How to improve vitamin D levels in plants

JP2024535023A5Pending Publication Date: 2025-09-02JOHN INNES CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024516471
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-09-14
Filing Date
2022-09-12
Publication Date
2025-09-02

AI Technical Summary

Technical Problem

Vitamin D deficiency is a significant public health issue due to inadequate dietary availability, reduced UV-B exposure, and increased use of sunscreens, affecting over a billion people worldwide, with plants being a poor dietary source and vegan populations at higher risk.

Method used

Genome editing is used to manipulate the sterol biosynthetic pathway in Solanaceous plants, specifically targeting the 7-dehydrocholesterol reductase (7-DR) gene to inhibit its activity, allowing for increased accumulation of 7-dehydrocholesterol (7-DHC) in plants, which can be converted to vitamin D upon UV-B exposure.

Benefits of technology

This method significantly increases vitamin D levels in plants, particularly in fruits like tomatoes, providing a potential dietary source that can meet daily vitamin D requirements and address deficiencies, especially in older adults and vegans.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Methods for increasing the levels of provitamin D3 and / or vitamin D3 in plants are described. Tomato plants were genetically modified to reduce the activity of 7-dehydrocholesterol reductase.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] The present invention relates to a method for improving the levels of vitamin D and / or provitamin D in plants. The present invention also relates to the plants obtained by said method, as well as to their fruits and to food products prepared from the plants of the invention. [Background technology]

[0002] Vitamin D was identified by its ability to prevent deficiency diseases that affect skeletal development, particularly rickets in children and osteomalacia and osteoporosis in adults. 1 Vitamin D is converted by two hydroxylation reactions to bioactive steroid hormone products that function not only in calcium homeostasis but also in signal transduction in multiple organs, including the heart, bone, lung, intestine, mammary gland, and brain. 2 As a result, vitamin D deficiency affects immune function and inflammation, and may contribute to the development of cancer, particularly breast and colon cancer. 3、4 , Parkinson's disease 5 , depression 6 , neurocognitive decline 7 , dementia 8 associated with an increased risk of 9 Vitamin D can be synthesized by humans from 7-dehydrocholesterol (7-DHC) after exposure of the skin to UV-B light. 10 However, the main source is dietary 11 Approximately 1 billion people worldwide suffer from vitamin D deficiency. 12, the number is increasing, mainly due to inadequate availability from the diet. Poor vitamin D status is a major public health problem in all age groups. The European Food Safety Authority defines an adequate intake as 15 μg per day for healthy individuals over 1 year of age, and in the United States, the National Institutes of Health recommends 15 μg per day for children and adults, rising to 20 μg per day for adults over 70 years of age. In general, these intakes are not achievable from food sources without supplementation, either through fortified foods or through vitamin D supplements. Advice for correcting vitamin D3 deficiency is based mostly on increased exposure to sunlight, since humans can synthesize vitamin D3 themselves from 7-DHC after exposure to UV-B radiation. However, even in individuals with adequate exposure to sunlight, vitamin D3 deficiency is common due to decreased provitamin D3 levels in the skin of the elderly (>70 years), high skin melanin content and burn scar tissue that reduces UV-B transmission, and intestinal malabsorption syndromes such as Crohn's disease and other intrinsic factor.

[0003] Additionally, sunbathing practices have declined due to concerns that exposure to UV-B radiation can cause skin cancer, and sunbathing has become accompanied by greater protection, the use of UV-blocking sunscreens, which limit vitamin D production.

[0004] Vitamin D2 was originally identified in plants but was eventually shown to result from fungal infections. 13 Provitamin D3 (7-DHC) is synthesized by some plants, such as tomato, mainly in the leaves during cholesterol and steroidal glycoalkaloid (SGAs) synthesis. UV-B exposure of tomato leaves produces vitamin D3, but in general, plants are considered relatively poor dietary sources, with the best sources being fish and dairy products. Mushrooms and yeasts have been used as sources of vitamin D2 after exposure to UV-B light, but vitamin D2 has been reported to be significantly less bioavailable than vitamin D3 in several epidemiological studies. 14、15The growing vegan population means that, without further supplementation, an increasing proportion of diets may be vitamin D deficient and will require vitamin D2 from mushrooms.

[0005] It would be beneficial to provide plants with increased levels of vitamin D and / or provitamin D. Summary of the Invention

[0006] Taking advantage of the partial duplication of the plant sterol biosynthetic pathway in Solanaceous plants, we engineered the accumulation of provitamin D3 in tomato by genome editing to provide biofortified foods with the option of producing nutritional supplements from waste materials.

[0007] In a first aspect of the present invention, there is provided a method for improving provitamin D3 levels in plants, comprising reducing the activity of 7-dehydrocholesterol reductase (7-DR) in the plant. In a preferred embodiment, the plant has a duplication of the 7-DR gene; wherein preferably one of the loci is targeted for reduced activity. As described herein, the 7-DR2 enzyme converts provitamin D3 / 7-DHC to cholesterol for the synthesis of tomatine in the leaves and fruits of tomato plants. As a result, inhibiting 7-DR2 activity in tomato can result in the accumulation of 7-DHC without any effect on plant sterol and brassinosteroid biosynthesis. It will be understood that the gene and enzyme are referred to herein as S17-DR2 (i.e., tomato-specific gene), but this is intended to include homologs and orthologs in other plant species.

[0008] "Reduced activity" may mean to reduce or eliminate enzyme activity or expression. In a preferred embodiment, the method comprises introducing a loss-of-function mutation into at least one copy of the 7-DR gene, preferably the Sl7-DR2 gene. The mutation may be in a coding sequence. The mutation may be an insertion, deletion, or modification. In some embodiments, the loss-of-function mutation may be introduced into multiple copies of the Sl7-DR2 gene. Preferably, the mutation is introduced by genome editing, preferably ZFN, TALEN, or CRISPR. In some embodiments, the mutation may be introduced using a mutagen (e.g., irradiation). In some embodiments, the mutation may be introduced into at least one copy of the gene to generate a plant with multiple mutations in the genome, e.g., a homozygous plant, using conventional breeding techniques.

