Reducing the expression of SARM1 for use in cell therapy

Abstract

The present invention relates to methods for adoptive immune cell therapy or prevention comprising administering SARM1-inhibited or SARM1-inactivated cells to a subject suffering from, or determined to be at risk of suffering from, cancer, an infection, disease or disorder.

Description

[Technical field]

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 284,995, filed December 1, 2021, the contents of which are incorporated herein by reference.

[0002] Throughout this application, various publications are referenced, including those referenced in parentheses. The disclosures of all publications mentioned in their entirety in this application are incorporated by reference into this application to provide a description of additional features in the art to which this invention pertains and which may be used in conjunction with this invention.

[0003] Reference to sequence listing This application incorporates by reference the nucleotide sequences present in the file entitled "221201_91818-A-PCT_Sequence_Listing_AWG.xml", which is 11,660 kb in size, was created on December 1, 2022 in IBM-PC machine format with MS-Windows® system compatibility, and is included as part of this application in the xml file filed on December 1, 2022. [Background technology]

[0004] Immunotherapies such as CAR T cell therapy offer a promising approach to treat several diseases and disorders. However, to make such therapies more effective, it is highly desirable to develop allogeneic adoptive transfer strategies that increase the persistence of engineered cells after transfer into patients. Summary of the Invention

[0005] The SARM1 (sterile alpha and TIR motif-containing 1) gene is an NAD+ hydrolase that acts as a negative regulator of the MYD88- and TRIF-dependent toll-like receptor signaling pathway by promoting Wallerian degeneration, an injury-induced form of programmed cell death. SARM1 can also activate cell death in response to stress (Molday et al., 2013).

[0006] The present invention discloses an approach to knock out, knock down or inhibit expression of the SARM1 gene in engineered immune cells to increase their persistence, proliferation and / or retention during cell therapy. Thus, biallelic knock out, knock down or inhibition of expression of the SARM1 gene in cells relevant for cell therapy as described herein may be utilized to improve cell therapy approaches, including cell therapy approaches for the treatment of cancer.

[0007] The disclosure also provides methods for adoptive immune cell therapy or prevention, comprising administering SARM1-inhibited or SARM1-inactivated cells to a subject suffering from, or determined to be at risk for, a cancer, infection, disease, or disorder. In some embodiments, the cells are immune cells (e.g., lymphocytes, monocytes, or macrophages). In some embodiments, the SARM1-inhibited immune cells are autologous. In other embodiments, the SARM1-inhibited immune cells are allogeneic. [Brief description of the drawings]

[0008] [Figure 1A-1B]Screening of the activity of RNA guide molecules targeting SARM1 in HeLa cells. Cells were harvested 72 hours after DNA transfection. Genomic DNA was extracted and subjected to capillary electrophoresis after amplification of the endogenous genomic region using on-target primers. The graph shows the mean ± standard deviation (STDV) of the percentage of editing (%) in three independent experiments. Figure 1A: SpCas9 coding plasmid was co-transfected with a plasmid expressing the indicated RNA guide molecule. Figure 1B: OMNI-50 or OMNI-79 CRISPR nuclease was co-transfected with the indicated RNA guide molecule. [Diagram 2] SpCas9 nuclease RNPs complexed with specific RNA guide molecules were electroporated into Neuro-2a cells to determine RNP activity. Cells were harvested 72 hours after DNA electroporation, genomic DNA was extracted, and then analyzed by next-generation sequencing (NGS). Graphs show the percentage of editing ± STDV in two independent electroporations. [Diagram 3] Relative amount of SARM1 RNA after editing. Neuro-2a cells were harvested 7 days after electroporation, RNA was extracted and reverse transcribed. Relative amount of SARM1 RNA was quantified using the AriaMx system. mRNA levels are quantified relative to untreated cells that did not undergo editing. [Figure 4] Editing activity of OMNI-103 CRISPR nuclease with RNA guide molecules targeting SARM1 in HeLa cells. Specific RNA guide molecules were co-transfected with OMNI-103 CRISPR nuclease to determine their on-target activity. Cells were harvested 72 hours after DNA transfection, genomic DNA was extracted, and the region of mutation was amplified and analyzed by NGS. Transfection efficiency was measured by mCherry fluorescence. Graph shows percentage of editing ± STDV in three independent transfections. [Diagram 5] Diagram of the SARM1 pathway. [Figure 6A]SARM1 editing and NGS results. [Figure 6B] Killing assay. [Figure 6C] Viability (ATPlite) assay. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0009] Detailed Description Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described in this specification can be used in the practice or testing of embodiments of the present invention, representative methods and / or materials are described below. In case of conflict, this specification, including definitions, will control. Additionally, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

[0010] In this specification, the term "a" or "an" is understood to refer to "one or more" of the listed components. It will be apparent to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Thus, the terms "a" or "an" and "at least one" have the same meaning in this application.

[0011] For the purpose of better understanding the present teachings, and without in any way limiting the scope of the teachings, unless otherwise indicated, all numbers and other numerical values ​​expressing quantities, percentages or proportions used in this specification and claims are understood to be modified in all instances by the term "about." Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations and may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should be construed in light of at least the number of reported significant digits and by applying ordinary rounding techniques.

[0012] Unless otherwise stated, adjectives such as "substantially" and "about" modifying a condition or relationship characterizing an embodiment of the invention are understood to mean that the condition or characteristic is defined to the extent that tolerance is acceptable in the operation of the embodiment for its intended application. Unless otherwise indicated, the word "or" in this specification and claims is considered to be an inclusive "or" rather than an exclusive "or" and indicates at least one or any combination of the items it conjoins.

[0013] In the description and claims of this application, the verbs "comprise," "include," and "have," and their conjugations, are used to indicate that the object of the verb is not necessarily a complete recitation of the components, elements, or parts of the subject of the verb. Other terms in this specification are intended to be defined by their known meanings in the art.

[0014] In some embodiments of the present invention, DNA nucleases are used to cleave DNA at target sites, inducing cellular repair mechanisms, including but not limited to non-homologous end joining (NHEJ). In classical NHEJ, the two ends of a double-strand break (DSB) site are rapidly but imprecisely joined (i.e., DNA mutations of small insertions or deletions at the break site are often generated).

[0015] As used herein, the term "modified cell" or "modified cell" refers to a cell in which a complex of an RNA molecule and a CRISPR nuclease makes a double-stranded break as a result of hybridization with a target sequence, i.e., on-target hybridization.

[0016] In this specification, the term "targeting sequence" or "targeting molecule" refers to a base sequence that can hybridize with a specific target sequence or a molecule that includes the base sequence, for example, a targeting sequence has a base sequence that is at least partially complementary to the sequence to be targeted. The targeting sequence or targeting molecule may be a part of an RNA molecule that can form a complex with CRISPR nuclease, alone or in combination with other RNA molecules, and the targeting sequence serves as the targeting portion of the CRISPR complex. When a molecule with a targeting sequence is present simultaneously with a CRISPR molecule, the RNA molecule, alone or in combination with one or more other RNA molecules (e.g., tracrRNA molecules), can direct the CRISPR nuclease to a specific target sequence. As a non-limiting example, the guide sequence portion of a CRISPR RNA molecule or a single guide RNA molecule may serve as a targeting molecule. Each possibility is a separate aspect of this invention. The targeting sequence can be custom designed to target a desired sequence.

[0017] In this specification, the term "targeting" or "directing" refers to preferentially hybridizing the targeting sequence of a targeting molecule to the nucleic acid having the target base sequence. The term "targeting" encompasses varying hybridization efficiency, and thus, the nucleic acid having the target base sequence is preferentially targeted, but it is understood that in addition to on-target hybridization, unintended off-target hybridization may also occur. When an RNA molecule targets a sequence, it is understood that the complex of the RNA molecule and the CRISPR nuclease molecule targets that sequence for nuclease activity.

[0018] The "guide sequence portion" of an RNA molecule refers to a base sequence that can hybridize to a specific target DNA sequence, for example, the guide sequence portion has a base sequence that is partially or completely complementary to the target DNA sequence along the guide sequence portion. In some embodiments, the length of the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides, or about 17-50, 17-49, 17-48, 17-47, 17-46, 17-45, 17-44, 17-43, 17-42, 17-41, 17-40 nucleotides. , 17-39, 17-38, 17-37, 17-36, 17-35, 17-34, 17-33, 17-31, 17-30, 17-29, 17-28, 17-27, 17-26, 17-25, 17-24, 17-22, 17-21, 18-25, 18-24, 18-23, 18-22, 18-21, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-22, 18-20, 20-21, 21-22, or 17-20. In some embodiments, the entire length of the guide sequence portion is completely complementary to the targeted DNA sequence along the guide sequence portion. The guide sequence portion may be a part of an RNA molecule that can form a complex with a CRISPR nuclease, with the guide sequence portion serving as the DNA targeting portion of the CRISPR complex. When an RNA molecule having a guide sequence portion is present simultaneously with a CRISPR molecule, alone or in combination with one or more other RNA molecules (e.g., tracrRNA molecules), the RNA molecule can direct the CRISPR nuclease to a specific target DNA sequence. Thus, a CRISPR complex can be formed by directly binding an RNA molecule having a guide sequence portion to a CRISPR nuclease, or by binding an RNA molecule having a guide sequence portion to one or more RNA molecules to a CRISPR nuclease. Each possibility is a separate aspect of this invention. The guide sequence portion can be custom designed to target a desired sequence. Thus, a molecule that includes a "guide sequence portion" is a type of targeting molecule.In some embodiments, the guide sequence portion comprises a sequence identical to a guide sequence portion described herein, e.g., a guide sequence set forth in any of SEQ ID NOs: 1-13457, or a sequence that differs by no more than 1, 2, 3, 4, or 5 nucleotides. Each possibility is a separate embodiment of this invention. In some of these embodiments, the guide sequence portion comprises a sequence identical to a sequence set forth in any of SEQ ID NOs: 1-13457. Throughout this application, the terms "guide molecule," "RNA guide molecule," "guide RNA molecule," and "gRNA molecule" are synonymous with a molecule that comprises a guide sequence portion.

[0019] As used herein, the term "non-discriminatory" refers to the guide sequence portion of an RNA molecule that targets a specific DNA sequence that is common to all alleles of a gene.

[0020] In some embodiments of the present invention, the RNA molecule targeting SARM1 comprises a guide sequence portion of 17-50 contiguous nucleotides of any one of the sequences set forth in SEQ ID NOs: 1-13457. The RNA molecule and / or the guide sequence portion of the RNA molecule may have modified nucleotides. Exemplary modifications to nucleotides / polynucleotides may be synthetic and may include polynucleotides having nucleotides containing bases other than naturally occurring adenine, cytosine, thymine, uracil or guanine bases. Modifications to polynucleotides include polynucleotides having synthetic, non-naturally occurring nucleosides, such as locked nucleic acids. Polynucleotides may be modified to increase or decrease the stability of the RNA. An example of a modified polynucleotide is an mRNA with 1-methylpseudouridine. For examples of modified polynucleotides and their uses, see U.S. Pat. No. 8,278,036, WO 2015 / 006747, and Weissman and Kariko (2015), which are incorporated herein by reference.

