How to treat SARS-CoV-2 infection
Patent Information
- Application Number
- JP2024531268
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-11-24
- Filing Date
- 2022-11-24
- Publication Date
- 2025-11-25
AI Technical Summary
There is an urgent need for effective strategies to prevent and treat SARS-CoV-2 infection, particularly to reduce viral load, inhibit replication, and mitigate the production of pro-inflammatory cytokines and chemokines associated with COVID-19 and long-term COVID symptoms.
The use of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide (BIT225) or its pharmaceutically acceptable salts to inhibit SARS-CoV-2 replication, reduce viral load, and decrease the production of pro-inflammatory cytokines and chemokines in infected subjects.
BIT225 effectively reduces viral load, inhibits SARS-CoV-2 replication, and decreases the production of pro-inflammatory cytokines and chemokines, thereby alleviating symptoms and severity of COVID-19 and long-term COVID complications.
Smart Images

Figure 00000026_0000 
Figure 00000026_0001 
Figure 00000026_0002
Abstract
Description
[Technical field]
[0001] This application claims priority to Australian Provisional Patent Application No. 2021903789 (filed November 24, 2021), the contents of which are incorporated herein by reference in their entirety.
[0002] The present invention relates to the treatment or prevention of SARS-CoV-2 infection. In particular, the present invention relates to antiviral compounds and their use in the treatment or prevention of SARS-CoV-2 infection. [Background technology]
[0003] The discussion of any prior art throughout this specification should not be considered as an admission that such prior art is widely known in the field or forms part of the common general knowledge.
[0004] Coronaviruses are a large family of viruses that cause illnesses ranging from the common cold to more severe diseases such as Middle East Respiratory Syndrome (MERS) and Severe Acute Respiratory Syndrome (SARS). Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) is a novel, highly transmissible airborne coronavirus strain that causes the disease designated COVID-19. COVID-19 was declared a pandemic by the World Health Organization on March 11, 2020.
[0005] The clinical spectrum of COVID-19 ranges from mild, self-limited airway disease to severe, progressive pneumonia. In addition, many people do not fully recover from the initial respiratory illness and continue to suffer from a post-COVID-19 syndrome called long COVID. The most common symptoms of long COVID are fatigue, shortness of breath, chest tightness, palpitations, poor concentration and brain fog, loss of smell and taste, loss of appetite, hair loss, sleep disorders, anxiety and depression (Huang et al. 2021, Lancet 397, 220-232). Most people with long COVID have mild initial symptoms and are not hospitalized. The effects of long COVID are now linked to a chronic immune response dysregulation (Paull et al. 2021, Viruses, 13: 1656).
[0006] There is an urgent need to develop strategies to prevent SARS-CoV-2 infection to eliminate potential adverse events that infection may cause.
[0007] It is an object of the present invention to overcome or ameliorate at least one of the disadvantages of the prior art, or to provide a useful alternative. Summary of the Invention [Problem to be solved by the invention]
[0008] The present application surprisingly shows that N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide (BIT225) inhibits SARS-CoV-2 replication, reduces infectious viral load and reduces the production of pro-inflammatory cytokines and chemokines.
[0009] The chemical structure of BIT225 is shown below: [ka]
[0010] BIT225 may also be referred to as N-carbamimidoyl-5-(1-methylpyrazol-4-yl)naphthalene-2-carboxamide or 5-(1-methylpyrazol-4-yl)2-naphthoylguanidine.
[0011] The present invention generally relates to the use of BIT225, or a pharma- ceutically acceptable salt thereof, for treating or preventing SARS-CoV-2 infection, for inhibiting the replication of SARS-CoV-2, for reducing the severity, intensity or duration of complications or symptoms associated with SARS-CoV-2 infection, for reducing infectious viral load in a subject infected with SARS-CoV-2, or for reducing the production of pro-inflammatory cytokines and chemokines in a subject infected with SARS-CoV-2. [Means for solving the problem]
[0012] According to one aspect, the present invention provides a method for the treatment or prevention of SARS-CoV-2 infection in a subject, the method comprising administering to the subject an effective amount of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof.
[0013] According to another aspect, the present invention provides a method for inhibiting replication of SARS-CoV-2 in a subject, the method comprising administering to the subject an effective amount of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof.
[0014] According to another aspect, the present invention provides a method for reducing the severity, intensity, or duration of a complication or symptom associated with SARS-CoV-2 infection in a subject, the method comprising administering to the subject an effective amount of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutical acceptable salt thereof.
[0015] According to another aspect, the present invention provides a method for reducing viral load in a subject infected with SARS-CoV-2, the method comprising administering to the subject an effective amount of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof.
[0016] According to another aspect, the present invention provides a method for reducing the production of pro-inflammatory cytokines or chemokines in a subject infected with SARS-CoV-2, the method comprising administering to the subject an effective amount of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutical acceptable salt thereof.
[0017] According to another aspect, the present invention provides a method for the treatment of SARS-CoV-2-infected subjects with proinflammatory The present invention provides a method for reducing the concentration of a cytokine or chemokine in a subject, the method comprising administering to the subject an effective amount of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutical acceptable salt thereof.
[0018] According to another aspect, the present invention provides a method for reducing the concentration of a pro-inflammatory cytokine or chemokine in the lungs or serum of a subject infected with SARS-CoV-2, the method comprising administering to the subject an effective amount of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutical acceptable salt thereof.
[0019] According to one aspect, the present invention provides a method for the treatment or prevention of COVID-19 in a subject, the method comprising administering to the subject an effective amount of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof.
[0020] According to another aspect, the present invention provides a method for reducing the severity, intensity, or duration of a complication or symptom associated with COVID-19 in a subject, the method comprising administering to the subject an effective amount of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof.
[0021] According to another aspect, the present invention provides the use of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for the manufacture of a medicament for the treatment or prevention of SARS-CoV-2 infection.
[0022] According to another aspect, the present invention provides the use of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for the manufacture of a medicament for inhibiting the replication of SARS-CoV-2.
[0023] According to another aspect, the present invention provides the use of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for the manufacture of a medicament for reducing the severity, intensity, or duration of a complication or symptom associated with SARS-CoV-2 infection.
[0024] According to another aspect, the present invention provides the use of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for the manufacture of a medicament for reducing viral load in a subject infected with SARS-CoV-2.
[0025] According to another aspect, the present invention provides the use of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for the manufacture of a medicament for reducing the production of pro-inflammatory cytokines or chemokines in a subject infected with SARS-CoV-2.
[0026] According to another aspect, the present invention provides the use of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for the manufacture of a medicament for reducing the concentration of a pro-inflammatory cytokine or chemokine in a subject infected with SARS-CoV-2.
[0027] According to another aspect, the present invention relates to a method for the preparation of a medicament for reducing the concentration of a pro-inflammatory cytokine or chemokine in the lung or serum of a subject infected with SARS-CoV-2, comprising administering to the subject a compound of formula (I) or (II) of the formula (I). The present invention provides the use of the compound according to claim 1, wherein the compound is a medicament for treating atopic dermatitis, said compound being capable of causing ... and / or a medicament for treating atopic dermatitis.
[0028] According to another aspect, the present invention provides the use of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for the manufacture of a medicament for the treatment or prevention of COVID-19.
[0029] According to another aspect, the present invention provides the use of N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for the manufacture of a medicament for reducing the severity, intensity, or duration of complications or symptoms associated with COVID-19.
[0030] According to another aspect, the present invention provides a composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for use in a method for treating or preventing SARS-CoV-2 infection.
[0031] According to another aspect, the present invention provides a composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for use in a method of inhibiting the replication of SARS-CoV-2.
[0032] According to another aspect, the present invention provides a composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for use in a method for reducing the severity, intensity, or duration of a complication or symptom associated with SARS-CoV-2 infection.
[0033] According to another aspect, the present invention provides a composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for use in a method of reducing viral load in a subject infected with SARS-CoV-2.
[0034] According to another aspect, the present invention provides a composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for use in a method for reducing the production of pro-inflammatory cytokines and chemokines in a subject infected with SARS-CoV-2.
[0035] According to another aspect, the present invention provides a composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for use in a method of treating or preventing COVID-19.