[0009] In other embodiments, post-transcriptional techniques can be used to reduce or eliminate enzyme activity.For example, RNAi, CRISPRi, or antisense techniques can all be used to reduce enzyme levels.Methods can include introducing siRNA or antisense molecules into plants; or introducing nucleic acid sequences that code siRNA or antisense molecules into plants.These nucleic acid sequences can be stably incorporated into plant genome.

[0010] Where enzyme activity is reduced (but not eliminated), activity is preferably reduced by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% or more compared to levels in wild-type or control plants. Methods for determining enzyme activity are within the expertise of one of ordinary skill in the art.

[0011] In embodiments, the level of 7-DHC in the plant is increased by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% or more compared to the level in a wild-type or control plant.

[0012] The method may further include exposing the plant or plant part to UVB radiation. Such exposure is preferably for a time and intensity sufficient to convert at least some of the 7-DHC present in the plant to vitamin D3. In such embodiments, the level of vitamin D3 is increased by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more compared to levels in wild-type or control plants.

[0013] In some embodiments, the plant further carries a mutation that increases the penetration of UV-B light into the fruit. For example, the y mutation in tomato causes the loss of UV-protective flavonols from the skin of "pink tomato", thus allowing for more penetration. The method may include introducing such a mutation into the plant of the present invention; this may be by conventional breeding techniques or by targeted genome editing. In other embodiments, the method of the present invention may be applied to a plant that already carries such a mutation; i.e., the mutant plant is used as a background for reducing Sl7-DR2 activity.

[0014] In one embodiment, the plant further carries one or more mutations that affect chlorophyll degradation in ripe fruit.An example is the mutation of the staygreen locus in tomato.Such mutations can further help to increase 7-DHC levels in ripe fruit.The stacking of these traits can be achieved by genome editing using ZFN, TALEN or CRISPR, or by introgression.

[0015] In one embodiment, the method further comprises processing the plant or plant parts to obtain 7-DHC and / or vitamin D3. Such an embodiment may be particularly useful where the plant parts are not typically consumed, such as the leaves or stems of a tomato plant after the tomatoes have been harvested.

[0016] In another aspect of the present invention, there is provided a genetically modified plant, part thereof or plant cell having reduced activity of 7-dehydrocholesterol reductase. The plant, part thereof or plant cell may comprise a loss-of-function mutation in the 7-DR gene, preferably the S17-DR2 gene.

[0017] The plant parts may be seeds, fruits, roots, tubers, leaves, flowers.

[0018] In each of the above aspects, the plant is preferably a member of the Solanaceae family, more preferably a Solanum species. The plant may be selected from Solanum lycopersicum, Solanum tuberosum, and Solanum melongena. In other embodiments, the plant may be selected from Capsicum species, such as C. annuum, C. baccatum, C. chinense, C. frutescens, and C. pubescens (which include bell pepper and chili pepper). In yet other embodiments, the plant may be Physalis species, such as tomatillo.

[0019] In another aspect of the present invention, there is also provided a plant or plant progeny obtained or obtainable by any of the above-mentioned methods. In another aspect, there is provided pollen, propagules, progeny or parts from a plant as described above, said pollen, propagules, progeny or parts comprising a loss-of-function mutation in the 7-DR gene, preferably the Sl7-DR2 gene.

[0020] In yet a further aspect, there is provided a food product produced from a plant or plant part of the present invention.

[0021] Some studies show that dietary supplementation with vitamin D or provitamin D can have beneficial effects on reducing serum total cholesterol, LDL cholesterol, and triglyceride levels. Thus, the present invention provides a potential route to cholesterol level reduction in a human or animal subject in need thereof by consuming the plant of the present invention, or a food product prepared therefrom. In one embodiment, the present invention provides a method of reducing cholesterol levels in a human or animal subject in need thereof, comprising consuming a plant or food product as described herein. Also provided is a plant or food product as described herein for use in reducing cholesterol levels in a human or animal subject. [Brief description of the drawings]