[0021] As used herein, "contiguous... nucleotides" in a SEQ ID NO: refers to the nucleotides of the sequence in the order set forth in the SEQ ID NO:, without any intervening nucleotides.

[0022] In some embodiments of the present invention, the guide sequence portion of the RNA molecule targeting SARM1 may be 50 nucleotides in length and may contain 20-22 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 1-13457. In some embodiments of the present invention, the guide sequence portion may be less than 22 nucleotides in length. For example, in some embodiments of the present invention, the guide sequence portion may be 17, 18, 19, 20 or 21 nucleotides in length. In such embodiments, the guide sequence portion may consist of 17, 18, 19, 20 or 21 nucleotides, respectively, of the 17-22 consecutive nucleotide sequence shown in any one of SEQ ID NOs: 1-13457. For example, the guide sequence portion of the 17 consecutive nucleotide sequence shown in SEQ ID NO: 13458 may consist of any one of the following base sequences (nucleotides excluded from the consecutive sequence are crossed out):

[0023] [ka]

[0024] In some embodiments of the invention, the guide sequence portion may be greater than 20 nucleotides in length. For example, in some embodiments of the invention, the guide sequence portion may be 21, 22, 23, 24, or 25 nucleotides in length. In such embodiments, the guide sequence portion comprises 17-50 nucleotides that contain a sequence of 20, 21, or 22 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-13457, and nucleotides that are fully complementary to (a sequence of) nucleotides adjacent to the 3' end, 5' end, or both, of the target sequence.

[0025] In some embodiments of the present invention, the CRISPR nuclease and the RNA molecule comprising the guide sequence portion form a CRISPR complex that binds to and cleaves the target DNA sequence. The CRISPR nuclease, for example, Cpf1, may form a CRISPR complex comprising the CRISPR nuclease and the RNA molecule without an additional tracrRNA molecule. Alternatively, the CRISPR nuclease, for example, Cas9, may form a CRISPR complex between the CRISPR nuclease, the RNA molecule, and the tracrRNA molecule. The guide sequence portion comprising a base sequence capable of hybridizing with a specific target DNA sequence and the sequence portion involved in CRISPR nuclease binding, for example, the tracrRNA sequence portion, may be present in the same RNA molecule. Alternatively, the guide sequence portion may be present in one RNA molecule, and the sequence portion involved in CRISPR nuclease binding, for example, the tracrRNA portion, may be present in another RNA molecule. A single RNA molecule comprising a guide sequence portion (e.g., a DNA-targeting RNA sequence) and at least one CRISPR protein-binding RNA sequence portion (e.g., a tracrRNA sequence portion) can form a complex with a CRISPR nuclease and act as a DNA-targeting molecule. In some embodiments, a first RNA molecule comprising a DNA-targeting RNA portion including a guide sequence portion and a second RNA molecule comprising a CRISPR protein-binding RNA sequence interact by base pairing to form an RNA complex that targets the CRISPR nuclease to the DNA target site, or fuse to form an RNA molecule that complexes with the CRISPR nuclease and targets the CRISPR nuclease to the DNA target site.

[0026] In some embodiments of the invention, the RNA molecule comprising the guide sequence portion may further comprise the sequence of a tracrRNA molecule. Such embodiments may be designed as a synthetic fusion of the guide portion of the RNA molecule with a transactivating crRNA (tracrRNA). (See Jinek et al., 2012). In such embodiments, the RNA molecule is a single guide RNA (sgRNA) molecule. Some embodiments of the invention may also form a CRISPR complex utilizing individual tracrRNA molecules and individual RNA molecules comprising the guide sequence portion. In such embodiments, the tracrRNA may hybridize with the RNA molecule via base pairing, which may be advantageous in certain applications of the invention described herein.

[0027] The term "tracr mate sequence" refers to a sequence that is sufficiently complementary to the tracrRNA molecule to hybridize with the tracrRNA through base pairing and promote the formation of a CRISPR complex (see U.S. Patent No. 8,906,616). In some embodiments of the present invention, the RNA molecule may further comprise a portion having a tracr mate sequence.

[0028] In the present invention, a "gene" includes a DNA region that codes for a gene product and all DNA regions that control the production of the gene product, whether or not the control sequence is contiguous with the coding and / or transcribed sequence. Thus, genes include, but are not necessarily limited to, promoter sequences, terminators, translation control sequences, such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites, and locus control regions.

[0029] "Eukaryotic" cells include, but are not limited to, fungal cells (eg, yeast), plant cells, animal cells, mammalian cells and human cells.

[0030] In this specification, the term "nuclease" refers to an enzyme capable of cleaving phosphodiester bonds between nucleotide subunits of nucleic acids. Nucleases may be isolated from natural sources or derived from natural sources. Natural sources may be living organisms. Alternatively, nucleases may be modified or synthetic proteins that retain phosphodiester bond cleavage activity. Genetic modification can be achieved using nucleases, such as CRISPR nucleases.

[0031] Any one or combination of strategies to reduce or inactivate SARM1 expression in cells for use in cell therapy may be used in this invention.

[0032] In some aspects of the invention, methods are provided for adoptive immune cell therapy or prophylaxis comprising administering SARM1-inhibited or SARM1-inactivated cells to a subject suffering from, or determined to be at risk of suffering from, cancer, an infectious disease, disease or disorder.

[0033] In some aspects, the SARM1-inhibited or SARM1-inactivated cells have been modified to reduce or inactivate expression of SARM1, or the cells have been modified to express a dominant-negative SARM1 sequence variant or a dominant-negative fragment thereof.

[0034] In some embodiments, the cells are selected from the group consisting of hematopoietic stem cells (HSC), induced pluripotent stem cells (iPS cells), iPS-derived cells, natural killer cells (NK), iPS-derived NK cells (iNK), T cells, innate immune-like T cells (iT), natural killer T cells (NKT), gamma delta T cells, iPS-derived T cells, invariant NKT cells (iNKT), iPS-derived NKT, monocytes, or macrophages. In some embodiments, progenitor cells are first modified and then differentiated to prepare SARM1-inhibited or SARM1-inactivated cells. Alternatively, SARM1-inhibited or SARM1-inactivated cells may be prepared by directly editing cells, such as primary NK cells.

[0035] In some embodiments, SARM1-inhibited or SARM1-inactivated cells exhibit increased functionality as compared to corresponding cells expressing wild-type or unmodified SARM1. In some embodiments, SARM1-inhibited or SARM1-inactivated cells exhibit increased and / or enhanced viability as compared to corresponding cells expressing wild-type or unmodified SARM1. In some embodiments, SARM1-inhibited or SARM1-inactivated cells exhibit enhanced functionality in vivo, such as killing capacity, cytotoxicity, trafficking, localization, persistence and / or proliferation as compared to corresponding cells expressing wild-type or unmodified SARM1.

[0036] In some aspects, SARM1-inhibited or SARM1-inactivated cells exhibit increased functionality, increased survival rate, increased persistence, increased proliferation and / or increased tumor retention in a subject compared to corresponding cells expressing wild-type or unmodified SARM1.

[0037] In some embodiments, the SARM1-inhibited or SARM1-inactivated cells exhibit increased cytotoxicity and / or increased killing activity in a subject compared to corresponding cells expressing wild-type or unmodified SARM1. For example, in some embodiments, the SARM1-inhibited or SARM1-inactivated cells exhibit higher killing activity of a target compared to corresponding cells expressing wild-type or unmodified SARM1.

[0038] In some embodiments, the subject has been determined to have or be at risk for having cancer.

[0039] In some embodiments, the cancer comprises a tumor and / or the cancer is a hematological malignancy.

[0040] In some embodiments, the cancer is selected from the group consisting of quiescent melanoma, metastatic prostate cancer, metastatic breast cancer, triple-negative breast cancer, bladder cancer, brain tumor, esophageal cancer, liver cancer, head and neck cancer, squamous cell lung cancer, non-small cell lung cancer, Merkel cell carcinoma, sarcoma, hepatocellular carcinoma, multiple myeloma, leukemia, non-Hodgkin's lymphoma, lymphoma, B-cell lymphoma, acute myeloid leukemia, pancreatic cancer, colorectal cancer, cervical cancer, gastric cancer, kidney cancer, metastatic renal cell carcinoma, leukemia, ovarian cancer, and malignant glioma.

[0041] In some aspects, SARM1-inhibited or SARM1-inactivated cells are prepared ex vivo or in vitro.

[0042] In some embodiments, the SARM1-inhibited or SARM1-inactivated cells are prepared in vivo.

[0043] In some embodiments, the SARM1-inhibited or SARM1-inactivated cells are prepared from cells obtained from a subject by mobilization and / or apheresis.

[0044] In some embodiments, the cells are obtained from cells obtained from the subject by bone marrow aspirate.

[0045] In some aspects, the cells are stimulated prior to SARM1 inhibition or SARM1 inactivation in the cells.

[0046] In some embodiments, the SARM1-inhibited or SARM1-inactivated cells are grown in culture prior to administration to a subject.

[0047] In some aspects, the SARM1 inhibited or SARM1 inactivated cells are capable of engraftment.

[0048] In some aspects, the SARM1-inhibited or SARM1-inactivated cells are capable of giving rise to progeny cells.

[0049] In some aspects, SARM1-inhibited or SARM1-inactivated cells are capable of giving rise to progeny cells following engraftment.

[0050] In some aspects, the SARM1 inhibited or SARM1 inactivated cells are capable of giving rise to progeny cells following autoengraftment.

[0051] In some aspects, the SARM1 inhibited or SARM1 inactivated cells are capable of giving rise to progeny cells for at least 12 months or at least 24 months after engraftment.

[0052] In some aspects, SARM1-inhibited or SARM1-inactivated cells are prepared by delivering a gapmer, shRNA, siRNA, customized TALEN, meganuclease, zinc finger nuclease, CRISPR nuclease or small molecule inhibitor to the cells.

[0053] In some aspects, an allele of the SARM1 gene in a SARM1-inhibited or SARM1-inactivated cell undergoes an insertion or deletion mutation.

[0054] In some embodiments, the insertion or deletion mutation results in a premature stop codon.

[0055] In some embodiments, the SARM1 inhibited or SARM1 inactivated cells are At least one CRISPR nuclease or a nucleotide molecule encoding a CRISPR nuclease; and An RNA molecule containing a guide sequence portion or a nucleotide molecule encoding an RNA molecule introducing into a cell a composition comprising The method is prepared by a process comprising: The CRISPR nuclease-RNA complex creates a double-stranded break in the SARM1 allele, The guide sequence portion of the RNA molecule comprises 17 to 50 contiguous nucleotides.

[0056] In some embodiments, the guide sequence portion is complementary to a target sequence located between 50 base pairs upstream and 50 base pairs downstream of exon I, exon II, exon III, exon IV, exon V, exon VI, exon VII, exon VIII, or exon IX of the SARM1 gene.

