A stable production system for AAV vector production
Patent Information
- Application Number
- JP2024527336
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-11-09
- Filing Date
- 2022-11-09
- Publication Date
- 2025-11-17
AI Technical Summary
Current methods for producing viral vectors, such as AAV, are costly due to the need for large amounts of DNA and transfection reagents, and suffer from low transfection efficiency and variability, which affects virus production.
Development of engineered cells containing stable nucleic acid sequences encoding AAV vector production systems and HSV helper systems, utilizing chemically inducible promoters to regulate gene expression, reducing the need for transient transfection and enhancing production efficiency.
This approach reduces costs and variability by stabilizing gene expression in cells, leading to higher virus titers and more consistent production processes.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] Field Described herein are AAV vector production systems and HSV helper systems. Also described herein are engineered cells and kits that contain the AAV vector production systems, and / or HSV helper systems and methods of using same for AAV vector production.
[0002] Related Applications This application claims the benefit under 35 USC § 119 of U.S. Provisional Application No. 63 / 277,335, filed November 9, 2021, the entire contents of which are incorporated herein by reference.
[0003] Electronic Sequence Listing Reference The contents of the electronic sequence listing (A121070006WO00-SEQ-ARM.xml; size: 82,612 bytes; and creation date November 4, 2022) are incorporated herein by reference in their entirety. [Background technology]
[0004] background Viral vectors are a promising gene delivery modality for cell and gene therapy. Viral vectors can be modified to carry therapeutic gene payloads to cells in a subject. The production of viral vectors usually involves transient transfection of a plasmid containing the genes required for viral vector production into cell cultures. However, transient transfection has several drawbacks. Large amounts of DNA and transfection reagents must be procured for the transfection process, which is costly. Also, low transfection efficiency can result in a very low number of "transfected" cells, increasing the variability associated with the transfection step and virus production. Summary of the Invention
[0005] overview Described herein are AAV vector production systems and HSV helper systems. Also described herein are kits that include AAV vector production systems and / or HSV helper systems.Finally, described herein are engineered cells that include AAV vector production systems (or at least a portion thereof) and / or HSV helper systems, as well as methods that use engineered cells for AAV vector production.
[0006] In some aspects, the present disclosure relates to engineered cells for adeno-associated virus (AAV) production. In some embodiments, the engineered cells comprise one or more stably integrated polynucleic acids collectively comprising nucleic acid sequences encoding each of Rep52 or Rep40; Rep78 or Rep68; E2A; E4Orf6; VARNA; VP1; VP2; VP3; and AAP; each of which is operably linked to a chemically inducible promoter.
[0007] In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of Rep52, Rep40, Rep78, Rep68, E2A, E4Orf6, VARNA, VP1, VP2, VP3, and AAP.
[0008] In some embodiments, the engineered cell comprises at least two chemically inducible promoters, wherein two or more of the at least two chemically inducible promoters comprise the same nucleic acid sequence. In some embodiments, each of the at least two chemically inducible promoters comprises the same nucleic acid sequence.
[0009] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding Rep52 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, Rep52 comprises the amino acid sequence of SEQ ID NO:18.
[0010] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding Rep40 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, Rep40 comprises the amino acid sequence of SEQ ID NO:20.
[0011] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding Rep78 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs: 1-9, and optionally, Rep78 comprises the amino acid sequence of any one of SEQ ID NOs: 21 or 22.
[0012] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding Rep68 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs: 1-9, and optionally, Rep68 comprises the amino acid sequence of any one of SEQ ID NOs: 26 or 27.
[0013] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding E2A operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, E2A comprises the amino acid sequence of SEQ ID NO:29.
[0014] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding E4Orf6 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, E4Orf6 comprises the amino acid sequence of SEQ ID NO:35.
[0015] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding a VA RNA operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NO: 1-9, and optionally, the VA RNA comprises the nucleic acid sequence of SEQ ID NO: 38.
[0016] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding VP1 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, VP1 comprises the amino acid sequence of any one of SEQ ID NOs:30 or 31.
[0017] In some embodiments, the engineered cell comprises a nucleic acid sequence encoding VP2 operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs:1-9, and optionally, VP2 comprises the amino acid sequence of SEQ ID NO:33.
[0018] In some embodiments, the engineered cell comprises a nucleic acid sequence encoding VP3 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, VP3 comprises the amino acid sequence of SEQ ID NO:34.
[0019] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding an AAP operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, the AAP comprises the amino acid sequence of SEQ ID NO:37.
[0020] In some embodiments, the engineered cell comprises a first stably integrated polynucleic acid, wherein the first stably integrated polynucleic acid comprises a nucleic acid sequence encoding Rep52 or Rep40 and a nucleic acid sequence encoding Rep78 or Rep68. In some embodiments, the nucleic acid sequence encoding Rep52 or Rep40 and the nucleic acid sequence encoding Rep78 or Rep68 are each operably linked to a first chemically inducible promoter. In some embodiments, the first chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the first stably integrated polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES). In some embodiments, the nucleic acid sequence encoding an IRES separates the nucleic acid sequence encoding Rep52 or Rep40 and the nucleic acid sequence encoding Rep78 or Rep68. In some embodiments, the first stably integrated polynucleic acid further comprises a selection marker operably linked to the promoter.
[0021] In some embodiments, the engineered cell comprises a second stably integrated polynucleic acid, wherein the second stably integrated polynucleic acid comprises a nucleic acid sequence encoding E2A, E4Orf6, and VARNA. In some embodiments, the nucleic acid sequences encoding E2A, E4Orf6, and VARNA are each operably linked to a second chemically inducible promoter. In some embodiments, the second chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the second stably integrated polynucleic acid further comprises a nucleic acid sequence encoding an IRES. In some embodiments, the nucleic acid sequence encoding an IRES separates the nucleic acid sequence encoding E2A and the nucleic acid sequence encoding E4Orf6. In some embodiments, the second stably integrated polynucleic acid further comprises a selection marker operably linked to the promoter.
[0022] In some embodiments, the engineered cell comprises a third stably integrated polynucleic acid, wherein the third stably integrated polynucleic acid comprises a nucleic acid sequence encoding VP1, VP2, VP3, and AAP. In some embodiments, the third stably integrated polynucleic acid further comprises a selectable marker operably linked to a promoter. In some embodiments, the nucleic acid sequences encoding VP1, VP2, VP3, and AAP are each operably linked to a third chemically inducible promoter. In some embodiments, the third chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9.
[0023] In some embodiments, the engineered cell further comprises a fourth stably integrated polynucleic acid, wherein the fourth stably integrated polynucleic acid comprises a nucleic acid sequence encoding a transcriptional activator that binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer. In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10-16. In some embodiments, the fourth stably integrated polynucleic acid further comprises a selection marker operably linked to the promoter.
[0024] In some embodiments, the engineered cells further comprise a stable landing pad.
[0025] In some embodiments, the engineered cells are derived from HEK293 cells, HeLa cells, BHK cells, or Sf9 cells.
[0026] In some aspects, the present disclosure relates to engineered cells for AAV production.In some embodiments, the engineered cells for AAV production comprise one or more stably integrated polynucleic acids, collectively comprising the nucleic acid sequence encoding each of Rep52 or Rep40; Rep78 or Rep68; E2A; E4Orf6; VARNA; VP1; VP2; VP3; and AAP, at least one of which is operably linked to a chemically inducible promoter; wherein (i) the nucleic acid sequence encoding Rep68 lacks the Rep52 start codon; (ii) the nucleic acid sequence encoding Rep78 lacks the Rep52 start codon and the Rep68 / 40 splice site; (iii) the nucleic acid sequence encoding Rep52 lacks the Rep40 splice site; and (iv) the nucleic acid sequence encoding VP1 lacks the start codons of VP2, VP3, and AAP.
[0027] In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of Rep52, Rep40, Rep78, Rep68, E2A, E4Orf6, VARNA, SC-VP1, VP2, VP3, and AAP.
[0028] In some embodiments, the engineered cell comprises at least two chemically inducible promoters, wherein two or more of the at least two chemically inducible promoters comprise the same nucleic acid sequence. In some embodiments, each of the at least two chemically inducible promoters comprises the same nucleic acid sequence.
[0029] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding Rep52 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, optionally wherein Rep52 comprises the amino acid sequence of SEQ ID NO:18, and optionally wherein the nucleic acid sequence encoding Rep52 comprises the nucleic acid sequence of SEQ ID NO:19.
[0030] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding Rep40 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, Rep40 comprises the amino acid sequence of SEQ ID NO:20.
[0031] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding Rep78 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, optionally wherein Rep78 comprises the amino acid sequence of SEQ ID NO:22, and optionally wherein the nucleic acid sequence encoding Rep78 comprises the nucleic acid sequence of SEQ ID NO:23.
[0032] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding Rep68 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, optionally wherein Rep68 comprises the amino acid sequence of SEQ ID NO:27, and optionally wherein the nucleic acid sequence encoding Rep68 comprises the nucleic acid sequence of SEQ ID NO:28.
[0033] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding E2A operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, E2A comprises the amino acid sequence of SEQ ID NO:31.
[0034] In some embodiments, the engineered cell comprises a nucleic acid sequence encoding E4Orf6 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, optionally wherein E4Orf6 comprises the amino acid sequence of SEQ ID NO:35, and optionally wherein the nucleic acid sequence encoding E4Orf6 comprises the nucleic acid sequence of SEQ ID NO:36.
[0035] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding a VA RNA operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NO: 1-9, and optionally, the VA RNA comprises the nucleic acid sequence of SEQ ID NO: 38.
[0036] In some embodiments, the engineered cell comprises a nucleic acid sequence encoding VP1 operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs:1-9, optionally wherein VP1 comprises the amino acid sequence of SEQ ID NO:31, and optionally wherein the nucleic acid sequence encoding VP1 comprises the nucleic acid sequence of SEQ ID NO:32.
[0037] In some embodiments, the engineered cell comprises a nucleic acid sequence encoding VP2 operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs:1-9, and optionally, VP2 comprises the amino acid sequence of SEQ ID NO:33.
[0038] In some embodiments, the engineered cell comprises a nucleic acid sequence encoding VP3 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, VP3 comprises the amino acid sequence of SEQ ID NO:35.
[0039] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding an AAP operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, the AAP comprises the amino acid sequence of SEQ ID NO:37.
[0040] In some embodiments, the engineered cell comprises a first stably integrated polynucleic acid, wherein the first stably integrated polynucleic acid comprises a nucleic acid sequence encoding Rep52 or Rep40 and a nucleic acid sequence encoding Rep78 or Rep68. In some embodiments, the first stably integrated polynucleic acid comprises a nucleic acid sequence encoding Rep52 and a nucleic acid sequence encoding Rep78 or Rep68. In some embodiments, the nucleic acid sequence encoding Rep52 and the nucleic acid sequence encoding Rep78 or Rep68 are each operably linked to a first chemically inducible promoter. In some embodiments, the first chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the first stably integrated polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES) or a 2A peptide. In some embodiments, the nucleic acid sequence encoding the IRES or the 2A peptide separates the nucleic acid sequence encoding Rep52 and the nucleic acid sequence encoding Rep78 or Rep68. In some embodiments, the first stably integrated polynucleic acid further comprises a selectable marker operably linked to the promoter.
[0041] In some embodiments, the engineered cell comprises a second stably integrated polynucleic acid, wherein the second stably integrated polynucleic acid comprises a nucleic acid sequence encoding E2A, a nucleic acid sequence encoding E4Orf6, and a nucleic acid sequence encoding VARNA. In some embodiments, the nucleic acid sequence encoding E2A, the nucleic acid sequence encoding E4Orf6, and the nucleic acid sequence encoding VARNA are each operably linked to a second chemically inducible promoter. In some embodiments, the second chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the second stably integrated polynucleic acid further comprises an internal ribosome entry site (IRES) or a nucleic acid sequence encoding a 2A peptide. In some embodiments, the nucleic acid sequence encoding an IRES or a 2A peptide separates the nucleic acid sequence encoding E2A and the nucleic acid sequence encoding E4Orf6. In some embodiments, the second stably integrated polynucleic acid further comprises a selection marker operably linked to the promoter.
[0042] In some embodiments, the engineered cell comprises a third stably integrated polynucleic acid, wherein the third stably integrated polynucleic acid comprises a nucleic acid sequence encoding VP1, a nucleic acid sequence encoding VP2, a nucleic acid sequence encoding VP3, and a nucleic acid sequence encoding AAP. In some embodiments, the nucleic acid sequence encoding VP1 is operably linked to a third chemically inducible promoter, and the nucleic acid sequence encoding VP2, the nucleic acid sequence encoding VP3, and the nucleic acid sequence encoding AAP are each operably linked to a fourth chemically inducible promoter. In some embodiments, the third chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the fourth chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the third stably integrated polynucleic acid further comprises a selection marker operably linked to the promoter.
[0043] In some embodiments, the engineered cell further comprises a fourth stably integrated polynucleic acid, wherein the fourth stably integrated polynucleic acid comprises a nucleic acid sequence encoding a transcriptional activator that binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer. In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10-16. In some embodiments, the fourth stably integrated polynucleic acid molecule further comprises a selection marker operably linked to the promoter.
[0044] In some embodiments, the engineered cells comprise one or more stably integrated polynucleic acids collectively comprising a nucleic acid sequence encoding each of UL5; UL8; UL29; UL30; UL42; and UL52; each of which is operably linked to a chemically inducible promoter.
[0045] In some embodiments, the one or more stably integrated polynucleic acids further comprise a nucleic acid sequence encoding one or more of UL12, ICP0, ICP4, and ICP22. In some embodiments, the one or more stably integrated polynucleic acids further comprise a nucleic acid sequence encoding each of UL12, ICP0, ICP4, and ICP22.
[0046] In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of UL5, UL8, UL29, UL30, UL42, UL52, UL12, ICP0, ICP4, and ICP22.
[0047] In some embodiments, the engineered cell comprises at least two chemically inducible promoters, wherein two or more of the at least two chemically inducible promoters comprise the same nucleic acid sequence. In some embodiments, each of the at least two chemically inducible promoters comprises the same nucleic acid sequence.
[0048] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding UL5 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, UL5 comprises the amino acid sequence of SEQ ID NO:41.
[0049] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding UL8 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, UL8 comprises the amino acid sequence of SEQ ID NO:42.
[0050] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding UL29 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, the UL29 comprises the amino acid sequence of SEQ ID NO:44.
[0051] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding UL30 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, the UL30 comprises the amino acid sequence of SEQ ID NO:39.
[0052] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding UL42 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, UL42 comprises the amino acid sequence of SEQ ID NO:40.
[0053] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding UL52 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, UL52 comprises the amino acid sequence of SEQ ID NO:43.
[0054] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding UL12 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, the UL12 comprises the amino acid sequence of SEQ ID NO:50.
[0055] In some embodiments, the engineered cell comprises a nucleic acid sequence encoding ICP0 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, ICP0 comprises the amino acid sequence of SEQ ID NO:51.
[0056] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding ICP4 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, ICP4 comprises the amino acid sequence of SEQ ID NO:52.
[0057] In some embodiments, the engineered cells comprise a nucleic acid sequence encoding ICP22 operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs:1-9, and optionally, ICP22 comprises the amino acid sequence of SEQ ID NO:53.
[0058] In some embodiments, the engineered cell comprises a first stably integrated polynucleic acid, wherein the first stably integrated polynucleic acid comprises a nucleic acid sequence encoding UL30 and a nucleic acid sequence encoding UL42. In some embodiments, the nucleic acid sequence encoding UL30 and the nucleic acid sequence encoding UL42 are each operably linked to a first chemically inducible promoter. In some embodiments, the first chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the first stably integrated polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES). In some embodiments, the nucleic acid sequence encoding an IRES separates the nucleic acid sequence encoding UL30 and the nucleic acid sequence encoding UL42. In some embodiments, the first stably integrated polynucleic acid further comprises a selection marker operably linked to the promoter.
[0059] In some embodiments, the engineered cell comprises a second stably integrated polynucleic acid, wherein the second stably integrated polynucleic acid comprises a nucleic acid sequence encoding UL5, a nucleic acid sequence encoding UL8, a nucleic acid sequence encoding UL52, and a nucleic acid sequence encoding UL29. In some embodiments, the nucleic acid sequence encoding UL5, the nucleic acid sequence encoding UL8, and the nucleic acid sequence encoding UL52 are each operably linked to a second chemically inducible promoter, and the nucleic acid sequence encoding UL29 is operably linked to a third chemically inducible promoter. In some embodiments, the second chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the third chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the second stably integrated polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES). In some embodiments, the nucleic acid sequence encoding an IRES separates the nucleic acid sequence encoding UL8 and the nucleic acid sequence encoding UL52. In some embodiments, the second stably integrated polynucleic acid further comprises a selectable marker operably linked to the promoter.
[0060] In some embodiments, the engineered cell further comprises a third stably integrated polynucleic acid, wherein the third stably integrated polynucleic acid comprises a nucleic acid sequence encoding a transcriptional activator that binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer. In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10-16. In some embodiments, the third stably integrated polynucleic acid further comprises a selection marker operably linked to the promoter.