[0036] According to another aspect, the present invention provides a composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide, or a pharma- ceutically acceptable salt thereof, for use in a method of reducing the severity, intensity, or duration of complications or symptoms associated with COVID-19.
[0037] According to another aspect, the present invention provides a composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for use in reducing the production of pro-inflammatory cytokines or chemokines in a subject infected with SARS-CoV-2.
[0038] According to another aspect, the present invention provides an N-carbazepine derivative for use in reducing the concentration of a pro-inflammatory cytokine or chemokine in a subject infected with SARS-CoV-2. Compositions are provided that include mimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof.
[0039] According to another aspect, the present invention provides a composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for use in reducing the concentration of pro-inflammatory cytokines or chemokines in the lungs or serum of a subject infected with SARS-CoV-2.
[0040] According to another aspect, the present invention provides a pharmaceutical composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for treating or preventing SARS-CoV-2 infection.
[0041] According to another aspect, the present invention provides a pharmaceutical composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for inhibiting the replication of SARS-CoV-2.
[0042] According to another aspect, the present invention provides a pharmaceutical composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for reducing the severity, intensity, or duration of complications or symptoms associated with SARS-CoV-2 infection.
[0043] According to another aspect, the present invention provides a pharmaceutical composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for reducing viral load in a subject infected with SARS-CoV-2.
[0044] According to another aspect, the present invention provides a pharmaceutical composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for reducing the production of pro-inflammatory cytokines and chemokines in a subject infected with SARS-CoV-2.
[0045] According to another aspect, the present invention provides a pharmaceutical composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for treating or preventing COVID-19.
[0046] According to another aspect, the present invention provides a pharmaceutical composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for reducing the severity, intensity, or duration of complications or symptoms associated with COVID-19.
[0047] According to another aspect, the present invention provides a pharmaceutical composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for reducing the production of pro-inflammatory cytokines or chemokines in a subject infected with SARS-CoV-2.
[0048] According to another aspect, the present invention provides a pharmaceutical composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for reducing the concentration of pro-inflammatory cytokines or chemokines in a subject infected with SARS-CoV-2.
[0049] In another aspect, the present invention relates to a method for detecting SARS-CoV-2 in the lungs or serum of a subject infected with SARS-CoV-2. A pharmaceutical composition comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof for reducing the concentration of a pro-inflammatory cytokine or chemokine is provided.
[0050] In certain embodiments, the SARS-CoV-2 is a viral strain selected from the group consisting of US-WA1 / 2020 (NR-52281), US-PHC658 / 2021 (delta variant; NR-55611), SouthAfrica / KRISP-K005325 / 2020 (beta variant; NR-54009), England / 204820464 / 2020 (alpha variant; NR-54000), Japan / TY7-503 / 2021-Brazil_P.1 (NR-54982) and USA / MD-HP20874 / 2021 (omicron variant; NR-56461).
[0051] In certain embodiments, the pro-inflammatory cytokine or chemokine is selected from the group consisting of interleukin 6 (IL-6), interleukin 1-alpha (IL-1alpha), tumor necrosis factor alpha (TNFalpha), transforming growth factor beta (TGFbeta), monocyte chemoattractant protein-1 (MCP1) and interleukin 1 beta (IL-1beta).
[0052] In certain embodiments, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof is administered by a route selected from oral, nasal, intravenous, intraperitoneal, inhalation and topical.
[0053] In certain embodiments, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof is administered orally.
[0054] In certain embodiments, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide, or a pharma- ceutically acceptable salt thereof, is administered daily.
[0055] In certain embodiments, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof is administered twice daily.
[0056] In certain embodiments, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide, or a pharma- ceutically acceptable salt thereof, is administered in a dosage of about 100 mg to about 600 mg.
[0057] In a particular embodiment, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof is administered orally and is administered in a dosage of about 600 mg.
[0058] In a particular embodiment, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof is administered orally and is administered in a dosage of about 200 mg.
[0059] In a particular embodiment, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof is administered orally and is administered in a dosage of about 100 mg.
[0060] In certain embodiments, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutical acceptable salt thereof is administered orally and daily. is administered.
[0061] In certain embodiments, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharma- ceutically acceptable salt thereof is administered orally and is administered twice daily.
[0062] In a particular embodiment, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide, or a pharma- ceutically acceptable salt thereof, is administered orally once daily at a dosage of about 200 mg.
[0063] In a particular embodiment, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide, or a pharma- ceutically acceptable salt thereof, is administered orally at a dosage of about 200 mg twice daily.
[0064] In a particular embodiment, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide, or a pharma- ceutically acceptable salt thereof, is administered orally at a dosage of about 100 mg once daily.
[0065] In a particular embodiment, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide, or a pharma- ceutically acceptable salt thereof, is administered orally at a dosage of about 100 mg twice daily.
[0066] In certain embodiments, N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide, or a pharma- ceutically acceptable salt thereof, is administered in combination with one or more additional antiviral agents. [Brief description of the drawings]
[0067] [Figure 1]Figure 1: BIT225 dose-response curves for viral load assessed by qPCR in monolayers of Vero E6 or Calu-3 cells in triplicate wells pre-exposed to one of six concentrations of BIT225 for 1 h and then infected (moi=0.1) with one of six SARS-CoV-2 strains: “BR” (triangle - Japan / TY7-503 / 2021-Brazil_P.1), “Delta” ("+" symbol - US-PHC658 / 2021), “Omicron” ("x" symbol - USA / MD-HP20874 / 2021), “SA” (diamond - SouthAfrica / KRISP-K005325 / 2020), “UK” (inverted triangle - England / 204820464 / 2020), and US (filled circle - US-WA1 / 2020). [Diagram 2] FIG. 2: Summary of EC50 values of viral load assessed by qPCR from both cell types (error bars are 95% asymptotic confidence intervals around EC50 estimates). [Diagram 3] Figure 3. BIT225 dose-response curves of infectious virus titers assessed by plaque assay in monolayers of Vero E6 or Calu-3 cells in triplicate wells pre-exposed to one of six concentrations of BIT225 and then infected (moi=0.1) with one of six SARS-CoV-2 strains: “BR” (triangle - Japan / TY7-503 / 2021-Brazil_P.1), “Delta” ("+" symbol - US-PHC658 / 2021), “Omicron” ("x" symbol - USA / MD-HP20874 / 2021), “SA” (diamond - SouthAfrica / KRISP-K005325 / 2020), “UK” (inverted triangle - England / 204820464 / 2020), and US (filled circle - US-WA1 / 2020). [Figure 4] FIG. 4: Summary of EC50 values of infectious virus titers assessed by plaque assay from both cells (error bars are 95% asymptotic confidence intervals for EC50 estimates). [Figure 5-1]Figure 5. Effect of BIT225 on body weight and mortality in SARS-2-infected K18-hACE2 mice. Time course of body weight change as a percentage of baseline pre-infection body weight is shown for experiment 1 (A) and experiment 2 (B and C). BIT225 administration (BID) was initiated 12 hours prior to intranasal infection with 104 PFU of SARS-CoV-2 (WA1 strain). In A, group mean trend lines are shown for mice administered (BID) vehicle control (triangles); BIT225 (100 mg / kg - diamonds & dashed line); or BIT225 (300 mg / kg - squares & solid line). Error bars are 95% confidence