[0022] [Figure 1]Figure 1 shows the accumulation of 7-DHC in Sl7-DR2 homozygous knockout lines. a, Cholesterol synthesis pathway (shown in light green) and phytosterol biosynthesis pathway (shown in light orange) in tomato, redrawn from Sonawane et al. 7-DHC can be converted to cholesterol by 7-DR2 and converted to vitamin D3 by exposure to UVB light. SMO, C-4 sterol methyl oxidase; C5-SD1, sterol C-5(6) desaturase 1. b, Five independent Sl7-DR2 knockout lines were generated by genome editing. Top: Schematic structure of Sl7-DR2 gene, exons shown as grey arrows. Bottom: Restoration mutations in each line are highlighted in light blue. CRISPR-Cas9 targeting sequence and protospacer adjacent motif sequence are shown in blue and red, respectively. c, 7-DHC content in wild-type (WT) and Sl7-DR2 knockout tomato fruits at different stages of ripening (IMG, immature green; MG, mature green; breaker, fruit turning ripe; B+7, fruit 7 days after breaker ripening). Data are shown as mean ± sem. From left to right: n=14, 19, 16, 15, 16, 14, 13, 11, 18, 13, 10, 15, 15, 14, 17, 11, 11, 15, 9, 17, 14, 17, 15 and 15 biologically independent fruit samples. ND, not detected. d, 7-DHC content in leaves of wild-type and Sl7-DR2 knockout lines. Data are shown as mean ± sem. From left to right: n=4, 5, 5, 4, 5 and 4 biologically independent leaf samples. Two-tailed t-tests were used to assess statistical significance between WT and mutants at each fruit maturity stage (c) or leaf (d) (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001). [Diagram 2]Figure 2 shows the localization and quantitative comparison of SGA and cholesterol in WT and Sl7-DR2 knockout mutant lines, and the conversion of 7-DHC to vitamin D3 by UV-B irradiation in Sl7-DR2 knockout. a, MALDI images of 7-DHC (m / z 367.33) and its laser-induced derivative ion (m / z 365.32), cholesterol (m / z 369.35), and α-tomatine (m / z 1,034.55). Scale bar, 2 mm. The HotMetal2 color scale indicates the range of total ion current normalized intensity. The same metabolites are shown with identical scaled intensity for wild-type and mutant samples. Due to potentially different ionization efficiencies, it is not straightforward to compare the relative abundance of different metabolites using MALDI images. b, α-tomatine content in leaves of wild-type and Sl7-DR2 knockout lines (mean ± sem, n = 3 biologically independent leaf samples for each line). c, Relative esculeoside A content (mean ± sem) of red-ripened (7 days after breaker) fruits of wild-type and Sl7-DR2 knockout lines. From left to right: n = 6, 6, 5, 8, 10 and 10 biologically independent fruit samples. d, Cholesterol content (mean ± sem) of leaves of wild-type and Sl7-DR2 knockout lines. From left to right: n = 4, 5, 5, 4, 5 and 4 biologically independent leaf samples. e, 7-DHC and vitamin D3 content in control and UVB-treated leaves or fruits (mean ± sem, n = 4 biologically independent leaf or fruit samples at each stage for control and MUT#2). Mut#2 tissues were irradiated with UVB light for 1 h. Experiments were repeated three times. ND, not detected. Two-tailed t tests were used to assess statistical significance between WT and mutant values ​​(b–d) and between control and UVB-treated tissues (e) (*P ≤ 0.05, **P ≤ 0.01, ***P ≤ 0.001, ****P ≤ 0.0001). [Diagram 3]Figure 3 shows a comparison of WT and Sl7-DR2 knockout plants. a Wild-type and Sl7-DR2 mutant adult plants. Scale bar, 20 cm. b Stigmasterol content of leaves from wild-type and Sl7-DR2 knockout lines (mean ± sem, n = 3). Two-tailed t-tests were used to assess statistical significance between WT and mutants. No significant differences were detected. Where relevant, see source data for P values. c MALDI images of 7-dehydrocholesterol (m / z 367.33) and its laser-induced derivative ions (m / z 365.32, m / z 363.31), cholesterol (m / z 369.35), and α-tomatine (m / z 1,034.55). Scale bar, 2 mm. The HotMetal2 color scale indicates the range of total ion current (TIC) normalized intensity. The same metabolites are shown with identical scaled intensity for wild-type and mutant samples. Further details can be found in the online Methods. d α-Tomatine content (mean ± sem) of immature green fruits of wild-type and Sl7-DR2 knockout lines. Statistical significance between WT and mutant values ​​was assessed using a two-tailed t-test (*P ≤ 0.05, **P ≤ 0.01). Where relevant, see source data for P values. e Cholesterol content (mean ± sem) of wild-type (WT) and Sl7-DR2 knockout tomato fruits during fruit ripening (IMG, immature green; MG, mature green; breaker; B+7, fruits 7 days after breaker ripening). From left to right: n=14, 19, 16, 15, 16, 14, 13, 11, 18, 13, 10, 15, 15, 14, 17, 11, 11, 15, 9, 17, 14, 17, 15, and 15. Two-tailed t-tests were used to assess statistical significance between WT and mutants (*P≦0.05, **P≦0.01, ***P≦0.001, ****P≦0.0001). Where relevant, please refer to source data for P values. [Figure 4]Figure 4 shows further comparison of WT and Sl7-DR2 knockout plants. a Relative expression levels of genes in cholesterol and phytosterol biosynthetic pathways in wild-type and Sl7-DR2 mutant leaves (mean ± sem). SlActin was used as an internal control. WT, n = 5; Sl7-DR2 KO, n = 15 (combined five samples from each of Mut#1, Mut#2 and Mut#3 carrying the same mutation in Sl7-DR2). b Relative expression levels of SlC5-SD1 in wild-type and Sl7-DR2 mutant leaves. SlActin was used as an internal control (mean ± sem, n = 5). Statistical significance between WT and mutants was assessed using two-tailed t-tests (*P ≤ 0.05, **P ≤ 0.01). Where relevant, please refer to source data for P values. c Representative LC-MS spectra of 7-dehydrocholesterol (7-DHC), vitamin D3 and cholesterol from the analytical samples and corresponding authentic standards. d Overlaid chromatograms of extracts from Mut#1 leaf tissue with and without 2 h UV irradiation (shown as light blue and black, respectively) and the standard mixture (10 μM 7-DHC, vitamin D3 and cholesterol), m / z = 385.3442–385.3480. Vitamin D3 was produced in large amounts in the UV-irradiated samples. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0023] The present invention will now be described in more detail. In the following passages, different aspects of the invention are defined in more detail. Each aspect thus defined may be combined with any other aspect or aspects, unless expressly indicated to the contrary. In particular, any feature indicated as being preferred or preferred may be combined with any other feature or features indicated as being preferred or preferred.

[0024] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of plant biology, microbiology, tissue culture, molecular biology, chemistry, biochemistry and recombinant DNA technology, bioinformatics, within the skill of the art, which are fully explained in the literature.

