siRNA and complexes targeting LPA

JP2024545222A5Pending Publication Date: 2025-12-26TUOJIE BIOTECH (SHANGHAI) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024535521
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-12-16
Filing Date
2022-12-16
Publication Date
2025-12-26

AI Technical Summary

Technical Problem

Current therapies lack effective methods to target and reduce lipoprotein(a) levels, which are associated with increased risk of cardiovascular events, as traditional drugs struggle to specifically address this lipid particle due to its structural similarity with other lipoproteins.

Method used

Development of siRNAs that target the apolipoprotein(a) gene (LPA) to suppress its expression, thereby reducing lipoprotein(a) levels and mitigating cardiovascular risk.

Benefits of technology

The siRNAs effectively lower lipoprotein(a) levels, potentially reducing the risk of cardiovascular diseases by inhibiting its expression at the genetic level.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2023109940000001
    Figure 2023109940000001
  • Figure 2023109940000002
    Figure 2023109940000002
  • Figure 2023109940000003
    Figure 2023109940000003
Patent Text Reader

Abstract

The present invention relates to siRNAs and complexes targeting LPA, in particular to siRNAs, siRNA complexes, compositions targeting LPA and their pharmaceutical uses, as well as to pharmaceutical compositions, cells or reagent kits containing said siRNAs, and methods of using said siRNAs and siRNA complexes for the treatment and / or prevention of subjects suffering from related disorders.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] This disclosure claims priority to Chinese patent application No. 202111545699.6, filed on December 16, 2021, the entire text of which is incorporated herein by reference.

[0002] The present disclosure belongs to the biopharmaceutical field, and specifically relates to siRNA, complexes, compositions, and pharmaceutical uses thereof that suppress the expression of the apolipoprotein(a) gene (Apo(a) gene, LPA). [Background technology]

[0003] Lipoprotein (a) [Lp(a)], first discovered by Norwegian geneticist Berg in 1963, is identified as a unique lipoprotein (Berg KA new serum type system in man-the Lp system.Acta Pathol Microbiol Scand 1963, 59:369-82.). [Lp(a) is composed of two parts: a lipid part that is an LDL-like particle located mainly in the core region, and a protein part located in the periphery, in which apolipoprotein (a) [apo(a)] and apoB100 are linked by disulfide bonds. Apo(a) is expressed mainly in the liver, and its expression is limited to humans and non-human primates, and it is characterized by the presence of three domains (Kringle) of a tricyclic structure stabilized by internal disulfide bonds. In the human lineage, the amplification and differentiation of Kringle IV domains in apo(a) has resulted in 10 different types of KIV domains, among which further amplification of Kringle IV type 2 (KIV-2) has resulted in multiallelic (1-40 copies) intracellular copy number variation (CNV), while the other Kringle IV-encoded domains (KIV-1 and KIV-3-KIV-10) are present only as single copies (Schmidt K, Noureen A, Kronenberg F, et al. Structure, Function, and Genetics of Lipoprotein(a)[J]. Journal of Lipid Research, 2016, 57(8):1339.). Since all Kringles are transcribed and translated, KIV-2 CNVs result in size polymorphism of the encoded apo(a), the expression of which is inversely proportional to the number of KIV-2 domains present, and the content of Lp(a) in plasma is significantly increased when the KIV-2 copy number is relatively low.

[0004] Patients with elevated Lp(a) have a 2-3 times higher risk of cardiovascular events than the normal population, leading to atherosclerotic cardiovascular disease, lower limb arterial disease, aortic valve stenosis, etc. (EnAs EA, Varkey B, Dharmarajan TS, et al. Lipoprotein(a): An independent, genetic, and causal factor for cardiovascular disease and acute myocardial infarction[J]. Indian Heart Journal, 2019, 71(2).). Lp(a) can lead to poor atherosclerotic cardiovascular disease (ASCVD) through two mechanisms: on the one hand, it can promote thrombus formation in plaque rupture or turbulence in vascular stenosis, resulting in vascular occlusion, or promote thrombus formation, since apo(a) has been confirmed to inhibit fibrinolysis in vitro, and on the other hand, LDL-like particles can promote intimal cholesterol deposition, inflammation or oxidized phospholipids, resulting in atherosclerotic stenosis or aortic valve stenosis (Albert Youngwoo Jang, Seung Hwan Han, Il Suk Sohn, et al. Lipoprotein(a) and Cardiovascular Diseases[J]. Circulation Journal, 2020, 84:867-874). However, even if Lp(a) is at a very high level, its cholesterol content is lower than the conventional LDL limit, so the pathogenicity of the LDL-like particle portion may be relatively low.

[0005] In 2016, the Chinese Guidelines for Prevention and Treatment of Adult Blood Dyslipidemia defined Lp(a) abnormality as >30 mg / dl, and based on this, approximately 30% of patients with past cardiovascular events in China have Lp(a) abnormality. In 2019, the American Lipid Association recommended that Lp(a) ≥ 50 mg / dl is an elevated level, and based on this, 20% of the world's population has elevated Lp(a) levels. Although elevated Lp(a) levels are common, there are no targeted therapeutic drugs, and no drugs targeting Lp(a) reduction have been approved for clinical use to date. Lp(a) protein is structurally similar to many lipoproteins and is difficult to directly target with small and large molecule drugs, but mRNA transcribed from the Lp(a) gene has a high degree of exclusivity in that it can specifically degrade the mRNA through siRNA post-transcriptional control mechanisms and further suppress Lp(a) expression. Therefore, siRNAs targeting the apo(a) gene (LPA) have been designed to attenuate its expression, thereby reducing serum Lp(a) levels and further reducing adverse cardiovascular events. Summary of the Invention

[0006] The present disclosure provides siRNAs targeting LPA.

[0007] In some embodiments, the present disclosure provides siRNAs comprising a sense strand and an antisense strand that form a double-stranded region.

[0008] The sense strand comprises a sequence that differs from any one of SEQ ID NO:1 or SEQ ID NO:2 by 3 or less (e.g., 0, 1, 2, 3) nucleotides and at least 15 (e.g., 16, 17, 18, 19, 20, 21) consecutive nucleotides; The antisense strand comprises a sequence that differs from the nucleotide sequence of any one of SEQ ID NO: 3 or SEQ ID NO: 4 by three or fewer nucleotides (e.g., 0, 1, 2, or 3), and comprises at least 15 (e.g., 16, 17, 18, 19, 20, or 21) consecutive nucleotides.

[0009] In some embodiments, antisense strand is at least partially reverse-complementary to target sequence to mediate RNA interference.In some embodiments, there are 5 or less, 4 or less, 3 or less, 2 or less, or 1 or less mismatches between antisense strand and target sequence.In some embodiments, antisense strand is completely reverse-complementary to target sequence.

[0010] In some embodiments, the sense strand is at least partially reverse-complementary to the antisense strand to form a double-stranded region.In some embodiments, there are 5 or less, 4 or less, 3 or less, 2 or less, or 1 or less mismatches between the sense strand and the antisense strand.In some embodiments, the sense strand is completely reverse-complementary to the antisense strand.

[0011] In some embodiments, the siRNA of the present disclosure comprises one or two blunt ends.

[0012] In some specific embodiments, each strand of the siRNA independently comprises an overhang having 1 to 2 unpaired nucleotides.

[0013] In some embodiments, the siRNA of the present disclosure comprises an overhang located at the 3' end of the siRNA antisense strand.

[0014] In some embodiments, the sense strand and the antisense strand each independently have 16-35, 16-34, 17-34, 17-33, 18-33, 18-32, 18-31, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 19-25, 19-24, or 19-23 nucleotides (e.g., 19, 20, 21, 22, 23 nucleotides).

[0015] In some embodiments, the lengths of the sense strand and the antisense strand are the same or different, the sense strand being 19-23 nucleotides in length and the antisense strand being 19-26 nucleotides in length. The length ratio of the sense strand to the antisense strand of the siRNA provided by the present disclosure may be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 19, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the length ratio of the sense strand to the antisense strand of the siRNA is 19 / 21, 21 / 23, or 23 / 25. In some embodiments, the length ratio of the sense strand to the antisense strand of the siRNA is 19 / 21.

[0016] In some embodiments, the sense strand comprises at least 15 contiguous nucleotides and has no more than two nucleotide differences from the nucleotide sequence of any one of SEQ ID NO: 1 or SEQ ID NO: 2. In some embodiments, there is no more than one nucleotide difference from the nucleotide sequence, and in some embodiments, there is one nucleotide difference. In some embodiments, the antisense strand comprises a sequence of at least 15 contiguous nucleotides and has no more than two nucleotide differences from the nucleotide sequence of SEQ ID NO:3 or SEQ ID NO:4, in some embodiments, no more than one nucleotide difference from the nucleotide sequence, and in some embodiments, one nucleotide difference.

[0017] In some embodiments, the sense strand comprises at least 15 contiguous nucleotides of the nucleotide sequence of any one of SEQ ID NO:1 or SEQ ID NO:2. In some embodiments, the sense strand comprises at least 16 contiguous nucleotides of the nucleotide sequence of any one of SEQ ID NO:1 or SEQ ID NO:2. In some embodiments, the sense strand comprises at least 18 contiguous nucleotides of the nucleotide sequence of any one of SEQ ID NO:1 or SEQ ID NO:2. In some embodiments, the sense strand comprises at least 19 contiguous nucleotides of the nucleotide sequence of any one of SEQ ID NO:1 or SEQ ID NO:2.

[0018] In some embodiments, the antisense strand comprises at least 15 contiguous nucleotides of the nucleotide sequence of any one of SEQ ID NO:3 or SEQ ID NO:4. In some embodiments, the antisense strand comprises at least 18 contiguous nucleotides of the nucleotide sequence of any one of SEQ ID NO:3 or SEQ ID NO:4. In some embodiments, the antisense strand comprises at least 19 contiguous nucleotides of the nucleotide sequence of any one of SEQ ID NO:3 or SEQ ID NO:4. In some embodiments, the antisense strand comprises at least 20 contiguous nucleotides of the nucleotide sequence of any one of SEQ ID NO:3 or SEQ ID NO:4. In some embodiments, the antisense strand comprises at least 21 contiguous nucleotides of the nucleotide sequence of any one of SEQ ID NO:3 or SEQ ID NO:4.

[0019] In some embodiments, the sense strand comprises a nucleotide sequence selected from SEQ ID NO:1 or SEQ ID NO:2.

[0020] In some embodiments, the antisense strand comprises a nucleotide sequence selected from SEQ ID NO:3 or SEQ ID NO:4.

[0021] In some embodiments, the siRNA described herein comprises: Group 1) consisting of the sense strand shown in SEQ ID NO: 1 and the antisense strand shown in SEQ ID NO: 3; Group 2) the sense strand shown in SEQ ID NO: 2 and the antisense strand shown in SEQ ID NO: 4; The present invention may include or be selected from any one of the following groups:

[0022] In some embodiments, the siRNA described herein comprises: Group 1), in which the sense strand is the nucleotide sequence shown in SEQ ID NO: 1 and the antisense strand is the nucleotide sequence shown in SEQ ID NO: 3; Group 2), in which the sense strand is the nucleotide sequence shown in SEQ ID NO: 2 and the antisense strand contains the nucleotide sequence shown in SEQ ID NO: 4; The present invention may include or be selected from any one of the following groups:

[0023] In the present disclosure, in the 5'-3' direction: SEQ ID NO:1 is GCUCCUUAUUGUUAUACGA, SEQ ID NO:2 is ACACCACAUCAACAUAAUA, SEQ ID NO:3 is UCGUAUAACAAUAAGGAGCUG, Sequence number 4 is UAUUAUGUUGAUGUGGUGUCA.

[0024] In some embodiments, at least one nucleotide of the sense strand and / or the antisense strand is a modified nucleotide.

[0025] In some embodiments, all nucleotides are modified nucleotides.

[0026] The present disclosure provides siRNAs comprising a sense strand and an antisense strand that form a double-stranded region.

[0027] The sense strand comprises a sequence that differs from any one of the nucleotide sequences of SEQ ID NO: 1 or SEQ ID NO: 2 by 3 or less nucleotides and comprises at least 15 consecutive nucleotides, the antisense strand comprises a sequence that differs from any one of the nucleotide sequences of SEQ ID NO: 3 or SEQ ID NO: 4 by 3 or less nucleotides and comprises at least 15 consecutive nucleotides, and at least one nucleotide at positions 2 to 8 (e.g., positions 2, 3, 4, 5, 6, 7, and 8) of the 5' region of the antisense strand comprises a 2'-methoxy modification, or a chemical modification shown in Formula (I) or a tautomer modification thereof.

[0028] Formula (I) is [ka] Selected from wherein Y is selected from O, NH and S; each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C6 alkyl group; J2 is H or a C1-C6 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; R3 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) p R6, wherein R6 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and p=1, 2 or 3; Q1 is [ka] Q2 is R2, or Q1 is R2, Q2 is [ka] and Among them, R1 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, a C2-C6 alkenyl group, a C2-C6 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and q=1, 2 or 3; J1 is H or a C1-C6 alkyl group; R2 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a ring; B is a base, Among them, the chemical modification shown in the above formula (I) or its tautomer modification is [ka] isn't it.

[0029] In some embodiments, when X is NH-CO, R1 is not H.

[0030] In some embodiments, B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0031] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0032] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0033] In some embodiments, B is the base at a position corresponding to the modified nucleotide in the antisense strand.

[0034] In some embodiments, formula (I) is selected from formula (I-1): [ka] Among them, Y is selected from O, NH and S; each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C6 alkyl group; Each J1, J2 is independently H or a C1-C6 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; R3 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) pR6, wherein R6 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and p=1, 2 or 3; R1 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, a C2-C6 alkenyl group, a C2-C6 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and q=1, 2 or 3; R2 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I).