intervals around the mean (n=5 / group). B shows body weight change associated with BIT225 (300 mg / kg) dose (squares) or vehicle (triangles) for each mouse. C; Kaplan-Meier mortality curves of mice in the 12-day study: BIT225 group (solid line) vs vehicle control (dashed line). [Figure 5-2] Figure 5. Effect of BIT225 on body weight and mortality in SARS-2-infected K18-hACE2 mice. Time course of body weight change as a percentage of baseline pre-infection body weight is shown for experiment 1 (A) and experiment 2 (B and C). BIT225 administration (BID) was initiated 12 hours prior to intranasal infection with 104 PFU of SARS-CoV-2 (WA1 strain). In A, group mean trend lines are shown for mice administered (BID) vehicle control (triangles); BIT225 (100 mg / kg - diamonds & dashed line); or BIT225 (300 mg / kg - squares & solid line). Error bars are 95% confidence intervals around the mean (n=5 / group). B shows body weight change associated with BIT225 (300 mg / kg) dose (squares) or vehicle (triangles) for each mouse. C; Kaplan-Meier mortality curves of mice in the 12-day study: BIT225 group (solid line) vs vehicle control (dashed line). [Figure 6-1]Figure 6: Effect on body weight and mortality in mice receiving BIT225 at different starting times. In A and B, four groups (n=5) of K18-hACE2 mice were infected intranasally with 104 PFU of SARS-CoV-2 (WA1 strain) and received BIT225 (300 mg / kg) twice daily from 24 h before infection (black squares); 24 h after infection (white squares with "+"); 48 h after infection (white triangles) or none in the vehicle group (black triangles). C; Kaplan-Meier mortality curves for each group vs vehicle (control vehicle = dashed line; 24 h before infection = solid line; 24 h after infection = dashed line with circle; 48 h after infection = cross). All mice treated with BIT225 survived until day 12, except for one mouse in the 48 h after infection group that died on day 11. [Figure 6-2] Figure 6: Effect on body weight and mortality in mice receiving BIT225 at different starting times. In A and B, four groups (n=5) of K18-hACE2 mice were infected intranasally with 104 PFU of SARS-CoV-2 (WA1 strain) and received BIT225 (300 mg / kg) twice daily from 24 h before infection (black squares); 24 h after infection (white squares with "+"); 48 h after infection (white triangles) or none in the vehicle group (black triangles). C; Kaplan-Meier mortality curves for each group vs vehicle (control vehicle = dashed line; 24 h before infection = solid line; 24 h after infection = dashed line with circle; 48 h after infection = cross). All mice treated with BIT225 survived until day 12, except for one mouse in the 48 h after infection group that died on day 11. [Figure 7]Figure 7. Dose-responsive viral load reduction in mice treated with BIT225 for 7 days. Lung (A&B) and serum (C&D) samples were collected on day 7 and analyzed for viral load by qRT-PCR (A&C); or infectious viral titer by plaque assay (B&D). Symbols represent data for individual mice: vehicle control (triangles); BIT225 (100 mg / kg - diamonds); BIT225 (300 mg / kg - squares). Horizontal lines and "+" indicate group medians and means, respectively. Welch's t-test was used to compare group means, and P values are indicated as **P<0.01; ***P<0.001. [Figure 8] Figure 8: Viral load reduction in mice treated with BIT225 for 5 or 12 days. Two groups of N=4 mice were scheduled for 5 days of treatment with BIT225 or vehicle control, and another two groups of N=7 mice were scheduled for 12 days of treatment as well. Lungs were harvested from surviving mice on days 5 or 12 post-infection and analyzed for viral load by qRT-PCR (A); or for infectious viral titer by plaque assay (B). Symbols represent data for individual mice: vehicle control (triangles); BIT225 (300 mg / kg - diamonds). Horizontal lines and "+" indicate group medians and means, respectively. Welch's t-test was used to compare control (N=3) and BIT225 (N=4) groups on day 5, and P values are indicated as **P<0.01. Note that, similar to FIG. 2, none of the mice in the control group survived to day 12, while all seven mice in the BIT225 group survived. [Figure 9-1]Figure 9. Dose-responsive cytokine levels in mice treated with BIT225 for 7 days. (A) Lungs; (B) Serum. Lungs were harvested from surviving mice 7 days post-infection and analyzed for concentrations of the indicated cytokines or chemokines by sandwich ELISA assay. Symbols represent data for individual mice: vehicle control (triangles); BIT225 (100 mg / kg - diamonds); BIT225 (300 mg / kg - squares). Horizontal lines and "+" indicate group medians and means, respectively. Welch's t-test was used to compare group means (N=5 mice) and P values are indicated as ns-P>0.05; *P<0.05; **P<0.01; ***P<0.001. [Figure 9-2] Figure 9. Dose-responsive cytokine levels in mice treated with BIT225 for 7 days. (A) Lungs; (B) Serum. Lungs were harvested from surviving mice 7 days post-infection and analyzed for concentrations of the indicated cytokines or chemokines by sandwich ELISA assay. Symbols represent data for individual mice: vehicle control (triangles); BIT225 (100 mg / kg - diamonds); BIT225 (300 mg / kg - squares). Horizontal lines and "+" indicate group medians and means, respectively. Welch's t-test was used to compare group means (N=5 mice) and P values are indicated as ns-P>0.05; *P<0.05; **P<0.01; ***P<0.001. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0068] definition In describing and claiming the present invention, the following terminology will be used in accordance with the definitions set out below. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting. All technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, unless otherwise defined.
[0069] In the context of the present invention, the words "include", "comprising" and the like must be interpreted in the inclusive rather than exclusive sense, ie in the sense of "including but not limited to".
[0070] The terms "preferred" and "preferably" refer to embodiments of the invention that may provide certain benefits, under certain circumstances. However, other embodiments may be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful, and is not intended to exclude other embodiments from the scope of the invention.
[0071] As used herein, the term "symptom(s)" refers to a sign or indication that a subject is suffering from a specific condition or disease. For example, as used herein, a symptom associated with SARS-CoV-2 infection refers to a sign or indication that a subject is infected with SARS-CoV-2.
[0072] As used herein, the term "complication(s)" refers to a pathological process or event occurring during a disease or condition that is not an inherent part of the disease or condition and may result from the disease / condition or from an independent cause.
[0073] As used herein, the term "effective amount" in the context of administering a treatment to a subject refers to an amount of the treatment that has a prophylactic and / or therapeutic effect(s). In certain embodiments, an "effective amount" in the context of administering a treatment to a subject refers to an amount of the treatment that is sufficient to achieve one, two, three, four, or more of the following effects: (i) reducing or ameliorating the severity of SARS-CoV-2 infection, a disease or condition associated therewith; (ii) reducing the duration of SARS-CoV-2 infection, a disease or condition associated therewith; (iii) preventing the progression of SARS-CoV-2 infection, a disease or condition associated therewith; (iv) preventing the progression of SARS-CoV-2 infection, a disease or condition associated therewith; (v) to prevent the onset or onset of SARS-CoV-2 infection or associated disease or symptoms; (vi) to prevent the recurrence of SARS-CoV-2 infection or associated disease or symptoms; (vii) to reduce or prevent the spread of SARS-CoV-2 from one cell to another, from one tissue to another, or from one organ to another; (ix) to prevent or prevent the spread of SARS-CoV-2 from one subject to another. (x) reducing organ failure associated with SARS-CoV-2 infection; (xi) reducing hospitalization in a subject; (xii) reducing the length of hospital stay; (xiii) increasing survival in a subject with SARS-CoV-2 infection or a disease associated therewith; (xiv) eliminating SARS-CoV-2 infection or a disease associated therewith; (xv) inhibiting or reducing SARS-CoV-2 replication; (xvi) inhibiting or reducing entry of SARS-CoV-2 into a host cell(s); (xviii) inhibiting or reducing the replication of the SARS-CoV-2 genome; (xix) inhibiting or reducing the synthesis of SARS-CoV-2 proteins; (xx) inhibiting or reducing SARS-CoV-2 particle assembly; (xxi) inhibiting or reducing the release of SARS-CoV-2 particles from a host cell(s); (xxii) reducing SARS-CoV-2 titer or viral load; and / or (xxiii) enhancing or improving the prophylactic or therapeutic effect(s) of another treatment.