[0025] For the purposes of the present invention, a "genetically modified" or "mutant" plant is a plant that is genetically modified compared to a naturally occurring wild type (WT) plant. In one embodiment, a mutant plant is a plant that is modified compared to a naturally occurring wild type (WT) plant using a mutagenesis method, such as the mutagenesis method described herein. In one embodiment, the mutagenesis method is targeted genome modification or genome editing. Targeted genome modification or targeted genome editing is a genome manipulation technique that uses targeted DNA double-strand breaks (DSBs) to stimulate genome editing through homologous recombination (HR)-mediated recombination events. In one embodiment, ZFN, TALEN or CRISPR are used to introduce mutations. In a preferred embodiment, the targeted genome editing technique is CRISPR. The use of this technology in genome editing is well described in the art, for example in US 8,697,359 and the references cited therein.

[0026] In another embodiment, conventional mutagenesis techniques, such as T-DNA insertional mutagenesis or any known physical or chemical mutagen, can be used to disrupt the genes described herein.In a further example, gene silencing methods known to those skilled in the art can be used to reduce the expression of one or more genes at the transcription or translation level, including but not limited to, the use of small interfering nucleic acid (siNA) against one or more genes.For example, siNA can include small interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), antagomir and small hairpin RNA (shRNA) that can mediate RNA interference.

[0027] In one example, mutation may be used to knock down or knock out the expression of native 7-DR gene (preferably S17-DR2 gene).Thus, in this example, the production of 7-DHC in the plant is provided by the presence of modified plant genome, not by the presence of transgene expressed in the plant.In other words, the genetically modified plant may be described as transgene-free.Nevertheless, in another embodiment, the genetically modified plant may be a transgenic plant.

[0028] The term "plant" as used herein includes whole plants, progeny of plants, and plant parts including seeds, fruits, shoots, stems, leaves, roots (including tubers), flowers, tissues, and organs. The term "plant" also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, and microspores.

[0029] The present invention also extends to harvestable parts of the plants of the present invention as described herein, including but not limited to seeds, leaves, fruits, flowers, stems, roots, rhizomes, tubers and bulbs. Aspects of the present invention also extend to products derived, preferably directly, from the harvestable parts of such plants, such as dry pellets or flours, oils, fats and fatty acids, starches or proteins. The present invention also relates to products derived from or from parts of the plants as described herein, more preferably food products.

[0030] In a most preferred embodiment, the plant part or harvestable product is a fruit. Thus, in a further aspect of the present invention there is provided a fruit produced from a plant as described herein.

[0031] In another embodiment, the plant part is pollen, propagules or progeny of a genetically modified plant as described herein. Thus, in a further aspect of the present invention, there is provided pollen, propagules or progeny produced from a plant as described herein.

[0032] According to all aspects of the present invention, the control plant as used herein is a plant that has not been modified according to the method of the present invention.In one embodiment, the control plant is a wild-type plant.The control plant is typically of the same plant species and preferably has the same genetic background as the modified plant.

[0033] Reference herein to "Sl7-DR2" (e.g., Sl7-DR2 gene or Sl7-DR2 enzyme) is intended to include not only the specific tomato isoform described herein, but also homologs and orthologs in other plants. Those skilled in the art will understand that suitable homologs can be identified by sequence comparison and identification of conserved domains. There are predictors in the art that can be used to identify such sequences. The function of homologs can be identified using methods known in the art. Thus, once homologous sequences are identified, homology may be determined by performing sequence alignment. Thus, the nucleotide sequences described herein are also applicable in carrying out the present invention in other plants.

[0034] The terms "introduction", "transfection" or "transformation" as used herein include the transfer of an exogenous polynucleotide or construct (e.g., a nucleic acid construct or a genome editing construct as described herein) into a host cell, regardless of the method used for the transfer. Plant tissue capable of subsequent clonal propagation, whether by organogenesis or embryogenesis, may be transformed with a genetic construct and whole plants may be regenerated therefrom. The particular tissue selected will vary depending on the clonal propagation system available and best suited for the particular species being transformed. Exemplary tissue targets include leaf discs, pollen, embryos, cotyledons, hypocotyls, female gametophytes, callus tissue, existing meristems (e.g., apical meristems, axillary buds, and root meristems), and induced meristems (e.g., cotyledonary meristems and hypocotyl meristems). The resulting transformed plant cells may then be used to regenerate transformed plants in a manner known to those skilled in the art.

[0035] Plant transformation is now a routine technique in many species.Any of several transformation methods known to those skilled in the art can be used to introduce one or more genome editing constructs of interest into suitable ancestor cells.The method described for transformation and regeneration of plants from plant tissue or plant cells can be used for transient or stable transformation.

[0036] Transformation methods include the use of liposomes, electroporation, chemicals that increase free DNA uptake, direct injection of DNA into plants (microinjection), gene guns (or biolistic delivery systems), lipofection, transformation and microinjection with viruses or pollen. Methods may be selected from calcium / polyethylene glycol methods for protoplasts, ultrasound-mediated gene transfection, optical or laser transfection, transfection with silicon carbide fibers, electroporation of protoplasts, microinjection into plant material, DNA or RNA coated biolistics, (non-integrative) virus infection, etc. Transgenic plants may also be produced through Agrobacterium tumefaciens-mediated transformation.

[0037] Optionally, to select transformed plants, the plant material obtained by transformation is usually subjected to selective conditions so that transformed plants can be distinguished from non-transformed plants. For example, seeds can be planted and subjected to appropriate selection by spraying after an initial growth period. Furthermore, seeds can be grown on agar plates with appropriate selection agents, after sterilization if appropriate, so that only transformed seeds can develop into plants. Alternatively, if no selection is performed, seeds can be planted and Sl7-DR2 activity levels or 7-DHC levels can be measured at appropriate times using standard techniques in the art. This alternative method, which avoids the introduction of transgenes, is preferred for producing transgene-free plants.

[0038] Following DNA transfer and regeneration, putatively transformed plants may also be evaluated to detect the presence of mutations of interest, copy number and / or genomic alterations, for example using PCR. Alternatively or additionally, integration and expression levels of the newly introduced DNA may be monitored using Southern, Northern and / or Western analysis, all techniques well known to those of ordinary skill in the art.