[0057] In some embodiments, the guide sequence portion is complementary to a target sequence located between 30 base pairs upstream and 30 base pairs downstream of an exon of the SARM1 gene; a) the exon is exon I, and the guide sequence portion includes a sequence identical to or differing by 3 nucleotides or less from any of the sequences set forth in SEQ ID NOs: 1 to 56, 301 to 356, 1348 to 2223, 57 to 114, 357 to 414, 2224 to 3095, 115 to 174, 415 to 474, and 3096 to 3963; b) the exon is exon II, and the guide sequence portion contains the same sequence as or a sequence that differs by 3 nucleotides or less from any of the sequences set forth in SEQ ID NOs: 3964 to 7683; c) the exon is exon III, and the guide sequence portion contains the same sequence as or contains a sequence that differs by 3 nucleotides or less from any of the sequences set forth in SEQ ID NOs: 7684 to 8967; d) the exon is exon IV, and the guide sequence portion contains the same sequence as or a sequence that differs by 3 nucleotides or less from any of the sequences set forth in SEQ ID NOs: 8968 to 9525; e) the exon is exon V, and the guide sequence portion contains the same sequence as or contains a sequence that differs by 3 nucleotides or less from any of the sequences set forth in SEQ ID NOs: 9526 to 10947; f) the exon is exon VI, and the guide sequence portion contains the same sequence as or contains a sequence that differs by 3 nucleotides or less from any of the sequences set forth in SEQ ID NOs: 10948 to 11571; g) the exon is exon VII, and the guide sequence portion contains the same sequence as or contains a sequence that differs by 3 nucleotides or less from any of the sequences set forth in SEQ ID NOs: 11572 to 12717; h) the exon is exon VIII, and the guide sequence portion contains the same sequence as or differs by 3 nucleotides or less from any of the sequences set forth in SEQ ID NOs: 12718 to 13455; or i) The exon is exon IX, and the guide sequence portion contains the same sequence as any of SEQ ID NOs: 598 to 1347 or contains a sequence that differs by 3 nucleotides or less.

[0058] In some embodiments, the guide sequence portion comprises 17 to 50 consecutive nucleotides including the nucleotides of the sequence set forth in any one of SEQ ID NOs: 1 to 13457.

[0059] In some aspects, SARM1-inhibited or SARM1-inactivated cells exhibit increased viability and / or increased functionality compared to corresponding cells expressing wild-type or unmodified SARM1.

[0060] In some aspects of the invention, a medicament is provided comprising a SARM1 inhibited or SARM1 inactivated cell for use in treating or preventing cancer, an infection, a disease or a disorder in a subject according to the methods set forth herein. In some aspects, the invention provides a kit for treating or preventing cancer, an infection, a disease or a disorder in a subject, the kit comprising a medicament and instructions for delivering the composition to a subject suffering from, or determined to be at risk for, cancer, an infection, a disease or disorder.

[0061] In some embodiments of the invention, there is provided a method for inactivating an allele of the SARM1 (sterile alpha and toll / interleukin-1 receptor motif-containing 1) gene in a cell, the method comprising: At least one CRISPR nuclease or a nucleotide molecule encoding a CRISPR nuclease; and An RNA molecule containing a guide sequence portion or a nucleotide molecule encoding an RNA molecule introducing into a cell a composition comprising where The CRISPR nuclease-RNA complex creates a double-stranded break in the SARM1 allele, The guide sequence portion comprises 17 to 50 consecutive nucleotides including a nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 13457, The cell is selected from the group consisting of hematopoietic stem cells (HSC), induced pluripotent stem cells (iPS cells), iPS-derived cells, natural killer cells (NK), iPS-derived NK cells (iNK), T cells, innate immune-like T cells (iT), natural killer T cells (NKT), gamma delta T cells, iPS-derived T cells, invariant NKT cells (iNKT), iPS-derived NKT, monocytes, or macrophages; A method is provided.

[0062] In some aspects of the invention, there are provided cells modified by a method for inactivating an allele of a SARM1 gene in a cell, wherein the modified cell comprises at least one inactivated SARM1 allele.

[0063] In some embodiments, the modified cells comprise two inactivated SARM1 alleles. In some embodiments, the modified cells exhibit increased viability and / or increased functionality compared to corresponding cells expressing wild-type or unmodified SARM1. In some embodiments, the increased functionality comprises increased cytotoxicity and / or increased killing capacity.

[0064] In some aspects, the cells are used in adoptive cell therapy or prophylaxis.

[0065] In some aspects, the adoptive cell therapy or prevention is the treatment or prevention of cancer, an infectious disease, a disease or disorder in a subject.

[0066] In some embodiments of the invention, methods are provided for inactivating SARM1 expression in a cell by delivering an RNA molecule that includes a guide sequence portion (e.g., a targeting sequence) that includes a base sequence that is fully or partially complementary to a target sequence that includes a SNP position (REF / SNP sequence) located in or near an allele of the SARM1 gene. In some embodiments, the guide sequence portion of the RNA molecule consists of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or more than 26 nucleotides. In some embodiments, the guide sequence portion is configured to direct a CRISPR nuclease to a target sequence, providing a cleavage event by the CRISPR nuclease complexed therewith selected from a double-stranded cleavage and a single-stranded cleavage within 500, 400, 300, 200, 100, 50, 25, or 10 nucleotides of the SARM1 target site. In some embodiments, the cleavage event allows for nonsense codon-mediated degradation of the SARM1 gene. In some embodiments, the RNA molecule is a guide RNA molecule, such as a crRNA molecule or a single guide RNA molecule.

[0067] In some embodiments, the target sequence of an allele of the SARM1 gene is altered (e.g., by introduction of an NHEJ-mediated indel (e.g., insertion or deletion)) to reduce or eliminate expression of a gene product encoded by the allele of the SARM1 gene. In some embodiments, the reduction or elimination of expression is due to nonsense codon-mediated mRNA decay, such as due to a premature stop codon. In some embodiments, the reduction or elimination of expression is due to expression of a truncated SARM1 gene product. In some embodiments, the guide sequence portion is complementary to a target sequence that includes the SNP position. In some embodiments, the SNP position is rs782593684. In some embodiments, the guide sequence portion includes a sequence that is the same as or differs by no more than 1, 2, or 3 nucleotides from any of SEQ ID NOs: 1-174. In some embodiments, the guide sequence portion comprises the same sequence as, or differs by 1, 2, or 3 nucleotides or less from, any of the sequences set forth in SEQ ID NOs: 1, 4, 8, 20, 24, 26-27, 33, 35, 37, 41, 47, 49, 51, 53, 56, 175-214, 57, 60, 64, 76, 80, 82-83, 92, 94, 98, 102, 105, 107, 109, 111, 114, 215-256, 115, 118, 122, 132, 139, 141-142, 151, 157, 161, 164-165, 167, 169, 171, 174, and 257-300. Each possibility is a separate embodiment of this invention. In some embodiments, the SNP position is 17:28372349_C_CT. In some embodiments, the guide sequence portion comprises a sequence identical to or differing by no more than 1, 2 or 3 nucleotides from any of SEQ ID NOs: 301-474.In some embodiments, the guide sequence portion includes the same sequence as any one of SEQ ID NOs: 301, 304, 315, 321, 326 to 328, 335, 338, 340, 344, 346 to 348, 353, 355 to 356, 475 to 513, 357, 361, 364, 368, 373, 384 to 385, 393, 396, 398, 402, 404 to 406, 411, 413 to 414, 514 to 554, 415 to 416, 419, 422, 424, 427, 432, 443 to 444, 458, 462, 464 to 466, 471, 473 to 474, and 555 to 597, or includes a sequence that differs by 1, 2, or 3 nucleotides or less. Each possibility represents a separate aspect of the present invention.

[0068] In some embodiments of the invention, there is provided an RNA molecule or a sequence encoding an RNA molecule, the RNA molecule comprising a guide sequence portion (e.g., a targeting sequence) that comprises a base sequence that is fully or partially complementary to a target sequence located in or near the SARM1 gene. In some embodiments, the guide sequence portion is complementary to a target sequence located between 30 base pairs upstream and 30 base pairs downstream of exon I, exon II, exon III, exon IV, exon V, exon VI, exon VII, exon VIII, or exon IX of the SARM1 gene. In some embodiments, the guide sequence portion is complementary to a target sequence located between 50 base pairs upstream and 50 base pairs downstream of exon I, exon II, exon III, exon IV, exon V, exon VI, exon VII, exon VIII, or exon IX of the SARM1 gene. Each possibility is a separate embodiment of the invention. In some embodiments, the target sequence of the SARM1 gene is altered (e.g., by introduction of an NHEJ-mediated indel (e.g., insertion or deletion)) to reduce or eliminate expression of a gene product encoded by the SARM1 gene. In some embodiments, the reduced or eliminated expression is due to nonsense codon-mediated mRNA decay. In some embodiments, the guide sequence portion of the RNA molecule consists of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or more than 26 nucleotides. In some embodiments, the guide sequence portion is configured to direct a CRISPR nuclease to the target sequence, providing a cleavage event by the CRISPR nuclease complexed therewith selected from a double-stranded break and a single-stranded break within 500, 400, 300, 200, 100, 50, 25, or 10 nucleotides of the SARM1 target site. In some embodiments, the cleavage event allows for nonsense codon mediated degradation of the SARM1 gene. In some embodiments, the RNA molecule is a guide RNA molecule, such as a crRNA molecule or a single guide RNA molecule.

[0069] In some embodiments, the guide sequence portion is complementary to a target sequence located between 30 base pairs upstream and 30 base pairs downstream of an exon of the SARM1 gene. In some embodiments, the guide sequence portion is complementary to a target sequence located between 50 base pairs upstream and 50 base pairs downstream of an exon of the SARM1 gene. In some embodiments, the guide sequence portion is complementary to a target sequence located between 7 base pairs upstream and 7 base pairs downstream of an exon of the SARM1 gene. In some embodiments, the exon is exon I, and the guide sequence portion includes the same sequence as or differs by 3 nucleotides or less from any of the sequences set forth in SEQ ID NOs: 1-56, 301-356, 1348-2223, 57-114, 357-414, 2224-3095, 115-174, 415-474, and 3096-3963. In some embodiments, the exon is exon II and the guide sequence portion comprises the same sequence as or differs by no more than 3 nucleotides from the sequence set forth in any of SEQ ID NOs: 3964-7683. In some embodiments, the exon is exon III and the guide sequence portion comprises the same sequence as or differs by no more than 3 nucleotides from the sequence set forth in any of SEQ ID NOs: 7684-8967. In some embodiments, the exon is exon IV and the guide sequence portion comprises the same sequence as or differs by no more than 3 nucleotides from the sequence set forth in any of SEQ ID NOs: 8968-9525. In some embodiments, the exon is exon V and the guide sequence portion comprises the same sequence as or differs by no more than 3 nucleotides from the sequence set forth in any of SEQ ID NOs: 9526-10947. In some embodiments, the exon is exon VI and the guide sequence portion comprises the same sequence as or differs by no more than 3 nucleotides from the sequence set forth in any of SEQ ID NOs: 10948-11571. In some embodiments, the exon is exon VII and the guide sequence portion comprises the same sequence as or differs by no more than 3 nucleotides from any of the sequences set forth in SEQ ID NOs: 11572-12717. In some embodiments, the exon is exon VIII and the guide sequence portion comprises the same sequence as or differs by no more than 3 nucleotides from any of the sequences set forth in SEQ ID NOs: 12718-13455.In some embodiments, the exon is exon IX, and the guide sequence portion comprises a sequence identical to or differing by 3 nucleotides or less from any of SEQ ID NOs: 598-1347.