[0061] In some embodiments, the engineered cell comprises a fourth stably integrated polynucleic acid, wherein the fourth stably integrated polynucleic acid comprises a nucleic acid sequence encoding ICP0, a nucleic acid sequence encoding UL12, a nucleic acid sequence encoding ICP4, and a nucleic acid sequence encoding ICP22.
[0062] In some embodiments, the nucleic acid sequence encoding ICP0, the nucleic acid sequence encoding UL12, and the nucleic acid sequence encoding ICP4 are each linked to a fourth chemically inducible promoter, and the nucleic acid sequence encoding ICP22 is operably linked to a fifth chemically inducible promoter.
[0063] In some embodiments, the fourth chemically inducible promoter and the fifth chemically inducible promoter comprise one or more of the nucleic acid sequences of SEQ ID NOs: 1-9.
[0064] In some embodiments, the first stably integrated polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES).
[0065] In some embodiments, a nucleic acid sequence encoding an IRES separates the nucleic acid sequence encoding UL12 and the nucleic acid sequence encoding ICP4.
[0066] In some embodiments, the first stably integrated polynucleic acid further comprises a selectable marker operably linked to the promoter.
[0067] In some embodiments, the engineered cells further comprise a stable landing pad.
[0068] In some embodiments, the engineered cells are derived from HEK293 cells, HeLa cells, BHK cells, or Sf9 cells.
[0069] In some aspects, the present disclosure relates to kits comprising the engineered cells described herein.
[0070] In some embodiments, the kit further comprises a transfer polynucleic acid molecule comprising, from 5' to 3': (i) a nucleic acid sequence of a 5' AAV inverted tandem repeat (ITR); (ii) a multiple cloning site; and (iii) a nucleic acid sequence of a 3' AAV inverted tandem repeat (ITR). In some embodiments, the transfer polynucleic acid is a plasmid or a vector.
[0071] In some embodiments, the kit further comprises a small molecule inducer that corresponds to a chemically inducible promoter of the engineered cell.
[0072] In some embodiments, the engineered cells of the kit include a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of Rep52, Rep40, Rep78, Rep68, E2A, E4Orf6, VARNA, VP1, VP2, VP3, and AAP. In some embodiments, the nucleic acid sequence encoding Rep52 or Rep40, the nucleic acid sequence encoding Rep78 or Rep68, the nucleic acid sequence encoding E2A, the nucleic acid sequence encoding EOrf6, the nucleic acid sequence encoding VARNA, the nucleic acid sequence encoding VP1, the nucleic acid sequence encoding VP2, the nucleic acid sequence encoding Vp3, and the nucleic acid sequence encoding AAP are each operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9.
[0073] In some embodiments, the engineered cells of the kit include a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of ICP0, ICP4, ICP22, UL5, UL8, UL12, UL29, UL30, UL42, and UL52. In some embodiments, the nucleic acid sequence encoding ICP0, the nucleic acid sequence encoding ICP4, the nucleic acid sequence encoding ICP22, the nucleic acid sequence encoding UL5, the nucleic acid sequence encoding UL8, the nucleic acid sequence encoding UL12, the nucleic acid sequence encoding UL29, the nucleic acid sequence encoding UL30, the nucleic acid sequence encoding UL42, and the nucleic acid sequence encoding UL52 are each operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9.
[0074] In some embodiments, the engineered cell of the kit comprises at least two chemically inducible promoters. In some embodiments, two or more of the at least two chemically inducible promoters are distinct.
[0075] In some embodiments, the kit comprises a polynucleic acid comprising a nucleic acid sequence of a transcriptional activator operably linked to a nucleic acid sequence of a promoter, where the transcriptional activator binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer, and optionally the engineered cell comprises a polynucleic acid comprising a nucleic acid sequence of the transcriptional activator. In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10-12.
[0076] In some embodiments, the kit comprises the small molecule inducer doxycycline or tetracycline.
[0077] In some aspects, the disclosure relates to methods of producing AAV vectors.
[0078] In some embodiments, the method includes: (a) introducing into an engineered cell described herein (including, by way of example, one or more polynucleotides collectively encoding Rep52 or Rep40; Rep78 or SC-Rep68; E2A; E4Orf6; VARNA; VP1; VP2; VP3; AAP; and a transcriptional activator); and (b) contacting the engineered cell with a small molecule inducer that corresponds to a chemically inducible promoter of the engineered cell, thereby activating Rep52 or Rep40. inducing expression of Rep40; Rep78 or SC-Rep68; E2A; E4Orf6; VARNA; VP1; VP2; VP3; and AAP; wherein the engineered cell comprises a heterologous polynucleic acid comprising a nucleic acid sequence of a transcriptional activator operably linked to a nucleic acid sequence of a promoter, wherein the transcriptional activator binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer; and wherein (b) occurs before, simultaneously with, or after (a).
[0079] In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of Rep52, Rep40, Rep78, Rep68, E2A, E4Orf6, VARNA, VP1, VP2, VP3, and AAP.
[0080] In some embodiments, the nucleic acid sequence encoding Rep52 or Rep40, the nucleic acid sequence encoding Rep78 or Rep68, the nucleic acid sequence encoding E2A, the nucleic acid sequence encoding EOrf6, the nucleic acid sequence encoding VARNA, the nucleic acid sequence encoding VP1, the nucleic acid sequence encoding VP2, the nucleic acid sequence encoding VP3, and the nucleic acid sequence encoding AAP are each operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the engineered cell comprises at least two chemically inducible promoters. In some embodiments, two or more of the at least two chemically inducible promoters are distinct.
[0081] In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs:10-12.
[0082] In some embodiments, the small molecule inducer is doxycycline or tetracycline.
[0083] In some embodiments, the method comprises: (a) introducing into an engineered cell of any one of claims F1-F28 a transfer polynucleic acid; (b) contacting the engineered cell with a small molecule inducer corresponding to a chemically inducible promoter of the engineered cell, thereby inducing expression of UL5, UL8, UL29, UL30, UL42, and UL52; wherein the engineered cell comprises a heterologous polynucleic acid comprising a nucleic acid sequence of a transcriptional activator operably linked to a nucleic acid sequence of the promoter, wherein the transcriptional activator binds to the chemically inducible promoter of the engineered cell when expressed in the presence of the small molecule inducer; and wherein (b) occurs prior to, concurrently with, or after (a).
[0084] In some embodiments, the engineered cells comprise one or more polynucleic acids that collectively comprise a nucleic acid sequence encoding each of Rep52 or Rep40; Rep78 or Rep68; E2A; E4Orf6; VARNA; VP1; VP2; VP3; and AAP.
[0085] In some embodiments, the engineered cells contain one or more stably integrated polynucleic acids that collectively comprise nucleic acid sequences encoding each of Rep52 or Rep40; Rep78 or Rep68; E2A; E4Orf6; VARNA; VP1; VP2; VP3; and AAP.
[0086] In some embodiments, the method further comprises (c) introducing one or more polynucleic acids collectively comprising a nucleic acid sequence encoding each of Rep52 or Rep40; Rep78 or Rep68; E2A; E4Orf6; VARNA; VP1; VP2; VP3; and AAP, wherein (c) occurs prior to (a) or (b), simultaneously with (a) or (b), or after (a) or (b).
[0087] In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of ICP0, ICP4, ICP22, UL5, UL8, UL12, UL29, UL30, UL42, and UL52.
[0088] In some embodiments, the nucleic acid sequence encoding Rep52 or Rep40, the nucleic acid sequence encoding ICP0, the nucleic acid sequence encoding ICP4, the nucleic acid sequence encoding ICP22, the nucleic acid sequence encoding UL5, the nucleic acid sequence encoding UL8, the nucleic acid sequence encoding IL12, the nucleic acid sequence encoding UL29, the nucleic acid sequence encoding UL30, the nucleic acid sequence encoding UL42, and the nucleic acid sequence encoding UL52 are each operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences selected from SEQ ID NOs: 1 to 9.
[0089] In some embodiments, the engineered cell comprises at least two chemically inducible promoters, hi some embodiments, two or more of the at least two chemically inducible promoters are distinct.
[0090] In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs:10-12.
[0091] In some embodiments, the small molecule inducer is doxycycline or tetracycline.
[0092] The following drawings form part of this specification and are included to further demonstrate certain aspects of the present disclosure, which may be better understood by reference to one or more of these drawings in combination with the detailed description of certain embodiments presented herein. It should be understood that the data presented in the drawings are not intended to limit the scope of the present disclosure in any way. [Brief description of the drawings]
[0093] [Figure 1] Figure 1 shows a plasmid schematic of the inducible AAV transient transfection plasmid. An EGFP-expressing transfer plasmid was used as the payload of the AAV. Tet-On 3G rtTA and pTRE3G constitutively expressing doxycycline-inducible:linked Rep52 / 40 and Rep78 / 68, linked E2A and E4orf6 with a VA RNA cassette, and AAV2 Cap were used to test the system in transient transfection with HEK293FT as the host cell line. [Diagram 2] Figure 2 shows the plasmid schematic of the inducible AAV stable integration plasmid. The Tet-On 3G plasmid expresses rtTA, which is required for induction of gene expression from the TRE3G promoter. The AAV system is divided into a transfer plasmid, Rep (Rep52 / 40+Rep78 / 68), helper (E2A+E4orf6 and VARNA), and Cap gene-containing plasmid. Expression of each gene required for AAV production is induced by the addition of doxycycline. The Sleeping Beauty transposon IR / DR and antibiotic selection cassette are included to enhance integration efficiency and enable efficient selection of cells with genomic integration events, respectively. [Diagram 3] Figure 3 shows results from the production of AAV using Rep+Cap and pTRE3G-induced expression of E2A+E4orf6 and VA RNA. Doxycycline induction results in an approximately 27-fold increase in AAV titer. [Figure 4]Figure 4 shows a plasmid schematic of the refactored AAV stable integration plasmid. The Rep, Cap, and helper genes are all under the control of a doxycycline-inducible promoter. Rep68 / 78 was modified to remove the Rep52 start codon, and in Rep78, the Rep68 / 40 splice site was removed. Rep52 was modified to remove the Rep40 splice site. All sequences were refactored to minimize promoter elements. The Rep52 and Rep78 genes are transcriptionally (IRES) or translationally (P2A) linked. The coding DNA sequences of the helper genes E2A and E4orf6 are transcriptionally (IRES) or translationally (P2A) linked. The Cap gene VP1 was modified to remove the start codon of VP2 / 3 / AAP and is expressed on the same plasmid as the wild-type VP2 / 3 / AAP gene fragment. [Diagram 5] Figure 5 shows a plasmid schematic of the HSV helper stable integration plasmid. All elements of the HSV-1 replication complex are under doxycycline-inducible control. The genes encoding the HSV-1 polymerase (UL30 and UL42) are transcriptionally linked via an IRES sequence. The HSV-1 endonuclease (UL12) is constitutively expressed from the hEF1a promoter. ICP0, UL12, ICP4, and ICP22 are also encoded under the control of the pTRE3G promoter. UL12 and ICP4 are also transcriptionally linked via an IRES. [Figure 6] Figure 6 shows the results of AAV production using pTRE3G-induced expression of Rep+Cap, HSV-1 polymerase, and helicase-primase elements, with and without UL12 endonuclease. Doxycycline induction results in an approximately 18-fold increase in AAV titer. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0094] Detailed Description The production of viral vectors usually involves transient transfection of plasmids into cell cultures. However, the stable integration of the genes required to produce therapeutic viral vectors into the genome offers several advantages compared to traditional production by transient transfection. Because the cells amplify the viral genes during their own cell division, it is no longer necessary to procure large amounts of DNA and transfection reagents for the transfection process, reducing costs. Also, because the DNA is already in the nucleus, viral titers may be higher and more consistent due to the minimal number of "untransfected" cells and the less variability associated with the transfection step. The simpler production process also saves scientists time.
[0095] However, some genes required for adeno-associated virus (AAV) vector production have been demonstrated to be cytostatic or cytotoxic by others, namely Rep, E2A, and E4. The cytotoxic and cytostatic nature of these proteins has hindered the development of stable AAV-producing cell lines in the widely used HEK293 cell line, since the native expression of adenovirus E1 genes in HEK293 cells upregulates the expression of these toxic genes. Cells stably transfected with these genes either cannot survive the selection process or have their expression silenced, resulting in the inability to produce relevant amounts of AAV.
[0096] Described herein are AAV vector production systems and HSV helper systems. Also described herein are kits that include AAV vector production systems and / or HSV helper systems.Finally, described herein are engineered cells that include AAV vector production systems (or at least a portion thereof) and / or HSV helper systems, as well as methods that use engineered cells for AAV vector production.
[0097] I. AAV Vector Production System In some aspects, the present disclosure relates to an AAV vector production system.The AAV vector production system comprises one or more polynucleic acids that collectively code the gene products required for the production of AAV vector in recombinant host cell (or "engineered cell" as described herein) as described herein.The AAV vector production system described herein comprises one or more polynucleotides that collectively code the AAV gene products: Rep52 (or its functional variant) or Rep40 (or its functional variant); Rep78 (or its functional variant) or Rep68 (or its functional variant); E2A (or its functional variant); E4Orf6 (or its functional variant); VARNA (or its functional variant); VP1 (or its functional variant); VP2 (or its functional variant); VP3 (or its functional variant); and AAP (or its functional variant). In some embodiments, the AAV vector production system comprises one or more polynucleotides that collectively encode the following: Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof); Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); and AAP (or a functional variant thereof). In some embodiments, the AAV vector production system further comprises a polynucleotide encoding MAAP (or a functional variant thereof), which is nonessential for the production of an AAV vector in a recombinant host cell.
[0098] In some embodiments, the AAV vector production system (i.e., the gene products of the viral vector components) are encoded on a single polynucleic acid. In other embodiments, multiple polynucleic acids collectively comprise the AAV vector production system (i.e., at least two of the gene products of the viral vector components are encoded on different polynucleic acids). For example, the AAV vector production system may comprise at least two, at least three, at least four, or at least five polynucleic acids. In some embodiments, the AAV vector production system comprises two, three, four, or five polynucleic acids. Exemplary AAV production system architectures are provided below (Part IC).
[0099] Rep52 is a protein involved in AAV genome packaging. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding Rep52. In some embodiments, Rep52 comprises the amino acid sequence of SEQ ID NO: 18. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding a functional variant of Rep52. The functional variant of Rep52 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 18 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of Rep52 (i.e., its function in AAV genome packaging). In some embodiments, the nucleic acid sequence encoding Rep52 lacks a Rep40 splice site. See Stutika et al. J Virol. 2015 Nov 11;90(3):1278-89, the entire contents of which are incorporated herein by reference. In some embodiments, the nucleic acid sequence encoding Rep52 and lacking a Rep40 splice site comprises the nucleic acid sequence of SEQ ID NO: 19 ("SS-Rep52"), or an analogous nucleic acid sequence lacking a Rep40 splice site and encoding Rep52 (or a Rep52 variant as described above).
[0100] Methods for determining the degree of identity between two sequences (e.g., two amino acid sequences or two polynucleic acids) are known to those skilled in the art. One exemplary method is the use of the Basic Local Alignment Search Tool (BLAST®) software with default parameters (blast.ncbi.nlm.nih.gov / Blast.cgi).
[0101] Rep40 is a protein involved in AAV genome packaging. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding Rep40. In some embodiments, Rep40 comprises the amino acid sequence of SEQ ID NO: 20. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding a functional variant of Rep40. The functional variant of Rep40 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 20 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of Rep40 (i.e., its function in AAV genome packaging).
[0102] Rep78 is a protein involved in AAV genome replication. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding Rep78. In some embodiments, Rep78 comprises the amino acid sequence of SEQ ID NO: 21. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding a functional variant of Rep78. A functional variant of Rep78 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 21 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of Rep78 (i.e., its function in AAV genome replication). An exemplary functional variant of Rep78 is one that lacks the Rep52 start codon. Such functional variants may include the amino acid sequence of SEQ ID NO: 22 ("SC / SS-Rep78"). In some embodiments, the nucleic acid sequence encoding Rep78 lacks the Rep68 / 40 splice site. See Stutika et al. J Virol. 2015 Nov 11; 90(3): 1278-89, the entire contents of which are incorporated herein by reference. In some embodiments, the nucleic acid sequence encoding Rep78 lacks the Rep52 start codon and the Rep68 / 40 splice site. In some embodiments, the nucleic acid sequence encoding Rep78 and lacking the Rep52 start codon and the Rep68 / 40 splice site comprises the nucleic acid sequence of SEQ ID NO: 23 or a similar nucleic acid sequence that lacks the Rep52 start codon and the Rep68 / 40 splice site and encodes a Rep78 variant (as described above).
[0103] Rep68 is a protein involved in AAV genome replication. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding Rep68. In some embodiments, Rep68 comprises the amino acid sequence of SEQ ID NO: 26. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding a functional variant of Rep68. A functional variant of Rep78 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 26 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of Rep68 (i.e., its function in AAV genome replication). An exemplary functional variant of Rep68 is one that lacks the Rep52 start codon. Such a functional variant may comprise the amino acid sequence of SEQ ID NO: 27 ("SC-Rep68"). In some embodiments, the nucleic acid sequence encoding Rep78 lacks a Rep52 start codon site. In some embodiments, the nucleic acid sequence encoding Rep78 and lacking a Rep52 start codon comprises the nucleic acid sequence of SEQ ID NO: 28, or an analogous nucleic acid sequence lacking the Rep52 start codon and encoding a Rep68 variant (as described above).
