Engineered RNA

Abstract

Disclosed herein are engineered RNAs and compositions comprising same for treating a disease or condition in a subject. Also disclosed herein are methods of treating a disease or condition in a subject by administering an engineered RNA, a polynucleotide encoding the engineered RNA described, or a pharmaceutical composition described herein.

Description

[Technical Field]

[0001] Related Applications This application claims priority under 35 U.S.C. § 119 to Provisional Application No. 63 / 272,418, filed October 27, 2021, Provisional Application No. 63 / 277,662, filed November 10, 2021, and Provisional Application No. 63 / 333,256, filed April 21, 2022, the disclosures of which are incorporated herein by reference in their entireties. Summary of the Invention

[0002] Disclosed herein is an engineered RNA comprising: (a) a targeting sequence having complementarity to a target RNA; and (b) an RNA element comprising: (i) an engineered SmOPT variant sequence having up to 90.9% sequence identity to AAUUUGUSKAG (SEQ ID NO: 1) or AAUUUUUGGAG (SEQ ID NO: 2), and (ii) an engineered U7 hairpin variant sequence having up to 96.8% sequence identity to CAGGUUUUCUGACUUCGGUCGGAAAACCCCU (SEQ ID NO: 3), or an engineered U7 hairpin variant sequence having up to 96.9% sequence identity to UAGGCUUUCUGGCUUUUUACCGGAAAGCCCCU (SEQ ID NO: 4). In some embodiments, the engineered SmOPT variant sequence and the engineered U7 hairpin variant sequence facilitate an increased amount of editing of a nucleotide base of a target RNA by an RNA editing entity compared to an otherwise identical RNA lacking the engineered SmOPT variant sequence, the engineered U7 hairpin variant sequence, or both, as determined by RNA sequencing. In some embodiments, the target RNA is associated with a disease or condition, wherein the disease or condition is selected from the group consisting of a neurodegenerative disease or disorder, a muscle disease or disorder, a metabolic disease or disorder, an eye disease or disorder, a liver disease or disorder, cancer, and any combination thereof. In some embodiments, the target RNA is associated with a disease or condition selected from the group consisting of Rett syndrome, Huntington's disease, Parkinson's disease, Alzheimer's disease, Stargardt disease, Usher syndrome, muscular dystrophy, spinal muscular atrophy (SMN), facioscapulohumeral muscular dystrophy (FSHD), limb-girdle muscular dystrophy (LGMD), amyotrophic lateral sclerosis (ALS), Tay-Sachs disease, human immunodeficiency virus (HIV), familial hypercholesterolemia, diabetes, and cancer. In some embodiments, the RNA element comprises an engineered SmOPT variant sequence having up to 90.9% sequence identity to SEQ ID NO:2. In some embodiments, the 5' end of the engineered SmOPT variant sequence comprises an additional U or C relative to SEQ ID NO:2. In some embodiments, the RNA element comprises SEQ ID NO:39.In some embodiments, the 3' end of the engineered SmOPT variant sequence contains an additional U or A relative to SEQ ID NO:2. In some embodiments, nucleotides 3, 4, 5, 6, and 7 of SEQ ID NO:2 each contain a U, and nucleotide 1 is the first nucleotide of SEQ ID NO:2 at the 5' end. In some embodiments, the engineered SmOPT variant sequence has at least one polynucleotide substitution containing a G to A substitution at nucleotide 8 of SEQ ID NO:2, and nucleotide 1 is the first nucleotide of SEQ ID NO:2 at the 5' end. In some embodiments, the engineered SmOPT variant sequence has at least one polynucleotide substitution containing a G to A, C, or U substitution at nucleotide 9 of SEQ ID NO:2, and nucleotide 1 is the first nucleotide of SEQ ID NO:2 at the 5' end. In some embodiments, the engineered SmOPT variant sequence has at least one polynucleotide substitution containing an A to C substitution at nucleotide 10 of SEQ ID NO:2, and nucleotide 1 is the first nucleotide of SEQ ID NO:2 at the 5' end. In some embodiments, the engineered SmOPT variant sequence has at least one polynucleotide substitution comprising a G to A, C, or U substitution at nucleotide 11 of SEQ ID NO:2, where nucleotide 1 is the first nucleotide of SEQ ID NO:2 at the 5'-end. In some embodiments, the RNA element comprises SEQ ID NO:40, SEQ ID NO:41, or SEQ ID NO:42. In some embodiments, the RNA element comprises an engineered SmOPT variant sequence having up to 90.9% sequence identity to SEQ ID NO:1. In some embodiments, the engineered SmOPT variant sequence has at least one polynucleotide substitution comprising a G to U substitution at nucleotide 6 of SEQ ID NO:1, where nucleotide 1 is the first nucleotide of SEQ ID NO:1 at the 5'-end. In some embodiments, the engineered SmOPT variant sequence has at least one polynucleotide substitution comprising an A to C substitution at nucleotide 1 of SEQ ID NO:1, where nucleotide 1 is the first nucleotide of SEQ ID NO:1 at the 5'-end.In some embodiments, the engineered SmOPT variant sequence has two, three, or four polynucleotide substitutions compared to SEQ ID NO:1 or SEQ ID NO:2. In some embodiments, the RNA element comprises an engineered U7 hairpin variant sequence having up to 96.8% sequence identity to SEQ ID NO:3. In some embodiments, the engineered U7 hairpin variant sequence has at least one polynucleotide substitution comprising a G insertion at nucleotide 3 of SEQ ID NO:3, where nucleotide 1 is the first nucleotide of SEQ ID NO:3 at the 5' end. In some embodiments, the RNA element comprises SEQ ID NO:44. In some embodiments, the engineered U7 hairpin variant sequence has at least one polynucleotide substitution comprising an A to U substitution at nucleotide 2 of SEQ ID NO:3, where nucleotide 1 is the first nucleotide of SEQ ID NO:3 at the 5' end. In some embodiments, the RNA element comprises SEQ ID NO:43. In some embodiments, the engineered U7 hairpin variant sequence has at least one polynucleotide substitution comprising a U to G, C, or A substitution at nucleotide 5 of SEQ ID NO:3, where nucleotide 1 is the first nucleotide of SEQ ID NO:3 at the 5' end. In some embodiments, the RNA element comprises SEQ ID NO: 45. In some embodiments, the engineered U7 hairpin variant sequence has at least one polynucleotide substitution comprising a U to C substitution at nucleotide 6 of SEQ ID NO: 3, where nucleotide 1 is the first nucleotide of SEQ ID NO: 3 at the 5' end. In some embodiments, the RNA element comprises SEQ ID NO: 46. In some embodiments, the engineered U7 hairpin variant sequence has at least one polynucleotide substitution comprising a U to G substitution at nucleotide 8 of SEQ ID NO: 3, where nucleotide 1 is the first nucleotide of SEQ ID NO: 3 at the 5' end.In some embodiments, the engineered U7 hairpin variant sequence has at least one polynucleotide substitution comprising a U to C or A substitution at nucleotide 10 of SEQ ID NO:3, where nucleotide 1 is the first nucleotide of SEQ ID NO:3 at the 5' end. In some embodiments, the RNA element comprises SEQ ID NO:47. In some embodiments, the engineered U7 hairpin variant sequence has at least one polynucleotide substitution comprising a G to C substitution at nucleotide 11 of SEQ ID NO:3, where nucleotide 1 is the first nucleotide of SEQ ID NO:3 at the 5' end. In some embodiments, the engineered U7 hairpin variant sequence has at least one polynucleotide substitution comprising an A to C substitution at nucleotide 12 of SEQ ID NO:3, where nucleotide 1 is the first nucleotide of SEQ ID NO:3 at the 5' end. In some embodiments, the RNA element comprises SEQ ID NO:48. In some embodiments, the engineered U7 hairpin variant sequence has between 2 and 15 polynucleotide substitutions compared to SEQ ID NO:3. In some embodiments, the engineered U7 hairpin variant sequence has 2, 3, 5, or 10 polynucleotide substitutions compared to SEQ ID NO:3. In some embodiments, the RNA element comprises an engineered U7 hairpin variant sequence having up to 96.9% sequence identity to SEQ ID NO: 4. In some embodiments, the engineered U7 hairpin variant sequence has 2 to 15 polynucleotide substitutions compared to SEQ ID NO: 4. In some embodiments, the engineered U7 hairpin variant sequence has 2, 3, 5, or 10 polynucleotide substitutions compared to SEQ ID NO: 4.In some embodiments, the engineered SmOPT variant sequence comprises at least one polynucleotide substitution compared to AAUUUN1UN2N3AG (SEQ ID NO: 7), wherein each of N1, N2, and N3 is independently A, U, G, or C, provided that if N1 of SEQ ID NO: 7 is G, then N2 is A, U, or G, or N3 is A, G, or C, or if N1 of SEQ ID NO: 7 is U, then at least one of N2 and N3 is A, U, or C, or when N2 of SEQ ID NO:7 is C, then N1 is A, U, or C, or N1 is A, G, or C, or when N2 of SEQ ID NO:7 is G, then N1 is A, G, or C, or N1 is A, U, or C, or when N3 of SEQ ID NO:7 is U, then N1 is A, U, or C, or N2 is A, U, or G, or when N3 of SEQ ID NO:7 is G, then N1 is A, G, or C, or N2 is A, U, or C. In some embodiments, the engineered U7 hairpin variant sequence is N1AGGN2UUUCUGN3CUUN4N5N6N7CN8GN9AAAN. 10 CCCN 11 N 12 (SEQ ID NO: 8) and contains at least one polynucleotide substitution, N1, N2, N3, N4, N5, N6, N7, N8, N9, N 10 , N 11 , and N 12 are independently A, U, G, or C, provided that when N1 of SEQ ID NO: 8 is C, then N2, N7, and N 11 At least one of N3 and N9 is A, G, or C, or at least one of N4 and N5 is U, G, or C, or at least one of N6 and N7 is U, G, or C, or at least one of N8 and N9 is U, G, or C, or at least one of N9 and N1 is U, G, or C, or at least one of N1 and N2 is U, G, or C, or at least one of N3 and N4 is U, G, or C, or at 10 At least one of N5, N6, and N8 is A, U, or G, or at least one of N5, N6, and N8 is A, U, or C, and N 12 is A, U, G, C, or absent, or when N1 of SEQ ID NO: 8 is U, N2, N8, and N 11at least one of N3, N9, and N is A, U, or G; 10 At least one of N4, N5, N6, and N is A, U, or C, or 12 or N7 is U, G, or C; or when N2 of SEQ ID NO: 8 is U, N1, N4, and N 10 at least one of N3 and N9 is A, U, or G; at least one of N5, N6, and N8 is U, G, or C, or at least one of N7 and N8 is A, U, or C; 11 At least one of is A, G, or C, and N 12 are A, U, G, C, or absent, or when N2 of SEQ ID NO: 8 is C, N1, N4, N5, N6, and N 12 at least one of N3, N9, and N 10 at least one of N is A, U, or C, or N7 is U, G, or C, or N8 and N 11 At least one of N1, N4, and N5 is A, U, or G, or when N3 of SEQ ID NO: 8 is A, N1, N4, and N5 are A, U, or G. 10 at least one of N2, N7, and N is A, U, or G; 11 at least one of N5, N6, and N8 is A, G, or C, or at least one of N5, N6, and N8 is A, U, or C, or N9 is U, G, or C, and N 12 are A, U, G, C, or absent, or when N3 of SEQ ID NO: 8 is G, N1, N4, N5, N6, and N 12 at least one of N2, N8, and N 11 at least one of N7 is A, U, or G, or N9 and N1 are U, G, or C;10 At least one of N1 and N4 is A, U, or C, or when N4 of SEQ ID NO: 8 is C, N1 and N4 are A, U, or C. 10 at least one of N2, N7, and N is A, U, or G; 11 at least one of N3 and N9 is A, G, or C, or at least one of N5, N6, and N8 is A, U, or C, and N 12 are A, U, G, C, or absent, or when N4 of SEQ ID NO: 8 is U, N1, N5, N6, and N 12 at least one of N2, N8, and N 11 at least one of N3, N9, and N is A, U, or G; 10 or N7 is U, G, or C; or when N5 of SEQ ID NO: 8 is G, N1, N4, and N 10 at least one of N2, N7, and N is A, U, or G; 11 at least one of N3 and N9 is A, G, or C, or at least one of N6 and N8 is A, U, or C, and N 12 are A, U, G, C, or absent, or when N5 of SEQ ID NO: 8 is U, N1, N4, N6, and N 12 at least one of N2, N8, and N 11 at least one of N3, N9, and N is A, U, or G; 10 or N7 is U, G, or C; or when N6 of SEQ ID NO: 8 is G, N1, N4, and N 10 at least one of N2, N7, and N is A, U, or G; 11at least one of N3 and N9 is A, G, or C, or at least one of N5 and N8 is A, U, or C, and N 12 are A, U, G, C, or absent, or when N6 of SEQ ID NO: 8 is U, N1, N4, N5, and N6 ... U, 12 at least one of N2, N8, and N 11 at least one of N3, N9, and N is A, U, or G; 10 or N7 is U, G, or C; or when N7 of SEQ ID NO: 8 is U, N1, N4, and N 10 at least one of is A, U, or G, or N2 and N 11 at least one of N3 and N9 is A, G, or C, or at least one of N5, N6, and N8 is A, U, or C, and N 12 are A, U, G, C, or absent, or when N7 of SEQ ID NO: 8 is A, N1, N4, N5, N6, and N 12 at least one of N2, N8, and N 11 at least one of N3, N9, and N is A, U, or G; 10 or when N8 of SEQ ID NO: 8 is G, N1, N4, and N 10 at least one of N2, N7, and N is A, U, or G; 11 at least one of N3 and N9 is A, G, or C, or at least one of N5 and N6 is A, U, or C, and N 12 are A, U, G, C, or absent, or when N8 of SEQ ID NO: 8 is C, N1, N4, N5, N6, and N12 at least one of N2 and N3 is A, G, or C; 11 at least one of N3, N9, and N is A, U, or G; 10 or N7 is U, G, or C; or when N9 of SEQ ID NO: 8 is A, N1, N4, and N 10 at least one of N2, N7, and N is A, U, or G; 11 at least one of N5, N6, and N8 is A, G, or C, or N3 is U, G, or C, or at least one of N5, N6, and N8 is A, U, or C, and N 12 are A, U, G, C, or absent, or when N9 of SEQ ID NO: 8 is G, N1, N4, N5, N6, and N 12 at least one of N2, N8, and N 11 at least one of N is A, U, or G, or N is U, G, or C, or N and N 10 At least one of is A, U, or C, or N of SEQ ID NO: 8 10 is C, then at least one of N1 and N4 is A, U, or G, or N2, N7, and N 11 at least one of N3 and N9 is A, G, or C, or at least one of N5, N6, and N8 is A, U, or C, and N 12 is A, U, G, C, or is absent, or N of SEQ ID NO: 8 10 If G, then N1, N4, N5, N6, and N 12 at least one of N2, N8, and N 11or at least one of N3 and N9 is A, U, or C, or N7 is U, G, or C, or N of SEQ ID NO: 8 11 If U, then N1, N4, and N 10 at least one of N2 and N7 is A, G, or C, or at least one of N3 and N9 is U, G, or C, or at least one of N5, N6, and N8 is A, U, or C, and N 12 is A, U, G, C, or is absent, or N of SEQ ID NO: 8 11 If C, then N1, N4, N5, N6, and N 12 At least one of N2 and N8 is A, G, or C, or at least one of N3, N9, and N 10 at least one of N is A, U, or C, or N is U, G, or C, or N of SEQ ID NO: 8 12 If does not exist, N1, N4, and N 10 at least one of N2, N7, and N is A, U, or G; 11 at least one of N3 and N9 is A, G, or C, or at least one of N5, N6, and N8 is A, U, or C, or N of SEQ ID NO: 8 12 is U, then at least one of N1, N4, N5, and N6, or N2, N8, and N 11 At least one of the A, U, or G, or N3, N9, and N 10is A, U, or C, or N7 is U, G, or C. In some embodiments, the RNA element comprises SEQ ID NO:49 or SEQ ID NO:60. In some embodiments, the RNA element comprises SEQ ID NO:50 or SEQ ID NO:61. In some embodiments, the RNA element comprises SEQ ID NO:51 or SEQ ID NO:62. In some embodiments, the targeting sequence, upon hybridization to the target RNA, forms a guide-target RNA scaffold that comprises a structural feature selected from the group consisting of a mismatch, a bulge, an internal loop, a hairpin, and any combination thereof, wherein the structural feature is substantially formed upon hybridization to the target RNA, and the structural feature is not present in the engineered guide RNA prior to hybridization of the engineered guide RNA to the target RNA. In some embodiments, the structural feature comprises a mismatch. In some embodiments, the mismatch comprises at least one adenosine-guanosine (AG) mismatch, at least one adenosine-adenosine (AA) mismatch, or at least one adenosine-cytidine (AC), wherein the adenosine is present in the target RNA. In some embodiments, the mismatch comprises an AC mismatch, wherein the adenosine is present in the target RNA. In some embodiments, the structural feature comprises a bulge. In some embodiments, the bulge comprises an asymmetric bulge. In some embodiments, the bulge comprises a symmetric bulge. In some embodiments, the structural feature comprises an internal loop. In some embodiments, the internal loop comprises an asymmetric internal loop. In some embodiments, the internal loop comprises a symmetric internal loop. In some embodiments, the structural feature comprises a hairpin. In some embodiments, the hairpin comprises a length of about 3 bases to about 15 bases long. In some embodiments, the engineered SmOPT variant sequence and the engineered U7 hairpin variant sequence are 3' to the mismatch. In some embodiments, the engineered RNA is encoded by a polynucleotide that is operably linked to an RNA polymerase type II promoter.In some embodiments, the RNA polymerase II type promoter is selected from the group consisting of a U1 promoter, a U6 promoter, a U7 promoter, and any combination thereof. In some embodiments, the RNA polymerase II type promoter is a U7 promoter. In some embodiments, the engineered RNA further comprises a terminator that is 3' to the mismatch. In some embodiments, the terminator is a U7 box terminator. In some embodiments, the terminator is a truncated terminator. In some embodiments, the RNA editing entity comprises an ADAR protein. In some embodiments, the ADAR protein is selected from the group consisting of ADAR1, ADAR2, and any combination thereof. In some embodiments, the target RNA is selected from the group consisting of ABCA4, ALAS1, APP, ATP7B, CFTR, DMD, DMPK, DUX4, GAPDH, GBA, HEXA, HFE, LIPA, LRRK2, MAPT, PCSK9 start site, PINK1, PMP22, SERPINA1, SCNN1A start site, SNCA, or SOD1, a fragment of any one of these, and any combination thereof. In some embodiments, the target RNA is ABCA4, wherein ABCA4 comprises a mutation selected from the group consisting of G6320A, G5714A, G5882A, and any combination thereof. In some embodiments, the engineered RNA is configured to facilitate editing of nucleotide bases of a target RNA by an RNA editing entity, such that a protein translated from the edited target RNA comprises at least one amino acid residue difference compared to a modified APP polypeptide generated from editing of the nucleotide bases of the target RNA, wherein the at least one amino acid residue difference is selected from the group consisting of K670E, K670R, K670G, M671V, A673V, A673T, D672G, E682G, H684R, K687R, K687E, K687G, I712X, T714X, and any combination thereof, of the APP polypeptide. In some embodiments, the target RNA is SERPINA1, and the SERPINA1 comprises a G9989A mutation.In some embodiments, the target RNA is SERPINA1, and SERPINA1 encodes a mutation of E342K in the protein encoded by the target RNA. In some embodiments, the target RNA is LRRK2, and LRRK2 encodes a mutation in the protein encoded by the target RNA, and the mutations are E10L, A30P, S52F, E46K, A53T, L119P, A211V, C228S, E334K, N363S, V366M, A419V, R506Q, N544E, N551K , A716V, M712V, I723V, P755L, R793M, I810V, K871E, Q923H, Q930R, R1067Q, S1096C, Q1111H, I1 122V, A1151T, L1165P, I1192V, H1216R, S1228T, P1262A, R1325Q, I1371V, R1398H, T1410M, D14 20N, N1437H, R1441C, R1441G, R1441H, A1442P, P1446L, V1450I, K1468E, R1483Q, R1514Q, P15 42S, V1613A, R1628P, M1646T, S1647T, Y1699C, R1728H, R1728L, L1795F, M1869V, M1869T, L187 0F, E1874X, R1941H, Y2006H, I2012T, G2019S, I2020T, T2031S, N2081D, T2141M, R2143H, Y2189C, T2356I, G2385R, V2390M, E2395K, M2397T, L2466H, Q2490N, and any combination thereof. In some embodiments, the target RNA is SNCA, and the SNCA comprises a mutation for RNA editing selected from the group consisting of a translation initiation site (TIS) AUG-GTG at codon 1, a TIS AUG at codon 5, an AUG at position 265 in exon 2, and any combination thereof. In some embodiments, the targeting sequence has target complementarity to a splice signal proximal to an exon within the target RNA.In some embodiments, the targeting sequence has target complementarity to (a) a branch point upstream of an exon in the target RNA, or (b) a donor splice site downstream of an exon in the target RNA. In some embodiments, the mismatch is located between 1 base and about 200 bases from either end of the targeting sequence. In some embodiments, the targeting sequence has target complementarity to a 3' or 5' untranslated region (UTR) of the target RNA. In some embodiments, the targeting sequence has target complementarity to a translation start site. In some embodiments, the targeting sequence has target complementarity to an intron region of the target RNA. In some embodiments, the targeting sequence has target complementarity to an exon region of the target RNA. In some embodiments, the engineered RNA is between about 80 nucleotides and about 600 nucleotides in length. In some embodiments, the engineered RNA is an antisense oligonucleotide (ASO). In some embodiments, the ASO comprises at least one chemical modification. In some embodiments, the at least one chemical modification is 5' adenylate, 5' guanosine-triphosphate cap, 5' N7-methylguanosine-triphosphate cap, 5' triphosphate cap, 3' phosphate, 3' thiophosphate, 5' phosphate, 5' thiophosphate, Cis-Syn thymidine dimer, trimer, C. 12Spacer, C3 spacer, C6 spacer, d spacer, PC spacer, r spacer, spacer 18, spacer 9, 3'-3' modification, 5'-5' modification, abasic site, acridine, azobenzene, biotin, biotin BB, biotin TEG, cholesteryl TEG, desthiobiotin TEG, DNP TEG, DNP-X, DOTA, dT-biotin, double biotin, PC-biotin, psoralen C2, psoralen C6, TINA, 3'DABCYL, black hole quencher 1, black hole quencher 2, DABCYL SE, dT-DABCYL, IRDye The ASO may comprise any one of QC-1, QSY-21, QSY-35, QSY-7, QSY-9, a carboxyl linker, a thiol linker, a 2'-deoxyribonucleoside analog purine, a 2'-deoxyribonucleoside analog pyrimidine, a ribonucleoside analog, a 2'-O-methylribonucleoside analog, a sugar-modified analog, a wobble / universal base, a fluorescent dye label, a 2'-fluoroRNA, a 2'-O-methylRNA, a methylphosphonate, a phosphodiester DNA, a phosphodiester RNA, a phosphothioate DNA, a phosphorothioate RNA, a UNA, a pseudouridine-5'-triphosphate, a 5-methylcytidine-5'-triphosphate, a 2-O-methyl-3 phosphorothioate, or any combination thereof. In some embodiments, the ASO is about 10 nucleotides to about 200 nucleotides in length. In some embodiments, the ASO is about 20 nucleotides to about 40 nucleotides in length. In some embodiments, the ASO is perfectly complementary to the target RNA. In some embodiments, the ASO is configured to inhibit, cover, mask, or block the target sequence of the target RNA. In some embodiments, the engineered RNA is a circularized engineered RNA.

[0003] Also disclosed herein are polynucleotides that encode the engineered RNAs described herein.

[0004] Also disclosed herein are delivery vehicles comprising the engineered RNA described herein or a polynucleotide encoding the engineered RNA described herein. In some embodiments, the delivery vehicle is selected from the group consisting of a vector, a liposome, a particle, a dendrimer, and any combination thereof. In some embodiments, the delivery vehicle is a viral vector. In some embodiments, the viral vector is an adeno-associated viral (AAV) vector or a derivative thereof. In some embodiments, the AAV vector, derivative thereof, or hybrid of any of these is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PH In some embodiments, the AAV vector or derivative thereof is selected from the group consisting of a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, and any combination thereof.

[0005] Also disclosed herein are pharmaceutical compositions comprising (a) an engineered RNA described herein, a polynucleotide described herein, or a delivery vehicle described herein, and (b) a pharmaceutically acceptable excipient, diluent, or carrier. In some embodiments, the pharmaceutical composition is in unit dose form.

[0006] Also disclosed herein are methods of treating a disease or condition in a subject, comprising administering to the subject an effective amount of an engineered RNA described herein, a polynucleotide described herein, a delivery vehicle described herein, or a pharmaceutical composition described herein to treat the disease or condition in the subject. In some embodiments, the disease or condition is selected from the group consisting of a neurodegenerative disease or disorder, a muscle disease or disorder, a metabolic disease or disorder, an eye disease or disorder, a liver disease or disorder, cancer, and any combination thereof. In some embodiments, the disease or condition is selected from the group consisting of Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, myotonic dystrophy, facioscapulohumeral muscular dystrophy, Rett syndrome, Charcot-Marie-Tooth disease, Alzheimer's disease, a tauopathy, Parkinson's disease, alpha-1 antitrypsin deficiency, cystic fibrosis-like disease, Wilson's disease, and Stargardt disease. In some embodiments, the disease or condition is associated with a mutation in a gene, or RNA encoded by the gene, selected from the group consisting of ABCA4, ALAS1, APP, ATP7B, CFTR, DMD, DMPK, DUX4, GAPDH, GBA, HEXA, HFE, LIPA, LRRK2, MAPT, PCSK9 start site, PINK1, PMP22, SERPINA1, SERPINA1 E342K, SCNN1A start site, SNCA, SOD1, a fragment of any of these, and any combination thereof.In some embodiments, administering is by inhalation, auricle, buccal, conjunctival, dental, intracervical, intranasal sinus, intratracheal, intraintestinal, epidural, extra-amniotic, extracorporeal, hemodialysis, infiltration, injection (e.g., brain parenchymal injection, intrathecal injection, intraventricular injection, intracisternal injection, intravenous injection), intrainterstitial, intraorbital, intraabdominal, intra-amniotic, intra-arterial, intra-articular, intrabiliary, intra-bronchial, intra-synovial, intracardiac, intracartilaginous, intracavitary, intracavity, intraventricular, intracisternal, intracorneal, intracoronary, intracoronary, intracavernosal, intradermal, intradiscal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intrahippocampal, intraileal, intralesional, intraluminal, intralymphatic, intramedullary, intrameningeal, intramuscular, intranasal, intraocular, intraovarian, intrapericardial, intraperitoneal, intrathoracic, The administration may be intraprostatic, intrapulmonary, intrasinusoidal, intraspinal, intraparenchymal, intrasynovial, intratendinous, intratesticular, intrathecal, intrathoracic, intratubular, intratumoral, intratympanic, intrauterine, intravascular, intravenous, intravenous bolus, infusion, intraventricular, intravesical, intravitreal, iontophoretic, irrigation, laryngeal, intranasal, nasogastric, intraocular, oral, oropharyngeal, parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, retrobulbar, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urethral, ​​vaginal, stereotactic, or any combination thereof. In some embodiments, the subject is a human. In some embodiments, the subject is a subject in need thereof. In some embodiments, the subject has been diagnosed with a disease or condition.