[0070] In an embodiment of the invention, an RNA molecule is used to direct a CRISPR nuclease to an exon or splice site of a SARM1 allele to generate a double-stranded break (DSB), which leads to the insertion or deletion of nucleotides by induction of the error-prone non-homologous end joining (NHEJ) mechanism and the formation of a frameshift mutation in the SARM1 allele. A frameshift mutation can, for example, generate a premature stop codon in the SARM1 allele, inactivate or knock out the SARM1 allele, generate a truncated protein, or cause nonsense codon-mediated mRNA decay of the transcript of the allele. In a further embodiment, an RNA molecule is used to direct a CRISPR nuclease to the promoter of a SARM1 allele.

[0071] The CRISPR compositions used to inactivate the SARM1 allele described herein may include at least one CRISPR nuclease, an RNA molecule, and a tracrRNA molecule, which are effective simultaneously in a subject or cell. At least one CRISPR nuclease, an RNA molecule, and a tracrRNA may be delivered substantially simultaneously, or may be delivered at different times and be effective simultaneously. For example, this includes delivering the CRISPR nuclease to a subject or cell before the RNA molecule and / or the tracrRNA are substantially present in the subject or cell.

[0072] According to some aspects, SARM1-inhibited or SARM1-inactivated cells are provided. In some embodiments, the cells are immune cells (e.g., monocytes, macrophages, lymphocytes, natural killer cells (NK), iPS-derived NK cells (iNK), T cells, innate immune-like T cells (iT), iPS-derived T cells, natural killer T cells (NKT), invariant NKT cells (iNKT), or iPS-derived NKT cells). In some embodiments, the SARM1-inhibited cells are stem cells, HSCs, or iPSc. Each possibility is a separate embodiment of this invention. The SARM1-inhibited or SARM1-inactivated cells (e.g., immune cells) may be prepared by utilizing a suitable SARM1 inhibitor, including peptides, polypeptides, proteins, nucleases, small molecules, or polynucleotides.

[0073] In some embodiments, the SARM1-inhibited or SARM1-inactivated cells are genetically modified to reduce the activity of SARM1. In some embodiments, the SARM1-inhibited or SARM1-inactivated cells are derived from progenitor cells genetically modified to reduce the activity of SARM1. In a non-limiting example, the SARM1-inhibited iNK is derived from iPSCs genetically modified to reduce the activity of SARM1, such as by knocking out the SARM1 allele using CRISPR, and further differentiated into iNK cells.

[0074] In some embodiments, the SARM1 inhibited or SARM1 inactivated cells, or cells derived therefrom, are used for cell therapy, hi some embodiments, the SARM1 inhibited cells, or cells derived therefrom, are used for immunotherapy.

[0075] According to some aspects of the disclosure, the specification provides a method for increasing cell viability and / or cell functionality by inactivating an allele of the SARM1 (sterile alpha and toll / interleukin-1 receptor motif-containing 1) gene in a cell, the method comprising introducing into the cell a composition comprising a CRISPR nuclease or a nucleotide molecule encoding the CRISPR nuclease, and an RNA molecule or a nucleotide molecule encoding the RNA molecule comprising a guide sequence portion of 17 to 50 consecutive nucleotides comprising nucleotides of any one of the sequences set forth in SEQ ID NOs: 1 to 13457, wherein a complex of the CRISPR nuclease and the RNA molecule makes a double-stranded break in the allele of the SARM1 gene. Non-limiting examples of cells that may be modified in this manner include liver cells (e.g., hepatocytes), lung cells, spleen cells, pancreatic cells, colon cells, skin cells, bladder cells, eye cells, ocular cells, retinal cells, corneal cells, brain cells, esophageal cells, head cells, cervical cells, ovarian cells, testicular cells, prostate cells, placental cells, epithelial cells, endothelial cells, adipocytes, kidney / renal cells, cardiac cells, muscle cells, blood cells (e.g., white blood cells), immune cells, central nervous system (CNS) cells, and ganglion cells, as well as combinations thereof.

[0076] SARM1 Editing Strategy The methods provided for knocking out a SARM1 allele in a cell may also be used to prepare SARM1 inactivated cells for use in cell therapy or immunotherapy.

[0077] SARM1 editing strategies include, but are not limited to, (1) biallelic knockout by targeting any one of exons 2-9, or a combination thereof, including within 7 nucleotides upstream and downstream of the exon to flank the splice donor and acceptor sites, where a frameshift in these exons results in a non-functional, truncated SARM1 protein, or nonsense codon-mediated degradation of the mutant SARM1 transcript; and (2) truncation of the SARM1 protein by mediating an indel in exon 1 that is upstream of or overlaps the second methionine codon in the exon, eliminating it to prevent translation reinitiation, or by targeting the exon 1-intron 1 junction to disrupt the splice donor.

[0078] CRISPR nucleases and PAM recognition In some embodiments, the sequence-specific nuclease is selected from a CRISPR nuclease or a functional variant thereof. In some embodiments, the sequence-specific nuclease is an RNA-guided DNA nuclease. In such embodiments, an RNA sequence that guides the RNA-guided DNA nuclease (e.g., Cpf1) binds to the RNA-guided DNA nuclease and / or guides the RNA-guided DNA nuclease to all SARM1 alleles in the cell. In some embodiments, the CRISPR complex does not further comprise a tracrRNA. In a non-limiting example where the RNA-guided DNA nuclease is a CRISPR protein, at least one nucleotide that differs between the dominant SARM1 allele and the functional allele may be present in and / or near a PAM site in the region to which the RNA molecule is designed to hybridize. The skilled artisan will appreciate that the RNA molecule can be engineered to bind to a selected target in the genome by methods commonly known in the art.

[0079] In this specification, the term "PAM" refers to a base sequence of a target DNA that is located near the target DNA sequence and is recognized by a CRISPR nuclease complex. The PAM sequence may vary depending on the type of nuclease. In addition, there are CRISPR nucleases that can target almost any PAM. In some embodiments of the present invention, the CRISPR system utilizes one or more RNA molecules with a guide sequence portion that guides the CRISPR nuclease to the target DNA site by forming Watson-Crick base pairs between the guide sequence portion and the protospacer of the target DNA site next to the protospacer adjacent motif (PAM), which is an additional requirement for target recognition. The CRISPR nuclease then cleaves the target DNA site and creates a double-stranded break in the protospacer. In a non-limiting example, a Type II CRISPR system utilizes a mature crRNA:tracrRNA complex that guides a CRISPR nuclease (e.g., Cas9) to a target DNA by forming Watson-Crick base pairs between the guide sequence portion of the crRNA and a protospacer on the target DNA adjacent to a protospacer adjacent motif (PAM). One of skill in the art will appreciate that the engineered RNA molecules of the present invention are further designed to associate with a target genomic DNA sequence of interest adjacent to a protospacer adjacent motif (PAM), e.g., a PAM that corresponds to a sequence associated with the CRISPR nuclease being utilized.The PAM can be, for example, by way of non-limiting example, NGG or NAG (wherein N is any nucleobase) for Streptococcus pyogenes Cas9 WT (SpCAS9); NNGRRT for Staphylococcus aureus (SaCas9); NNNVRYM for Jejuni Cas9 WT; NGAN or NGNG for SpCas9-VQR variants; NGCG for SpCas9-VRER variants; NGAG for SpCas9-EQR variants; NRRH for SpCas9-NRRH variants (wherein N is any nucleobase, R is A or G, and H is A, C, or T); NRTH for SpCas9-NRTH variants (wherein N is any nucleobase, R is A or G, and H is A, C, or T); SpCas9-NRCH barrier NRCH (where N is any nucleobase, R is A or G, and H is A, C, or T) for the SpG variant of SpCas9; NG (where N is any nucleobase); NG or NA (where N is any nucleobase) for the SpCas9-NG variant of SpCas9; NR, NRN, or NYN (where N is any nucleobase, R is A or G, and Y is C or T) for the SpRY variant of SpCas9; and Streptococcus canis. canis Cas9 variant (ScCas9) is NNG (N is any nucleobase); Staphylococcus aureus SaKKH-Cas9 variant (SaCas9) is NNNRRT (N is any nucleobase and R is A or G); Neisseria meningitidis (NmCas9) is NNNNGATT (N is any nucleobase); Alicyclobacillus acidiphilus Cas12b (AacCas12b) is TTN (N is any nucleobase); or Cpfl is TTTV (V is A, C, or G).The RNA molecules of the present invention are each designed to form a complex with one or more different CRISPR nucleases and to target a base sequence of interest using one or more different PAM sequences corresponding to the CRISPR nucleases.

[0080] In some embodiments, RNA-guided DNA nuclease, for example, CRISPR nuclease, can be used to cause DNA cleavage at desired position in the genome of a cell, either double-stranded or single-stranded in nature.The most commonly used RNA-guided DNA nuclease is from CRISPR system, but other RNA-guided DNA nucleases are also contemplated for use in genome editing compositions and genome editing methods described herein.See, for example, US Patent Application Publication No. 2015 / 0211023 (the entire contents of which are incorporated by reference).

[0081] There are many different CRISPR systems that can be used to practice the present invention. The CRISPR system may be a type I, type II or type III system. Non-limiting examples of suitable CRISPR proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9, Casl0, Casl These include Od, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, Csxl0, Csxl6, CsaX, Csx3, Cszl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cul966.

[0082] In some embodiments, the RNA-guided DNA nuclease is a CRISPR nuclease derived from a type II CRISPR system (e.g., Cas9). CRISPR nucleases have been shown to be effective in the detection and characterization of Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Neisseria meningitidis, Treponema denticola, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridomogenes, and Streptosporangium roseum. roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas species sp.), Crocosphaera watsonii, Cyanothece sp.), Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicellulosiruptor bescii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp.), Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, or any species encoding a CRISPR nuclease with a known PAM sequence. CRISPR nucleases encoded by uncultured bacteria may also be used in the context of the present invention. (See Burstein et al. Nature, 2017). Variants of CRISPR proteins with known PAM sequences, such as SpCas9 D1135E variant, SpCas9 VQR variant, SpCas9 EQR variant, or SpCas9 VRER variant, may also be used in the context of the present invention.

[0083] Thus, RNA-guided DNA nucleases of the CRISPR system, such as Cas9 protein or modified Cas9, or homologs or orthologues of Cas9, or other RNA-guided DNA nucleases belonging to other CRISPR systems, such as Cpf1 and its homologs and orthologues, may be used in the compositions of the invention.Other CRISPR nucleases may also be used, such as those described in WO2020 / 223514 and WO2020 / 223553, the contents of each of which are incorporated by reference.