[0104] E2A is a protein involved in AAV genome replication. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding E2A. In some embodiments, E2A comprises the amino acid sequence of SEQ ID NO: 29. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding a functional variant of E2A. A functional variant of E2A comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 29 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of E2A (i.e., its function in AAV genome replication).
[0105] E4Orf6 is a protein involved in AAV genome replication. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding E4Orf6. In some embodiments, E4Orf6 comprises the amino acid sequence of SEQ ID NO: 35. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding a functional variant of E4Orf6. The functional variant of E4Orf6 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 35 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of E4Orf6 (i.e., its function in AAV genome replication). In some embodiments, the nucleic acid sequence encoding E4Orf6 lacks a splice site, such as the E4orf6sf "splice-locked" variant reported in, for example, Querido E., Identification and elimination of an aberrant splice product from cDNAs encoding the human adenovirus type 5 E4orf6 protein, Virology. 2000 Sep 30;275(2):263-6. In some embodiments, the nucleic acid sequence encoding E4Orf6 lacking a splice site comprises the nucleic acid sequence of SEQ ID NO:36 ("SS-E4ORF6"), or a similar nucleic acid sequence lacking a splice site and encoding E4Orf6 (or a variant thereof, as described above).
[0106] VARNA is a non-coding RNA that stimulates the expression of AAV proteins. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding VARNA. In some embodiments, the VARNA comprises the nucleic acid sequence of SEQ ID NO: 38. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding a functional variant of VARNA. A functional variant of VARNA comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 38 and maintains at least 80% (i.e., at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of VARNA (i.e., its function of stimulating the expression of AAV proteins).
[0107] VP1 is an AAV capsid protein. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding VP1. In some embodiments, VP1 comprises the amino acid sequence of SEQ ID NO: 30. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding a functional variant of VP1. A functional variant of VP1 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 30 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) of the function of VP1 (i.e., its function as an AAV capsid protein). An exemplary functional variant of VP1 is one that lacks the start codon for VP2, VP3, AAP, or a combination thereof. In some embodiments, the variant of VP1 lacks the start codons for VP2, VP3, and AAP and comprises the amino acid sequence of SEQ ID NO: 31 ("SC-VP1"). In some embodiments, the nucleic acid sequence encoding VP1 lacks the start codons for VP2, VP3, AAP, or a combination thereof. In some embodiments, the nucleic acid sequence encoding VP1 lacking the start codons for VP2, VP3, and AAP comprises the nucleic acid sequence of SEQ ID NO: 32, or an analogous nucleic acid sequence lacking the start codons for VP2, VP3, and AAP and encoding a VP1 variant (as described above).
[0108] VP2 is an AAV capsid protein. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding VP2. In some embodiments, VP2 comprises the amino acid sequence of SEQ ID NO: 33. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding a functional variant of VP2. A functional variant of VP2 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 33 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) of the function of VP2 (i.e., its function as an AAV capsid protein).
[0109] VP3 is an AAV capsid protein. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding VP3. In some embodiments, VP3 comprises the amino acid sequence of SEQ ID NO: 34. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding a functional variant of VP3. A functional variant of VP3 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 34 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) of the function of VP3 (i.e., its function as an AAV capsid protein).
[0110] AAP is a protein that promotes AAV capsid assembly. In some embodiments, the AAV vector production system comprises a polynucleic acid that encodes AAP. In some embodiments, the AAP comprises the amino acid sequence of SEQ ID NO: 37. In some embodiments, the AAV vector production system comprises a polynucleic acid that encodes a functional variant of AAP. The functional variant of APP comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 37 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) of the function of AAP (i.e., its function in promoting AAV capsid assembly).
[0111] MAAP is a membrane-associated accessory protein that is beneficial to AAV replication / infection. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding MAAP. In some embodiments, the MAAP comprises the amino acid sequence of SEQ ID NO: 49. In some embodiments, the AAV vector production system comprises a polynucleic acid encoding a functional variant of MAAP. A functional variant of MAPP comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 49 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) of the function of MAAP (i.e., its function in promoting replication / infection).
[0112] The AAV production system described herein comprises at least one expression cassette. As used herein, the term "expression cassette" refers to a polynucleic acid sequence that encodes a nucleic acid sequence of a promoter operably linked to a nucleic acid that encodes a product (e.g., an RNA product, VARNA (or a functional variant thereof), and / or a polypeptide product, such as Rep52 (or a functional variant thereof), Rep40 (or a functional variant thereof), Rep78 (or a functional variant thereof), Rep68 (or a functional variant thereof), E2A (or a functional variant thereof), E4Orf6 (or a functional variant thereof), VP1 (or a functional variant thereof), VP2 (or a functional variant thereof), VP3 (or a functional variant thereof), AAP (or a functional variant thereof), MAAP (or a functional variant thereof), or any combination thereof). In some embodiments, multiple products are encoded within a single expression cassette. For example, in some embodiments, a single promoter drives expression of a polycistronic RNA encoding multiple products (RNA and / or polypeptide products). The polycistronic RNA may include a nucleic acid sequence for an internal ribosomal entry site (IRES) and / or a nucleic acid sequence for a viral 2A peptide (V2A).
[0113] The IRES may comprise the nucleic acid sequence of SEQ ID NO:45. CCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATG
[0114] The IRES may contain the nucleic acid sequence of SEQ ID NO: 46. CCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGGCCCGGAACCTGGCCCTGTCTTCTTGACGAGCATTCC TAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGT GCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAG AAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATAGTTATC
[0115] The viral 2A peptide may comprise the amino acid sequence of ATNFSLLKQAGDVEENPGP (SEQ ID NO: 47) or EGRGSLLTCGDVEENPGP (SEQ ID NO: 48).
[0116] In some embodiments, the polynucleic acid of the AAV vector production system comprises multiple cassettes. When the AAV vector production system comprises multiple cassettes, the cassettes may be positioned in various orientations. For example, in some embodiments, each of the cassettes is encoded in the same orientation (i.e., encoded on the same strand). In other embodiments, at least one cassette is encoded in the opposite orientation (i.e., encoded on the opposite strand). The cassettes positioned in the opposite orientation may have convergent expression (→←) or divergent expression (←→). In some embodiments, the expression cassettes are positioned in alternating orientations.
[0117] As described herein, a promoter is "operably linked" to a nucleic acid coding sequence when the position of the promoter relative to the nucleic acid coding sequence is such that binding of a transcriptional activator to the promoter is capable of inducing expression of the coding sequence. The promoter of the expression cassette may be a constitutive promoter or an inducible promoter.
[0118] The promoter may be a constitutive promoter (i.e., an unregulated promoter that allows continuous transcription). Examples of constitutive promoters are known in the art and include, but are not limited to, cytomegalovirus (CMV) promoter, elongation factor 1 alpha (EF1 alpha) promoter, simian vacuolating virus 40 (SV40) promoter, ubiquitin-C (UBC) promoter, U6 promoter, and phosphoglycerate kinase (PGK) promoter. For example, see Ferreira et al., Tuning gene expression with synthetic upstream open reading frames. Proc. Natl. Acad. Sci. USA 2013 July; 110 (28): 11284-89; US Patent Publication No. 2014 / 377861, the entirety of which is incorporated herein by reference.
[0119] Alternatively, the promoter may be an inducible promoter (i.e., it activates transcription only under certain circumstances). The inducible promoter may be a chemically inducible promoter, a temperature inducible promoter, or a light inducible promoter. Examples of chemically inducible promoters are known in the art and include, but are not limited to, tetracycline / doxycycline inducible promoters, cumate inducible promoters, ABA inducible promoters, CRY2-CIB1 inducible promoters, DAPG inducible promoters, and mifepristone inducible promoters. For example, see Stanton et al., ACS Synth.Biol. 2014 Dec 19;3(12):880-91; Liang et al., Sci.Signal. 2011 Mar 15;4(164):rs2; U.S. Patent No. 7,745,592; U.S. Patent No. 7,935,788, which are incorporated herein by reference in their entirety. The chemically inducible promoter may comprise one or more of the nucleic acid sequences set forth in SEQ ID NOs: 1-9.
[0120] A.Selectable markers As described above, an AAV vector production system comprises one or more polynucleic acids that collectively encode gene products necessary for the production of an AAV vector in a recombinant host cell (or "engineered cell" as described herein), as described herein. In some embodiments, one or more of the polynucleic acids of the AAV vector production system comprises an expression cassette comprising: (i) a nucleic acid sequence of a promoter (constitutive or inducible, as described herein); and (ii) a nucleic acid sequence encoding a selectable marker. In some embodiments, each of the polynucleic acids of the AAV vector production system comprises a selectable marker. In some embodiments, each polynucleic acid of the AAV vector production system comprises a nucleic acid sequence of a separate selectable marker.
[0121] As used herein, the term "selectable marker" refers to a protein that, when introduced into or expressed in a cell, confers a trait suitable for selection.
[0122] The selectable marker may be a fluorescent protein. Examples of fluorescent proteins are known in the art (e.g., TagBFP, EBFP2, EGFP, EYFP, mKO2, or Sirius). For example, see U.S. Patent No. 5,874,304; European Patent No. 0969284; U.S. Patent Application Publication No. 2010 / 167394, the entire contents of which are incorporated herein by reference.
[0123] Alternatively or additionally, the selectable marker may be an antibiotic resistance protein. Examples of antibiotic resistance proteins are known in the art (e.g., puromycin, hygromycin, neomycin, zeocin, blasticidin, or phleomycin selection facilitation). See, for example, Publication No. WO 1997 / 15668; Publication No. WO 1997 / 43900, the entire contents of which are incorporated herein by reference.
[0124] B. Inducible AAV Vector Production System In some embodiments, the AAV vector production system described herein comprises one or more polynucleotides collectively encoding the following: Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); and AAP (or a functional variant thereof); and optionally MAAP (or a functional variant thereof); at least one of which is operably linked to a chemically inducible promoter. In some embodiments, the AAV vector production system comprises one or more polynucleotides collectively encoding the following: Rep52 (or a functional variant thereof); Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof); Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); and AAP (or a functional variant thereof); and optionally MAAP (or a functional variant thereof); each of which is operably linked to a chemically inducible promoter.
[0125] In any of the embodiments described in this section, the chemically inducible promoter may comprise a tetracycline / doxycycline inducible promoter, a coumarate inducible promoter, an ABA inducible promoter, a CRY2-CIB1 inducible promoter, a DAPG inducible promoter, a mifepristone inducible promoter, or a combination thereof. In some embodiments, the chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO:9.
[0126] In some embodiments, a nucleic acid sequence encoding Rep52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding Rep40 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep78 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep68 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E2A (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding VARNA (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP2 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP3 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding AAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding MAAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0127] In some embodiments, a nucleic acid sequence encoding Rep40 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding Rep52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep78 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep68 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E2A (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding VARNA (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP2 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP3 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding AAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding MAAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0128] In some embodiments, a nucleic acid sequence encoding Rep78 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding Rep40 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep68 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E2A (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding VARNA (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP2 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP3 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding AAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding MAAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0129] In some embodiments, a nucleic acid sequence encoding Rep78 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding Rep40 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep68 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E2A (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding VARNA (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP2 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP3 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding AAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding MAAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0130] In some embodiments, a nucleic acid sequence encoding Rep68 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding Rep40 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep78 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E2A (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding VARNA (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP2 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP3 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding AAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding MAAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0131] In some embodiments, a nucleic acid sequence encoding E2A (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding Rep40 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep78 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep68 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding VARNA (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP2 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP3 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding AAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding MAAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0132] In some embodiments, a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding Rep40 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep78 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep68 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E2A (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding VARNA (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP2 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP3 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding AAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding MAAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0133] In some embodiments, a nucleic acid sequence encoding VARNA (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding Rep40 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep78 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep68 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E2A (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding Rep52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP2 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP3 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding AAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding MAAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0134] In some embodiments, a nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding Rep40 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep78 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep68 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E2A (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding VARNA (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP2 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP3 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding AAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding MAAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0135] In some embodiments, a nucleic acid sequence encoding VP2 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding Rep40 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep78 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep68 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E2A (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding VARNA (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP3 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding AAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding MAAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0136] In some embodiments, a nucleic acid sequence encoding VP3 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding Rep40 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep78 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep68 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E2A (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding VARNA (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP2 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding AAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding MAAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0137] In some embodiments, a nucleic acid sequence encoding AAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding Rep40 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep78 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep68 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E2A (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding VARNA (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP2 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP3 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding MAAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0138] In some embodiments, a nucleic acid sequence encoding MAAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding Rep40 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep78 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep68 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E2A (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding VARNA (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP2 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding VP3 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding Rep52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding AAP (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0139] In some embodiments, the AAV vector production system described herein comprises one or more polynucleotides collectively encoding: Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); and AAP (or a functional variant thereof); each of which is operably linked to a chemically inducible promoter. In some embodiments, the AAV vector production system comprises one or more polynucleotides collectively encoding: Rep52 (or a functional variant thereof); Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof); Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); AAP (or a functional variant thereof); and optionally MAAP (or a functional variant thereof); each of which is operably linked to a chemically inducible promoter.
[0140] In some embodiments, the AAV vector production system described herein comprises a single chemically inducible promoter. In such embodiments, the single chemically inducible promoter may be operably linked to the nucleic acid sequence encoding the following: Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); and AAP (or a functional variant thereof). In some embodiments, a single chemically inducible promoter may be operably linked to a nucleic acid sequence encoding the following: Rep52 (or a functional variant thereof); Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof); Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); AAP (or a functional variant thereof); and optionally MAAP (or a functional variant thereof).
[0141] In some embodiments, the AAV vector production system comprises at least two, at least three, at least four, or at least five chemically inducible promoters. In some embodiments, the AAV vector production system comprises two, three, four, or five chemically inducible promoters.
[0142] In some embodiments where the AAV vector production system comprises at least two chemically inducible promoters, the two or more chemically inducible promoters comprise the same nucleic acid sequence. In some embodiments where the AAV vector production system comprises at least two chemically inducible promoters, each of the chemically inducible promoters comprises the same nucleic acid sequence. In some embodiments where the AAV vector production system comprises at least two chemically inducible promoters, one or more of the chemically inducible promoters comprise distinct nucleic acid sequences. In some embodiments where the AAV vector production system comprises at least two chemically inducible promoters, each of the chemically inducible promoters comprises distinct nucleic acid sequences.
[0143] The inducible AAV vector production system described herein may further comprise a polynucleic acid comprising an expression cassette comprising: (i) a nucleic acid sequence of a promoter (constitutive or inducible, as described herein); and (ii) a nucleic acid sequence encoding a transcriptional activator, where the transcriptional activator binds to the chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer. In embodiments where the AAV vector production system comprises two or more distinct chemically inducible promoters, the system may comprise nucleic acid sequences of two or more corresponding transcriptional activators.
[0144] In some embodiments, the transcriptional activator is Tet-On 3G. In some embodiments, Tet-On 3G comprises the amino acid sequence of SEQ ID NO: 10. In some embodiments, the transcriptional activator is a functional variant of Tet-On 3G. A functional variant of Tet-On 3G comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 10 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of Tet-On 3G (i.e., its function as a transcriptional activator).
[0145] In some embodiments, the transcriptional activator is TetOff-Advanced. In some embodiments, TetOff-Advanced comprises the amino acid sequence of SEQ ID NO: 11. In some embodiments, the transcriptional activator is a functional variant of TetOff-Advanced. A functional variant of TetOff-Advanced comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 11 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of TetOff-Advanced (i.e., its function as a transcriptional activator).
[0146] In some embodiments, the transcriptional activator is VanR-VP16. In some embodiments, VanR-VP16 comprises the amino acid sequence of SEQ ID NO: 12. In some embodiments, the transcriptional activator is a functional variant of VanR-VP16. A functional variant of VanR-VP16 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 12 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of VanR-VP16 (i.e., its function as a transcriptional activator).
[0147] In some embodiments, the transcriptional activator is TtgR-VP16. In some embodiments, TtgR-VP16 comprises the amino acid sequence of SEQ ID NO: 13. In some embodiments, the transcriptional activator is a functional variant of TtgR-VP16. A functional variant of TtgR-VP16 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 13 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of TtgR-VP16 (i.e., its function as a transcriptional activator).
[0148] In some embodiments, the transcriptional activator is PhlF-VP16. In some embodiments, PhlF-VP16 comprises the amino acid sequence of SEQ ID NO: 14. In some embodiments, the transcriptional activator is a functional variant of PhlF-VP16. A functional variant of PhlF-VP16 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 14 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of PhlF-VP16 (i.e., its function as a transcriptional activator).
[0149] In some embodiments, the transcription activator is a cTA. In some embodiments, the cTA comprises the amino acid sequence of SEQ ID NO: 15. In some embodiments, the transcription activator is a functional variant of a cTA. A functional variant of a cTA comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 15 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of the cTA (i.e., its function as a transcription activator).