[0035] In some embodiments of formula (I-1), B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0036] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0037] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0038] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0039] In some embodiments, formula (I) is selected from formula (I-2): [ka] Among them, Y is selected from O, NH and S; each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C6 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; Each J1, J2 is independently H or a C1-C6 alkyl group; R3 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) p R6, wherein R6 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and p=1, 2 or 3; R1 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, a C2-C6 alkenyl group, a C2-C6 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and q=1, 2 or 3; R2 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, S-CH3, NCH3(CH3), OCH2CH2OCH3, an -O-alkylamino group, and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I).

[0040] In some embodiments of formula (I-2), B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0041] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0042] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0043] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0044] In some embodiments, the chemical modification or tautomer modification thereof is [ka] isn't it.

[0045] In some embodiments, each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C3 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; Each J1 and J2 is independently H or a C1-C3 alkyl group; R3 is H, OH, halogen, NH2, C1-C3 alkyl group, C1-C3 alkoxy group, C2-C4 alkenyl group, C2-C4 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) p R6, wherein R6 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and p=1, 2 or 3; R1 is H, a C1-C3 alkyl group, a C1-C3 alkoxy group, a C2-C4 alkenyl group, a C2-C4 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C4 alkenyl and C2-C4 alkynyl, and q=1, 2 or 3; R2 is H, OH, halogen, NH2, C1-C3 alkyl group, C1-C3 alkoxy group, C2-C4 alkenyl group, C2-C4 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C4 alkenyl and C2-C4 alkynyl, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a ring.

[0046] B is as defined in formula (I).

[0047] In some embodiments, B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0048] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0049] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0050] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0051] In some embodiments, each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H, a methyl group, an ethyl group, an n-propyl group, or an isopropyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; Each of J1 and J2 is independently H or a methyl group; R3 is H, OH, F, Cl, NH2, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-methylamino, -O-ethylamino, and (CH2). pR6, wherein R6 is selected from OH, F, Cl, a methoxy group, an ethoxy group, N3, a vinyl group, an allyl group, an ethynyl group, and a propargyl group, and p=1 or 2; R1 is H, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl, or (CH2) q R7, wherein R7 is selected from OH, F, Cl, a methoxy group, an ethoxy group, N3, a vinyl group, an allyl group, an ethynyl group, and a propargyl group, and q=1 or 2; R2 is H, OH, F, Cl, NH2, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-methylamino, -O-ethylamino, and (CH2). r R8, wherein R8 is selected from OH, F, Cl, methoxy, ethoxy, N3, vinyl, allyl, ethynyl and propargyl, and r=1 or 2; Optionally, R1 and R2 are directly linked to form a ring.

[0052] B is as defined in formula (I).

[0053] In some embodiments, B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0054] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0055] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0056] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0057] B is as defined in formula (I).

[0058] In some embodiments, B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, and 3-nitropyrrole.

[0059] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0060] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0061] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0062] In some embodiments, Y is O or NH, and each X is independently selected from NH—CO, CH, and NH; n=0 or 1, m=0 or 1, s=0 or 1, Each J1 and J2 is independently H; R1 is selected from H, a methyl group, and CH2OH; R2 is selected from H, OH, NH2, a methyl group, and CH2OH; R3 is selected from H, OH, NH2, a methyl group, and CH2OH; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I).

[0063] In some embodiments, B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0064] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0065] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0066] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0067] In some embodiments, Y is O or NH, and each X is independently selected from NH—CO, CH, and NH; n=0 or 1, m=0 or 1, s=0 or 1, Each J1 and J2 is independently H; R1 is selected from H, a methyl group, and CH2OH; R2 is selected from H, a methyl group, and CH2OH; R3 is selected from H, OH, NH2, a methyl group, and CH2OH; Optionally, R1 and R2 are directly linked to form a ring.

[0068] In some embodiments, B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0069] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0070] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0071] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0072] In some embodiments, the chemical modification shown in formula (I) above or a tautomer modification thereof is [ka] Among them, B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0073] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0074] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0075] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0076] In some embodiments, the chemical modification shown in formula (I) above or a tautomeric modification thereof is [ka] wherein B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0077] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0078] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0079] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0080] In some embodiments, the chemical modification shown in formula (I) or a tautomeric modification thereof is [ka] Selected from Wherein, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole and 3-nitropyrrole.

[0081] In some embodiments, B is a base at a position corresponding to positions 2 to 8 of the 5' region of the antisense strand.

[0082] In some embodiments, when the chemical modification shown in formula (I) or a tautomer modification thereof is at the 5th position of the 5' region, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole. In some embodiments, B is the base at the position corresponding to the 5th position of the 5' region of the antisense strand.

[0083] In some embodiments, when the chemical modification shown in formula (I) or its tautomer modification is at position 6 of the 5' region, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole. In some embodiments, B is the base at the position corresponding to position 6 of the 5' region of the antisense strand.

[0084] In some embodiments, when the chemical modification shown in formula (I) or a tautomer modification thereof is at position 7 of the 5' region, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole. In some embodiments, B is the base at the position corresponding to position 7 of the 5' region of the antisense strand.

[0085] In some embodiments, the nucleotide comprising the chemical modification according to formula (I) or a tautomeric modification thereof is selected from a nucleotide comprising the chemical modification according to formula (I') or a tautomeric modification thereof: [ka] wherein Y is selected from O, NH and S; each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C6 alkyl group; J2 is H or a C1-C6 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; R3 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) p R6, wherein R6 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and p=1, 2 or 3; Q 1’ teeth [ka] Q 2’ is R2, or Q 1’ R2, Q 2’ teeth [ka] and Among them, R1 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, a C2-C6 alkenyl group, a C2-C6 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and q=1, 2 or 3; J1 is H or a C1-C6 alkyl group; R2 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) rR8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a ring; B is a base, M is O or S; Among them, the chemical modification shown in the above formula (I') or its tautomer modification is [ka] isn't it.

[0086] In some embodiments, when X is NH-CO, R1 is not H.

[0087] In some embodiments of formula (I'), B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0088] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0089] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0090] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0091] In some embodiments, formula (I') is selected from formula (I'-1): [ka] wherein Y is selected from O, NH and S; each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C6 alkyl group; Each J1, J2 is independently H or a C1-C6 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; R3 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) p R6, wherein R6 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and p=1, 2 or 3; R1 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, a C2-C6 alkenyl group, a C2-C6 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and q=1, 2 or 3; R2 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and r=1, 2 or 3; M is O or S; Optionally, R1 and R2 are directly linked to form a ring; B is as defined in formula (I').

[0092] In some embodiments of formula (I'-1), B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0093] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0094] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0095] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0096] In some embodiments, formula (I') is selected from formula (I'-2): [ka] wherein Y is selected from O, NH and S; each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C6 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; Each J1, J2 is independently H or a C1-C6 alkyl group; R3 is H, OH, halogen, NH2, C1-C6 alkyl group, C1-C6 alkoxy group, C2-C6 alkenyl group, C2-C6 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) p R6, wherein R6 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and p=1, 2 or 3; R1 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, a C2-C6 alkenyl group, a C2-C6 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and q=1, 2 or 3; R2 is H, a C1-C6 alkyl group, a C1-C6 alkoxy group, S-CH3, NCH3(CH3), OCH2CH2OCH3, an -O-alkylamino group, and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a ring; M is O or S; B is as defined in formula (I').

[0097] In some embodiments of formula (I'-2), B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0098] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0099] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0100] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0101] In some embodiments, the chemical modification or tautomer modification thereof is [ka] isn't it.

[0102] In some embodiments, when X is NH-CO, R1 is not H.

[0103] In some embodiments, each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H or a C1-C3 alkyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; Each J1 and J2 is independently H or a C1-C3 alkyl group; R3 is H, OH, halogen, NH2, C1-C3 alkyl group, C1-C3 alkoxy group, C2-C4 alkenyl group, C2-C4 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) p R6, wherein R6 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C6 alkenyl and C2-C6 alkynyl, and p=1, 2 or 3; R1 is H, a C1-C3 alkyl group, a C1-C3 alkoxy group, a C2-C4 alkenyl group, a C2-C4 alkynyl group, or (CH2) q R7, wherein R7 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C4 alkenyl and C2-C4 alkynyl, and q=1, 2 or 3; R2 is H, OH, halogen, NH2, C1-C3 alkyl group, C1-C3 alkoxy group, C2-C4 alkenyl group, C2-C4 alkynyl group, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-alkylamino group and (CH2) r R8, wherein R8 is selected from OH, halogen, methoxy, ethoxy, N3, C2-C4 alkenyl and C2-C4 alkynyl, and r=1, 2 or 3; Optionally, R1 and R2 are directly linked to form a ring.

[0104] In some embodiments, each X is independently selected from CR4(R4'), S, NR5, and NH-CO, wherein R4, R4', and R5 are each independently H, a methyl group, an ethyl group, an n-propyl group, or an isopropyl group; n=0, 1 or 2, m=0, 1 or 2, s=0 or 1; Each of J1 and J2 is independently H or a methyl group; R3 is H, OH, F, Cl, NH2, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-methylamino, -O-ethylamino, and (CH2). p R6, wherein R6 is selected from OH, F, Cl, a methoxy group, an ethoxy group, N3, a vinyl group, an allyl group, an ethynyl group, and a propargyl group, and p=1 or 2; R1 is H, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl, or (CH2) q R7, wherein R7 is selected from OH, F, Cl, a methoxy group, an ethoxy group, N3, a vinyl group, an allyl group, an ethynyl group, and a propargyl group, and q=1 or 2; R2 is H, OH, F, Cl, NH2, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl, S-CH3, NCH3(CH3), OCH2CH2OCH3, -O-methylamino, -O-ethylamino, and (CH2). r R8, wherein R8 is selected from OH, F, Cl, methoxy, ethoxy, N3, vinyl, allyl, ethynyl and propargyl, and r=1 or 2; Optionally, R1 and R2 are directly linked to form a ring.

[0105] In some embodiments, B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0106] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0107] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0108] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0109] In some embodiments, Y is O or NH, and each X is independently selected from NH—CO, CH, and NH; n=0 or 1, m=0 or 1, s=0 or 1, Each J1 and J2 is independently H; R1 is selected from H, a methyl group, and CH2OH; R2 is selected from H, OH, NH2, a methyl group, and CH2OH; R3 is selected from H, OH, NH2, a methyl group, and CH2OH; Optionally, R1 and R2 are directly linked to form a ring.

[0110] In some embodiments, B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0111] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0112] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0113] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0114] In some embodiments, Y is O or NH, and each X is independently selected from NH—CO, CH, and NH; n=0 or 1, m=0 or 1, s=0 or 1, Each J1 and J2 is independently H; R1 is selected from H, a methyl group, and CH2OH; R2 is selected from H, a methyl group, and CH2OH; R3 is selected from H, OH, NH2, a methyl group, and CH2OH; Optionally, R1 and R2 are directly linked to form a ring.

[0115] In some embodiments, B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0116] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0117] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0118] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0119] In some embodiments, the chemical modification shown in formula (I') above or a tautomer modification thereof is [ka] Selected from In which M is O or S; B is as defined in formula (I').

[0120] In some embodiments, B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0121] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0122] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0123] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0124] In some embodiments, the chemical modification shown in formula (I') above or a tautomer modification thereof is [ka] Selected from In which M is O or S; B is as defined in formula (I').

[0125] In some embodiments, B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0126] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0127] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0128] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0129] In some embodiments, the chemical modification shown in formula (I') above or a tautomer modification thereof is [ka] Selected from In which M is O or S; B is as defined in formula (I').

[0130] In some embodiments, B is a base selected from a purine base, a pyrimidine base, indole, 5-nitroindole, 3-nitropyrrole, and the like.

[0131] In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2-modified purine, N8-modified purine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudouracil, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0132] In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

[0133] In some embodiments, B is the base at the position corresponding to the modified nucleotide in the antisense strand.

[0134] In some embodiments, the chemical modification shown in formula (I') above or a tautomer modification thereof is [ka] and those in which the adenine in those structures is replaced with guanine, cytosine, uracil, or thymine, but are not limited to these.

[0135] In some embodiments, at least one nucleotide among positions 2 to 8 (e.g., positions 2, 3, 4, 5, 6, 7, 8) of the 5' region of the antisense strand comprises a 2'-methoxy modification.

[0136] In some embodiments, any one of nucleotides 5, 6, and 7 of the 5' region of the antisense strand comprises a 2'-methoxy modification.

[0137] In some embodiments, the modified nucleotide is located at any one of positions 2-8 of the 5' region of the antisense strand.

[0138] In some embodiments, the modified nucleotide is located at any one of positions 5, 6, or 7 of the 5' region of the antisense strand.

[0139] In some embodiments, when the chemical modification shown in Formula (I') or a tautomer modification thereof is at the 5th position of the 5' region, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole, and in some embodiments, B is a base at a position corresponding to the 5th position of the 5' region of the antisense strand.

[0140] In some embodiments, when the chemical modification shown in formula (I') or a tautomer modification thereof is at position 6 of the 5' region, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole, and in some embodiments, B is a base at a position corresponding to position 6 of the 5' region of the antisense strand.

[0141] In some embodiments, when the chemical modification shown in Formula (I') or a tautomer modification thereof is at position 7 of the 5' region, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole, and in some embodiments, B is a base at a position corresponding to position 7 of the 5' region of the antisense strand.

[0142] In some embodiments, at least one additional nucleotide of the siRNA sense strand and / or antisense strand is a modified nucleotide selected from 2'-methoxy modified nucleotide, 2'-substituted alkoxy modified nucleotide, 2'-alkyl modified nucleotide, 2'-substituted alkyl modified nucleotide, 2'-amino modified nucleotide, 2'-substituted amino modified nucleotide, 2'-fluoro modified nucleotide, 2'-deoxy nucleotide, 2'-deoxy-2'-fluoro modified nucleotide, 3'-deoxy-thymine nucleotide, isonucleotide, LNA, ENA, cET, UNA, GNA. In some embodiments, the modified nucleotide is independently selected from 2'-methoxy modified nucleotide, 2'-fluoro modified nucleotide and 2'-deoxy modified nucleotide.