[0074] In certain embodiments, an effective amount does not provide complete protection from SARS-CoV-2 infection, but rather results in lower titers or viral loads, reduced SARS-CoV-2 counts, or lower viral loads compared to untreated subjects. In certain embodiments, an effective amount provides a 0.5-fold, 1-fold, 2-fold, 4-fold, 6-fold, 8-fold, 10-fold, 15-fold, 20-fold, 25-fold, 50-fold, 75-fold, 100-fold, 125-fold, 150-fold, 175-fold, 200-fold, 300-fold, 400-fold, 500-fold, 750-fold, or 1,000-fold or greater reduction in SARS-CoV-2 titer or viral load compared to untreated subjects. In some embodiments, the effective amount results in a reduction in SARS-CoV-2 titer or viral load of about 1 log or more, about 2 logs or more, about 3 logs or more, about 4 logs or more, about 5 logs or more, about 6 logs or more, about 7 logs or more, about 8 logs or more, about 9 logs or more, about 10 logs or more, 1-3 logs, 1-5 logs, 1-8 logs, 1-9 logs, 2-10 logs, 2-5 logs, 2-7 logs, 2-8 logs, 2-9 logs, 2-10 logs, 3-5 logs, 3-7 logs, 3-8 logs, 3-9 logs, 4-6 logs, 4-8 logs, 4-9 logs, 5-6 logs, 5-7 logs, 5-8 logs, 5-9 logs, 6-7 logs, 6-8 logs, 6-9 logs, 7-8 logs, 7-9 logs, or 8-9 logs compared to an untreated subject. The benefits of reducing the titer, viral load, number or total load of a SARS-CoV-2 infection include, but are not limited to, less severe symptoms of infection, fewer symptoms of infection, and reduced duration of illness associated with the infection.
[0075] As used herein, "co-administration," "administering simultaneously," "co-administration," "co-administered," and the like, refer to the administration of BIT225 or a pharmacologic agent thereof in a manner suitable for the treatment of SARS-CoV-2 infection or for the treatment of symptoms / complications related to SARS-CoV-2 infection. Concomitant administration includes providing a subject with BIT225 or a pharma- ceutically acceptable salt thereof and one or more additional viral therapeutics together. Concomitant administration as contemplated herein includes providing BIT225 or a pharma- ceutically acceptable salt thereof and one or more additional viral therapeutics as separate compounds, such as separate pharmaceutical compositions administered, for example, sequentially, simultaneously, or at different times. Preferably, when BIT225 or a pharma- ceutically acceptable salt thereof and one or more additional viral therapeutics are administered separately, they are not administered at times so far apart from each other that BIT225 or a pharma- ceutically acceptable salt thereof and one or more additional viral therapeutics cannot interact. BIT225 or a pharma- ceutically acceptable salt thereof and one or more additional viral therapeutics may be administered in any order. In one embodiment, BIT225, or a pharma- ceutically acceptable salt thereof, may be administered prior to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 16 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) administration of one or more additional viral therapeutics to a subject. In accordance with the subject invention, co-administration also includes providing one or more additional viral therapeutic agents admixed with BIT225 or a pharma- ceutically acceptable salt thereof, such as in a pharmaceutical composition.
[0076] Additional viral therapeutics of the present invention include vaccine agents, or antiviral agents, such as inhibitors of neuraminidase or hemagglutinin, or agents that modulate the immune system or host cell factors. Viral therapeutics contemplated for use in accordance with the subject invention include, but are not limited to, amantadine, rimantadine, ribavirin, idoxuridine, trifluridine, vidarabine, acyclovir, ganciclovir, foscarnet, zidovudine, didanosine, peramivir, zalcitabine, stavudine, famciclovir, oseltamivir, zanamivir, and valacyclovir.
[0077] In a related embodiment, to a subject diagnosed with SARS-CoV-2 infection, BIT225, or a soluble salt thereof, may be administered concurrently with other therapeutics useful in the treatment of symptoms associated with SARS-CoV-2 infection. For example, a cough suppressant, mucolytic, expectorant, antipyretic, analgesic, or nasal decongestant may be administered concurrently with BIT225 or a soluble salt thereof to a subject diagnosed with SARS-CoV-2 infection.
[0078] The term "infection" as used herein refers to invasion by the proliferation and / or presence of a virus in a cell or a subject. In one embodiment, the infection is an "active" infection, i.e., an infection in which the virus is replicating in a cell or a subject. Such an infection is characterized by the spread of the virus from a cell, tissue, and / or organ initially infected by the virus to other cells, tissues, and / or organs. The infection may also be a latent infection, i.e., an infection in which the virus is dormant.
[0079] As used herein, the phrase "treating a SARS-CoV-2 infection" refers to improving, reducing, or alleviating at least one symptom or biological consequence of a SARS-CoV-2 infection in a subject and / or reducing the severity of the symptoms or biological consequences of a SARS-CoV-2 infection in a subject following exposure to SARS-CoV-2. "reducing or decreasing the titer, amount, replication, or proliferation of SARS-CoV-2." The expression "treating SARS-CoV-2 infection" also encompasses shortening the time period during which a subject exhibits at least one symptom or biological consequence of SARS-CoV-2 infection. Methods for treating SARS-CoV-2 infection according to the present invention include administering to a subject a pharmaceutical composition of the present invention after the subject is infected with SARS-CoV-2 and / or after the subject exhibits or is diagnosed with one or more symptoms or biological consequences of SARS-CoV-2 infection.
[0080] As used herein, the phrase "preventing SARS-CoV-2 infection" means preventing at least one symptom or biological consequence of SARS-CoV-2 infection in a subject and / or inhibiting or attenuating the degree to which SARS-CoV-2 is able to enter, spread, and / or reproduce in or among cells of the animal's body. The phrase "preventing SARS-CoV-2 infection" also encompasses reducing the susceptibility of a subject to at least one symptom or biological consequence of SARS-CoV-2 infection. A method for preventing SARS-CoV-2 infection (i.e., prophylaxis) includes administering a pharmaceutical composition of the present invention to a subject before the subject is infected with SARS-CoV-2 and / or before the subject exhibits one or more symptoms or biological consequences of SARS-CoV-2 infection. Methods for preventing SARS-CoV-2 infection may include administering a pharmaceutical composition of the invention to a subject during a particular period or season of the year (e.g., during the 1-2 months immediately preceding the time when peak populations are typically found to be affected by SARS-CoV-2 infections), or before the subject travels to or is exposed to an environment with a high incidence of SARS-CoV-2 infections, and / or before the subject is exposed to another subject infected with SARS-CoV-2.
[0081] As used herein, the terms "replication", "viral replication" and "viral replication" in the context of viruses refer to one or more or all of the stages of the viral life cycle that result in the reproduction of the virus. The steps of the viral life cycle include, but are not limited to, viral attachment to the host cell surface, penetration or entry of the host cell (e.g., through receptor-mediated endocytosis or membrane fusion), uncoating (a process in which the viral capsid is removed and degraded by viral or host enzymes, thus releasing the viral genomic nucleic acid), genome replication, synthesis of viral messenger RNA (mRNA), viral protein synthesis, and assembly of viral ribonucleoprotein complexes for genome replication, assembly of viral particles, post-translational modification of viral proteins, and release from the host cell by lysis or budding and acquisition of a phospholipid envelope containing encapsulated viral glycoproteins. In some embodiments, the terms "replication", "viral replication" and "viral replication" refer to the replication of the viral genome. In other embodiments, the terms "replication", "viral replication" and "viral replication" refer to the synthesis of viral proteins.
[0082] As used herein, the term "titer" in the context of a virus refers to the number of viral particles present in a given volume of blood or other biological fluid, or weight of tissue or organ. The terms "viral amount" and "viral load" may also be used.
[0083] As used herein, the term "COVID-19" refers to the disease caused by SARS-CoV-2.
[0084] As used herein, the term "subject" is used to refer to animals (e.g., birds, reptiles, and mammals). In a specific embodiment, the subject is a bird. In another embodiment, the subject is a mammal, including non-primates (e.g., camels, donkeys, zebras, cows, pigs, horses, goats, sheep, cats, dogs, rats, and mice) and primates (e.g., monkeys, chimpanzees, and humans). In certain embodiments, the subject is a non-human animal. In some embodiments, the subject is a farm animal or pet. In another embodiment, the subject is a human. In another embodiment, the subject is a human infant. In another embodiment, the subject is a human child. In another embodiment, the subject is a human adult. In another embodiment, the subject is an elderly human. In another embodiment, the subject is a premature infant.
[0085] The pharmaceutical composition of the present invention may be in the form of liposome or micelle, in which the compound of the present invention is mixed with amphiphilic agents such as lipids that exist in aggregate form as micelles, insoluble monolayers, liquid crystals, or lamellar layers in aqueous solution, in addition to other pharma- ceutical acceptable carriers.Suitable lipids for liposome formulations include, but are not limited to, monoglycerides, diglycerides, sulfatides, lysolecithin, phospholipids, saponins, bile acids, and the like.The preparation of such liposome formulations is within the level of skill of the art, as disclosed, for example, in U.S. Patent Nos. 4,235,871; 4,501,728; 4,837,028; and 4,737,323, all of which are incorporated herein by reference.