[0039] The method may further include selecting one or more mutant plants, preferably for further propagation. The selected plants may be propagated by various means, such as by clonal propagation or classical breeding techniques. For example, the first generation (or T1) transformed plants may be self-pollinated, homozygous second generation (or T2) transformants may be selected, and then the T2 plants may be further propagated using classical breeding techniques. The generated transformed organisms may take various forms. For example, they may be chimeras of transformed and non-transformed cells; clonal transformants (e.g., cells all transformed to contain the expression cassette); grafts of transformed and non-transformed tissues (e.g., in plants, transformed rootstock grafted onto non-transformed shoots). EXAMPLES

[0040] Provitamin D3 / 7-DHC has been identified in tomato leaves, but does not normally accumulate in the fruit, where it acts as an intermediate in the formation of SGA; tomatine in green fruit and esculoside in ripe fruit. 16 Recently, it has been shown that a dual pathway involving several specific isoforms of enzymes more generally involved in plant sterol and brassinosteroid biosynthesis produces cholesterol for SGA formation and can be used in Solanaceae species, including tomato (Ref. 17, Fig. 1a). This partial separation of sterol and cholesterol biosynthesis in solanaceous plants allows metabolic flexibility for the synthesis of important hormones (brassinosteroids) as well as the more specialized stress chemicals of plants, SGAs, which have fungicidal, antimicrobial, and insecticidal properties. The presence of this "dual" pathway for cholesterol and SGA biosynthesis in tomato makes the manipulation of provitamin D3 / 7-DHC relatively simple. A specific isoform of 7-dehydrocholesterol reductase (Sl7-DR2) converts provitamin D3 / 7-DHC to cholesterol for the synthesis of tomatine in leaves and fruits (Fig. 1a). As a result, inhibiting the activity of Sl7-DR2 in tomato could result in the accumulation of 7-DHC without any effect on plant sterol and brassinosteroid biosynthesis. We tested the effect of blocking Sl7-DR2 activity on increasing 7-DHC levels in tomato by generating a knockout of Sl7-DR2 using CRISPR / Cas9 genome editing. Two sgRNAs were designed against sequences in the second exon of the gene encoding the Sl7-DR2 protein, taking care to minimize any homology between the sgRNAs and the Sl7-DR1 gene (Fig. 1b). We recovered five independent knockout alleles of the Sl7-DR2 gene in the T1 generation, three of which carried identical deletions of 108 bp of the exon 2 sequence between the two sgRNAs. The other two knockout alleles were generated by a 2 bp deletion with a 1 bp insertion in the second exon or by only a 1 bp insertion, both of which were expected to cause a frameshift and prematurely terminate the Sl7-DR2 protein (Fig. 1b). Homozygous knockout alleles were recovered in the T1 generation, and homozygous knockout lines lacking the T-DNA carrying the Cas9 gene and sgRNA sequences were recovered for four of the five lines in the T2 generation.

[0041] In the T2 generation, five independently derived homozygous knockout alleles of Sl7-DR2, four lacking the CRISPR / Cas9 T-DNA, were selected after segregation. No off-target editing of the 7-DR1 gene was detected in these mutant lines. Fruits and leaves at different maturity stages were analyzed for 7-DHC content and levels of other plant sterols, cholesterol and SGA. Sterol and provitamin D3 profiles of edited and control wild-type tomato plants were determined using LC-MS. 16、18 .

[0042] Loss of Sl7-DR2 activity had no effect on growth or development of tomato lines (Figure 3a), in contrast to the phenotype of a loss-of-function mutation in an equivalent gene involved in phytosterol biosynthesis (DWARF5) in Arabidopsis, which is dwarfed due to inhibition of brassinosteroid biosynthesis. 19 The lack of effect of the Sl7-DR2 mutation on plant sterol metabolism was confirmed by comparing the levels of stigmasterol, the end product of the plant sterol pathway in tomato, in leaves of wild-type and edited lines (Figure 3b). In wild-type control plants, 7-DHC was only detected in immature green fruits and was undetectable in ripening and mature fruits. In contrast, Sl7-DR2 activity deletion caused a substantial increase in provitamin D3 / 7-DHC levels in leaves and green fruits (Figures 1c and 1d). Although 7-DHC levels were lower in mature fruits of the Sl7-DR2 mutant, they remained high enough that, if proportionally converted to vitamin D3 (e.g., by treatment with UV-B light), consumption of one or two tomatoes could provide an amount of vitamin D3 equivalent to the RDA for dietary supplementation (10 μg / day). In older adults, where 7-DHC levels are reduced, deficiency can also be addressed by consuming fruits biofortified with provitamin D3 / 7-DHC.

[0043] MALDI images showed that increased provitamin D3 / 7-DHC was distributed in both the tomato flesh and skin (Fig. 2a, 3c). Tomatine and dehydrotomatine are degraded to esculoside A and B during fruit ripening, which means that tomatine is reduced to low levels in the mature fruit. 20 MALDI images of mutant and wild-type green fruits showed that α-tomatine was lower in the Sl7-DR2 mutant than in the control (Fig. 2a, 3c, d), and leaf analysis showed substantially lower levels in the mutant, but α-tomatine was not eliminated (Fig. 2b). A strong reduction in the levels of SGA, esculoside A, was also observed in mature fruits of the mutant compared to the control line (Fig. 2c). These reductions could be considered beneficial, since SGA has been reported to be a toxic substance / antinutritional agent and may cause allergies in consumers. Interestingly, cholesterol levels in leaves or fruits were not reduced compared to the control, and in most mutant lines, cholesterol levels were higher than in the wild-type control, both in fruits (Fig. 2a, 3e) and leaves (Fig. 2d). This suggested that the block in flux along the SGA biosynthetic pathway could be compensated for by an increased flux of intermediates catalyzed by enzymes of the phytosterol pathway (or at least Sl7-DR1) to replenish cholesterol production and limit the decrease in SGA accumulation. However, this was not accompanied by compensatory changes in the expression of genes encoding enzymes in either pathway, as shown by qRT-PCR analysis of these genes in leaves of WT and mutant lines (Figure 4a). The only gene showing a consistent change in transcript level in the mutant compared to the wild type was SlC5-SD1 in the phytosterol pathway, which showed consistently lower transcript levels, about 30%, than in the control (Figure 1a, Figure 4b).