[0007] Also disclosed herein is an engineered RNA described herein, a polynucleotide described herein, a delivery vehicle described herein, or a pharmaceutical composition described herein for use in treating a disease or condition of a subject. In some embodiments, the disease or condition is selected from the group consisting of a neurodegenerative disease or disorder, a muscle disease or disorder, a metabolic disease or disorder, an eye disease or disorder, a liver disease or disorder, cancer, and any combination thereof. In some embodiments, the disease or condition is selected from the group consisting of Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, myotonic dystrophy, facioscapulohumeral muscular dystrophy, Rett syndrome, Charcot-Marie-Tooth disease, Alzheimer's disease, a tauopathy, Parkinson's disease, alpha-1 antitrypsin deficiency, cystic fibrosis-like disease, Wilson's disease, and Stargardt disease. In some embodiments, the disease or condition is associated with a mutation in a gene, or RNA encoded by the gene, selected from the group consisting of ABCA4, ALAS1, APP, ATP7B, CFTR, DMD, DMPK, DUX4, GAPDH, GBA, HEXA, HFE, LIPA, LRRK2, MAPT, PCSK9 start site, PINK1, PMP22, SERPINA1, SERPINA1 E342K, SCNN1A start site, SNCA, SOD1, a fragment of any of these, and any combination thereof.In some embodiments, administering is by inhalation, auricle, buccal, conjunctival, dental, intracervical, intranasal sinus, intratracheal, intraintestinal, epidural, extra-amniotic, extracorporeal, hemodialysis, infiltration, injection (e.g., brain parenchymal injection, intrathecal injection, intraventricular injection, intracisternal injection, intravenous injection), intrainterstitial, intraorbital, intraabdominal, intra-amniotic, intra-arterial, intra-articular, intrabiliary, intra-bronchial, intra-synovial, intracardiac, intracartilaginous, intracavitary, intracavity, intraventricular, intracisternal, intracorneal, intracoronary, intracoronary, intracavernosal, intradermal, intradiscal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intrahippocampal, intraileal, intralesional, intraluminal, intralymphatic, intramedullary, intrameningeal, intramuscular, intranasal, intraocular, intraovarian, intrapericardial, intraperitoneal, intrathoracic, The administration may be intraprostatic, intrapulmonary, intrasinusoidal, intraspinal, intraparenchymal, intrasynovial, intratendinous, intratesticular, intrathecal, intrathoracic, intratubular, intratumoral, intratympanic, intrauterine, intravascular, intravenous, intravenous bolus, infusion, intraventricular, intravesical, intravitreal, iontophoretic, irrigation, laryngeal, intranasal, nasogastric, intraocular, oral, oropharyngeal, parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, retrobulbar, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urethral, ​​vaginal, stereotactic, or any combination thereof. In some embodiments, the subject is a human.

[0008] The novel features of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which exemplary principles of the present disclosure are utilized, and the accompanying drawings, in which: [Brief explanation of the drawings]

[0009] [Figure 1A]A shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). B shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). C shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). D shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). [Figure 1B] A shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). B shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). C shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). D shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). [Figure 1C]A shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). B shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). C shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). D shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). [Figure 1D] A shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). B shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). C shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). D shows an exemplary mutagenesis library screen for SmOPT and a U7 hairpin, highlighting a single base substitution (solid frame), paired hairpin substitution (dotted frame), and an extra overlapping base (dashed frame). [Figure 2A] Guide RNA mutations of SmOPT sequences with mouse U7 (mU7) hairpin or human U7 (hU7) hairpin sequences and the mutation effect on fold-change editing efficiency when normalized to unmodified SmOPT mU7 guide RNA are shown. [Figure 2B]1 shows guide RNA mutations of a U1Sm sequence with an mU7 hairpin or a U7Sm sequence with an mU7 hairpin, and the effect of the mutations on fold-change editing efficiency normalized to the unmodified SmOPT mU7 guide RNA. [Figure 2C] 1 shows the effect of mutation of the mU7 hairpin sequence by SmOPT or mutation of the hU7 hairpin sequence by SmOPT, and the mutational effect on fold-change editing efficiency normalized to unmodified SmOPT mU7 guide RNA. [Figure 2D] Mutations in SmOPT and mU7 associated with increased editing of target RNA are shown. The graph on the left shows the percentage of editing data from the library screen, and the graph on the right shows the percentage of editing data from individual single-copy transfections. [Figure 3] Representative individual mutations in SmOPT and mU7 hairpins associated with increased editing of target RNAs tested in combination with each other are shown. [Figure 4] Figure 1 shows an exemplary SmOPT mU7 hairpin combination variant tested against a broader range of gene targets for RNA editing. Guide RNA expression constructs were evaluated at day 2 for plasmid transient transfection and at day 13 for single-copy genomic integration. [Figure 5] Figure 1 shows exemplary SmOPT mU7 hairpin combination variants tested for exon skipping gene targets, independent of RNA editing. Guide RNA expression constructs were evaluated at day 2 for plasmid transient transfection and at day 13 for single-copy genomic integration. [Figure 6] Exemplary SmOPT mU7 hairpin combination variants tested on antisense oligonucleotides for clinically relevant DMD exon skipping in differentiated muscle cells. Guide RNA expression constructs were randomly integrated into the genome and evaluated after 10 days of myocyte differentiation. DETAILED DESCRIPTION OF THE INVENTION

[0010] Disclosed herein are engineered RNAs containing the RNA elements described herein for the treatment of diseases associated with mutations in target RNA. Examples of engineered RNAs containing RNA elements useful for treating such diseases include engineered guide RNAs and chemically synthesized antisense oligonucleotides (ASOs). In some cases, engineered guide RNAs can be used to site-specifically edit adenosines in target RNAs using RNA editing entities (e.g., adenosine deaminases acting on RNA (ADARs)). In some cases, ASOs can be used to bind to target RNAs (block or cover target RNAs) to alter RNA interactions, processing, expression, or a combination thereof. As described herein, the engineered RNAs (e.g., engineered guide RNAs or antisense oligonucleotides (ASOs)) of the present disclosure can be operably linked to heterologous engineered RNA elements, such as variant sequences of Sm- or Sm-like binding domain consensus sequences (SmOPT variant sequences), engineered U7 hairpin variant sequences, or combinations thereof.

[0011] RNA elements The RNA element of the present disclosure may comprise an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or a combination thereof, described herein, and the RNA element may be operably linked to the engineered RNA (e.g., an engineered guide RNA, ASO) of the present disclosure. In some embodiments of the present disclosure, the RNA element of the present disclosure may be a modified or variant of an optimized Sm or Sm-like protein binding domain that excludes the Sm protein binding domain sequence of SEQ ID NO: 1 (AAUUUGUSKAG) or the SmOPT sequence of SEQ ID NO: 2 (AAUUUUUGGAG) and instead includes a variant of the SmOPT sequence of SEQ ID NO: 2 (AAUUUUUGGAG), forming the engineered SmOPT variant sequence. In some embodiments, the RNA elements of the present disclosure may be engineered U7 hairpin variants that include modifications or variants of the U7 hairpin sequence of SEQ ID NO: 3 (mouse: CAGGUUUUCUGACUUCGGUCGGAAAACCCCU) or SEQ ID NO: 4 (human: UAGGCUUUCUGGCUUUUUACCGGAAAGCCCCU) described herein.

[0012] In some embodiments, an engineered RNA (e.g., an engineered guide RNA, an antisense oligonucleotide) of the present disclosure may include an RNA element, such as an engineered SmOPT variant sequence or a variant of the SmOPT sequence of SEQ ID NO: 2. As used herein, "engineered SmOPT variant sequence" refers to a non-naturally occurring, modified, or variant SmOPT sequence compared to the naturally occurring or unmodified SmOPT sequence (SEQ ID NO: 2), and the engineered SmOPT variant sequence may include a polynucleotide substitution or at least one polynucleotide substitution (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11), up to 11 (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, 1), or 1 to 10 (e.g., 2 to 9, 3 to 8, 4 to 7, 5 to 6) compared to the wild-type, naturally occurring, or unmodified sequence. As used herein, "engineered SmOPT variant sequence" can refer to an engineered SmOPT variant sequence AAUUUUUGGAG, SEQ ID NO:2, comprising a modification of the SmOPT sequence, such as AAUUUGUSKAG, where the engineered SmOPT variant sequence has or comprises up to 90.9% sequence identity to SEQ ID NO:2. In some embodiments, the engineered SmOPT variant sequence has at least about 9% sequence identity to SEQ ID NO:2. In other embodiments, the engineered SmOPT variant sequence has about 9% to 90.9% sequence identity to SEQ ID NO:2. In some embodiments, the engineered SmOPT variant sequence can comprise at least one polynucleotide substitution (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10), no more than 10 polynucleotide substitutions (e.g., 9, 8, 7, 6, 5, 4, 3, 2, 1), or 1 to 10 polynucleotide substitutions compared to the unmodified SEQ ID NO:2.

[0013] In some embodiments, the engineered SmOPT variant sequence is the polynucleotide sequence N0AAUUUUUGN9AN 11 (SEQ ID NO: 82), wherein N0 is absent or is U, and N9 or N11 is G, A, C, or U. In some embodiments, the engineered SmOPT variant sequence is N0AAUUUUUGN9AN 11 (SEQ ID NO: 82), wherein N0 is absent or is U or A, and N9 or N 11 is G, A, C or U.

[0014] In some embodiments, the engineered SmOPT variant sequence is the polynucleotide sequence N0AAUUUUUGN9AN 11 (SEQ ID NO: 82), wherein N0 is absent or is U, and N9 or N 11 is G, A, C, or U, and the polynucleotide sequence is not SEQ ID NO: 2. In some embodiments, the engineered SmOPT variant sequence is N0AAUUUUUGN9AN 11 (SEQ ID NO: 82), wherein N0 is absent or is U, and N9 or N 11 is G, A, C, or U, and the polynucleotide sequence is not SEQ ID NO:2.

[0015] In some embodiments, the engineered SmOPT variant sequence is the polynucleotide sequence AAUUUUUGN9AN 11 (SEQ ID NO: 83), and N 11 is A, C, or U. In some embodiments, the engineered SmOPT variant sequence is AAUUUUUGN9AN 11 (SEQ ID NO: 83), and may comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to N9 or N 11 is A, C, or U.

[0016] In some embodiments, the engineered SmOPT variant sequence may comprise the polynucleotide sequence UAAUUUUUGGAG (SEQ ID NO: 84). In some embodiments, the engineered SmOPT variant sequence may comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to UAAUUUUUGGAG (SEQ ID NO: 84).

[0017] In some embodiments, the engineered SmOPT variant sequence may comprise the polynucleotide sequence AAUUUUUGGAC (SEQ ID NO: 85). In some embodiments, the engineered SmOPT variant sequence may comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to AAUUUUUGGAC (SEQ ID NO: 85).

[0018] In some embodiments, the engineered SmOPT variant sequence may comprise the polynucleotide sequence AAUUUUUGGAU (SEQ ID NO: 86). In some embodiments, the engineered SmOPT variant sequence may comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to AAUUUUUGGAU (SEQ ID NO: 86). (SEQ ID NO: 86).

[0019] In preferred embodiments, the engineered SmOPT variant sequence may comprise the polynucleotide sequence AAUUUUUGGAA (SEQ ID NO: 87). In some embodiments, the engineered SmOPT variant sequence may comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to AAUUUUUGGAA (SEQ ID NO: 87).

[0020] In some embodiments, the engineered U7 hairpin variant has the polynucleotide sequence CN2GGN5N6N7UUCN 11 GN 13CUUCGGN 20 CN 22 GAAN 26 N 27 CCCCN 32 N2 is A or U, N5 is either absent or G, N6 is U or A, N7 is U or C, and N 11 is A or U, and N 13 is A or C, and N 20 is U or G, and N 22 is U or G, and N 26 is A or G, and N 27 is A or U, and N 32 is either U or absent. In some embodiments, the engineered U7 hairpin variant is CN2GGN5N6N7UUCN 11 GN 13 CUUCGGN 20 CN 22 GAAN 26 N 27 CCCCN 32 N2 is A or U, N5 is either absent or G, N6 is U or A, N7 is U or C, and N8 is a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to N8 (SEQ ID NO: 88), N9 is A or U, N1 is absent or G, N1 is U or A, N2 is absent or G, N3 is absent or G, N4 is absent or G, N5 is absent or G, N6 is U or A, N7 is absent or G, and N8 is absent or G. 11 is A or U, and N 13 is A or C, and N 20 is U or G, and N 22 is U or G, and N 26 is A or G, and N 27 is A or U, and N 32 is either U or absent.

[0021] In some embodiments, the engineered U7 hairpin variant has the polynucleotide sequence CN2GGN5N6N7UUCN 11 GN 13 CUUCGGN 20 CN 22 GAAN26 N 27 CCCCN 32 N2 is A or U, N5 is either absent or G, N6 is U or A, N7 is U or C, and N 11 is A or U, and N 13 is A or C, and N 20 is U or G, and N 22 is U or G, and N 26 is A or G, and N 27 is A or U, and N 32 is either U or absent, and the polynucleotide sequence is not SEQ ID NO: 3. In some embodiments, the engineered U7 hairpin variant is CN2GGN5N6N7UUCN 11 GN 13 CUUCGGN 20 CN 22 GAAN 26 N 27 CCCCN 32 N2 is A or U, N5 is either absent or G, N6 is U or A, N7 is U or C, and N8 is a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to N8 (SEQ ID NO: 88), N9 is A or U, N1 is absent or G, N1 is U or A, N2 is absent or G, N3 is absent or G, N4 is absent or G, N5 is absent or G, N6 is U or A, N7 is absent or G, and N8 is absent or G. 11 is A or U, and N 13 is A or C, and N 20 is U or G, and N 22 is U or G, and N 26 is A or G, and N 27 is A or U, and N 32 is either U or absent and the polynucleotide sequence is not SEQ ID NO:3.

[0022] In some embodiments, the engineered U7 hairpin variant comprises the polynucleotide sequence CAGGN5UUUUCUGN 13 CUUCGGN 20 CGGAAAACCCCN 32U (SEQ ID NO: 89), N5 is either absent or G, and N 13 is either A or C, and N 20 is either U or G, and N 32 is U or absent, or the polynucleotide sequence is not SEQ ID NO: 3. In some embodiments, the engineered U7 hairpin variant is CAGGN5UUUUCUGN 13 CUUCGGN 20 CGGAAAACCCCN 32 U (SEQ ID NO: 89), wherein N5 is either absent or G, and N 13 is either A or C, and N 20 is either U or G, and N 32 is U or absent, or the polynucleotide sequence is not SEQ ID NO:3.

[0023] In some embodiments, an engineered U7 hairpin variant can comprise the polynucleotide sequence CUGGUUUUCUGACUUCGGUCGGAAAACCCCU (SEQ ID NO: 90). In some embodiments, an engineered U7 hairpin variant can comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to CUGGUUUUCUGACUUCGGUCGGAAAACCCCU (SEQ ID NO: 90).

[0024] In some embodiments, an engineered U7 hairpin variant can comprise the polynucleotide sequence CAGGGUUUUCUGACUUCGGUCGGAAAACCCCCU (SEQ ID NO: 91). In some embodiments, an engineered U7 hairpin variant can comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to CAGGGUUUUCUGACUUCGGUCGGAAAACCCCCU (SEQ ID NO: 91).

[0025] In some embodiments, an engineered U7 hairpin variant can comprise the polynucleotide sequence CAGGAUUUCUGACUUCGGUCGGAAAUCCCCU (SEQ ID NO: 92). In some embodiments, an engineered U7 hairpin variant can comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to CAGGAUUUCUGACUUCGGUCGGAAAUCCCCU (SEQ ID NO: 92).

[0026] In some embodiments, an engineered U7 hairpin variant can comprise the polynucleotide sequence CAGGUCUUCUGACUUCGGUCGGAAGACCCCU (SEQ ID NO: 93). In some embodiments, an engineered U7 hairpin variant can comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to CAGGUCUUCUGACUUCGGUCGGAAGACCCCU (SEQ ID NO: 93).

[0027] In some embodiments, an engineered U7 hairpin variant can comprise the polynucleotide sequence CAGGUUUUCAGACUUCGGUCUGAAAACCCCU (SEQ ID NO: 94). In some embodiments, an engineered U7 hairpin variant can comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to CAGGUUUUCAGACUUCGGUCUGAAAACCCCU (SEQ ID NO: 94).

[0028] In some embodiments, an engineered U7 hairpin variant can comprise the polynucleotide sequence CAGGUUUUCUGCCUUCGGGCGGAAAACCCCU (SEQ ID NO: 95). In some embodiments, an engineered U7 hairpin variant can comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to CAGGUUUUCUGCCUUCGGGCGGAAAACCCCU (SEQ ID NO: 95).

[0029] In some embodiments, an engineered U7 hairpin variant can comprise the polynucleotide sequence CAGGGUUUUCUGCCUUCGGGCGGAAAACCCCCU (SEQ ID NO: 96). In some embodiments, an engineered U7 hairpin variant can comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to CAGGGUUUUCUGCCUUCGGGCGGAAAACCCCCU (SEQ ID NO: 96).

[0030] In some embodiments, an engineered U7 hairpin variant can comprise the polynucleotide sequence CAGGGUUUUCAGACUUCGGUCUGAAAACCCCCU (SEQ ID NO: 97). In some embodiments, an engineered U7 hairpin variant can comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to CAGGGUUUUCAGACUUCGGUCUGAAAACCCCCU (SEQ ID NO: 97).

[0031] In some embodiments, an engineered U7 hairpin variant can comprise the polynucleotide sequence CAGGUUUUCAGCCUUCGGGCUGAAAACCCCU (SEQ ID NO: 98). In some embodiments, an engineered U7 hairpin variant can comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to CAGGUUUUCAGCCUUCGGGCUGAAAACCCCU (SEQ ID NO: 98).

[0032] In some embodiments, an engineered U7 hairpin variant can comprise the polynucleotide sequence CAGGGUUUUCAGCCUUCGGGCUGAAAACCCCCU (SEQ ID NO: 99). In some embodiments, an engineered U7 hairpin variant can comprise a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to CAGGGUUUUCAGCCUUCGGGCUGAAAACCCCCU (SEQ ID NO: 99).

[0033] In some embodiments, the RNA element may include an engineered SmOPT variant having the polynucleotide sequence of SEQ ID NO: 82 and an engineered U7 hairpin variant sequence having the polynucleotide sequence of any one of SEQ ID NOs: 88-99.

[0034] In some embodiments, the RNA element may include an engineered SmOPT variant having the polynucleotide sequence of SEQ ID NO: 83 and an engineered U7 hairpin variant sequence having the polynucleotide sequence of any one of SEQ ID NOs: 88-99.

[0035] In some embodiments, the RNA element may include an engineered SmOPT variant having the polynucleotide sequence of SEQ ID NO: 84 and an engineered U7 hairpin variant sequence having the polynucleotide sequence of any one of SEQ ID NOs: 88-99.

[0036] In some embodiments, the RNA element may include an engineered SmOPT variant having the polynucleotide sequence of SEQ ID NO: 85 and an engineered U7 hairpin variant sequence having the polynucleotide sequence of any one of SEQ ID NOs: 88-99.

[0037] In some embodiments, the RNA element may include an engineered SmOPT variant having the polynucleotide sequence of SEQ ID NO: 86 and an engineered U7 hairpin variant sequence having the polynucleotide sequence of any one of SEQ ID NOs: 88-99.

[0038] In some embodiments, the RNA element may include an engineered SmOPT variant having the polynucleotide sequence of SEQ ID NO: 87 and an engineered U7 hairpin variant sequence having the polynucleotide sequence of any one of SEQ ID NOs: 88-99.

[0039] In some embodiments, the RNA element may comprise an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence having the polynucleotide sequence (expressed as DNA) of SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, or SEQ ID NO:59. In some embodiments, the RNA element may comprise an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence having the polynucleotide sequence (expressed as RNA) of SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, or SEQ ID NO:70.

[0040] In some embodiments, an RNA element can comprise an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence having a polynucleotide sequence (expressed as DNA) of SEQ ID NO: 49. In some embodiments, an RNA element can comprise an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence having a polynucleotide sequence (expressed as DNA) with at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 49.

[0041] In some embodiments, an RNA element may comprise an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence having a polynucleotide sequence (expressed as DNA) of SEQ ID NO: 50. In some embodiments, an RNA element may comprise an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence having a polynucleotide sequence (expressed as DNA) having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 50.

[0042] In some embodiments, an RNA element can comprise an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence having a polynucleotide sequence (expressed as DNA) of SEQ ID NO: 51. In some embodiments, an RNA element can comprise an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence having a polynucleotide sequence (expressed as DNA) having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 51.

[0043] In some embodiments, an RNA element may comprise an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence having a polynucleotide sequence (expressed as RNA) of SEQ ID NO: 60. In some embodiments, an RNA element may comprise an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence having a polynucleotide sequence (expressed as RNA) having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 60.

[0044] In some embodiments, an RNA element can comprise an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence having a polynucleotide sequence (expressed as RNA) of SEQ ID NO: 61. In some embodiments, an RNA element can comprise an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence having a polynucleotide sequence (expressed as RNA) having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 61.

[0045] In some embodiments, an RNA element may comprise an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence having a polynucleotide sequence (expressed as RNA) of SEQ ID NO: 62. In some embodiments, an RNA element may comprise an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence having a polynucleotide sequence (expressed as RNA) having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 62.

[0046] Some examples of the present disclosure provide engineered RNAs (e.g., engineered guide RNAs, ASOs) described herein that include RNA elements such as engineered U7 hairpin variant sequences, or variants or modifications of the U7 hairpin sequence of SEQ ID NO: 3 or SEQ ID NO: 4. As used herein, the phrase "engineered U7 hairpin variant" refers to a non-naturally occurring hairpin, modified hairpin, or variant hairpin sequence compared to a naturally occurring or unmodified hairpin sequence, where an engineered U7 hairpin variant sequence has a polynucleotide substitution, or at least one polynucleotide substitution (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30), 30 or fewer polynucleotide substitutions (e.g., 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14 , 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1), or 1 to 30 polynucleotide substitutions (e.g., 2 to 29, 3 to 28, 4 to 27, 5 to 26, 6 to 25, 7 to 24, 8 to 23, 9 to 22, 10 to 21, 11 to 20, 12 to 19, 13 to 18, 14 to 17, 15 to 16).In some embodiments, the engineered U7 hairpin variant sequence has a polynucleotide substitution or at least one polynucleotide substitution (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26) compared to a wild-type, naturally occurring, or unmodified sequence, e.g., a human U7 hairpin sequence of UAGGCUUUCUGGCUUUUUACCGGAAAGCCCCU (SEQ ID NO: 4). , 27, 28, 29, 30, 31), 31 or fewer polynucleotide substitutions (e.g., 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1), or 1 to 31 polynucleotide substitutions (e.g., 2 to 30, 3 to 29, 4 to 28, 5 to 27, 6 to 26, 7 to 25, 8 to 24, 9 to 23, 10 to 22, 11 to 21, 12 to 20, 13 to 19, 14 to 18, 15 to 17). In some embodiments, an "engineered U7 hairpin variant," as used herein, can refer to an engineered U7 hairpin comprising a variant of the mouse U7 hairpin sequence (CAGGUUUUCUGACUUCGGUCGGAAAACCCCU (SEQ ID NO: 3)) or a variant of the human U7 hairpin sequence (UAGGCUUUCUGGCUUUUUACCGGAAAGCCCCU (SEQ ID NO: 4)), wherein the engineered U7 hairpin variant sequence has up to 96.8% (inclusive) sequence identity to SEQ ID NO: 3 or up to 96.9% (inclusive) sequence identity to SEQ ID NO: 4. In some embodiments, when an engineered RNA (e.g., an engineered guide RNA or an antisense oligonucleotide) comprises an engineered U7 hairpin variant sequence, the engineered U7 hairpin variant sequence has up to 96.8% (inclusive) sequence identity to SEQ ID NO: 3.In some embodiments, when the engineered RNA (e.g., an engineered guide RNA or an antisense oligonucleotide) comprises an engineered U7 hairpin variant sequence, the engineered U7 hairpin variant sequence has up to 96.9% (inclusive) sequence identity to SEQ ID NO:4.

[0047] In some embodiments, the engineered RNA can be an engineered guide RNA configured to edit nucleotide bases of a target RNA (e.g., an engineered guide RNA having an RNA element having the polynucleotide sequence of any one of SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:60, SEQ ID NO:61, or SEQ ID NO:62). RNA editing can be achieved using an engineered guide RNA having a targeting sequence configured to hybridize to the target RNA, capable of hybridizing to the target RNA, or having sufficient complementarity to the target RNA to at least partially permit hybridization. The engineered RNA (e.g., engineered guide RNA or ASO) described herein can include RNA elements of an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence. In some embodiments, an engineered guide RNA comprising an engineered SmOPT variant sequence and an engineered U7 hairpin variant RNA element facilitates an increased amount of editing of a nucleotide base of a target RNA by an RNA editing entity compared to an otherwise equivalent guide RNA lacking the engineered SmOPT variant sequence, the engineered U7 hairpin variant sequence, or a combination thereof, as determined by an in vitro assay, such as, but not limited to, RNA sequencing.