[0150] In some embodiments, the transcriptional activator is rcTA. In some embodiments, rcTA comprises the amino acid sequence of SEQ ID NO: 16. In some embodiments, the transcriptional activator is a functional variant of rcTA. A functional variant of rcTA comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 16 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of rcTA (i.e., its function as a transcriptional activator).
[0151] C. Architecture of an exemplary AAV vector production system For illustrative purposes, selected AAV vector production system architectures are described below.
[0152] 1. First Exemplary Architecture In some embodiments, the AAV vector production system comprises: (a) a first polynucleic acid comprising at least one expression cassette; (b) a second polynucleic acid comprising at least two expression cassettes; and (c) a third expression cassette comprising at least two expression cassettes.
[0153] In some embodiments, the first polynucleic acid comprises: (i) a nucleic acid sequence encoding Rep52 (or a functional variant thereof); a nucleic acid sequence encoding Rep40 (or a functional variant thereof), or both; and (ii) a nucleic acid sequence encoding Rep78 (or a functional variant thereof), a nucleic acid sequence encoding Rep68 (or a functional variant thereof), or both. In some embodiments, the nucleic acid sequence encoding (i) and the nucleic acid sequence encoding (ii) are each operably linked to a first chemically inducible promoter (as described herein). In some embodiments, the first chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the first polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES). In some embodiments, the nucleic acid sequence encoding an IRES separates the nucleic acid sequence encoding (i) from the nucleic acid sequence encoding (ii). In some embodiments, the first polynucleic acid further comprises a selectable marker operably linked to a promoter (constitutive or inducible as described herein).
[0154] In some embodiments, the second polynucleic acid comprises a nucleic acid sequence encoding E2A (or a functional variant thereof), E4Orf6 (or a functional variant thereof), and VARNA (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding E2A (or a functional variant thereof), E4Orf6 (or a functional variant thereof), and VARNA (or a functional variant thereof) are each operably linked to a second chemically inducible promoter (as described herein). In some embodiments, the second chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the second polynucleic acid further comprises a nucleic acid sequence encoding an IRES. In some embodiments, the nucleic acid sequence encoding an IRES separates the nucleic acid sequence encoding E2A (or a functional variant thereof) and the nucleic acid sequence encoding E4Orf6 (or a functional variant thereof). In some embodiments, the second polynucleic acid further comprises a selection marker operably linked to a promoter (constitutive or inducible, as described herein).
[0155] In some embodiments, the third stably integrated polynucleic acid comprises a nucleic acid sequence encoding VP1 (or a functional variant thereof), VP2 (or a functional variant thereof), VP3 (or a functional variant thereof), AAP (or a functional variant thereof); and optionally MAAP (or a functional variant thereof). In some embodiments, the third polynucleic acid further comprises a selection marker operably linked to the promoter. In some embodiments, the nucleic acid sequences encoding VP1 (or a functional variant thereof), VP2 (or a functional variant thereof), VP3 (or a functional variant thereof), and AAP (or a functional variant thereof) are each operably linked to a third chemically inducible promoter (as described herein). In some embodiments, the third chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9.
[0156] In some embodiments, the AAV vector production system further comprises a fourth polynucleic acid, wherein the fourth polynucleic acid comprises a nucleic acid sequence encoding a transcriptional activator that binds to a chemically inducible promoter of the AAV production system when expressed in the presence of a small molecule inducer. In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10-16. In some embodiments, the fourth polynucleic acid further comprises a selection marker operably linked to the promoter (constitutive or inducible as described herein).
[0157] 2. Second Exemplary Architecture In some embodiments, the AAV vector production system collectively comprises nucleic acid sequences encoding each of Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); AAP (or a functional variant thereof); and, optionally, MAAP (or a functional variant thereof). , comprising one or more stably integrated polynucleic acids; at least one of which is operably linked to a chemically inducible promoter (as described herein); wherein: (i) the nucleic acid sequence encoding Rep68 (or a functional variant thereof) lacks a Rep52 start codon; (ii) the nucleic acid sequence encoding Rep78 (or a functional variant thereof) lacks a Rep52 start codon and a Rep68 / 40 splice site; (iii) the nucleic acid sequence encoding Rep52 (or a functional variant thereof) lacks a Rep40 splice site; and (iv) the nucleic acid sequence encoding VP1 (or a functional variant thereof) lacks start codons for VP2, VP3, and AAP.
[0158] In some embodiments, the first polynucleic acid comprises: (i) a nucleic acid sequence encoding Rep52 (or a functional variant thereof); a nucleic acid sequence encoding Rep40 (or a functional variant thereof), or both; and (ii) a nucleic acid sequence encoding Rep78 (or a functional variant thereof), a nucleic acid sequence encoding Rep68 (or a functional variant thereof), or both. In some embodiments, the first polynucleic acid comprises a nucleic acid sequence encoding Rep52 (or a functional variant thereof), and a nucleic acid sequence encoding Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding Rep52 (or a functional variant thereof), and the nucleic acid sequence encoding Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof) are each operably linked to a first chemically inducible promoter (as described herein). In some embodiments, the first chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the first polynucleic acid further comprises an internal ribosome entry site (IRES) or a nucleic acid sequence encoding a 2A peptide. In some embodiments, the nucleic acid sequence encoding an IRES or a 2A peptide separates the nucleic acid sequence encoding Rep52 (or a functional variant thereof) from the nucleic acid sequence encoding Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof). In some embodiments, the first polynucleic acid further comprises a selection marker operably linked to a promoter (constitutive or inducible as described herein).
[0159] In some embodiments, the second polynucleic acid comprises a nucleic acid sequence encoding E2A (or a functional variant thereof), a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof), and a nucleic acid sequence encoding VARNA (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding E2A (or a functional variant thereof), the nucleic acid sequence encoding E4Orf6 (or a functional variant thereof), and the nucleic acid sequence encoding VARNA (or a functional variant thereof) are each operably linked to a second chemically inducible promoter (as described herein). In some embodiments, the second chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the second polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES) or a 2A peptide. In some embodiments, the nucleic acid sequence encoding an IRES or a 2A peptide separates the nucleic acid sequence encoding E2A from the nucleic acid sequence encoding E4Orf6. In some embodiments, the second polynucleic acid further comprises a selectable marker operably linked to a promoter (constitutive or inducible, as described herein).
[0160] In some embodiments, the third polynucleic acid comprises a nucleic acid sequence encoding VP1 (or a functional variant thereof), a nucleic acid sequence encoding VP2 (or a functional variant thereof), a nucleic acid sequence encoding VP3 (or a functional variant thereof), a nucleic acid sequence encoding AAP (or a functional variant thereof), and optionally a nucleic acid sequence encoding MAAP (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a third chemically inducible promoter (as described herein), and the nucleic acid sequence encoding VP2 (or a functional variant thereof), the nucleic acid sequence encoding VP3 (or a functional variant thereof), and the nucleic acid sequence encoding AAP (or a functional variant thereof) are each operably linked to a fourth chemically inducible promoter (as described herein). In some embodiments, the third chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the fourth chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the third polynucleic acid further comprises a selectable marker operably linked to a promoter (constitutive or inducible as described herein).
[0161] In some embodiments, the AAV vector production system further comprises a fourth polynucleic acid, wherein the fourth polynucleic acid comprises a nucleic acid sequence encoding a transcriptional activator that binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer. In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10-16. In some embodiments, the fourth polynucleic acid molecule further comprises a selection marker operably linked to the promoter (constitutive or inducible as described herein).
[0162] 3. Third Exemplary Architecture In some embodiments, the architecture of the AAV vector production system is as depicted in FIG.
[0163] 4. Fourth Exemplary Architecture In some embodiments, the architecture of the AAV vector production system is as depicted in FIG.
[0164] 5. Fifth Exemplary Architecture In some embodiments, the architecture of the AAV vector production system is as depicted in FIG.
[0165] II. HSV helper system for AAV vector production In some aspects, the present disclosure relates to the HSV helper system for AAV vector production.As described herein, the helper system comprises one or more polynucleic acids that collectively code UL5 (or its functional variant), UL8 (or its functional variant), UL29 (or its functional variant), UL30 (or its functional variant), UL42 (or its functional variant), UL52 (or its functional variant), UL12 (or its functional variant), ICP10 (or its functional variant), ICP4 (or its functional variant) and ICP22 (or its functional variant).
[0166] In some embodiments, the helper system is encoded on a single polynucleic acid. In other embodiments, a plurality of polynucleic acids collectively comprise the helper system. For example, the helper system may comprise at least 2, at least 3, at least 4, or at least 5 polynucleic acids. In some embodiments, the helper system comprises 2, 3, 4, or 5 polynucleic acids. Exemplary helper system architectures are provided below (Part IC).
[0167] UL5 (together with UL8 and UL52) is part of a helicase / primase complex that aids in AAV genome replication. In some embodiments, the helper system comprises a polynucleic acid encoding UL5. In some embodiments, UL5 comprises the amino acid sequence of SEQ ID NO: 41. In some embodiments, the helper system comprises a polynucleic acid encoding a functional variant of UL5. A functional variant of UL5 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 41 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of UL5 (i.e., its function in AAV genome replication).
[0168] UL8 (together with UL5 and UL52) is part of a helicase / primase complex that aids in AAV genome replication. In some embodiments, the helper system comprises a polynucleic acid encoding UL8. In some embodiments, UL8 comprises the amino acid sequence of SEQ ID NO: 42. In some embodiments, the helper system comprises a polynucleic acid encoding a functional variant of UL8. A functional variant of UL8 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 42 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of UL8 (i.e., its function in AAV genome replication).
[0169] UL52 (together with UL5 and UL8) is part of a helicase / primase complex that aids in AAV genome replication. In some embodiments, the helper system comprises a polynucleic acid encoding UL52. In some embodiments, UL52 comprises the amino acid sequence of SEQ ID NO: 43. In some embodiments, the helper system comprises a polynucleic acid encoding a functional variant of UL52. A functional variant of UL52 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 43 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of UL52 (i.e., its function in AAV genome replication).
[0170] UL30 (together with its cofactor UL42) is part of a polymerase complex that helps AAV genome replication. In some embodiments, the helper system comprises a polynucleic acid encoding UL30. In some embodiments, UL30 comprises the amino acid sequence of SEQ ID NO: 39. In some embodiments, the helper system comprises a polynucleic acid encoding a functional variant of UL30. A functional variant of UL30 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 39 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of UL30 (i.e., its function in AAV genome replication).
[0171] UL42 (together with its cofactor UL30) is part of a polymerase complex that helps AAV genome replication. In some embodiments, the helper system comprises a polynucleic acid encoding UL42. In some embodiments, UL42 comprises the amino acid sequence of SEQ ID NO: 40. In some embodiments, the helper system comprises a polynucleic acid encoding a functional variant of UL42. A functional variant of UL42 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 40 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of UL42 (i.e., its function in AAV genome replication).
[0172] UL29 (or ICP8) is a DNA binding protein that helps AAV genome replication. In some embodiments, the helper system comprises a polynucleic acid encoding UL29. In some embodiments, UL29 comprises the amino acid sequence of SEQ ID NO: 44. In some embodiments, the helper system comprises a polynucleic acid encoding a functional variant of UL29. A functional variant of UL29 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 44 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of UL29 (i.e., its function in AAV genome replication).
[0173] UL12 is a nuclease that plays a role in replication (Reuven et al. Journal of virology 78.9(2004):4599-4608, incorporated by reference in its entirety). In some embodiments, the helper system comprises a polynucleic acid encoding UL12. In some embodiments, UL12 comprises the amino acid sequence of SEQ ID NO:50. In some embodiments, the helper system comprises a polynucleic acid encoding a functional variant of UL12. A functional variant of UL12 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO:50 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of UL12 (i.e., its function in AAV genome replication).
[0174] ICP0 is a RING protein with E3 ubiquitin ligase activity that plays a role in balancing lytic replication and latency (Smith et al. Future virology 6.4 (2011): 421-429, incorporated by reference in its entirety). In some embodiments, the helper system comprises a polynucleic acid encoding ICP0. In some embodiments, ICP0 comprises the amino acid sequence of SEQ ID NO: 51. In some embodiments, the helper system comprises a polynucleic acid encoding a functional variant of ICP0. A functional variant of ICP0 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 51 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) of the function of ICP0 (i.e., its function as a ubiquitin ligase).
[0175] ICP4 is a 1298 amino acid nuclear phosphoprotein required to activate transcription of early and late genes (11, 37). Consistent with its ability to bind to viral DNA (3, 33), ICP4 is recruited to viral replication compartments that contain large amounts of replicating viral DNA. In some embodiments, the helper system comprises a polynucleic acid encoding ICP4. In some embodiments, ICP4 comprises the amino acid sequence of SEQ ID NO: 52. In some embodiments, the helper system comprises a polynucleic acid encoding a functional variant of ICP4. A functional variant of ICP4 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) to SEQ ID NO:52 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of ICP4 (i.e., its function in AAV viral propagation).
[0176] ICP22 regulates viral genes associated with the viral primary envelope (Maruzuru, Yuhei, et al. Journal of virology 88.13(2014):7445-7454). In some embodiments, the helper system comprises a polynucleic acid encoding ICP22. In some embodiments, ICP22 comprises the amino acid sequence of SEQ ID NO:53. In some embodiments, the helper system comprises a polynucleic acid encoding a functional variant of ICP22. A functional variant of ICP22 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO:53 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of ICP22 (i.e., its function in AAV regulating genes associated with the primary envelope).
[0177] The helper system described herein comprises at least one expression cassette. As used herein, the term "expression cassette" refers to a polynucleic acid sequence that encodes a nucleic acid sequence of a promoter that is operably linked to a nucleic acid that encodes a product (e.g., an RNA product and / or a polypeptide product, such as UL5 (or a functional variant thereof), UL8 (or a functional variant thereof), UL29 (or a functional variant thereof), UL30 (or a functional variant thereof), UL42 (or a functional variant thereof), UL52 (or a functional variant thereof), ICP0 (or a functional variant thereof), UL12 (or a functional variant thereof), ICP4 (or a functional variant thereof), ICP22 (or a functional variant thereof), or any combination thereof). In some embodiments, multiple products are encoded within a single expression cassette. For example, in some embodiments, a single promoter drives the expression of a polycistronic RNA that encodes multiple products (RNA products and / or polypeptide products). The polycistronic RNA may include a nucleic acid sequence for an internal ribosome entry site (IRES) and / or a nucleic acid sequence for a viral 2A peptide (V2A).
[0178] The IRES may comprise the nucleic acid sequence of SEQ ID NO:45. CCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATG
[0179] The IRES may contain the nucleic acid sequence of SEQ ID NO: 46. CCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTGTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGGCCCGGAACCTGGCCCTGTCTTCTTGACGAGCATTCC TAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGACAGGT GCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCGTATTCAACAAGGGGCTGAAGGATGCCCAG AAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATAGTTATC
[0180] The viral 2A peptide may comprise the amino acid sequence of ATNFSLLKQAGDVEENPGP (SEQ ID NO: 47) or EGRGSLLTCGDVEENPGP (SEQ ID NO: 48).
[0181] In some embodiments, the helper system comprises multiple cassettes. In cases when the helper system comprises multiple cassettes, the cassettes may be positioned in various orientations. For example, in some embodiments, each of the cassettes is encoded in the same orientation (i.e., encoding on the same strand). In other embodiments, at least one cassette is encoded in the opposite orientation (i.e., encoding on the opposite strand). Cassettes positioned in opposite orientations may have convergent expression (→←) or divergent expression (←→). In some embodiments, the expression cassettes are positioned in alternating orientations.
[0182] As described herein, a promoter is "operably linked" to a nucleic acid coding sequence when the position of the promoter relative to the nucleic acid coding sequence is such that binding of a transcriptional activator to the promoter is capable of inducing expression of the coding sequence. The promoter of the expression cassette may be a constitutive promoter or an inducible promoter.
[0183] The promoter may be a constitutive promoter (i.e., an unregulated promoter that allows continuous transcription). Examples of constitutive promoters are known in the art and include, but are not limited to, cytomegalovirus (CMV) promoter, elongation factor 1 alpha (EF1 alpha) promoter, simian vacuolating virus 40 (SV40) promoter, ubiquitin-C (UBC) promoter, U6 promoter, and phosphoglycerate kinase (PGK) promoter. For example, see Ferreira et al., Tuning gene expression with synthetic upstream open reading frames. Proc. Natl. Acad. Sci. USA 2013 July; 110 (28): 11284-89; US Patent Publication No. 2014 / 377861, the entirety of which is incorporated herein by reference.
[0184] Alternatively, the promoter may be an inducible promoter (i.e., it activates transcription only under certain circumstances). The inducible promoter may be a chemically inducible promoter, a temperature inducible promoter, or a light inducible promoter. Examples of chemically inducible promoters are known in the art and include, but are not limited to, tetracycline / doxycycline inducible promoters, coumarate inducible promoters, ABA inducible promoters, CRY2-CIB1 inducible promoters, DAPG inducible promoters, and mifepristone inducible promoters. For example, see Stanton et al., ACS Synth.Biol. 2014 Dec 19;3(12):880-91; Liang et al., Sci.Signal. 2011 Mar 15;4(164):rs2; U.S. Patent No. 7,745,592; U.S. Patent No. 7,935,788, which are incorporated herein by reference in their entirety. The chemically inducible promoter may comprise one or more of the nucleic acid sequences set forth in SEQ ID NOs: 1-9.