[0084] In certain embodiments, the CRISPR nuclease may be a "functional derivative" of a naturally occurring Cas protein. A "functional derivative" of a native sequence polypeptide is a compound that has qualitative biological properties in common with the native sequence polypeptide. "Functional derivatives" include, but are not limited to, fragments of the native sequence, and derivatives of native sequence polypeptides and their fragments, provided that they have biological activity in common with the corresponding native sequence polypeptide. The biological activity contemplated herein is the ability to hydrolyze DNA substrates into fragments. The term "derivative" encompasses both amino acid sequence variants of the polypeptide and covalent modifications and fusions thereof. Suitable derivatives of Cas polypeptides or fragments thereof include, but are not limited to, mutants, fusions, and covalent modifications of Cas proteins or fragments thereof. Cas proteins, including Cas proteins or fragments thereof, as well as derivatives of Cas proteins or fragments thereof, may be obtainable from cells or may be chemically synthesized, or may be obtained by a combination of these methods. The cells may be cells that naturally produce a Cas protein, or cells that naturally produce a Cas protein and have been engineered to produce an endogenous Cas protein at a higher expression level, or to produce a Cas protein from an exogenously introduced nucleic acid encoding the same or a different Cas than the endogenous Cas. In some cases, the cells do not naturally produce a Cas protein and have been engineered to produce a Cas protein.

[0085] In some embodiments, the CRISPR nuclease is Cpf1. Cpf1 is a single RNA-guided endonuclease that utilizes a T-rich protospacer adjacent motif. Cpf1 cleaves DNA by staggered DNA double-strand breaks. Two Cpf1 enzymes from Acidaminococcus and Lachnospiraceae have been shown to efficiently edit genomes in human cells (see Zetsche et al., 2015).

[0086] Thus, RNA-guided DNA nucleases of Type II CRISPR systems such as Cas9 protein or modified Cas9 or homologs, orthologs or variants of Cas9, or other RNA-guided DNA nucleases belonging to other CRISPR systems such as Cpf1 and its homologs, orthologs or variants may be used in the present invention.

[0087] In some embodiments, the guide molecule comprises one or more chemical modifications that confer new or improved properties (e.g., stability against degradation, hybridization energy, or binding to RNA-guided DNA nucleases). Suitable chemical modifications include, but are not limited to, modified bases, modified sugars, or modified internucleoside linkages. Non-limiting examples of suitable chemical modifications include 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, 2'-O-methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, dihydrouridine, 2'-O-methylpseudouridine, β,D-galactosylqueosine, 2'-O-methylguanosine, inosine, N6-isopentenyladenosine, 1-methyladenosine, 1-methyladenosine, 1-methylguano ... Chirpseudouridine, 1-methylguanosine, 1-methylinosine, 2,2-dimethylguanosine, 2-methyladenosine, 2-methylguanosine, 3-methylcytidine, 5-methylcytidine, N6-methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-methoxyaminomethyl-2-thiouridine, β,D-mannosylqueuosine, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-Methoxyuridine, 2-methylthio-N6-isopentenyladenosine, N-((9-β-D-ribofuranosyl-2-methylthiopurin-6-yl)carbamoyl)threonine, N-((9-β-D-ribofuranosylpurin-6-yl)N-methylcarbamoyl)threonine, uridine-5-oxyacetic acid-methyl ester, uridine-5-oxyacetic acid, wybutoxocine, queosine, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine , 4-thiouridine, 5-methyluridine, N-((9-β-D-ribofuranosylpurin-6-yl)-carbamoyl)threonine, 2'-O-methyl-5-methyluridine, 2'-O-methyluridine, wybutosine, 3-(3-amino-3-carboxy-propyl)uridine, (acp3)u, 2'-O-methyl (M), 3'-phosphorothioate (MS), 3'-thioPACE (MSP), pseudouridine or 1-methylpseudouridine.Each possibility represents a separate aspect of the present invention.

[0088] In addition to targeting SARM1 alleles with RNA-guided CRISPR nucleases, other means of inhibiting SARM1 expression in target cells for use in treating cells (e.g., hematopoietic stem cells (HSCs), induced pluripotent stem cells (iPS cells), natural killer cells (NKs), iPS-derived NK cells (iNKs), T cells, innate immune-like T cells (iTs), gamma delta T cells, iPSc-derived T cells, natural killer T cells (NKTs), invariant NKT cells (iNKTs), iPS-derived NKTs, monocytes or macrophages) include, but are not limited to, the use of gapmers, shRNAs, siRNAs, customized TALENs, meganucleases or zinc finger nucleases, small molecule inhibitors, and other methods known in the art for reducing or eliminating expression of genes in target cells. See, e.g., U.S. Pat. Nos. 6,506,559; 7,560, 438; 8,420,391; 8,552,171; 7,056,704; 7,078,196; 8,362,231; 8,372,968; 9,045,754 and International Publication Nos. 2004 / 067736; 2006 / 097853; 2003 / 0 See Nos. 87341; 2000 / 041566; 2003 / 080809; 2010 / 079430; 2010 / 079430; 2011 / 072246; 2018 / 057989; and 2017 / 164230, the entire contents of which are incorporated by reference.

[0089] Advantageously, guide RNA molecules comprising at least one guide sequence portion as provided herein, when complexed with CRISPR nuclease in cells, provide improved SARM1 knockout efficacy compared to other guide RNA molecules. These specially designed sequences may also be useful for identifying SARM1 target sites for other nucleotide targeting-based gene editing or gene silencing methods, such as siRNA, TALEN, meganucleases or zinc finger nucleases.

[0090] Cellular delivery The compositions described herein that are useful for reducing or eliminating the expression of SARM1 may be delivered to a target cell by suitable means. The RNA guide molecules used to target SARM1 in the methods of the invention may be delivered to cells that contain and / or express a SARM1 allele and that are intended or destined to be administered to a subject for cell therapy. For example, in certain aspects of the invention, RNA molecules that specifically target a SARM1 allele are delivered to a target cell, the target cell being a hematopoietic stem cell (HSC), an induced pluripotent stem cell (iPS cell), a natural killer cell (NK), an iPS-derived NK cell (iNK), a T cell, an innate immune-like T cell (iT), a natural killer T cell (NKT), an invariant NKT cell (iNKT), a monocyte, or a macrophage. Delivery to a cell may be performed in vivo, ex vivo, or in vitro. In some aspects, delivery to a cell may be performed ex vivo or in vitro, and the resulting modified cell may be administered to a subject in need. In some embodiments, delivery to a cell occurs in vivo, and modification of the cell occurs within a subject in need thereof.Furthermore, the nucleic acid compositions described herein may be delivered to a cell as one or more of a DNA molecule, an RNA molecule, a ribonucleoprotein (RNP), a nucleic acid vector, or a combination thereof.

[0091] In some embodiments, the RNA molecule comprises a chemical modification. Non-limiting examples of suitable chemical modifications include 2'-O-methyl (M), 2'-O-methyl-3'-phosphorothioate (MS), or 2'-O-methyl-3'-thioPACE (MSP), pseudouridine, and 1-methylpseudouridine. Each possibility is a separate aspect of this invention.

[0092] A suitable viral vector system may be used to deliver the nucleic acid composition, e.g., the composition of the RNA molecule of the present invention. Conventional viral and non-viral based gene transfer can be used to introduce the nucleic acid and target the tissue. In certain embodiments, the nucleic acid is administered for in vivo or ex vivo gene therapy. Non-viral vector delivery systems include naked nucleic acid and nucleic acid complexed with a delivery vehicle (e.g., liposome or poloxamer). For reviews of gene therapy procedures, see Anderson (1992); Nabel & Felgner (1993); Mitani & Caskey (1993); Dillon (1993); Miller (1992); Van Brunt (1988); Vigne (1995); Kremer & Perricaudet (1995); Haddada et al. (1995) and Yu et al. (1994).

[0093] Methods of non-viral delivery of nucleic acids and / or proteins include electroporation, lipofection, microinjection, biolistics, particle gun acceleration, virosomes, liposomes, immunoliposomes, lipid nanoparticles (LNPs), polycation or lipid:nucleic acid conjugates, artificial virions, and uptake of nucleic acids by facilitators, or the nucleic acids and / or proteins can be delivered by bacteria or viruses (e.g., Agrobacterium, Rhizobium sp. NGR234, Sinorhizobium meliloti, Mesorhizobium loti, tobacco mosaic virus, potato virus X, cauliflower mosaic virus, and cassava vein mosaic virus). Delivery to plant cells can be achieved by the use of recombinant endothelial cells (e.g., Chung et al., 2006). Sonoporation, e.g., using the Sonitron 2000 system (Rich-Mar), can also be used to deliver nucleic acids. Cationic lipid-mediated delivery of proteins and / or nucleic acids is also contemplated for in vivo, ex vivo or in vitro delivery. (See Zuris et al. (2015); Coelho et al. (2013); see also Judge et al. (2006) and Basha et al. (2011)).

[0094] Non-viral vectors, such as transposon-based systems (e.g., recombinant Sleeping Beauty transposon system or recombinant PiggyBac transposon system), may be delivered to target cells and used to transpose the base sequence of the composition molecule or the base sequence encoding the composition molecule in the target cell.

[0095] Other representative nucleic acid delivery systems include those offered by Amaxa Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.) and Copernicus Therapeutics Inc. (see, e.g., U.S. Pat. No. 6,008,336). Lipofection is described, for example, in U.S. Pat. Nos. 5,049,386, 4,946,787 and 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam®, Lipofectin® and Lipofectamine® RNAiMAX). Cationic and neutral lipids suitable for efficient receptor-recognition lipofection of polynucleotides include those disclosed in WO 91 / 17424 and WO 91 / 16024. Delivery to cells (ex vivo administration) or target tissues (in vivo administration) is possible.

[0096] The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to those of skill in the art (see, e.g., Crystal, Science (1995); Blaese et al., (1995); Behr et al., (1994); Remy et al. (1994); Gao and Huang (1995); Ahmad and Allen (1992); U.S. Pat. Nos. 4,186,183; 4,217,344; 4,235,871; 4,261,975; 4,485,054; 4,501,728; 4,774,085; 4,837,028 and 4,946,787).

[0097] Another method of delivery involves packaging the nucleic acid to be delivered into an EnGeneIC delivery vehicle (EDV). The EDV is delivered specifically to the target tissue using a bispecific antibody, where one arm of the antibody has specificity for the target tissue and the other arm has specificity for the EDV. The antibody carries the EDV to the target cell surface, where it is carried into the cell by endocytosis. After entering the cell, the contents are released. (See MacDiarmid et al., 2009).

[0098] The use of RNA or DNA viral systems for viral delivery of nucleic acids takes advantage of the highly evolved methods of targeting viruses to specific cells in the body and transporting the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or used to treat cells in vitro and the modified cells are administered to patients (ex vivo). Traditional viral systems for delivering nucleic acids include, but are not limited to, retroviral, lentiviral, adenoviral, adeno-associated viral, vaccinia viral and herpes simplex viral vectors for gene transfer.

[0099] The tropism of retroviruses can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells and usually have high viral titers. The choice of retroviral gene transfer system depends on the target tissue. Retroviral vectors consist of cis-acting long terminal repeats and are capable of packaging up to 6-10 kb of foreign sequence. A minimal set of cis-acting LTRs is sufficient for vector replication and packaging, and is used to integrate therapeutic genes into target cells and permanently express the transgene. Widely used retroviral vectors include those based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof. (See, e.g., Buchschacher et al. (1992); Johann et al. (1992); Sommerfelt et al. (1990); Wilson et al. (1989); Miller et al. (1991); WO 94 / 26877).