[0048] Some examples described herein provide the following: an engineered RNA (e.g., an engineered guide RNA, an antisense oligonucleotide) of the present disclosure is an RNA having a targeting sequence that has sufficient complementarity to a target RNA and can hybridize to the target RNA, or a combination thereof, as well as an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence (e.g., an R sequence having a polynucleotide sequence of any one of SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:60, SEQ ID NO:61, or SEQ ID NO:62). and wherein the engineered RNA (e.g., engineered guide RNA, ASO) comprises or is operably linked to an engineered SmOPT variant sequence, the engineered SmOPT variant sequence has up to 90.9% (e.g., about 9%, 18%, 27%, 36%, 45%, 55%, 64%, 73%, 82%) sequence identity to AAUUUGUSKAG (SEQ ID NO: 1) or AAUUUUUGGAG (SEQ ID NO: 2), and the engineered RNA comprises an RNA element comprising an engineered U7 hair strand. When comprising or operably linked to a U7 hairpin variant sequence, the engineered U7 hairpin variant sequence may be up to 96.8% (including 96.8%) (e.g., about 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, %,37%,38%,39%,40%,41%,42%,43%,44%,45%,46%,47%,48%,49%,50%,51%,52%,53%,54%,55%,56%,57%,58%,59%,60%,61%,62%,63%,64%,65%,66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96.7%) sequence identity to UAGGCUUUCUGGCUUUUUACCGGAAAGCCCCU (SEQ ID NO: 4), or engineered U7 hairpin variant sequences having up to 96.9% (including 96.9%) (e.g., about 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 11 8%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96.In other embodiments, an engineered RNA (e.g., an engineered guide RNA, ASO) of the present disclosure comprises (a) a targeting sequence that has sufficient complementarity to the target RNA and can hybridize to the target RNA, or a combination thereof, (b) an engineered SmOPT variant sequence, and (c) an engineered U7 hairpin variant sequence, wherein when the engineered RNA (e.g., an engineered guide RNA, ASO) comprises the engineered SmOPT variant sequence of (b), the engineered SmOPT variant sequence has at least about 9% (e.g., about 10%, 11%, 12%, 13%, 14% or more) sequence identity to AAUUUGUSKAG (SEQ ID NO: 1) or AAUUUUUGGAG (SEQ ID NO: 2). ,15%,16%,17%,18%,19%,20%,21%,22%,23%,24%,25%,26%,27%,28%,29%,30%,31%,32%,33%,34%,35%,36%,37%,38%,39%,40%,41%,42%,43%,44%,45%,46%,47%,48%,49%,50%,51%,52%,53%,54%,55%,56%,57%,58%,59%,59%,50%,51%,52%,53%,54%,55%,56%,57%,58%,59%,59%,50%,51%,52%,54%,55%,56%,57%,58%,59%,59%,59%,50%,51%,52%,53 ...0%,51%,52 3%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%.9%) sequence identity to CAGGUUUUCUGACUUCGGUCGGAAAACCCCU (SEQ ID NO: 3), and if the engineered RNA (e.g., engineered guide RNA, ASO) comprises the engineered U7 hairpin variant sequence of (c), the engineered U7 hairpin variant sequence has at least about 3% (e.g., 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 1%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 2%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93% 94%, 95%, 96%, 96.7%, 96.8% or more of sequence identity to UAGGCUUUCUGGCUUUUUACCGGAAAGCCCCU (SEQ ID NO: 4). %, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69 %, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 96.7%, 96.8%, 96.In yet a further embodiment, the engineered RNA (e.g., engineered guide RNA, ASO) of the present disclosure comprises (a) a targeting sequence having sufficient complementarity to the target RNA and capable of hybridizing to the target RNA, or a combination thereof, (b) an engineered SmOPT variant sequence, and (c) an engineered U7 hairpin variant sequence, wherein the engineered RNA comprises the engineered SmOPT variant sequence of (b). If included, the engineered SmOPT variant sequence is approximately 9% to 90.9% (e.g., 10% to 90.8%, 11% to 90%, 12% to 89%, 13% to 88%, 14% to 87%, 15% to 86%, 16% to 85%, 17% to 84%, 18% to 83%, 19% to 82%, 20% to 81%, 21% to 80%, 22% to 79%, 23% to 25%, 24% to 26%, 25% to 27%, 26% to 28%, 27% to 30%, 28% to 31%, 29% to 40%, 30% to 32%, 31% to 33%, 32% to 34%, 33% to 35%, 34% to 36%, 35% to 37%, 36% to 38%, 37% to 39%, 38% to 40%, 39% to 41%, 40% to 42%, 41% to 43%, 42% to 44%, 43% to 45%, 44% to 46%, 45% to 47%, 46% to 48%, 47% to 49%, 48% to 50%, 49% to 51%, 49% to 52%, 49% to 53%, 51% to 54%, 51% to 55%, 52% to 55%, 53% to 56%, 54% to 57%, 54% to 58%, 55% to 59%, 56% to 59%, 57% to 58%, 58% to 59%, 59% to 60%, 6 23%~78%, 24%~77%, 25%~76%, 26%~75%, 27%~74%, 28%~73%, 29%~72%, 30%~71%, 31%~70%, 32%~69%, 33%~68%, 34%~67%, 35%~66%, 36%~65%, 37%~64%, 38%~63%, 39%~62%, 40%~61%, 41%~60%, 42%~59%, 43%~58%, 44%~57%, 45%~56%, 46% If the engineered RNA (e.g., engineered guide RNA, ASO) contains an engineered U7 hairpin variant sequence (c), the engineered U7 hairpin variant sequence has a sequence identity of about 3% to 96.8% (e.g., 4% to 96%) to CAGGUUUUCUGACUUCGGUCGGAAAACCCCU (SEQ ID NO: 3).7%, 5%~96%, 6%~95%, 7%~94%, 8%~93%, 9%~92%, 10%~91%, 11%~90%, 12%~89%, 13%~88%, 14%~87%, 15%~86%, 16%~85%, 17%~84%, 18%~83%, 19%~82%, 20%~81%, 21%~80%, 22%~79%, 23%~78%, 24%~77%, 25%~76%, 26%~75%, 27%~74%, 28%~73%, 29%~72%, 30%~71%, 31%~ The engineered U7 hairpin variant sequence has sequence identity of 70%, 32% to 69%, 33% to 68%, 34% to 67%, 35% to 66%, 36% to 65%, 37% to 64%, 38% to 63%, 39% to 62%, 40% to 61%, 41% to 60%, 42% to 59%, 43% to 58%, 44% to 57%, 45% to 56%, 46% to 55%, 47% to 54%, 48% to 53%, 49% to 52%, 50% to 51%). CGGAAAGCCCCU (SEQ ID NO: 4) about 3% to 96.9% (e.g., 4% to 96.8%, 5% to 96.7%, 6% to 96%, 7% to 95%, 8% to 94%, 9% to 93%, 10% to 92%, 11% to 91%, 12% to 90%, 13% to 89%, 14% to 88%, 15% to 87%, 16% to 86%, 17% to 85%, 18% to 84%, 19% to 83%, 20% to 82%, 21% to 81%, 22% to 80%, 23% to 79%, 24% to 78%, 25% to 77%, having sequence identity of 26% to 76%, 27% to 75%, 28% to 74%, 29% to 73%, 30% to 72%, 31% to 71%, 32% to 70%, 33% to 69%, 34% to 68%, 35% to 67%, 36% to 66%, 37% to 65%, 38% to 64%, 39% to 63%, 40% to 62%, 41% to 61%, 42% to 60%, 43% to 59%, 44% to 58%, 45% to 57%, 46% to 56%, 47% to 55%, 48% to 54%, 49% to 53%, 50% to 52%.

[0049] In some embodiments, an engineered RNA (e.g., an engineered guide RNA, ASO) of the present disclosure comprises (a) a targeting sequence having sufficient complementarity to a target RNA and capable of hybridizing to the target RNA, or a combination thereof, (b) an engineered SmOPT variant sequence, and (c) an engineered U7 hairpin variant sequence, wherein when the engineered RNA comprises an engineered SmOPT variant sequence, the engineered SmOPT variant sequence has a sequence similar to or different from SEQ ID NO: 1 or SEQ ID NO: 2, such as N1N2N3N4N5N6N7N8N9N 10 N 11 (SEQ ID NO: 5), and the engineered RNA (e.g., engineered guide RNA, ASO) contains an engineered U7 hairpin variant sequence, the engineered U7 hairpin variant sequence may be N1N2N3N4N5N6N7N8N9N compared to SEQ ID NO: 3 or SEQ ID NO: 4. 10 N 11 N 12 N 13 N 14 N 15 N 16 N 17 N 18 N 19 N 20 N 21 N 22 N 23 N 24 N 25 N 26 N 27 N 28 N 29 N 30 N 31 N 32At least one polynucleotide substitution (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32), 32 or less polynucleotide substitutions (e.g., 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1) or 1 to 32 polynucleotide substitutions or 1 to 31 polynucleotide substitutions (e.g., 2 to 31, 3 to 30, 4 to 29, 5 to 28, 6 to 27, 7 to 26, 8 to 25, 9 to 24, 10 to 23, 11 to 22, 12 to 21, 13 to 20, 14 to 19, 15 to 18, 16 to 17), 31 are independently A, U, G, or C, and n 32 is A, U, G, C, or absent. In some embodiments of the present disclosure, when an engineered RNA (e.g., an engineered guide RNA, ASO) comprises an engineered SmOPT variant sequence, the engineered SmOPT variant sequence is not SEQ ID NO: 1 or SEQ ID NO: 2, or when an engineered RNA comprises an engineered U7 hairpin variant sequence, the engineered U7 hairpin variant sequence is not SEQ ID NO: 3, or the engineered U7 hairpin variant sequence is not SEQ ID NO: 4.

[0050] Some embodiments provide (b) an engineered RNA (e.g., an engineered guide RNA, ASO) of the present disclosure comprising an engineered SmOPT variant sequence, wherein the engineered SmOPT variant sequence comprises at least one polynucleotide substitution (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11), up to 11 polynucleotide substitutions (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, 1), or 1 to 11 polynucleotide substitutions (e.g., 2 to 10, 3 to 9, 4 to 8, 5 to 7) of AAUUUN1UN2N3AG (SEQ ID NO: 7), wherein each of N1, N2, and N3 is independently A, U, G, or C, with the proviso that if N1 of SEQ ID NO: 7 is G, then N2 is A, U, or G, or N3 is A, G, or C, or When N1 of SEQ ID NO:7 is U, at least one of N2 and N3 is A, U, or C; or when N2 of SEQ ID NO:7 is C, N1 is A, U, or C, or N1 is A, G, or C; or when N2 of SEQ ID NO:7 is G, N1 is A, G, or C, or N1 is A, U, or C; or when N3 of SEQ ID NO:7 is U, N1 is A, U, or C, or N2 is A, U, or G; or when N3 of SEQ ID NO:3A is G, N1 is A, G, or C, or N2 is A, U, or C; or when the engineered RNA comprises an engineered SmOPT variant sequence, the engineered SmOPT variant sequence is not SEQ ID NO:1 or SEQ ID NO:2. In some cases, the engineered SmOPT variant may comprise a G to U substitution at nucleotide 6 of SEQ ID NO:1. In some cases, the engineered SmOPT variant may include a G to U substitution at nucleotide 6 of SEQ ID NO: 1. In some cases, the engineered SmOPT variant includes an A to C substitution at nucleotide 1 of SEQ ID NO: 1. In some cases, the engineered SmOPT variant includes a G to A substitution at nucleotide 8 of SEQ ID NO: 2. In some cases, the engineered SmOPT variant includes a G to A, C, or U substitution at nucleotide 9 of SEQ ID NO: 2.In some cases, the engineered SmOPT variant comprises an A to C substitution at nucleotide 10 of SEQ ID NO:2. In some cases, the engineered SmOPT variant comprises a G to A, C, or U substitution at nucleotide 11 of SEQ ID NO:2. In some cases, the 5' end of SEQ ID NO:2 comprises a U or C insertion. In some cases, the 3' end of SEQ ID NO:2 comprises a U or A insertion. In some cases, nucleotides 3, 4, 5, 6, and 7 of SEQ ID NO:2 each comprise a U.

[0051] In some examples, the engineered RNA (e.g., engineered guide RNA, ASO) described herein comprises (c) an engineered U7 hairpin variant sequence, wherein the engineered U7 hairpin variant sequence is 10 CCCN 11 N 12 At least one polynucleotide substitution (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32), up to 32 polynucleotide substitutions (e.g., 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 29, 30, 31, 32), of (SEQ ID NO: 8). , 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1) or 1 to 32 polynucleotide substitutions (e.g., 2 to 31, 3 to 30, 4 to 29, 5 to 28, 6 to 27, 7 to 26, 8 to 25, 9 to 24, 10 to 23, 11 to 22, 12 to 21, 13 to 20, 14 to 19, 15 to 18, 16 to 17), including N1, N2, N3, N4, N5, N6, N7, N8, N9, N 10 , N 11 , and N 12 are independently A, U, G, or C, provided that when N1 of SEQ ID NO: 8 is C, then N2, N7, and N 11 At least one of N3 and N9 is A, G, or C, or at least one of N4 and N5 is U, G, or C, or at least one of N6 and N7 is U, G, or C, or at least one of N8 and N9 is U, G, or C, or at least one of N9 and N1 is U, G, or C, or at least one of N1 and N2 is U, G, or C, or at least one of N3 and N4 is U, G, or C, or at10 At least one of N5, N6, and N8 is A, U, or G, or at least one of N5, N6, and N8 is A, U, or C, and N 12 is A, U, G, C, or absent, or when N1 of SEQ ID NO: 8 is U, N2, N8, and N 11 at least one of N3, N9, and N is A, U, or G; 10 At least one of N4, N5, N6, and N is A, U, or C, or 12 or N7 is U, G, or C; or when N2 of SEQ ID NO: 8 is U, N1, N4, and N 10 at least one of N3 and N9 is A, U, or G, or at least one of N5, N6, and N8 is A, U, or C, or at least one of N7 and N8 is A, U, or C, or at least one of N9 and N10 is A, U, or C, or at least one of N11, N12, and N13 is A, U, or C, or at least one of N12, N13, and N14 is A, U, or C, or at least one of N14, N15, N16, and N17 is A, U, or C, or at least one of N15, N16, and N18 is A, U, or C, or at least one of N16, N17, and N18 is A, U, or C, or at least one of N18, N19, and N20 is A, U, or C, or at least one of N20, N21, and N22 is A, U, or G, 11 At least one of is A, G, or C, and N 12 are A, U, G, C, or absent, or when N2 of SEQ ID NO: 8 is C, N1, N4, N5, N6, and N 12 at least one of N3, N9, and N 10 at least one of N is A, U, or C, or N7 is U, G, or C, or N8 and N 11 At least one of N1, N4, and N5 is A, U, or G, or when N3 of SEQ ID NO: 8 is A, N1, N4, and N5 are A, U, or G. 10 at least one of N2, N7, and N is A, U, or G; 11 at least one of N5, N6, and N8 is A, G, or C, or at least one of N5, N6, and N8 is A, U, or C, or N9 is U, G, or C, and N 12 are A, U, G, C, or absent, or when N3 of SEQ ID NO: 8 is G, N1, N4, N5, N6, and N 12at least one of N2, N8, and N 11 at least one of N7 is A, U, or G, or N9 and N1 are U, G, or C; 10 At least one of N1 and N4 is A, U, or C, or when N4 of SEQ ID NO: 8 is C, N1 and N4 are A, U, or C. 10 at least one of N2, N7, and N is A, U, or G; 11 at least one of N3 and N9 is A, G, or C, or at least one of N5, N6, and N8 is A, U, or C, and N 12 are A, U, G, C, or absent, or when N4 of SEQ ID NO: 8 is U, N1, N5, N6, and N 12 at least one of N2, N8, and N 11 at least one of N3, N9, and N is A, U, or G; 10 or N7 is U, G, or C; or when N5 of SEQ ID NO: 8 is G, N1, N4, and N 10 at least one of N2, N7, and N is A, U, or G; 11 at least one of N3 and N9 is A, G, or C, or at least one of N6 and N8 is A, U, or C, and N 12 are A, U, G, C, or absent, or when N5 of SEQ ID NO: 8 is U, N1, N4, N6, and N 12 at least one of N2, N8, and N 11 at least one of N3, N9, and N is A, U, or G; 10or N7 is U, G, or C; or when N6 of SEQ ID NO: 8 is G, N1, N4, and N 10 at least one of N2, N7, and N is A, U, or G; 11 at least one of N3 and N9 is A, G, or C, or at least one of N5 and N8 is A, U, or C, and N 12 are A, U, G, C, or absent, or when N6 of SEQ ID NO: 8 is U, N1, N4, N5, and N6 ... U, 12 at least one of N2, N8, and N 11 at least one of N3, N9, and N is A, U, or G; 10 or N7 is U, G, or C; or when N7 of SEQ ID NO: 8 is U, N1, N4, and N 10 at least one of is A, U, or G, or N2 and N 11 at least one of N3 and N9 is A, G, or C, or at least one of N5, N6, and N8 is A, U, or C, and N 12 are A, U, G, C, or absent, or when N7 of SEQ ID NO: 8 is A, N1, N4, N5, N6, and N 12 at least one of N2, N8, and N 11 at least one of N3, N9, and N is A, U, or G; 10 or when N8 of SEQ ID NO: 8 is G, N1, N4, and N 10 at least one of N2, N7, and N is A, U, or G; 11at least one of N3 and N9 is A, G, or C, or at least one of N5 and N6 is A, U, or C, and N 12 are A, U, G, C, or absent, or when N8 of SEQ ID NO: 8 is C, N1, N4, N5, N6, and N 12 at least one of N2 and N3 is A, G, or C; 11 at least one of N3, N9, and N is A, U, or G; 10 or N7 is U, G, or C; or when N9 of SEQ ID NO: 8 is A, N1, N4, and N 10 at least one of N2, N7, and N is A, U, or G; 11 at least one of N5, N6, and N8 is A, G, or C, or N3 is U, G, or C, or at least one of N5, N6, and N8 is A, U, or C, and N 12 are A, U, G, C, or absent, or when N9 of SEQ ID NO: 8 is G, N1, N4, N5, N6, and N 12 at least one of N2, N8, and N 11 at least one of N is A, U, or G, or N is U, G, or C, or N and N 10 At least one of is A, U, or C, or N of SEQ ID NO: 8 10 is C, then at least one of N1 and N4 is A, U, or G, or N 2, N7, and N 11 at least one of N3 and N9 is A, G, or C, or at least one of N5, N6, and N8 is A, U, or C, and N 12is A, U, G, C, or is absent, or N of SEQ ID NO: 8 10 If G, then N1, N4, N5, N6, and N 12 at least one of N2, N8, and N 11 or at least one of N3 and N9 is A, U, or C, or N7 is U, G, or C, or N of SEQ ID NO: 8 11 If U, then N1, N4, and N 10 at least one of N2 and N7 is A, G, or C, or at least one of N3 and N9 is U, G, or C, or at least one of N5, N6, and N8 is A, U, or C, and N 12 is A, U, G, C, or is absent, or N of SEQ ID NO: 8 11 If C, then N1, N4, N5, N6, and N 12 At least one of N2 and N8 is A, G, or C, or at least one of N3, N9, and N 10 at least one of N is A, U, or C, or N is U, G, or C, or N of SEQ ID NO: 8 12 If does not exist, N1, N4, and N 10 at least one of N2, N7, and N is A, U, or G; 11 at least one of N3 and N9 is A, G, or C, or at least one of N5, N6, and N8 is A, U, or C, or N of SEQ ID NO: 8 12 is U, then at least one of N1, N4, N5, and N6, or N2, N8, and N 11 at least one of N3, N9, and N is A, U, or G; 10is A, U, or C, or N7 is U, G, or C.

[0052] In some embodiments, when an engineered RNA (e.g., an engineered guide RNA, ASO) contains an engineered SmOPT variant sequence (b), the engineered Sm or Sm-like protein binding domain sequence contains at least one polynucleotide substitution compared to the wild-type or unmodified Sm or Sm-like protein binding domain polynucleotide sequence of SEQ ID NO: 1 or the SmOPT sequence of SEQ ID NO: 2. One type of spliceosomal protein is commonly found in small nuclear ribonucleoproteins (snRNPs), including the Sm proteins found in the nuclei of eukaryotic cells. snRNPs are involved in several different functions, including pre-mRNA splicing, rRNA processing, histone mRNA 3'-end processing, telomere replication, tRNA maturation, and more. Sm and Sm-like proteins are not only small proteins (approximately 8-28 kDa), but are also members of a family of polypeptides in eukaryotes that share a common domain known as the Sm domain. The engineered RNA sequences or spliceosomal sequences disclosed herein may, in some instances, comprise an Sm or Sm-like protein-binding domain derived from a spliceosomal small RNA (snRNA) or a non-spliceosomal snRNA, and a hairpin derived from a spliceosomal snRNA or a non-spliceosomal snRNA. In some embodiments, SEQ ID NO: 1 may comprise the U1Sm sequence (AAUUUGUGGAG SEQ ID NO: 20) or the U7Sm sequence (AAUUUGUCUAG SEQ ID NO: 21).

[0053] In some embodiments, when an engineered RNA (e.g., an engineered guide RNA, ASO) described herein comprises an RNA element of the engineered SmOPT variant sequence of (b) (e.g., an RNA element having a polynucleotide sequence of any one of SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:60, SEQ ID NO:61, or SEQ ID NO:62), the engineered SmOPT variant sequence comprises at least one polynucleotide substitution (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11), up to 11 polynucleotide substitutions (e.g., 10, 9, 8, 7, 6, 5, 4, 3, 2, 1), or 1 to 11 polynucleotide substitutions (e.g., 2 to 10, 3 to 9, 4 to 8, 5 to 7), and the polynucleotide substitutions of the sequence of (b) as used herein are AAUUUGUSKAG (

[0023] The term "SmOPT sequence" refers to one or more nucleoside or base changes in a wild-type or unmodified Sm or Sm-like protein binding domain sequence, including the engineered SmOPT variant sequence described, wherein the engineered guide RNA has at least one polynucleotide substitution, and the engineered SmOPT variant sequence maintains sufficient function and activity to facilitate increased RNA levels or increased editing of nucleotide bases in a target RNA by an RNA editing entity, as determined by an in vitro assay, such as, but not limited to, RNA sequencing, compared to other equivalent RNAs that lack the engineered SmOPT variant sequence or the engineered Sm or Sm-like protein binding domain sequence.

[0054] Some embodiments of the present disclosure provide engineered RNAs (e.g., engineered guide RNAs, ASOs) as described herein, wherein when the engineered RNA (e.g., engineered guide RNAs, ASOs) comprises an engineered U7 hairpin variant sequence RNA element (such as an RNA element having the polynucleotide sequence of any one of SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:60, SEQ ID NO:61, or SEQ ID NO:62), the engineered U7 hairpin variant sequence comprises at least one polynucleotide substitution (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, , 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30), 32 or fewer polynucleotide substitutions (e.g., 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1), or 1 to 30 polynucleotide substitutions (e.g., 2 to 29, 3 to 28, 4 to 27, 5 to 26, 6 to 25, 7 to 24, 8 to 23, 9 to 22, 10 to 21 , 11-20, 12-19, 13-18, 14-17, 15-16), and as used herein, (c) a polynucleotide substitution in a hairpin refers to, for example, CAGGUUUUCUGACUUCGGUCGGAAAACCCCU (SEQ ID NO: 3) or a change in one or more nucleosides or bases in a wild-type or unmodified mouse U7 hairpin. When an engineered RNA (e.g., an engineered guide RNA, ASO) contains an RNA element of an engineered U7 hairpin variant sequence, the engineered U7 hairpin variant sequence includes at least one polynucleotide substitution. Nucleotide substitutions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31), up to 31 polynucleotide substitutions (e.g., 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1), or 1 to 31 polynucleotide substitutions (e.g., 2 to 29, 3 to 28, 4 to 27, 5 to 26, 6 to 25,As used herein, a polynucleotide substitution in a hairpin (c) refers to, for example, UAGGCUUUCUGGCUUUUUACCGGAAAGCCCCU (SEQ ID NO: 4) or one or more nucleoside or base changes in a wild-type or unmodified human U7 hairpin sequence. In some embodiments, an engineered guide RNA comprising an RNA element of a described engineered U7 hairpin variant sequence with at least one polynucleotide substitution maintains sufficient function and activity to facilitate increased RNA levels or increased amount of nucleotide base editing of a target RNA by an RNA editing entity, as determined by an in vitro assay, such as, but not limited to, RNA sequencing, compared to an otherwise equivalent guide RNA lacking the engineered U7 hairpin variant sequence.

[0055] In some embodiments, the engineered U7 hairpin variant sequence comprises a G insertion at nucleotide 3 of SEQ ID NO:3. In some cases, the engineered U7 hairpin variant sequence comprises an A to U substitution at nucleotide 2 of SEQ ID NO:3. In some cases, the engineered U7 hairpin variant sequence comprises a U to G, C, or A substitution at nucleotide 5 of SEQ ID NO:3. In some cases, the engineered U7 hairpin variant sequence comprises a U to C substitution at nucleotide 6 of SEQ ID NO:3. In some cases, the engineered U7 hairpin variant sequence comprises a U to G substitution at nucleotide 8 of SEQ ID NO:3. In some cases, the engineered U7 hairpin variant sequence comprises a U to C or A substitution at nucleotide 10 of SEQ ID NO:3. In some cases, the engineered U7 hairpin variant sequence comprises a G to C substitution at nucleotide 11 of SEQ ID NO:3. In some cases, the engineered U7 hairpin variant sequence comprises an A to C substitution at nucleotide 12 of SEQ ID NO:3.

[0056] In some examples, the engineered guide RNAs herein provide (a) a targeting sequence, (b) an engineered Sm or Sm-like protein binding domain sequence, e.g., an engineered SmOPT variant sequence, and (c) an engineered U7 hairpin variant sequence, as well as an engineered SmOPT variant sequence, wherein the engineered U7 hairpin variant facilitates increased RNA levels or increased editing of nucleotide bases of a target RNA by an RNA editing entity compared to an otherwise equivalent guide RNA lacking the engineered SmOPT variant sequence, the engineered U7 hairpin variant sequence, or both, as determined by an in vitro assay, such as, but not limited to, RNA sequencing.

[0057] In some instances, the engineered RNA (e.g., engineered guide RNA, ASO) comprises an engineered Sm or Sm-like protein binding domain. In some embodiments, (b) the engineered RNA (e.g., engineered guide RNA, ASO) comprising an engineered Sm or Sm-like protein binding domain can have at least one polynucleotide substitution compared to the unmodified Sm or Sm-like protein binding domain polynucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2. Some embodiments can provide an engineered RNA (e.g., engineered guide RNA, ASO) comprising an engineered Sm or Sm-like protein binding domain with two, three, or four polynucleotide substitutions compared to the unmodified Sm or Sm-like protein binding domain polynucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

[0058] Some embodiments may provide an engineered RNA (e.g., an engineered guide RNA, ASO) comprising an engineered U7 hairpin variant sequence. In some instances, the engineered U7 hairpin variant sequence may comprise at least one polynucleotide substitution compared to the unmodified hairpin polynucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4. Some embodiments may provide an engineered U7 hairpin variant sequence having 2 to 15 polynucleotide substitutions compared to the unmodified hairpin polynucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4. In further instances, the engineered U7 hairpin variant sequence may have 2, 3, 5, or 10 polynucleotide substitutions compared to the unmodified hairpin polynucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4.

[0059] In some embodiments, an engineered RNA of the present disclosure comprises, from 5' to 3', (a) a targeting sequence, (b) an engineered Sm or Sm-like protein binding domain variant of the present disclosure, and (c) an engineered U7 hairpin variant sequence of the present disclosure. In some embodiments, an engineered RNA of the present disclosure may comprise a wild-type Sm or Sm-like protein binding domain and an engineered U7 hairpin variant sequence of the present disclosure. In some embodiments, an engineered RNA of the present disclosure may comprise an engineered Sm or Sm-like protein binding domain variant of the present disclosure and a wild-type U7 hairpin sequence.

[0060] In some embodiments of the present disclosure, an engineered RNA comprising a targeting sequence and an RNA element of an engineered SmOPT variant sequence (e.g., a modified or variant Sm or Sm-like protein binding domain) and an engineered U7 hairpin variant sequence (e.g., a modified or variant U7 hairpin, a modified or variant mouse U7 snRNA hairpin, a modified or variant human U7 snRNA hairpin) can be located 3' of at least one mismatch that occurs when the targeting sequence and the target RNA are hybridized.

[0061] Engineered RNA The engineered RNAs described herein (e.g., engineered guide RNAs, antisense oligonucleotides (ASOs)) comprise a targeting sequence that can be operably linked to an RNA element (e.g., an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, and combinations thereof, e.g., an element having the polynucleotide sequence of any one of SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:60, SEQ ID NO:61, or SEQ ID NO:62). In some embodiments, the engineered RNAs described herein comprise a targeting sequence that enables the engineered RNA to hybridize to a target RNA or a region of a target RNA molecule. In some embodiments, the engineered RNAs described herein (e.g., engineered guide RNAs, antisense oligonucleotides) comprise a targeting sequence that is sufficiently complementary to the target RNA for hybridization of the engineered RNA and the target RNA. Various embodiments include engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides) that comprise a targeting sequence operably linked to an RNA element, such as an engineered SmOPT variant sequence. In other embodiments, the engineered RNA (e.g., engineered RNA, antisense oligonucleotide) of the present disclosure comprises a targeting sequence operably linked to an RNA element, such as an engineered U7 hairpin variant sequence. Some embodiments of the present disclosure provide an engineered RNA (e.g., engineered guide RNA, antisense oligonucleotide) comprising an engineered SmOPT variant sequence and a targeting sequence operably linked to an engineered U7 hairpin variant sequence.

[0062] Targeting Sequence The engineered RNA disclosed herein can be engineered or designed in any manner suitable for RNA editing or RNA interaction, processing or expression modification.In some examples, engineered RNA generally comprises at least a targeting sequence that can hybridize with the target RNA or target RNA molecule region, which are interchangeable herein, or in some embodiments, has target complementarity with the target RNA or target RNA molecule region, which are interchangeable herein.Targeting sequence is also referred to as "targeting domain" or "targeting region", which can be interchangeably used herein.

[0063] In some cases, the targeting sequence of the engineered RNA described herein allows the engineered guide RNA to target an RNA sequence by base pairing, such as Watson-Crick base pairing. In some cases, the targeting sequence can be located at either the N-terminus or C-terminus of the engineered RNA. In some cases, the targeting sequence can be located at both ends. The targeting sequence can be of any length. In some cases, the targeting sequence can be at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 1 0, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85 5, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122 , 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or up to about 200 nucleotides in length.In some cases, the targeting sequence is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41 , 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122 , 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or 200 nucleotides in length or less. In some examples, the engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides) of the present disclosure comprise a targeting sequence that can be about 60 to about 500, about 60 to about 200, about 75 to about 100, about 80 to about 200, about 90 to about 120, or about 95 to about 115 nucleotides in length. In some examples, the engineered RNAs described herein comprise a targeting sequence that can be about 100 nucleotides in length.