[0044] To determine whether the elevated levels of 7-DHC in Sl7-DR2 mutant plants were convertible to vitamin D3, we followed the method described by Japelt et al. 18Leaves and sliced ​​fruits were treated with 1 h of irradiation with UV-B light as described by. Leaf treatment was very effective for this conversion, resulting in a vitamin D3 yield of almost 200 μg per g dry weight (Figure 2e). Vitamin D3 yields from green fruits were lower, reaching about 0.3 μg per g dry weight, and even lower in red fruits, averaging about 0.2 μg per g dry weight. These lower values ​​in fruits reflected a reduced content of 7-DHC precursor in green and red mature fruits compared to leaves (Figure 2e). However, considering that a medium-sized tomato has a dry weight of about 8-10 g, the levels of vitamin D3 achievable in single Sl7-DR2 mutant green fruits are close to 30% and 20% of the RDA for red fruits in the United States and European countries (10-15 μg / day). Clearly, it would be desirable to further enhance 7-DHC levels in mature fruits. The conversion of provitamin D3 to vitamin D3 can be enhanced by sun-drying the tomatoes.

[0045] The dual pathway of cholesterol / SGA biosynthesis is also present in other food crops of the Solanaceae family, including eggplant (Solanum melongena), potato (Solanum tuberosum) and pepper (Capsicum annuum). 17 The close link between cholesterol / SGA biosynthesis, 7-DHC accumulation and photosynthesis in tomato leaves and green fruits (Fig. 1c-d, Fig. 2b-d, Fig. 3d-e) suggests that knocking out Sl7-DR2 activity in peppers, whose fruits may be green when eaten, may provide an additional effective route to vitamin D3 biofortification of plant-based foods. Furthermore, mutations that increase UV-B light penetration into fresh fruits, such as the y mutation in tomato, which causes loss of UV-protective flavonols from the pericarp of "pink tomatoes", may also provide increased conversion of provitamin D3 to vitamin D3 after UV-B exposure. Such stacking may be achieved by further gene editing or by introgression. 21In addition to enriching fresh fruits with vitamin D3, the leaves of the Sl7-DR2 mutant are a rich source of provitamin D3 and therefore could provide an important novel raw material using waste plant material from tomato cultivation for the production of plant-based vitamin D3 supplements, which would be suitable for vegans.

[0046] method

[0047] plant material Tomato (Solanum lycopersicum) cultivar Money Maker plants and Sl7-DR2 knockout mutants were grown in a greenhouse at the John Innes Centre (Norwich, UK) at an average ambient temperature of 20° C. to 22° C. Supplemental lighting was available to maintain 16 hours of light each day, if required.

[0048] Plasmid construction Two specific target sequences (Figure 1b) in exon 2 of the Sl7-DR2 (Solyc06g074090) gene were selected to generate Sl7-DR2 knockout mutants. These were introduced into the sgRNA scaffold by PCR. To generate the sgRNA expression cassettes, each sgRNA amplicon and a synthetic U6-III promoter (pICSL90001) were cloned into GoldenGate Level 1 acceptors (pICH47732 and pICH47742). A Level 2 binary vector, pICSL002203, containing a Cas9 expression cassette and a kanamycin resistance (nptII) expression cassette was used as the destination vector to generate the Sl7-DR2 CRISPR / Cas9 construct. Plasmids pICSL90001, pICH47732, pICH47742 and pICSL002203 were kindly provided by The Sainsbury Laboratory (TSL) SynBio group (http: / / synbio.tsl.ac.uk / ). Agrobacterium rhizogenes (strain ArATCC15834) 22sgRNA efficiency was tested by co-transformation of tomato with S17-DR2. The sequence of exon 2 of S17-DR2 was amplified by PCR directly from hairy roots with Phire Plant Direct PCR Master Mix (Thermo Fisher Scientific) according to the manufacturer's instructions using primers flanking the sgRNA target sequence, SEQ ID NO:1 (F: TGTTTCACTGGGCTGGTTTAGC) and SEQ ID NO:2 (R: GAGAAGTCTTTCACCATGTCACGA).

[0049] Tomato stable transformation Galdon-Armero et al. (2020) 23 The Sl7-DR2 CRISPR / Cas9 construct was transformed into Agrobacterium tumefaciens (strain AGL1) for stable transformation using cotyledons as the initial explants according to standard transformation protocols as previously reported.

[0050] Screening of Sl7-DR2 knockout lines DNA was isolated from finely ground powder of leaf tissue using the DNeasy® Plant Mini Kit (Qiagen) according to the manufacturer's instructions. Five independent Sl7-DR2 knockout lines were obtained by genotyping with primers flanking the sgRNA target sequence, SEQ ID NO: 3 (F: TGTTTCACTGGGCTGGTTTAGC) and SEQ ID NO: 4 (R: GAGAAGTCTTTCACCATGTCACGA), and confirmed by sequencing.

