see also U.S. Pat. Nos. 6,479,626; 6,903,185; and 7,153,949. The proteins described herein can include any combination of suitable linkers between the individual zinc fingers of the protein. Furthermore, increased binding specificity in zinc finger binding domains is described, for example, in co-owned International Patent Publication WO 02 / 077227.

[0445] Zinc finger proteins and methods for the design and construction of fusion proteins (and polynucleotides encoding same) are known to those of skill in the art and include those disclosed in U.S. Patent Nos. 6,140,0815; 789,538; 6,453,242; 6,534,261; 5,925,523; 6,007,988; 6,013,453; and 6,200,759; International Patent Publication Nos. WO 95 / 19431; WO 96 / 19432; and WO 03 / 016496.

[0446] Furthermore, as disclosed in these and other references, zinc finger proteins and / or multi-fingered zinc finger proteins can be linked together, e.g., as a fusion protein, using any suitable linker sequence, including, for example, linkers of 5 or more amino acids in length. See also U.S. Pat. Nos. 6,479,626; 6,903,185; and 7,153,949 for exemplary linker sequences of 6 or more amino acids in length. The zinc finger molecules described herein can include any combination of suitable linkers between the individual zinc finger proteins and / or multi-fingered zinc finger proteins of the zinc finger molecule.

[0447] In certain embodiments, the DNA-binding domain or endonuclease domain comprises a zinc finger molecule comprising an engineered zinc finger protein that binds (in a sequence-specific manner) to a target DNA sequence. In some embodiments, the zinc finger molecule comprises one zinc finger protein or a fragment thereof. In other embodiments, the zinc finger molecule comprises multiple zinc finger proteins (or fragments thereof), for example, 2, 3, 4, 5, 6, or more zinc finger proteins (and optionally at most 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 zinc finger proteins). In some embodiments, the zinc finger molecule comprises at least three zinc finger proteins. In some embodiments, the zinc finger molecule comprises four, five, or six fingers. In some embodiments, the zinc finger molecule comprises eight, nine, ten, eleven, or twelve fingers. In some embodiments, a zinc finger molecule comprising three zinc finger proteins recognizes a target DNA sequence comprising 9 or 10 nucleotides. In some embodiments, a zinc finger molecule comprising four zinc finger proteins recognizes a target DNA sequence comprising 12 to 14 nucleotides, and in some embodiments, a zinc finger molecule comprising six zinc finger proteins recognizes a target DNA sequence comprising 18 to 21 nucleotides.

[0448] In some embodiments, the zinc finger molecule comprises a bimanual zinc finger protein. A bimanual zinc finger protein is a protein in which two clusters of zinc finger proteins are separated by an intervening amino acid, such that the two zinc finger domains bind to two discontinuous target DNA sequences. An example of a bimanual zinc finger binding protein is SIP1, in which a cluster of four zinc finger proteins is located at the amino terminus of the protein and a cluster of three zinc finger proteins is located at the carboxyl terminus (see Remade, et al. (1999) EMBO Journal 18(18):5073-5084). Each cluster of zinc fingers in these proteins can bind to a unique target sequence, and the spacing between the two target sequences can include multiple nucleotides.

[0449] Linker In some embodiments, the engineered polypeptide can include a linker, e.g., a peptide linker, e.g., a linker described in Table 1 or Table 10. In some embodiments, the engineered polypeptide includes, from N- to C-terminal, a Cas domain (e.g., a Cas domain in Table 8), a linker in Table 10 (or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto), and an RT domain (e.g., an RT domain in Table 6). In some embodiments, the engineered polypeptide includes a flexible linker between the endonuclease and the RT domain, e.g., a linker comprising the amino acid sequence SGGSSGGSSGSETPGTSESATPESSGGSSGGSS (SEQ ID NO: 11,002). In some embodiments, the RT domain of the engineered polypeptide can be located C-terminal to the endonuclease domain. In some embodiments, the RT domain of the engineered polypeptide can be located N-terminal to the endonuclease domain. In some embodiments, the recombinant polypeptide comprises an amino acid sequence listed in Table A1, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0450] [Table 10-1]

[0451] [Table 10-2]

[0452] [Table 10-3]

[0453] [Table 10-4]

[0454] In some embodiments, the linker of the genetically engineered polypeptide is (SGGS) n (SEQ ID NO: 5025), (GGGS) n (SEQ ID NO: 5026), (GGGGS) n (SEQ ID NO: 5027), (G) n , (EAAAK) n (SEQ ID NO: 5028), (GGS) n , or (XP) n The motif comprises a motif selected from:

[0455] Selection of recombinant polypeptides by pooled screening Candidate recombinant polypeptide can be screened to evaluate the gene editing ability of candidate.For example, can use the RNA recombinant system designed for the targeted editing of coding sequence in human genome.In certain embodiments, this recombinant system can be used with pool screening method.

[0456] For example, a library of candidate recombinant polypeptides and template guide RNAs (tgRNAs) can be introduced into mammalian cells to test the gene-editing capabilities of the candidates by pooled screening techniques. In certain embodiments, the library of candidate recombinant polypeptides is introduced into mammalian cells, followed by introduction of tgRNAs into the cells.

[0457] Representative, non-limiting examples of mammalian cells that can be used in the screen include HEK293T cells, U2OS cells, HeLa cells, HepG2 cells, Huh7 cells, K562 cells, or iPS cells.

[0458] The candidate engineered polypeptides can include 1) a Cas-nuclease, e.g., a wild-type Cas nuclease, e.g., a wild-type Cas9 nuclease, a mutant Cas nuclease, e.g., a Cas nickase, e.g., a Cas9 nickase such as Cas9 N863A nickase, or a Cas nuclease selected from Tables 7 or 8, 2) a peptide linker, e.g., a sequence from Tables 1 or 10, which can exhibit varying degrees of length, flexibility, hydrophobicity, and / or secondary structure; and 3) a reverse transcriptase (RT), e.g., an RT domain from Tables 1 or 6. The candidate engineered polypeptide library includes a plurality of different candidate engineered polypeptides that differ from each other with respect to one, two, or all three of the Cas nuclease, peptide linker, or RT domain components, or a plurality of nucleic acid expression vectors encoding such candidate engineered polypeptides.