[0064] In some cases, the targeting domain comprises 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity with the target RNA, which is sufficient complementarity to hybridize with the target RNA.In some cases, the targeting sequence comprises less than 100% complementarity with the target RNA sequence, and can partially hybridize with the target RNA.For example, the targeting sequence and the region of the target RNA that can be bound by the targeting sequence can have a single base mismatch.

[0065] Some embodiments of the present disclosure provide engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides) described herein that include a targeting sequence that is complementary or sufficiently complementary to the target RNA, thereby providing partial or complete hybridization of the targeting sequence and the target RNA to form a guide-target RNA scaffold. A "guide-target RNA scaffold" as disclosed herein refers to the resulting double-stranded RNA formed upon hybridization of a guide RNA with a potential structure and a target RNA. The guide-target RNA scaffold has one or more structural features that form within the double-stranded RNA duplex upon hybridization. For example, the guide-target RNA scaffold may have one or more structural features selected from a bulge, a mismatch, an internal loop, a hairpin, or a wobble base pair. Various aspects of the present disclosure provide targeting sequences that are fully complementary to the target RNA. In some examples, the engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides) of the present disclosure include a targeting sequence that is substantially complementary to the target RNA. Useful targeting sequences of the present disclosure can have sufficient complementarity to the target RNA.

[0066] As used herein, "sufficient complementarity" can mean at least 5 nucleotides (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600), or 600 or fewer nucleotides (e.g., 550, 450, 350, 250, 150, 105, 95, 85, 75, 65, 55, 45, 35, 25, 15, 5) of the engineered RNA are complementary to the target RNA. Complementary to or base-paired to the target RNA can mean that 5-600 nucleotides (e.g., 10-550, 15-450, 20-350, 25-250, 30-150, 35-105, 40-95, 45-85, 50-75, 55-65) of the engineered RNA are complementary to or base-paired to the target RNA, and at least 70% (e.g., 71%, 72%, 73%, 74%, 75%) of the engineered RNA nucleotides are complementary to or base-paired to the target RNA. %, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% can mean complementary to the target RNA, and 100% or less (e.g., 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 89%, 88%, 87%, 86%, 85%, 84%, 83%, 82%, 81%, 80%, 79% , 78%, 77%, 76%, 75%, 74%, 73%, 72%, 71%, 70%, or it can mean that at least 70% to 100% (e.g., 71% to 99%, 72% to 98%, 73% to 97%, 74% to 96%, 75% to 95%, 76% to 94%, 77% to 93%, 78% to 92%, 79% to 91%, 80% to 90%, 81% to 89%, 82% to 88%, 83% to 87%, 84% to 86%) of the engineered RNA nucleotides are complementary to the target RNA.

[0067] In some examples, an engineered RNA (e.g., an engineered guide RNA, ASO) as described herein may include a targeting sequence that has target complementarity to a splice signal proximal to an exon within the target RNA.

[0068] Some embodiments can provide an engineered RNA as described herein, wherein the targeting sequence has target complementarity to (a) a branch point upstream of an exon in the target RNA, or (b) a donor splice site downstream of an exon in the target RNA. In some embodiments, the engineered RNA (e.g., engineered guide RNA, ASO) of the present disclosure can include a targeting sequence that has target complementarity to (a) a 3' or 5' untranslated region (UTR) of the target RNA, (b) a translation start site, (c) an intron region of the target RNA, or (d) an exon region of the target RNA.

[0069] In some embodiments, a double-stranded RNA (dsRNA) substrate is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The resulting dsRNA substrate is also referred to herein as a "guide-target RNA scaffold." Described herein are "structural features" that may be present in a guide-target RNA scaffold of the present disclosure. Examples of structural features include mismatches, bulges (symmetric or asymmetric), internal loops (symmetric or asymmetric internal loops), or hairpins (recruiting or non-recruiting hairpins). An engineered guide RNA of the present disclosure can have between 1 and 50 features. An engineered guide RNA of the present disclosure can have 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 5-20, 1-3, 4-5, 2-10, 20-40, 10-40, 20-50, 30-50, 4-7, or 8-10 features. In some embodiments, upon hybridization of a potential engineered guide RNA with a target RNA, a structural feature (e.g., a mismatch, a bulge, an internal loop) can be formed from the potential structure of the engineered potential guide RNA, thereby forming a guide-target RNA scaffold. The term "potential engineered guide RNA" refers to an engineered guide RNA that includes a portion of its sequence that, upon hybridization to a target RNA, or only upon hybridization, substantially forms at least a portion of a structural feature other than a single A / C mismatch feature at the target adenosine being edited. In some embodiments, the structural feature is not formed from a latent structure, but instead is a preformed structure (eg, a GluR2 recruitment hairpin or a hairpin derived from U7 snRNA).

[0070] In some embodiments, upon hybridization of a described engineered RNA (e.g., an engineered guide RNA, an antisense oligonucleotide) with a described target RNA, or at least a portion thereof, such as a targeting sequence described herein, one or more structural features (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25), up to 50 structural features (e.g., 49, 48, 47, 46, 45, 40, 35, 30, 25, 20, 15, 10, 5, 1), or between 1 and 50 structural features (e.g., 2-49, 3-48, 4-47, 5-46, 6-45, , 7-44, 8-43, 9-42, 10-41, 11-40, 12-39, 13-38, 14-37, 15-36, 16-35, 17-34, 18-33, 19-32, 20-31, 21-30, 22-29, 23-28, 24-27, 25-26, 1-5, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 5-20, 1-3, 4-5, 2-10, 20-40, 10-40, 20-50, 30-50, 4-7, 8-10), wherein the one or more structural features are selected from the group consisting of a bulge, a mismatch, an internal loop, a hairpin, a wobble base pair, and any combination thereof.

[0071] In some embodiments, the targeting sequences described herein can be formed or configured to have at least one mismatched nucleotide (e.g., 2, 3, 4, 5) when hybridized to a target RNA. In some instances, a structural feature of the guide-target RNA scaffold formed upon hybridization of an engineered RNA and a target RNA of the present disclosure can include a wobble base pair, where a wobble base pair refers to two bases that weakly pair. For example, a wobble base pair of the present disclosure can refer to a G paired with a U.

[0072] Some examples of the present disclosure provide engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides) described herein, which include a targeting sequence in which at least one mismatch is formed upon hybridization of the targeting sequence to the target RNA, the at least one mismatch comprising at least one adenosine-guanosine (AG) mismatch, at least one adenosine-adenosine (AA) mismatch, or at least one adenosine-cytidine (AC) mismatch, where the adenosine (A) in the mismatch may be present in the target RNA. In examples of the present disclosure, the engineered RNAs described herein may have at least one mismatch comprising an AC mismatch, where the adenosine in the mismatch may be present in the target RNA. Some embodiments provide that the at least one mismatch may be located from about 1 base to about 200 bases from either end of the targeting sequence.

[0073] Some aspects of the present disclosure provide engineered RNAs comprising targeting sequences that can fully or partially hybridize to a target RNA, for example, under stringent, moderate, or weak hybridization conditions, thereby forming a guide-target RNA scaffold. In some examples, the guide-target RNA scaffold comprises at least one structural feature. "Stringent hybridization conditions" refers, for example, to overnight incubation at 42°C in a solution containing 50% formamide, 5xSSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5xDenhardt's solution, 10% dextran sulfate, and 20 μg / mL denatured, sheared salmon sperm DNA, followed by a wash in 0.1xSSC at approximately 65°C. In some embodiments, the engineered RNAs of the present disclosure can hybridize to the target RNAs of the present disclosure under low stringency hybridization conditions. Varying the stringency of hybridization can be achieved by manipulating formamide concentration (lower percentages of formamide result in lower stringency), salt conditions, or temperature. For example, lower stringency conditions include overnight incubation at 37°C in a solution containing 6x SSPE (20x SSPE = 3M NaCl, 0.2M NaH2PO4, 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, and 100 μg / mL salmon sperm-blocked DNA, followed by a wash in 1x SSPE, 0.1% SDS at 50°C. In addition, to achieve even lower stringency, washes following stringent hybridization can be performed at higher salt concentrations (e.g., 5x SSC).

[0074] Antisense oligonucleotides Engineered RNA In some embodiments, the engineered RNA of the present disclosure may be an antisense oligonucleotide (also referred to as an ASO) containing short, chemically modified, or synthetic single-stranded nucleotides. Some examples are directed to engineered RNAs that may be antisense oligonucleotides substantially complementary to a target RNA. ASOs are chemically modified or synthetic DNA or RNA that may be substantially or fully complementary to a target sequence and may be designed or configured to inhibit, cover, mask, or block the target sequence. Given their short length, ASOs may be chemically modified to avoid degradation. ASOs may be DNA or RNA, but the DNA does not encode RNA. In some embodiments of the present disclosure, the delivered antisense oligonucleotide may be RNA itself or DNA encoding RNA. Described herein are engineered RNA antisense oligonucleotides that are modified or altered from naturally occurring RNA and can regulate or alter RNA interaction, processing, expression, or a combination thereof. In some cases, ASOs designed or configured to inhibit, cover, mask, or block a target sequence of a target RNA promote exon skipping of exons in the target sequence. Methods have been used to induce exon skipping of protein-coding transcripts.In many cases, some proteins, such as alpha-synuclein and DMD, can be expressed as different splice variants, some of which may be involved in disease.By promoting exon skipping events, it is thought that exons containing mutations involved in certain diseases can be bypassed or codon reading frames can be restored, thereby facilitating the translation of variants sufficient to correct certain diseases or disorders or alleviate the symptoms of certain diseases or disorders.

[0075] Some examples described herein include fragments of 5 or more nucleotides (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50), fragments of 50 or less nucleotides (e.g., 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 25, 20, 15, 10, 5), or fragments of 5 to 50 nucleotides. The present disclosure provides antisense oligonucleotides comprising a single strand of an nucleotide (e.g., 6-49, 7-48, 8-47, 9-46, 10-45, 11-44, 12-43, 13-42, 14-41, 15-40, 16-39, 17-38, 18-37, 19-36, 20-35, 21-34, 22-33, 23-32, 24-31, 25-30), which inhibit or block gene expression by hybridizing to a target RNA. In some embodiments, the ASO is about 10 to about 200 nucleotides in length (e.g., about 10 to about 180 nucleotides, about 15 to about 100 nucleotides, about 15 to about 60 nucleotides, about 20 to about 50 nucleotides, or about 20 to about 40 nucleotides in length).

[0076] In some embodiments, the antisense oligonucleotides described herein may contain modifications. The modifications may be substitutions, insertions, deletions, chemical modifications, physical modifications, stabilization, purification, or any combination thereof. In some cases, the modifications may be chemical modifications. Antisense oligonucleotides may contain chemical modifications, for example, to avoid degradation in view of their short length. Suitable chemical modifications include 5' adenylate, 5' guanosine triphosphate cap, 5' N7-methylguanosine triphosphate cap, 5' triphosphate cap, 3' phosphate, 3' thiophosphate, 5' phosphate, 5' thiophosphate, Cis-Syn thymidine dimer, trimer, C 12Spacer, C3 spacer, C6 spacer, d spacer, PC spacer, r spacer, spacer 18, spacer 9, 3'-3' modification, 5'-5' modification, abasic site, acridine, azobenzene, biotin, biotin BB, biotin TEG, cholesteryl TEG, desthiobiotin TEG, DNP TEG, DNP-X, DOTA, dT-biotin, double biotin, PC-biotin, psoralen C2, psoralen C6, TINA, 3'DABCYL, black hole quencher 1, black hole quencher 2, DABCYL SE, dT-DABCYL, IRDye The antisense oligonucleotide may comprise any one of QC-1, QSY-21, QSY-35, QSY-7, QSY-9, a carboxyl linker, a thiol linker, a 2' deoxyribonucleoside analog purine, a 2' deoxyribonucleoside analog pyrimidine, a ribonucleoside analog, a 2'-O-methylribonucleoside analog, a sugar-modified analog, a wobble / universal base, a fluorescent dye label, a 2' fluoroRNA, a 2' O-methyl RNA, a methylphosphonate, a phosphodiester DNA, a phosphodiester RNA, a phosphothioate DNA, a phosphorothioate RNA, a UNA, a pseudouridine-5'-triphosphate, a 5-methylcytidine-5'-triphosphate, a 2-O-methyl 3 phosphorothioate, or any combination thereof. In some embodiments, the antisense oligonucleotide does not comprise a chemical modification.

[0077] Chemical modification can be performed at any position of ASO, engineered guide RNA, or other RNA payload. In some cases, the modification can be located at the 5'-end or 3'-end. In some cases, the polynucleotide can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85 5, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 1 The modified bases include those selected from 22, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, or 150. More than one modification can be made to an ASO, engineered guide RNA, or other RNA payload. In some cases, the modification can be permanent. In other cases, the modification can be transient. In some cases, multiple modifications can be made to an engineered RNA (ASO, engineered guide RNA, or other RNA payload). Modifications to an engineered RNA can alter the physicochemical properties of the nucleotide, such as nucleotide conformation, polarity, hydrophobicity, chemical reactivity, base pairing interactions, or any combination thereof.

[0078] Chemical modifications can also be phosphorothioate substitutions. In some cases, natural phosphodiester bonds can be susceptible to rapid degradation by cellular nucleases, and modification of internucleotide linkages using phosphorothioate (PS) bond substitutes can make them more stable against hydrolysis by cellular degradation. The modification can increase stability in polynucleic acids. The modification can also enhance biological activity. In some cases, phosphorothioate-enhanced RNA polynucleic acids can inhibit RNase A, RNase T1, calf serum nuclease, or any combination thereof. These properties can enable the use of PS-RNA polynucleic acids to be used in applications where exposure to nucleases is highly likely in vivo or in vitro. For example, phosphorothioate (PS) bonds can be introduced between the last 3-5 nucleotides at the 5' or 3' end of the polynucleic acid, which can inhibit exonuclease degradation. In some cases, phosphorothioate bonds can be added throughout the polynucleic acid to reduce attack by endonucleases.

[0079] In some embodiments, chemical modifications may occur at the 3'OH group, 5'OH group, backbone, sugar moiety, or nucleotide base. Chemical modifications may include non-naturally occurring linker molecules in interstrand or intrastrand crosslinks. In one aspect, chemically modified nucleic acids include modifications of one or more of the 3'OH or 5'OH group, backbone, sugar moiety, or nucleotide base, or the addition of non-naturally occurring linker molecules. In some embodiments, the chemically modified backbone includes a backbone other than a phosphodiester backbone. In some embodiments, the modified sugar includes a sugar other than deoxyribose (in modified DNA) or a sugar other than ribose (in modified RNA). In some embodiments, the modified base includes a base other than adenine, guanine, cytosine, thymine, or uracil. In some embodiments, the engineered RNA (ASO, engineered guide RNA, or other RNA payload) includes at least one chemically modified base. In some cases, the engineered RNA contains 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more modified bases. In some cases, chemical modifications to the base moiety include adenine, guanine, cytosine, thymine, or uracil, and natural and synthetic modifications of purine or pyrimidine bases.

[0080] In some embodiments, at least one chemical modification of the engineered RNA comprises modification of one or both of the non-linking phosphate oxygens in the phosphodiester backbone linkages, modification of one or more of the linking phosphate oxygens in the phosphodiester backbone linkages, modification of a component of the ribose sugar, replacement of a phosphate moiety with a "dephospho" linker, modification or replacement of a naturally occurring nucleobase, modification of the ribose-phosphate backbone, modification of the 5' end of the polynucleotide, modification of the 3' end of the polynucleotide, modification of the deoxyribose phosphate backbone, replacement of a phosphate group, modification of the ribophosphate backbone, modification to the sugar of the nucleotide, modification to the base of the nucleotide, or any one or any combination of stereochemically pure modifications of the nucleotide. Chemical modifications to the engineered RNA include any of the modifications encompassed herein, although some exemplary modifications are listed in Table 1. [Table 1-1] [Table 1-2]

[0081] Modification of the phosphate backbone In some embodiments, chemical modifications include modification of one or both of the non-linking phosphate oxygens in the phosphodiester backbone linkages or modification of one or more of the linking phosphate oxygen atoms in the phosphodiester backbone linkages. As used herein, "alkyl" is meant to refer to a saturated hydrocarbon group that may be straight-chain or branched. Exemplary alkyl groups include methyl (Me), ethyl (Et), propyl (e.g., n-propyl or isopropyl), butyl (e.g., n-butyl, isobutyl, or t-butyl), or pentyl (e.g., n-pentyl, isopentyl, or neopentyl). Alkyl groups can contain 1 to about 20, 2 to about 20, 1 to about 12, 1 to about 8, 1 to about 6, 1 to about 4, or 1 to about 3 carbon atoms. As used herein, "aryl" can refer to a monocyclic or polycyclic (e.g., having 2, 3, or 4 fused rings) aromatic hydrocarbon, such as, for example, phenyl, naphthyl, anthracenyl, phenanthrenyl, indanyl, or indenyl. In some embodiments, aryl groups have 6 to about 20 carbon atoms. As used herein, "alkenyl" may refer to an aliphatic group containing at least one double bond. As used herein, "alkynyl" may refer to a straight or branched hydrocarbon chain containing 2 to 12 carbon atoms and characterized by one or more triple bonds. Examples of alkynyl groups include ethynyl, propargyl, or 3-hexynyl. "Arylalkyl" or "aralkyl" may refer to an alkyl moiety in which an alkyl hydrogen atom is replaced by an aryl group. Aralkyl includes groups in which more than one hydrogen atom is replaced by an aryl group. Examples of "arylalkyl" or "aralkyl" include benzyl, 2-phenylethyl, 3-phenylpropyl, 9-fluorenyl, benzhydryl, and trityl groups. "Cycloalkyl" may refer to a cyclic, bicyclic, tricyclic, or polycyclic non-aromatic hydrocarbon group having 3 to 12 carbon atoms. Examples of cycloalkyl moieties include, but are not limited to, cyclopropyl, cyclopentyl, and cyclohexyl. "Heterocyclyl" can refer to a monovalent radical of a heterocyclic ring system.Representative heterocyclyls include, but are not limited to, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, pyrrolidonyl, piperidinyl, pyrrolinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, and morpholinyl. "Heteroaryl" can refer to a monovalent radical of a heteroaromatic ring system. Examples of heteroaryl moieties can include imidazolyl, oxazolyl, thiazolyl, triazolyl, pyrrolyl, furanyl, indolyl, thiophenylpyrazolyl, pyridinyl, pyrazinyl, pyridazinyl, pyrimidinyl, indolizinyl, purinyl, naphthyridinyl, quinolyl, and pteridinyl.

[0082] In some embodiments, the phosphate group of a chemically modified nucleotide can be modified by replacing one or more oxygen atoms with another substituent. In some embodiments, a chemically modified nucleotide can include replacing an unmodified phosphate moiety with a modified phosphate as described herein. In some embodiments, the modification of the phosphate backbone can include a change that results in either an uncharged linker or a charged linker with asymmetric charge distribution. Examples of modified phosphate groups can include phosphorothioates, phosphonothioacetates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. In some embodiments, one of the non-bridging phosphate oxygen atoms in the phosphate backbone moiety can be replaced with any of the following groups: sulfur (S), selenium (Se), BR3 (where R can be, for example, hydrogen, alkyl, or aryl), C (e.g., an alkyl group, an aryl group, etc.), H, NR2 (where R can be, for example, hydrogen, alkyl, or aryl, or where R can be, for example, alkyl or aryl). The phosphorus atom of an unmodified phosphate group can be achiral. However, by replacing one of the non-bridging oxygens with one of the atoms or groups of atoms described above, the phosphorus atom can be made chiral. The phosphorus atom in such a modified phosphate group can be an asymmetric center. The stereogenic phosphorus atom can have either the "R" configuration (herein Rp) or the "S" configuration (herein Sp). In some cases, an ASO can include a stereochemically pure nucleotide containing a phosphorothioate S conformation or a phosphorothioate R conformation. In some embodiments, the chiral phosphate product may be present in a diastereomeric excess of 50%, 60%, 70%, 80%, 90% or more, hi some embodiments, the chiral phosphate product may be present in a diastereomeric excess of 95%.In some embodiments, the chiral phosphate product may be present in 96% diastereomeric excess. In some embodiments, the chiral phosphate product may be present in 97% diastereomeric excess. In some embodiments, the chiral phosphate product may be present in 98% diastereomeric excess. In some embodiments, the chiral phosphate product may be present in 99% diastereomeric excess. In some embodiments, both non-bridging oxygens of the phosphorodithioate may be replaced with sulfur. The phosphorus center of the phosphorodithioate may be achiral, preventing the formation of oligoribonucleotide diastereomers. In some embodiments, modifications to one or both non-bridging oxygens may include replacing the non-bridging oxygens with a group independently selected from S, Se, B, C, H, N, and OR (R may be, for example, alkyl or aryl). In some embodiments, the phosphate linker can also be modified by replacement of the bridging oxygen (i.e., the oxygen linking the phosphate to the nucleoside), nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate), and carbon (bridged methylene phosphonate). Replacement can occur at either or both of the linking oxygens.

[0083] In certain embodiments, nucleic acids include linked nucleic acids. Nucleic acids can be linked together using any internucleic acid linkage. Two major classes of internucleic acid linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleic acid linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (P=S). Representative non-phosphorus-containing internucleic acid linkages include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiesters (-OC(O)-S-), thionocarbamate (-OC(O)(NH)-S-), siloxane (-O-Si(H)2-O-), and N,N*-dimethylhydrazine (-CH2-N(CH3)-N(CH3)). In certain embodiments, nucleic acid linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers, such as alkylphosphonates and phosphorothioates. Non-natural nucleic acids can contain a single modification. Non-natural nucleic acids can contain multiple modifications within one of the moieties or between different moieties.

[0084] Backbone phosphate modifications to nucleic acids include, but are not limited to, methylphosphonates, phosphorothioates, phosphoramidates (bridged or unbridged), phosphotriesters, phosphorodithioates, phosphodithioates, and boranophosphates, which may be used in any combination. Other non-phosphate linkages may also be used.

[0085] In some embodiments, backbone modifications (e.g., methylphosphonate, phosphorothioate, phosphoramidate, and phosphorodithioate internucleotide linkages) can confer immunomodulatory activity to the modified nucleic acids and / or enhance their in vivo stability.

[0086] In some cases, the phosphorus derivative (or modified phosphate group) can be and may be attached to a sugar or sugar analog moiety in the form of a monophosphate, diphosphate, triphosphate, alkylphosphonate, phosphorothioate, phosphorodithioate, phosphoramidate, etc.

[0087] In some cases, backbone modifications include replacing phosphodiester linkages with alternative moieties such as anionic, neutral, or cationic groups. Examples of such modifications include anionic internucleoside linkages, N3'-P5' phosphoramidate modifications, boranophosphate DNA, prooligonucleotides, neutral internucleoside linkages such as methylphosphonates, amide-linked DNA, methylene (methylimino) linkages, formacetal and thioformacetal linkages, backbones containing sulfonyl groups, morpholino oligos, peptide nucleic acids (PNAs), and positively charged deoxyribonucleic guanidine (DNG) oligos. Modified nucleic acids can include chimeric or mixed backbones containing one or more modifications, for example, a combination of phosphate linkages, such as a combination of phosphodiester and phosphorothioate linkages.

[0088] Alternatives to phosphate include, for example, short-chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short-chain heteroatom or heterocyclic internucleoside linkages. These include morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonic acid and sulfonamide backbones, amide backbones, and others with a mixture of N, O, S, and CH2 building blocks. It is also understood that both the sugar and phosphate moieties of a nucleotide can be replaced, for example, with an amide-type linkage (aminoethylglycine) (PNA). For example, it may be possible to link other types of molecules (conjugates) to nucleotides or nucleotide analogs to enhance cellular uptake.Conjugates can be chemically bound to nucleotides or nucleotide analogs.Such conjugates include, but are not limited to, cholesterol moieties, thioethers such as hexyl-S-tritylthiol, thiocholesterol, aliphatic chains such as dodecanediol or undecyl residues, phospholipids such as dihexadecyl-lactoglycerol or triethylammonium l-di-O-hexadecyl-lactoglycero-SH-phosphonate, polyamines or polyethylene glycol chains, or lipid moieties such as adamantane acetic acid, palmityl moieties, or octadecylamine or hexylamino-carbonyl-oxycholesterol moieties.

[0089] In some embodiments, the chemical modifications described herein include modifications of the phosphate backbone. In some embodiments, the engineered RNAs (ASOs, engineered guide RNAs, or other RNA payloads) described herein include at least one chemically modified phosphate backbone. Exemplary chemical modifications of the phosphate group or backbone may include replacing one or more of the oxygens with another substituent. Furthermore, modified nucleotides present in the engineered RNA may include replacing an unmodified phosphate moiety with a modified phosphate described herein. In some embodiments, the phosphate backbone modification may include changes that result in either an uncharged linker or a charged linker with an asymmetric charge distribution. Examples of modified phosphate groups may include phosphorothioates, phosphonothioacetates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. In some embodiments, one of the non-bridging phosphate oxygen atoms in the phosphate backbone moiety can be replaced by any of the following groups: sulfur (S), selenium (Se), BR (where R can be, for example, hydrogen, alkyl, or aryl), C (e.g., an alkyl group, an aryl group, etc.), H, NR (where R can be, for example, hydrogen, alkyl, or aryl), or OR (where R can be, for example, alkyl or aryl). The phosphorus atom of the unmodified phosphate group can be achiral. However, by replacing one of the non-bridging oxygens with one of the atoms or groups of atoms described above, the phosphorus atom can be made chiral. That is, the phosphate atom in the modified phosphate group can be an asymmetric center, and the phosphorus atom in the modified phosphate group can be an asymmetric center. The stereogenic phosphorus atom can have either the "R" configuration (herein Rp) or the "S" configuration (herein Sp). In such cases, the chemically modified ASO can be stereogenic (e.g., S or R conformation).In some cases, the chemically modified engineered RNA contains stereochemically pure phosphate modifications, for example, the chemically modified engineered RNA may contain phosphorothioate S conformation or phosphorothioate R conformation.

[0090] Phosphorodithioates have both non-bridging oxygens replaced by sulfur. The phosphorus center of phosphorodithioates can be achiral, preventing the formation of oligoribonucleotide diastereomers. In some embodiments, modifications to one or both non-bridging oxygens can include replacing the non-bridging oxygens with a group independently selected from S, Se, B, C, H, N, and OR (R can be, for example, alkyl or aryl).

[0091] The phosphate linker can also be modified by replacement of the bridging oxygen (i.e., the oxygen connecting the phosphate to the nucleoside), nitrogen (bridged phosphoramidate), sulfur (bridged phosphorothioate), and carbon (bridged methylene phosphonate). Replacement can occur at either or both bridging oxygens.

[0092] Replacement of the phosphate moiety In some embodiments, at least one phosphate group of an engineered RNA (ASO, engineered guide RNA, or other RNA payload) of the present disclosure can be chemically modified. In some embodiments, the phosphate group can be replaced with a non-phosphorus-containing connector. In some embodiments, the phosphate moiety can be replaced with a dephosphorylated linker. In some embodiments, the charged phosphate group can be replaced with a neutral group. In some cases, the phosphate group can be replaced with methylphosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino. In some embodiments, the nucleotide analogs described herein can also be modified at the phosphate group. Modified phosphate groups can include modifications in the linkage between two nucleotides, such as phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates, including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidates and aminoalkylphosphoramidates), thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates. The phosphate or modified phosphate linkage between two nucleotides can be via a 3'-5' or 2'-5' linkage, and the linkage can contain reverse polarity, such as 3'-5' to 5'-3' or 2'-5' to 5'-2'.

[0093] Phosphate group substitution In some embodiments, the chemical modifications described herein include modifications by phosphate group replacement. In some embodiments, the engineered RNAs (ASOs, engineered guide RNAs, or other RNA payloads) described herein include at least one chemical modification including a phosphate group substitution or replacement. Exemplary phosphate group substitutions may include non-phosphorus-containing connectors. In some embodiments, the phosphate group substitution or replacement may include replacing a charged phosphate group with a neutral moiety. Exemplary moieties that may replace the phosphate group may include methylphosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, or methyleneoxymethylimino.