[0051] Quantitative real-time PCR analysis Total RNA was extracted from tomato leaf tissue using the Trizol method (Sigma-Aldrich). DNase I (Roche) treated RNA was reverse transcribed using SuperScript™ III (Invitrogen). All RT-qPCR reactions were performed using SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma) with the X96 Touch™ Real-Time PCR Detection System (Biorad). Data were analyzed using CFX Maestro software. SlActin (Solyc03g078400) was selected as the housekeeping reference gene. Relative expression of genes was calculated by the ΔCt method. Gene-specific primers were designed using NCBI primer BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ) and are listed in the table below.

[0052] [Table 1] TIFF2024535023000003.tif241166TIFF2024535023000004.tif203168

[0053] MALDI image analysis Dong et al. (2020) 24 Fruit cryosectioning was performed as previously described in. Fresh immature green fruits (approximately 16 days after anthesis) were flash frozen in liquid nitrogen and then embedded on a flat metal holder on dry ice with M1 embedding matrix (Thermo Scientific). The embedded tissue was transferred to a CryoStar NX70 microtome (Thermo Scientific) and thermally equilibrated at -18 °C for at least 3 h. Tissues were cut into 35 μm thick sections and thaw mounted on Superfrost Plus slides (Thermo Scientific) before drying in a desiccator under vacuum.

[0054] Optical images were captured using a Canon 5D Mark IV camera equipped with a Canon MP-E 65mm f / 2.8 1–5x Macro Photo lens (Canon Inc, Ota-ku, Tokyo, Japan) at a 1:1 ratio. Raw image files were processed with Capture One photo editing software (Capture One, Frederiksberg, Denmark).

[0055] Approximately 3 μg mm -2 in 80% methanol / 0.05% TFA to a density of 10 mg ml -1 Sections were covered with 2,5-dihydrobenzoic acid matrix (DHB) using a SunCollect MALDI sprayer (SunChrome, Friedrichsdorf, Germany) containing 100 ml of DHB solution.

[0056] MALDI imaging was performed on a Synapt G2-Si mass spectrometer containing a MALDI source (Waters, Wilmslow, UK) equipped with a 2.5 kHz Nd:YAG laser operating at 355 nm. Slides were fixed in the instrument metal holder and scanned with a flatbed scanner (Canon). Images were used to generate pattern files and acquisition methods in HDImaging software version 1.4 (Waters) with the following parameters: total section approximately 400 mm 2area, low setting (60 μm) laser beam diameter with 105 μm step size, generating approximately 36 k pixels per section, MALDI-MS positive sensitivity mode, m / z 50-1200, scan time 0.5 s, laser repetition rate 1 kHz, laser energy 200. For ion mobility measurements, the same parameters were used in MALDI-HDMS mode with the following additional tune page settings: trapping DC bias: 45.0, transfer wave velocity (m / s): 315, IMS wave height (V): 40.0, variable wave velocity enabled by linear ramp, start wave velocity (m / s): 1500.0, end wave velocity (m / s): 200.0. Red phosphorus cluster and lock mass correction were used for instrument calibration. Total scan time for all sections was 10-12 h, with lock mass acquired for 2 s every 10 min.

[0057] MS raw files were processed in HDI1.4 with the following parameters: detection of the 2000 most abundant peaks, m / z window 0.05, MS resolution 10,000, lock mass 526.554 (red phosphorus cluster). Processed data were loaded into HDI1.4 and normalized by total ion content (TIC). Images were generated using the HotMetal2 color scale and exported as png image files. For comparison and generation of average spectra, MS raw data were converted to imzml and analyzed using Scils Lab MVS software version 2021c Premium 3D (SCiLS, Bruker Daltonik GmbH, Bremen, Germany).

[0058] The compounds of interest, 7-dehydrocholesterol, cholesterol and alpha-tomatine, were identified by comparing drift times and masses of authentic standards analyzed on the same instrument. The masses detected during MALDI for 7-dehydrocholesterol, vitamin D3 and cholesterol are listed in the table below. Cholesterol is susceptible to laser-induced oxidation during MALDI-TOF mass spectrometry. 25 , 7-dehydrocholesterol has an even higher tendency for nonenzymatic autooxidation 26、27Among the standard peaks generated during MALDI, taking into consideration their specificity and relative abundance, 367.33, 365.32, and 363.31 are selected as representative masses of 7-dehydrocholesterol, and 369.35 and 1034.55 are selected as representative masses of cholesterol and α-tomatine, respectively.

[0059] [Table 2]

[0060] * cholcal: cholecalciferol, vitamin D3; 7dh: 7-dehydrocholesterol (7-DHC); chol: cholesterol.

[0061] Sterol Analysis The method for sterol extraction and analysis was described by Jaepelt et al. (2011) 16 The freeze-dried material (approximately 20 mg) was weighed into a 2 mL Eppendorf tube and mixed with 100 μL of 60% potassium hydroxide (Sigma-Aldrich), 500 μL of 96% ethanol (Sigma-Aldrich) and 300 μL of 15% ascorbic acid (Sigma-Aldrich). The tube was shaken in a thermoshaker (Eppendorf) at 22 °C for approximately 18 h. 750 μL of 20% ethyl acetate (v / v) in pentane was added and shaken for 30 min on a flat shaker, followed by centrifugation at 2000 x g for 5 min at room temperature. The organic layer was transferred to a new 2 ml Eppendorf tube. The extraction process was repeated twice. The total extract was diluted with 500 μL of 0.1 mol L 2SO4 by inverting the tube 30 times. -1The alkali was completely removed by washing with hydrochloric acid. The upper layer was transferred to a 2 mL Eppendorf tube and then centrifuged at 1000 x g for 2 min. The total extract was evaporated to dryness using a Genevac EZ-2 Elite evaporator with the program "Very Low BP Mix". The residue was finally redissolved in 200 μL methanol and filtered through a 0.22 μm nylon Corning® Costar® Spin-X® tube filter (Sigma-Aldrich). Samples were stored at -80°C until analysis.