[0086] Routes of administration include, but are not limited to, intravenous, intraperitoneal, subcutaneous, intracranial, intradermal, intramuscular, intraocular, intrathecal, intracerebral, intranasal, transmucosal, or by oral, rectal infusion, via intravenous drip, patches and implants, with the oral route being particularly preferred.
[0087] Compositions suitable for injectable use include sterile aqueous solutions (if water soluble) and sterile powders for extemporaneous preparation of sterile injectable solutions. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. Prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the composition of agents that delay absorption, for example, aluminum monostearate and gelatin.
[0088] Sterile injectable solutions are prepared by incorporating the required amount of active compound in a suitable solvent with various other ingredients listed above, and then sterilizing, for example, by filter sterilization or other suitable means, as necessary. Dispersions are also contemplated, and these may be prepared by incorporating various sterilized active ingredients into a sterile vehicle containing a basic dispersion medium and the required other ingredients listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred preparation method includes vacuum drying and freeze-drying techniques, which yield a powder of the active ingredient and any additional desired ingredients from a previously sterile-filtered solution.
[0089] When the active ingredients are suitably protected, they may be administered orally, for example, with an inert diluent or with an assimilable edible carrier, or it may be enclosed in a hard or soft shell gelatin capsule, or it may be compressed into tablets. For oral therapeutic administration, the active compound may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 0.01%, more preferably 0.1%, more preferably 1% by weight of the active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 1 and about 99%, more preferably about 2 to about 90%, more preferably about 5 to about 80% by weight of the unit. The amount of active compound in such therapeutically useful compositions is such that a suitable dosage will be obtained. Preferred compositions or preparations according to the invention are prepared so that an oral dosage form contains between about 0.1 ng and 2000 mg of active compound.
[0090] Tablets, troches, pills, capsules and the like may also contain ingredients as listed hereafter: binders such as gums, arabic gum, cornstarch or gelatin; excipients such as dicalcium phosphate; disintegrating agents such as cornstarch, potato starch, alginic acid and the like; lubricants such as magnesium stearate; and sweeteners such as sucrose, lactose or saccharin may be added; or flavorings such as peppermint, wintergreen oil or cherry flavoring. When the dosage unit form is a capsule, it may contain a liquid carrier in addition to materials of the above types. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For example, tablets, pills or capsules may be coated with shellac, sugar or both. A syrup or elixir may contain the active compound, sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring agent such as cherry or orange flavoring. Any material used in preparing any dosage unit form should be pharma- ceutical pure and substantially non-toxic in the amounts used.In addition, the active compound(s) may be incorporated into sustained-release preparation and formulations.
[0091] The invention also extends to forms suitable for topical application such as creams, lotions and gels, in which ingredients may be added or modified to assist penetration of surface barriers.
[0092] Procedures for the preparation of dosage unit forms and topical preparations are described in the Pharmaceutical Handbook, 1999. th edition (edited by Ainley Wade), The Pharmaceutical Press London; CRC Handbook of Chemistry and Physics (edited by Robert C. Weast), CRC Press Inc.; Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9 thedition,McGraw Hill;Remington: The Science and Practice of Pharmacy,19 th edition (edited by Joseph P. Remington and Alfonso R. Gennaro), Mack Publishing Co., and other textbooks.
[0093] The term "pharmaceutical acceptable salt" as used herein refers to any salt of BIT225 that is pharma- ceutical acceptable and does not significantly reduce or inhibit the activity of BIT225. Suitable examples include acid addition salts with organic or inorganic acids, such as acetates, tartrates, trifluoroacetates, lactates, maleates, fumarates, citrates, methions, sulfonates, sulfates, phosphates, nitrates, or chlorides.
[0094] Pharmaceutically acceptable carrier and / or diluent includes any solvent, dispersion medium, coating, antibacterial and antifungal agent, isotonic and absorption delaying agent and the like.The use of such media and agents for pharmaceutical active substances is well known in the art.Except where any conventional media or agent is incompatible with active ingredient, its use in therapeutic composition is contemplated.Auxiliary active ingredients can also be incorporated into the composition.
[0095] It is particularly advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. As used herein, dosage unit form refers to physically discrete units suited as unitary doses for treating subjects; each unit may be combined with the required pharmaceutical carrier. Each dosage unit contains a predetermined amount of active material calculated to produce a desired therapeutic effect in association with a given dosage form. The specifications for the novel dosage unit forms of the present invention are dictated by and directly dependent upon (a) the unique characteristics of the active material and the particular therapeutic effect to be achieved, and (b) the inherent limitations in the art of compounding.
[0096] The effective amount contemplated by the present invention will vary depending on the severity of the condition and the health and age of the recipient. In general terms, the effective amount may vary from 0.01 ng / kg body weight to about 100 mg / kg body weight. Effective amounts include about 100 mg to about 600 mg, specifically about 100 mg, about 150 mg, about 200 mg, about 250 mg, about 300 mg, about 350 mg, about 400 mg, about 450 mg, about 500 mg, about 550 mg, or about 600 mg.
[0097] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of raw materials or reaction conditions used herein must be understood to be modified in all instances by the term "about."
[0098] As used herein, the term "about" may mean within one or more standard deviations per the practice in the art. Alternatively, "about" may mean within a range of up to 20%. When a particular value is provided in the specification and claims, the meaning of "about" should be assumed to be within an acceptable range of error for the particular value.
[0099] The recitation of numerical ranges with endpoints includes all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).
[0100] Preferred embodiments of the invention Although the present invention has been described in conjunction with the specific embodiments detailed herein, other embodiments may achieve the same or similar results. Variations and modifications of the present invention will be apparent to those skilled in the art, and the present invention is intended to cover all such modifications and equivalents.
[0101] The present application is based on the surprising discovery that BIT225 has activity against SARS-CoV-2.
[0102] The present invention provides methods and compositions (such as pharmaceutical compositions) for treating or preventing SARS-CoV-2 infection or resulting COVID-19.
[0103] The present invention provides materials and methods for preventing and / or treating viral infections. Specifically, the subject invention provides materials and methods for preventing SARS-CoV-2 infection; treating / ameliorating symptoms associated with SARS-CoV-2 infection; and / or preventing / delaying the onset of complications associated with SARS-CoV-2 infection.
[0104] The present invention provides a method for the treatment or prevention of SARS-CoV-2 infection in a subject, the method comprising administering to the subject an effective amount of BIT225 or a pharma- ceutically acceptable salt thereof.
[0105] The present invention also provides a method for inhibiting replication of SARS-CoV-2 in a subject, the method comprising administering to the subject an effective amount of BIT225 or a pharma- ceutically acceptable salt thereof.
[0106] The present invention further relates to a method for the treatment of a complication or symptom associated with SARS-CoV-2 infection in a subject. A method for reducing the severity, intensity, or duration is provided, the method comprising administering to the subject an effective amount of BIT225 or a pharma- ceutical acceptable salt thereof.
[0107] The present invention further provides a method for reducing SARS-CoV-2 viral load in a subject, the method comprising administering to the subject an effective amount of BIT225 or a pharma- ceutical acceptable salt thereof.
[0108] The present invention further provides a method for reducing the production of pro-inflammatory cytokines or chemokines in a subject infected with SARS-CoV-2, the method comprising administering to the subject an effective amount of BIT225 or a pharma- ceutically acceptable salt thereof.