[0459] For screening of candidate recombinant polypeptides, a two-component system comprising a recombinant polypeptide component and a tgRNA component can be used. The recombinant component can include, for example, an expression vector, such as an expression plasmid or lentiviral vector encoding the candidate recombinant polypeptide, including a human codon-optimized nucleic acid encoding the candidate recombinant polypeptide, such as the Cas-linker-RT fusion described above. In certain embodiments, a lentiviral cassette is used that includes: (i) a promoter for expression in mammalian cells, such as a CMV promoter; (ii) a candidate recombinant library, such as a Cas-linker-RT fusion comprising a Cas nuclease from Table 7 or 8, a peptide linker from Table 10, and an RT from Table 6, e.g., a Cas-linker-RT fusion such as those in Table 1; (iii) a self-cleaving polypeptide, such as a T2A peptide; (iv) a marker allowing selection in mammalian cells, such as a puromycin resistance gene; and (v) a termination signal, such as a polyA tail.

[0460] The tgRNA component can include a tgRNA or an expression vector, e.g., an expression plasmid that generates the tgRNA and drives expression of the tgRNA using, e.g., a U6 promoter, where the tgRNA is a non-coding RNA sequence that is recognized by Cas, localizing it to the genomic locus of interest, and that templates reverse transcription of the desired edit into the genome via the RT domain.

[0461] To prepare a pool of cells expressing recombinant polypeptide library candidates, mammalian cells, e.g., HEK293T or U2OS cells, can be transduced with a pooled recombinant polypeptide candidate expression vector preparation, e.g., a lentiviral preparation of the recombinant candidate polypeptide library. In certain embodiments, lentiviral plasmids are used, and HEK293 Lenti-X cells are seeded in 15 cm plates (approximately 12 x 10 cells) prior to lentiviral plasmid transfection. 6In such an embodiment, lentiviral plasmid transfection can be performed using Lentiviral Packaging Mix (Biosettia), and transfection of plasmid DNA for the recombinant candidate library can be performed using Lipofectamine 2000 and Opti-MEM medium according to the manufacturer's protocol. In such an embodiment, extracellular DNA can be removed by a complete medium change the next day, and virus-containing medium can be collected 48 hours later. The lentiviral medium can be concentrated using a Lenti-X Concentrator (TaKaRa Biosciences), and 5 mL lentiviral aliquots can be made and stored at -80°C. Lentiviral titer determination can be performed after selection, for example, by counting colony-forming units after puromycin selection.

[0462] To monitor gene editing of target DNA, mammalian cells, such as HEK293T or U2OS cells carrying target DNA, can be used. In other embodiments for monitoring gene editing of target DNA, mammalian cells, such as HEK293T or U2OS cells carrying a target DNA genomic landing pad, can be used. In certain embodiments, the target DNA genomic landing pad can contain a gene to be edited for the treatment of a disease or disorder of interest. In other specific embodiments, the target DNA is a genetic sequence that expresses a protein exhibiting a detectable characteristic that can be monitored to determine whether gene editing has occurred. For example, in certain embodiments, blue fluorescent protein (BFP)- or green fluorescent protein (GFP)-expressing genomic landing pads are used. In certain embodiments, mammalian cells, such as HEK293T or U2OS cells carrying target DNA, e.g., a target DNA genomic landing pad, are seeded into culture plates at 500x to 3000x cells per recombinant library candidate and transduced at a multiplicity of infection (MOI) of 0.2 to 0.3 to minimize the number of infections per cell. Puromycin (2.5 μg / mL) can be added 48 hours after infection to allow for selection of infected cells. In such an embodiment, the cells are placed under puromycin selection for at least 7 days and then scaled up for tgRNA introduction, e.g., tgRNA electroporation.

[0463] To confirm whether gene editing occurs, mammalian cells containing the target DNA to be edited can be infected with a candidate recombinant polypeptide library and then transfected with a tgRNA designed for use in editing the target DNA. The cells can then be analyzed, for example, by cell sorting and sequence analysis, to determine whether editing of the target locus occurred according to the designed results, or whether no editing or incomplete editing occurred.

[0464] In certain embodiments, to confirm whether genome editing occurs, BFP- or GFP-expressing mammalian cells, such as HEK293T or U2OS cells, may be infected with a recombinant library candidate and then transfected or electroporated at 250,000 cells / well with a tgRNA plasmid or RNA, e.g., 200 ng of a tgRNA plasmid designed to convert BFP to GFP or GFP to BFP, at a cell number that ensures >250×-1000× coverage per library candidate. In such embodiments, the genome editing ability of various constructs in this assay may be assessed by sorting cells by fluorescence-activated cell sorting (FACS) for the expression of color-converted fluorescent proteins (FPs) 4-10 days after electroporation. Cells are sorted and collected into distinct populations: non-edited cells (showing the original fluorescent protein signal), edited cells (showing the converted fluorescent protein signal), and incompletely edited cells (showing no fluorescent protein signal). A sample of unsorted cells can also be collected as an input population to determine candidate enrichment during analysis.

[0465] To determine whether the recombinant library candidates exhibit genome editing capabilities in the assay, genomic DNA (gDNA) is collected from the sorted cell populations and analyzed by sequencing the recombinant library candidates in each population. Briefly, the recombinant candidates are amplified from the genome using primers specific to the recombinant polypeptide expression vector, e.g., a lentiviral cassette, and amplified in a second round of PCR to dilute the genomic DNA, which can then be sequenced, for example, by a next-generation sequencing platform. After quality control of the sequencing reads, reads of at least about 1500 nucleotides, and generally no more than about 3200 nucleotides, are mapped to the recombinant polypeptide library sequence, and those containing a minimum of about 80% match with the library sequence are considered to have successfully aligned with a given candidate for this pooled screen. To identify candidates capable of gene editing in the assay, for example, editing BFP to GFP or GFP to BFP, the read count of each library candidate in the edited population is compared to its read count in the initial unsorted population.