[0185] A.Selectable markers As described above, the helper system as described herein comprises one or more polynucleic acids collectively encoding UL5 (or a functional variant thereof), UL8 (or a functional variant thereof), UL29 (or a functional variant thereof), UL30 (or a functional variant thereof), UL42 (or a functional variant thereof), and UL52 (or a functional variant thereof). In some embodiments, one or more of the polynucleic acids of the helper system comprises an expression cassette comprising: (i) a nucleic acid sequence of a promoter (constitutive or inducible as described herein); and (ii) a nucleic acid sequence encoding a selectable marker. In some embodiments, each of the polynucleic acids of the helper system comprises a selectable marker. In some embodiments, each of the polynucleic acids of the helper system comprises a nucleic acid sequence of a separate selectable marker.
[0186] As used herein, the term "selectable marker" refers to a protein that, when introduced into or expressed in a cell, confers a trait suitable for selection.
[0187] The selectable marker may be a fluorescent protein. Examples of fluorescent proteins are known in the art (e.g., TagBFP, EBFP2, EGFP, EYFP, mKO2, or Sirius). For example, see U.S. Patent No. 5,874,304; European Patent No. 0969284; U.S. Patent Application Publication No. 2010 / 167394, the entire contents of which are incorporated herein by reference.
[0188] Alternatively, or in addition, the selectable marker may be an antibiotic resistance protein. Examples of antibiotic resistance proteins are known in the art (e.g., puromycin, hygromycin, Geneticin™ (G418), neomycin, zeocin, blasticidin, or phleomycin selection facilitation). See, e.g., Publication No. WO 1997 / 15668; Publication No. WO 1997 / 43900, the entireties of which are incorporated herein by reference.
[0189] B. Inducible HSV Helper Systems In some embodiments, the HSV helper system described herein comprises one or more polynucleotides collectively encoding UL5 (or a functional variant thereof); UL8 (or a functional variant thereof); UL29 (or a functional variant thereof); UL30 (or a functional variant thereof); UL42 (or a functional variant thereof); and UL52 (or a functional variant thereof); at least one of which is operably linked to a chemically inducible promoter. In some embodiments, the one or more polynucleotides of the HSV helper system described herein further encode (collectively) the following: ICP0 (or a functional variant thereof); UL12 (or a functional variant thereof); ICP4 (or a functional variant thereof); and ICP22 (or a functional variant thereof). In some embodiments, the sequences encoding ICP0 (or a functional variant thereof); UL12 (or a functional variant thereof); ICP4 (or a functional variant thereof); and / or ICP22 (or a functional variant thereof) are operably linked to a chemically inducible promoter.
[0190] In any of the embodiments described in this section, the chemically inducible promoter may comprise a tetracycline / doxycycline inducible promoter, a coumarate inducible promoter, an ABA inducible promoter, a CRY2-CIB1 inducible promoter, a DAPG inducible promoter, a mifepristone inducible promoter, or a combination thereof. In some embodiments, the chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 4. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 5. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 6. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 7. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO: 8. In some embodiments, the chemically inducible promoter comprises the nucleic acid sequence of SEQ ID NO:9.
[0191] In some embodiments, a nucleic acid sequence encoding UL5 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding UL8 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL29 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL30 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL42 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding UL52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP0 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL12 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP4 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP22 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0192] In some embodiments, a nucleic acid sequence encoding UL5 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding UL8 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL29 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL30 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL42 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding UL52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP0 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL12 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP4 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP22 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0193] In some embodiments, a nucleic acid sequence encoding UL5 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding UL8 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL29 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL30 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL42 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding UL52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP0 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL12 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP4 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP22 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0194] In some embodiments, a nucleic acid sequence encoding UL30 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding UL8 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL29 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL5 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL42 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding UL52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP0 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL12 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP4 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP22 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0195] In some embodiments, a nucleic acid sequence encoding UL42 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding UL8 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL29 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL30 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL5 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding UL52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP0 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL12 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP4 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP22 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0196] In some embodiments, a nucleic acid sequence encoding UL52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding UL8 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL29 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL30 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL42 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding UL5 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP0 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL12 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP4 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP22 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0197] In some embodiments, a nucleic acid sequence encoding ICP0 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding UL8 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL29 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL30 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL42 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding UL5 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL12 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP4 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP22 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0198] In some embodiments, a nucleic acid sequence encoding UL12 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding UL8 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL29 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL30 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL42 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding UL5 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP0 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP4 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP22 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0199] In some embodiments, a nucleic acid sequence encoding ICP4 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding UL8 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL29 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL30 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL42 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding UL5 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP0 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL12 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP22 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0200] In some embodiments, a nucleic acid sequence encoding ICP22 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein), optionally wherein a nucleic acid sequence encoding UL8 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL29 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL30 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL42 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein). and / or a nucleic acid sequence encoding UL5 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL52 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP0 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding UL12 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein); and / or a nucleic acid sequence encoding ICP4 (or a functional variant thereof) is operably linked to a chemically inducible promoter (as described herein).
[0201] In some embodiments, the helper system comprises at least 2, at least 3, at least 4, or at least 5 chemically inducible promoters. In some embodiments, the helper system comprises 2, 3, 4, or 5 chemically inducible promoters.
[0202] In some embodiments, where the helper system comprises at least two chemically inducible promoters, the two or more chemically inducible promoters comprise the same nucleic acid sequence. In some embodiments, where the helper system comprises at least two chemically inducible promoters, each of the chemically inducible promoters comprises the same nucleic acid sequence. In some embodiments, where the helper system comprises at least two chemically inducible promoters, one or more chemically inducible promoters comprise distinct nucleic acid sequences. In some embodiments, where the helper system comprises at least two chemically inducible promoters, each of the chemically inducible promoters comprises distinct nucleic acid sequences.
[0203] The helper systems described herein may further comprise a polynucleic acid comprising an expression cassette comprising: (i) a nucleic acid sequence of a promoter (constitutive or inducible as described herein); and (ii) a nucleic acid sequence encoding a transcriptional activator, where the transcriptional activator binds to the chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer. In embodiments where the helper system comprises two or more distinct chemically inducible promoters, the system may comprise two or more corresponding nucleic acid sequences of transcriptional activators.
[0204] In some embodiments, the transcriptional activator is Tet-On 3G. In some embodiments, Tet-On 3G comprises the amino acid sequence of SEQ ID NO: 10. In some embodiments, the transcriptional activator is a functional variant of Tet-On 3G. A functional variant of Tet-On 3G comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 10 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of Tet-On 3G (i.e., its function as a transcriptional activator).
[0205] In some embodiments, the transcriptional activator is TetOff-Advanced. In some embodiments, TetOff-Advanced comprises the amino acid sequence of SEQ ID NO: 11. In some embodiments, the transcriptional activator is a functional variant of TetOff-Advanced. A functional variant of TetOff-Advanced comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 11 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of TetOff-Advanced (i.e., its function as a transcriptional activator).
[0206] In some embodiments, the transcriptional activator is VanR-VP16. In some embodiments, VanR-VP16 comprises the amino acid sequence of SEQ ID NO: 12. In some embodiments, the transcriptional activator is a functional variant of VanR-VP16. A functional variant of VanR-VP16 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 12 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of VanR-VP16 (i.e., its function as a transcriptional activator).
[0207] In some embodiments, the transcriptional activator is TtgR-VP16. In some embodiments, TtgR-VP16 comprises the amino acid sequence of SEQ ID NO: 13. In some embodiments, the transcriptional activator is a functional variant of TtgR-VP16. A functional variant of TtgR-VP16 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 13 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of TtgR-VP16 (i.e., its function as a transcriptional activator).
[0208] In some embodiments, the transcriptional activator is PhlF-VP16. In some embodiments, PhlF-VP16 comprises the amino acid sequence of SEQ ID NO: 14. In some embodiments, the transcriptional activator is a functional variant of PhlF-VP16. A functional variant of PhlF-VP16 comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 14 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of PhlF-VP16 (i.e., its function as a transcriptional activator).
[0209] In some embodiments, the transcription activator is a cTA. In some embodiments, the cTA comprises the amino acid sequence of SEQ ID NO: 15. In some embodiments, the transcription activator is a functional variant of a cTA. A functional variant of a cTA comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 15 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of the cTA (i.e., its function as a transcription activator).
[0210] In some embodiments, the transcriptional activator is rcTA. In some embodiments, rcTA comprises the amino acid sequence of SEQ ID NO: 16. In some embodiments, the transcriptional activator is a functional variant of rcTA. A functional variant of rcTA comprises at least 80% identity (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity) with SEQ ID NO: 16 and maintains at least 80% (at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% function) of rcTA (i.e., its function as a transcriptional activator).
[0211] C. Exemplary HSV Helper System Architecture For exemplary purposes, the HSV helper system architecture choices are set forth below.
[0212] 1. First Exemplary Architecture In some embodiments, the HSV helper system comprises one or more stably integrated polynucleic acids collectively comprising a nucleic acid sequence encoding each of the following: UL5 (or a functional variant thereof); UL8 (or a functional variant thereof); UL29 (or a functional variant thereof); UL30 (or a functional variant thereof); UL42 (or a functional variant thereof); and UL52 (or a functional variant thereof); each of which is operably linked to a chemically inducible promoter (as described herein). In some embodiments, one or more polynucleotides of the HSV helper system described herein further encode (collectively) the following: ICP0 (or a functional variant thereof); UL12 (or a functional variant thereof); ICP4 (or a functional variant thereof); and ICP22 (or a functional variant thereof). In some embodiments, the sequences encoding ICP0 (or a functional variant thereof); UL12 (or a functional variant thereof); ICP4 (or a functional variant thereof); and / or ICP22 (or a functional variant thereof) are operably linked to a chemically inducible promoter.
[0213] In some embodiments, the helper system comprises a first polynucleic acid, wherein the first polynucleic acid comprises a nucleic acid sequence encoding UL30 (or a functional variant thereof) and a nucleic acid sequence encoding UL42 (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding UL30 (or a functional variant thereof) and the nucleic acid sequence encoding UL42 (or a functional variant thereof) are each operably linked to a first chemically inducible promoter. In some embodiments, the first chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the first polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES). In some embodiments, the nucleic acid sequence encoding an IRES separates the nucleic acid sequence encoding UL30 (or a functional variant thereof) and the nucleic acid sequence encoding UL42 (or a functional variant thereof). In some embodiments, the first polynucleic acid further comprises a selection marker operably linked to a promoter (constitutive or inducible as described herein).
[0214] In some embodiments, the helper system comprises a second stably integrated polynucleic acid, wherein the second stably integrated polynucleic acid comprises a nucleic acid sequence encoding UL5 (or a functional variant thereof), a nucleic acid sequence encoding UL8 (or a functional variant thereof), a nucleic acid sequence encoding UL52 (or a functional variant thereof), and a nucleic acid sequence encoding UL29 (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding UL5 (or a functional variant thereof), the nucleic acid sequence encoding UL8 (or a functional variant thereof), and the nucleic acid sequence encoding UL52 are each operably linked to a second chemically inducible promoter, and the nucleic acid sequence encoding UL29 (or a functional variant thereof) is operably linked to a third chemically inducible promoter. In some embodiments, the second chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the third chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the second polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES). In some embodiments, the nucleic acid sequence encoding an IRES separates the nucleic acid sequence encoding UL8 (or a functional variant thereof) from the nucleic acid sequence encoding UL52 (or a functional variant thereof). In some embodiments, the second polynucleic acid further comprises a selection marker operably linked to a promoter (constitutive or inducible as described herein).
[0215] In some embodiments, the helper system further comprises a third polynucleic acid, wherein the third polynucleic acid comprises a nucleic acid sequence encoding a transcriptional activator that binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer. In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10-16. In some embodiments, the third polynucleic acid further comprises a selection marker operably linked to the promoter (constitutive or inducible as described herein).
[0216] In some embodiments, the helper system comprises a fourth stably integrated polynucleic acid, wherein the fourth stably integrated polynucleic acid comprises a nucleic acid sequence encoding ICP0 (or a functional variant thereof), a nucleic acid sequence encoding UL12 (or a functional variant thereof), a nucleic acid sequence encoding ICP4 (or a functional variant thereof), and a nucleic acid sequence encoding ICP22 (or a functional variant thereof). In some embodiments, the fourth polynucleic acid further comprises a selection marker operably linked to a promoter (constitutive or inducible as described herein).
[0217] 2. Second Exemplary Architecture In some embodiments, the architecture of the HSV helper system is as depicted in FIG.
[0218] III. Engineered Cells In some aspects, the disclosure relates to an engineered cell that comprises: (i) one or more polynucleic acids of an AAV vector production system described in Part I; (ii) one or more polynucleic acids of an HSV helper system described in Part II; or (iii) a combination thereof. In the context of an engineered cell, such polynucleic acids are considered heterologous polynucleic acids (i.e., polynucleic acid sequences not naturally found in the cell). In some embodiments, the engineered cell comprises each of the polynucleic acids of the AAV production system described in Part I. In some embodiments, the engineered cell comprises each of the polynucleic acids of the HSV helper system described in Part II. In some embodiments, the engineered cell comprises: (i) each of the polynucleic acids of the AAV production system described in Part I; and (ii) one or more of the polynucleic acids of the HSV helper system described in Part II. In some embodiments, the engineered cell comprises: (i) one or more of the polynucleic acids of the AAV production system described in Part I; and (ii) each of the polynucleic acids of the HSV helper system described in Part II. In some embodiments, the engineered cells comprise: (i) each of the polynucleic acids of the AAV production system described in Part I; and (ii) each of the polynucleic acids of the HSV helper system described in Part II.
[0219] In some embodiments, the heterologous polynucleic acid of the engineered cell is present transiently.
[0220] In other embodiments, the polynucleic acid of the AAV vector production system or the HSV helper system is stably integrated into the genome of the engineered cell. In some embodiments, one or more polynucleic acids of the AAV vector production system are stably integrated into the genome of the engineered cell; one or more polynucleic acids of the HSV helper system are stably integrated into the genome of the engineered cell; or a combination thereof. In some embodiments, each polynucleic acid of the AAV vector production system is stably integrated into the genome of the engineered cell; one or more polynucleic acids of the HSV helper system are stably integrated into the genome of the engineered cell. In some embodiments, one or more polynucleic acids of the AAV vector production system are stably integrated into the genome of the engineered cell; each of the polynucleic acids of the HSV helper system is stably integrated into the genome of the engineered cell. In some embodiments, each of the heterologous polynucleic acids is stably integrated into the genome of the engineered cell. In some embodiments, each of the heterologous polynucleic acids is stably integrated into the genome of the engineered cell at a different location within the genome of the engineered cell.
[0221] In some embodiments, the engineered cells are derived from HEK293 cells.
[0222] In some embodiments, the engineered cells are derived from HeLa cells.
[0223] In some embodiments, the engineered cells are derived from BHK cells.
[0224] In some embodiments, the engineered cells are derived from Sf9 cells.
[0225] A. Landing Pad The engineered cells described herein may further comprise a landing pad. As used herein, the term "landing pad" refers to a heterologous polynucleic acid sequence that facilitates targeted insertion of a "payload" sequence into a specific locus (or multiple loci) of the genome of a cell. The landing pad is therefore integrated into the genome of the cell. Fixing the integration site is desirable to reduce inter-experimental variability that may be caused by positional epigenetic effects or proximal regulatory elements. The ability to control payload copy number is also desirable to adjust the expression level of the payload without changing any genetic components.
[0226] In some embodiments, the landing pad is located in a safe haven site in the genome of the engineered cell. As used herein, the term "safe haven site" refers to a location in the genome where a gene or genetic element can be introduced without interfering with the expression or regulation of adjacent genes and / or where adjacent genomic elements do not interfere with the expression or regulation of the introduced gene or genetic element. Examples of safe haven sites are known to those skilled in the art and include, but are not limited to, AAVS1, ROSA26, COSMIC, H11, CCR5, and LiPS-A3S. For example, see Gaidukov et al., Nucleic Acids Res. 2018 May 4; 46(8): 4072-4086; U.S. Patent No. 8,980,579; U.S. Patent No. 10,017,786; U.S. Patent No. 9,932,607; U.S. Patent No. 2013 / 280222; International Publication No. WO 2017 / 180669, which are incorporated herein in their entirety. In some embodiments, the safe harbor site is a known site. In other embodiments, the safe harbor site is a site that has not been previously disclosed. See "Methods for identifying highly expressed genomic loci and their uses" herein. In some embodiments, the engineered cells described herein comprise a landing pad integrated into a safe harbor locus selected from the group consisting of AAVS1, ROSA26, COSMIC, H11, CCR5, and LiPS-A3S.
[0227] In some embodiments, the engineered cells are derived from HEK293 cells. In some embodiments, the engineered HEK293 cells contain a landing pad integrated into a safe harbor locus selected from the group consisting of AAVS1, ROSA26, CCR5, and LiPS-A3S.
[0228] In some embodiments, the engineered cells are derived from BHK cells. In some embodiments, the engineered BHK cells contain a landing pad integrated into a safe harbor locus selected from the group consisting of ROSA26, COSMIC, and H11.