[0100] At least six viral vectors are currently available for gene transfer in clinical trials, which utilize an approach involving complementation of a defective vector with a gene inserted into a helper cell line to generate the transducing agent.

[0101] pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (see Dunbar et al., 1995; Kohn et al., 1995; Malech et al., 1997). PA317 / pLASN was the first therapeutic vector used in a gene therapy trial (Blaese et al., 1995). Transduction efficiency of the MFG-S packaging vector was greater than 50% (Ellem et al., (1997); Dranoff et al., 1997).

[0102] Packaging cells are used to form viral particles capable of infecting host cells. Such cells include 293 cells that package adenovirus, AAV, and Psi-2 or PA317 cells that package retrovirus. Viral vectors used in gene therapy are usually generated by producer cell lines that package nucleic acid vectors into viral particles. The vectors usually contain the minimum viral sequences required for packaging and subsequent integration into the host (if applicable), with other viral sequences being replaced with expression cassettes that code for the proteins to be expressed. Missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy usually only have inverted terminal repeats (ITRs) from the AAV genome that are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line that lacks other AAV genes, i.e., ITR sequences, but contains a helper plasmid that codes for rep and cap. The cell line is also infected with adenovirus as a helper. The helper virus promotes the replication of AAV vectors and the expression of AAV genes from the helper plasmid. Due to the lack of ITR sequences, the helper plasmid is not packaged in large quantities. Adenovirus contamination can be reduced, for example, by heat treatment, to which adenovirus is more sensitive than AAV. In addition, AAV can be produced on a clinical scale using the baculovirus system (see U.S. Pat. No. 7,479,554).

[0103] In many gene therapies, it is desirable for the gene therapy vector to be delivered with a high degree of specificity to a particular tissue. Thus, viral vectors can be modified to have specificity for a given cell by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus. The ligand is selected to have affinity for a receptor known to be present on the cells of interest. For example, Han et al. (1995) reported that Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and that the recombinant virus infects certain human breast cancer cells expressing the human epidermal growth factor receptor. This principle can be extended to other virus-target cell combinations, where the target cell expresses a receptor and the virus expresses a fusion protein containing a ligand for a cell surface receptor. For example, filamentous phage can be engineered to display antibody fragments (e.g., FAB or Fv) with specific binding affinity for virtually any cellular receptor of choice. This description applies primarily to viral vectors, but the same principles can be applied to non-viral vectors. Such vectors can be engineered to contain specific uptake sequences that favor uptake by specific target cells.

[0104] Gene therapy vectors can be delivered in vivo by administration to an individual patient, for example, by systemic administration (eg, intravitreal, intravenous, intraperitoneal, intramuscular, subcutaneous or intracranial injection) or by local application.

[0105] The vector can be delivered ex vivo to cells, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirate, tissue biopsy) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into the patient after selection of cells incorporating the vector. Exemplary, non-limiting ex vivo approaches may include removing tissues from the patient (e.g., peripheral blood, bone marrow, and spleen) for culture, transferring the nucleic acid to the cultured cells (e.g., hematopoietic stem cells), and then engrafting the cells into the patient's target tissue (e.g., bone marrow and spleen). In some embodiments, the stem cells or hematopoietic stem cells may be further treated with a survival enhancer.

[0106] Ex vivo cell transfection for diagnostics, research, or for gene therapy (e.g., by re-infusion of the transfected cells into a host) is well known to those of skill in the art. In a preferred embodiment, cells are isolated from a subject, transfected with a nucleic acid composition, and re-infused into the subject (e.g., patient). A variety of cell types suitable for ex vivo transfection are well known to those of skill in the art (see, e.g., Freshney, "Culture of Animal Cells, A Manual of Basic Technique and Specialized Applications (6th edition, 2010) and references cited therein in the discussion of methods for isolating and culturing cells from patients).

[0107] Vectors (e.g., retroviruses, liposomes) carrying therapeutic nucleic acid compositions can also be administered directly to an organism to transduce cells in vivo. Administration is by routes typically used to introduce molecules into ultimate contact with blood or tissue cells, including, but not limited to, injection, infusion, topical application (e.g., eye drops and creams), and electroporation. Suitable methods of administering such nucleic acids are available and well known to those of skill in the art, and although multiple routes of administration of a particular composition can be used, a particular route can often provide a more rapid and effective response than another route. According to some embodiments, the composition is delivered by IV injection.

[0108] Suitable vectors for introducing transgenes into immune cells (e.g., T cells) include non-integrating lentiviral vectors, see, e.g., U.S. Patent Application Publication No. 2009 / 0117617.

[0109] Pharmaceutically acceptable carriers are determined in part by the composition being administered, as well as by the method used to administer the composition. Thus, there are a wide variety of suitable formulations of pharmaceutical compositions available, e.g., as described in Remington's Pharmaceutical Sciences, 17th ed., 1989.

[0110] The disclosed compositions and methods may also be used in the manufacture of a medicament or for immunotherapy to treat cancer, a disease, disorder, or infection in a patient.

[0111] An example of an RNA guide sequence that specifically targets an allele of the SARM1 gene. While numerous guide sequences can be designed to target the SARM1 gene, the sequences set forth in Table 1 and identified by SEQ ID NOs: 1-13457 were specifically selected to effectively carry out the methods described herein. Examples of SARM1 biallelic knockout cells are provided in PCT International Application No. PCT / US2021 / 034583, the entire contents of which are incorporated by reference. According to some aspects of the invention, the guide molecules disclosed herein may be utilized to generate SARM1 biallelic knockout cells that exhibit increased viability and / or increased functionality compared to corresponding cells expressing wild-type or unmodified SARM1. Non-limiting examples of cells include liver cells (e.g., hepatocytes), lung cells, spleen cells, pancreatic cells, colon cells, skin cells, bladder cells, eye cells, ocular cells, retinal cells, corneal cells, brain cells, esophageal cells, head cells, cervical cells, ovarian cells, testicular cells, prostate cells, placental cells, epithelial cells, endothelial cells, fat cells, kidney / renal cells, cardiac cells, muscle cells, blood cells (e.g., white blood cells), immune cells, central nervous system (CNS) cells, and ganglion cells, as well as combinations thereof.

[0112] Table 1 shows guide sequences designed for use as described for association with SARM1 alleles in the above embodiments. Each engineered guide molecule is further designed to associate with a target genomic DNA sequence of interest adjacent to a protospacer adjacent motif (PAM), e.g., a PAM matching the sequence NGG or NAG, where "N" is any nucleobase. The guide sequences were designed to function in conjunction with one or more different CRISPR nucleases, including, but not limited to, SpCas9WT (PAM SEQ:NGG), SpCas9.VQR.1 (PAM SEQ:NGAN), SpCas9.VQR.2 (PAM SEQ:NGNG), SpCas9.EQR (PAM SEQ:NGAG), SpCas9.VRER (PAM SEQ:NGCG), SaCas9WT (PAM SEQ:NNGRRT), SpRY (PAM SEQ:NRN or NYN), NmCas9WT (PAM SEQ:NNNNGATT), Cpf1 (PAM SEQ:TTTV), or JeCas9WT (PAM SEQ:NNNVRYM). The RNA molecules of the invention are each designed to form a complex with one or more different CRISPR nucleases and to target a base sequence of interest using one or more different PAM sequences that correspond to the CRISPR nuclease used.

[0113] [Table 1]

[0114] Examples are provided to facilitate a complete understanding of the present invention. The following examples are illustrative of representative modes of making and practicing the present invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples, which are for illustrative purposes only. EXAMPLES

[0115] Experimental details Example 1 SARM1 knockout analysis Guide sequence portions containing 17-50 consecutive nucleotides including the nucleotides of any one of SEQ ID NOs: 1-13457 are screened for high on-target activity using SpCas9 in HeLa cells. On-target activity is determined by DNA capillary electrophoresis analysis.

[0116] Example 2 SARM1 editing analysis SARM1 (Sterile alpha and toll / interleukin-1 receptor motif-containing 1) is an NAD+ hydrolase whose activity is associated with axon degeneration. To select the optimal RNA-guided molecule for biallelic knockout of SARM1, 23 RNA-guided molecules targeting SARM1 exons were screened in HeLa cells (Table 2). Briefly, SpCas9 coding plasmid (64 ng) was co-transfected with DNA plasmids expressing RNA-guided molecules (20 ng) in a 96-well plate format using jetOPTIMUS® reagent (Polyplus). Cells were harvested 72 hours after DNA transfection, and genomic DNA was extracted and used for capillary electrophoresis using primers amplifying endogenous genomic regions. The graph in Figure 1A shows the mean ± standard deviation (STDV) of the percentage of editing (%) of three independent experiments. Analysis of the capillary electrophoresis data for all RNA-guided molecules shows an activity range of 10% to 90%.

[0117] Further screening was performed with OMNI-50 (SEQ ID NO: 13471) and OMNI-79 (SEQ ID NO: 13472) CRISPR nucleases in HeLa cells. The transfection conditions were identical to those of SpCas9 transfection. Editing efficiency was measured by next generation sequencing (NGS) analysis. The editing efficiency of OMNI-50 with g13 was 43% (STDV=3.94). The editing efficiency of OMNI-79 with g33 was 35% (STDV=4.2). See Figure 1B. The guide sequence portion of the RNA guide molecule is shown in Table 4.

[0118] To verify that the RNA guide molecules confer Sarm1 knockout by nonsense codon-mediated decay (NMD), mouse Neuro-2a cells expressing SARM1 were used. To test the effect of the 10 most active guide RNA molecules targeting human SARM1 from the HeLa screen, the inventors identified 10 mouse-specific guide RNA molecules targeting mouse SARM1 DNA corresponding to the human guide RNA molecules. The activity of the mouse RNA guide molecules was tested in mouse cells. Briefly, 150×10 3 Neuro-2a cells were mixed with preassembled RNPs consisting of 105 pmol SpCas9 protein and 120 pmol sgRNA (see Table 3), mixed with 100 pmol electroporation enhancer (IDT-1075916), and electroporated using SF cell 4D-nucleofector X Kit S (PBC2-00675, Lonza) by applying the DS-134 program. A fraction of cells was harvested 72 hours after electroporation, and genomic DNA was extracted to measure on-target activity by NGS. According to the NGS analysis, all guide RNA molecules showed high insertion or deletion (indel) activity (Figure 2).

[0119] To assess the effect of editing on the levels of SARM1 transcripts, total RNA was extracted from Neuro-2a cells 7 days after electroporation and Sarm1 mRNA levels were measured by qRT-PCR. The results demonstrate a greater than 80% reduction in the levels of Sarm1 mRNA due to nonsense codon-mediated decay (NMD) (Figure 3).