[0466] For pooled screening, genetically modified candidates with genome editing capabilities are identified based on the enrichment of the edited (converted FP) population relative to the unsorted (input) cells. In some embodiments, an enrichment of at least 1.0, 1.5, 2.0, 2.5, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or at least 100 times the input indicates potentially useful gene editing activity, e.g., at least 2-fold enrichment. In some embodiments, enrichment is converted to a log value by taking the log base 2 of the enrichment ratio. In some embodiments, a log enrichment score of at least 0, 1, 2, 3, 4, 5, 5.5, 6.0, 6.2, 6.3, 6.4, 6.5, or at least 6.6 indicates potentially useful gene editing activity, e.g., a log enrichment score of at least 1.0. In certain embodiments, the enrichment values ​​observed for the genetically modified candidates can be compared to the enrichment values ​​observed under similar conditions using a reference, for example, element ID number 17380 described in Example 7.

[0467] In some embodiments, multiple tgRNAs can be used to screen recombinant candidate libraries.In certain embodiments, multiple tgRNAs can be used to optimize template / Cas-linker-RT fusion pairs, for example, for gene editing of specific target genes, for example, gene targets for disease treatment.In certain embodiments, pooling method for screening recombinant candidate can be carried out using many different tgRNAs in array format.

[0468] In some embodiments, multiple types of edits, for example, insertions, substitutions, and / or deletions of different lengths, may be used to screen a recombinant candidate library.

[0469] In some embodiments, multiple target sequences, e.g., different fluorescent proteins, may be used to screen a transgenic candidate library. In some embodiments, multiple target sequences, e.g., different fluorescent proteins, may be used to screen a transgenic candidate library. In some embodiments, multiple cell types, e.g., HEK293T or U2OS, may be used to screen a transgenic candidate library. One skilled in the art will understand that a given candidate may exhibit altered editing capabilities or increased or decreased observable or useful activity across different conditions, including tgRNA sequence (e.g., nucleotide modification, PBS length, RT template length), target sequence, target location, type of editing, location of mutation relative to the first strand nick of the transgenic polypeptide, or cell type. Thus, in some embodiments, a transgenic library candidate is screened across multiple parameters, e.g., using at least two different tgRNAs in at least two cell types, and gene editing activity is identified by enrichment in any single condition. In other embodiments, candidates with more robust activity across different tgRNAs and cell types are identified by enrichment in at least two conditions, e.g., all conditions screened. For clarity, candidates found to show little to no enrichment under any given condition are not presumed to be inactive across all conditions and can be screened using different parameters or reconstituted at the polypeptide level, for example, by exchanging, shuffling, or altering domains (e.g., RT domains), linkers, or other signals (e.g., NLS).

[0470] Exemplary Cas9-Linker-RT Fusion Sequences In some embodiments, the engineered polypeptide comprises a linker sequence and an RT sequence. In some embodiments, the engineered polypeptide comprises a linker sequence listed in Table 1, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto. In some embodiments, the engineered polypeptide comprises an amino acid sequence of an RT domain listed in Table 1, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto. In some embodiments, the recombinant polypeptide comprises a linker sequence listed in Table 1, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; and an amino acid sequence of an RT domain listed in Table 1, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto. In some embodiments, the recombinant polypeptide comprises (i) a linker sequence listed in a row of Table 1, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto; and (ii) an amino acid sequence of an RT domain listed in the same row of Table 1, or an amino acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity thereto.

[0471] Exemplary Recombinant Polypeptides In some embodiments, an engineered polypeptide (e.g., an engineered polypeptide that is part of a system described herein) comprises the amino acid sequence of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, an engineered polypeptide comprises the amino acid sequence of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 80% identity thereto. In some embodiments, an engineered polypeptide comprises the amino acid sequence of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 90% identity thereto. In some embodiments, an engineered polypeptide comprises the amino acid sequence of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 95% identity thereto. In some embodiments, an engineered polypeptide comprises the amino acid sequence of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 99% identity thereto. In some embodiments, an engineered polypeptide comprises the amino acid sequence of any one of SEQ ID NOs: 1-7743. In some embodiments, the recombinant polypeptide comprises the amino acid sequence of any one of SEQ ID NOs: 6001-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the recombinant polypeptide comprises the amino acid sequence of any one of SEQ ID NOs: 4501-4541, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0472] In some embodiments, the recombinant polypeptide comprises an amino acid sequence listed in Table A1, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0473] In some embodiments, the engineered polypeptide comprises the amino acid sequence of a SEQ ID NO: listed in Table D1, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the engineered polypeptide comprises the amino acid sequence of a SEQ ID NO: listed in Table D2, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the engineered polypeptide comprises the amino acid sequence of a SEQ ID NO: listed in Table D3, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the engineered polypeptide comprises the amino acid sequence of a SEQ ID NO: listed in Table D4, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the engineered polypeptide comprises the amino acid sequence of a SEQ ID NO: listed in Table D5, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the engineered polypeptide comprises the amino acid sequence of a SEQ ID NO: listed in Table D6, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the engineered polypeptide comprises the amino acid sequence of a SEQ ID NO: listed in Table D7, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the engineered polypeptide comprises the amino acid sequence of a SEQ ID NO: listed in Table D8, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the recombinant polypeptide comprises an amino acid sequence of a SEQ ID NO: listed in Table D9, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.In some embodiments, the engineered polypeptide comprises the amino acid sequence of a SEQ ID NO: listed in Table D10, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the engineered polypeptide comprises the amino acid sequence of a SEQ ID NO: listed in Table D11, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the engineered polypeptide comprises the amino acid sequence of a SEQ ID NO: listed in Table D12, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0474] In some embodiments, the engineered polypeptide comprises an amino acid sequence listed in Table T1, or an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical thereto. In some embodiments, the engineered polypeptide comprises a linker comprising a linker sequence listed in Table T1, or an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical thereto. In some embodiments, the engineered polypeptide comprises an RT domain comprising an RT domain sequence listed in Table T1, or an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical thereto. In some embodiments, the recombinant polypeptide comprises: (i) a linker comprising a linker sequence listed in a row of Table T1, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto; and (ii) an RT domain comprising an RT domain sequence listed in the same row of Table T1, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0475] [Table T1]