[0229] Each of the landing pads described herein comprises at least one recombination site. Recombination sites for various integrases have been previously identified. For example, landing pads may comprise recombination sites corresponding to Bxb1 integrase, lambda integrase, Cre recombinase, Flp recombinase, gamma delta resolvase, Tn3 resolvase, φC31 integrase, or R4 integrase. Exemplary recombination site sequences are known in the art (for example, attP, attB, attR, attL, Lox, and Frt).
[0230] The landing pads described herein may contain one or more expression cassettes.
[0231] B. Exemplary Engineered Cells For exemplary purposes, selected engineered cells are described below.
[0232] 1. First Exemplary Engineered Cells In some embodiments, the engineered cells comprise one or more stably integrated polynucleic acids collectively comprising a nucleic acid sequence encoding each of the following: Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); and AAP (or a functional variant thereof); each of which is operably linked to a chemically inducible promoter (as described herein). In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of the following: Rep52 (or a functional variant thereof), Rep40 (or a functional variant thereof), Rep78 (or a functional variant thereof), Rep68 (or a functional variant thereof), E2A (or a functional variant thereof), E4Orf6 (or a functional variant thereof), VARNA (or a functional variant thereof), VP1 (or a functional variant thereof), VP2 (or a functional variant thereof), VP3 (or a functional variant thereof), and AAP (or a functional variant thereof). In some embodiments, the engineered cells comprise at least two chemically inducible promoters, wherein two or more of the at least two chemically inducible promoters comprise the same nucleic acid sequence. In some embodiments, each of the at least two chemically inducible promoters comprises the same nucleic acid sequence.
[0233] In some embodiments, the engineered cell comprises a first stably integrated polynucleic acid, wherein the first polynucleic acid comprises: (i) a nucleic acid sequence encoding Rep52 (or a functional variant thereof); a nucleic acid sequence encoding Rep40 (or a functional variant thereof), or both; and (ii) a nucleic acid sequence encoding Rep78 (or a functional variant thereof), a nucleic acid sequence encoding Rep68 (or a functional variant thereof), or both. In some embodiments, the nucleic acid sequence encoding (i) and the nucleic acid sequence encoding (ii) are each operably linked to a first chemically inducible promoter (as described herein). In some embodiments, the first chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the first stably integrated polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES). In some embodiments, the nucleic acid sequence encoding an IRES separates the nucleic acid sequence encoding (i) from the nucleic acid sequence encoding (ii). In some embodiments, the first stably integrated polynucleic acid further comprises a selectable marker operably linked to a promoter (constitutive or inducible as described herein).
[0234] In some embodiments, the engineered cell comprises a second stably integrated polynucleic acid, wherein the second stably integrated polynucleic acid comprises a nucleic acid sequence encoding E2A (or a functional variant thereof), E4Orf6 (or a functional variant thereof), and VARNA (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding E2A (or a functional variant thereof), E4Orf6 (or a functional variant thereof), and VARNA (or a functional variant thereof) are each operably linked to a second chemically inducible promoter (as described herein). In some embodiments, the second chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the second polynucleic acid further comprises a nucleic acid sequence encoding an IRES. In some embodiments, the nucleic acid sequence encoding an IRES separates the nucleic acid sequence encoding E2A (or a functional variant thereof) and the nucleic acid sequence encoding E4Orf6 (or a functional variant thereof). In some embodiments, the second stably integrated polynucleic acid further comprises a selectable marker operably linked to a promoter (constitutive or inducible as described herein).
[0235] In some embodiments, the engineered cell comprises a third stably integrated polynucleic acid, wherein the third stably integrated polynucleic acid comprises a nucleic acid sequence encoding VP1 (or a functional variant thereof), VP2 (or a functional variant thereof), VP3 (or a functional variant thereof), and AAP (or a functional variant thereof). In some embodiments, the third stably integrated polynucleic acid further comprises a selectable marker operably linked to a promoter. In some embodiments, the nucleic acid sequences encoding VP1 (or a functional variant thereof), VP2 (or a functional variant thereof), VP3 (or a functional variant thereof), and AAP (or a functional variant thereof) are each operably linked to a third chemically inducible promoter (as described herein). In some embodiments, the third chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9.
[0236] In some embodiments, the engineered cell further comprises a fourth stably integrated polynucleic acid, wherein the fourth stably integrated polynucleic acid further comprises a nucleic acid sequence encoding a transcriptional activator that binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer. In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10-16. In some embodiments, the fourth stably integrated polynucleic acid further comprises a selection marker operably linked to the promoter.
[0237] In some embodiments, the engineered cells further comprise a stable landing pad.
[0238] In some embodiments, the engineered cells are derived from HEK293 cells, HeLa cells, BHK cells, or Sf9 cells.
[0239] 2. Second Exemplary Engineered Cells In some embodiments, the engineered cells contain one or more stabilizing proteins that collectively comprise a nucleic acid sequence encoding each of Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); and AAP (or a functional variant thereof). at least one of which is operably linked to a chemically inducible promoter; wherein: (i) the nucleic acid sequence encoding Rep68 (or a functional variant thereof) lacks a Rep52 start codon; (ii) the nucleic acid sequence encoding Rep78 (or a functional variant thereof) lacks a Rep52 start codon and a Rep68 / 40 splice site; (iii) the nucleic acid sequence encoding Rep52 (or a functional variant thereof) lacks a Rep40 splice site; and (iv) the nucleic acid sequence encoding VP1 (or a functional variant thereof) lacks start codons for VP2, VP3, and AAP.
[0240] In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of the following: Rep52 (or a functional variant thereof), Rep40 (or a functional variant thereof), Rep78 (or a functional variant thereof), Rep68 (or a functional variant thereof), E2A (or a functional variant thereof), E4Orf6 (or a functional variant thereof), VARNA (or a functional variant thereof), SC-VP1 (or a functional variant thereof), VP2 (or a functional variant thereof), VP3 (or a functional variant thereof), and AAP (or a functional variant thereof). In some embodiments, the engineered cells comprise at least two chemically inducible promoters, wherein two or more of the at least two chemically inducible promoters comprise the same nucleic acid sequence. In some embodiments, each of the at least two chemically inducible promoters comprises the same nucleic acid sequence.
[0241] In some embodiments, the engineered cell comprises a first stably integrated polynucleic acid, wherein the first stably integrated polynucleic acid comprises: (i) a nucleic acid sequence encoding Rep52 (or a functional variant thereof); a nucleic acid sequence encoding Rep40 (or a functional variant thereof), or both; and (ii) a nucleic acid sequence encoding Rep78 (or a functional variant thereof), a nucleic acid sequence encoding Rep68 (or a functional variant thereof), or both. In some embodiments, the first stably integrated polynucleic acid comprises a nucleic acid sequence encoding Rep52 (or a functional variant thereof), and a nucleic acid sequence encoding Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding Rep52 (or a functional variant thereof), and the nucleic acid sequence encoding Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof) are each operably linked to a first chemically inducible promoter (as described herein). In some embodiments, the first chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the first stably integrated polynucleic acid further comprises an internal ribosome entry site (IRES) or a nucleic acid sequence encoding a 2A peptide. In some embodiments, the nucleic acid sequence encoding an IRES or a 2A peptide separates a nucleic acid sequence encoding Rep52 (or a functional variant thereof) from a nucleic acid sequence encoding Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof). In some embodiments, the first stably integrated polynucleic acid further comprises a selection marker operably linked to a promoter (constitutive or inducible as described herein).
[0242] In some embodiments, the engineered cell comprises a second stably integrated polynucleic acid, wherein the second stably integrated polynucleic acid comprises a nucleic acid sequence encoding E2A (or a functional variant thereof), a nucleic acid sequence encoding E4Orf6 (or a functional variant thereof), and a nucleic acid sequence encoding VARNA (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding E2A (or a functional variant thereof), the nucleic acid sequence encoding E4Orf6 (or a functional variant thereof), and the nucleic acid sequence encoding VARNA (or a functional variant thereof) are each operably linked to a second chemically inducible promoter (as described herein). In some embodiments, the second chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the second stably integrated polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES) or a 2A peptide. In some embodiments, the nucleic acid sequence encoding the IRES or the 2A peptide separates the nucleic acid sequence encoding E2A and the nucleic acid sequence encoding E4Orf6. In some embodiments, the second stably integrated polynucleic acid further comprises a selectable marker operably linked to a promoter (constitutive or inducible as described herein).
[0243] In some embodiments, the engineered cell comprises a third stably integrated polynucleic acid, wherein the third stably integrated polynucleic acid comprises a nucleic acid sequence encoding VP1 (or a functional variant thereof), a nucleic acid sequence encoding VP2 (or a functional variant thereof), a nucleic acid sequence encoding VP3 (or a functional variant thereof), and a nucleic acid sequence encoding AAP (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding VP1 (or a functional variant thereof) is operably linked to a third chemically inducible promoter (as described herein), and the nucleic acid sequence encoding VP2 (or a functional variant thereof), the nucleic acid sequence encoding VP3 (or a functional variant thereof), and the nucleic acid sequence encoding AAP (or a functional variant thereof) are each operably linked to a fourth chemically inducible promoter (as described herein). In some embodiments, the third chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the fourth chemically inducible promoter comprises one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the third stably integrated polynucleic acid further comprises a selectable marker operably linked to a promoter (constitutive or inducible as described herein).
[0244] In some embodiments, the engineered cell further comprises a fourth stably integrated polynucleic acid, wherein the fourth polynucleic acid comprises a nucleic acid sequence encoding a transcriptional activator that binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer. In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10-16. In some embodiments, the fourth polynucleic acid molecule further comprises a selection marker operably linked to the promoter (constitutive or inducible as described herein).
[0245] In some embodiments, the engineered cells further comprise a stable landing pad.
[0246] In some embodiments, the engineered cells are derived from HEK293 cells, HeLa cells, BHK cells, or Sf9 cells.
[0247] 3. Third Exemplary Engineered Cells In some embodiments, the engineered cells comprise one or more stably integrated polynucleic acids collectively comprising a nucleic acid sequence encoding each of the following: UL5 (or a functional variant thereof); UL8 (or a functional variant thereof); UL29 (or a functional variant thereof); UL30 (or a functional variant thereof); UL42 (or a functional variant thereof); and UL52 (or a functional variant thereof); each of which is operably linked to a chemically inducible promoter. In some embodiments, the engineered cells comprise one or more stably integrated polynucleic acids further comprising UL12 (or a functional variant thereof), ICP0 (or a functional variant thereof), ICP4 (or a functional variant thereof), and ICP22 (or a functional variant thereof), each of which is operably linked to a chemically inducible promoter. In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of the following: UL5 (or a functional variant thereof), UL8 (or a functional variant thereof), UL29 (or a functional variant thereof), UL30 (or a functional variant thereof), UL42 (or a functional variant thereof), UL52 (or a functional variant thereof), UL12 (or a functional variant thereof), ICP0 (or a functional variant thereof), ICP4 (or a functional variant thereof), and ICP22 (or a functional variant thereof). In some embodiments, the engineered cells comprise at least two chemically inducible promoters, wherein two or more of the at least two chemically inducible promoters comprise the same nucleic acid sequence. In some embodiments, each of the at least two chemically inducible promoters comprises the same nucleic acid sequence.
[0248] In some embodiments, the engineered cell comprises a first stably integrated polynucleic acid, wherein the first stably integrated polynucleic acid comprises a nucleic acid sequence encoding UL30 (or a functional variant thereof) and a nucleic acid sequence encoding UL42 (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding UL30 (or a functional variant thereof) and the nucleic acid sequence encoding UL42 (or a functional variant thereof) are each operably linked to a first chemically inducible promoter. In some embodiments, the first chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the first stably integrated polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES). In some embodiments, the nucleic acid sequence encoding an IRES separates the nucleic acid sequence encoding UL30 (or a functional variant thereof) and the nucleic acid sequence encoding UL42 (or a functional variant thereof). In some embodiments, the first stably integrated polynucleic acid further comprises a selectable marker operably linked to a promoter (constitutive or inducible as described herein).
[0249] In some embodiments, the engineered cell comprises a second stably integrated polynucleic acid, wherein the second stably integrated polynucleic acid comprises a nucleic acid sequence encoding UL5 (or a functional variant thereof), a nucleic acid sequence encoding UL8 (or a functional variant thereof), a nucleic acid sequence encoding UL52 (or a functional variant thereof), and a nucleic acid sequence encoding UL29 (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding UL5 (or a functional variant thereof), the nucleic acid sequence encoding UL8 (or a functional variant thereof), and the nucleic acid sequence encoding UL52 are each operably linked to a second chemically inducible promoter, and the nucleic acid sequence encoding UL29 (or a functional variant thereof) is operably linked to a third chemically inducible promoter. In some embodiments, the second chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the third chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the second stably integrated polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES). In some embodiments, the nucleic acid sequence encoding an IRES separates the nucleic acid sequence encoding UL8 (or a functional variant thereof) from the nucleic acid sequence encoding UL52 (or a functional variant thereof). In some embodiments, the second stably integrated polynucleic acid further comprises a selection marker operably linked to a promoter (constitutive or inducible as described herein).
[0250] In some embodiments, the engineered cell further comprises a third polynucleic acid, wherein the third polynucleic acid comprises a nucleic acid sequence encoding a transcriptional activator that binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer. In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10-16. In some embodiments, the third stably integrated polynucleic acid further comprises a selection marker operably linked to a promoter (constitutive or inducible as described herein).
[0251] In some embodiments, the engineered cell comprises a fourth polynucleic acid, wherein the fourth polynucleic acid comprises a nucleic acid sequence encoding UL12 (or a functional variant thereof), ICP0 (or a functional variant thereof), ICP4 (or a functional variant thereof), and ICP22 (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding UL12 (or a functional variant thereof), ICP0 (or a functional variant thereof), ICP4 (or a functional variant thereof) is operably linked to a fourth chemically inducible promoter, and ICP22 (or a functional variant thereof) is operably linked to a fifth chemically inducible promoter. In some embodiments, the fourth chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the fifth chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the fourth stably integrated polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES). In some embodiments, a nucleic acid sequence encoding an IRES separates the nucleic acid sequence encoding UL12 (or a functional variant thereof) from the nucleic acid sequence encoding ICP4 (or a functional variant thereof). In some embodiments, the fourth stably integrated polynucleic acid further comprises a selection marker operably linked to a promoter (constitutive or inducible as described herein).
[0252] In some embodiments, the engineered cells further comprise a stable landing pad.
[0253] In some embodiments, the engineered cells are derived from HEK293 cells, HeLa cells, BHK cells, or Sf9 cells.
[0254] IV. Kit In some aspects, the disclosure relates to a kit that includes: (i) an AAV vector production system described herein in Part I; (ii) an HSV helper system described herein in Part II; or (iii) both.
[0255] In some embodiments, the kit comprises: one or more polynucleic acids that collectively comprise an AAV vector production system; one or more polynucleic acids that collectively comprise an HSV helper system; or a combination thereof.
[0256] In some embodiments, the kit comprises an engineered cell as described in Part III.
[0257] In some embodiments, the kit comprises a transfer polynucleic acid. The transfer polynucleic acid described herein comprises a central nucleic acid sequence flanked at the 5' and 3' ends by nucleic acid sequences of lentiviral long tandem repeats (LTRs) or transposase binding sites containing inverted and direct repeats (IR / DRs), such as Sleeping Beauty transposase binding sites, PiggyBac binding sites, or Leap-In binding sites. Exemplary lentiviral LRTs and transposase IR / DRs, such as Sleeping Beauty IR / DRs, are known to those skilled in the art.
[0258] The central nucleic acid of the transfer polynucleic acid may contain a nucleic acid sequence of a multiple cloning site. Exemplary multiple cloning sites are known to those skilled in the art. The multiple cloning site can be used to clone a payload molecule (or a gene of interest) (or an expression cassette encoding the payload molecule) into the transfer polynucleic acid before generating a viral vector in a host cell.
[0259] In some embodiments, the kit further comprises a small molecule inducer corresponding to a chemically inducible promoter of the AAV vector production system or a chemically inducible promoter of the HSV helper system, hi some embodiments, the small molecule inducer is tetracycline, doxycycline, coumarate, ABA, CRY2-CIB1, DAPG, mifepristone, lactose, or arabinose.
[0260] Exemplary kits are provided below.
[0261] A. First Exemplary Kit In some embodiments, the kit comprises an engineered cell comprising one or more stably integrated polynucleic acids collectively comprising a nucleic acid sequence encoding each of the following: Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); and AAP (or a functional variant thereof); at least one of which is operably linked to a chemically inducible promoter (as described herein).
[0262] In some embodiments, the kit further comprises a transfer polynucleic acid molecule comprising, from 5' to 3': (i) a nucleic acid sequence of a 5' AAV inverted tandem repeat (ITR); (ii) a multiple cloning site; and (iii) a nucleic acid sequence of a 3' AAV inverted tandem repeat (ITR). In some embodiments, the transfer polynucleic acid is a plasmid or a vector.
[0263] In some embodiments, the kit further comprises a small molecule inducer that corresponds to a chemically inducible promoter of the engineered cell.
[0264] In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of the following: Rep52 (or a functional variant thereof), Rep40 (or a functional variant thereof), Rep78 (or a functional variant thereof), Rep68 (or a functional variant thereof), E2A (or a functional variant thereof), E4Orf6 (or a functional variant thereof), VARNA (or a functional variant thereof), VP1 (or a functional variant thereof), VP2 (or a functional variant thereof), VP3 (or a functional variant thereof), and AAP (or a functional variant thereof).