[0094] Modification of the ribophosphate backbone In some embodiments, the chemical modifications described herein include modifying the ribophosphate backbone of the engineered RNA. In some embodiments, the engineered RNA (ASO, engineered guide RNA, or other RNA payload) described herein includes at least one chemically modified ribophosphate backbone. Exemplary chemically modified ribophosphate backbones can also be used to construct scaffolds that can mimic nucleic acids, where the phosphate linker and ribose sugar can be replaced by nuclease-resistant nucleosides or nucleotide surrogates. In some embodiments, the nucleobases can be tethered by alternative backbones. Examples include morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates.

[0095] Sugar modifications In some embodiments, the chemical modifications described herein include sugar modifications. In some embodiments, the engineered RNAs (ASOs, engineered guide RNAs, or other RNA payloads) described herein include at least one chemically modified sugar. Exemplary chemically modified sugars can include a 2' hydroxyl group (OH) that has been modified or substituted with several different "oxy" or "deoxy" substituents. In some embodiments, modifications to the 2' hydroxyl group can enhance nucleic acid stability because the hydroxyl can no longer be deprotonated to form a 2' alkoxide ion. 2'-alkoxides can catalyze decomposition by intramolecular nucleophilic attack on the linker atom. Examples of "oxy"-2' hydroxyl group modifications include alkoxy or aryloxy (OR, where "R" can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), polyethylene glycol (PEG), O(CHCHO), and hydroxyl groups. n CH2CH2OR (wherein R can be, for example, H or optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20)). In some embodiments, the "oxy"-2' hydroxyl group modification is selected from a wide variety of amino groups, including LNA (where the 2' hydroxyl can be connected to the 4' carbon of the same ribose sugar, e.g., by a Ci-6 alkylene or Cj-6 heteroalkylene bridge; exemplary bridges include methylene, propylene, ether, or amino bridges), O-amino (where amino can be, e.g., NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino), and aminoalkoxy, O(CH) n-amino (where amino can be, for example, NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino). In some embodiments, the "oxy"-2' hydroxyl group modification can include a methoxyethyl group (MOE), (OCH2CHOCH3, e.g., PEG derivatives). In some cases, the deoxy modification can include hydrogen (i.e., deoxyribose sugars, e.g., in partial overhanging portions of dsRNA), halo (e.g., bromo, chloro, fluoro, or iodo), amino (where amino can be, for example, NH2, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid), NH(CH2CH2NH) nThe sugar groups may include CH2CH2-amino (wherein amino can be, e.g., as described herein), NHC(O)R (wherein R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano, mercapto, alkylthioalkyl, thioalkoxy, and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, which can be optionally substituted, e.g., with amino, as described herein. In some cases, the sugar group can also contain one or more carbons that have the opposite stereochemical configuration to that of the corresponding carbon in ribose. Thus, modified nucleic acids can include nucleotides that include, e.g., arabinose as the sugar. A nucleotide "monomer" can have an alpha linkage at the Γ position on the sugar, e.g., an alpha-nucleoside. Modified nucleic acids can also include "abasic" sugars that lack a nucleobase at C-. Abasic sugars can also be further modified at one or more of the constituent sugar atoms. Modified nucleic acids can also include one or more sugars that can be in the L-form, e.g., an L-nucleoside. In some embodiments, the engineered RNAs (ASOs, engineered guide RNAs, or other RNA payloads) described herein contain a sugar group ribose, which may be a five-membered ring containing oxygen. Exemplary modified nucleosides and nucleotides can include substitution of oxygen in ribose (e.g., with sulfur (S), selenium (Se), or an alkylene, such as methylene or ethylene), addition of a double bond (e.g., replacing ribose with cyclopentenyl or cyclohexenyl), ring contraction of ribose (e.g., forming a four-membered ring of cyclobutane or oxetane), or ring expansion of ribose (e.g., forming a six- or seven-membered ring with additional carbon or heteroatoms, such as anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino, which also have phosphoramidate backbones).In some embodiments, modified nucleotides can include polycyclic forms (e.g., tricyclic, and "unlocked" forms, such as glycol nucleic acids (GNAs) (e.g., R-GNAs or S-GNAs, where the ribose can be replaced by a glycol unit linked to a phosphodiester bond), threose nucleic acids. In some embodiments, modifications to the sugar of the engineered RNA include modifying the engineered RNA to include locked nucleic acids (LNAs), unlocked nucleic acids (UNAs), or bridged nucleic acids (BNAs).

[0096] Modification of the ribose sugar components In some embodiments, the engineered RNA (ASO, engineered guide RNA, or other RNA payload) described herein comprises at least one chemical modification of the ribose sugar moiety. In some embodiments, the chemical modification of the ribose sugar moiety can include 2'-O-methyl, 2'-O-methoxy-ethyl (2'-MOE), 2'-fluoro, 2'-aminoethyl, 2'-deoxy-2'-furoarabino-cleic acid, 2'-deoxy, 2'-O-methyl, 3'-phosphorothioate, 3'-phosphonoacetate (PACE), or 3'-phosphonothioacetate (thioPACE). In some embodiments, the chemical modification of the ribose sugar moiety comprises a non-natural nucleic acid. In some cases, the non-natural nucleic acid comprises modifications at the 5' and 2' positions of the sugar ring, e.g., a 5'-CH2-substituted 2'-O-protected nucleoside. In some cases, non-natural nucleic acids include amide-linked nucleoside dimers prepared for incorporation into oligonucleotides, where the 3'-linked nucleosides in the dimers (5' to 3') include 2'-OCH3 and 5'-(S)-CH3. Non-natural nucleic acids may include 2'-substituted 5'-CH2 (or O) modified nucleosides. Non-natural nucleic acids may include 5'-methylene phosphonate DNA and RNA monomers and dimers. Non-natural nucleic acids may include 5' phosphonate monomers with 2' substitutions and other modified 5' phosphonate monomers. Non-natural nucleic acids may include 5'-modified methylene phosphonate monomers. Non-natural nucleic acids may include 5' or 6' phosphonate ribonucleoside analogs containing hydroxyl groups at the 5' and / or 6' positions. Non-natural nucleic acids may include 5' phosphonate deoxyribonucleoside monomers and dimers with a 5' phosphate group. Non-natural nucleic acids can include nucleosides having a 6' phosphonate group, and the 5' and / or 6' positions can be unsubstituted or substituted with a thio-tert-butyl group (SC(CH3)3) (and its analogs), a methyleneamino group (CH2NH2) (and its analogs), or a cyano group (CN) (and its analogs).

[0097] In some embodiments, non-natural nucleic acids also include modifications to the sugar moiety. In some cases, the nucleic acid contains one or more nucleosides in which the sugar group has been modified. Such sugar-modified nucleosides may confer enhanced nuclease stability, increased binding affinity, or some other beneficial biological property. In certain embodiments, the nucleic acid includes a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings include, but are not limited to, the addition of substituents (including 5' and / or 2' substituents), bridging of two ring atoms to form bicyclic nucleic acids, and the substitution of S, N(R), or C(R1)(R2) (R = H, C1-C) at the ribosyl ring oxygen atom. 12 alkyl or protecting groups), and combinations thereof.

[0098] In some cases, the engineered RNAs described herein (ASOs, engineered guide RNAs, or other RNA payloads) contain modified sugars or sugar analogs. Thus, in addition to ribose and deoxyribose, the sugar moiety can be a pentose, deoxypentose, hexose, deoxyhexose, glucose, arabinose, xylose, lyxose, or a sugar "analog" cyclopentyl group. The sugar can be in pyranosyl or furanosyl form. The sugar moiety can be a furanoside of ribose, deoxyribose, arabinose, or 2'-O-alkylribose, and the sugar can be attached to the respective heterocyclic base in either the [alpha] or [beta] anomeric configuration. Sugar modifications include, but are not limited to, 2'-alkoxy-RNA analogs, 2'-amino-RNA analogs, 2'-fluoro-DNA, and 2'-alkoxy or amino-RNA / DNA chimeras. For example, the sugar modification can include 2'-O-methyl-uridine or 2'-O-methyl-cytidine. Sugar modifications include 2'-O-alkyl substituted deoxyribonucleosides and 2'-O-ethylene glycol-like ribonucleosides.

[0099] Modifications to the sugar moiety include natural modifications of ribose and deoxyribose, as well as non-natural modifications. Sugar modifications include, but are not limited to, OH, F, O-, S-, or N-alkyl, O-, S-, or N-alkenyl, O-, S-, or N-alkynyl, or O-alkyl-O-alkyl modifications at the 2' position, where alkyl, alkenyl, and alkynyl are substituted or unsubstituted C1-C 10 Alkyl or C2-C 10 It can be alkenyl or alkynyl. 2' sugar modifications include, but are not limited to, -O[(CH2) n O] m CH3, -O(CH2) n OCH3, -O(CH2) n NH2, -O(CH2) n CH3, -O(CH2) n ONH2 and -O(CH2) n Also included are ON[(CH2)nCH3)]2, where n and m can be from 1 to about 10. Other chemical modifications at the 2' position include, but are not limited to: C1-C 10Examples of suitable substituents include lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving groups, reporter groups, intercalators, groups for improving the pharmacokinetic or pharmacodynamic properties of oligonucleotides, and other substituents with similar properties. Similar modifications can also be made at other positions on the sugar, particularly the 3' position of the sugar on the 3'-terminal nucleotide, or the 3' position of the sugar on 2'-5'-linked oligonucleotides, and the 5' position of the 5'-terminal nucleotide. Chemically modified sugars also include sugars containing modifications at the bridging ring oxygen, e.g., CH2 and S. Nucleotide sugar analogs can also have sugar mimetics, such as a cyclobutyl moiety in place of the pentofuranosyl sugar. Examples of nucleic acids with modified sugar moieties include, but are not limited to, nucleic acids containing 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH, and 2'-O(CH)OCH substituents. Substituents at the 2' position also include allyl, amino, azido, thio, O-allyl, O-(C-C 10 alkyl), OCF3, O(CH2)2SCH3, O(CH2)2-ON(R m )(R n ), and O-CH2-C(=O)-N(R m )(R n ), where each R m and R n are independently H or substituted or unsubstituted C-C 10 It is alkyl.

[0100] In certain embodiments, the nucleic acids described herein comprise one or more bicyclic nucleic acids. In certain such embodiments, the bicyclic nucleic acid comprises a bridge between the 4' ribosyl ring atom and the 2' ribosyl ring atom. In certain embodiments, the nucleic acids provided herein comprise one or more bicyclic nucleic acids, wherein the bridge comprises a 4'-2' bicyclic nucleic acid. Examples of such 4'-2' bicyclic nucleic acids include, but are not limited to, one of the following formulas: 4'-(CH2)-O-2' (LNA), 4'-(CH2)-S-2', 4'-(CH2)2-O-2' (ENA), 4'-CH(CH3)-O-2', and 4'-CH(CHOCH3)-O-2', and analogs thereof, 4'-C(CH3)(CH3)-O-2', and analogs thereof.

[0101] Modifications on the base of a nucleotide In some embodiments, the chemical modifications described herein include modifications of the base (e.g., nucleobase) of a nucleotide. Exemplary nucleobases may include adenine (A), thymine (T), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or replaced in the engineered RNAs (ASOs, engineered guide RNAs, or other RNA payloads) described herein. The nucleobases of the nucleotide may be independently selected from purines, pyrimidines, and purine or pyrimidine analogs. In some embodiments, the nucleobases may be natural or synthetic derivatives of bases.

[0102] In some embodiments, the chemical modifications described herein comprise modifying uracil. In some embodiments, the engineered RNAs (ASOs, engineered guide RNAs, or other RNA payloads) described herein comprise at least one chemically modified uracil. Exemplary chemically modified uracils include pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl -uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-selenouridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, l-taurin nomethyl-4-thio-pseudouridine, 5-methyl-uridine, 1-methyl-pseudouridine, 5-methyl-2-thio-uridine, l-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydroundine, dihydropseudoundine, 5,6-Dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3-carboxypropylpseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl])-2-thio-uridine, α-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O-methyl-sh uridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5-carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl-uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl)uridine, 5-[3-(1E-propenylamino)uridine, pyrazolo[3,4-d]pyrimidine, xanthine, and hypoxanthine.

[0103] In some embodiments, the chemical modifications described herein comprise modifying cytosines. In some embodiments, the engineered RNAs (ASOs, engineered guide RNAs, or other RNA payloads) described herein comprise at least one chemically modified cytosine. Exemplary chemically modified cytosines include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methylcytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-methylcytidine, 5-halocytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolocytidine, pyrrolopseudoisocytidine, 2-thio-cytidine, 2-thio-5-methylcytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, and 5-aza-zebularine. , 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O-trimethyl-cytidine, 1-thio-cytidine, 2'-F-ara-cytidine, 2'-F-cytidine, 2'-OH-ara-cytidine.

[0104] In some embodiments, the chemical modification described herein comprises modifying adenine. In some embodiments, the engineered RNA (ASO, engineered guide RNA, or other RNA payload) described herein comprises at least one chemically modified adenine. Exemplary chemically modified adenines include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azidoadenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza -2,6-Diaminopurine, 1-methyl-adenosine, 2-methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl Thiyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, α-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl 2'-O-ara-adenosine, 2'-F-ara-adenosine, 2'-F-ara-adenosine, 2'-OH-ara-adenosine, and N6-(19-amino-pentaoxanonadecyl)-adenosine.

[0105] In some embodiments, the chemical modifications described herein comprise modifying guanines. In some embodiments, the engineered RNAs (ASOs, engineered guide RNAs, or other RNA payloads) described herein comprise at least one chemically modified guanine. Exemplary chemically modified guanines include inosine, 1-methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, non-demethylated hydroxywybutosine, 7-deaza-guanosine, queosine, epoxyqueosine, galactosylqueosine, mannosylqueosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, alkaleosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methyl-guanosine, N 2-Methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2,N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methithio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, α-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl l-2'-O-methyl-guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine, l-methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O-methylinosine, l,2'-O-dimethylinosine, 6-O-phenyl-2'-deoxyinosine, 2'-O-ribosylguanosine, 1-thioguanosine, 6-O-methyguanosine, O 6 -methyl-2'-deoxyguanosine, 2'-F-ara-guanosine, and 2'-F-guanosine.

[0106] In some cases, chemical modification of engineered RNA may include the introduction or substitution of nucleic acid analogs or non-natural nucleic acids into engineered RNA.In some embodiments, the nucleic acid analogs can be any one of the chemically modified nucleic acids described herein.Exemplary nucleic acid analogs can be found in PCT / US2021 / 034272, PCT / US2015 / 025175, PCT / US2014 / 050423, PCT / US2016 / 067353, PCT / US2018 / 041503, PCT / US18 / 041509, PCT / US2004 / 011786, or PCT / US2004 / 011833, all of which are expressly incorporated by reference in their entirety. Chemically modified nucleotides described herein can include variants of guanosine, uridine, adenosine, thymidine, and cytosine, including any natural or unnatural guanosine, uridine, adenosine, thymidine, or cytidine that has been chemically altered by, for example, acetylation, methylation, or hydroxylation. Exemplary chemically modified nucleotides include 1-methyl-adenosine, 1-methyl-guanosine, 1-methyl-inosine, 2,2-dimethyl-guanosine, 2,6-diaminopurine, 2'-amino-2'-deoxyadenosine, 2'-amino-2'-deoxycytidine, 2'-amino-2'-deoxyguanosine, 2'-amino-2'-deoxyuridine, 2-amino-6-chloropurine riboside, 2-aminopurine riboside, 2'-araadenosine, 2'-aracytidine, 2'-arauridine, 2'-azido-2'-deoxyadenosine, 2'-azido-2'-deoxycytidine, 2'-azido -2'-deoxyguanosine, 2'-azido-2'-deoxyuridine, 2-chloroadenosine, 2'-fluoro-2'-deoxyadenosine, 2'-fluoro-2'-deoxycytidine, 2'-fluoro-2'-deoxyguanosine, 2'-fluoro-2'-deoxyuridine, 2'-fluorothymidine, 2-methyl-adenosine, 2-methyl-guanosine, 2-methyl-thio-N6-isopenenyl-adenosine, 2'-O-methyl-2-aminoadenosine, 2'-O-methyl-2'-deoxyadenosine, 2'-O-methyl-2'-deoxycytidine, 2'-O-methyl-2'-deoxyguanosine,2,-O-methyl-2'-deoxyuridine, 2'-O-methyl-5-methyluridine, 2'-O-methylinosine, 2'-O-methylpseudouridine, 2-thiocytidine, 2-thio-cytidine, 3-methyl-cytidine, 4-acetyl-cytidine, 4-thiouridine, 5-(carboxyhydroxymethyl)-uridine, 5,6-dihydrouridine, 5-aminoallylcytidine, 5-aminoallyl-deoxyuridine , 5-Bromulidine, 5-carboxymethylaminomethyl-2-thio-uracil, 5-carboxymethylamonomethyl-uracil, 5-chloro-ara-cytosine, 5-fluoro-uridine, 5-iodouridine, 5-methoxycarbonylmethyl-uridine, 5-methoxy-uridine, 5-methyl-2-thio-uridine, 6-azacytidine, 6-azauridine, 6-chloro-7-deaza-guanosine, 6-chloropurine Riboside, 6-mercapto-guanosine, 6-methyl-mercaptopurine-riboside, 7-deaza-2'-deoxy-guanosine, 7-deazaadenosine, 7-methyl-guanosine, 8-azaadenosine, 8-bromoadenosine, 8-bromo-guanosine, 8-mercapto-guanosine, 8-oxoguanosine, benzimidazole riboside, beta-D-mannosyl-queosine, dihydrouridine, inosine, N1- Methyladenosine, N6-([6-aminohexyl]carbamoylmethyl)-adenosine, N6-isopentenyl-adenosine, N6-methyl-adenosine, N7-methyl-xanthosine, N-uracil-5-oxyacetic acid methyl ester, puromycin, chiosin, uracil-5-oxyacetic acid, uracil-5-oxyacetic acid methyl ester, wybutoxosin, xanthosine, and xyloadenosine may be mentioned. In some embodiments, the chemically modified nucleic acids described herein are selected from the group consisting of 2-amino-6-chloropurine riboside-5'-triphosphate, 2-aminopurine-riboside-5'-triphosphate, 2-aminoadenosine-5'-triphosphate, 2'-amino-2'-deoxycytidine-triphosphate, 2-thiocytidine-5'-triphosphate, 2-thiouridine-5'-triphosphate, 2'-fluorothymidine-5'-triphosphate, 2'-O-methyl-inosine-5'-triphosphate,4-thiouridine-5'-triphosphate, 5-aminoallylcytidine-5'-triphosphate, 5-aminoallyllysine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate phosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 5-iodo-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate phosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine riboside-5'-triphosphate, 7-deazaadenosine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 8-azaadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-riboside-5'-triphosphate , N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, 6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, puromycin-5'-triphosphate, or xanthosine-5'-triphosphate. In some embodiments, the chemically modified nucleic acids described herein are selected from the group consisting of pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyluridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine,The nucleotides include at least one chemically modified nucleotide selected from 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, and 4-methoxy-2-thio-pseudouridine. In some embodiments, the artificial nucleic acids described herein are 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine , 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-thiozebularine, 2-thiozebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, and 4-methoxy-1-methyl-pseudoisocytidine. In some embodiments, the chemically modified nucleic acids described herein are selected from the group consisting of 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine,The nucleotide comprises at least one chemically modified nucleotide selected from N6-glycinylcarbamoyl adenosine, N6-threonylcarbamoyl adenosine, 2-methylthio-N6-threonylcarbamoyl adenosine, N6,N6-dimethyl adenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine. In other embodiments, the chemically modified nucleic acids described herein comprise at least one chemically modified nucleotide selected from inosine, 1-methyl-inosine, wyosine, wybutsine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-thio-6-guanosine. In certain embodiments, the chemically modified nucleic acids described herein are selected from the group consisting of 6-aza-cytidine, 2-thio-cytidine, alpha-thio-cytidine, pseudo-iso-cytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudouridine, 5,6-dihydrouridine, alpha-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, pyrrolo-cytidine, ino- The nucleotides include at least one chemically modified nucleotide selected from the group consisting of cytidine, alpha-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine, 7-deaza-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudo-cytidine, 6-chloro-purine, N6-methyl-adenosine, alpha-thio-adenosine, 8-azido-adenosine, and 7-deaza-adenosine.

[0107] Modified bases of non-natural nucleic acids include, but are not limited to, uracil-5-yl, hypoxanthine-9-yl (I), 2-aminoadenine-9-yl, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyladenine and guanine and other alkyl derivatives of adenine and guanine, 2-propyladenine and guanine and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-proline, 5-isopropyl uracil ... methyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine. Certain unnatural nucleic acids, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2 substituted purines, N-6 substituted purines, O-6 substituted purines, 2-aminopropyladenine, 5-propynyluracil, 5-propynylcytosine, 5-methylcytosine, those that increase the stability of duplex formation, universal nucleic acids, hydrophobic nucleic acids, mixed nucleic acids, size-expanded nucleic acids, fluorinated nucleic acids, 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines (including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine). 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl, other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyl (-C≡C-CH3)uracil, 5-propynylcytosine, other alkynyl derivatives of pyrimidine nucleic acids, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil),4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl, other 5-substituted uracils and cytosines, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, tricyclic pyrimidines, pheno oxazine cytidine ([5,4-b][l,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][l,4]benzothiazin-2(3H)-one), G-clamp, phenoxazine cytidine (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one), pyrido[3',2':4,5]pyrrolo[2,3-d]pyrimidin-2-one), in which the purine or pyrimidine base may be replaced by other heterocycles, 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, 2-pyridone, azacytosine, 5-bromocytosine, bromouracil, 5-chlorocytosine, chlorinated cytosine, cyclocytosine, cytosine arabinoside, 5-fluorocytosine, fluoropyrimidine, fluorouracil, 5,6-dihydrocytosine, 5-iodocytosine Cytosine, hydroxyurea, iodouracil, 5-nitrocytosine, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, and 5-iodouracil, 2-amino-adenine, 6-thio-guanine, 2-thio-thymine, 4-thio-thymine, 5-propynyl-uracil, 4-thio-uracil, N4-ethylcytosine, 7-deazaguanine, 7-deaza-8-azaguanine, 5-hydroxycytosine, 2'-deoxyuridine, or 2-amino-2'-deoxyadenosine.

[0108] In some cases, the at least one chemical modification may include chemically modifying the 5' or 3' end of the engineered RNA, such as the 5' or 3' end. In some embodiments, the engineered RNA may include a chemical modification including a 3' nucleotide, which may be stabilized against degradation, for example, by incorporating one or more of the modified nucleotides described herein. In this embodiment, uridine may be replaced with a modified uridine, such as 5-(2-amino)propyluridine and 5-bromouridine, or any of the modified uridines described herein, and adenosine and guanosine may be replaced with a modified adenosine and guanosine, for example, an 8-position modification, such as 8-bromoguanosine, or any of the modified adenosines or guanosines described herein. In some embodiments, deazanucleotides, such as 7-deaza-adenosine, may be incorporated into the gRNA. In some embodiments, O- and N-alkylated nucleotides, such as N6-methyladenosine, may be incorporated into the gRNA. In some embodiments, sugar-modified ribonucleotides may be incorporated, e.g., the 2'OH-group may be replaced with a group selected from, e.g., H, -OR, -R (where R may be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or a sugar), halo, -SH, -SR (where R may be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or a sugar), amino (where amino may be, e.g., NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or an amino acid), or cyano (-CN). In some embodiments, the phosphate backbone may be modified, e.g., with a phosphothioate group, as described herein.In some embodiments, the nucleotides in the overhang region of the gRNA can each independently be modified or unmodified nucleotides, including, but not limited to, 2'-sugar-modified nucleotides such as 2-F2'-O-methyl, thymidine (T), 2'-O-methoxyethyl-5-methyluridine (Teo), 2'-O-methoxyethyl adenosine (Aeo), 2'-O-methoxyethyl-5-methylcytidine (m5Ceo), or any combination thereof.

[0109] Engineered guide RNAs As disclosed herein, engineered guide RNAs of the present disclosure having an RNA element described herein (such as an SmOPT variant sequence, a U7 hairpin variant sequence, or both, such as an element having the polynucleotide sequence of any one of SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:60, SEQ ID NO:61, or SEQ ID NO:62) can be used to edit nucleotide bases of a target RNA. The engineered guide RNAs described herein include a targeting sequence having sufficient complementarity to a target RNA operably linked to an RNA element described herein, where the RNA element is an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both. In some embodiments, the engineered guide RNAs described herein may also include a promoter, a terminator, and additional elements disclosed herein for RNA editing.

[0110] In some examples of the present disclosure, the engineered guide RNAs described herein can have a length of about 80 nucleotides to about 600 nucleotides (e.g., 90-500, 100-400, 200-300), can have a length of at least about 80 or more nucleotides (e.g., 85, 95, 150, 250, 350, 450, 550, 600, 650), or can have a length of about 600 nucleotides or less (e.g., 575, 525, 475, 425, 375, 325, 275, 225, 175, 125, 115, 110, 105, 95, 90, 85, 80, 75, 70).

[0111] Circularized guide RNA In some cases, the engineered RNA can be circularized. A circularized engineered guide RNA can be produced from a precursor engineered polynucleotide. In some cases, the precursor engineered polynucleotide can be a precursor engineered linear polynucleotide. In some cases, the precursor engineered polynucleotide can be linear. For example, the precursor engineered polynucleotide can be a linear mRNA transcribed from a plasmid. In another example, the precursor engineered polynucleotide can be constructed to be a linear polynucleotide having domains such as a ribozyme domain and a ligation domain that enable circularization in a cell. A linear polynucleotide having a ligation domain and a ribozyme domain can be transfected into a cell and can be circularized via endogenous cellular enzymes. In some cases, the precursor engineered polynucleotide can be circular. In some cases, the precursor engineered polynucleotide can comprise DNA, RNA, or both. In some cases, the precursor engineered polynucleotide can comprise a precursor engineered guide RNA. In some cases, the precursor engineered guide RNA can be used to produce an engineered guide RNA.

[0112] A circular or cyclic engineered guide polynucleotide, such as an engineered guide RNA, can be formed directly or indirectly by forming a linkage (e.g., a covalent linkage) between two or more ends of an RNA sequence, such as the 5' and 3' ends. The RNA sequence can include the engineered guide RNA (e.g., a recruitment domain, a targeting domain, or both). The linkage can be formed by using an enzyme, such as a ligase. Suitable ligases (or synthetases) can include ligases that form covalent bonds. The covalent bond can include a carbon-oxygen bond, a carbon-sulfur bond, a carbon-nitrogen bond, a carbon-carbon bond, a phosphate ester bond, or any combination thereof. The linkage can also be formed by using a recombinase. An enzyme can be recruited to the RNA sequence to form the linkage. A circular or looped RNA can be formed by ligating two or more ends of an RNA sequence using a linking element. In some embodiments, the linkage can be formed by a ligation reaction. In some cases, the linkage can be formed by a homologous recombination reaction. The linking element can be used to form the circular or looped RNA using click chemistry. The linking element can be an azide-based linkage. The circular or looped RNA can be formed by genetically encoding or chemically synthesizing the circular or looped RNA.