[0476] In some embodiments, the engineered polypeptide comprises an amino acid sequence listed in Table T2, or an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical thereto. In some embodiments, the engineered polypeptide comprises a linker comprising a linker sequence listed in Table T2, or an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical thereto. In some embodiments, the engineered polypeptide comprises an RT domain comprising an RT domain sequence listed in Table T2, or an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical thereto. In some embodiments, the recombinant polypeptide comprises: (i) a linker comprising a linker sequence listed in a row of Table T2, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto; and (ii) an RT domain comprising an RT domain sequence listed in the same row of Table T2, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0477] [Table T2-1]

[0478] [Table T2-2]

[0479] [Table T2-3]

[0480] Exemplary recombinant polypeptide subsequences In some embodiments, the recombinant polypeptide comprises, from N-terminus to C-terminus, one or more (e.g., one, two, three, four, five, or all six) of: an N-terminal methionine residue, a first nuclear localization signal (NLS), a DNA-binding domain, a linker, an RT domain, and / or a second NLS. In some embodiments, the recombinant polypeptide comprises, from N-terminus to C-terminus, an NLS (e.g., a first NLS), a DNA-binding domain, a linker, and an RT domain, wherein the linker and RT domain are the linker and RT domain of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to said linker and RT domain. In some embodiments, the recombinant polypeptide comprises, from N-terminus to C-terminus, a DNA-binding domain, a linker, an RT domain, and an NLS (e.g., a second NLS), where the linker and RT domain are the linker and RT domain of an recombinant polypeptide of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to said linker and RT domain. In some embodiments, the recombinant polypeptide comprises, from N-terminus to C-terminus, a first NLS, a DNA-binding domain, a linker, an RT domain, and a second NLS, where the linker and RT domain are the linker and RT domain of an recombinant polypeptide of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to said linker and RT domain. In some embodiments, the recombinant polypeptide further comprises an N-terminal methionine residue.

[0481] In some embodiments, the recombinant polypeptide comprises, from N-terminus to C-terminus, an N-terminal methionine residue, a first nuclear localization signal (NLS) (e.g., an amino acid sequence of or having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to any one of SEQ ID NOs: 1-7743 and / or any of Tables A1, T1, T2, or D1-D12), a DNA binding domain (e.g., a DNA binding domain listed in Table 8, e ... For example, a Cas domain, e.g., a SpyCas9 domain or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto; or a DNA-binding domain of any one of SEQ ID NOs: 1 to 7743 and / or a recombinant polypeptide listed in any of Tables A1, T1, T2, or D1 to D12 or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto), a phosphorylation domain, a phospholipid ... Car (e.g., an amino acid sequence of, or having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to, any one of SEQ ID NOs: 1 to 7743 and / or any of the recombinant polypeptides listed in Tables A1, T1, T2, or D1 to D12), RT domain (e.g., an amino acid sequence of, or having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to, any one of SEQ ID NOs: 1 to 7743 and / or any of the recombinant polypeptides listed in Tables A1, T1, T2, or D1 to D12), a recombinant polypeptide having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% identity thereto), and a second NLS (e.g., a recombinant polypeptide of any one of SEQ ID NOs: 1-7743 and / or a recombinant polypeptide listed in any of Tables A1, T1, T2 or D1-D12, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% identity thereto).In some embodiments, the recombinant polypeptide further comprises (e.g., from the C-terminus to the second NLS) a T2A sequence and / or a puromycin sequence (e.g., an amino acid sequence of, or having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to, any one of SEQ ID NOs: 1-7743 and / or any of the recombinant polypeptides listed in Tables A1, T1, T2, or D1-D12). In some embodiments, a nucleic acid encoding a recombinant polypeptide (e.g., as described herein) encodes a T2A sequence, e.g., the T2A sequence is located between a region encoding the recombinant polypeptide and a second region, the second region optionally encoding a selectable marker, e.g., puromycin.

[0482] In certain embodiments, the first NLS comprises a first NLS sequence of a genetically engineered polypeptide having the amino acid sequence of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the first NLS comprises a first NLS sequence of a genetically engineered polypeptide listed in any of Tables A1, T1, T2, or D1-D12, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the first NLS sequence comprises a C-myc NLS. In certain embodiments, the first NLS comprises the amino acid sequence PAAKRVKLD (SEQ ID NO: 11,095), or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0483] In certain embodiments, the recombinant polypeptide further comprises a spacer sequence between the first NLS and the DNA-binding domain. In certain embodiments, the spacer sequence between the first NLS and the DNA-binding domain comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids. In certain embodiments, the spacer sequence between the first NLS and the DNA-binding domain comprises the amino acid sequence GG.

[0484] In certain embodiments, the DNA-binding domain comprises the DNA-binding domain of a recombinant polypeptide of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the DNA-binding domain comprises the DNA-binding domain of a recombinant polypeptide listed in any of Tables A1, T1, T2, or D1-D12, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the DNA-binding domain comprises a Cas domain (e.g., listed in Table 8). In certain embodiments, the DNA-binding domain comprises the amino acid sequence of a SpyCas9 polypeptide (e.g., a Cas9 N863A polypeptide listed in Table 8), or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the DNA binding domain has the amino acid sequence: [ka] or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95% or 99% identity thereto.

[0485] In certain embodiments, the recombinant polypeptide further comprises a spacer sequence between the DNA-binding domain and the linker. In certain embodiments, the spacer sequence between the DNA-binding domain and the linker comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids. In certain embodiments, the spacer sequence between the DNA-binding domain and the linker comprises the amino acid sequence GG.

[0486] In certain embodiments, the linker comprises the linker sequence of a recombinant polypeptide of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises the linker sequence of a recombinant polypeptide listed in any of Tables A1, T1, T2, or D1-D12, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises the amino acid sequence listed in Table 1 or 10, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0487] In certain embodiments, the recombinant polypeptide further comprises a spacer sequence between the linker and the RT domain. In certain embodiments, the spacer sequence between the linker and the RT domain comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids. In certain embodiments, the spacer sequence between the linker and the RT domain comprises the amino acid sequence GG.

[0488] In certain embodiments, the RT domain comprises the RT domain sequence of a recombinant polypeptide of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises the RT domain sequence of a recombinant polypeptide listed in any of Tables A1, T1, T2, or D1-D12, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an amino acid sequence listed in Table 1 or 6, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the RT domain has a length of about 400-500, 500-600, 600-700, 700-800, 800-900, or 900-1000 amino acids.