[0143] In some embodiments, three consecutive nucleotides in the sense strand of the siRNA are 2'-fluoro modified nucleotides.

[0144] In some embodiments, in the sense strand of the siRNA, three consecutive nucleotides located at positions 7 to 9 of the 5' end are 2'-fluoro modified nucleotides.

[0145] In some embodiments, in the sense strand of the siRNA, three consecutive nucleotides located at positions 7 to 9 at the 5' end are 2'-fluoro modified nucleotides, and all remaining positions in the sense strand are non-2'-fluoro modified nucleotides.

[0146] In some embodiments, in the 5' to 3' direction, the nucleotides at positions 2, 4, 6, 9, 12, 14, 16, and 18 of the antisense strand are each independently a 2'-fluoro modified nucleotide.

[0147] In some embodiments, in the 5' to 3' direction, the nucleotides at positions 2, 4, 6, 10, 12, 14, 16, and 18 of the antisense strand are each independently a 2'-fluoro modified nucleotide.

[0148] In some embodiments, the sense strand comprises: N a N a N a N a XN a N b N b N b N a N a N a N a N a N a N a N a N a N a The nucleotide sequence (5'-3') of the formula: Wherein, each X is independently N a Or N b and N a is a nucleotide modified with a 2'-methoxy group, and N b is a 2'-fluoro modified nucleotide.

[0149] In some embodiments, the sense strand is 5'-N a N a N a N a N a N a N b N b N b N a N a N a N a N a N a N a N a N a N a -3', or 5'-Na N a N a N a N b N a N b N b N b N a N a N a N a N a N a N a N a N a N a -3', Of these, N a is a nucleotide modified with a 2'-methoxy group, and N b is a 2'-fluoro modified nucleotide.

[0150] In some embodiments, the sense strand is 5'-N a N a N a N a N a N a N b N b N b N a N a N a N a N a N a N a N a N a N a -3', or 5'-N a N a N a N a N b N a N b N b N b N a N a N a N a N a N a N a N a N a Na -3', Of these, N a is a nucleotide modified with a 2'-methoxy group, and N b is a 2'-fluoro modified nucleotide.

[0151] In some embodiments, the antisense strand is 5'-N a 'N b 'N a 'N b 'N a 'N b 'W'N a 'N a 'N b 'N a 'N b 'N a 'N b 'N a 'N b 'N a 'N b 'N a 'N a 'N a '-3', or 5'-N a 'N b 'N a 'N b 'N a 'N b 'W'N a 'N b 'N a 'N a 'N b 'N a 'N b 'N a 'N b 'N a 'N b 'N a 'N a 'N a "-3', Of these, N a ' is a nucleotide modified with a 2'-methoxy group, and N bwhere W′ is a 2′-fluoro modified nucleotide and W′ is a 2′-methoxy modified nucleotide or a nucleotide containing the chemical modification shown in formula (I) or a tautomeric modification thereof.

[0152] In some specific embodiments, W' represents a nucleotide containing a chemical modification as shown in formula (I) or a tautomeric modification thereof: In some specific embodiments, formula (I) is [ka] Selected from Wherein, B is selected from guanine, adenine, cytosine, or uracil. In some specific embodiments, B is selected from the base at the position corresponding to position 7 of the 5' region of the antisense strand.

[0153] In some specific embodiments, formula (I) is [ka] Selected from wherein M is O or S, and wherein B is selected from guanine, adenine, cytosine, or uracil. In some specific embodiments, B is selected from the base at the position corresponding to position 7 of the 5' region of the antisense strand.

[0154] In some specific embodiments, M is S. In some specific embodiments, M is O.

[0155] In some specific embodiments, W' represents a nucleotide modified with a 2'-methoxy group.

[0156] In some embodiments, at least one phosphate group of sense strand and / or antisense strand is a phosphate group having a modification group.By virtue of the modification group, the siRNA has improved stability in biological samples or environments.In some embodiments, the phosphate group having the modification group is a thiophosphate group.

[0157] In some embodiments, the thiophosphate group is Between the first and second nucleotides of the 5'-terminal end of the sense strand, Between the second and third nucleotides of the 5'-terminal end of the sense strand, the first nucleotide terminus of the 3'-terminal end of the sense strand; Between the first and second nucleotides of the 3'-terminal end of the sense strand, Between the second and third nucleotides of the 3'-terminal end of the sense strand, Between the first and second nucleotides at the 5'-end of the antisense strand, Between the second and third nucleotides of the 5'-terminal end of the antisense strand, the first nucleotide end of the 3' end of the antisense strand; Between the first and second nucleotides at the 3'-terminal end of the antisense strand, and Between the second and third nucleotides of the 3'-terminal end of the antisense strand, It is present in at least one position selected from the positions:

[0158] In some embodiments, the sense strand and / or the antisense strand comprises a plurality of thiophosphate groups, the thiophosphate groups being: Between the first and second nucleotides at the 5'-terminal end of the sense strand, and Between the second and third nucleotides at the 5'-terminal end of the sense strand, and Between the first and second nucleotides at the 5'-terminal end of the antisense strand, and Between the second and third nucleotides at the 5'-end of the antisense strand, and and optionally at the first nucleotide terminus of the 3'-terminal end of the sense strand, and / or optionally between the first and second nucleotides of the 3'-terminal end of the sense strand, and / or optionally between the second and third nucleotides of the 3'-terminal end of the sense strand, and / or optionally between the first and second nucleotides of the 3'-terminal end of the antisense strand, and / or optionally between the second and third nucleotides of the 3'-terminal end of the antisense strand.

[0159] In some embodiments, the sense strand is 5'-NmsNmsNmNmNfNmNfNfNfNmNmNmNmNmNmNmNmNmNm-3', or 5'-NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNm-3', or 5'-NmsNmsNmNmNfNmNfNfNmNmNmNmNmNmNmNmNmNms-3', or 5'-NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNms-3', or 5'-NmsNmsNmNmNfNmNfNfNfNmNmNmNmNmNmNmNmNmsNm-3', or 5'-NmsNmsNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmsNm-3', or 5'-NmsNmsNmNmNfNmNfNfNmNmNmNmNmNmNmNmNmsNms-3', or 5'-NmsNmsNmNmNmNmNfNfNmNmNmNmNmNmNmNmNmsNms-3', Wherein, Nm represents any nucleotide modified with a 2'-methoxy group, for example, C, G, U, A, T modified with a 2'-methoxy group, Nf represents any nucleotide modified with a 2'-fluoro group, for example, C, G, U, A, T modified with a 2'-fluoro group, The lower case letter s indicates that the two adjacent nucleotides on both sides of the letter s are linked together by a thiophosphate group, and when the lower case letter s is at the first position of the 3' end, it indicates that the end of the nucleotide adjacent to the left of the letter s is a thiophosphate group.

[0160] In some embodiments, the antisense strand is 5'-Nm'sNf'sNm'Nf'Nm'Nf'W'Nm'Nm'Nf'Nm'Nf'Nm'Nf'Nm'Nf'Nm'Nf'Nm'sNm'sNm'-3' or 5'-Nm'sNf'sNm'Nf'Nm'Nf'W'Nm'Nf'Nm'Nm'Nf'Nm'Nf'Nm'Nf'Nm'Nf'Nm'Nf'Nm'sNm'sNm'sNm'-3', Wherein, Nm' represents any nucleotide modified with a 2'-methoxy group, for example, C, G, U, A, T modified with a 2'-methoxy group, and Nf' represents any nucleotide modified with a 2'-fluoro group, for example, C, G, U, A, T modified with a 2'-fluoro group; The lower case letter s indicates that the two adjacent nucleotides on both sides of the letter s are linked together by a thiophosphate group, and when the lower case letter s is at the first position of the 3' end, it indicates that the end of one nucleotide adjacent to the left of the letter s is a thiophosphate group. W' represents a nucleotide modified with a 2'-methoxy group or a nucleotide containing the chemical modification shown in formula (I) or a tautomeric modification thereof.

[0161] In some embodiments, formula (I) is [ka] Selected from In some embodiments, B is a base at a position corresponding to position 7 of the 5' region of the antisense strand.

[0162] In some embodiments, formula (I) is [ka] Selected from wherein M is O or S, and wherein B is selected from guanine, adenine, cytosine, or uracil. In some specific embodiments, B is the base at the position corresponding to position 7 of the 5' region of the antisense strand.

[0163] In some specific embodiments, M is S. In some specific embodiments, M is O.

[0164] In some embodiments, the sense strand comprises a nucleotide sequence that differs by no more than 3 nucleotides from the nucleotide sequence of any one of SEQ ID NO:1 or SEQ ID NO:2 and comprises at least 15 contiguous nucleotides.

[0165] In some embodiments, the sense strand comprises a sequence that differs by no more than 3 nucleotides from the nucleotide sequence of any one of SEQ ID NO:1 or SEQ ID NO:2, and comprises at least 19 contiguous nucleotides, and in some embodiments, differs by no more than 1 nucleotide from the nucleotide sequence.

[0166] In some embodiments, the antisense strand comprises a sequence that differs by no more than 3 nucleotides from the nucleotide sequence of any one of SEQ ID NO:5 or SEQ ID NO:6, and comprises at least 21 contiguous nucleotides, and in some embodiments, differs by no more than 1 nucleotide from the nucleotide sequence, wherein W' represents a nucleotide modified with a 2'-methoxy group, or a nucleotide containing a chemical modification shown in Formula (I) or a tautomer modification thereof.

[0167] In some embodiments, the sense strand nucleotide sequence is selected from any one of SEQ ID NO:1 or SEQ ID NO:2.

[0168] In some embodiments, the antisense strand nucleotide sequence is selected from any one of SEQ ID NO:5 or SEQ ID NO:6, wherein W' represents a nucleotide modified with a 2'-methoxy group, or a nucleotide containing a chemical modification as shown in Formula (I) or a tautomer modification thereof.

[0169] In some embodiments, formula (I) is [ka] Selected from In some embodiments, B is a base at a position corresponding to position 7 of the 5' region of the antisense strand.

[0170] In some embodiments, formula (I) is [ka] Selected from wherein M is O or S; wherein B is selected from guanine, adenine, cytosine, or uracil; in some specific embodiments, B is the base at the position corresponding to position 7 of the 5' region of the antisense strand.

[0171] In some specific embodiments, M is S. In some specific embodiments, M is O.

[0172] In some specific embodiments, the sense strand comprises a nucleotide sequence set forth in any one of SEQ ID NO:39 to SEQ ID NO:43.

[0173] In some specific embodiments, the antisense strand comprises a nucleotide sequence set forth in any one of SEQ ID NO:44 to SEQ ID NO:52.

[0174] In some specific embodiments, the sense strand is selected from the nucleotide sequences set forth in any one of SEQ ID NO: 39 to SEQ ID NO: 43, In some specific embodiments, the antisense strand is selected from the nucleotide sequences set forth in any one of SEQ ID NO:44 to SEQ ID NO:52.

[0175] In some specific embodiments, the siRNA described herein comprises: Group 1) consisting of a sense strand shown in SEQ ID NO: 42 and an antisense strand shown in SEQ ID NO: 49; Group 2) the sense strand shown in SEQ ID NO: 43 and the antisense strand shown in SEQ ID NO: 50; Group 3) consisting of the sense strand shown in SEQ ID NO: 42 and the antisense strand shown in SEQ ID NO: 50; Group 4) the sense strand shown in SEQ ID NO: 43 and the antisense strand shown in SEQ ID NO: 49; Group 5) the sense strand shown in SEQ ID NO: 39 and the antisense strand shown in SEQ ID NO: 44; Group 6) consisting of a sense strand shown in SEQ ID NO: 40 and an antisense strand shown in SEQ ID NO: 45; Group 7) consisting of the sense strand shown in SEQ ID NO: 39 and the antisense strand shown in SEQ ID NO: 46; Group 8) the sense strand shown in SEQ ID NO: 40 and the antisense strand shown in SEQ ID NO: 47; Group 9) consisting of the sense strand shown in SEQ ID NO: 41 and the antisense strand shown in SEQ ID NO: 48; It may include or be selected from any one of the following:

[0176] In some specific embodiments, the siRNA described herein comprises: The sense strand comprises the nucleotide sequence shown in SEQ ID NO: 42, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 49; The sense strand comprises the nucleotide sequence shown in SEQ ID NO: 43, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 50; The sense strand comprises the nucleotide sequence shown in SEQ ID NO: 42, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 50; The sense strand comprises the nucleotide sequence shown in SEQ ID NO: 43, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 49; The sense strand comprises the nucleotide sequence shown in SEQ ID NO: 39, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 44; The sense strand comprises the nucleotide sequence shown in SEQ ID NO: 40, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 45; The sense strand comprises the nucleotide sequence shown in SEQ ID NO: 39, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 46; The sense strand comprises the nucleotide sequence shown in SEQ ID NO: 40, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 47; The sense strand comprises the nucleotide sequence shown in SEQ ID NO: 41, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 48; It is chosen from one of the following:

[0177] In some specific embodiments, the siRNA described herein comprises: The sense strand is the nucleotide sequence shown in SEQ ID NO: 42, and the antisense strand is the nucleotide sequence shown in SEQ ID NO: 49; The sense strand is the nucleotide sequence shown in SEQ ID NO: 43, and the antisense strand is the nucleotide sequence shown in SEQ ID NO: 50; The sense strand is the nucleotide sequence shown in SEQ ID NO: 42, and the antisense strand is the nucleotide sequence shown in SEQ ID NO: 50; The sense strand is the nucleotide sequence shown in SEQ ID NO: 43, and the antisense strand is the nucleotide sequence shown in SEQ ID NO: 49; The sense strand is the nucleotide sequence shown in SEQ ID NO: 39, and the antisense strand is the nucleotide sequence shown in SEQ ID NO: 44; The sense strand is the nucleotide sequence shown in SEQ ID NO: 40, and the antisense strand is the nucleotide sequence shown in SEQ ID NO: 45; The sense strand is the nucleotide sequence shown in SEQ ID NO: 39, and the antisense strand is the nucleotide sequence shown in SEQ ID NO: 46; The sense strand is the nucleotide sequence shown in SEQ ID NO: 40, and the antisense strand is the nucleotide sequence shown in SEQ ID NO: 47; The sense strand is the nucleotide sequence shown in SEQ ID NO: 41, and the antisense strand is the nucleotide sequence shown in SEQ ID NO: 48; It is chosen from one of the following:

[0178] In the present disclosure, in the 5'-3' direction: SEQ ID NO: 39 is GmsCmsUmCmCfUmUfAfUfUmGmUmUmAmUmAmCmGmAm, SEQ ID NO: 40 is AmsCmsAmCmCfAmCfAfUfCmAmAmCmAmUmAmAmUmAm, SEQ ID NO: 41 is AmsCmsAmCmCmAmCfAfUfCmAmAmCmAmUmAmAmUmsAm, SEQ ID NO: 42 is GmsCmsUmCmCmUmUfAfUfUmGmUmUmAmUmAmCmGmsAm, SEQ ID NO: 43 is GmsCmsUmCmCmUmUfAfUfUmGmUmUmAmUmAmCmGmAm, SEQ ID NO: 44 is UmsCfsGmUfAmUfAmAmCfAmAmUfAmAfGmGfAmGfCmsUmsGm, SEQ ID NO: 45 is UmsAfsUmUfAmUfGmUmUfGmAmUfGmUfGmGfUmGfUmsCmsAm, SEQ ID NO: 46 is UmsCfsGmUfAmUfAmAfCmAfAmUfAmAfGmGfAmGfCmsUfsGm, SEQ ID NO: 47 is UmsAfsUmUfAmUfGmUfUmGfAmUfGmUfGmGfUmGfUmsCfsAm, SEQ ID NO: 48 is UmsAfsUmUfAmUfGmUmUmGfAmUfGmUfGmGfUmGfUmsCmsAm, SEQ ID NO: 49 is UmsCfsGmUfAmUf(-)hmpNA(A)AmCmAfAmUfAmAfGmGfAmGfCmsUmsGm, SEQ ID NO: 50 is UmsCfsGmUfAmUfAmAmCmAfAmUfAmAfGmGfAmGfCmsUmsGm, Among them, Af = adenine 2'-F ribonucleoside, Cf = cytosine 2'-F ribonucleoside, Uf = uracil 2'-F ribonucleoside, Gf = guanine 2'-F ribonucleoside, Am = adenine 2'-OMe ribonucleoside, Cm = cytosine 2'-OMe ribonucleoside, Gm = guanine 2'-OMe ribonucleoside. ribonucleoside), Um=uracil 2'-OMe ribonucleoside.

[0179] s represents that the two adjacent nucleotides on either side of the letter s are linked together by a phosphorothioate diester group; (-)hmpNA(A) [ka] Represents.

[0180] The present disclosure further provides a siRNA complex comprising any one of the above siRNAs and a targeting ligand linked to the above siRNA.

[0181] In some embodiments, the siRNA is covalently or non-covalently linked to said targeting ligand.

[0182] In some embodiments, the targeting ligand targets the liver, in some embodiments, the targeting ligand binds to the asialoglycoprotein receptor (ASGPR), and in some embodiments, the targeting ligand comprises a galactose cluster or a galactose derivative cluster, and the galactose derivative is selected from N-acetyl-galactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, Nn-butyrylgalactosamine, or N-isobutyrylgalactosamine.

[0183] In some embodiments, the targeting ligand is linked to the 3' end of the sense strand of the siRNA.

[0184] In some embodiments, the targeting ligand is linked to the siRNA terminus via a phosphate, thiophosphate, or phosphate group, and in some embodiments, via a phosphodiester group.

[0185] In some embodiments, the targeting ligand is indirectly linked to the siRNA terminus via a phosphate, thiophosphate, or phosphate group, and in some embodiments, via a phosphodiester group.

[0186] In some embodiments, the targeting ligand is linked directly to the siRNA terminus via a phosphate, thiophosphate, or phosphoryl group, and in some embodiments, via a phosphodiester group.

[0187] In some embodiments, the targeting ligand is linked directly to the siRNA sense strand end via a phosphate or thiophosphate group, and in some embodiments, is linked to the siRNA sense strand end via a phosphodiester group.

[0188] In some embodiments, the targeting ligand is linked directly to the 3' end of the siRNA sense strand via a phosphate or thiophosphate group, and in some embodiments, via a phosphodiester group.

[0189] In some embodiments, in order to facilitate the entry of siRNA into cells, a lipophilic group such as cholesterol can be introduced at the end of the siRNA sense strand, and the lipophilic group can be covalently bound to a small interfering nucleic acid, for example, cholesterol, lipoprotein, vitamin E, etc. can be introduced at the end to contribute to the interaction with intracellular mRNA through a cell membrane made of lipid bilayer. In addition, siRNA can be modified by non-covalent bonding, for example, by binding to phospholipid molecules, polypeptides, cationic polymers, etc. through hydrophobic or ionic bonds to improve stability and biological activity.

[0190] In some specific embodiments, the targeting ligand is selected from the following structures, or a pharma- ceutically acceptable salt thereof: [ka] T is a targeting moiety.

[0191] In some specific embodiments, the targeting ligand is selected from the following structures, or a pharma- ceutically acceptable salt thereof: [ka] T is a targeting moiety.

[0192] In some specific embodiments, the targeting ligand has the structure: [ka] T is a targeting moiety.

[0193] In some specific embodiments, the targeting ligand is selected from the following structures, or a pharma- ceutically acceptable salt thereof: [ka] T is a targeting moiety.

[0194] In some embodiments, the targeting moiety of the targeting ligand comprises one or more targeting groups or moieties that cooperate to direct the delivery of the therapeutic reagent linked thereto to a desired target location. In some cases, the targeting moiety can bind to a cell or cell receptor and trigger endocytosis to facilitate entry of the therapeutic reagent into the cell. The targeting moiety can include a compound that has affinity for a cell receptor or cell surface molecule or an antibody. A variety of targeting ligands, including targeting moieties, can be linked to therapeutic reagents and other compounds to target the reagent to a cell and a specific cell receptor.

[0195] In some embodiments, the types of targeting moieties include carbohydrates, cholesterol and cholesteryl groups or steroids. Targeting moieties capable of binding to cell receptors include sugars such as galactose, galactose derivatives (e.g., N-acetyl-galactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, Nn-butyrylgalactosamine, N-isobutyrylgalactosamine, mannose and mannose derivatives).

[0196] It is known that targeting moieties that bind to the asialoglycoprotein receptor (ASGPR) can be used to target oligomeric compounds to the liver, in particular. The asialoglycoprotein receptor is abundantly expressed in liver cells (hepatocytes). Targeting moieties of cellular receptors that target ASCPR include galactose and galactose derivatives. Specifically, clusters of galactose derivatives, including clusters of 2, 3, 4 or more N-acetyl-galactosamine (GalNAc or NAG), can promote uptake of certain compounds in hepatocytes. Coupling GalNAc clusters to oligomeric compounds is for targeting the composition to the liver, where the N-acetyl-galactosamine sugars can bind to the asialoglycoprotein receptor on the surface of liver cells. Binding to the asialoglycoprotein receptor is believed to promote entry of the compound into the cell interior by initiating receptor-mediated endocytosis.

[0197] In some embodiments, the targeting ligand may comprise two, three, four or more targeting moieties. In some embodiments, the targeting ligands disclosed herein may comprise one, two, three, four or more targeting moieties linked to a branching group via L2.

[0198] In some embodiments, each targeting moiety comprises a galactosamine derivative, which is N-acetyl-galactosamine. Other sugars that can be used as targeting moieties and have affinity for the asialoglycoprotein receptor may be selected from galactose, galactosamine, N-formyl-galactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-butyryl-galactosamine, and N-isobutyryl-galactosamine, etc.

[0199] In some embodiments, the targeting ligand of the present disclosure comprises N-acetylgalactosamine as a targeting moiety; [ka]

[0200] In some embodiments, the targeting ligand comprises three terminal galactosamines or galactosamine derivatives (e.g., N-acetyl-galactosamines), each of which has affinity for a sialoglycoprotein receptor. In some embodiments, the targeting ligand comprises three terminal N-acetyl-galactosamines (GalNAc or NAG) as targeting moieties.

[0201] In some embodiments, the targeting ligand comprises four terminal galactosamines or galactosamine derivatives (e.g., N-acetyl-galactosamines), each of which has affinity for the asialoglycoprotein receptor. In some embodiments, the targeting ligand comprises four terminal N-acetyl-galactosamines (GalNAc or NAG) as targeting moieties.

[0202] The term commonly used in the art when referring to three terminal N-acetyl-galactosamines is triantennary. These include antennary, trivalent and trimer.

[0203] The term commonly used in the art when referring to four terminal N-acetyl-galactosamines is tetraantennary. Antennary, tetravalent and tetramer.

[0204] In some specific embodiments, the targeting ligand provided by the present disclosure is selected from the following structures: [ka]

[0205] In some specific embodiments, the targeting ligand provided by the present disclosure is selected from the following structures: [ka]

[0206] In some embodiments, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, Nn-butyrylgalactosamine, or N-isobutyrylgalactosamine can be substituted for the N-acetylgalactosamine moiety in the targeting ligand.

[0207] In some specific embodiments, the sense strand of the siRNA complex comprises any one of SEQ ID NO:53-SEQ ID NO:57.

[0208] In some specific embodiments, the antisense strand of the siRNA complex comprises any one of SEQ ID NO:49-SEQ ID NO:52, SEQ ID NO:58-SEQ ID NO:60.

[0209] In some specific embodiments, the siRNA complex comprises: Group 1) consisting of a sense strand shown in SEQ ID NO:56 and an antisense strand shown in SEQ ID NO:49; Group 2) the sense strand shown in SEQ ID NO: 57 and the antisense strand shown in SEQ ID NO: 50; Group 3) consisting of a sense strand shown in SEQ ID NO: 56 and an antisense strand shown in SEQ ID NO: 50; Group 4) the sense strand shown in SEQ ID NO: 57 and the antisense strand shown in SEQ ID NO: 49; Group 5) the sense strand shown in SEQ ID NO: 53 and the antisense strand shown in SEQ ID NO: 46; Group 6) consisting of the sense strand shown in SEQ ID NO: 54 and the antisense strand shown in SEQ ID NO: 47; Group 7) the sense strand shown in SEQ ID NO: 55 and the antisense strand shown in SEQ ID NO: 48; The present invention may include or be selected from any one of the following groups:

[0210] In some specific embodiments, the siRNA described herein comprises: The sense strand comprises the nucleotide sequence shown in SEQ ID NO:56, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:49; The sense strand comprises the nucleotide sequence shown in SEQ ID NO:57, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:50; The sense strand comprises the nucleotide sequence shown in SEQ ID NO:56, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:50; The sense strand comprises the nucleotide sequence shown in SEQ ID NO:57, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:49; The sense strand comprises the nucleotide sequence shown in SEQ ID NO:53, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:46; The sense strand comprises the nucleotide sequence shown in SEQ ID NO:54, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:47; The sense strand comprises the nucleotide sequence shown in SEQ ID NO:55, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:48; It is chosen from one of the following:

[0211] In some specific embodiments, the siRNA described herein comprises: The sense strand comprises the nucleotide sequence shown in SEQ ID NO:56, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:49; The sense strand comprises the nucleotide sequence shown in SEQ ID NO:57, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:50; The sense strand comprises the nucleotide sequence shown in SEQ ID NO:56, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:50; The sense strand comprises the nucleotide sequence shown in SEQ ID NO:57, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:49; The sense strand comprises the nucleotide sequence shown in SEQ ID NO:53, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:46; The sense strand comprises the nucleotide sequence shown in SEQ ID NO:54, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:47; The sense strand comprises the nucleotide sequence shown in SEQ ID NO:55, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:48; It is chosen from one of the following:

[0212] In the present disclosure, in the 5'-3' direction: SEQ ID NO:53 is GmsCmsUmCmCfUmUfAfUfUmGmUmUmAmUmAmCmGmAm-NAG0052', SEQ ID NO:54 is AmsCmsAmCmCfAmCfAfUfCmAmAmCmAmUmAmAmUmAm-NAG0052', SEQ ID NO: 55 is AmsCmsAmCmCmAmCfAfUfCmAmAmCmAmUmAmAmUmsAm-NAG0052', SEQ ID NO:56 is GmsCmsUmCmCmUmUfAfUfUmGmUmUmAmUmAmCmGmsAm-NAG0052', SEQ ID NO:57 is GmsCmsUmCmCmUmUfAfUfUmGmUmUmAmUmAmCmGmAm-NAG0052', SEQ ID NO: 46 is UmsCfsGmUfAmUfAmAfCmAfAmUfAmAfGmGfAmGfCmsUfsGm, SEQ ID NO: 47 is UmsAfsUmUfAmUfGmUfUmGfAmUfGmUfGmGfUmGfUmsCfsAm, SEQ ID NO: 48 is UmsAfsUmUfAmUfGmUmUmGfAmUfGmUfGmGfUmGfUmsCmsAm, SEQ ID NO: 49 is UmsCfsGmUfAmUf(-)hmpNA(A)AmCmAfAmUfAmAfGmGfAmGfCmsUmsGm, SEQ ID NO: 50 is UmsCfsGmUfAmUfAmAmCmAfAmUfAmAfGmGfAmGfCmsUmsGm, Among them, Af = adenine 2'-F ribonucleoside, Cf = cytosine 2'-F ribonucleoside, Uf = uracil 2'-F ribonucleoside, Gf = guanine 2'-F ribonucleoside, Am = adenine 2'-OMe ribonucleoside, Cm = cytosine 2'-OMe ribonucleoside, Gm = guanine 2'-OMe ribonucleoside. ribonucleoside), Um=uracil 2'-OMe ribonucleoside.