[0120] Next, a novel CRISPR nuclease that exhibits a unique PAM requirement, OMNI-103 (SEQ ID NO: 13473), was tested for editing SARM1. This nuclease was tested in HeLa cells as described above. For this purpose, OMNI-103 was transfected into HeLa cells using the corresponding OMNI-P2A-mCherry expression vector (pmOMNI, Table 7) together with sgRNA molecules (sequences of guide sequence portion (gRNA) shown in Table 5A) designed to target specific locations in the human genome. Cells were harvested after 72 hours and half of the cells were used to quantify the transfection efficiency by FACS using mCherry fluorescence as a marker. The remaining cells were lysed and PCR reactions of their genomic DNA were performed to amplify the corresponding putative genomic targets. The amplicons were subjected to NGS and the resulting sequences were then used to calculate the percentage of editing at each target site. Short insertions or deletions (indels) around the cut site are a typical outcome of repair of DNA ends after nuclease-induced DNA cleavage. Therefore, the percentage of editing was estimated from the proportion of indels in each amplicon sequence (see Table 5B and Figure 4).

[0121] Example 3 SARM1-Edited NK Cell Assay Metabolic assays Glycolysis and oxidative mitochondrial metabolism: The Seahorse assay is performed according to the modified manufacturer's instructions using the Seahorse XF Glycolysis Stress Test Kit and the Seahorse XF Cell Mito Stress Kit (Agilent Technologies) to simultaneously analyze glycolysis and oxidative mitochondrial metabolism. Briefly, NK and iNK cells are washed and resuspended in glucose-free medium (GIBCO). 1.5×10 5Cells are plated in triplicate per well and analyzed on a Seahorse Xfe96 Analyzer (Agilent Technologies). Metabolic function is measured by stepwise injection of glucose, oligomycin, FCCP, sodium pyruvate, rotenone, and antimycin A. SRC measurements are calculated as the mean maximal OCR minus the mean basal OCR. ATP-linked respiration is calculated as the mean basal OCR minus the mean post-oligomycin value. Glycolysis is calculated as the mean post-glucose ECAR minus the mean basal ECAR. Glycolytic reserve is calculated as the mean maximal ECAR minus the mean post-glucose ECAR.

[0122] ATP quantification assay: 1 x 10 per well 5 NK and iNK cells are analyzed using the ATP Bioluminescence Assay Kit HS II (Sigma Aldrich) and an Infinite M200 PRO Luminometer (Tecan).

[0123] NAD+ and NADH quantification assay: NAD+ and NADH concentrations are quantified using the NAD / NADH Cell-Based Assay Kit (Cayman Chemical) as described by the manufacturer and analyzed using an Infinite M200 PRO Luminometer. For analysis of oxidative stress, NK and iNK cells are cultured with hydrogen peroxide (Sigma Aldrich) for 1 h. After treatment, cells are cultured in serum-free medium containing 5 mM MitoSox Indicator Dye (Thermo Fisher). Cells are then washed and counterstained with anti-CD56 antibody and a fixable viability dye for flow cytometry analysis. For metabolite mass spectrometry analysis, iNK cells and expanded peripheral blood NK cells are snap frozen in liquid nitrogen and metabolomics are performed.

[0124] Killing assay In vitro assay to assess cytotoxicity: Tumor target cells are stained with CFSE and resuspended in medium containing 5% FBS. NK effector cells are co-cultured with target cells in 96-well plates at an E:T ratio of 5:1 and in the presence of propidium iodide. Co-cultured cells are placed in an IncuCyte (Sartorius), live cell analysis system for up to 24 hours, and the killing capacity of NK cells is quantified by dual stained cells indicating dead target cells.

[0125] 3D tumor spheroid cytotoxicity assay: Tumor cells are cultured for several days to form spheroids. Then, 4 × 10 4 NK or iNK cells were gently added to each well and the cells were co-cultured for several days. At the end of the culture, the cells in each well were disrupted into a single cell suspension and stained with a fluorescently conjugated CD56 antibody and a fixative viability dye for flow cytometry analysis. Tumor cells were quantified based on NucLight Red and NK or iNK cells were quantified based on CD56 expression.

[0126] In vivo model for maintenance of SARM1-edited NK cells: A retention model in NSG mice is used to test the in vivo functionality of the edited NK cells. Three experimental groups are used (control, edited and non-edited cells). Mice are irradiated with 300 rad per day before cells are injected. Cells are resuspended in 200 μl of buffer and injected intravenously into mice. IL2 and IL15 are injected intraperitoneally. Mice are sacrificed 3-4 days after injection and bone marrow and spleen are analyzed to measure NK retention capacity. A table summarizing the assay is shown below:

[0127] [Table A]

[0128] [Table 2]

[0129] [Table 3]

[0130] [Table 4]

[0131] [Table 5A]

[0132] [Table 5B]

[0133] [Table 6]

[0134] [Table 7]

[0135] Example 4 Knocking out SARM1 in NK cells improves the killing activity of NK cells Introduction SARM1 (Sterile alpha and Toll / interleukin-1 receptor motif-containing 1) is an NAD+ hydrolase whose activity is associated with axonal degeneration. GMX1778 is a potent and specific inhibitor of the NAD+ biosynthetic enzyme nicotinamide phosphoribosyltransferase (NAMPT). Selective inhibition of NAMPT by GMX1778 blocks NAD+ production, leading to cell death. Thus, NAMPT is a key regulator of intracellular NAD concentrations and, consequently, energy metabolism. See Figure 5.

[0136] result Editing and NGS: 2×10 6Thawed primary NK cells were expanded for 5 days and then electroporated with 113 pmoles of SpCas9 and 226 pmoles of SARM1_g91 gRNA (GUACUGGUGGCAAACCCAGU (SEQ ID NO: 11104)). NGS analysis of cells 7 days later showed 90% editing of SARM1. See Figure 6A.

[0137] Killing assay: 10 days after electroporation, 6,250 NK cells were plated in triplicate with 2,500 GFP-labeled MCF7 target cells. Co-cultures were incubated for 24 hours at an E:T ratio of 2.5:1. Images were taken every hour on an Incucyte®. Killing assay medium was MEM-α supplemented with 10% FBS and 20 ng / ml IL-15. See Figure 6B.

[0138] Viability (ATPlite) assay: 15 days after electroporation, 50,000 SARM1_g91_KO and non-treated (NT) cells were plated in triplicate with increasing concentrations of GMX1778 and incubated for 48 hours. Cell viability was quantified by ATPlite kit. See Figure 6C.

[0139] conclusion These results indicate that the cell survival rate of SARM1 knockout NK cells is improved by treatment with GMX1778 (a SARM1 inducer), and also indicate that the killing ability of SARM1 knockout NK cells is improved.

[0140] Therefore, the results of this example provide a proof of concept that knocking out SARM1 in NK cells improves the killing activity of NK cells. Other nuclease and guide molecule combinations may be used to knock out SARM1 and achieve the same effect. These unexpected results are the first to show that knocking out SARM1 in NK cells improves the killing activity of NK cells. Therefore, SARM1-KO NK cells may be used in immunotherapy, for example, cancer therapy.

[0141] References 1. Ahmad and Allen (1992) “Antibody-mediated Specific Binging and Cytotoxicity of Lipsome-entrapped Doxorubicin to Lung Cancer Cells in Vitro”, Cancer Research 52:4817-20. 2. Anderson (1992) “Human gene therapy”, Science 256:808-13. 3. Basha et al. (2011) “Influence of Cationic Lipid Composition on Gene Silencing Properties of Lipid Nanoparticle Formulations of siRNA in Antigen-Presenting Cells”, Mol. Ther. 19(12):2186-200. 4. Behr (1994) Gene transfer with synthetic cationic amphiphiles: Prospects for gene therapy”, Bioconjuage Chem 5:382-89. 5. Blaese (1995) “Vectors in cancer therapy: how will they deliver”, Cancer Gene Ther. 2:291-97. 6. Blaese et al. (1995) “T lympocyte-directed gene therapy for ADA-SCID: initial trial results after 4 years”, Science 270(5235):475-80. 7. Buchschacher and Panganiban (1992) “Human immunodeficiency virus vectors for inducible expression of foreign genes”, J. Virol. 66:2731-39. 8. Burstein et al. (2017) “New CRISPR-Cas systems from uncultivated microbes”, Nature 542:237-41. 9. Chang and Wilson (1987) “Modification of DNA ends can decrease end-joining relative to homologous recombination in mammalian cells”, Proc. Natl. Acad. Sci. USA 84:4959-4963. 10. Chung et al. (2006) “Agrobacterium is not alone: gene transfer to plants by viruses and other bacteria”, Trends Plant Sci. 11(1):1-4. 11. Coelho et al. (2013) “Safety and efficacy of RNAi therapy for transthyretin amyloidosis” N. Engl. J. Med. 369, 819-829. 12. Collias and Beisel (2021) “CRISPR technologies and the search for the PAM-free nuclease”, Nature Communications 12, 555. 13. Crystal (1995) “Transfer of genes to humans: early lessons and obstacles to success”, Science 270(5235):404-10. 14. Dillon (1993) “Regulation gene expression in gene therapy” Trends in Biotechnology 11(5):167-173. 15. Dranoff et al. (1997) “A phase I study of vaccination with autologous, irradiated melanoma cells engineered to secrete human granulocyte macrophage colony stimulating factor”, Hum. Gene Ther. 8(1):111-23. 16. Dunbar et al. (1995) “Retrovirally marked CD34-enriched peripheral blood and bone marrow cells contribute to long-term engraftment after autologous transplantation”, Blood 85:3048-57. 17. Ellem et al. (1997) “A case report: immune responses and clinical course of the first human use of ganulocyte / macrophage-colony-stimulating-factor-tranduced autologous melanoma cells for immunotherapy”, Cancer Immunol Immunother 44:10-20. 18. Gao and Huang (1995) “Cationic liposome-mediated gene transfer” Gene Ther. 2(10):710-22. 19. Haddada et al. (1995) “Gene Therapy Using Adenovirus Vectors”, in: The Molecular Repertoire of Adenoviruses III: Biology and Pathogenesis, ed. Doerfler and Boehm, pp. 297-306. 20. Han et al. (1995) “Ligand-directed retro-viral targeting of human breast cancer cells”, Proc Natl Acad Sci U.S.A. 92(21):9747-51. 21. Hu et al. (2018) “Evolved Cas9 variants with broad PAM compatibility and high DNA specificity”, Nature 556(7699):57-63. 22. Jinek et al. (2012) “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity,” Science 337(6096):816-21. 23. Johan et al. (1992) “GLVR1, a receptor for gibbon ape leukemia virus, is homologous to a phosphate permease of Neurospora crassa and is expressed at high levels in the brain and thymus”, J Virol 66(3):1635-40. 24. Judge et al. (2006) “Design of noninflammatory synthetic siRNA mediating potent gene silencing in vivo”, Mol Ther. 13(3):494-505. 25. Kohn et al. (1995) “Engraftment of gene-modified umbilical cord blood cells in neonates with adnosine deaminase deficiency”, Nature Medicine 1:1017-23. 26. Kremer and Perricaudet (1995) “Adenovirus and adeno-associated virus mediated gene transfer”, Br. Med. Bull. 51(1):31-44. 27. Macdiarmid et al. (2009) “Sequential treatment of drug-resistant tumors with targeted minicells containing siRNA or a cytotoxic drug”, Nat Biotehcnol. 27(7):643-51. 28. Malech et al. (1997) “Prolonged production of NADPH oxidase-corrected granulocyes after gene therapy of chronic granulomatous disease”, PNAS 94(22):12133-38. 29. Miller et al. (1991) “Construction and properties of retrovirus packaging cells based on gibbon ape leukemia virus”, J Virol. 65(5):2220-24. 30. Miller (1992) “Human gene therapy comes of age”, Nature 357:455-60. 31. Mitani and Caskey (1993) “Delivering therapeutic genes - matching approach and application”, Trends in Biotechnology 11(5):162-66. 32. Molday et al. (2013) “X-linked juvenile retinoschisis: Clinical diagnosis, genetic analysis, and molecular mechansims”, Prog Retin Eye Res. 31(3): 195-212. 33. Nabel and Felgner (1993) “Direct gene transfer for immunotherapy and immunization”, Trends in Biotechnology 11(5):211-15. 34. Nishimasu et al. (2018) “Engineered CRISPR-Cas9 nuclease with expanded targeting space”, Science 361(6408):1259-1262. 35. Remy et al. (1994) “Gene Transfer with a Series of Lipphilic DNA-Binding Molecules”, Bioconjugate Chem. 5(6):647-54. 36. Sentmanat et al. (2018) “A Survey of Validation Strategies for CRISPR-Cas9 Editing”, Scientific Reports 8:888, doi:10.1038 / s41598-018-19441-8. 37. Sommerfelt et al. (1990) “Localization of the receptor gene for type D simian retroviruses on human chromosome 19”, J. Virol. 64(12):6214-20. 38. Van Brunt (1988) “Molecular framing: transgenic animals as bioactors” Biotechnology 6:1149-54. 39. Vigne et al. (1995) “Third-generation adenovectors for gene therapy”, Restorative Neurology and Neuroscience 8(1,2): 35-36. 40. Walton et al. (2020) “Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants”, Science 368(6488):290-296. 41. Weissman and Kariko (2015) “mRNA:Fulfilling the promise of gene therapy”, Molecular Therapy (9):1416-7. 42. Wilson et al. (1989) “Formation of infectious hybrid virion with gibbon ape leukemia virus and human T-cell leukemia virus retroviral envelope glycoproteins and the gag and pol proteins of Moloney murine leukemia virus”, J. Virol. 63:2374-78. 43. Yu et al. (1994) “Progress towards gene therapy for HIV infection”, Gene Ther. 1(1):13-26. 44. Zetsche et al. (2015) “Cpf1 is a single RNA-guided endonuclease of a class 2 CRIPSR-Cas system” Cell 163(3):759-71. 45. Zuris et al. (2015) “Cationic lipid-mediated delivery of proteins enables efficient protein based genome editing in vitro and in vivo” Nat Biotechnol. 33(1):73-80.