[0489] In certain embodiments, the recombinant polypeptide further comprises a spacer sequence between the RT domain and the second NLS. In certain embodiments, the spacer sequence between the RT domain and the second NLS comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids. In certain embodiments, the spacer sequence between the RT domain and the second NLS comprises the amino acid sequence AG.

[0490] In certain embodiments, the second NLS comprises a second NLS sequence of a genetically engineered polypeptide of any one of SEQ ID NOs: 1-7743. In certain embodiments, the second NLS comprises a second NLS sequence of a genetically engineered polypeptide listed in any of Tables A1, T1, T2, or D1-D12. In certain embodiments, the second NLS sequence comprises multiple partial NLS sequences. In some embodiments, the NLS sequence, e.g., the second NLS sequence, comprises a first partial NLS sequence comprising, for example, the amino acid sequence KRTADGSEFE (SEQ ID NO: 11,097), or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the NLS sequence, e.g., the second NLS sequence, comprises a second partial NLS sequence. In embodiments, the NLS sequence, e.g., the second NLS sequence, comprises an SV40A5 NLS, e.g., a bipartite SV40A5 NLS, e.g., comprising the amino acid sequence KRTADGSEFESPKKKAKVE (SEQ ID NO: 11,098), or an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical thereto. In certain embodiments, the NLS sequence, e.g., the second NLS sequence, comprises the amino acid sequence KRTADGSEFEKRTADGSEFESPKKKAKVE (SEQ ID NO: 11,099), or an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical thereto.

[0491] In certain embodiments, the recombinant polypeptide further comprises a spacer sequence between the second NLS and the T2A and / or puromycin sequence. In certain embodiments, the spacer sequence between the second NLS and the T2A and / or puromycin sequence comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids. In certain embodiments, the spacer sequence between the second NLS and the T2A and / or puromycin sequence comprises the amino acid sequence GSG.

[0492] Linker and RT domains In some embodiments, the recombinant polypeptide comprises a linker (e.g., as described herein) and an RT domain (e.g., as described herein). In certain embodiments, the recombinant polypeptide comprises, from N-terminus to C-terminus, a linker (e.g., as described herein) and an RT domain (e.g., as described herein).

[0493] In certain embodiments, the linker comprises a linker sequence listed in Table 10, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises a linker sequence of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises a linker sequence of any one of SEQ ID NOs: 6001-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises a linker sequence of any one of SEQ ID NOs: 4501-4541, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises the linker sequence of an exemplary genetically engineered polypeptide listed in Table A1, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises the linker sequence of a genetically engineered polypeptide having the amino acid sequence of a SEQ ID NO: listed in Table T1, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises the linker sequence of a genetically engineered polypeptide having the amino acid sequence of a SEQ ID NO: listed in Table T2, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises a linker sequence of a recombinant polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D1, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises a linker sequence of a recombinant polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D2, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.In certain embodiments, the linker comprises a linker sequence of a genetically engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D3, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises a linker sequence of a genetically engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D4, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises a linker sequence of a genetically engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D5, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises a linker sequence of a genetically engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D6, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises a linker sequence of a genetically engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D7, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises a linker sequence of a genetically engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D8, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises a linker sequence of a recombinant polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D9, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises a linker sequence of a recombinant polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D10, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.In certain embodiments, the linker comprises a linker sequence of a recombinant polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D11, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the linker comprises a linker sequence of a recombinant polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D12, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0494] In certain embodiments, the RT domain comprises an RT domain sequence listed in Table 6, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an RT domain sequence of an exemplary recombinant polypeptide listed in Table A1, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an RT domain sequence of an recombinant polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table T1, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an RT domain sequence of an recombinant polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table T2, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an RT domain sequence of an engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D1, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an RT domain sequence of an engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D2, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an RT domain sequence of an engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D3, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an RT domain sequence of a recombinant polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D4, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.In certain embodiments, the RT domain comprises an RT domain sequence of an engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D5, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an RT domain sequence of an engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D6, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an RT domain sequence of an engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D7, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an RT domain sequence of an engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D8, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an RT domain sequence of an engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D9, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an RT domain sequence of an engineered polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D10, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an RT domain sequence of a recombinant polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D11, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In certain embodiments, the RT domain comprises an RT domain sequence of a recombinant polypeptide having an amino acid sequence of a SEQ ID NO: listed in Table D12, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0495] In some embodiments, the recombinant polypeptide comprises a portion of the recombinant polypeptide of any one of SEQ ID NOs: 1-7743, wherein the portion comprises a linker and an RT domain, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to said portion.

[0496] In some embodiments, the recombinant polypeptide comprises a linker of the recombinant polypeptide of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to said linker. In some embodiments, the recombinant polypeptide comprises a linker of the recombinant polypeptide of any one of SEQ ID NOs: 6001-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to said linker. In some embodiments, the recombinant polypeptide comprises a linker of the recombinant polypeptide of any one of SEQ ID NOs: 4501-4541, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to said linker. In some embodiments, the recombinant polypeptide comprises a linker of a recombinant polypeptide listed in any of Tables A1, T1, T2, or D1-D12, or a linker comprising an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0497] In some embodiments, the recombinant polypeptide comprises the RT domain of the recombinant polypeptide of any one of SEQ ID NOs: 1-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to said RT domain. In some embodiments, the recombinant polypeptide comprises the RT domain of the recombinant polypeptide of any one of SEQ ID NOs: 6001-7743, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to said RT domain. In some embodiments, the recombinant polypeptide comprises the RT domain of the recombinant polypeptide of any one of SEQ ID NOs: 4501-4541, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to said RT domain. In some embodiments, the recombinant polypeptide comprises an RT domain of an recombinant polypeptide listed in any of Tables A1, T1, T2, or D1-D12, or an RT domain comprising an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto.