[0113] Circular or looped RNAs can be formed by using self-cleaving entities such as ribozymes, tRNAs, aptamers, catalytically active fragments of any of these, or any combination thereof. For example, ribozymes, tRNAs, aptamers, catalytically active fragments of any of these, or any combination thereof can be added to the 3' end, 5' end, or both of the precursor engineered RNAs. In another example, ribozymes, tRNAs, aptamers, catalytically active fragments of any of these, or any combination thereof can be added to the 3' end, 5' end, or both of the precursor engineered RNAs. The self-cleaving ribozyme can include, for example, RNase P RNA, hammerhead ribozyme (e.g., Schistosoma mansoni ribozyme), glmS ribozyme, HDV-like ribozyme, R2 element, peptidyl transferase 23S rRNA, GIR1 branched ribozyme, leadzyme, group II intron, hairpin ribozyme, VS ribozyme, CPEB3 ribozyme, CoTC ribozyme, or group I intron. In some cases, the self-cleaving ribozyme can be a trans-acting ribozyme that joins one RNA end to a separate RNA end. In some embodiments, an aptamer can be added to each end of the engineered guide RNA. A ligase can be contacted with the aptamer at each end of the engineered guide RNA to form a covalent linkage between the aptamers, thereby forming a circular engineered guide RNA. In some cases, a self-cleaving element or aptamer can be configured to facilitate the self-circularization of an engineered polynucleotide or a pro-polynucleotide (e.g., from a precursor engineered polypeptide) after transcription in a cell. In some cases, the circularization of a guide RNA can be demonstrated by PCR. For example, a primer can be developed that binds to the end of the guide RNA and faces outward so that a product is formed only when the guide is circularized.

[0114] In some cases, circularization can occur by back-slicing and ligation of an exon. For example, an RNA can be engineered from 5' to 3' to contain a forward complementary intron, an exon (which may contain a guide sequence), followed by a reverse complementary intron. When transcribed, the complementary introns can hybridize to form dsRNA. The internal exon containing the guide sequence can be removed by splicing and ligated by an endogenous ligase to form a circular guide. In one example, the engineered guide RNA can initiate intracellular circularization through the autocatalytic reaction of an encoded ribozyme. After cleavage by one or more ribozymes, the linear polynucleotide undergoes intracellular RNA ligation of the 5' and 3' ends of the ligation sequence by an endogenous ligase to circularize the guide RNA.

[0115] Suitable self-cleaving molecules may include ribozymes. For example, ribozyme domains can generate autocatalytic RNA. Ribozymes may include RNase P, rRNA (such as peptidyl transferase 23S rRNA), leadzymes, group I intron ribozymes, group II intron ribozymes, GIR1 branched ribozymes, glmS ribozymes, hairpin ribozymes, hammerhead ribozymes, HDV ribozymes, twister ribozymes, twister sister ribozymes, VS ribozymes, pistol ribozymes, Hatchet ribozymes, viroids, or any combination thereof. Ribozymes may include P3 twister U2A ribozymes. Ribozymes may include 5'GCCATCAGTCGCCGGTCCCAAGCCCGGATAAAATGGGAGGGGGCGGGAAACCGCCT3' (SEQ ID NO: 105). The ribozyme may comprise 5'GCCAUCAGUCGCCGGUCCCAAGCCCGGAUAAAAUGGGAGGGGGCGGGAAACCGCCU3' (SEQ ID NO: 106). The ribozyme may comprise at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'GCCATCAGTCGCCGGTCCCAAGCCCGGATAAAATGGGAGGGGGCGGGAAACCGCCT3' (SEQ ID NO: 105). The ribozyme may comprise at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'GCCAUCAGUCGCCGGUCCCAAGCCCGGAUAAAAUGGGAGGGGGCGGGAAACCGCCU3' (SEQ ID NO: 106). The ribozyme may comprise a P1 twister ribozyme. The ribozyme can comprise 5'AACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGC3 (SEQ ID NO: 107). The ribozyme can comprise 5'AACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGUACAGUCCACGC3' (SEQ ID NO: 108).The ribozyme may contain at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'AACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGC 3' (SEQ ID NO: 107). The ribozyme may contain at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'AACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGUACAGUCCACGC 3' (SEQ ID NO: 108).

[0116] The ligation domain can facilitate the linkage, covalent or non-covalent binding, of a first nucleotide to a second nucleotide. In some embodiments, the ligation domain can recruit a ligation entity to facilitate a ligation reaction. In some cases, the ligation domain can recruit a recombination entity to facilitate homologous recombination. In some cases, a first ligation domain can facilitate the linkage, covalent or non-covalent binding, to a second ligation domain. In some embodiments, a first ligation domain can facilitate the complementary pairing of a second ligation domain. In some cases, the ligation domain can include 5'AACCATGCCGACTGATGGCAG3' (SEQ ID NO: 109). In some embodiments, the ligation domain can include 5'GATGTCAGGTGCGGCTGACTACCGTC3' (SEQ ID NO: 110). In some cases, the ligation domain can include 5'AACCAUGCCGACUGAUGGCAG3' (SEQ ID NO: 111). In some cases, the ligation domain may comprise 5'GAUGUCAGGUGCGGCUGACUACCGUC3' (SEQ ID NO: 112). In some cases, the ligation domain may comprise at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'AACCATGCCGACTGATGGCAG3' (SEQ ID NO: 109). In some cases, the ligation domain may comprise at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'GATGTCAGGTGCGGCTGACTACCGTC3' (SEQ ID NO: 110). In some cases, the ligation domain may comprise at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'AACCAUGCCGACUGAUGGCAG3' (SEQ ID NO: 111).In some cases, the ligation domain may comprise at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5'GAUGUCAGGUGCGGCUGACUACCGUC3' (SEQ ID NO: 112).

[0117] Engineered guide RNAs with recruitment domains In some instances, an engineered guide RNA may comprise a recruitment domain that is formed and present in the absence of hybridization of the engineered guide RNA to a target RNA, and the recruitment domain recruits an RNA editing entity (e.g., an ADAR, an APOBEC, or both). A "recruitment domain" may be interchangeably referred to herein as a "recruitment sequence" or "recruitment region." In some instances, an engineered guide RNA may be configured to facilitate editing of nucleotide bases of a polynucleotide in a region of the target RNA, regulated expression of a polypeptide encoded by the target RNA, or both. In some cases, an engineered guide RNA may be configured to facilitate editing of nucleotides or polynucleotide bases in a region of the RNA by an RNA editing entity. To facilitate editing, the engineered guide RNA of the present disclosure may be configured to recruit an RNA editing entity. Some embodiments provide an RNA editing entity comprising an ADAR protein, wherein the ADAR protein may be selected from the group consisting of ADAR1 (e.g., human or mouse), ADAR2 (e.g., human or mouse), and any combination thereof. Various RNA editing entity recruitment domains may be utilized. In some examples, the recruitment domain comprises glutamate ionotropic receptor AMPA subunit 2 (GluR2), APOBEC, or Alu. In some embodiments of the present disclosure, the RNA editing entity may comprise an ADAR protein, an APOBEC protein, or both. When the RNA editing entity is an ADAR protein, the ADAR protein may be selected from the group consisting of ADAR1, ADAR2, and a combination of ADAR1 and ADAR2. Other embodiments may target an RNA editing entity selected from the group consisting of human ADAR1, mouse ADAR1, human ADAR2, mouse ADAR2, and any combination thereof.

[0118] In some cases, two or more recruitment domains can be included in the engineered guide RNA of the present disclosure.In the case where a recruitment domain is present, the recruitment domain can be used to position the RNA editing entity so that it can effectively react with the target RNA after the target sequence, for example, antisense sequence, and hybridize to the target RNA.In some cases, the recruitment domain can allow the RNA editing entity to bind transiently to the engineered guide RNA.In some cases, the recruitment domain can allow the RNA editing entity to bind permanently to the engineered guide RNA.The recruitment domain can be of any length. In some cases, the recruitment domain can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, up to about 80 nucleotides in length. In some cases, the recruitment domain can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or 80 or less nucleotides in length. In some cases, the recruitment domain can be about 45 nucleotides in length. In some cases, at least a portion of the recruitment domain comprises at least 1 to about 75 nucleotides. In some cases, at least a portion of the recruitment domain comprises about 45 nucleotides to about 60 nucleotides.

[0119] In some embodiments, the recruitment domain comprises a GluR2 sequence or a functional fragment thereof. In some cases, the GluR2 sequence can be recognized by an RNA editing entity, such as an ADAR, or a biologically active fragment thereof. In some embodiments, the GluR2 sequence can be a non-naturally occurring sequence. In some cases, the GluR2 sequence can be modified, for example, for enhanced recruitment. In some embodiments, the GluR2 sequence can comprise a portion of a naturally occurring GluR2 sequence and a synthetic sequence.

[0120] In some examples, the recruitment domain comprises a GluR2 sequence, or a sequence having at least about 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity to GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO: 9), or a length relative to GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO: 9), or both. In some cases, the recruitment domain may comprise at least about 80% sequence homology to at least about 10, 15, 20, 25, or 30 nucleotides of SEQ ID NO: 9. In some examples, the recruitment domain may comprise at least about 90%, 95%, 96%, 97%, 98%, or 99% sequence homology to SEQ ID NO:9, at least about 90%, 95%, 96%, 97%, 98%, or 99% length to SEQ ID NO:9, or a combination thereof.

[0121] Additional RNA editing entity recruitment domains are also contemplated. In some embodiments, the recruitment domain comprises an apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEC) domain. In some cases, the APOBEC domain may comprise a non-naturally occurring sequence or a naturally occurring sequence. In some embodiments, the APOBEC domain coding sequence may comprise a modified portion. In some cases, the APOBEC domain coding sequence may comprise a portion of a naturally occurring APOBEC domain coding sequence. In another embodiment, the recruitment domain may be derived from an Alu domain.

[0122] Any number of recruitment domains can be found in the engineered RNA of the present disclosure. In some instances, at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to about 10 recruitment domains can be included in the engineered RNA. The recruitment domain can be located anywhere in the engineered guide RNA. In some cases, the recruitment domain can be on the N-terminus, middle, or C-terminus of the polynucleotide. The recruitment domain can be upstream or downstream of the targeting sequence. In some cases, the recruitment domain is adjacent to the targeting sequence of the guide. The recruitment sequence can contain all ribonucleotides or deoxyribonucleotides, although recruitment domains containing both ribonucleotides and deoxyribonucleotides may not be excluded in some cases.

[0123] Engineered guide RNAs with potential structures In some instances, the engineered guide RNAs disclosed herein may be formed in the absence of hybridization of the engineered guide RNA to the target RNA and may lack a recruitment domain. In some instances, recruitment of an RNA editing entity may be achieved by a guide-target RNA scaffold formed upon hybridization of the engineered guide RNA and the target RNA. In some instances, the engineered guide RNA does not contain structural features that recruit an RNA editing entity (e.g., ADAR, APOBEC, or both) when present in aqueous solution and not bound to a target RNA molecule. Some embodiments provide an RNA editing entity comprising an ADAR protein, wherein the ADAR protein may be selected from the group consisting of ADAR1 (e.g., human or mouse), ADAR2 (e.g., human or mouse), and any combination thereof. Upon hybridization to the target RNA, the engineered guide RNA forms one or more structural features with the target RNA that recruit an RNA editing entity (e.g., ADAR).

[0124] In the absence of a recruitment sequence, the engineered guide RNA can still associate with an RNA editing entity (e.g., ADAR) to facilitate editing of the target RNA, regulate the expression of the polypeptide encoded by the target RNA, or a combination thereof. This can be achieved by features built into the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA and the target RNA described herein. The term "cryptographic structure" refers to a structural feature that is substantially formed only upon hybridization of the engineered guide RNA to the target RNA. For example, the sequence of the engineered guide RNA provides one or more structural features, but these structural features are substantially formed only upon hybridization to the target RNA, and therefore, one or more potential structural features appear as structural features upon hybridization to the target RNA. Upon hybridization of the engineered guide RNA to the target RNA, the structural features are formed, and therefore the potential structure provided by the engineered guide RNA is not masked. A potential guide RNA as described herein refers to an engineered guide RNA that includes a portion of its sequence that, upon hybridization to a target RNA, forms at least a portion of a structural feature other than a single A / C mismatch feature at the target adenosine to be edited. In some embodiments, the targeting sequence structural feature may include any one of a mismatch, a symmetric bulge, an asymmetric bulge, a symmetric internal loop, an asymmetric internal loop, a hairpin, a wobble base pair, a chemical modification, or any combination thereof.

[0125] Provided herein are engineered guide RNAs and compositions comprising the engineered guide RNAs. In some instances, the engineered guide RNA can be an engineered polynucleotide. For example, in some embodiments, the present disclosure provides an engineered polynucleotide encoding the engineered RNA (e.g., an engineered guide RNA, an antisense oligonucleotide). In some embodiments, the engineered RNA comprises DNA. In some instances, the engineered RNA comprises modified or unmodified RNA bases. In some embodiments, the engineered RNA comprises modified or unmodified DNA bases. In some instances, the engineered RNA comprises both DNA and RNA bases.

[0126] In some examples, the engineered RNAs provided herein (e.g., engineered guide RNAs, antisense oligonucleotides) comprise engineered RNAs that can be configured to form, at least in part, a guide-target RNA scaffold upon hybridization to a target RNA or at least a portion of a target RNA. In some embodiments, the guide-target RNA scaffold is formed upon hybridization of the engineered RNAs (e.g., engineered guide RNAs, antisense oligonucleotides) of the present disclosure to the target RNA. The guide-target RNA scaffold can have a structural feature that forms within the double-stranded RNA duplex. For example, the guide-target RNA scaffold can have at least one structural feature, or two or more structural features, selected from the group consisting of a mismatch, a bulge (e.g., a symmetric or asymmetric bulge), an internal loop (e.g., a symmetric or asymmetric internal loop), a hairpin (e.g., a recruitment hairpin or a hairpin containing a non-targeting domain), a wobble base pair, and any combination thereof, and the guide-target RNA scaffold recruits an RNA editing entity and facilitates chemical modification of bases of nucleotides in the target RNA by the RNA editing entity.

[0127] Structural features that may be present in the guide-target RNA scaffolds of the present disclosure may be described herein. A guide-target RNA scaffold may be formed upon hybridization of an engineered guide RNA and a target RNA, and the scaffold may have at least one or more structural features. Examples of structural features include a mismatch, a bulge (symmetric or asymmetric), an internal loop (symmetric or asymmetric internal loop), or a hairpin (a hairpin containing a non-targeting domain), or a wobble base pair. An engineered guide RNA of the present disclosure may have from 1 to 50 features. Engineered guide RNAs of the present disclosure can have 1-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 5-20, 1-3, 4-5, 2-10, 20-40, 10-40, 20-50, 30-50, 4-7, or 8-10 features. As disclosed herein, a "structured motif" refers to or includes a combination of two or more features in a guide-target RNA scaffold.

[0128] In some instances, a double-stranded RNA (dsRNA) substrate (guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. As disclosed herein, "mismatch," as used herein, refers to a single nucleotide in an engineered RNA (e.g., an engineered guide RNA, ASO) of the present disclosure that is not paired with an opposing single nucleotide in the target RNA within the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA and target RNA of the present disclosure. A mismatch can include any two single nucleotides that do not form a base pair. If the number of involved nucleotides on the guide RNA and target RNA sides exceeds one, the resulting structure is no longer considered a mismatch, but rather a bulge or internal loop, depending on the size of the structural feature. In some embodiments, the mismatch can be an A / C mismatch, an A / G mismatch, or an A / A mismatch. For example, an A / C mismatch can include a C in an engineered RNA (e.g., an engineered guide RNA, ASO) of the present disclosure opposite an A in the target RNA. An A / C mismatch can include an A in an engineered RNA (e.g., an engineered guide RNA, ASO) of the present disclosure opposite a C in the target RNA. For example, a G / G mismatch can include a G in an engineered RNA (e.g., an engineered guide RNA, ASO) of the present disclosure opposite a G in the target RNA. In some embodiments, a mismatch located 5' to the editing site can facilitate base flipping of the A (or target A) in the edited target RNA. The mismatch can also serve to confer sequence specificity. Thus, the mismatch can be a structural feature formed from a potential structure provided by a potential engineered guide RNA. In some embodiments, the mismatch includes an A / C mismatch, where the A can be in the target RNA and the C can be in the targeting sequence of the engineered RNA (e.g., an engineered guide RNA, antisense oligonucleotide). In another embodiment, the A in the A / C mismatch can be the base of a nucleotide in the target RNA edited by the RNA editing entity.

[0129] A double-stranded RNA (dsRNA) substrate (guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. In some embodiments, a "bulge" refers to a structure that is formed substantially only upon formation of the guide-target RNA scaffold, in which consecutive nucleotides in either the engineered guide RNA or the target RNA of the present disclosure are not complementary to their positional counterparts on the opposing strand. The bulge may alter the secondary or tertiary structure of the guide-target RNA scaffold. The bulge may have 0 to 4 consecutive nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the target RNA side of the guide-target RNA scaffold, or the bulge may have 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. However, as used herein, the term "bulge" does not refer to a structure in which a single participating nucleotide of an engineered guide RNA and a single participating nucleotide of a target RNA do not base-pair; a single participating nucleotide of an engineered guide RNA and a single participating nucleotide of a target RNA that do not base-pair is referred to herein as a mismatch. Furthermore, if the number of participating nucleotides on either the engineered guide RNA side or the target RNA side exceeds four, the resulting structure is no longer considered a bulge, but rather an internal loop. In some embodiments, a guide-target RNA scaffold of the present disclosure has two bulges. In some embodiments, a guide-target RNA scaffold of the present disclosure has three bulges. In some embodiments, a guide-target RNA scaffold of the present disclosure has four bulges. Thus, a bulge can be a structural feature formed from a potential structure provided by a potential engineered guide RNA.

[0130] In some embodiments, the presence of a bulge in the guide-target RNA scaffold can position or aid in the positioning of an ADAR to selectively edit the target A in the target RNA and reduce off-target editing of non-target A(s) in the target RNA. In some examples, the presence of a bulge in the guide-target RNA scaffold can recruit or aid in the recruitment of additional amounts of ADAR proteins (e.g., mouse or human ADAR1, mouse or human ADAR2, or any combination thereof). The bulge in the guide-target RNA scaffolds disclosed herein can recruit other proteins, such as other RNA editing entities (e.g., apolipoprotein B mRNA editing catalytic polypeptide-like (APOBEC), or both ADARs and APOBECs). In some embodiments, a bulge located 5' of the editing site can facilitate base flipping of the target "A" in the target RNA to be edited. The bulge can also help confer sequence specificity for the A in the target RNA to be edited compared to other A(s) present in the target RNA. For example, the bulge may help direct ADAR editing by constraining it in an orientation that results in selective editing of target A of the target RNA.

[0131] In some embodiments, a guide-target RNA scaffold is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The bulge of the present disclosure can be a symmetric bulge or an asymmetric bulge. A symmetric bulge is formed when the same number of nucleotides are present on each side of the bulge. For example, a symmetric bulge in a guide-target RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the present disclosure can be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and two nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the present disclosure can be formed by three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and three nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the present disclosure can be formed by four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and four nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, the symmetric bulge may be a structural feature formed from the potential structure provided by the engineered potential guide RNA.

[0132] In some examples, a double-stranded RNA (dsRNA) substrate (guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The bulge can be symmetric or asymmetric. An asymmetric bulge is formed when there are different numbers of nucleotides on each side of the bulge. For example, an asymmetric bulge in a guide-target RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. In some embodiments, an asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 1 nucleotide on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric bulge of the present disclosure may be formed by one nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and two nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA scaffold and two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and three nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA scaffold and three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and four nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA scaffold and four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and three nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by two nucleotides on the target RNA side of the guide-target RNA scaffold and three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and four nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by two nucleotides on the target RNA side of the guide-target RNA scaffold and four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric bulge of the present disclosure can be formed by three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and four nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure can be formed by three nucleotides on the target RNA side of the guide-target RNA scaffold and four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, the asymmetric bulge can be a structural feature formed from a potential structure provided by an engineered potential guide RNA.

[0133] In some instances, a double-stranded RNA (dsRNA) substrate (guide-target RNA scaffold) is formed upon hybridization of the engineered guide RNA of the present disclosure to the target RNA. As disclosed herein, an "internal loop" refers to a structure that is substantially formed upon formation of the guide-target RNA scaffold, in which nucleotides in either the engineered guide RNA or the target RNA are not complementary to their positional counterparts on the opposite strand, and one side of the internal loop, either on the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold, has five or more nucleotides. If the number of nucleotides involved on both the engineered guide RNA side and the target RNA side is less than five, the resulting structure is no longer considered an internal loop, but rather a bulge or mismatch, depending on the size of the structural feature. The internal loop can be a symmetric internal loop or an asymmetric internal loop. An internal loop present near the editing site can aid in base flipping of target A in the target RNA being edited.

[0134] In some embodiments, a guide-target RNA scaffold can be formed upon hybridization of an engineered RNA (e.g., an engineered guide RNA, an antisense oligonucleotide) of the present disclosure to a target RNA. One side of the internal loop on either the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold can be formed by 5 to 150 nucleotides. One side of the internal loop can be formed by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 120, 135, 140, 145, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1,000 nucleotides, or any number in between. One side of the internal loop can be formed by 5 nucleotides. One side of the internal loop can be formed by 10 nucleotides. One side of the internal loop may be formed by 15 nucleotides. One side of the internal loop may be formed by 20 nucleotides. One side of the internal loop may be formed by 25 nucleotides. One side of the internal loop may be formed by 30 nucleotides. One side of the internal loop may be formed by 35 nucleotides. One side of the internal loop may be formed by 40 nucleotides. One side of the internal loop may be formed by 45 nucleotides. One side of the internal loop may be formed by 50 nucleotides. One side of the internal loop may be formed by 55 nucleotides. One side of the internal loop may be formed by 60 nucleotides. One side of the internal loop may be formed by 65 nucleotides. One side of the internal loop may be formed by 70 nucleotides. One side of the internal loop may be formed by 75 nucleotides. One side of the internal loop may be formed by 80 nucleotides. One side of the internal loop may be formed by 85 nucleotides. One side of the internal loop may be formed by 90 nucleotides. One side of the internal loop may be formed by 95 nucleotides.One side of the internal loop may be formed by 100 nucleotides. One side of the internal loop may be formed by 110 nucleotides. One side of the internal loop may be formed by 120 nucleotides. One side of the internal loop may be formed by 130 nucleotides. One side of the internal loop may be formed by 140 nucleotides. One side of the internal loop may be formed by 150 nucleotides. One side of the internal loop may be formed by 200 nucleotides. One side of the internal loop may be formed by 250 nucleotides. One side of the internal loop may be formed by 300 nucleotides. One side of the internal loop may be formed by 350 nucleotides. One side of the internal loop may be formed by 400 nucleotides. One side of the internal loop may be formed by 450 nucleotides. One side of the internal loop may be formed by 500 nucleotides. One side of the internal loop may be formed by 600 nucleotides. One side of the internal loop can be formed by 700 nucleotides. One side of the internal loop can be formed by 800 nucleotides. One side of the internal loop can be formed by 900 nucleotides. One side of the internal loop can be formed by 1,000 nucleotides. Thus, the internal loop can be a structural feature formed from the potential structure provided by the engineered potential guide RNA.

[0135] In some embodiments, a double-stranded RNA (dsRNA) substrate (guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The internal loop can be a symmetric internal loop or an asymmetric internal loop. A "symmetric internal loop" can be formed when there are the same number of nucleotides on each side of the internal loop. For example, a symmetric internal loop in a guide-target RNA scaffold of the present disclosure can have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. In some examples described herein, a symmetric internal loop of the present disclosure can be formed from 5 to 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 5 to 150 nucleotides on the target RNA side of the guide-target RNA scaffold, where the number of nucleotides is the same on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 5 to 1,000 nucleotides on the engineered guide RNA side of the dsRNA target and 5 to 1,000 nucleotides on the target RNA side of the guide-target RNA scaffold, where the number of nucleotides is the same on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 5 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by eight nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and eight nucleotides on the target RNA side of the guide-target RNA scaffold.A symmetric internal loop of the present disclosure may be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 15 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 15 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 20 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 20 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 30 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 30 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 40 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 40 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 50 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 60 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 60 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 70 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 70 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 80 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 80 nucleotides on the target RNA side of the guide-target RNA scaffold.A symmetric internal loop of the present disclosure can be formed by 90 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 90 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 100 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 110 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 110 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 120 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 120 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 130 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 130 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 140 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 140 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 150 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 200 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 250 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 250 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 300 nucleotides on the target RNA side of the guide-target RNA scaffold.The symmetric internal loop of the present disclosure can be formed by 350 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 350 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 400 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 450 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 450 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 500 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 600 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 600 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 700 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 700 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 800 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 800 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 900 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 900 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 1,000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 1,000 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, the symmetric internal loop can be a structural feature formed from potential structures provided by potential engineered guide RNAs.

[0136] Some examples of the present disclosure provide guide-target RNA scaffolds that can be formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The internal loop can be a symmetric internal loop or an asymmetric internal loop. An "asymmetric internal loop" is formed when there are different numbers of nucleotides on each side of the internal loop. For example, an asymmetric internal loop in a guide-target RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. In some embodiments, an asymmetric internal loop of the present disclosure can be formed by 5 to 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 5 to 150 nucleotides on the target RNA side of the guide-target RNA scaffold, where the number of nucleotides on the engineered guide RNA side of the guide-target RNA scaffold is different from the number of nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 to 1,000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 5 to 1,000 nucleotides on the target RNA side of the guide-target RNA scaffold, where the number of nucleotides on the engineered guide RNA side of the guide-target RNA scaffold is different from the number of nucleotides on the target RNA side of the guide-target RNA scaffold. In some examples, the asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides on the target RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of an 8-nucleotide internal loop of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of a 9-nucleotide internal loop of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of a 10-nucleotide internal loop of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of a 7-nucleotide internal loop of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of an 8-nucleotide internal loop of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure can be formed by six nucleotides on the target RNA side of the guide-target RNA scaffold and eight nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by six nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of a nine-nucleotide internal loop of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by six nucleotides on the target RNA side of the guide-target RNA scaffold and nine nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by six nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of a ten-nucleotide internal loop of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by six nucleotides on the target RNA side of the guide-target RNA scaffold and ten nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by seven nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of an eight-nucleotide internal loop of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by seven nucleotides on the target RNA side of the guide-target RNA scaffold and eight nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by seven nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of a nine-nucleotide internal loop of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by seven nucleotides on the target RNA side of the guide-target RNA scaffold and nine nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by seven nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of a ten-nucleotide internal loop of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure can be formed by 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of a 9-nucleotide internal loop of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of a 10-nucleotide internal loop of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and the target RNA side of a 10-nucleotide internal loop of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 9 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop shown can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 ... The asymmetric internal loop of the present disclosure may be formed by 1,000 nucleotides on the RNA side and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 1,000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 1,000 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, the asymmetric internal loop may be a structural feature formed from a potential structure provided by a potential engineered guide RNA.

[0137] Some embodiments provide a guide-target RNA scaffold formed upon hybridization of an engineered guide RNA and a target RNA of the present disclosure, wherein a structural feature can be present in the guide-target RNA scaffold of the present disclosure, the structural feature can be a hairpin. In some cases, the engineered guide RNA of the present disclosure may lack a hairpin domain. In other cases, the engineered guide RNAs described herein may contain one hairpin domain, or two or more hairpin domains. As described herein, a "hairpin" includes an RNA duplex in which a portion of a single-stranded RNA strand folds back on itself to form an RNA duplex. The portion of the single-stranded RNA strand folds back on itself due to having nucleotide sequences that base-pair with each other, and the nucleotide sequences are separated by an intervening sequence that does not base-pair with itself, thus forming a base-paired portion and a non-base-paired intervening loop portion. The hairpin's entire duplex structure can have a length of 10 to 500 nucleotides. The loop portion of the hairpin can be 3 to 15 nucleotides long. Hairpins can be present in any of the engineered guide RNAs disclosed herein. The engineered guide RNAs disclosed herein can have 1 to 10 hairpins. In some embodiments, the engineered guide RNAs disclosed herein can have one hairpin. In some embodiments, the engineered guide RNAs disclosed herein can have two hairpins. As disclosed herein, a hairpin can refer to a recruitment hairpin, a hairpin, or a non-recruitment hairpin. Hairpins can be located anywhere within the engineered guide RNAs of the present disclosure. In some embodiments, one or more hairpins are proximal to or at the 3' end of the engineered guide RNA of the present disclosure, proximal to or at the 5' end of the engineered guide RNA of the present disclosure, or any combination thereof.