[0213] The letter s indicates that the two adjacent nucleotides on either side of the letter s are linked together with a phosphorothioate diester group, and (-)hmpNA(A) is [ka] and NAG0052' represents [ka] Represents.

[0214] In some embodiments, the siRNA complex has the following structure: [ka] Among them, Af = adenine 2'-F ribonucleoside, Cf = cytosine 2'-F ribonucleoside, Uf = uracil 2'-F ribonucleoside; Gf = guanine 2'-F ribonucleoside, Am = adenine 2'-OMe ribonucleoside, Cm = cytosine 2'-OMe ribonucleoside, Gm = guanine 2'-OMe ribonucleoside, Um = uracil 2'-OMe ribonucleoside.

[0215] [ka] represents a thiophosphate group, [ka] represents a phosphodiester group, NAG0052' is [ka] represents (-)hmpNA(A) [ka] Represents.

[0216] In some embodiments, the pharma- ceutically acceptable salt may be any salt conventional in the art, including, but not limited to, sodium salts, potassium salts, ammonium salts, amine salts, and the like.

[0217] In some embodiments, the siRNA complex is selected from TJR100396, TJR100436, TJR100397, TJR100437, TJR100391, TJR100392, TJR100395.

[0218] In some embodiments, the siRNA complex is selected from TJR100396, which has the following structure: [ka] In some embodiments, the siRNA complex is selected from TJR100436, which has the following structure: [ka] In some embodiments, the siRNA complex is selected from TJR100397, which has the following structure: [ka] In some embodiments, the siRNA complex is selected from TJR100437, which has the following structure: [ka] In some embodiments, the siRNA complex is selected from TJR100395, which has the following structure: [ka] Af = adenine 2'-F ribonucleoside, Cf = cytosine 2'-F ribonucleoside, Uf = uracil 2'-F ribonucleoside; Gf = guanine 2'-F ribonucleoside, Am = adenine 2'-OMe ribonucleoside, Cm = cytosine 2'-OMe ribonucleoside, Gm = guanine 2'-OMe ribonucleoside, Um = uracil 2'-OMe ribonucleoside.

[0219] [ka] represents a thiophosphate group, [ka] represents a phosphodiester group, and NAG0052' represents [ka] (-)hmpNA(A) [ka] Represents.

[0220] Another aspect of the disclosure provides a composition comprising the above-described complex and one or more pharma- ceutically acceptable excipients, such as vectors, transporters, diluents, and / or delivery polymers.

[0221] In the present disclosure, a variety of drug delivery systems are known and may be applicable to the siRNA or siRNA complexes of the present disclosure, such as packaging in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the compound, receptor-mediated cellular endocytosis, construction of a nucleic acid that is part of a reverse transcription virus or other vector.

[0222] Another aspect of the present disclosure provides the use of the conjugate or a composition comprising the conjugate in the preparation of a medicament for treating a disease in a subject, which in some embodiments is selected from a liver-derived disease.

[0223] Another aspect of the disclosure provides a method of treating a disease in a subject, comprising administering to the subject the above complex or composition.

[0224] Another aspect of the present disclosure provides a method of suppressing mRNA expression in a subject, comprising administering to the subject the above-described complex or composition.

[0225] Another aspect of the present disclosure provides a method for delivering an expression-inhibitory oligomeric compound to the liver in vivo, comprising administering to a subject the above-described complex or composition.

[0226] The conjugates, compositions and methods disclosed herein can reduce the level of a target mRNA in a cell, a group of cells, a tissue or a subject, and include administering to a subject a therapeutically effective amount of an expression-inhibitory oligomeric compound described herein, wherein the expression-inhibitory oligomeric compound is linked to a targeting ligand, thereby inhibiting expression in the subject of the target mRNA.

[0227] In some embodiments, the subject has previously been identified as having a pathogenic upregulation of a target gene in a target cell or tissue.

[0228] A subject as described in this disclosure refers to a subject suffering from a disease or condition that would benefit from the reduction or inhibition of target mRNA expression.

[0229] Delivery may be by local administration (e.g., direct injection, implantation, or topical administration), systemic administration, or by subcutaneous, intravenous, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration.

[0230] In alternative embodiments, the pharmaceutical compositions provided by the present disclosure may be administered by injection, for example, intravenous, intramuscular, intradermal, subcutaneous, intraduodenal, or intraperitoneal injection.

[0231] In an alternative embodiment, after the targeting ligand is linked to the expression-inhibiting oligomeric compound into a complex, the complex may be packaged into a reagent kit.

[0232] The present disclosure further provides a pharmaceutical composition comprising a siRNA or siRNA complex according to the present disclosure.

[0233] In some embodiments, the pharmaceutical composition may further include a pharma- ceutically acceptable additive and / or adjuvant, which may be one or more of a variety of agents or compounds commonly used in the art. For example, the pharma- ceutically acceptable additive may include at least one of a pH buffer, a protectant, and an osmolality adjuster.

[0234] In some embodiments, the siRNA, siRNA complex or pharmaceutical composition when contacted with a cell expressing a target gene will inhibit expression of the target gene by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, as measured by, for example, psiCHECK activity screening and luciferase reporter gene detection methods, as well as by other methods, such as PCR or branched DNA (bDNA) based methods, or protein based methods, such as immunofluorescence assays such as Western Blot or flow cytometry.

[0235] In some embodiments, when the siRNA, siRNA complex or pharmaceutical composition is contacted with a cell expressing a target gene, the percentage of over-expression of target gene mRNA by the siRNA complex or pharmaceutical composition is 99% or less, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, or 10% or less, as measured by, for example, psiCHECK activity screening and luciferase reporter gene detection methods, as well as by other methods, such as PCR or branched DNA (bDNA) based methods, or protein based methods, such as immunofluorescence analysis such as Western Blot or flow cytometry.

[0236] In some embodiments, when the siRNA, siRNA complex or pharmaceutical composition is contacted with a cell expressing a target gene, the siRNA complex retains on-target activity and reduces off-target activity by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% or at least 75%, as measured, for example, by psiCHECK activity screening and luciferase reporter gene detection methods, as well as by other methods, such as PCR or branched DNA (bDNA) based methods, or protein based methods, such as immunofluorescence assays such as Western Blot or flow cytometry.

[0237] In some embodiments, when the siRNA, siRNA complex or pharmaceutical composition is contacted with a cell expressing a target gene, the siRNA complex reduces on-target activity by at most 20%, at most 19%, at most 15%, at most 10%, at most 5% or more than 1%, and reduces off-target activity by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70% or at least 75%, as measured by, for example, psiCHECK activity screening and luciferase reporter gene detection methods, as well as by, for example, PCR or branched DNA (bDNA) based methods, or protein based methods, for example, immunofluorescence assays such as Western Blot and flow cytometry.

[0238] In some embodiments, when the siRNA, siRNA complex or pharmaceutical composition is contacted with a cell expressing a target gene, the siRNA complex enhances on-target activity by at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80%, and reduces off-target activity by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%, as measured by, for example, psiCHECK activity screening and luciferase reporter gene detection methods, as well as by, for example, PCR or branched DNA (bDNA) based methods, or protein based methods, for example, immunofluorescence assays such as Western Blot and flow cytometry.

[0239] The present disclosure further provides a cell comprising an siRNA or siRNA complex according to the present disclosure.

[0240] The present disclosure further provides a reagent kit comprising an siRNA or siRNA complex according to the present disclosure.

[0241] The present disclosure further provides a method for silencing a target gene or a target gene mRNA in a cell, the method comprising introducing into said cell an siRNA, siRNA complex and / or pharmaceutical composition according to the present disclosure.

[0242] The present disclosure further provides a method for silencing a target gene or a target gene mRNA in a cell, either in vivo or in vitro, comprising introducing into the cell an siRNA, siRNA complex and / or pharmaceutical composition according to the present disclosure.

[0243] The present disclosure further provides a method for suppressing expression of a target gene or mRNA of a target gene, comprising administering to a subject in need thereof an effective amount or dose of an siRNA, siRNA complex and / or pharmaceutical composition according to the present disclosure.

[0244] In some embodiments, administration is by routes including intramuscular, intrabronchial, intrathoracic, intraperitoneal, intraarterial, intralymphatic, intravenous, subcutaneous, cerebrospinal, or combinations thereof.

[0245] In some embodiments, an effective amount or dose of the siRNA, siRNA complex and / or pharmaceutical composition is from about 0.001 mg / kg body weight to about 200 mg / kg body weight, from about 0.01 mg / kg body weight to about 100 mg / kg body weight, or from about 0.5 mg / kg body weight to about 50 mg / kg body weight.

[0246] In some embodiments, the target gene is LPA.

[0247] The present disclosure provides such siRNA and / or pharmaceutical composition and / or siRNA complex for treating and / or preventing a disease associated with elevated levels of lipoprotein(a) and / or apolipoprotein(a) in a subject, or any other associated condition, pathology or syndrome, wherein in some embodiments, the disease associated with elevated levels of lipoprotein(a) and / or apolipoprotein(a) is selected from cardiovascular diseases, and in some embodiments, the cardiovascular disease is selected from: The cause is selected from ischemic stroke, atherosclerosis, thrombus formation, coronary heart disease, lower limb arterial disease or aortic valve stenosis, myocardial infarction, coronary artery stenosis, carotid artery stenosis, femoral artery stenosis, and heart failure.

[0248] The present disclosure provides the above siRNA and / or pharmaceutical composition and / or siRNA complex for treating and / or preventing a disease selected from a cardiovascular disease, and in some embodiments, the cardiovascular disease is selected from ischemic stroke, atherosclerosis, thrombosis, coronary heart disease, lower limb arterial disease or aortic valve stenosis, myocardial infarction, coronary artery stenosis, carotid artery stenosis, femoral artery stenosis, and heart failure.

[0249] The present disclosure provides the above siRNA and / or pharmaceutical composition and / or siRNA complex for reducing lipoprotein(a) and / or apolipoprotein(a) levels.

[0250] The present disclosure provides use of the above-mentioned siRNA and / or pharmaceutical composition and / or siRNA complex in the preparation of a medicament for suppressing the expression of LPA.

[0251] The present disclosure provides use of the above siRNA and / or pharmaceutical composition and / or siRNA complex in the preparation of a medicament for treating and / or preventing a disease associated with elevated levels of lipoprotein (a) and / or apolipoprotein (a) in a subject, wherein in some embodiments, the disease associated with elevated levels of lipoprotein (a) and / or apolipoprotein (a) is selected from cardiovascular diseases, and in some embodiments, the cardiovascular diseases are selected from ischemic stroke, atherosclerosis, thrombosis, coronary heart disease, lower limb arterial disease or aortic valve stenosis, myocardial infarction, coronary artery stenosis, carotid artery stenosis, femoral artery stenosis, and heart failure.

[0252] The present disclosure provides use of the above-mentioned siRNA and / or pharmaceutical composition and / or siRNA complex in the preparation of a medicament for treating and / or preventing a disease selected from a cardiovascular disease, in some embodiments, the cardiovascular disease is selected from ischemic stroke, atherosclerosis, thrombosis, coronary heart disease, lower limb arterial disease or aortic valve stenosis, myocardial infarction, coronary artery stenosis, carotid artery stenosis, femoral artery stenosis, and heart failure.

[0253] The present disclosure provides the use of the above-described siRNA and / or pharmaceutical composition and / or siRNA complex in the preparation of a medicament for reducing lipoprotein(a) and / or apolipoprotein(a) levels.

[0254] The present disclosure provides a method for suppressing expression of LPA, comprising administering to a subject an effective amount or dose of the above-mentioned siRNA and / or pharmaceutical composition and / or siRNA complex.

[0255] The present disclosure provides a method for treating and / or preventing a disease associated with elevated levels of lipoprotein (a) and / or apolipoprotein (a) in a subject, comprising administering to the subject an effective amount or dose of the above-mentioned siRNA and / or pharmaceutical composition and / or siRNA complex, and in some embodiments, the disease associated with elevated levels of lipoprotein (a) and / or apolipoprotein (a) is selected from cardiovascular diseases, and in some embodiments, the cardiovascular diseases are selected from ischemic stroke, atherosclerosis, thrombosis, coronary heart disease, lower limb arterial disease or aortic valve stenosis, myocardial infarction, coronary artery stenosis, carotid artery stenosis, femoral artery stenosis, and heart failure.

[0256] The present disclosure provides a method for treating and / or preventing a disease selected from a cardiovascular disease, comprising administering to a subject an effective amount or dose of the above-mentioned siRNA and / or pharmaceutical composition and / or siRNA complex, and in some embodiments, the cardiovascular disease is selected from ischemic stroke, atherosclerosis, thrombosis, coronary heart disease, lower limb arterial disease or aortic valve stenosis, myocardial infarction, coronary artery stenosis, carotid artery stenosis, femoral artery stenosis, and heart failure.

[0257] The present disclosure provides a method for reducing lipoprotein(a) and / or apolipoprotein(a) levels, comprising administering to a subject an effective amount or dose of the above-mentioned siRNA and / or pharmaceutical composition and / or siRNA complex.

[0258] The present disclosure provides a method for delivering an siRNA that suppresses the expression and / or replication of LPA in the body to the liver, comprising administering the siRNA and / or pharmaceutical composition and / or siRNA complex to a subject.

[0259] The present disclosure further provides an siRNA or siRNA complex characterized in that a T base replaces one or more, e.g., 1, 2, 3, 5, 6, 7, 8, 9, 10, U bases of any one of the siRNAs or siRNA complexes of the present disclosure.

[0260] Pharmaceutically acceptable salts of the compounds described in the present disclosure are selected from inorganic salts or organic salts, and the compounds described in the present disclosure can react with acidic or basic substances to produce the corresponding salts.