[0498] In certain embodiments, the linker and RT domain of the recombinant polypeptide comprises the amino acid sequence of the linker and RT domain of the recombinant polypeptide having the amino acid sequence of any one of SEQ ID NOs: 1-7743 (or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto). In certain embodiments, the linker and RT domain of the recombinant polypeptide comprises the amino acid sequence of the linker and RT domain having at least 80% identity to the linker and RT domain of any one of SEQ ID NOs: 1-7743. In certain embodiments, the linker and RT domain of the recombinant polypeptide comprises the amino acid sequence of the linker and RT domain having at least 90% identity to the linker and RT domain of any one of SEQ ID NOs: 1-7743. In certain embodiments, the linker and RT domain of the recombinant polypeptide comprises the amino acid sequence of the linker and RT domain having at least 95% identity to the linker and RT domain of any one of SEQ ID NOs: 1-7743. In certain embodiments, the linker and RT domain of the recombinant polypeptide comprises an amino acid sequence of the linker and RT domain that is at least 99% identical to the linker and RT domain of any one of SEQ ID NOs: 1-7743. In certain embodiments, the linker and RT domain of the recombinant polypeptide comprises an amino acid sequence of the linker and RT domain of a recombinant polypeptide having an amino acid sequence of any one of SEQ ID NOs: 6001-7743 (or an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical thereto). In certain embodiments, the linker and RT domain of the recombinant polypeptide comprises an amino acid sequence of the linker and RT domain of a recombinant polypeptide having an amino acid sequence of any one of SEQ ID NOs: 4501-4541 (or an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical thereto).In certain embodiments, the linker and RT domain of the recombinant polypeptide comprises the amino acid sequence of (or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to) the linker and RT domain from a single row of any of Tables A1, T1, T2, or D1-D12 (e.g., from a single exemplary recombinant polypeptide listed in any of Tables A1, T1, T2, or D1-D12).

[0499] In certain embodiments, the linker and RT domains of the recombinant polypeptide comprise linker and RT domain amino acid sequences from (or amino acid sequences having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to) two different amino acid sequences selected from SEQ ID NOs: 1-7743. In certain embodiments, the linker and RT domains of the recombinant polypeptide comprise linker and RT domain amino acid sequences from (or amino acid sequences having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity to) different rows of any of Tables A1, T1, T2, or D1-D12.

[0500] In certain embodiments, the recombinant polypeptide further comprises a first NLS (e.g., a 5' NLS), e.g., as described herein. In certain embodiments, the recombinant polypeptide further comprises a second NLS (e.g., a 3' NLS), e.g., as described herein. In certain embodiments, the recombinant polypeptide further comprises an N-terminal methionine residue.

[0501] RT family and mutants In certain embodiments, the recombinant polypeptide comprises the amino acid sequence of an RT domain sequence from a family selected from AVIRE, BAEVM, FFV, FLV, FOAMV, GALV, KORV, MLVAV, MLVBM, MLVCB, MLVFF, MLVMS, PERV, SFV1, SFV3L, WMSV, XMRV6, BLVAU, BLVJ, HTL1A, HTL1C, HTL1L, HTL32, HTL3P, ​​HTLV2, JSRV, MLVF5, MLVRD, MMTVB, MPMV, SFVCP, SMRVH, SRV1, SRV2, and WDSV. In certain embodiments, the recombinant polypeptide comprises the amino acid sequence of an RT domain sequence from a family selected from AVIRE, BAEVM, FFV, FLV, FOAMV, GALV, KORV, MLVAV, MLVBM, MLVCB, MLVFF, MLVMS, PERV, SFV1, SFV3L, WMSV, and XMRV6.

[0502] In certain embodiments, the recombinant polypeptide comprises the amino acid sequence of an RT domain sequence from the MLVMS RT domain. In embodiments, the amino acid sequence of the RT domain sequence comprises one or more point mutations listed in column 1 of Table M1, or corresponding point mutations. In embodiments, the amino acid sequence of the RT domain sequence comprises one or more point mutations listed in column 3 of Table M1 (MLVMS), or corresponding point mutations. In embodiments, the amino acid sequence of the RT domain sequence comprises one or more point mutations at the amino acid positions of the RT domain listed in columns 1 and 2 of Table M2, or corresponding amino acid positions.

[0503] In certain embodiments, the recombinant polypeptide comprises the amino acid sequence of an RT domain sequence from the AVIRE RT domain. In some embodiments, the amino acid sequence of the RT domain sequence comprises one or more point mutations listed in column 2 of Table M1, or corresponding point mutations. In some embodiments, the amino acid sequence of the RT domain sequence comprises one or more point mutations listed in column 4 of Table M1 (AVIRE), or corresponding point mutations. In some embodiments, the amino acid sequence of the RT domain sequence comprises one or more point mutations at amino acid positions of the RT domain listed in columns 3 and 4 of Table M2, or corresponding amino acid positions. In certain embodiments, the RT domain comprises (e.g., at the C-terminus) IENSSP (SEQ ID NO: 15465) Includes:

[0504] [Table M1]

[0505] [Table M2]

[0506] In certain embodiments, the engineered polypeptide comprises a gammaretrovirus-derived RT domain. In certain embodiments, the gammaretrovirus-derived RT domain of the engineered polypeptide comprises the amino acid sequence of an RT domain sequence from a family selected from AVIRE, BAEVM, FFV, FLV, FOAMV, GALV, KORV, MLVAV, MLVBM, MLVCB, MLVFF, MLVMS, PERV, SFV1, SFV3L, WMSV, and XMRV6. In some embodiments, the gammaretrovirus-derived RT domain of the engineered polypeptide is not derived from a PERV. In some embodiments, the RT comprises one, two, three, four, five, six, or more mutations shown in Table 2 and corresponding to mutations D200N, L603W, T330P, D524G, E562Q, D583N, P51L, S67R, E67K, T197A, H204R, E302K, F309N, W313F, L435G, N454K, H594Q, L671P, E69K, or D653N in the RT domain of murine leukemia virus reverse transcriptase. In some embodiments, the recombinant polypeptide further comprises a linker having at least 99% identity to the linker domain of any one of SEQ ID NOs: 1-7743. In some embodiments, the recombinant polypeptide further comprises a linker having at least 99% or 100% identity to SEQ ID NO: 5217 or SEQ ID NO: 11,041.