[0138] In some instances, the "recruitment hairpin" can at least partially recruit an RNA editing entity, such as an ADAR, as disclosed herein. In some embodiments, the recruitment hairpin may be formed and exist in the absence of binding to a target RNA. In some embodiments, the recruitment hairpin is a GluR2 domain or a portion thereof. In some embodiments, the recruitment hairpin is an Alu domain or a portion thereof. The recruitment hairpin may comprise a naturally occurring ADAR substrate or cleavage thereof, as defined herein. Thus, recruitment hairpins such as GluR2 are not structural features formed by potential structures provided in the engineered potential guide RNA, but rather are preformed structural features that may be present in a construct comprising the engineered guide RNA.

[0139] In some embodiments, a "non-recruiting hairpin" as disclosed herein does not have the primary function of recruiting an RNA editing entity. In some cases, a non-recruiting hairpin does not recruit an RNA editing entity. A non-recruiting hairpin can function to improve localization of an engineered guide RNA to a target RNA. In some embodiments, a non-recruiting hairpin improves nuclear retention. In some embodiments, a non-recruiting hairpin comprises a hairpin from a U7 snRNA. Thus, a non-recruiting hairpin, such as a hairpin derived from a U7 snRNA, is not a structural feature formed by a potential structure provided in an engineered potential guide RNA, but rather is a pre-formed structural feature that may be present in a construct comprising an engineered guide RNA construct.

[0140] Hairpins of the present disclosure can be of any length, hi some embodiments, hairpins can be about 10 to 500 or more nucleotides. In some cases, the hairpin may be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80 , 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 1 43, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258,259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289 9, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 3 20, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381 , 382, ​​383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412 2, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 4 43, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500 or more nucleotides.10-20, 10-30, 10-40, 10-50, 10-60, 10-70, 10-80, 10-90, 10-100, 10-110, 10-120, 10-130, 10-140, 10-150, 10-160, 10-170, 10-180, 10-190, 10-200, 10-210, 10-220, 10-230, 10-240, 10-250, 10-260, 10-270, 10-280, 10-290, 10-300, 10-310, 10-320, 10-330, 10-340, 10-350, 10-360, 10-370, 10-380, 10-390, 10-400, 10-410, 10-420, 10-430, 10-440, 10-450, 10-460, 10-470, 10-480, 10-490, 10-500, 10-510, 10-520, 10-530, 10-540, 10-550, 10-560, 10-570, 10-580, 10-590, 10-600, 10-610, 10-620, 10-630, 10-640, 10-650, 10-660 It may contain 0 to 280, 10 to 290, 10 to 300, 10 to 310, 10 to 320, 10 to 330, 10 to 340, 10 to 350, 10 to 360, 10 to 370, 10 to 380, 10 to 390, 10 to 400, 10 to 410, 10 to 420, 10 to 430, 10 to 440, 10 to 450, 10 to 460, 10 to 470, 10 to 480, 10 to 490, or 10 to 500 nucleotides.

[0141] In other embodiments, the structural features described herein include wobble bases. A "wobble base pair" refers to two bases that weakly base pair. For example, a wobble base pair in the present disclosure may refer to a G paired with a U. Thus, a wobble base pair may be a structural feature formed from a potential structure provided by an engineered potential guide RNA.

[0142] RNA editing RNA editing refers to the process by which RNA can be enzymatically modified after synthesis at a specific nucleoside. RNA editing can include any one of the insertion, deletion, or substitution of a nucleotide(s). Examples of RNA editing include chemical modifications such as pseudouridylation (isomerization of uridine residues) and deamination (removal of an amine group from cytidine to produce uridine, i.e., C to U editing, or adenosine to produce inosine, i.e., A to I editing). RNA editing can be used to introduce mutations, correct missense mutations, or edit coding or non-coding regions of RNA to inhibit RNA translation and result in protein knockdown. In some cases, using the engineered RNA of the present disclosure to inhibit, cover, mask, or block a target sequence in a target RNA can be used to knock down the expression of a protein translated from the target RNA.

[0143] An engineered RNA (e.g., an engineered guide RNA or ASO) of the present disclosure comprising a targeting sequence can be linked to a heterologous engineered RNA element (e.g., an engineered SmOPT variant, an engineered U7 hairpin variant, or both, such as an element having the polynucleotide sequence of any one of SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:60, SEQ ID NO:61, or SEQ ID NO:62). The engineered guide RNAs described herein are longer than antisense oligonucleotides. Therefore, engineered guide RNAs can have a much higher order structure compared to shorter chemically modified guide or antisense oligonucleotides that cannot generate the same structure as the engineered guide RNA. In some embodiments, an engineered RNA (e.g., an engineered guide RNA or ASO) of the present disclosure comprising a targeting sequence substantially complementary to a target RNA can be operably linked to an engineered SmOPT variant sequence described herein. In other examples, an engineered RNA (e.g., an engineered guide RNA or ASO) of the present disclosure that includes a targeting sequence substantially complementary to a target RNA can be operably linked to an engineered U7 hairpin variant sequence described herein. Furthermore, in further embodiments of the present disclosure, an engineered RNA (e.g., a guide RNA or ASO) described that includes a targeting sequence substantially complementary to a target RNA can be operably linked to an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence described herein.

[0144] In some cases, RNA editing entities such as ADARs may be, but are not limited to, enzymes that catalyze the chemical conversion of adenosine to inosine in RNA. Because the properties of inosine mimic those of guanosine (for example, inosine forms two hydrogen bonds with cytosine), inosine can be recognized as guanosine by the cellular translation machinery. Therefore, "adenosine-to-inosine (A to I) RNA editing" effectively changes the primary sequence of the RNA target. Generally, ADAR enzymes share a common domain architecture, including a variable number of amino-terminal dsRNA-binding domains (dsRBDs) and a single carboxy-terminal catalytic deaminase domain. Human ADARs possess two or three dsRBDs. Evidence suggests that ADARs can form homodimers and, when bound to double-stranded RNA, heterodimers with other ADARs; however, it is currently uncertain whether dimerization is required for editing. The engineered guide RNAs disclosed herein can facilitate RNA editing by any one or any combination of human ADAR genes (e.g., ADAR1-3). ADARs have a typical modular domain organization, including at least two copies of a dsRNA-binding domain (dsRBD, ADAR1 with three dsRBDs, ADAR2 and ADAR3 with two dsRBDs each) in their N-terminal region, followed by a C-terminal deaminase domain. The engineered guide RNAs disclosed herein facilitate RNA editing by endogenous ADAR enzymes. In some embodiments, exogenous ADARs can be delivered together with the engineered guide RNAs disclosed herein.

[0145] As provided herein, an engineered guide RNA may contain a targeting sequence that has target complementarity to a target RNA of interest. Hybridization of a target RNA to the targeting sequence of an engineered guide RNA can provide structural features that are substrates for ADAR editing. Thus, the engineered guide RNAs provided herein can bind site-specifically to the target and facilitate targeted editing of the target RNA. Furthermore, the engineered guide RNAs described herein may contain two additional sequences that, when present, increase the amount or efficiency of editing. First, the engineered guide RNA may contain an Sm or Sm-like binding domain sequence. Second, the engineered guide RNA may contain a hairpin from an snRNA. Without wishing to be bound by theory, the presence of either of these features can improve the localization of the engineered guide RNA to the target RNA. Furthermore, the engineered guide RNAs disclosed herein may contain an engineered Sm or Sm-like binding domain in which at least one nucleotide is substituted for the naturally occurring Sm or Sm-like binding domain. Furthermore, the engineered RNAs of the present disclosure may comprise snRNA hairpins in which at least one nucleotide is substituted relative to a naturally occurring snRNA hairpin. For example, the engineered guide RNAs of the present disclosure may comprise a targeting sequence having sufficient complementarity to the target RNA to allow hybridization of the engineered guide RNA and the target RNA, and the engineered guide RNA is operably linked to an RNA element such as an engineered SmOPT variant sequence comprising a modification or variant of the Sm binding domain sequence of SEQ ID NO: 1 (AAUUUGUSKAG) or the SmOPT sequence of SEQ ID NO: 2 (AAUUUUUGGAG) described herein, an engineered U7 hairpin variant sequence comprising a modification or variant of the U7 hairpin sequence of SEQ ID NO: 3 (mouse: CAGGUUUUCUGACUUCGGUCGGAAAACCCCU) or SEQ ID NO: 4 (human: UAGGCUUUCUGGCUUUUUACCGGAAAGCCCCU), or a combination thereof.

[0146] In some embodiments, the engineered guide RNAs described herein can be further operably linked to an RNA polymerase II type promoter.Non-limiting examples of useful RNA polymerase II type promoters of the present disclosure include U1 promoters (e.g., SEQ ID NO: 10, human), U7 promoters (e.g., SEQ ID NO: 11-mouse, SEQ ID NO: 12-human), and any combination thereof.In some embodiments, the engineered guide RNAs described herein can be operably linked to a U7 promoter. Some examples include the following: an engineered guide RNA comprising a targeting sequence of (a); an engineered SmOPT variant sequence of (b), wherein the engineered SmOPT variant sequence is an engineered Sm or Sm-like protein binding domain, and the engineered Sm or Sm-like protein binding domain sequence can be an engineered SmOPT variant sequence; an engineered SmOPT variant sequence of (b); an engineered U7 hairpin variant sequence of (c), wherein the engineered U7 hairpin variant sequence is an engineered mouse U7 snRNA hairpin variant sequence or an engineered human U7 snRNA hairpin variant sequence; an engineered U7 hairpin variant sequence of (c); or both the engineered SmOPT variant sequence of (b) and the engineered U7 hairpin variant sequence of (c).

[0147] In some embodiments, the described engineered guide RNAs further comprise a terminator. Exemplary terminators include, but are not limited to, the mouse U7 terminator (SEQ ID NO: 13), the human U7 terminator (SEQ ID NO: 14), or a U7 box terminator, where the terminator can be operably linked to the engineered guide RNA. In some embodiments, the terminator comprises a 3' box. In some embodiments, the terminator is a 3' box. The 3' box can be, but is not limited to, the mouse U7 3' box (mU7 3' box, SEQ ID NO: 15) or the human U7 3' box (hU7 3' box, SEQ ID NO: 16). In some embodiments, the engineered RNAs of the present disclosure further comprise a terminator that is 3' of at least one mismatch formed upon hybridization of the targeting sequence and the target RNA. In some embodiments, the terminator is 3' to a hairpin disclosed herein. In some embodiments, the terminator comprises a 3' box, one or more nucleotides positioned between the 3' box and the hairpin, and one or more nucleotides 3' to the 3' box, hi some embodiments, the terminator comprises a 3' box and one or more nucleotides positioned between the 3' box and the hairpin.

[0148] In some embodiments, the terminator is a truncated terminator. The truncated terminator can be a terminator having at least one nucleotide longer than the reference terminator. The reference terminator for the truncated terminator is, for example, the mouse U7 terminator (SEQ ID NO: 13), the human U7 terminator (SEQ ID NO: 14), or a U7 box terminator. In some embodiments, the truncated terminator cleaves 1 to 150 nucleotides shorter than the reference terminator. In some embodiments, the cleavage is 50 nucleotides shorter than the reference terminator. In some embodiments, the cleavage is 79 nucleotides shorter than the reference terminator. In some embodiments, the cleavage is 92 nucleotides shorter than the reference terminator. In some embodiments, the cleavage is of one or more nucleotides located between the hairpin and the 3' box compared to the reference terminator. In some embodiments, the cleavage is of one or more nucleotides located 3' of the 3' box compared to the reference terminator. In some embodiments, the truncation is of one or more nucleotides located between the hairpin and the 3' box compared to the reference terminator, and one or more nucleotides located 3' of the 3' box compared to the reference terminator. For example, the truncated terminator has a deletion of 50 nucleotides 3' to the 3' box compared to the reference terminator (e.g., SEQ ID NO: 14). As another example, the truncated terminator has a deletion of 50 nucleotides 3' to the 3' box compared to the reference terminator (e.g., SEQ ID NO: 14), and a deletion of 28 nucleotides located between the hairpin and the 3' box compared to the reference terminator (e.g., SEQ ID NO: 14). In some embodiments, the hairpin is truncated compared to a reference hairpin, such as the sequence of a hairpin disclosed herein. In some embodiments, the truncated hairpin has a deletion of 1 to 15 nucleotides compared to the reference hairpin. In some embodiments, the truncated hairpin has a deletion of 7 nucleotides compared to the reference hairpin. Various elements of engineered guide RNAs are shown in Table 2.

[0149] In some embodiments, the engineered guide RNAs of the present disclosure target the RAB7A 3'UTR, which can be expressed using a U7 or U1 promoter, such as, but not limited to, a mouse U7 (mU7) promoter, a human U7 (hU7) promoter, or a human U1 (hU1) promoter, using (a) (b) an engineered SmOPT variant sequence and (c) an engineered U7 hairpin variant sequence, operably linked to a mouse U7 (mU7) or human U7 (hU7) terminator sequence. In some embodiments, the mouse U7 or human U7 terminator is a truncated terminator.

[0150] Other aspects described herein provide engineered guide RNAs of the present disclosure targeting RAB7A exon 1, which can be expressed using the mU7 promoter or the RAB7A exon 3 human U7 promoter using (a) (b) an engineered SmOPT variant sequence, (c) an engineered U7 hairpin variant sequence, or both the engineered SmOPT variant sequence of (b) and the engineered U7 hairpin variant sequence of (c), and are operably linked to a mouse U7 or human U7 terminator sequence. In some embodiments, the mouse U7 or human U7 terminator is a truncated terminator.

[0151] Another example can provide an engineered RNA of the present disclosure, which can be expressed using (a) any promoter (e.g., U1, U6, or U7) with (b) an engineered SmOPT variant sequence, (c) an engineered U7 hairpin variant sequence, or both the (b) engineered SmOPT variant sequence and the (c) engineered U7 hairpin variant sequence, and is an engineered guide RNA targeting the LRRK2 gene operably linked to a mouse U7 terminator sequence or a human U7 terminator sequence. In some embodiments, the mouse U7 terminator sequence or the human U7 terminator sequence is a truncated terminator.

[0152] In some embodiments, the engineered RNA can be expressed using any promoter, for example, a U6 promoter or a U1 promoter, having (a) (b) sequence or an engineered SmOPT variant sequence, (c) a hairpin or engineered U7 hairpin variant sequence, or both the engineered SmOPT variant sequence of (b) and the engineered U7 hairpin variant sequence of (c), wherein at least one of (b) and (c) comprises an engineered guide RNA targeting the ABCA4 gene operably linked to an engineered terminator sequence (e.g., a mouse U7 or human U7 terminator sequence). In some embodiments, the mouse U7 or human U7 terminator is a truncated terminator.

[0153] In some examples, the engineered RNA of the present disclosure comprises an engineered guide RNA that can be expressed using, for example, a human U1 promoter with a 5' dual hnRNP A1-binding domain, and targets the RAB7A 3'UTR, operably linked to a terminator sequence, e.g., a mouse U7 or human U7 terminator sequence, having (a) (b) an engineered SmOPT variant sequence, (c) an engineered U7 hairpin variant sequence, or both the engineered SmOPT variant sequence of (b) and the engineered U7 hairpin variant sequence of (c). In some embodiments, the mouse U7 or human U7 terminator is a truncated terminator.

[0154] Some embodiments provide in vitro assays that can determine editing efficiency. In some aspects, the in vitro assays for determining the amount of nucleotide base editing of a target RNA by an RNA editing entity using an engineered guide RNA described herein include RNA sequencing. For example, an engineered guide RNA containing an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both can facilitate increased editing of nucleotide bases of a target RNA by an RNA editing entity, as determined by RNA sequencing, compared to an otherwise equivalent RNA lacking the engineered SmOPT variant sequence, the engineered U7 hairpin variant sequence, or both the engineered SmOPT variant sequence and the engineered U7 hairpin variant sequence. Some examples provide in vitro assays that can determine editing efficiency by (i) transfecting the target RNA into a primary cell line, (ii) transfecting the engineered polynucleotide and an otherwise equivalent polynucleotide into a primary cell line, and (iii) sequencing the target RNA. In some embodiments, editing efficiency can be determined by (i) transfecting the target RNA into a primary cell line, (ii) transfecting the engineered polynucleotide and an otherwise equivalent polynucleotide into the primary cell line, and (iii) mass spectrometry analysis of the target RNA. In some embodiments, editing of nucleotide bases of the target RNA by an RNA editing entity can be determined in an in vitro assay comprising (i) directly or indirectly introducing (e.g., transfecting) the target RNA into a primary cell line, (ii) directly or indirectly introducing (e.g., transfecting) the engineered polynucleotide into the primary cell line, and (iii) sequencing the target RNA. In some cases, transfecting the target RNA into a primary cell line can comprise transfecting a plasmid encoding the target RNA into the primary cell line.In some cases, transfecting the engineered polynucleotide into the primary cell line may include transfecting a precursor engineered polynucleotide or a polynucleotide (e.g., a plasmid) encoding the precursor engineered polynucleotide into the primary cell line. In some cases, sequencing may include Sanger sequencing of the target RNA after the target RNA has been converted to cDNA by reverse transcriptase.

[0155] In some embodiments, engineered guide RNAs of the present disclosure, comprising a targeting sequence sufficiently complementary to a target RNA of interest and an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence, facilitated ADAR-mediated RNA editing of 1-100% of target adenosines. Engineered guide RNAs of the present disclosure can facilitate editing of 40-90% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure can facilitate RNA editing of at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100%, 5-20%, 20-40%, 40-60%, 60-80%, 80-100%, 60-80%, 70-90%, or up to 90% or more of the target adenosines. Optionally, additionally, engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 10% editing of off-target adenosines. Optionally, additionally, engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining editing of less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, or 0% of off-target adenosines. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4]

Table 2-5

Table 2-6

Table 2-7

Table 2-8

Table 2-9

Table 2-10

Table 2-11

Table 2-12

[0156] Target RNA and mutation In various embodiments described herein, the engineered RNA (engineered guide RNA, ASO) provided herein may include a targeting sequence substantially complementary to a target RNA, and an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence. The engineered guide RNA of the present disclosure is useful as a therapeutic agent for treating a subject suffering from a disease or condition, where the subject may have a target RNA containing a mutation or a target RNA requiring a mutation. In some examples of the present disclosure, a method for treating (including preventing, alleviating, or alleviating) a subject suffering from a disease or condition or a symptom of a disease or condition comprises administering to the subject a therapeutic agent that facilitates editing of the target RNA. In some embodiments, editing the target RNA can facilitate correction of the mutation. For example, the engineered RNA of the present disclosure can facilitate editing of an adenosine present in a mutation to an inosine (read as guanosine). By targeting RNAs with G-to-A point mutations, the engineered RNAs of the present disclosure can correct the mutations by directly utilizing ADAR1- or ADAR2-mediated editing of the mutations. In some cases, as described herein, the mutations can be corrected by exon skipping. The engineered RNAs (engineered guide RNAs, ASOs) described herein can facilitate ADAR1- or ADAR2-mediated adenosine editing, facilitating the skipping of exons with specific mutations, thereby restoring functional proteins. In some cases, the engineered RNAs (engineered guide RNAs, ASOs) of the present disclosure can be designed or configured to inhibit, cover, mask, or block target sequences with mutations in the target RNA, thereby facilitating exon skipping of the mutations in the target RNA in the absence of ADAR-mediated editing.In some cases, the engineered RNAs of the present disclosure can facilitate editing of a target adenosine, or can inhibit, cover, mask, or block a target sequence, either of which induces exon skipping of a mutation in the target RNA.

[0157] The mutation may be a missense mutation or a nonsense mutation. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate multiple RNA editing of a target RNA. As used herein, the term "mutation" refers to a change to a nucleic acid sequence encoding a protein compared to the consensus sequence of that protein. A "missense" mutation substitutes one codon for another. A "nonsense" mutation changes a codon from one encoding a specific amino acid to a stop codon. Nonsense mutations often result in truncated translation of a protein. A "silent" mutation does not affect the resulting protein. As used herein, the term "point mutation" refers to a mutation that affects only one nucleotide in a gene sequence. A "splice site mutation" is a mutation present in pre-mRNA (before processing to remove introns) that causes mistranslation of a protein due to incorrect delineation of a splice site, often resulting in truncation. A mutation may include a single nucleotide mutation (SNV). A mutation may include a sequence variant, sequence variation, sequence change, or allelic variant. A reference DNA sequence can be obtained from a reference database. Mutations may affect function. Mutations may not affect function. Mutations may occur at the DNA level in one or more nucleotides, at the ribonucleic acid (RNA) level in one or more nucleotides, at the protein level in one or more amino acids, or any combination thereof. Reference sequences can be obtained from databases such as the NCBI Reference Sequence Database (RefSeq) database. Specific changes that may constitute mutations may include substitutions, deletions, insertions, inversions, or transversions in one or more nucleotides or one or more amino acids. Mutations may be point mutations. Mutations may be fusion genes. Fusion pairs or fusion genes may result from mutations such as translocations, interstitial deletions, chromosomal inversions, or any combination thereof. Mutations may constitute variations in the number of repeat sequences, such as triplicates, tetraplexes, etc. For example, mutations may be an increase or decrease in the copy number associated with a given sequence (copy number variation, or CNV).A mutation may include two or more sequence changes in different alleles, or two or more sequence changes in one allele. A mutation may include two different nucleotides at one position in one allele, such as a mosaic. A mutation may include two different nucleotides at one position in one allele, such as a chimera. A mutation may be present in malignant tissue. The presence or absence of a mutation may indicate an increased risk of developing a disease or condition. The presence or absence of a mutation may indicate the presence of a disease or condition. A mutation may be present in benign tissue. The absence of a mutation may indicate that the tissue or sample is benign. Alternatively, the absence of a mutation may not indicate that the tissue or sample is benign. The methods described herein may include identifying the presence of a mutation in a sample.

[0158] In some cases, the engineered RNAs (engineered guide RNAs, ASOs) disclosed herein can be designed or configured to inhibit, cover, mask, or block a target sequence in a target RNA, thereby knocking down the expression of a protein translated from the target RNA. In some embodiments, the engineered RNAs (engineered guide RNAs or ASOs) described herein can introduce mutations to generate protein knockdown. Protein knockdown can also be referred to as reduced expression of a wild-type protein. The engineered guide RNAs disclosed herein can target one or any combination of the following: a translation initiation site (TIS), an untranslated region such as a 5'UTR, a polyadenylation (polyA) signal site, or a splice site.

[0159] TIS. In some embodiments, the engineered RNA of the present disclosure targets adenosine at the translation initiation site (TIS). The engineered guide RNA facilitates ADAR-mediated RNA editing of TIS (AUG) to GUG. This results in the inhibition of RNA translation, thereby resulting in protein knockdown.

[0160] 5'UTR. In some embodiments, engineered guide RNAs of the present disclosure target one or more adenosines in the 5' untranslated region (5'UTR). In some embodiments, engineered guide RNAs of the present disclosure may target a Kozak sequence in the 5'UTR. In some embodiments, engineered guide RNAs of the present disclosure may target an internal ribosome entry site (IRES) in the 5'UTR. In some embodiments, engineered guide RNAs of the present disclosure may target an iron-responsive element (IRE) in the 5'UTR. In some embodiments, engineered guide RNAs facilitate ADAR-mediated RNA editing of one or more adenosines in the 5'UTR (including one or more adenosines present in one or more structures in the 5'UTR). In some cases, extensive or excessive editing of multiple adenosines can be facilitated via engineered guide RNAs of the present disclosure, which can result in ribosome stalling of mRNA transcripts, thereby resulting in protein knockdown.

[0161] Splice Sites. In some embodiments, the engineered RNAs disclosed herein target adenosines at splice sites. The engineered guide RNA facilitates ADAR-mediated RNA editing of the A at the splice site. This can result in mistranslation and / or cleavage of the protein encoded by the pre-mRNA molecule, thereby resulting in protein knockdown.

[0162] PolyA signal sequence. In some embodiments, the engineered RNAs of the present disclosure target one or more adenosines in a polyA signal sequence. In some embodiments, the engineered guide RNA facilitates ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence, thereby disrupting RNA processing and resulting in degradation of the target mRNA and, thereby, protein knockdown. In some embodiments, the target may have one or more polyA signal sequences. In these cases, one or more engineered RNAs of the present disclosure, each with a different sequence, can be multiplexed to target adenosines in one or more polyA signal sequences. In both cases, the engineered RNAs of the present disclosure facilitate ADAR-mediated RNA editing of adenosines in the polyA signal sequence to inosines (which are read as guanosines by the cellular machinery), resulting in protein knockdown.

[0163] ABCA4. Provided herein are engineered RNA payloads, such as engineered guide RNAs or antisense oligonucleotides (ASOs), operably linked to any one of the engineered SmOPT variant sequences or engineered U7 variant sequences disclosed herein, or any combination thereof, wherein the engineered RNA payload targets ABCA4 RNA. In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting ABCA4, is operably linked to any one of SEQ ID NOs: 49 (the RNA sequence of SEQ ID NO: 60). In some cases, the engineered RNA payload, such as an ASO or guide RNA targeting ABCA4, is operably linked to any one of SEQ ID NOs: 50 (the RNA sequence of SEQ ID NO: 61). In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting ABCA4, is operably linked to any one of SEQ ID NOs: 51 (the RNA sequence of SEQ ID NO: 62). Some examples provide engineered RNAs (e.g., engineered guide RNAs, ASOs) of the present disclosure that can include a targeting sequence having target complementarity to a target RNA that is ATP-binding cassette subfamily A member 4 (ABCA4). In some embodiments of the present disclosure, the engineered guide RNAs or therapeutics described herein that include an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence can facilitate RNA editing of an ABCA4 target RNA that can have a mutation selected from the group consisting of G6320A, G5714A, G5882A, and any combination thereof. The engineered guide RNAs described herein that include an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence can correct a G to A mutation in the ABCA4 gene, among other RNA elements.The engineered guide RNAs of the present disclosure may comprise an engineered SmOPT variant sequence having up to 90.9% sequence identity to SEQ ID NO:1 or SEQ ID NO:2, an engineered U7 hairpin variant sequence having up to 96.8% sequence identity to SEQ ID NO:3, or up to 96.9% sequence identity to SEQ ID NO:4, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence. In other embodiments, the engineered guide RNAs described herein may comprise an engineered SmOPT variant sequence having at least one polynucleotide substitution (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11) compared to SEQ ID NO:1 or SEQ ID NO:2. Some embodiments provide an engineered guide RNA as described herein, wherein the engineered guide RNA comprises an engineered U7 hairpin variant sequence having at least one polynucleotide substitution (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32) compared to SEQ ID NO: 3 or SEQ ID NO: 4. Further embodiments can provide an engineered guide RNA comprising a targeting sequence having substantial complementarity to an ABCA4 target, and an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence, incorporated with any promoter disclosed herein (e.g., U1, U6, or U7), which can drive expression of the engineered guide RNA. In some cases, ABCA4 mutations cause or contribute to macular degeneration in a subject in need thereof, and the engineered guide RNA described can be administered for treatment. In some cases, the macular degeneration can be Stargardt's macular degeneration. In some embodiments, a human subject can be at risk for or has Stargardt's macular degeneration (or Stargardt's disease), which can be caused, at least in part, by one of the mutations described in ABCA4.Some embodiments of the present disclosure provide an engineered guide RNA for facilitating editing in a subject, thereby correcting a mutation in ABCA4 and reducing the occurrence of Stargardt disease, the engineered guide RNA comprising a targeting sequence substantially complementary to an ABCA4 target RNA and an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence. In some examples, the target RNA molecule includes an adenosine with a 5' G. In some examples, the adenosine with a 5' G can be a base intended for chemical modification by an RNA editing entity. In some examples, the RNA editing entity can be an ADAR, which chemically modifies the adenosine with a 5' G after recruitment by the guide-target RNA scaffold. Thus, such an engineered guide RNA can be used in a method for treating a subject suffering from Stargardt macular degeneration.