[0265] In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-3 operably linked to a nucleic acid sequence encoding at least one of the following: Rep52 (or a functional variant thereof), Rep40 (or a functional variant thereof), Rep78 (or a functional variant thereof), Rep68 (or a functional variant thereof), E2A (or a functional variant thereof), E4Orf6 (or a functional variant thereof), VARNA (or a functional variant thereof), VP1 (or a functional variant thereof), VP2 (or a functional variant thereof), VP3 (or a functional variant thereof), and AAP (or a functional variant thereof).
[0266] In some embodiments, the nucleic acid sequence encoding Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof), the nucleic acid sequence encoding Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof), the nucleic acid sequence encoding E2A (or a functional variant thereof), the nucleic acid sequence encoding EOrf6 (or a functional variant thereof), the nucleic acid sequence encoding VARNA (or a functional variant thereof), the nucleic acid sequence encoding VP1 (or a functional variant thereof), the nucleic acid sequence encoding VP2 (or a functional variant thereof), the nucleic acid sequence encoding VP3 (or a functional variant thereof), and the nucleic acid sequence encoding AAP (or a functional variant thereof) are each operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the engineered cell comprises at least two chemically inducible promoters. In some embodiments, two or more of the at least two chemically inducible promoters are distinct.
[0267] In some embodiments, the nucleic acid sequence encoding Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof), the nucleic acid sequence encoding Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof), the nucleic acid sequence encoding E2A (or a functional variant thereof), the nucleic acid sequence encoding EOrf6 (or a functional variant thereof), the nucleic acid sequence encoding VARNA (or a functional variant thereof), the nucleic acid sequence encoding VP1 (or a functional variant thereof), the nucleic acid sequence encoding VP2 (or a functional variant thereof), the nucleic acid sequence encoding VP3 (or a functional variant thereof), and the nucleic acid sequence encoding AAP (or a functional variant thereof) are each operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-3. In some embodiments, the engineered cell comprises at least two chemically inducible promoters. In some embodiments, two or more of the at least two chemically inducible promoters are distinct.
[0268] In some embodiments, the kit comprises a polynucleic acid comprising a nucleic acid sequence of a transcriptional activator operably linked to a nucleic acid sequence of a promoter (constitutive or inducible as described herein), where the transcriptional activator binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer, and optionally the engineered cell comprises a polynucleic acid comprising a nucleic acid sequence of the transcriptional activator. In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10-16.
[0269] In some embodiments, the kit comprises a polynucleic acid comprising a nucleic acid sequence of a transcriptional activator operably linked to a nucleic acid sequence of a promoter (constitutive or inducible as described herein), where the transcriptional activator binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer, and optionally the engineered cell comprises a polynucleic acid comprising a nucleic acid sequence of the transcriptional activator. In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10-12.
[0270] In some embodiments, the kit comprises a small molecule inducer corresponding to the chemically inducible promoter of lentiviral vector production. In some embodiments, the small molecule inducer is tetracycline, doxycycline, coumarate, ABA, CRY2-CIB1, DAPG, mifepristone, lactose, or arabinose. In some embodiments, the kit comprises tetracycline or doxycycline.
[0271] B. Second Exemplary Kit In some embodiments, the kit comprises an engineered cell comprising one or more stably integrated polynucleic acids collectively comprising a nucleic acid sequence encoding each of the following: UL5 (or a functional variant thereof); UL8 (or a functional variant thereof); UL29 (or a functional variant thereof); UL30 (or a functional variant thereof); UL42 (or a functional variant thereof); and UL52 (or a functional variant thereof); at least one of which is operably linked to a chemically inducible promoter (as described herein). In some embodiments, the one or more stably integrated polynucleic acids further encode (collectively) the following: ICP0 (or a functional variant thereof); UL12 (or a functional variant thereof); ICP4 (or a functional variant thereof); and ICP22 (or a functional variant thereof). In some embodiments, the sequences encoding ICP0 (or a functional variant thereof); UL12 (or a functional variant thereof); ICP4 (or a functional variant thereof); and / or ICP22 (or a functional variant thereof) are operably linked to a chemically inducible promoter.
[0272] In some embodiments, the kit further comprises a transfer polynucleic acid molecule comprising, from 5' to 3': (i) a nucleic acid sequence of a 5' AAV inverted tandem repeat (ITR); (ii) a multiple cloning site; and (iii) a nucleic acid sequence of a 3' AAV inverted tandem repeat (ITR). In some embodiments, the transfer polynucleic acid is a plasmid or a vector.
[0273] In some embodiments, the kit further comprises a small molecule inducer that corresponds to a chemically inducible promoter of the engineered cell.
[0274] In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of UL5 (or a functional variant thereof), UL8 (or a functional variant thereof), UL29 (or a functional variant thereof), UL30 (or a functional variant thereof), UL42 (or a functional variant thereof), and UL52 (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding UL5 (or a functional variant thereof), the nucleic acid sequence encoding UL8 (or a functional variant thereof), the nucleic acid sequence encoding UL29 (or a functional variant thereof), the nucleic acid sequence encoding UL30 (or a functional variant thereof), the nucleic acid sequence encoding UL42 (or a functional variant thereof), the nucleic acid sequence encoding UL52 (or a functional variant thereof), the nucleic acid sequence encoding ICP0 (or a functional variant thereof), the nucleic acid sequence encoding UL12 (or a functional variant thereof), the nucleic acid sequence encoding ICP4 (or a functional variant thereof), and the nucleic acid sequence encoding ICP22 (or a functional variant thereof) are each operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the engineered cell comprises at least two chemically inducible promoters. In some embodiments, two or more of the at least two chemically inducible promoters are separate.
[0275] In some embodiments, the kit comprises a polynucleic acid comprising a nucleic acid sequence of a transcriptional activator operably linked to a nucleic acid sequence of a promoter (constitutive or inducible as described herein), where the transcriptional activator binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer, and optionally the engineered cell comprises a polynucleic acid comprising a nucleic acid sequence of the transcriptional activator. In some embodiments, the transcriptional activator comprises an amino acid sequence of any one of SEQ ID NOs: 10-16. In some embodiments, the kit comprises the small molecule inducer doxycycline or tetracycline.
[0276] V. Method In some aspects, the disclosure relates to a method of producing an AAV vector in an engineered cell (e.g., an engineered cell described herein). In some embodiments, the method includes expressing in the engineered cell: Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof); Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); and AAP (or a functional variant thereof). In some embodiments, the method comprises expressing in the engineered cells UL5 (or a functional variant thereof), UL8 (or a functional variant thereof), UL29 (or a functional variant thereof), UL30 (or a functional variant thereof), UL42 (or a functional variant thereof), and UL52 (or a functional variant thereof). In some embodiments, the method comprises expressing in the engineered cells ICP0 (or a functional variant thereof), UL12 (or a functional variant thereof), ICP4 (or a functional variant thereof), and ICP22 (or a functional variant thereof).
[0277] In some embodiments, the engineered cells comprise one or more polynucleic acids of an inducible AAV vector production system (as described herein); one or more polynucleic acids of an inducible HSV helper system (as described herein); or both. In some embodiments, the engineered cells comprise an inducible AAV vector production system (as described herein). In some embodiments, the engineered cells comprise an inducible HSV helper system as described herein. In some embodiments, the engineered cells comprise an inducible AAV vector production system (as described herein) and an inducible HSV helper system as described herein.
[0278] Exemplary kits are provided below.
[0279] A. First Exemplary Method In some embodiments, a method of producing an AAV vector includes: (a) introducing a transfer polynucleic acid into an engineered cell that contains one or more stably integrated polynucleic acids that collectively comprise a nucleic acid sequence encoding each of Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); and AAP (or a functional variant thereof); at least one of which is operably linked to a chemically inducible promoter (as described herein); and (b) introducing into the engineered cell a small molecule inducer that corresponds to the chemically inducible promoter of the engineered cell. and contacting the engineered cell with a heterologous polynucleic acid comprising a nucleic acid sequence of a transcriptional activator operably linked to a nucleic acid sequence of a promoter (constitutive or inducible as described herein), the transcriptional activator binding to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer; and wherein (b) occurs prior to, concurrently with, or subsequent to (a).
[0280] In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of the following: Rep52 (or a functional variant thereof), Rep40 (or a functional variant thereof), Rep78 (or a functional variant thereof), Rep68 (or a functional variant thereof), E2A (or a functional variant thereof), E4Orf6 (or a functional variant thereof), VARNA (or a functional variant thereof), VP1 (or a functional variant thereof), VP2 (or a functional variant thereof), VP3 (or a functional variant thereof), and AAP (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof), the nucleic acid sequence encoding Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof), the nucleic acid sequence encoding E2A (or a functional variant thereof), the nucleic acid sequence encoding EOrf6 (or a functional variant thereof), the nucleic acid sequence encoding VARNA (or a functional variant thereof), the nucleic acid sequence encoding VP1 (or a functional variant thereof), the nucleic acid sequence encoding VP2 (or a functional variant thereof), the nucleic acid sequence encoding VP3 (or a functional variant thereof), and the nucleic acid sequence encoding AAP (or a functional variant thereof) are each operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the engineered cell comprises at least two chemically inducible promoters. In some embodiments, two or more of the at least two chemically inducible promoters are distinct.
[0281] In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10 to 16. In some embodiments, the small molecule inducer is doxycycline, tetracycline, DAPG, coumarate, lactose, or arabinose.
[0282] In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-3 operably linked to a nucleic acid sequence encoding at least one of the following: Rep52 (or a functional variant thereof), Rep40 (or a functional variant thereof), Rep78 (or a functional variant thereof), Rep68 (or a functional variant thereof), E2A (or a functional variant thereof), E4Orf6 (or a functional variant thereof), VARNA (or a functional variant thereof), VP1 (or a functional variant thereof), VP2 (or a functional variant thereof), VP3 (or a functional variant thereof), and AAP (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof), the nucleic acid sequence encoding Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof), the nucleic acid sequence encoding E2A (or a functional variant thereof), the nucleic acid sequence encoding EOrf6 (or a functional variant thereof), the nucleic acid sequence encoding VARNA (or a functional variant thereof), the nucleic acid sequence encoding VP1 (or a functional variant thereof), the nucleic acid sequence encoding VP2 (or a functional variant thereof), the nucleic acid sequence encoding VP3 (or a functional variant thereof), and the nucleic acid sequence encoding AAP (or a functional variant thereof) are each operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-3. In some embodiments, the engineered cell comprises at least two chemically inducible promoters. In some embodiments, two or more of the at least two chemically inducible promoters are distinct.
[0283] In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10 to 12. In some embodiments, the small molecule inducer is doxycycline or tetracycline.
[0284] B. Second Exemplary Method In some embodiments, a method of producing an AAV vector includes: (a) introducing a transfer polynucleic acid into an engineered cell that contains one or more stably integrated polynucleic acids that collectively comprise a nucleic acid sequence encoding each of UL5 (or a functional variant thereof); UL8 (or a functional variant thereof); UL29 (or a functional variant thereof); UL30 (or a functional variant thereof); UL42 (or a functional variant thereof); and UL52 (or a functional variant thereof); at least one of which is operably linked to a chemically inducible promoter; and (b) introducing into the engineered cell a subunit corresponding to the chemically inducible promoter of the engineered cell. and contacting the engineered cell with a small molecule inducer, thereby inducing expression of UL5 (or a functional variant thereof), UL8 (or a functional variant thereof), UL29 (or a functional variant thereof), UL30 (or a functional variant thereof), UL42 (or a functional variant thereof), and UL52 (or a functional variant thereof); wherein the engineered cell comprises a heterologous polynucleic acid comprising a nucleic acid sequence of a transcriptional activator operably linked to a nucleic acid sequence of a promoter, the transcriptional activator binding to the chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer; wherein (b) occurs prior to, simultaneously with, or after (a). In some embodiments, one or more stably integrated polynucleic acids of the engineered cell further comprise a nucleic acid sequence encoding ICP0 (or a functional variant thereof), UL12 (or a functional variant thereof), ICP4 (or a functional variant thereof), and / or ICP22 (or a functional variant thereof).
[0285] In some embodiments, the engineered cells comprise one or more polynucleic acids that collectively comprise a nucleic acid sequence encoding each of the following: Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); and AAP (or a functional variant thereof).
[0286] In some embodiments, the engineered cells comprise one or more stably integrated polynucleic acids that collectively comprise a nucleic acid sequence encoding each of the following: Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6; VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); and AAP (or a functional variant thereof).
[0287] In some embodiments, the method further comprises introducing one or more polynucleic acids collectively comprising a nucleic acid sequence encoding each of the following: (c) Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof); Rep78 (or a functional variant thereof) or Rep68 (or a functional variant thereof); E2A (or a functional variant thereof); E4Orf6 (or a functional variant thereof); VARNA (or a functional variant thereof); VP1 (or a functional variant thereof); VP2 (or a functional variant thereof); VP3 (or a functional variant thereof); and AAP (or a functional variant thereof); wherein (c) occurs prior to, concurrently with, or after (a) or (b).
[0288] In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of the following: UL5 (or a functional variant thereof), UL8 (or a functional variant thereof), UL29 (or a functional variant thereof), UL30 (or a functional variant thereof), UL42 (or a functional variant thereof), UL52 (or a functional variant thereof), ICP0 (or a functional variant thereof), UL12 (or a functional variant thereof), ICP4 (or a functional variant thereof), and ICP22 (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof), the nucleic acid sequence encoding UL5 (or a functional variant thereof), the nucleic acid sequence encoding UL8 (or a functional variant thereof), the nucleic acid sequence encoding UL29 (or a functional variant thereof), the nucleic acid sequence encoding UL30 (or a functional variant thereof), the nucleic acid sequence encoding UL42 (or a functional variant thereof), the nucleic acid sequence encoding UL52 (or a functional variant thereof), the nucleic acid sequence encoding ICP0 (or a functional variant thereof), the nucleic acid sequence encoding UL12 (or a functional variant thereof), the nucleic acid sequence encoding ICP4 (or a functional variant thereof), and the nucleic acid sequence encoding ICP22 (or a functional variant thereof) are each operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9. In some embodiments, the engineered cell comprises at least two chemically inducible promoters. In some embodiments, two or more of the at least two chemically inducible promoters are separate.
[0289] In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10 to 16. In some embodiments, the small molecule inducer is doxycycline, tetracycline, coumarate, lactose, or arabinose.
[0290] In some embodiments, the engineered cells comprise a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-3 operably linked to a nucleic acid sequence encoding at least one of the following: UL5 (or a functional variant thereof), UL8 (or a functional variant thereof), UL29 (or a functional variant thereof), UL30 (or a functional variant thereof), UL42 (or a functional variant thereof), UL52 (or a functional variant thereof), ICP0 (or a functional variant thereof), UL12 (or a functional variant thereof), ICP4 (or a functional variant thereof), and ICP22 (or a functional variant thereof). In some embodiments, the nucleic acid sequence encoding Rep52 (or a functional variant thereof) or Rep40 (or a functional variant thereof), the nucleic acid sequence encoding UL5 (or a functional variant thereof), the nucleic acid sequence encoding UL8 (or a functional variant thereof), the nucleic acid sequence encoding UL29 (or a functional variant thereof), the nucleic acid sequence encoding UL30 (or a functional variant thereof), the nucleic acid sequence encoding UL42 (or a functional variant thereof), the nucleic acid sequence encoding UL52 (or a functional variant thereof), the nucleic acid sequence encoding ICP0 (or a functional variant thereof), the nucleic acid sequence encoding UL12 (or a functional variant thereof), the nucleic acid sequence encoding ICP4 (or a functional variant thereof), and the nucleic acid sequence encoding ICP22 (or a functional variant thereof) are each operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-3. In some embodiments, the engineered cell comprises at least two chemically inducible promoters. In some embodiments, two or more of the at least two chemically inducible promoters are separate.
[0291] In some embodiments, the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10 to 12. In some embodiments, the small molecule inducer is doxycycline or tetracycline.
[0292] example Example 1. Inducible control of AAV vector production This approach uses small molecule inducers to control the transcription of genes required for AAV production, including cytostatic or cytotoxic Rep, E2A, E4orf6. The following design is based on the use of doxycycline (Figures 1-2, Tables 1-3). In the absence of doxycycline, any expression of genes required for AAV production is minimal, which minimizes the cellular stress and toxicity associated with AAV production. This results in the ability to generate stable AAV-producing cell lines.
[0293] The plasmids were designed to remove or minimize the native promoter elements to eliminate unregulated expression from Rep, Cap, E2A, and E4orf6. Further modifications include linking Rep52 / 68 40 to Rep78 / and E2A to E4orf6 with attenuated IRES sequences to minimize undesired basal expression from multiple transcription units and provide the correct stoichiometry of Rep52 / 40:Rep78 / 68 and E2A:E4orf6, respectively.