[0261] In another embodiment, if no configuration is specified, the compounds of the present disclosure may have a particular geometric or stereoisomeric form. The present disclosure includes all cis and trans isomers, (-)- and (+)-enantiomers, (R)- and (S)-enantiomers, diastereomers, (D)-isomers, (L)-isomers, and racemic and other mixtures thereof, such as mixtures enriched in enantiomers or diastereomers, and all such compounds are intended to be within the scope of the present disclosure. Substituents such as alkyl groups may have other asymmetric carbon atoms. All such isomers and mixtures thereof are within the scope of the present disclosure.

[0262] Also, unless a configuration is specified, the compounds and intermediates of the present disclosure may exist in different tautomeric forms, and all such forms are included within the scope of the present disclosure. The term "tautomer" or "tautomeric form" refers to structural isomers of different energies that are interconvertible by a low energy barrier. For example, proton tautomers (also called protolytic tautomers) include interconversions by protolysis, such as keto-enol and imine-enamine, lactam-lactim isomerization, etc. An example of lactam-lactim equilibrium is between A and B as shown below.

[0263] [ka] All of the compounds in this disclosure can be depicted in Form A or Form B. All tautomeric forms are within the scope of this disclosure. The naming of a compound does not exclude any tautomeric forms.

[0264] The compounds of the present disclosure may be asymmetric, e.g., have one or more stereoisomers.Unless otherwise specified, all stereoisomers include, e.g., enantiomers and diastereomers.The compounds of the present disclosure that contain asymmetric carbon atoms can be isolated in optically pure form or racemic form.Optical pure forms can be resolved from racemic mixtures or synthesized by using chiral raw materials or chiral reagents.

[0265] Optically active (R)- and (S)-isomers and D- and L-isomers can be prepared by chiral synthesis or chiral reagents or other conventional techniques. To obtain one enantiomer of a compound of the present disclosure, it can be prepared by asymmetric synthesis or derivatization with chiral auxiliaries, in which the resulting diastereomeric mixture is isolated and the required enantiomer is purified by cleavage of the auxiliaries. Alternatively, if the molecule contains a basic (e.g., amino) or acidic (e.g., carboxy) functional group, the diastereomeric salt can be formed with an appropriate optically active acid or base, and the diastereomeric separation can be carried out by conventional methods well known in the art, followed by recovery to obtain the enantiomer in pure form. Note that the separation of enantiomers and diastereomers is generally accomplished by chromatography, which employs a chiral stationary phase and is optionally combined with a chemical derivatization method (e.g., forming a carbamate from an amine).

[0266] The present disclosure further includes certain isotopically labeled compounds of the present disclosure that are the same as those described herein, but in which one or more atoms are replaced with an atom having an atomic mass or mass number different from the atomic mass or mass number normally found in nature. Illustrative examples of isotopes that can be attached to the compounds of the present disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, iodine, and chlorine, e.g., 2 H, 3 H, 11 C. 13 C. 14 C. 13 N, 15 N, 15 O. 17 O. 18 O. 31 P, 32 P, 35 S, 18 F, 123 I, 125 I and 36 Cl, etc.

[0267] Unless otherwise stated, when a position is specifically designated as deuterium (D), it should be understood that the position is deuterium (i.e., at least 10% deuterium incorporated) with an abundance at least 1000 times higher than the natural abundance of deuterium (which is 0.015%). In the example compounds, having an abundance higher than the natural abundance of deuterium may be at least 1000 times more abundant deuterium, at least 2000 times more abundant deuterium, at least 3000 times more abundant deuterium, at least 4000 times more abundant deuterium, at least 5000 times more abundant deuterium, at least 6000 times more abundant deuterium, or more abundant deuterium. The present disclosure further includes various deuterated forms of the compounds of formula I and formula II. Each available hydrogen atom connected to a carbon atom may be independently replaced with a deuterium atom. Those skilled in the art can synthesize deuterated forms of the compounds of formula I and formula II with reference to the relevant literature. Deuterated forms of the compounds of Formula I and Formula II may be prepared using commercially available deuterated starting materials or may be synthesized by conventional techniques with deuterated reagents including, but not limited to, deuterated borane, tritiated borane in tetrahydrofuran, lithium aluminum deuteride, deuterated iodoethane, deuterated iodomethane, and the like.

[0268] Unless otherwise specified, in the chemical structures of the compounds described in this disclosure, " [ka] " bond indicates no configuration is specified, i.e., if chiral isomers are present in the chemical structure, [ka] " is a bond like " [ka] " or " [ka] " or " [ka] "and" [ka] For convenience, all of the above structural formulas are depicted in one isomeric form, but the present disclosure also includes all isomers, such as tautomers, rotamers, geometric isomers, diastereomers, racemates and enantiomers. In the chemical structures of the compounds described in the present disclosure, [ka] " bond has no specified configuration, i.e., " [ka] The configuration of the bond "" may be the E configuration or the Z configuration, or may include both E and Z configurations simultaneously. Explanation of terms

[0269] In order that the present disclosure may be more readily understood, certain technical and scientific terms are specifically defined below. Unless expressly defined otherwise herein, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art.

[0270] Unless otherwise specified, in the context of this disclosure, "apolipoprotein (a) gene", Apo (a) gene, LPA are used interchangeably in this disclosure. LPA includes, but is not limited to, human LPA, cynomolgus monkey LPA, mouse LPA, and rat LPA, and its amino acid and complete coding sequence, mRNA sequence can be easily obtained using previously disclosed databases such as GenBank, UniProt, OMIM, and Macaca Genome Project site.

[0271] The term "target sequence" refers to a continuous portion of the nucleotide sequence of the mRNA molecule formed during LPA transcription, including the RNA processing product mRNA as the main transcription product. The portion of the target sequence that is targeted must be long enough to function as a substrate for iRNA-directed cleavage. In one embodiment, the target sequence is within the protein coding region of LPA.

[0272] As used herein, in the context of RNA-mediated gene silencing, the sense strand (also referred to as SS, SS strand or significant strand) refers to the strand that contains the same or essentially the same sequence as the target mRNA sequence, and the antisense strand (also referred to as AS or AS strand) refers to the strand that has a sequence complementary to the target mRNA sequence.

[0273] In the context of describing the siRNA sense strand described herein, the term "a sequence having no more than 3 nucleotide differences from the nucleotide sequence of any one of SEQ ID NO:1 or SEQ ID NO:2, and comprising at least 15 consecutive nucleotides" is intended to indicate that the siRNA sense strand described herein comprises at least 15 consecutive nucleotides of the sense strand of any one of SEQ ID NO:1 or SEQ ID NO:2, or a sequence having no more than 3 nucleotide differences from at least 15 consecutive nucleotides of the sense strand of any one of SEQ ID NO:1 or SEQ ID NO:2 (optionally a sequence having no more than 2 nucleotide differences, optionally a sequence having one nucleotide difference). Optionally, the siRNA sense strand described herein comprises at least 16 consecutive nucleotides of the sense strand of any one of SEQ ID NO:1 or SEQ ID NO:2, or a sequence having no more than 3 nucleotide differences from at least 16 consecutive nucleotides of the sense strand of any one of SEQ ID NO:1 or SEQ ID NO:2 (optionally a sequence having no more than 2 nucleotide differences, optionally a sequence having one nucleotide difference).

[0274] In the context of describing the siRNA antisense strand described herein, the term "a sequence that differs by no more than 3 nucleotides from the antisense strand of any one of SEQ ID NO:3 or SEQ ID NO:4, and that comprises at least 15 consecutive nucleotides" is intended to indicate that the siRNA antisense strand described herein comprises at least 15 consecutive nucleotides of the antisense strand of any one of SEQ ID NO:3 or SEQ ID NO:4, or a sequence that differs by no more than 3 nucleotides from at least 15 consecutive nucleotides of the antisense strand of any one of SEQ ID NO:3 or SEQ ID NO:4 (optionally, a sequence that differs by no more than 2 nucleotides, optionally, a sequence that differs by 1 nucleotide).

[0275] In the present disclosure, the "5' region" of the sense strand or the antisense strand, i.e., the "5' end" and the "5' terminus" are used interchangeably. For example, the nucleotides at positions 2 to 8 of the 5' region of the antisense strand may be substituted with the nucleotides at positions 2 to 8 of the 5' end of the antisense strand. Similarly, the "3' region", "3' terminus" and the "3' terminus" of the sense strand or the antisense strand are used interchangeably.

[0276] Unless otherwise specified, in the context of this disclosure, "G", "C", "A", "T" and "U" respectively represent nucleotides containing the bases guanine, cytosine, adenine, thymidine and uracil. Lower case d represents that one nucleotide adjacent to the downstream side of the letter d is a deoxyribonucleotide, lower case m represents that one nucleotide adjacent to the upstream side of the letter m is a methoxy-modified nucleotide, lower case f represents that one nucleotide adjacent to the upstream side of the letter f is a fluoro-modified nucleotide, and lower case s represents that the two nucleotides adjacent to the letter s are linked together by a thiophosphate group.

[0277] As used in this disclosure, the term "2'-fluoro modified nucleotide" refers to a nucleotide formed by replacing the hydroxy group at the 2' position of the ribosyl group of a nucleotide with a fluoro, and "non-2'-fluoro modified nucleotide" refers to a nucleotide or nucleotide analog formed by replacing the hydroxy group at the 2' position of the ribosyl group of a nucleotide with a non-fluoro group.

[0278] As used in this disclosure, the term "2'-methoxy modified nucleotide" refers to a nucleotide formed by replacing the 2'-hydroxy group of a ribosyl group with a methoxy group.

[0279] As used herein, the terms "complementary" or "reverse complementary" can be used interchangeably and have the meaning known to those skilled in the art that in a double-stranded nucleic acid molecule, bases in one strand pair with bases in another strand in a complementary manner. In DNA, the purine base adenine always pairs with the pyrimidine base thymine (or uracil in RNA), and the purine base guanine always pairs with the pyrimidine base cytosine. Each base pair contains one purine and one pyrimidine. If adenine in one strand always pairs with thymine (or uracil) in the other strand, and guanine always pairs with cytosine, the two strands are said to be complementary to each other, and the sequence of the strand can be deduced from the sequence of its complementary strand. Accordingly, "mismatch" is used in the art to mean that bases at corresponding positions in a double-stranded nucleic acid are not present paired in a complementary manner.

[0280] As used herein, the term "suppression" can be used interchangeably with "reduction," "silencing," "downregulation," "inhibition," and other similar terms, and includes any level of suppression. Suppression can be assessed by a reduction in the absolute or relative level of one or more of these variables as compared to a control level. The control level can be any type of control level used in the art, such as a pre-administration baseline level or a level determined from an untreated or control (e.g., buffer control or inactive agent control only) treated subject, cell, or sample. For example, the degree of suppression of target gene expression by siRNA can be indicated by the amount of excess mRNA expression, for example, 99% or less, 95% or less, 90% or less, 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, or 10% or less. The inhibition rate of target gene expression can be detected using the Dual-Glo (registered trademark) Luciferase Assay System. The firefly chemiluminescence value (Fir) and Renilla chemiluminescence value (Ren) are read, respectively, and the relative value Ratio = Ren / Fir is calculated. In the present disclosure, the excess mRNA expression ratio (or excess activity %) = Ratio (siRNA-treated group) / Ratio (siRNA-free control group), and inhibition rate (%) = 100% - excess mRNA expression (%).

[0281] Unless otherwise specified, the "compounds," "ligands," "nucleic acid-ligand complexes," "siRNA complexes," "nucleic acids," "complexes," "chemical modifications," "targeting ligands," "dsRNAs," and "RNAi" of the present disclosure can each independently exist in the form of a salt, mixed salt, or non-salt (e.g., free acid or free base). When present in the form of a salt or mixed salt, it may be a pharma- ceutically acceptable salt.

[0282] The term "pharmaceutically acceptable salts" includes pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.

[0283] "Pharmaceutically acceptable acid addition salt" refers to a salt formed with an inorganic or organic acid that is capable of retaining the bioavailability of the free base without other adverse effects. Inorganic acid salts include, but are not limited to, hydrochloride, hydrobromide, sulfate, nitrate, phosphate, etc., and organic acid salts include, but are not limited to, formate, acetate, 2,2-dichloroacetate, trifluoroacetate, propionate, caproate, octanoate, decanoate, undecylenate, glycolate, gluconate, lactate, sebacate, adipate, glutarate, malonate, oxalate, maleate, succinate, fumarate, tartrate, citrate, palmitate, stearate, oleate, cinnamate, laurate, malate, glutamate, pyroglutamate, aspartate, benzoate, mesylate, benzenesulfonate, p-toluenesulfonate, alginate, ascorbate, salicylate, 4-aminosalicylate, naphthalenedisulfonate, etc. These salts can be prepared by methods known in the art.

[0284] "Pharmaceutically acceptable base addition salt" refers to a salt formed with an inorganic or organic base that can retain the bioavailability of the free acid without other side effects. Salts derived from inorganic bases include, but are not limited to, sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts, iron salts, zinc salts, copper salts, manganese salts, aluminum salts, etc. Preferred inorganic salts are ammonium salts, sodium salts, potassium salts, calcium salts and magnesium salts, with sodium salts being preferred. Salts derived from organic bases include, but are not limited to, the following salts: primary amines, secondary amines, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, triethanolamine, dimethylethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, choline, betaine, ethylenediamine, glucosamine, methylglucosamine, theobromine, purine, piperazine, piperidine, N-ethylpiperidine, polyamide resins, and the like. Preferred organic bases include isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine. These salts can be prepared by methods known in the art.

[0285] An "effective amount" or "effective dose" is the amount of a drug, compound, or pharmaceutical composition required to obtain any one or more beneficial or desired therapeutic results. For prophylactic use, beneficial or desired results include biochemical, histological, and / or behavioral manifestations of a condition, its complications, and intermediate pathological phenotypes manifested during the progression of a condition, including eliminating or reducing the risk, reducing the severity, or delaying the onset of a condition. For therapeutic use, beneficial or desired results include clinical results such as reducing the incidence of or improving one or more symptoms of a condition associated with various target genes, target mRNAs, or target proteins of the present disclosure, reducing the dosage of other drugs required to treat the condition, improving the therapeutic efficacy of another drug, and / or delaying the progression of a condition associated with a target gene, target mRNA, or target protein of the present disclosure in a patient.