[0164] Another example of the present disclosure is amyloid precursor protein (APP), which can be targeted for editing by an engineered guide RNA. Provided herein are engineered RNA payloads, such as engineered guide RNAs or antisense oligonucleotides (ASOs), operably linked to any one of the engineered SmOPT variant sequences or engineered U7 variant sequences disclosed herein, or any combination thereof, where the engineered RNA payload targets APP RNA. In certain cases, the engineered RNA payload, such as an ASO or guide RNA-targeted APP, is operably linked to any one of SEQ ID NOs: 49 (the RNA sequence of SEQ ID NO: 60). In some cases, the engineered RNA payload, such as an ASO or guide RNA-targeted APP, is operably linked to any one of SEQ ID NOs: 50 (the RNA sequence of SEQ ID NO: 61). In certain cases, the engineered RNA payload, such as an ASO or guide RNA-targeted APP, is operably linked to any one of SEQ ID NOs: 51 (the RNA sequence of SEQ ID NO: 62). In some embodiments, specific residues can be targeted using engineered RNAs (e.g., engineered guide RNAs, ASOs) comprising an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence, and the methods described herein. In some examples, the engineered RNAs (e.g., engineered guide RNAs, ASOs) described herein are configured to facilitate editing of nucleotide bases in a target RNA by an RNA editing entity to form an edited target RNA, such that a protein translated from the edited target RNA contains at least one modification or mutation selected from the group consisting of K670E, K670R, K670G, M671V, A673V, A673T, D672G, E682G, H684R, K687R, K687E, K687G, I712X, T714X, and any combination thereof.In some embodiments of the present disclosure, the target RNA encodes an unmodified APP polypeptide containing at least one amino acid residue difference compared to a modified APP polypeptide generated from editing the nucleotide bases of the APP target RNA, wherein the at least one amino acid residue difference is selected from the group consisting of K670E, K670R, K670G, M671V, A673V, A673T, D672G, E682G, H684R, K687R, K687E, K687G, I712X, T714X, and any combination thereof. In some examples, the target RNA molecule at least partially encodes an amyloid precursor protein (APP), an APP initiation site, an APP cleavage site, or a beta-secretase (BACE) or gamma-secretase cleavage site of the APP protein. In some examples, cleavage of the APP protein at the cleavage site causes or contributes to amyloid beta (Aβ or Abeta) peptide deposition in the brain or blood vessels. In some instances, Abeta deposition causes or contributes to neurodegenerative diseases. In some instances, the diseases include Alzheimer's disease, Parkinson's disease, corticobasal degeneration, dementia with Lewy bodies, Lewy body variants of Alzheimer's disease, Parkinson's disease with dementia, Pick's disease, progressive supranuclear palsy, dementia, frontotemporal dementia with parkinsonism associated with tau mutations on chromosome 17, or any combination thereof. The engineered RNA (e.g., engineered guide RNA, ASO) of the present disclosure, which comprises a targeting sequence substantially complementary to an APP target RNA and comprises an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence, can be used to facilitate editing of nucleotide bases of an APP target RNA by an RNA editing entity to form an edited APP target RNA, such that a protein translated from the edited APP target RNA comprises at least one change or mutation described herein.Such engineered RNAs can therefore be used in methods of treating subjects suffering from neurodegenerative diseases such as, but not limited to, Alzheimer's disease, Parkinson's disease, dementia, and the like.

[0165] DMPK. Provided herein are engineered RNA payloads, such as engineered guide RNAs or antisense oligonucleotides (ASOs), operably linked to any one of the engineered SmOPT variant sequences or engineered U7 variant sequences disclosed herein, or any combination thereof, wherein the engineered RNA payload targets DMPK RNA. In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting DMPK, is operably linked to any one of SEQ ID NOs: 49 (the RNA sequence of SEQ ID NO: 60). In some cases, the engineered RNA payload, such as an ASO or guide RNA targeting DMPK, is operably linked to any one of SEQ ID NOs: 50 (the RNA sequence of SEQ ID NO: 61). In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting DMPK, is operably linked to any one of SEQ ID NOs: 51 (the RNA sequence of SEQ ID NO: 62). In some embodiments, the present disclosure provides an engineered RNA (e.g., an engineered guide RNA, ASO) comprising a targeting sequence sufficiently complementary to a DMPK target RNA and an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence, which facilitates RNA editing of DMPK to knock down expression of myotonic dystrophy protein kinase. In some cases, the engineered RNA (engineered guide RNA, ASO) of the present disclosure can be designed or configured to inhibit, cover, mask, or block a target sequence in the target DMPK RNA, thereby knocking down expression of myotonic dystrophy protein kinase. Myotonic dystrophy (DM1) is a rare neuromuscular disease characterized by progressive muscle weakness and an inability to relax muscles (muscle tone), primarily distal skeletal muscles.In some embodiments, an engineered RNA (e.g., an engineered guide RNA, ASO) of the present disclosure comprising an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence targets DMPK, and a composition comprising such an engineered guide RNA facilitates ADAR-mediated RNA editing of DMPK to knock down expression of myotonic dystrophy protein kinase.

[0166] DUX4. Provided herein are engineered RNA payloads, such as engineered guide RNAs or antisense oligonucleotides (ASOs), operably linked to any one of the engineered SmOPT variant sequences or engineered U7 variant sequences disclosed herein, or any combination thereof, wherein the engineered RNA payload targets DUX4 RNA. In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting DUX4, is operably linked to any one of SEQ ID NOs: 49 (the RNA sequence of SEQ ID NO: 60). In some cases, the engineered RNA payload, such as an ASO or guide RNA targeting DUX4, is operably linked to any one of SEQ ID NOs: 50 (the RNA sequence of SEQ ID NO: 61). In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting DUX4, is operably linked to any one of SEQ ID NOs: 51 (the RNA sequence of SEQ ID NO: 62). The present disclosure provides engineered RNAs (e.g., engineered guide RNAs, ASOs) that include an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence, and a targeting sequence sufficiently complementary to a DUX4 target RNA that facilitates the RNA editing DUX4 to knock down expression of the DUX4 protein. In some cases, the engineered RNAs (engineered guide RNAs, ASOs) of the present disclosure can be designed or configured to inhibit, cover, mask, or block a target sequence in the target DUX4 RNA, thereby knocking down expression of the DUX4 protein. Facioscapulohumeral muscular dystrophy (FSHD), an autosomal dominant neuromuscular disease, is a rare neuromuscular disease characterized by progressive skeletal muscle weakness and exhibiting significant heterogeneity in phenotypic severity and age of onset. The genetic cause of FSHD involves mutations within the D4Z4 repeat region on chromosome 4 that result in hypomethylation and dysregulated expression of the DUX4 gene (a germline transcription factor).In some embodiments, the present disclosure provides compositions of engineered RNA (e.g., engineered guide RNA, ASO) that target DUX4 and comprise an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence, and that facilitate ADAR-mediated RNA editing of DUX4-FL, mediating knockdown of DUX4, specifically DUX4-FL.

[0167] In some embodiments, the engineered RNA (e.g., engineered guide RNA, ASO) of the present disclosure facilitates ADAR-mediated RNA editing of target genes (e.g., DMPK, DUX4-FL), which results in knockdown of protein levels. In some cases, the engineered RNA (engineered guide RNA, ASO) of the present disclosure can be designed or configured to inhibit, cover, mask, or block the target sequence in the target RNA, thereby knocking down the expression of the protein translated from the target RNA. The knockdown of protein levels is quantified as a reduction in the expression of the protein (e.g., DMPK protein: myotonic dystrophy protein kinase, DUX4-FL protein). For example, an engineered RNA (e.g., an engineered guide RNA, ASO) of the present disclosure comprising a targeting sequence sufficiently complementary to a DMPK or DUX4 target of interest and an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence can facilitate 1% to 100% DMPK protein knockdown or DUX4-FL protein knockdown. The engineered RNAs of the present disclosure may be 1% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%, 90% to 100%, 20% to 40%, 30% to 50%, 40% to 60%, 50% to 70%, 60% to 80%, 20% to 50%, 30% to 60%, at least 5%, at least 10%, at least 15%, at least It can facilitate 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% DMPK protein knockdown or DUX4-FL protein knockdown.In some embodiments, the engineered RNAs (e.g., engineered guide RNAs, ASOs) of the present disclosure facilitate 30% to 60% DMPK or DUX4-FL protein knockdown. DMPK or DUX4-FL protein knockdown can be measured by an assay comparing a sample or subject treated with an engineered RNA (e.g., engineered guide RNAs, ASOs) of the present disclosure comprising an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence, to a control sample or subject not treated with an engineered guide RNA comprising an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence.

[0168] DMD. Provided herein is an engineered RNA payload, such as an engineered guide RNA or antisense oligonucleotide (ASO), operably linked to any one of the engineered SmOPT variant sequences or engineered U7 variant sequences disclosed herein, or any combination thereof, wherein the engineered RNA payload targets DMD RNA. In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting DMD, is operably linked to any one of SEQ ID NOs: 49 (the RNA sequence of SEQ ID NO: 60). In some cases, the engineered RNA payload, such as an ASO or guide RNA targeting DMD, is operably linked to any one of SEQ ID NOs: 50 (the RNA sequence of SEQ ID NO: 61). In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting DMD, is operably linked to any one of SEQ ID NOs: 51 (the RNA sequence of SEQ ID NO: 62). In some embodiments, the present disclosure provides an engineered RNA (e.g., an engineered guide RNA, ASO) that includes a targeting sequence sufficiently complementary to a DMD target RNA and an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence, which facilitate exon skipping of a DMD pre-RNA to produce a functional dystrophin protein. Duchenne muscular dystrophy (DMD) is a rare neuromuscular disease typically characterized by the loss of one or more exons of the dystrophin protein. DMD progression leads to muscle weakening over time in an irreversible manner. In some embodiments, an engineered RNA (engineered guide RNA, ASO) of the present disclosure comprising an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence targets DMPK, and a composition comprising such an engineered guide RNA can restore functional dystrophin protein from DMD transcripts carrying mutations that lead to DMD progression by promoting skipping of mutated exons.In some cases, the engineered RNA can induce exon 2 skipping in DMD pre-RNA in a subject. In some cases, the engineered RNA can induce exon 51 skipping in DMD pre-RNA in a subject. In some cases, the engineered RNA can induce exon 45 skipping in DMD pre-RNA in a subject. In some cases, the engineered RNA can induce exon 53 skipping in DMD pre-RNA in a subject. In some cases, the engineered RNA can induce exon 44 skipping in DMD pre-RNA in a subject. In some cases, the engineered RNA can induce exon 52 skipping in DMD pre-RNA in a subject. In some cases, the engineered RNA can induce exon 50 skipping in DMD pre-RNA in a subject. In some cases, the engineered RNA can induce exon 71 skipping in DMD pre-RNA in a subject. In some cases, the engineered RNA can induce exon 74 skipping in DMD pre-RNA in a subject.

[0169] LRRK2. Provided herein are engineered RNA payloads, such as engineered guide RNAs or antisense oligonucleotides (ASOs), operably linked to any one of the engineered SmOPT variant sequences or engineered U7 variant sequences disclosed herein, or any combination thereof, wherein the engineered RNA payload targets LRRK2 RNA. In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting LRRK2, is operably linked to any one of SEQ ID NOs: 49 (the RNA sequence of SEQ ID NO: 60). In some cases, the engineered RNA payload, such as an ASO or guide RNA targeting LRRK2, is operably linked to any one of SEQ ID NOs: 50 (the RNA sequence of SEQ ID NO: 61). In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting LRRK2, is operably linked to any one of SEQ ID NOs: 51 (the RNA sequence of SEQ ID NO: 62). The engineered RNAs (e.g., engineered guide RNAs, ASOs) described herein may comprise a targeting sequence having target complementarity to a leucine-rich repeat kinase 2 (LRRK2) target RNA, further comprising an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence.In some embodiments, such engineered RNAs can facilitate RNA editing of LRRK2-encoded mutations associated with a disease or condition, including E10L, A30P, S52F, E46K, A53T, L119P, A211V, C228S, E334K, N363S, V366M, A419V, R506Q , N544E, N551K, A716V, M712V, I723V, P755L, R793M, I810V, K871E, Q923H, Q930R, R1067Q, S1096C , Q1111H, I1122V, A1151T, L1165P, I1192V, H1216R, S1228T, P1262A, R1325Q, I1371V, R1398H, T1 410M, D1420N, N1437H, R1441C, R1441G, R1441H, A1442P, P1446L, V1450I, K1468E, R1483Q, R1514 Q, P1542S, V1613A, R1628P, M1646T, S1647T, Y1699C, R1728H, R1728L, L1795F, M1869V, M1869T, L The LRRK2 pathogenic variant may be selected from the group consisting of 1870F, E1874X, R1941H, Y2006H, I2012T, G2019S, I2020T, T2031S, N2081D, T2141M, R2143H, Y2189C, T2356I, G2385R, V2390M, E2395K, M2397T, L2466H, Q2490N, and any combination thereof. In some embodiments, such engineered RNAs targeting LRRK2 can be used to treat diseases or conditions, such as neurodegenerative diseases (Parkinson's disease), by editing, knocking down, or both, pathogenic variants of LRRK2. In some embodiments, the pathogenic variant of LRRK2 may include the G2019S mutation.An engineered RNA (e.g., an engineered guide RNA, ASO) that targets LRRK2 and includes an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence can be used to treat an LRRK2-related disease or condition, such as, but not limited to, muscular dystrophy, ornithine transcarbamylase deficiency, retinitis pigmentosa, breast cancer, ovarian cancer, Alzheimer's disease, pain, Stargardt macular dystrophy, Charcot-Marie-Tooth disease, Rett syndrome, or any combination thereof.

[0170] Provided herein are engineered RNA payloads, such as engineered guide RNAs or antisense oligonucleotides (ASOs), operably linked to any one of the engineered SmOPT variant sequences or engineered U7 variant sequences disclosed herein, or any combination thereof, wherein the engineered RNA payload targets MAPT RNA. In certain cases, the engineered RNA payload, such as an ASO or a guide RNA targeting MAPT, is operably linked to any one of SEQ ID NOs: 49 (the RNA sequence of SEQ ID NO: 60). In some cases, the engineered RNA payload, such as an ASO or a guide RNA targeting MAPT, is operably linked to any one of SEQ ID NOs: 50 (the RNA sequence of SEQ ID NO: 61). In certain cases, the engineered RNA payload, such as an ASO or a guide RNA targeting MAPT, is operably linked to any one of SEQ ID NOs: 51 (the RNA sequence of SEQ ID NO: 62). In some embodiments, an engineered RNA (engineered guide RNA, ASO) of the present disclosure comprising an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both, targets a coding sequence of an RNA (e.g., a TIS, such as the c.1 TIS, c.31 TIS, c.91 TIS, or c.379 TIS of MAPT). In some embodiments, an engineered RNA (engineered guide RNA, ASO) of the present disclosure comprising an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both, targets a non-coding sequence of an RNA (e.g., a polyA sequence). The present disclosure provides an engineered RNA (e.g., engineered guide RNA, ASO) comprising an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence, and a targeting sequence sufficiently complementary to the MAPT target RNA to facilitate the RNA editing MAPT to knock down expression of Tau protein.In some cases, the engineered RNAs (engineered guide RNAs, ASOs) disclosed herein can be designed or configured to inhibit, cover, mask, or block target sequences in the target MAPT RNA, thereby knocking down Tau protein expression. Tau pathology can be a major driver of a wide range of neurodegenerative diseases, collectively known as tauopathies. For example, diseases in which Tau can play a major role include, but are not limited to, Alzheimer's disease (AD), frontotemporal dementia (FTD), Parkinson's disease, progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), and chronic traumatic encephalopathy. Tauopathies are characterized by the intracellular accumulation of neurofibrillary tangles (NFTs) composed of aggregated, misfolded Tau (MAPT gene). Thus, the engineered RNAs (engineered guide RNAs, ASOs) of the present disclosure, which comprise an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both, and target MAPT RNA for ADAR-mediated editing to knockdown Tau protein, can prevent or ameliorate disease progression in several diseases, including, but not limited to, AD, FTD, autism, traumatic brain injury, Parkinson's disease, and Dravet syndrome.

[0171] Provided herein are engineered RNA payloads, such as engineered guide RNAs or antisense oligonucleotides (ASOs), operably linked to any one of the engineered SmOPT variant sequences or engineered U7 variant sequences disclosed herein, or any combination thereof, wherein the engineered RNA payload targets PMP22 RNA. In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting PMP22, is operably linked to any one of SEQ ID NOs: 49 (the RNA sequence of SEQ ID NO: 60). In some cases, the engineered RNA payload, such as an ASO or guide RNA targeting PMP22, is operably linked to any one of SEQ ID NOs: 50 (the RNA sequence of SEQ ID NO: 61). In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting PMP22, is operably linked to any one of SEQ ID NOs: 51 (the RNA sequence of SEQ ID NO: 62). The present disclosure provides engineered RNAs (e.g., engineered guide RNAs, ASOs) that target PMP22 and include an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence, facilitating RNA editing of peripheral myelin protein-22 (PMP22) to knock down PMP22 expression. In some cases, the engineered RNAs (engineered guide RNAs, ASOs) disclosed herein can be designed or configured to inhibit, cover, mask, or block a target sequence in the target PMP22 RNA, thereby knocking down PMP22 protein expression. Charcot-Marie-Tooth syndrome (CMT1A) is the most common genetically driven peripheral neuropathy characterized by progressive distal muscle atrophy, sensory loss, and foot / hand deformities.In some embodiments, the present disclosure provides an engineered RNA (e.g., engineered guide RNA, ASO) composition that targets PMP22 and comprises an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence, and facilitates ADAR-mediated RNA editing of PMP22. In some embodiments, the engineered RNA (e.g., engineered guide RNA, ASO) of the present disclosure targets a coding sequence in PMP22. For example, the coding sequence can be the translation initiation site (TIS) (AUG) of PMP22, and the engineered RNA can facilitate ADAR-mediated RNA editing from AUG to GUG. An engineered RNA (e.g., an engineered guide RNA, ASO) of the present disclosure that targets PMP22 and comprises an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence can facilitate ADAR-mediated RNA editing of PMP22, thereby resulting in its protein knockdown.

[0172] SERPINA1. Provided herein are engineered RNA payloads, such as engineered guide RNAs or antisense oligonucleotides (ASOs), operably linked to any one of the engineered SmOPT variant sequences or engineered U7 variant sequences disclosed herein, or any combination thereof, wherein the engineered RNA payload targets SERPINA1 RNA. In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting SERPINA1, is operably linked to any one of SEQ ID NOs: 49 (the RNA sequence of SEQ ID NO: 60). In some cases, the engineered RNA payload, such as an ASO or guide RNA targeting SERPINA1, is operably linked to any one of SEQ ID NOs: 50 (the RNA sequence of SEQ ID NO: 61). In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting SERPINA1, is operably linked to any one of SEQ ID NOs: 51 (the RNA sequence of SEQ ID NO: 62). In some embodiments, the present disclosure is directed to an engineered RNA (e.g., an engineered guide RNA, ASO) comprising a targeting sequence substantially complementary to a serpin family A member 1 (SERPINA1) target RNA and an engineered SmOPT variant sequence, an engineered U7 hairpin variant sequence, or both an engineered SmOPT variant sequence and an engineered U7 hairpin variant sequence, wherein the engineered RNA can facilitate RNA editing of SERPINA1. For example, such an engineered RNA can correct a G to A mutation at nucleotide position 9989 of the SERPINA1 gene (G9989A), or the SERPINA1 target RNA encodes an E342K mutation. In some instances, the mutation causes or contributes to an antitrypsin (AAT) deficiency, such as alpha-1 antitrypsin deficiency (AATD), in a subject to which the engineered guide RNA of the present disclosure can be administered. Some embodiments are directed to methods of treating a subject, which may be a human, at risk of developing or having an alpha-1-antitrypsin deficiency.Such alpha-1 antitrypsin deficiency may be caused, at least in part, by mutations in SERPINA1, and for this reason, an engineered RNA (e.g., engineered guide RNA, ASO) comprising the engineered SmOPT variant sequence, the engineered U7 hairpin variant sequence, or both the engineered SmOPT variant sequence and the engineered U7 hairpin variant sequence described herein can facilitate editing of the mutation in, for example, a human subject, thereby correcting the mutation in SERPINA1 and reducing the occurrence of alpha-1 antitrypsin deficiency in the subject. Thus, an engineered RNA (e.g., engineered guide RNA, ASO) of the present disclosure that targets SERPINA1 and has an engineered SmOPT variant sequence, the engineered U7 hairpin variant sequence, or both the engineered SmOPT variant sequence and the engineered U7 hairpin variant sequence can be used in methods of treating a subject suffering from alpha-1 antitrypsin deficiency.

[0173] Some embodiments provide engineered RNAs (e.g., engineered guide RNAs, ASOs) comprising exemplary targeting sequences capable of targeting the SERPINA1 gene linked to any promoter (e.g., U1, U6, U7) disclosed herein, which can be incorporated to drive expression of the engineered guide RNA. Alpha-1 antitrypsin deficiency can be caused, at least in part, by mutations in SERPINA1, and for this reason, the engineered RNAs (e.g., engineered guide RNAs, ASOs) described herein can facilitate editing in SERPINA1, thus correcting the mutations in SERPINA1 and reducing the occurrence of alpha-1 antitrypsin deficiency in a subject.

[0174] SNCA. Provided herein are engineered RNA payloads, such as engineered guide RNAs or antisense oligonucleotides (ASOs), operably linked to any one of the engineered SmOPT variant sequences or engineered U7 variant sequences disclosed herein, or any combination thereof, wherein the engineered RNA payload targets SNCA RNA. In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting SNCA, is operably linked to any one of SEQ ID NOs: 49 (the RNA sequence of SEQ ID NO: 60). In some cases, the engineered RNA payload, such as an ASO or guide RNA targeting SNCA, is operably linked to any one of SEQ ID NOs: 50 (the RNA sequence of SEQ ID NO: 61). In certain cases, the engineered RNA payload, such as an ASO or guide RNA targeting SNCA, is operably linked to any one of SEQ ID NOs: 51 (the RNA sequence of SEQ ID NO: 62). In some embodiments, the present disclosure provides engineered RNAs (e.g., engineered g...

Claims

1. (a) a targeting sequence having complementarity to a target RNA; (b) (i) an engineered SmOPT variant sequence having at least 80% identity to SEQ ID NO:87, SEQ ID NO:84, SEQ ID NO:85, or SEQ ID NO:86; and (ii) an engineered U7 hairpin variant sequence having a sequence of at least 80% identity to SEQ ID NO:96, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:98, or SEQ ID NO:

99. and an engineered RNA comprising:

2. The engineered RNA of claim 1, wherein the engineered SmOPT variant sequence comprises the sequence of SEQ ID NO: 87, SEQ ID NO: 84, SEQ ID NO: 85, or SEQ ID NO:

86.

3. The engineered RNA of claim 1, wherein the engineered U7 hairpin variant sequence comprises the sequence of SEQ ID NO:96, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:98, or SEQ ID NO:

99.

4. The engineered RNA of claim 1, wherein the targeting sequence, upon hybridization to the target RNA, forms a guide-target RNA scaffold comprising a structural feature selected from the group consisting of a mismatch, a bulge, an internal loop, a hairpin, and any combination thereof, wherein the structural feature is substantially formed upon hybridization to the target RNA, and wherein the structural feature is not present in the engineered guide RNA prior to the hybridization of the engineered guide RNA to the target RNA.

5. The engineered RNA of claim 1, further comprising a terminator.

6. The engineered RNA of claim 5, wherein the terminator is a U7 box terminator or a truncated terminator.

7. The engineered RNA of claim 1, wherein the RNA elements include SEQ ID NO:62, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:67, SEQ ID NO:68, and SEQ ID NO:

70.

8. The engineered RNA of claim 1, wherein the target RNA is DUX4, MAPT, SNCA, ABCA4, ALAS1, APP, ATP7B, CFTR, DMD, DMPK, GAPDH, GBA, HEXA, HFE, LIPA, LRRK2, PCSK9 start site, PINK1, PMP22, SERPINA1, SCNN1A start site, SOD1, a fragment of any one of these, or a combination thereof.

9. The engineered RNA of claim 8, wherein the target RNA is SNCA, and the SNCA comprises a mutation for RNA editing selected from the group consisting of a translation initiation site (TIS) AUG-GTG at codon 1, a TIS AUG at codon 5, an AUG at position 265 in exon 2, and any combination thereof.

10. The engineered RNA of claim 9, wherein the engineered RNA is a circularized engineered RNA.

11. A polynucleotide encoding an engineered RNA, wherein the engineered RNA comprises: (a) a targeting sequence having complementarity to a target RNA; (b) (iii) an engineered SmOPT variant sequence having at least 80% identity to SEQ ID NO:87, SEQ ID NO:84, SEQ ID NO:85, or SEQ ID NO:86; and (iv) an engineered U7 hairpin variant sequence having a sequence of at least 80% identity to SEQ ID NO:96, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:98, or SEQ ID NO:

99. and an RNA element comprising:

12. The polynucleotide described in claim 11, wherein the manipulated SmOPT variant sequence comprises the sequence of SEQ ID NO:87, SEQ ID NO:84, SEQ ID NO:85, or SEQ ID NO:

86.

13. The polynucleotide of claim 11, wherein the engineered U7 hairpin variant sequence comprises the sequence of SEQ ID NO:96, SEQ ID NO:90, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:97, SEQ ID NO:98, or SEQ ID NO:

99.

14. A polynucleotide described in claim 11, comprising the sequence of SEQ ID NO:51, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:52, SEQ ID NO:56, SEQ ID NO:57, or SEQ ID NO:

59.

15. The polynucleotide of claim 11, wherein the polynucleotide is operably linked to an RNA polymerase type II promoter.

16. The polynucleotide described in claim 15, wherein the RNA polymerase type II promoter is a U1 promoter, a U6 promoter, a U7 promoter, or a combination thereof.

17. A delivery vehicle comprising the engineered RNA of claim 1.

18. A delivery vehicle comprising the polynucleotide described in claim 11.

19. The delivery vehicle described in claim 18, wherein the delivery vehicle is a viral vector, and the viral vector is an adeno-associated virus (AAV) vector or a derivative thereof.

20. The AAV vector, its derivative, or a hybrid of any of these is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.

20. The delivery vehicle of claim 19, wherein the vector is selected from the group consisting of AAV.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAVhu68, derivatives of any of these, and hybrids of any of these.

21. The delivery vehicle of claim 20, wherein the AAV vector or derivative thereof is selected from the group consisting of a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, and any combination thereof.

22. A pharmaceutical composition comprising the polynucleotide of claim 11 and a pharmaceutically acceptable excipient, diluent, or carrier.

23. The pharmaceutical composition of claim 22 for treating a disease or condition in a subject.

24. The pharmaceutical composition of claim 23, wherein the disease or condition is selected from the group consisting of a neurodegenerative disease or disorder, a muscle disease or disorder, a metabolic disease or disorder, an eye disease or disorder, a liver disease or disorder, cancer, and any combination thereof.

25. The pharmaceutical composition of claim 23, wherein the disease or condition is selected from the group consisting of Duchenne muscular dystrophy (DMD), Becker muscular dystrophy, myotonic dystrophy, facioscapulohumeral muscular dystrophy, Rett syndrome, Charcot-Marie-Tooth disease, Alzheimer's disease, tauopathy, Parkinson's disease, alpha-1 antitrypsin deficiency, cystic fibrosis-like disease, Wilson's disease, and Stargardt disease.

26. The pharmaceutical composition of claim 23, wherein the disease or condition is associated with a mutation in a gene or RNA encoded by DUX4, MAPT, SNCA, ABCA4, ALAS1, APP, ATP7B, CFTR, DMD, DMPK, GAPDH, GBA, HEXA, HFE, LIPA, LRRK2, PCSK9 start site, PINK1, PMP22, SERPINA1, SCNN1A start site, SOD1, a fragment of any one of these, or a combination thereof.

Images