[0507] In some embodiments, the RT domain comprises the amino acid sequence of the RT domain of AVIRE RT (e.g., the AVIRE_P03360 sequence, e.g., SEQ ID NO: 8001), or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the RT domain comprises the amino acid sequence of AVIRE RT further comprising one, two, three, four, or five mutations selected from the group consisting of D200N, G330P, L605W, T306K, and W313F, or corresponding positions in a homologous RT domain. In some embodiments, the RT domain comprises the amino acid sequence of AVIRE RT further comprising one, two, or three mutations selected from the group consisting of D200N, G330P, and L605W, or corresponding positions in a homologous RT domain.

[0508] In some embodiments, the RT domain comprises the amino acid sequence of the RT domain of BAEVM RT (e.g., the BAEVM_P10272 sequence, e.g., SEQ ID NO: 8004), or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the RT domain comprises the amino acid sequence of BAEVM RT further comprising one, two, three, four, or five mutations selected from the group consisting of D198N, E328P, L602W, T304K, and W311F, or corresponding positions in a homologous RT domain. In some embodiments, the RT domain comprises the amino acid sequence of BAEVM RT further comprising one, two, or three mutations selected from the group consisting of D198N, E328P, and L602W, or corresponding positions in a homologous RT domain.

[0509] In some embodiments, the RT domain comprises the amino acid sequence of the RT domain of FFV RT (e.g., the FFV_O93209 sequence, e.g., SEQ ID NO: 8012), or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the RT domain comprises the amino acid sequence of FFV RT further comprising one, two, three, or four mutations selected from the group consisting of D21N, T293N, T419P, and L393K, or corresponding positions in a homologous RT domain. In some embodiments, the RT domain comprises the amino acid sequence of FFV RT further comprising one, two, or three mutations selected from the group consisting of D21N, T293N, and T419P, or corresponding positions in a homologous RT domain. In some embodiments, the RT domain comprises the amino acid sequence of FFV RT further comprising the mutation D21N. In some embodiments, the RT domain comprises the amino acid sequence of FFV RT further comprising one, two, or three mutations selected from the group consisting of T207N, T333P, and L307K, or corresponding positions in a homologous RT domain. In some embodiments, the RT domain comprises the amino acid sequence of FFV RT further comprising one or two mutations selected from the group consisting of T207N and T333P, or corresponding positions in a homologous RT domain.

[0510] In some embodiments, the RT domain comprises the amino acid sequence of the RT domain of FLV RT (e.g., the FLV_P10273 sequence, e.g., SEQ ID NO: 8019), or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the RT domain comprises the amino acid sequence of FLV RT further comprising one, two, three, or four mutations selected from the group consisting of D199N, L602W, T305K, and W312F, or corresponding positions in a homologous RT domain. In some embodiments, the RT domain comprises the amino acid sequence of FLV RT further comprising one or two mutations selected from the group consisting of D199N and L602W, or corresponding positions in a homologous RT domain.

[0511] In some embodiments, the RT domain comprises the amino acid sequence of the RT domain of FOAMV RT (e.g., the FOAMV_P14350 sequence, e.g., SEQ ID NO: 8021), or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the RT domain comprises the amino acid sequence of FOAMV RT further comprising one, two, three, or four mutations selected from the group consisting of D24N, T296N, S420P, and L396K, or corresponding positions in a homologous RT domain. In some embodiments, the RT domain comprises the amino acid sequence of FOAMV RT further comprising one, two, or three mutations selected from the group consisting of D24N, T296N, and S420P, or corresponding positions in a homologous RT domain. In some embodiments, the RT domain comprises the amino acid sequence of FOAMV RT further comprising the mutation D24N, or corresponding positions in a homologous RT domain. In some embodiments, the RT domain comprises the amino acid sequence of FOAMV RT further comprising one, two, or three mutations selected from the group consisting of T207N, S331P, and L307K, or corresponding positions in a homologous RT domain. In some embodiments, the RT domain comprises the amino acid sequence of FOAMV RT further comprising one or two mutations selected from the group consisting of T207N and S331P, or corresponding positions in a homologous RT domain.

[0512] In some embodiments, the RT domain comprises the amino acid sequence of the RT domain of GALV RT (e.g., the GALV_P21414 sequence, e.g., SEQ ID NO: 8027), or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the RT domain comprises the amino acid sequence of GALV RT further comprising one, two, three, four, or five mutations selected from the group consisting of D198N, E328P, L600W, T304K, and W311F, or corresponding positions in a homologous RT domain. In some embodiments, the RT domain comprises the amino acid sequence of GALV RT further comprising one, two, or three mutations selected from the group consisting of D198N, E328P, and L600W, or corresponding positions in a homologous RT domain.

[0513] In some embodiments, the RT domain comprises the amino acid sequence of the RT domain of KORV RT (e.g., the KORV_Q9TTC1 sequence, e.g., SEQ ID NO: 8047), or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity thereto. In some embodiments, the RT domain comprises the amino acid sequence of GALV RT, further comprising one, two, three, four, five, or six mutations selected from the group consisting of D32N, D322N, E452P, L274W, T428K, and W435F, or corresponding positions in a homologous RT domain. In some embodiments, the RT domain comprises the amino acid sequence of GALV RT, further comprising one, two, three, or four mutations selected from the group consisting of D32N, D322N, E452P, and L274W, or corresponding positions in a homologous RT domain. In some embodiments, the RT domain comprises the amino acid sequence of GALV RT further comprising the mutation D32N. In some embodiments, the RT domain comprises the amino acid sequence of KORV RT further comprising one, two, three, four, or five mutations selected from the group consisting of D231N, E361P, L633W, T337K, and W344F, or corresponding positions in a homologous RT domain. In some embodiments, the RT domain comprises the amino acid sequence of KORV RT further comprising one, two, or three mutations selected from the group consisting of D231N, E361P, and L633W, or corresponding positions in a homologous RT domain.

[0514] In some embodiments, the RT domain comprises the amino acid sequence of the RT domain of MLVAV RT (e.g., the MLVAV_P03356 sequence, e.g., SEQ ID NO: 8053), or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity ther...