[0109] The invention is further described by the following non-limiting examples. EXAMPLES
[0110] Example 1 – Generation of BIT225 A mixture of 5-bromo-2-naphthoic acid (2.12 g, 8.44 mmol), 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (1.84 g, 8.86 mmol), and tetrakis(triphenylphosphine)palladium(0) (502 mg, 0.435 mmol) in a 250 mL round-bottom flask was evacuated and purged with nitrogen (3 cycles). Acetonitrile (40 mL) and 2 M aqueous sodium carbonate (10 mL) were added to the mixture via syringe, and the mixture was heated to reflux under nitrogen for 22 hours. After the reaction mixture was allowed to cool, 1 M aqueous hydrochloric acid (30 mL) was added, which was then extracted with ethyl acetate (3×50 mL). The combined organic layers were dried (MgSO4), filtered and concentrated in vacuo to provide the crude product (2.98 g after air drying). This crude material was dissolved in hot ethanol (150 mL) and filtered hot to remove a yellow impurity (120 mg). The filtrate was concentrated in vacuo and the residue was recrystallized from dichloromethane (30 mL) to provide 5-(1-methyl-1H-pyrazol-4-yl)-2-naphthoic acid as a white solid (724 mg, 34%). A second crop of 5-(1-methyl-1H-pyrazol-4-yl)-2-naphthoic acid (527 mg, 25%) was obtained from the concentrated mother liquor by recrystallization from dichloromethane (20 mL).
[0111] Oxalyl chloride (1.1 mL, 13 mmol) was added to a solution of 5-(1-methyl-1H-pyrazol-4-yl)-2-naphthoic acid (1.19 g, 4.71 mmol) in anhydrous dichloromethane (200 mL (added in small portions during the reaction to effect dissolution)) containing dimethylformamide (2 drops) under nitrogen, and the mixture was stirred at room temperature for 4.25 hours. The reaction mixture was then heated at 40° C. for 1 hour and then concentrated under reduced pressure. The resulting crude acid chloride was suspended in anhydrous tetrahydrofuran (50 mL) and this mixture was added dropwise to a solution of guanidine hydrochloride (2.09 g, 21.9 mmol) in 2 M aqueous sodium hydroxide (15 mL, 30 mmol), and the reaction mixture was then stirred for 30 minutes. The organic phase was separated and the aqueous phase was extracted with chloroform (3×30 mL) followed by ethyl acetate (3×30 mL). The combined organic extracts were washed successively with 1 M aqueous sodium hydroxide (60 mL) and water (40 mL), then dried (Na2SO4) and concentrated in vacuo to give a glassy solid (1.45 g after drying under high vacuum). This solid was dissolved in dichloromethane and then allowed to evaporate slowly to give BIT225 as a yellow solid (1.15 g, 83%).
[0112] Example 2 – In vitro assay Virus: "US" US-WA1 / 2020 (NR-52281), "Delta" US-PHC658 / 2021 (Delta variant; NR-55 611), "SA" SouthAfrica / KRISP-K005325 / 2020 (beta variant; NR-54009), "UK" England / 204820464 / 2020 (alpha variant; NR-54000), "BR" Japan / TY7-503 / 2021-Brazil_P.1 (NR-54982), and "Omicron" USA / MD-HP20874 / 2021 (Omicron variant; NR-56461) Infected cells: Vero (African green monkey kidney) and Calu 3 (human lung epithelial carcinoma) BIT225 concentrations: 0, 0.3, 0.6, 1.25, 2.5, 5 and 10 μM (measured in triplicate) Add BIT225 1 hour before infection
[0113] Viral stocks were obtained from BEI Resources (Manassas, VA, USA). Viruses were passaged in Vero E6 or Calu 3 cells and maintained at 37°C and 5% CO2 in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum.
[0114] The number of viral genome copies released into the culture medium by Vero and Calu 3 cells on day 4 post-infection was measured by qRT-PCR (copies / ml (log10)) using the method described by Winkler et al. 2020 (Nat. Immunol. 21:1327-1335). Briefly, total viral RNA was extracted using MagMax™ with a KingFisher™ Flex extraction robot (ThermoFisher Scientific, Waltham, MA, USA). The SARS-CoV-2 nucleocapsid (N) gene was reverse transcribed and amplified using the TaqMan® RNA-to CT™ 1-Step Kit (ThermoFisher Scientific, Waltham, MA, USA). The SARS-CoV-2 N gene was extracted from the test culture medium using the mirVana™ Total RNA Isolation Kit (ThermoFisher Scientific, Waltham, MA, USA). · Forward primer: ATGCTGCAATCGTGCTACAA; · Reverse primer: GACTGCCGCCTCTGCTC; Probe: 56FAM / TCAAGGAAC / ZEN / AACATTGCCAA / 3IABkFQ, was detected using
[0115] The amount of infectious virus released into the culture medium by Vero and Calu 3 cells 4 days after infection was compared with that of van den Worm et al. 2012 (PLoS One 7(3):e32857) was determined by plaque assay (PFU / ml (log10)). Briefly, Vero-E6 cells in 6-well clusters were incubated for 1 h at 37°C with test culture medium diluted in PBS containing DEAE (0.005% w / v) and 2% FCS. The test culture medium was then replaced with 2 ml of a 1.2% suspension of Avicel (RC-581; FMC Biopolymer) in DMEM containing 2% FBS, 25 mM HEPES, penicillin (100 IU / ml) and streptomycin (100 IU / ml). Cells were incubated for 48-60 h at 37°C, fixed with formaldehyde, and plaques were then visualized using crystal violet staining.
[0116] For dose-response curves, the R package (drc) was used to generate plots and estimate EC50 values. All plotting and statistical analyses were performed using R statistical software, version 4.0.4 (R_Core_Team. 2021. R: A The study was conducted using the R Foundation for Statistical Computing (R language and environment for statistical computing, URL https: / / www.R-project.org / ).
[0117] Dose-response curves were fitted and analyzed using the R package, drc (Ritz C, Baty F, Streibig JC, Gerhard D. 2015. Dose-Response Analysis Using R. PLoS One 10:e0146021). A three-parameter log-logistic model (Eq. 1) was fitted to the concentration (x) vs response (f(x)) data via the function drm(...,fct=LL.3), and the "delta" method and t-distribution were used to estimate the EC50 values (parameter e in Eq. 1) and asymptotic confidence intervals.
[0118]
number
[0119] (where x, f(x) and parameter e are as above; d and b are parameters that obtain the maximum and slope of the optimal response curve, respectively).
[0120] Experiments were performed in a dose-response format, and virus released into the culture medium was quantified by qRT PCR (for genome copies) and plaque assay (for infectious virus).Monolayers were exposed to test concentrations of BIT225 for 1 h prior to infection with SARS-CoV-2 at a multiplicity of infection (moi) of 0.1.
[0121] The results demonstrated that BIT225 inhibited the production and release of SARS-CoV-2 from infected monolayer cultures of Vero-E6 and Calu-3 cells. Dose-response curves (Figures 1 and 3) show that BIT225 has similar antiviral efficacy against all six viral strains of SARS-CoV-2 tested and in both cell types. Table 1 shows the parameter estimates (EC 50 ; maximal response; and Hill slope) are listed.
[0122] In the qRT-PCR assay (Fig. 1 and 2), the BIT225 reaction curves were similar for the six virus strains, with EC 50 Estimates ranged between 2.5 μM and 4.8 μM across the two cell types (mean 3.7 μM). In the plaque assays (Figures 3 and 4), the EC 50 ranged between 3.4 μM and 7.9 μM (mean 6.2 μM), and the EC 50 (3.8 μM) was found to be lower than the estimates for the delta, omicron and beta mutants (P<0.05, Tukey adjusted). Analysis of variance for the maximum response and Hill slope estimates (Table 1) found that the mean values of both parameters were slightly lower in Calu 3 cells than in Vero cells, but these parameters did not differ significantly between the virus strains.
[0123] [Table 1-1]
[0124] [Table 1-2]
[0125] Example 3 – Mouse studies Six- to eight-week-old transgenic mice expressing human ACE2 under the control of the cytokeratin 18 promoter (K18-hACE2 mice) were purchased from The Jackson Laboratory (Bar Harbor, ME, USA; stock number 034860) and assessed for health disorders upon arrival. Animals underwent 1–2 weeks of acclimation and were housed individually to minimize the risk of cross-infection. Animals were kept under isoflurane anesthesia during dosing and virus inoculation and were returned to their cages during recovery.
[0126] The 2019n-CoV / US-WA1 / 2020 strain of SARS-CoV-2 was used in these studies (obtained from BEI Resources, National Institute of Allergy and Infectious Diseases (NIAID), Manassas, VA, USA). The virus was Vero E6 cells were passaged in Vero E6 cells (CRL-1586™, ATCC, Washington, DC, USA). Vero E6 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS).