[0062] Sterol compounds were identified and quantified by comparing the retention times and mass spectrometry spectra of authentic standards analyzed on the same instrument: 7-dehydrocholesterol, vitamin D3, cholesterol, stigmasterol (Sigma-Aldrich). Liquid chromatographic analysis was performed on a Dionex UltimMate (Thermo Fisher Scientific) equipped with a thermostatted column compartment. Flow rate was 0.6 mL min -1Chromatographic separation was performed on a 50x2.1mm 2.6μ Kinetex F5 column (Phenomenex) at 4°C. Solvent was 0.2% formic acid and 25% acetonitrile (v / v) in Milli-Q water (A) vs. 100% methanol (B). The gradient program was as follows: 60% B for 0.5 min, linear gradient to 85% B for 7 min, linear gradient to 100% B for 0.5 min, isocratic elution for 1 min, and linear gradient back to 60% B for 0.5 min and re-equilibration for 3.5 min, total run time 13 min. The column was maintained at 40°C. 5 μL of sample was injected. Mass analysis was performed using a Q Exactive Orbitrap mass spectrometer (Thermo Scientific) equipped with an atmospheric pressure chemical ionization (APCI) source. The MS was set to collect data-dependent MS2 of the top 4 ions with a full scan of 70,000 resolution from m / z 180-2000, and an ionization width of m / z 4.0, 30% normalized collision energy. These ions were then ignored for 5 seconds to select the next most abundant ion; isotopic peaks were also ignored. Data-dependent MS2 analysis was at 17,500 resolution, 50 msec maximum ion time, and an automatic acquisition control target of 1x105 ions. MS scans had a 50 msec maximum ion time, and an automatic acquisition control target of 30x106 ions. Spray chamber conditions were 231 °C capillary temperature, 21.25 units sheath gas, 5 units auxiliary gas, no spare gas, 4 μA current, 363 °C probe heater temperature, 50 V S-lens RF. Xcalibur software (version 4.3, Thermo Scientific) was used for instrument control and data acquisition.

[0063] SGA analysis Itkin et al. (2011) 28SGA extraction was performed as described by. Briefly, 20 mg of freeze-dried sample (leaves or fruits) was sonicated in 1 mL of 100% methanol, incubated on ice for 1 h, and centrifuged at 4000 rpm for 10 min. The supernatant was collected, centrifuged at 4000 rpm for 3 min, and filtered through a 0.22 μ filter. Sample extracts were stored at -80 °C until analysis. α-Tomatine was identified and quantified by comparison of retention time and mass spectrometry spectrum to an authentic standard (Sigma-Aldrich). Esculeoside A was identified based on the mass spectrometry spectrum compared to previously published spectra and relative retention time (Itkin et al. 2011).

[0064] 0.6mL min -1 Chromatographic separation was performed on a 50×2.1 mm 2.6μ Kinetex EVO C18 column (Phenomenex) at a flow rate of 1000 s. The solvent was 0.1% formic acid (v / v) in Milli-Q water (A) vs. 100% acetonitrile (B). The gradient program was as follows: 4 min linear gradient from 2% B to 40% B, then 2 min linear gradient to 95% B, 1 min isocratic elution and 0.1 min linear gradient back to 2% B and 2.1 min re-equilibration, total run time 9.2 min. Mass spectrometry was performed using a Q Exactive Orbitrap mass spectrometer (Thermo Scientific) equipped with an electrospray ionization (ESI) source. All other settings were the same as described above for sterol analysis.

[0065] UV treatment Fruits were cut into 1 mm slices before UV exposure. Leaf or fruit tissues were exposed to UV-B light (3.2 mW cm-2) for 1 h, 20 cm under an inverted short-wavelength transilluminator. After treatment, samples were immediately frozen in liquid nitrogen for the following analyses.

[0066] statistical analysis All experiments herein were independently repeated at least three times, and results from a representative data set are shown. All values ​​are presented as mean ± sem. GraphPad Prism (version 9.2.0) was used for statistical analysis. Statistical differences between wild type and mutants were performed using two-tailed Student's t-test. References: TIFF2024535023000006.tif165163TIFF2024535023000007.tif162161

Claims

1. 1. A method for improving provitamin D3 levels in a plant, the method comprising reducing the activity of 7-dehydrocholesterol reductase (7-DR) in the plant.

2. 2. The method of claim 1, wherein said method comprises introducing one or more mutations that reduce said activity of the enzyme encoded by said 7-DR gene in said plant.

3. 3. The method of claim 2, wherein the plant genome comprises a duplication of the 7-DR gene and the one or more mutations are introduced into the 7-DR2 gene.

4. 3. The method of claim 2, further comprising breeding the mutant plant to obtain a plant that is homozygous for the mutation.

5. 10. The method of claim 1, wherein post-transcriptional techniques are used to reduce or eliminate enzymatic activity.

6. 10. The method of claim 1, further comprising exposing the plant or plant part to UV-B radiation.

7. The method of claim 1, wherein the plant possesses a mutation that increases the penetration of UV-B light into the fruit.

8. 10. The method of claim 1, further comprising processing the plant or plant part to obtain 7-DHC and / or vitamin D3.

9. A genetically modified plant, part thereof or plant cell having reduced activity of 7-dehydrocholesterol reductase.

10. 10. The plant, part thereof or plant cell of claim 9, comprising a loss-of-function mutation in the 7-DR gene.

11. 11. The plant, part thereof or plant cell of claim 10, wherein the loss-of-function mutation is in the 7-DR2 gene.

12. 12. The method of any one of claims 1 to 8, or the plant, part thereof or plant cell of any one of claims 9 to 11, wherein the plant is a member of the Solanaceae family, more preferably a Solanum species, most preferably selected from tomato (Solanum lycopersicum), potato (Solanum tuberosum) and eggplant (Solanum melongena).

13. A food product produced from a plant or plant part according to any one of claims 9 to 11.