Claims

1. SARM1-inhibiting or SARM1-inactivated cells for use in a method for adoptive immune cell therapy or prevention, comprising administering the SARM1-inhibiting or SARM1-inactivated cells to a subject who is suffering from or has been determined to be at risk of suffering from cancer, an infectious disease, disease or disorder.

2. The cell of claim 1, wherein the SARM1-inhibited or SARM1-inactivated cell has been modified to reduce or inactivate expression of SARM1, or the cell has been modified to express a dominant-negative SARM1 sequence variant or a dominant-negative fragment thereof.

3. The cell according to claim 1 or 2, wherein the cell is selected from the group consisting of hematopoietic stem cells (HSCs), induced pluripotent stem cells (iPS cells), iPS-derived cells, natural killer cells (NKs), iPS-derived NK cells (iNKs), T cells, innate immune-like T cells (iTs), natural killer T cells (NKTs), γδT cells, iPS-derived T cells, invariant NKT cells (iNKTs), iPS-derived NKTs, monocytes, or macrophages.

4. the SARM1-inhibited or SARM1-inactivated cells exhibit increased functionality, increased survival, increased persistence, increased proliferation, and / or increased tumor retention in the subject compared to corresponding cells expressing wild-type or unmodified SARM1; and / or the SARM1-inhibited or SARM1-inactivated cells exhibit increased cytotoxicity and / or increased killing activity in the subject compared to corresponding cells expressing wild-type or unmodified SARM1; The cell according to claim 1 or 2.

5. The subject is diagnosed as having or at risk of having cancer. Optionally, the cancer comprises a tumor, and / or the cancer is a hematological malignancy. Optionally, the cancer is selected from the group consisting of quiescent melanoma, metastatic prostate cancer, metastatic breast cancer, triple-negative breast cancer, bladder cancer, brain tumor, esophageal cancer, liver cancer, head and neck cancer, squamous cell lung cancer, non-small cell lung cancer, Merkel cell carcinoma, sarcoma, hepatocellular carcinoma, multiple myeloma, leukemia, non-Hodgkin's lymphoma, lymphoma, B-cell lymphoma, acute myeloid leukemia, pancreatic cancer, colorectal cancer, cervical cancer, gastric cancer, kidney cancer, metastatic renal cell carcinoma, leukemia, ovarian cancer, and malignant glioma. The cell according to claim 1 or 2.

6. The SARM1-inhibiting or SARM1-inactivating cells are prepared ex vivo or in vitro, or The SARM1-inhibited or SARM1-inactivated cells are prepared in vivo. The cell according to claim 1 or 2.

7. The SARM1-inhibited or SARM1-inactivated cells are prepared from cells obtained from the subject by mobilization and / or apheresis. Optionally, the cells are obtained from cells obtained from the subject by bone marrow aspiration; and / or the cells are stimulated prior to SARM1 inhibition or SARM1 inactivation in the cells; and / or The SARM1-inhibited or SARM1-inactivated cells are expanded in culture prior to administration to the subject; and / or The SARM1-inhibited or SARM1-inactivated cells are capable of engraftment. The cell according to claim 1 or 2.

8. 3. The cell of claim 1 or 2, wherein the SARM1-inhibited or SARM1-inactivated cell is capable of giving rise to progeny cells.

9. The SARM1-inhibited or SARM1-inactivated cells are capable of giving rise to progeny cells after engraftment. Optionally, the SARM1-inhibited or SARM1-inactivated cells are capable of giving rise to progeny cells after autologous engraftment; and / or The SARM1-inhibited or SARM1-inactivated cells are capable of giving rise to progeny cells for at least 12 months or at least 24 months after engraftment. The cell according to claim 1 or 2.

10. The SARM1-inhibited or SARM1-inactivated cells are prepared by delivering a gapmer, shRNA, siRNA, customized TALEN, meganuclease, zinc finger nuclease, CRISPR nuclease or small molecule inhibitor to the cells; or an allele of the SARM1 gene in the SARM1-inhibited or SARM1-inactivated cell undergoes an insertion or deletion mutation; Optionally, the insertion or deletion mutation results in a premature stop codon. The cell according to claim 1 or 2.

11. SARM1 inhibited or SARM1 inactivated cells are At least one CRISPR nuclease or a nucleotide molecule encoding a CRISPR nuclease; and An RNA molecule containing a guide sequence portion or a nucleotide molecule encoding the RNA molecule introducing into said cells a composition comprising and prepared by a process comprising: the complex of the CRISPR nuclease and the RNA molecule makes a double-stranded break in the allele of the SARM1 gene; the guide sequence portion of the RNA molecule comprises 17 to 50 contiguous nucleotides; Optionally, the guide sequence portion is complementary to a target sequence located between 50 base pairs upstream and 50 base pairs downstream of exon I, exon II, exon III, exon IV, exon V, exon VI, exon VII, exon VIII, or exon IX of the SARM1 gene; and / or the guide sequence portion is complementary to a target sequence located between 30 base pairs upstream and 30 base pairs downstream of the exon of the SARM1 gene; a) the exon is exon I, and the guide sequence portion comprises a sequence identical to or differing by 3 nucleotides or less from any of the sequences set forth in SEQ ID NOs: 1-56, 301-356, 1348-2223, 57-114, 357-414, 2224-3095, 115-174, 415-474, and 3096-3963; b) the exon is exon II, and the guide sequence portion comprises a sequence identical to or differing by no more than 3 nucleotides from any of SEQ ID NOs: 3964-7683; c) the exon is exon III, and the guide sequence portion comprises a sequence identical to or differing by no more than 3 nucleotides from any of SEQ ID NOs: 7684-8967; d) the exon is exon IV, and the guide sequence portion comprises a sequence identical to or differing by no more than 3 nucleotides from any of SEQ ID NOs: 8968-9525; e) the exon is exon V, and the guide sequence portion comprises a sequence identical to or differing by no more than 3 nucleotides from any of SEQ ID NOs: 9526-10947; f) the exon is exon VI, and the guide sequence portion comprises a sequence identical to or differing by no more than 3 nucleotides from any of SEQ ID NOs: 10948-11571; g) the exon is exon VII, and the guide sequence portion comprises a sequence identical to or differing by no more than 3 nucleotides from any of SEQ ID NOs: 11572-12717; h) the exon is exon VIII and the guide sequence portion comprises a sequence identical to or differing by no more than 3 nucleotides from any of SEQ ID NOs: 12718-13455; or i) the exon is exon IX and the guide sequence portion comprises a sequence identical to or differing by no more than 3 nucleotides from any of SEQ ID NOs: 598-1347; and / or The guide sequence portion comprises 17 to 50 consecutive nucleotides including the nucleotides of the sequence set forth in any one of SEQ ID NOs: 1 to 13457; The cell according to claim 1 or 2.

12. 3. A medicament comprising SARM1-inhibited or SARM1-inactivated cells for use in a method for treating or preventing cancer, an infection, a disease or disorder in a subject according to claim 1 or 2.

13. A kit for treating or preventing cancer, an infectious disease, a disease or a disorder in a subject, comprising the pharmaceutical composition of claim 1 or 2 and instructions for delivering the composition to a subject who is suffering from or has been determined to be at risk of suffering from cancer, an infectious disease, a disease or a disorder.

14. 1. An ex vivo method for inactivating an allele of the SARM1 (sterile alpha and toll / interleukin-1 receptor motif-containing 1) gene in a cell, comprising: At least one CRISPR nuclease or a nucleotide molecule encoding a CRISPR nuclease; and RNA molecule containing a guide sequence portion or a nucleotide molecule encoding said RNA molecule introducing into said cells a composition comprising where: the complex of the CRISPR nuclease and the RNA molecule makes a double-stranded break in the allele of the SARM1 gene; The guide sequence portion comprises 17 to 50 consecutive nucleotides including the nucleotides of a sequence set forth in any one of SEQ ID NOs: 1 to 13457; the cells are selected from the group consisting of hematopoietic stem cells (HSCs), induced pluripotent stem cells (iPS cells), iPS-derived cells, natural killer cells (NKs), iPS-derived NK cells (iNKs), T cells, innate immune-like T cells (iTs), natural killer T cells (NKTs), γδ T cells, iPS-derived T cells, invariant NKT cells (iNKTs), iPS-derived NKTs, monocytes, or macrophages; method.

15. 15. A cell modified by the method of claim 14, wherein the modified cell comprises at least one inactivated SARM1 allele. Optionally, the modified cells are used for adoptive cell therapy or prophylaxis. Optionally, the adoptive cell therapy or prevention is treatment or prevention of cancer, an infectious disease, a disease, or a disorder in a subject. Modified cells.

Images