[0127] Quantification of the viral inoculum produced in vitro and viral load in tissue homogenates at the end of the study was determined by plaque assay in Vero E6 cells. Viral genomes in serum and tissue homogenates were detected by quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR). Viral strain: 2019n-CoV / USA-WA1 / 2020.
[0128] Mice were administered 10 mg of 10 ... 4 They were inoculated with PFU of SARS-CoV-2 (2019n-CoV / USA-WA1 / 2020) by oral gavage and treated as follows: Experiment 1, Group 1: 10 mg / kg / day via intranasal administration 4 Five mice inoculated with PFU of SARS-CoV-2 (2019n-CoV / USA-WA1 / 2020) and treated by oral gavage of 100 mg / kg BIT225 (3 ml / kg dose volume; 33.4 mg / ml in vehicle) twice daily for 7 days. Experiment 1, Group 2: On day 1, 10 4 Five mice inoculated with PFU of SARS-CoV-2 (2019n-CoV / USA-WA1 / 2020) and treated with 300 mg / kg BIT225 (dose volume of 3 ml / kg; 100 mg / ml in vehicle) by oral gavage twice daily for 7 days. Experiment 1, Group 3: 10 mg / kg / day via intranasal administration 4Five mice inoculated with PFU of SARS-CoV-2 (2019n-CoV / USA-WA1 / 2020) and treated with vehicle control (3 ml / kg dose volume; vehicle) by oral gavage twice daily for 7 days. Experiment 2, Group 1: 10 mg / kg / day via intranasal administration 4 Seven mice were inoculated with PFU of SARS-CoV-2 (2019n-CoV / USA-WA1 / 2020) and treated with 300 mg / kg BIT225 by oral gavage twice daily for 12 days. Experiment 2, Group 2: 10 days via intranasal administration 4 Seven mice were inoculated with PFU of SARS-CoV-2 (2019n-CoV / USA-WA1 / 2020) and treated with vehicle control by oral gavage twice daily for 12 days. Experiment 3, Group 1: 10 mg / kg / day via intranasal administration 4 Four mice inoculated with PFU of SARS-CoV-2 (2019n-CoV / USA-WA1 / 2020) and treated with 300 mg / kg BIT225 by oral gavage twice daily for 5 days. Experiment 3, Group 2: 10 days via intranasal administration 4 Four mice inoculated with PFU of SARS-CoV-2 (2019n-CoV / USA-WA1 / 2020) and treated with vehicle control by oral gavage twice daily for 5 days. Experiment 4, Group 1: 10 via intranasal administration 4 Five mice received twice-daily treatment with 300 mg / kg BIT225 starting 24 h before inoculation with PFU SARS-CoV-2 (2019n-CoV / USA-WA1 / 2020). Experiment 4, Group 2: 10 via intranasal administration 4 Five mice received twice-daily treatment with 300 mg / kg BIT225 starting 24 hours after inoculation with PFU of SARS-CoV-2 (2019n-CoV / USA-WA1 / 2020). Experiment 4, Group 3: 10 via intranasal administration 4Five mice received twice-daily treatment with 300 mg / kg BIT225 starting 48 h before inoculation with PFU SARS-CoV-2 (2019n-CoV / USA-WA1 / 2020). Experiment 4, Group 4: 10 via intranasal administration 4 Five mice received twice daily treatment with vehicle control starting 24 h prior to inoculation with PFU of SARS-CoV-2 (2019n-CoV / USA-WA1 / 2020).
[0129] The vehicle control was 0.5% (w / v) hydroxypropyl methylcellulose, 0.5% (v / v) benzyl alcohol, and · 0.4% (v / v) polysorbate 80 in Milli-Q water (HPMC-SV).
[0130] Body weights were recorded every morning before the first dose. Mortality was pre-determined (under ethical discretion) as a determining factor for immediate euthanasia if the body weight loss was greater than 30% compared to pre-inoculation body weight on day 1. Mice that survived to the scheduled termination time (days 5, 7, or 12 for different experiments) were euthanized and lung and blood samples were taken for quantification of viral genome copy number, infectious viral titer, and cytokine concentrations.
[0131] The percent body weight change from day 1 (pre-infection) was calculated for each mouse at each time point (Equation 2).
number
[0132] Group means at time points were compared using two-tailed Welch t-tests. Between-group comparisons of body weight change, viral genome copy number, infectious titer, and cytokine levels also used two-tailed Welch t-tests.
[0133] For mortality comparisons, standard Kaplan-Meier analysis (right-censored) was performed using the R package: survival (v3.2-13; Therneau, TM (2020). A Package for Survival Analysis in R. https: / / CRAN.R-project.org / package=survival) and survival curves were compared by log-rank test.
[0134] The number of viral genome copies in blood and lung tissue homogenates was determined by Winkler et al. The viral RNA was determined by qRT-PCR using the method described by et al. 2020 (Nat. Immunol. 21: 1327-1335). Briefly, total viral RNA was extracted from serum or tissues using the MagMax™ mirVana™ Total RNA Isolation Kit (ThermoFisher Scientific, Waltham, MA, USA) with a KingFisher™ Flex extraction robot (ThermoFisher Scientific, Waltham, MA, USA). The SARS-CoV-2 nucleocapsid (N) gene was reverse transcribed and amplified using the TaqMan® RNA-to CT™ 1-Step Kit (ThermoFisher Scientific, Waltham, MA, USA). The SARS-CoV-2 N gene was · Forward primer: ATGCTGCAATCGTGCTACAA; · Reverse primer: GACTGCCGCCTCTGCTC; Probe: 56FAM / TCAAGGAAC / ZEN / AACATTGCCAA / 3IABkFQ, was detected using
[0135] The amount of infectious virus in blood and lung tissue homogenates was determined by plaque assay using the method described by van den Worm et al. 2012 (PLoS One 7(3):e32857). Briefly, in 6-well clusters, Vero-E6 cells were incubated with blood or lung homogenates in PBS containing DEAE (0.005% w / v) and 2% FCS for 1 h at 37°C. Blood and lung tissue homogenates were then replaced with 2 ml of a 1.2% suspension of Avicel (RC-581; FMC Biopolymer) in DMEM containing 2% FBS, 25 mM HEPES, penicillin (100 IU / ml) and streptomycin (100 IU / ml). Cells were incubated for 48-60 h at 37°C, fixed with formaldehyde, and plaques were then visualized using crystal violet staining.
[0136] Disease markers measured were survival rate, percent body weight change from pre-infection baseline, viral load (qPCR assay), and infectious viral titer (plaque assay) in lung tissue and serum samples. In addition, levels of six pro-inflammatory cytokines / chemokines (IL-6; IL-1α; IL-1β; TNFα; TGFβ; MCP-1) were measured in lung and serum samples.
[0137] Three experiments of different dosing regimens and duration were performed to compare disease endpoints in BIT225 and vehicle-treated groups. Experiment 1 compared vehicle to two levels of BIT225 (100 mg / kg and 300 mg / kg) over 7 days in groups of 5 mice (Figure 5A). Experiment 2 compared vehicle to two levels of BIT225 (100 mg / kg and 300 mg / kg) over 12 days in groups of 7 mice (Figure 5B&C) to include mortality analysis and to compare vehicle to BIT225 (300 mg / kg). Experiment 3 involved sacrificing BIT225-treated or vehicle control mice (n=4 / group) on day 5 post-infection. Based on previous results, day 5 was expected to be prior to death for any animals in the vehicle control group, but one mouse in the vehicle group had died by day 3. Nonetheless, three mice in the vehicle group survived until day 5, allowing comparison of viral load (FIG. 8) and cytokine / chemokine (data not shown) responses between groups.
[0138] Across all three experiments, all 16 mice that received vehicle alone started to lose weight starting on day 3 post-infection. In contrast, 21 of 21 mice continued to gain weight while receiving BIT225 every 12 h. In experiment 1 (Fig. 5A), there was no significant difference in weight fluctuation between the two BIT225 dose levels (100 mg / kg or 300 mg / kg), and on day 7, all 10 BIT225-treated mice had weights greater than their pre-infection weights. The vehicle control group showed significant weight loss compared to either BIT225 group (P<0.001; one-way ANOVA). On days 5, 6, and 7, the differences between group mean body weight changes were statistically lower in the vehicle group compared with the BIT225 groups combined: 3.8% (P = 0.01); 6.4% (P = 0.001); and 8.1% (95% CI [5.6 to 10.7], P = 0.001), respectively (P values are from Welch's t test adjusted for testing at six time points).