[0294] Adherent HEK293FT cells were co-transfected with EGFP-expressing transfer plasmid, pRepCap, and pHelper. Inducible variants of pRep, pCap, and pHelper were tested for their ability to replace the "wild-type" plasmid and produce AAV via doxycycline induction. Doxycycline was added at the time of transfection. Control samples were also prepared containing only the "wild-type" AAV2 pRepCap and pHelper plasmids or a negative control transfection mix with no DNA. 72 hours after transfection, AAV was harvested by three freeze-thaw cycles in a dry ice isopropanol bath. The virus stock was serially diluted 1x, 10x, and 100x, and 10μL of the resulting virus stock was transduced by addition to 5e4 HEK293FT cells seeded in a 96-well plate. Seventy-two hours after transduction, transduced cells were harvested and the percentage of EGFP-positive cells was determined by flow cytometry and used to calculate transducing units per mL (TU / mL).
[0295] The results are shown in Figure 3. The presence of AAV particles in the non-induced samples may be due to leakage of the TRE3G system in a transient format. The inducible pRep, pHelper, and pCap genes can be integrated into various HEK293 and HeLa cell lines, and the resulting packaging cell lines can be characterized for their inducibility and AAV productivity.
[0296] Example 2. Refactored AAV. The current system of AAV production relies on DNA sequences that encompass all regulatory elements and splice variants of the Rep, Cap, and helper genes. Minimizing this system to the essential genes for AAV production provides more control and a higher probability of establishing stable producer cell lines. The essential genes for AAV production are the large Rep78, small Rep52, E2A, E4orf6, and Cap genes. It was hypothesized that expressing only the essential Rep, Cap, and helper genes in a context other than their native architecture would provide better control over gene expression (Figure 4, Tables 1-3). This enhanced control would more tightly regulate the expression of the cytotoxic Rep and helper proteins and improve cell health and increase the likelihood of generating stable packaging cell lines.
[0297] Example 3. HSV helper system-induced AAV. Herpesviruses can be used as helper viruses to produce adeno-associated viruses (AAV). The HSV replication genes UL5, UL8, UL9, UL29, UL30, UL42, and UL52 are the only HSV factors required for productive AAV replication. Currently, infection is used for HSV-based AAV production, and integration of these genes would eliminate the need for viruses. It was hypothesized that inducible expression of these genes would provide the proteins necessary to produce AAV in stable cell lines providing an alternative platform for AAV manufacturing (Figure 5, Tables 1-3). Advantages of this platform may include higher packaging efficiency and higher yields compared to adenovirus-based systems.
[0298] Adherent HEK293T cells were co-transfected with an EGFP-expressing transfer plasmid, pRepCap, and pHelper. Inducible variants of pRep, pCap, and pHelper were replaced with the "wild-type" plasmid to determine their ability to produce AAV upon doxycycline induction. The pHelper inducible variant was replaced with HSV doxycycline, where HSV doxycycline was added at the time of transfection. Control samples were also prepared containing only the "wild-type" AAV2 pRepCap and pHelper plasmids, or a negative control transfection mix with no DNA. 72 hours after transfection, AAV was harvested by three freeze-thaw cycles in a dry ice isopropanol bath. Viral stocks were treated with DNAse and proteinase to release genomes from packaged AAV. Lysed samples were serially diluted 1.0e5 and 1e6 fold, genome copy numbers were determined by ddPCR using a sequence-specific probe against the GFP gene within packaged AAV particles, and results were calculated as viral genomes / mL (vg / mL).
[0299] The results are shown in Figure 6. Inclusion of an HSV-based helper system resulted in inducible AAV production, as indicated by increased levels of AAV in the presence of doxycycline. The presence of AAV particles in the non-induced samples may be due to leakage of the TRE3G system in a transient format. The inducible pRep, HSV, and pCap genes were integrated into various HEK293 and HeLa cell lines, and the resulting packaging cell lines were characterized for their inducibility and AAV productivity.
[0300] [Table 1]
[0301] [Table 2]
[0302] [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8] [Table 3-9] [Table 3-10] [Table 3-11] [Table 3-12]
[0303] Other Aspects All features disclosed in this specification may be combined in any combination. Each feature disclosed in this specification may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features.
[0304] From the above description, those skilled in the art can easily ascertain the essential features of the present disclosure, and can make various changes and modifications to the present disclosure to adapt it to various applications and conditions without departing from the spirit and scope thereof. Accordingly, other embodiments are also within the scope of the claims.
[0305] Equivalent Although several inventive embodiments have been described and illustrated herein, those skilled in the art will readily envision various other means and / or structures for performing the functions and / or results and / or obtaining one or more advantages described herein, and each such variation and / or modification is deemed to be within the scope of the inventive embodiments described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the particular application(s) for which the teachings of the present invention are used. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific inventive embodiments described herein. Thus, it will be understood that the foregoing embodiments are presented by way of example only, and that within the scope of the appended claims and their equivalents, the inventive embodiments may be practiced otherwise than as specifically described and claimed. The inventive aspects of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods is encompassed within the inventive scope of the present disclosure, if such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent.
[0306] All definitions and those used herein should be understood to control for any dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.
[0307] All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which may in some cases cover the entire document.
[0308] As used herein and in the claims, the indefinite articles "a" and "an" should be understood to mean "at least one," unless clearly indicated otherwise.
[0309] As used herein and in the claims, the term "and / or" should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctive in some cases and disjunctive in other cases. Multiple elements listed with "and / or" should be interpreted in the same manner, i.e., "one or more" of the elements so conjoined. Other elements may optionally be present other than the elements specifically identified by the "and / or" clause, whether related to the elements specifically identified or not. Thus, as a non-limiting example, a reference to "A and / or B", when used in combination with open-ended language such as "comprising", can refer in one embodiment to A only (optionally including elements other than B); in another embodiment to B only (optionally including elements other than A); in yet another embodiment to both A and B (optionally including other elements), etc.
[0310] As used herein and in the claims, "or" should be understood to have the same meaning as "and / or" defined above. For example, when separating items in a list, "or" or "and / or" should be interpreted as inclusive, i.e., including at least one of, but also including more than one, and optionally including additional unlisted items, of a number or list of elements. Only terms clearly indicated to the contrary, such as "only one of" or "exactly one of," or, when used in the claims, "consisting of," refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or" as used herein, when used in the claims, when preceded by terms of exclusivity, such as "either," "one of," "only one of," "exactly one of," "consisting essentially of," etc., shall be interpreted only as indicating exclusive alternatives (i.e., "one or the other but not both") and shall have its ordinary meaning as used in the field of patent law.
[0311] As used herein and in the claims, the phrase "at least one" in reference to a list of one or more elements means at least one element selected from any one or more of the elements in the list of elements, but it should be understood that it does not necessarily include at least one of each and every element specifically listed in the list of elements, and does not exclude any combination of elements in the list of elements. This definition also allows for the optional presence of elements other than those specifically identified in the list of elements to which the phrase "at least one" refers, whether or not related to the specifically identified elements. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B" or, equivalently, "at least one of A and / or B") can refer in one embodiment to at least one, optionally inclusive of more than one, A, with B being absent (and optionally including elements other than B); in another embodiment to at least one, optionally inclusive of more than one, B, with A being absent (and optionally including elements other than A); in yet another embodiment to at least one, optionally inclusive of more than one, A, and at least one, optionally inclusive of more than one, B (optionally including other elements), etc.
[0312] It should also be understood that, unless expressly indicated otherwise, in any method claimed herein that includes two or more steps or actions, the order of the method steps or actions is not necessarily limited to the order in which the method steps or actions are recited.
[0313] In the claims and the above specification, all transitional phrases such as "comprising," "including," "carrying," "having," "containing," "involving," "holding," "composed of," and the like, are to be understood to be open-ended, i.e., meaning inclusive but not exclusive. Only the transitional phrases "consisting of" and "consisting essentially of" are intended to be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03. It is to be understood that embodiments described herein with open-ended transitional phrases (e.g., "comprising") are also contemplated in alternative embodiments as "consisting of" and "consisting essentially of" the features recited by the open-ended transitional phrase. For example, if the disclosure describes "a composition comprising A and B," the disclosure also contemplates the alternative embodiments "a composition consisting of A and B" and "a composition consisting essentially of A and B."
Claims
1. An engineered cell for producing adeno-associated virus (AAV), comprising one or more stably integrated polynucleic acids collectively comprising nucleic acid sequences encoding each of Rep52; Rep78; E2A; E4Orf6; VP1; VP2; VP3; and AAP, each of which is operably linked to a chemically inducible promoter.
2. The engineered cell of claim 1, comprising a nucleic acid sequence encoding a VA RNA operably linked to a chemically inducible promoter.
3. the nucleic acid sequence encoding Rep78 lacks the Rep52 start codon and the Rep68 / 40 splice site; and / or the nucleic acid sequence encoding Rep52 lacks a Rep40 splice site; and / or the nucleic acid sequence encoding Rep52 and the nucleic acid sequence encoding Rep78 are separate nucleic acid sequences; and / or The engineered cells do not contain a nucleic acid sequence encoding Rep40 or a nucleic acid sequence encoding Rep68.
2. The engineered cell of claim 1.
4. the engineered cell comprises a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of Rep52, Rep78, E2A, E4Orf6, VARNA, VP1, VP2, VP3, and AAP; and / or the engineered cell comprises at least two chemically inducible promoters, wherein two or more of the at least two chemically inducible promoters comprise the same nucleic acid sequence, optionally wherein each of the at least two chemically inducible promoters comprises the same nucleic acid sequence; 2. The engineered cell of claim 1.
5. the engineered cell comprises a nucleic acid sequence encoding Rep52 operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9, optionally wherein Rep52 comprises the amino acid sequence of SEQ ID NO: 18; and / or the engineered cell comprises a nucleic acid sequence encoding Rep78 operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9, optionally wherein Rep78 comprises the amino acid sequence of any one of SEQ ID NOs: 21 or 22; and / or the engineered cell comprises a nucleic acid sequence encoding E2A operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9, optionally wherein E2A comprises the amino acid sequence of SEQ ID NO: 29; and / or the engineered cell comprises a nucleic acid sequence encoding E4Orf6 operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9, optionally wherein E4Orf6 comprises the amino acid sequence of SEQ ID NO: 35; and / or the engineered cell comprises a nucleic acid sequence encoding a VA RNA operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9, optionally wherein the VA RNA comprises the nucleic acid sequence of SEQ ID NO: 38; and / or the engineered cell comprises a nucleic acid sequence encoding VP1 operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9, optionally wherein VP1 comprises the amino acid sequence of any one of SEQ ID NOs: 30 or 31; and / or the engineered cell comprises a nucleic acid sequence encoding VP2 operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9, optionally wherein VP2 comprises the amino acid sequence of SEQ ID NO: 33; and / or the engineered cell comprises a nucleic acid sequence encoding VP3 operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9, optionally wherein VP3 comprises the amino acid sequence of SEQ ID NO: 34; and / or the engineered cell comprises a nucleic acid sequence encoding an AAP operably linked to a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs: 1-9, optionally wherein the AAP comprises the amino acid sequence of SEQ ID NO: 37; 2. The engineered cell of claim 1.
6. 2. The engineered cell of claim 1, wherein the engineered cell comprises a first stably integrated polynucleic acid, wherein the first stably integrated polynucleic acid comprises a nucleic acid sequence encoding Rep52 and a nucleic acid sequence encoding Rep78.
7. a nucleic acid sequence encoding Rep52 and a nucleic acid sequence encoding Rep78, each operably linked to a first chemically inducible promoter, optionally wherein the first chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9; and / or the first stably integrated polynucleic acid further comprises a nucleic acid sequence encoding an internal ribosome entry site (IRES), optionally wherein the nucleic acid sequence encoding the IRES separates the nucleic acid sequence encoding Rep52 and the nucleic acid sequence encoding Rep78; and / or the first stably integrated polynucleic acid further comprises a selectable marker operably linked to the promoter; The engineered cell of claim 6.
8. the engineered cell comprises a second stably integrated polynucleic acid, wherein the second stably integrated polynucleic acid comprises nucleic acid sequences encoding E2A, E4Orf6, and VARNA, optionally wherein the nucleic acid sequences encoding E2A, E4Orf6, and VARNA are each operably linked to a second chemically inducible promoter, further optionally wherein the second chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9; and / or the second stably integrated polynucleic acid further comprises a nucleic acid sequence encoding an IRES, optionally wherein the nucleic acid sequence encoding the IRES separates the nucleic acid sequence encoding E2A and the nucleic acid sequence encoding E4Orf6; and / or the second stably integrated polynucleic acid further comprises a selectable marker operably linked to the promoter; 2. The engineered cell of claim 1.
9. the engineered cell comprises a third stably integrated polynucleic acid, wherein the third stably integrated polynucleic acid comprises a nucleic acid sequence encoding VP1, VP2, VP3, and AAP; optionally, wherein the third stably integrated polynucleic acid further comprises a selectable marker operably linked to a promoter, and / or optionally, wherein the nucleic acid sequences encoding VP1, VP2, VP3, and AAP are each operably linked to a third chemically inducible promoter; further optionally, wherein the third chemically inducible promoter comprises one or more nucleic acid sequences of SEQ ID NOs: 1-9; and / or further comprising a fourth stably integrated polynucleic acid, wherein the fourth stably integrated polynucleic acid comprises a nucleic acid sequence encoding a transcriptional activator that binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer; optionally, wherein the transcriptional activator comprises an amino acid sequence set forth in any one of SEQ ID NOs: 10-16, and / or optionally, wherein the fourth stably integrated polynucleic acid further comprises a selectable marker operably linked to the promoter; and / or The engineered cells further comprise a stable landing pad; and / or The engineered cells are derived from HEK293 cells, HeLa cells, BHK cells, or Sf9 cells; 2. The engineered cell of claim 1.
10. The engineered cell of claim 1, comprising one or more stably integrated polynucleic acids collectively comprising nucleic acid sequences encoding each of UL5; UL8; UL29; UL30; UL42; UL52; UL12; ICP0; ICP4; and ICP22, each of which is operably linked to a chemically inducible promoter.
11. A kit comprising the engineered cells of any one of claims 1 to 10.
12. and / or a transfer polynucleic acid molecule comprising, from 5' to 3': (i) a nucleic acid sequence of a 5' AAV inverted tandem repeat (ITR); (ii) a multiple cloning site; and (iii) a nucleic acid sequence of a 3' AAV inverted tandem repeat (ITR), optionally wherein the transfer polynucleic acid is a plasmid or vector; and / or the kit further comprises a small molecule inducer corresponding to the chemically inducible promoter of the engineered cell; and / or the engineered cell comprises a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of Rep52, Rep78, E2A, E4Orf6, VARNA, VP1, VP2, VP3, and AAP; and / or a nucleic acid sequence encoding Rep52, a nucleic acid sequence encoding Rep78, a nucleic acid sequence encoding E2A, a nucleic acid sequence encoding EOrf6, a nucleic acid sequence encoding VARNA, a nucleic acid sequence encoding VP1, a nucleic acid sequence encoding VP2, a nucleic acid sequence encoding Vp3, and a nucleic acid sequence encoding AAP are each operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9, optionally wherein the engineered cell comprises at least two chemically inducible promoters, further optionally wherein two or more of the at least two chemically inducible promoters are distinct; and / or the kit comprises a polynucleic acid comprising a nucleic acid sequence of a transcriptional activator operably linked to a nucleic acid sequence of a promoter, wherein the transcriptional activator binds to a chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer, optionally wherein the engineered cell comprises a polynucleic acid comprising a nucleic acid sequence of a transcriptional activator; optionally wherein the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOS: 10-12, and / or optionally wherein the kit comprises the small molecule inducer doxycycline or tetracycline. The kit of claim 11.
13. 1. A method for producing an AAV vector, comprising: (a) introducing a transfection polynucleic acid into an engineered cell according to any one of claims 1 to 10; (b) contacting the engineered cells with a small molecule inducer corresponding to a chemically inducible promoter of the engineered cells, thereby inducing expression of Rep52; Rep78; E2A; E4Orf6; VP1; VP2; VP3; and AAP; Including, wherein the engineered cell comprises a heterologous polynucleic acid comprising a nucleic acid sequence of a transcriptional activator operably linked to a nucleic acid sequence of a promoter, wherein the transcriptional activator binds to the chemically inducible promoter of the engineered cell when expressed in the presence of a small molecule inducer; where (b) occurs before, simultaneously with, or after (a); The method.
14. The method of claim 13, wherein in (b), the engineered cells comprise a nucleic acid sequence encoding a VA RNA operably linked to a chemically inducible promoter.
15. the engineered cell comprises a chemically inducible promoter comprising one or more nucleic acid sequences of SEQ ID NOs: 1-9 operably linked to a nucleic acid sequence encoding at least one of Rep52, Rep78, E2A, E4Orf6, VARNA, VP1, VP2, VP3, and AAP; and / or a nucleic acid sequence encoding Rep52, a nucleic acid sequence encoding Rep78, a nucleic acid sequence encoding E2A, a nucleic acid sequence encoding EOrf6, a nucleic acid sequence encoding VARNA, a nucleic acid sequence encoding VP1, a nucleic acid sequence encoding VP2, a nucleic acid sequence encoding VP3, and a nucleic acid sequence encoding AAP are each operably linked to a chemically inducible promoter comprising one or more of the nucleic acid sequences of SEQ ID NOs: 1-9, optionally wherein the engineered cell comprises at least two chemically inducible promoters, further optionally wherein two or more of the at least two chemically inducible promoters are distinct; and / or the transcriptional activator comprises the amino acid sequence of any one of SEQ ID NOs: 10-12; and / or the small molecule inducer is doxycycline or tetracycline; The method of claim 13.