[0286] As used herein, the terms "patient," "subject," or "individual" can be used interchangeably and include a human or a non-human animal, such as a mammal, for example, a human or a monkey.

[0287] The siRNA provided by the present disclosure can be obtained by conventional preparation methods in the field (such as solid-phase synthesis and liquid-phase synthesis methods). Among them, solid-phase synthesis has already been commercialized as a customization service. The modified nucleotide group can be introduced into the siRNA described in the present disclosure by the nucleoside monomer having the corresponding modification, and the method of preparing the nucleoside monomer having the corresponding modification and the method of introducing the modified nucleotide group into the siRNA are also well known to those skilled in the art.

[0288] The term "chemical modification" or "modification" includes any alteration of a nucleotide by chemical means, such as the addition or removal of a chemical moiety, or the substitution of one chemical moiety for another.

[0289] The term "base" includes any known DNA and RNA base and base analogs, such as purines and pyrimidines, as well as the naturally occurring compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs.

[0290] The terms "flat-ended" or "blunt-ended" are used interchangeably and refer to the absence of unpaired nucleotides or nucleotide analogs at a given end of the siRNA, i.e., the absence of nucleotide overhangs. In most cases, an siRNA with two blunt ends is double-stranded over its entire length.

[0291] The term "about" or "approximately" means that a numerical value is within an acceptable error range of a specific value as measured by a person skilled in the art, and is determined by how the numerical portion is measured (i.e., the limitations of the measurement system). For example, "about" may mean within 1 or more than 1 standard deviation. Alternatively, "about" or "essentially including" may mean varying within a range of at most 20%, for example, between 1% and 15%, between 1% and 10%, between 1% and 5%, between 0.5% and 5%, between 0.5% and 1%. In the present disclosure, the term "about" preceding a number or a numerical range also includes, in each case, the number of embodiments given. Unless otherwise stated, when a specific value appears in the present application and claims, the meaning of "about" or "essentially including" should be assumed to be within an acceptable error range of the specific value.

[0292] Unless otherwise specified, "optionally," "optionally," "optionally," or "alternatively" means that the subsequently described event or circumstance may or may not occur, and the description includes cases where the event or circumstance occurs and cases where it does not occur. For example, "optionally, R1 and R2 are directly linked to form a ring" means that R1 and R2 are directly linked to form a ring may occur but need not exist, and the description includes cases where R1 and R2 are directly linked to form a ring and cases where R1 and R2 do not form a ring.

[0293] As used herein, the term "comprises" or "includes" means including the elements, integers, or steps described above, but not excluding any other elements, integers, or steps. When the term "comprises" or "includes" is used herein, it also covers the case where the described elements, integers, or steps are included, unless otherwise indicated. For example, when referring to "comprises" a specific sequence, it is intended to cover the case where the specific sequence is included.

[0294] The term "alkyl group" refers to a saturated aliphatic hydrocarbon group that is a straight or branched chain group containing from 1 to 20 carbon atoms. In some embodiments, it is selected from alkyl groups containing from 1 to 12 carbon atoms. Non-limiting examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropyl, 1-ethylpropyl, 2-methylbutyl, 3-methylbutyl, n-hexyl, 1-ethyl-2-methylpropyl, 1,1,2-trimethylpropyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 2,2-dimethylbutyl, 1,3-dimethylbutyl, 2-ethylbutyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 2,3-dimethylbutyl, n-heptyl, 2-methylhexyl, 3-methylhexyl, 4-methylhexyl, 5-methylhexyl, 6-methylhexyl, 7-methylhexyl, 8-methylhexyl, 9-methylhexyl, 10-methylhexyl, 11-methylhexyl, 12-methylhexyl, 13-methylhexyl, 14-methylhexyl, 15-methylhexyl, 16-methylhexyl, 17-methylhexyl, 18-methylhexyl, 19-methylhexyl, 20-methylhexyl, 21-methylhexyl, 22-methylhexyl, 23-methylhexyl, 24-methylhexyl, 25-methylhexyl, 26-methylhexyl, 27-methylhexyl, 28-methylhexyl, 29-methylhexyl, 30-methylhexyl, 31-methylhexyl, 32-methylhexyl, 33-methylhexyl, 34-methylhexyl, 35-methylhexyl, 36-methylhexyl, 37-methylhexyl, 38-methylhexyl, 39-methylhexyl, 40-methylhexyl, 41-methylhexyl, 42-methylhexyl, 43-methylhex Examples of such groups include 2,3-dimethylpentyl, 2,4-dimethylpentyl, 2,2-dimethylpentyl, 3,3-dimethylpentyl, 2-ethylpentyl, 3-ethylpentyl, n-octyl, 2,3-dimethylhexyl, 2,4-dimethylhexyl, 2,5-dimethylhexyl, 2,2-dimethylhexyl, 3,3-dimethylhexyl, 4,4-dimethylhexyl, 2-ethylhexyl, 3-ethylhexyl, 4-ethylhexyl, 2-methyl-2-ethylpentyl, 2-methyl-3-ethylpentyl, n-nonyl, 2-methyl-2-ethylhexyl, 2-methyl-3-ethylhexyl, 2,2-diethylpentyl, n-decyl, 3,3-diethylhexyl, 2,2-diethylhexyl, and various branched chain isomers thereof.In some embodiments, alkyl groups are selected from those containing 1 to 6 carbon atoms, non-limiting examples of which include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropyl, 1-ethylpropyl, 2-methylbutyl, 3-methylbutyl, n-hexyl, 1-ethyl-2-methylpropyl, 1,1,2-trimethylpropyl, 1,1-dimethylbutyl, 1,2-dimethylbutyl, 2,2-dimethylbutyl, 1,3-dimethylbutyl, 2-ethylbutyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl, 2,3-dimethylbutyl, and the like. An alkyl group can be substituted or unsubstituted, and when substituted, the substituents can be substituted at any available attachment point, which in some embodiments are independently selected from one or more groups selected from alkyl groups, alkenyl groups, alkynyl groups, alkoxy groups, alkylthio groups, alkylamino groups, halogens, mercapto groups, hydroxy groups, nitro groups, cyano groups, cycloalkyl groups, heterocycloalkyl groups, aryl groups, heteroaryl groups, cycloalkoxy groups, heterocycloalkoxy groups, cycloalkylthio groups, heterocycloalkylthio groups, oxo groups, carboxy groups, or carboxylic acid ester groups.

[0295] The term "alkoxy group" refers to -O-(alkyl group) and -O-(unsubstituted cycloalkyl group), where alkyl group is defined above. Non-limiting examples of alkoxy groups include methoxy, ethoxy, propoxy, butoxy, cyclopropoxy, cyclobutoxy, cyclopentyloxy, and cyclohexyloxy. An alkoxy group may be optionally substituted or unsubstituted, and when substituted, the substituents, in some embodiments, are independently selected from halogen, deuterium, hydroxy, oxo, nitro, cyano, C 1-6 Alkyl group, C 1-6 Alkoxy group, C 2-6 Alkenyloxy group, C 2-6 Alkynyloxy group, C3-6 Cycloalkoxy groups, 3- to 6-membered heterocycloalkoxy groups, C 3-8 a cycloalkenyloxy group, a 5- to 6-membered aryl group, or a heteroaryl group; 1-6 Alkyl group, C 1-6 Alkoxy group, C 2-6 Alkenyloxy group, C 2-6 Alkynyloxy group, C 3-6 Cycloalkoxy groups, 3- to 6-membered heterocycloalkoxy groups, C 3-8 The cycloalkenyloxy group, the 5- to 6-membered aryl group, or the heteroaryl group is optionally substituted with one or more groups selected from halogen, deuterium, a hydroxy group, an oxo group, a nitro group, and a cyano group. Similarly, the definitions of "alkynyloxy group", "alkenyloxy group", "cycloalkoxy group", "heterocycloalkoxy group", and "cycloalkenyloxy group" are the same as those of the above "alkoxy group".

[0296] The term "alkenyl group" refers to a straight or branched chain non-aromatic hydrocarbon group containing at least one carbon-carbon double bond and having 2 to 10 carbon atoms. There may be up to 5 carbon-carbon double bonds in such a group. For example, a "C2-C6" alkenyl group is defined as an alkenyl group having 2 to 6 carbon atoms. Examples of alkenyl groups include, but are not limited to, vinyl, propenyl, butenyl, and cyclohexenyl groups. The straight, branched, or cyclic portions of the alkenyl group may contain double bonds and are optionally 1-, 2-, 3-, 4-, or 5-substituted at any position allowed by normal valences.

[0297] The term "cycloalkenyl group" refers to a monocyclic hydrocarbon group having the specified number of carbon atoms and at least one carbon-carbon double bond.

[0298] The term "alkynyl group" refers to a straight or branched chain hydrocarbon group containing 2 to 10 carbon atoms and containing at least one carbon-carbon triple bond. Up to five carbon-carbon triple bonds may be present. Thus, a "C2-C6 alkynyl group" refers to an alkenyl group having 2 to 6 carbon atoms. Examples of alkynyl groups include, but are not limited to, ethynyl, 2-propynyl, and 2-butynyl groups. The straight and branched chain portions of the alkynyl group may contain triple bonds as permitted by normal valences, and are optionally 1-, 2-, 3-, 4-, or 5-substituted at any position permitted by normal valences.

[0299] The term "ketone" refers to any alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, heterocyclyl, heteroaryl, or aryl group linked by a carbonyl bridge, as described herein. Examples of ketone groups include, but are not limited to, alkanoyl groups (e.g., acetyl, propionyl, butyryl, valeryl, hexanoyl), alkenoyl groups (e.g., acryloyl), alkynoyl groups (e.g., acetylenic acyl, propynoyl, butynoyl, pentanoyl, hexanoyl), aroyl groups (e.g., benzoyl), and heteroaroyl groups (e.g., pyrroloyl, imidazoyl, quinolyl, pyridyloyl).

[0300] The term "alkoxycarbonyl group" refers to any alkoxy group as defined above linked by a carbonyl bridge (i.e., -C(O)O-alkyl group). Examples of alkoxycarbonyl groups include, but are not limited to, methoxycarbonyl, ethoxycarbonyl, isopropoxycarbonyl, n-propoxycarbonyl, tert-butoxycarbonyl, benzyloxycarbonyl or n-pentyloxycarbonyl groups.

[0301] The term "aryloxycarbonyl group" refers to any aryl group as defined above linked by an oxycarbonyl bridge (i.e., -C(O)O-aryl group). Examples of aryloxycarbonyl groups include, but are not limited to, phenoxycarbonyl and naphthyloxycarbonyl groups.

[0302] The term "heteroaryloxycarbonyl group" refers to any heteroaryl group as defined above linked by an oxycarbonyl bridge (i.e., a -C(O)O-heteroaryl group). Examples of heteroaryloxycarbonyl groups include, but are not limited to, 2-pyridyloxycarbonyl, 2-oxazolyloxycarbonyl, 4-thiazolyloxycarbonyl or pyrimidinyloxycarbonyl groups.

[0303] The term "cycloalkyl group" or "carbocycle" refers to a saturated or partially unsaturated monocyclic or polycyclic cyclic hydrocarbon substituent, the cycloalkyl ring containing 3 to 20 carbon atoms. In some embodiments, it is selected from those containing 3 to 7 carbon atoms. Non-limiting examples of monocyclic cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cyclohexadienyl, and the like. Polycyclic cycloalkyl groups include spiro, fused, and bridged ring cycloalkyl groups. Cycloalkyl groups may be substituted or unsubstituted. If substituted, the substituents may be substituted at any available attachment point. In some embodiments, the cycloalkyl groups may be independently selected from halogen, deuterium, hydroxy, oxo, nitro, cyano, C 1-6 Alkyl group, C 1-6 Alkoxy group, C 2-6 Alkenyloxy group, C 2-6 Alkynyloxy group, C 3-6 Cycloalkoxy groups, 3- to 6-membered heterocycloalkoxy groups, C 3-8 a cycloalkenyloxy group, a 5- to 6-membered aryl group, or a heteroaryl group; 1-6 Alkyl group, C 1-6Alkoxy group, C 2-6 Alkenyloxy group, C 2-6 Alkynyloxy group, C 3-6 Cycloalkoxy groups, 3- to 6-membered heterocycloalkoxy groups, C 3-8 The cycloalkenyloxy group, the 5- to 6-membered aryl group, or the heteroaryl group is optionally substituted with one or more groups selected from halogen, deuterium, a hydroxy group, an oxo group, a nitro group, and a cyano group.

[0304] The cycloalkyl ring may be fused to an aryl or heteroaryl group, in which the ring connected to the parent structure is a cycloalkyl group, non-limiting examples of which include indanyl, tetrahydronaphthyl, benzocycloheptanyl, etc. Cycloalkyl groups may be optionally substituted or unsubstituted, and when substituted, the substituents, in some embodiments, are independently halogen, deuterium, hydroxy, oxo, nitro, cyano, C 1-6 Alkyl group, C 1-6 Alkoxy group, C 2-6 Alkenyloxy group, C 2-6 Alkynyloxy group, C 3-6 Cycloalkoxy groups, 3- to 6-membered heterocycloalkoxy groups, C 3-8 a cycloalkenyloxy group, a 5- to 6-membered aryl group, or a heteroaryl group; 1-6 Alkyl group, C 1-6 Alkoxy group, C 2-6 Alkenyloxy group, C 2-6 Alkynyloxy group, C 3-6 Cycloalkoxy groups, 3- to 6-membered heterocycloalkoxy groups, C 3-8 The cycloalkenyloxy group, the 5- to 6-membered aryl group, or the heteroaryl group is optionally substituted with one or more groups selected from halogen, deuterium, a hydroxy group, an oxo group, a nitro group, and a cyano group.