[0139] In experiment 2 (Figure 5B), all mice in the vehicle control group (n=7) started to lose weight starting on day 3 post-infection. Two deaths occurred in the morning of day 8, and the remaining 5 mice in the control group died by day 9 (Figure 5C). In contrast, in the group administered BIT225 for 12 days (n=7), all mice survived and continued to gain weight until euthanasia on day 12 for tissue collection. Analysis of variance and t-tests for individual days determined a high degree of statistical difference in the weight difference between these two groups starting on day 3 (adjusted P values as shown in Figure 5B). Experiment 3 (administration for 5 days; n=4 each for BIT225 and control groups) gave the same weight fluctuation trends as experiments 1 and 2, with all mice receiving BIT225 remaining healthy and gaining weight until day 5 (data not shown). In the control group, one mouse died by day 3, and the other three lost between 5% and 15% body weight by day 5. Kaplan-Meier mortality curves for experiment 2 are shown in Figure 5C. The control and BIT225 curves are significantly different (P<0.001 by log-rank test). Administration of BIT225 provided a clear survival advantage.
[0140] Experiment 4 compared the effectiveness of initiating BIT225 treatment 24 hours before, 24 hours after, or 48 hours after SARS-2 infection (Figure 6). Four groups of five mice received the same lethal inoculum (10 4pfu) and were administered either vehicle control or BIT225 (300 mg / kg) twice daily starting 24 h before infection. In the post-infection group, dosing was switched from vehicle to BIT225 in the morning on day 2 (24 h after inoculation) or day 3 (48 h after inoculation). Kaplan-Meier survival curves for this experiment are shown in Figure 6B: As in previous studies, all mice in the vehicle control group had died by day 8. All mice pre-treated (n=5) and 24 h after BIT225 treatment (n=5) remained healthy and continued to gain weight as expected for their age through day 12. One of five mice in the 48 h after treatment group began to lose weight starting on day 4 and died on day 11, but the other four mice in that cohort remained healthy and gained weight similarly to the other BIT225 mice. Trend lines for group means (not shown) suggest that delayed initiation of BIT225 dosing tends to result in lower weight gain, but the difference between the pre- and 48-h-treated groups was not statistically significant (P=0.3, t-test) on day 11. Importantly, the 48-h-treated group was clearly superior to the untreated group.
[0141] BIT225 was associated with a significant reduction in both viral load and infectious virus in lung homogenates and serum in mice treated with 100 mg / kg or 300 mg / kg BIT225 for 7 days (Figure 7). In addition, the viral reduction was dose-responsive. In the lung, the 100 mg / kg dose reduced viral load by approximately 2 log 10 (P<0.001, t-test), and the 300 mg / kg dose gave a reduction of approximately 3.5 log 10 The doses provided a significant reduction in infectious virus (P<0.001 between doses). Similarly, infectious virus recovered from lung tissue was reduced by approximately 2000 and 4000 PFU / mL at each dose (P<0.001). These variations were also reflected in serum samples, although virus was detected at lower absolute levels.
[0142] Lung viral loads were also measured in mice that survived to day 5 (experiment 3) or day 12 (experiment 2) (Figure 8). All 11 mice treated with BIT225 (300 mg / kg twice daily) survived and showed lung viral loads below the limit of detection in the qRT-PCR assay and very low plaque counts (<200 / mL); the 3 mice that survived to day 5 had pulmonary viral loads of 10 5 ~10 6 The virus had a viral load of 100 copies / mg and produced approximately 3,000-4,000 plaques / mL of homogenate.
[0143] The proinflammatory cytokines interleukin-6 (IL-6) (RayBio® Mouse IL-6 ELISA [ELM-IL6-1], RayBiotech Life, Peachtree Corners, GA, USA), interleukin-1 alpha (IL-1α) (RayBio® Mouse IL-1 ELISA [ELM-IL1alpha-1]), interleukin-1 beta (IL-1β) (RayBio® Mouse IL-1 ELISA [ELM-IL1beta-1], RayBiotech Life, Peachtree Corners, GA, USA), tumor necrosis factor alpha (TNF-α) (RayBio® Mouse TNF-alpha ELISA [ELM-TNFα-1], RayBiotech Life, Peachtree Corners, GA, USA), and transforming growth factor beta (TGF-β) (TGFbeta-1 Mouse ELISA Kit [BMS6084], ThermoFisher Inflammation was measured by determining the amount of proinflammatory chemokine monocyte chemoattractant protein-1 (MCP-1) (RayBio® Mouse MCP-1 ELISA [ELM-MCP1-1], RayBiotech Life, Peachtree Corners, GA, USA) according to the respective manufacturers' instructions. The ELISA protocol utilized a solid-phase sandwich ELISA design. Cytokine / chemokine target antibodies were pre-coated onto the plate. Samples were added to the wells to bind to the capture antibody. Addition of a second antibody allowed detection of the target-antibody sandwich complex, which was quantified using a colorimetric reporting signal that was directly proportional to the concentration in the original specimen.
[0144] Mice administered BIT225 had reduced end-of-treatment levels of five inflammatory cytokines (IL-6, IL-1α, IL-1β, TNGα, and TGFβ) and one chemokine (MCP-1) measured in both lung and serum samples, consistent with reduced disease severity and viral spread. All comparisons with vehicle controls, except for IL-6 in the 100 mg / kg dose group, resulted in statistically significant (P<0.05) lower levels in the BIT225 group. Figure 9 shows data from all 15 mice measured 7 days after infection. Overall, mean and median cytokine concentrations in the high-dose BIT225 group were less than half the levels of the vehicle control group, as well as lower than the low-dose group. Similar cytokine reductions were measured in serum and lung samples from mice administered for 5 and 12 days (not shown).
[0145] In vivo results demonstrate that BIT225 inhibits SARS-CoV-2 replication, reduces infectious viral load, reduces the production of exemplary pro-inflammatory cytokines and chemokines, and reduces the severity of complications associated with SARS-CoV-2 infection.
Claims
1. A pharmaceutical composition for the treatment or prevention of SARS-CoV-2 infection in a subject, comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharmaceutically acceptable salt thereof.
2. 2. The pharmaceutical composition of claim 1, wherein replication of SARS-CoV-2 is inhibited.
3. 10. The pharmaceutical composition of claim 1, wherein the severity, intensity, or duration of complications or symptoms associated with SARS-CoV-2 infection is reduced.
4. The pharmaceutical composition of claim 1 , wherein the viral load is reduced.
5. 10. The pharmaceutical composition of claim 1, wherein the production of a pro-inflammatory cytokine or chemokine is reduced.
6. A pharmaceutical composition for the treatment or prevention of COVID-19 in a subject, comprising N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharmaceutically acceptable salt thereof.
7. 7. The pharmaceutical composition of claim 6, wherein the severity, intensity, or duration of complications or symptoms associated with COVID-19 is reduced.
8. A pharmaceutical composition described in any one of claims 1 to 7, which is administered by a route selected from oral, nasal, intravenous, intraperitoneal, inhalation and topical.
9. A pharmaceutical composition described in any one of claims 1 to 7, which is administered orally.
10. A pharmaceutical composition described in any one of claims 1 to 7, wherein N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharmaceutically acceptable salt thereof is administered at a dosage of about 100 mg to about 600 mg.
11. N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphtho 8. The pharmaceutical composition according to any one of claims 1 to 7, wherein tamoxifen or a pharmaceutically acceptable salt thereof is orally administered once a day at a dose of about 100 mg to about 200 mg.
12. A pharmaceutical composition described in any one of claims 1 to 7, wherein N-carbamimidoyl-5-(1-methyl-1H-pyrazol-4-yl)-2-naphthamide or a pharmaceutically acceptable salt thereof is orally administered twice a day at a dose of about 100 mg to about 200 mg.