Claims

1. A recombinant polypeptide comprising: a Cas domain (e.g., a Cas nickase domain, e.g., a Cas9 nickase domain); 1. A reverse transcriptase (RT) domain comprising the sequence of SEQ ID NO: 8,003 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, or an amino acid sequence of Table 1 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto, a reverse transcriptase (RT) domain, wherein the RT domain is C-terminal to the Cas domain; and a linker disposed between the RT domain and the Cas domain, the linker comprising the sequence of SEQ ID NO: 15,401, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto, or a sequence from the same row as the RT domain of Table 1, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identity thereto; A recombinant polypeptide comprising: (i) the RT domain has a sequence having at least 90%, 95%, 98%, 99%, or 100% identity to the RT domain of Table 1; (ii) the linker has a sequence that has at least 90%, 95%, 97%, 99%, or 100% identity to a linker sequence from the same row of Table 1 as the RT domain; (iii) the RT domain has a sequence having at least 90%, 95%, 98%, 99%, or 100% identity to an RT domain listed in Table T1, and optionally the linker has a sequence having at least 90%, 95%, 97%, 99%, or 100% identity to a linker sequence from the same row of Table T1 as the RT domain; and / or (iv) the RT domain has a sequence having at least 90%, 95%, 98%, 99%, or 100% identity to an RT domain listed in Table T2, and optionally the linker has a sequence having at least 90%, 95%, 97%, 99%, or 100% identity to a linker sequence from the same row of Table T2 as the RT domain.

3. 2. The recombinant polypeptide of claim 1, wherein the RT domain comprises a mutation listed in Table 2. Claim 4: (i) the Cas domain comprises a sequence of Table 7 or 8, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity thereto; (ii) the Cas domain is a Cas nickase domain; (iii) the Cas domain is a Cas9 nickase domain; and / or (iv) the Cas domain comprises an N863A mutation. (i) the recombinant polypeptide comprises an NLS, e.g., the recombinant polypeptide comprises two NLSs; (ii) the recombinant polypeptide comprises an NLS N-terminal to the Cas9 domain; (iii) the recombinant polypeptide comprises an NLS C-terminal to the RT domain; (iv) the recombinant polypeptide comprises a first NLS that is N-terminal to the Cas9 domain and a second NLS that is C-terminal to the RT domain; (v) the recombinant polypeptide comprises the sequence of SEQ ID NO: 4000, including the first NLS and the Cas domain, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity thereto; and / or (vi) The recombinant polypeptide of claim 1, wherein the recombinant polypeptide comprises the sequence of SEQ ID NO: 4001, including the second NLS, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity thereto. (i) the recombinant polypeptide comprises a GG amino acid sequence between the Cas domain and the linker; (ii) the recombinant polypeptide comprises an AG amino acid sequence between the RT domain and the second NLS; (iii) The recombinant polypeptide of claim 1, wherein the recombinant polypeptide comprises a GG amino acid sequence between the linker and the RT domain.

7. The recombinant polypeptide of claim 1, comprising an amino acid sequence according to any one of SEQ ID NOs: 1 to 3332 in the sequence listing, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identity thereto. (i) results in at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 1500%, 2000% or 2500% increase in converted GFP+ compared to unsorted input cells in the assay of Example 2 using HEK cells and g4 guide RNA; (ii) In the assay of Example 1 using HEK cells and g4 guide RNA, in the N-terminal to C-terminal direction: a) NLS and Cas domain sequence of SEQ ID NO: 4000; b) a linker having the sequence EAAAKGSS (SEQ ID NO: 5152); c) an RT domain having the sequence of PERV_Q4VFZ2_3mutA_WS; and d) NLS sequence of SEQ ID NO: 4001 and / or has an activity that is at least 50%, 60%, 70%, 80%, or 90% of the activity of a recombinant polypeptide comprising (iii) The recombinant polypeptide of claim 1, which has an activity that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 200%, 250%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, 1500%, 2000% or 2500% greater than the activity of a recombinant polypeptide comprising the sequence of SEQ ID NO: 4002, e.g., in the assay of Example 1 using HEK cells and g4 guide RNA.

9. 10. A nucleic acid (e.g., DNA or RNA, e.g., mRNA) encoding the recombinant polypeptide of claim 1.

10. A cell comprising a recombinant polypeptide according to any one of claims 1 to 8 or a nucleic acid according to claim 9.

11. 1. A system comprising: i) a recombinant polypeptide according to claim 1, and ii) a template RNA, a) a gRNA spacer complementary to a portion of the target nucleic acid sequence; b) a gRNA scaffold that binds to the Cas domain of the genetically engineered polypeptide; c) a heterologous sequence of interest; and d) Primer binding site sequence (PBS sequence) A template RNA comprising A system including:

12. 12. An in vitro or ex vivo method for modifying a target nucleic acid in a cell (e.g., a human cell), comprising contacting the cell with the system of claim 11 or a nucleic acid encoding same, thereby modifying the target nucleic acid.

13. A lipid nanoparticle formulation comprising the recombinant polypeptide of any one of claims 1 to 8, the nucleic acid of claim 9, or the system of claim 11.

14. A pharmaceutical composition comprising a recombinant polypeptide according to any one of claims 1 to 8, a nucleic acid according to claim 9, or a system according to claim 11, optionally further comprising a pharmaceutically acceptable excipient or carrier, wherein the pharmaceutically acceptable excipient or carrier is selected from the group consisting of a plasmid vector, a viral vector, a vesicle, and a lipid nanoparticle.

15. A kit comprising a recombinant polypeptide described in any one of claims 1 to 8, a nucleic acid described in claim 9, or a system described in claim 11.

16. 12. The system of claim 11 for use in a method of modifying a target nucleic acid molecule in a cell, the method comprising contacting the cell with the system.

17. A pharmaceutical composition comprising a recombinant polypeptide according to any one of claims 1 to 8, or a nucleic acid according to claim 9, or a system according to claim 11, for use in modifying a target genome by target-primed reverse transcription.

18. Use of a recombinant polypeptide according to any one of claims 1 to 8, or a nucleic acid according to claim 9, or a system according to claim 11, in the manufacture of a drug for modifying a target genome by target-primed reverse transcription.