[0305] The term "heterocycloalkyl group" or "heterocycle" or "heterocyclyl group" refers to a saturated or partially unsaturated monocyclic or polycyclic cyclic hydrocarbon substituent containing 3 to 20 ring atoms, one or more of which is selected from the group consisting of nitrogen, oxygen, or S(O). m (wherein m is an integer of 0-2), but does not include the ring moiety -OO-, -OS-, or -SS-, with the remaining ring atoms being carbon. In some embodiments, it is selected from those containing 3 to 12 ring atoms, of which 1 to 4 are heteroatoms. In some embodiments, it is selected from those containing 3 to 7 ring atoms. Non-limiting examples of monocyclic heterocycloalkyl groups include pyrrolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothienyl, dihydroimidazolyl, dihydrofuranyl, dihydropyrazolyl, dihydropyrrolyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, homopiperazinyl, and the like. Polycyclic heterocycloalkyl groups include spiro, fused, and bridged ring heterocycloalkyl groups. Non-limiting examples of "heterocycloalkyl groups" include: [ka] etc.

[0306] The term "hydroxy" refers to an -OH group.

[0307] The term "halogen" refers to fluorine, chlorine, bromine or iodine.

[0308] The term "haloalkyl group" refers to an alkyl group substituted with a halogen, wherein the alkyl group is as defined above.

[0309] The term "cyano" refers to -CN.

[0310] The term "nitro group" refers to --NO.sub.2.

[0311] The term "oxo" refers to the group =O, e.g., a carbon atom and an oxygen atom are linked by a double bond, thereby forming a ketone or aldehyde group.

[0312] The term "amino group" refers to -NH2.

[0313] The term "carboxy" refers to -C(O)OH.

[0314] The term "aldehyde group" refers to --CHO.

[0315] In the chemical structure of the present disclosure, [ka] " or [ka] can be linked to any one or more groups in accordance with the scope of the invention described herein, and the asterisk "*" represents a chiral center.

[0316] In this disclosure, unless otherwise specified, a "phosphate group" is a phosphodiester group.

[0317] In this disclosure, a thiophosphate group refers to a phosphodiester group modified by replacing one non-bridging oxygen atom with a sulfur atom; [ka] (M is an S atom).

[0318] In the context of this disclosure: [ka] Based on [ka] can be substituted with any group capable of linking to an adjacent nucleotide.

[0319] The term "linked," when referring to a connection between two molecules, refers to whether the two molecules are joined by a covalent bond or whether the two molecules are joined by a non-covalent bond (e.g., a hydrogen bond or an ionic bond), and includes a direct link and an indirect link.

[0320] The term "directly linked" refers to a connection between a first compound or group and a second compound or group without any intervening atoms or groups.

[0321] The term "indirectly linked" refers to a connection between a first compound or group and a second compound or group through an intermediate group, compound or molecule (eg, a linking group).

[0322] The term "substituted" refers to the replacement of any one or more hydrogen atoms on a particular atom (usually carbon, oxygen, and nitrogen atoms) with any group as defined herein, provided that the valence does not exceed the normal valence of the particular atom and results in the formation of a stable compound. Non-limiting examples of substituents include C1-C6 alkyl groups, C2-C6 alkenyl groups, C2-C6 alkynyl groups, cyano groups, hydroxy groups, oxo groups, carboxy groups, cycloalkyl groups, cycloalkenyl groups, heterocyclyl groups, heteroaryl groups, aryl groups, ketones, alkoxycarbonyl groups, aryloxycarbonyl groups, heteroaryloxycarbonyl groups, or halogens (e.g., F, Cl, Br, I). When a substituent is a ketone or oxo (i.e., =O), two (2) hydrogens on the atom are replaced.

[0323] "Substituted with one or more" means that the group may be substituted with a single or multiple substituents. Substitution with multiple substituents may be multiple of the same substituent or may be a combination of one or multiple different substituents.

[0324] Several abbreviations in this disclosure are defined as follows: DCE: dichloroethane; Sc(OTf)3: scandium trifluoromethanesulfonate, TFH: tetrahydrofuran; Pd / C: palladium-carbon; TFA: trifluoroacetic acid; DMF: dimethylformamide, DIPEA: N-ethyldiisopropylamine, HoBt: 1-hydroxybenzotriazole; EDCI: 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride; DMTrCl: 4,4'-dimethoxytrityl chloride; DIEA: N,N-diisopropylethylamine, HATU: 2-(7-azabenzotriazole)-N,N,N',N'-tetramethyluronium hexafluorophosphate; LiOH: lithium hydroxide; DMAP: 4-dimethylaminopyridine; HBTU: benzotriazole-N,N,N',N'-tetramethyluronium hexafluorophosphate; DMTrCl: 1-[chloro(4-methoxyphenyl)benzyl]-4-methoxybenzene; CF3SO3H: trifluoromethanesulfonic acid, BnBr: benzyl bromide; DEPBT: 3-(diethoxyphosphoryloxy)-1,2,3-benzotriazin-4-one; Bz: benzoyl protecting group, MMTr: methoxyphenyldiphenylmethyl group; DMTr: dimethoxytrityl protecting group. [Brief description of the drawings]

[0325] [Figure 1] This shows the mRNA expression level in TTR on day 7 after administration of TRD002218 and TRD007205. [Diagram 2]This shows the mRNA expression level in TTR on day 28 after administration of TRD002218 and TRD007205. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0326] The present disclosure will be further described below in conjunction with examples, but these examples are not intended to limit the scope of the present disclosure. Experimental methods for which specific conditions are not specified in the examples of the present disclosure generally follow standard conditions, such as those in the Cold Spring Harbor Antibody Technology Laboratory Manual, the Molecular Cloning Manual, etc., or conditions suggested by raw material or product manufacturers. Reagents for which a specific source is not specified are standard commercially available reagents.

[0327] Part 1. Off-target modification Example 1. Preparation of Chemical Modifications 1.1 Synthesis of Compound 1-1a and Compound 1-1b [ka] Compound 1 (500mg, 3.42mmol) and triethylamine (Et3N, 692mg, 6.84mmol, 0.95mL) were dissolved in dichloromethane (DCM, 10mL), and a solution of 4-toluenesulfonyl chloride (tsCl, 717mg, 3.76mmol) in dichloromethane (10mL) was added dropwise in an ice bath. After the addition was completed, the reaction was allowed to proceed with stirring at room temperature overnight. After the reaction was completed, the reaction was quenched with water, and the aqueous phase was extracted three times with dichloromethane (15mL). The combined organic phase was first washed with saturated aqueous sodium bicarbonate (10mL), then washed with saturated saline (20mL), and the solvent was evaporated to dryness under reduced pressure to obtain crude product 2 (820mg, 80%), which was used directly in the next reaction. MS m / z: C 14 H 21 O5S, [M+H] + Theoretical: 301.10, Actual: 301.2.

[0328] [ka] Compound 3 (239 mg, 1.22 mmol) was dissolved in dimethylformamide (DMF, 10 mL), and a solution of NaH (60% dissolved in mineral oil, 93 mg, 2.33 mmol) was added in an ice bath, and the reaction was carried out while stirring for 30 minutes. Compound 2 (350 mg, 1.16 mmol) was then added dropwise, and after the addition was completed, the reaction was carried out while stirring at 60° C. for 5 hours. After the reaction was completed, water was added to quench the reaction, and the aqueous phase was extracted three times with ethyl acetate (15 mL). The combined organic phase was first washed three times with water (10 mL), and then washed with saturated saline (10 mL). The solvent was then evaporated to dryness under reduced pressure, and the mixture was analyzed by reverse phase preparative HPLC (C 18 (Conditions: 5%-50% (A: HO, B: CHCN), flow rate: 70 mL / min) and freeze-drying to give 220 mg of compound 4. MS m / z: C 19 H 21 N5O3Na, [M+Na] + Theoretical: 390.16, Actual: 390.3.

[0329] [ka] Compound 4 (1.50 g, 4.08 mmol) was dissolved in 20 mL of a mixture of acetic acid and water (4:1) at room temperature and stirred at 60 °C for 30 min. After the reaction was completed, the solvent was evaporated to dryness under reduced pressure and the resulting mixture was analyzed by reverse phase preparative HPLC (C 18 (Conditions: 5%-25% (A: HO, B: CHCN), flow rate: 70 mL / min) and freeze-drying to give 1.10 g of compound 5. MS m / z: C 16 H 18 N5O3, [M+H] + Theoretical: 328.13, Actual: 328.4.

[0330] [ka] Compound 5 (1.00 g, 3.05 mmol) was dissolved in pyridine (Py, 10 mL), and a solution of 4,4'-dimethoxytrityl chloride (DMTrCl, 1.50 g, 4.58 mmol) in pyridine (5 mL) was added dropwise in an ice bath. After the addition was completed, the reaction was allowed to proceed with stirring at room temperature overnight. After the reaction was completed, the reaction was quenched with water, and the solvent was evaporated to dryness under reduced pressure. The reaction was then analyzed by reverse phase preparative HPLC (C 18 (Conditions: 5%-80% (A: HO, B: CHCN), flow rate: 70 mL / min) and freeze-drying to give 1.00 g of compound 6. MS m / z: C 37 H 36 N5O5, [MH] + Theoretical: 630.26, Found: 630.5. Racemic compound 6 was resolved by chiral column (Daicel CHIRALPAK® IE 250 mm×4.6 mm, 5 μm, A: n-hexane, B: ethanol) to give 410 mg of 6A(−) and 435 mg of 6B(+).

[0331] [ka] Compound 6A(-) (200 mg, 0.32 mmol), tetrazolium (11 mg, 0.16 mmol), N-methylimidazole (5 mg, 0.06 mmol), and 3A molecular sieves (500 mg) were dissolved in 10 mL of acetonitrile, and compound 7 (144 mg, 0.48 mmol) was added at room temperature and stirred at room temperature overnight. After the reaction was completed, the molecular sieves were removed by filtration, dichloromethane (30 mL) was added, and the mixture was washed three times with saturated aqueous sodium bicarbonate solution (10 mL), and further washed with saturated saline (20 mL). The filtrate was concentrated and dried, and then purified by reverse phase preparative HPLC (C 18 (Conditions: 5% to 100% (A: water, B: CH3CN), flow rate: 70 mL / min) and freeze-drying to obtain 200 mg of compound 1-1a. MS m / z: C 40 H 39 N6O7P, [M-Diisopropyl+OH] +Theory: 747.26, Actual measurement: 747.6. 1H NMR (400 MHz, acetonitrile-d3)δ 7.56, 7.54(2s, 1H), 7.36-7.27(m, 2H), 7.24-7.21(m, 7H), 6.83-6.80(m, 4H), 4.12-4.10(m, 2H), 3.75-3.68(m, 10H), 3.20-2.80(m, 2H), 2.68-2.54(m, 4H), 1.22-1.04(m, 18H).

[0332] [ka] Compound 6B(+) (200 mg, 0.32 mmol), tetrazolium (11 mg, 0.16 mmol), N-methylimidazole (5 mg, 0.06 mmol), and 3A molecular sieves (500 mg) were dissolved in 10 mL of acetonitrile, and compound 7 (144 mg, 0.48 mmol) was added at room temperature and stirred at room temperature overnight. After the reaction was completed, the molecular sieves were removed by filtration, dichloromethane (30 mL) was added, and the mixture was washed three times with saturated aqueous sodium bicarbonate solution (10 mL), and then with saturated saline (20 mL). The filtrate was concentrated and dried, and then purified by reverse phase preparative HPLC (C 18 (Conditions: 5% to 100% (A: water, B: CH3CN), flow rate: 70 mL / min) and freeze-drying to obtain 200 mg of compound 1-1b. MS m / z: C 40 H 39 N6O7P, [M-Diisopropyl+OH] + Theoretical: 747.26, Actual: 747.5.

[0333] 1.2 Synthesis of Compound 1-6a [ka] Compound 1 (10 g, 68.404 mmol), compound 2 (15 g, 62.186 mmol) and triphenylphosphine (32.62 g, 124.371 mmol) were dissolved in anhydrous THF (30 mL), and DIAD (24.656 mL, 124.371 mmol) was slowly added dropwise at 0°C. The reaction solution was reacted at 25°C for 12 h, and LCMS showed that the reaction was complete. The reaction solution was extracted with ethyl acetate (200 mL) and water (200 mL), the organic phase was dried, and the filtrate was concentrated, and the resulting residue was purified by normal phase column (DCM / MeOH=10 / 1) to obtain the target product 3 (20 g).

[0334] [ka] Compound 3 (20 g, 28.585 mmol) was dissolved in acetic acid (24 mL, 426.016 mmol) and H2O (12 mL) and stirred at 60 °C for 1 h. The reaction was then concentrated to dryness and THF (12 mL) and H2O (12 mL) were added and stirred at 80 °C for 7 h. LCMS showed the reaction was complete. The reaction was extracted with ethyl acetate (200 mL) and water (100 mL), and solid sodium carbonate was added to the aqueous phase until a large amount of solid precipitated in the aqueous phase. The solid was filtered, washed with water, and the filter cake was sucked dry by oil pump to obtain the target compound 5 (9 g).

[0335] [ka] Under nitrogen gas protection, compound 5 (6.8 g, 18.581 mmol) was dissolved in pyridine (80 mL), and TMSCl (14.250 mL, 111.489 mmol) was added slowly at 0 °C, and stirred for 2 h. Then, isobutyryl chloride (2.044 mL, 19.511 mmol) was added at 0 °C, and stirred at 25 °C for 1 h, and LCMS showed that the reaction was complete. After extraction with dichloromethane (200 mL) and water (200 mL), and the organic phase was concentrated and dried, the sample was mixed and purified by normal phase column (DCM:MeOH = 10:1), and a peak was obtained at 4.8%) to obtain yellow oily compound 6 (12 g).

[0336] [ka] Under nitrogen gas protection, compound 6 (5.5 g, 12.392 mmol) was dissolved in pyridine (30 mL), molecular sieve 4A 1 / 16 (7 g, 12.392 mmol) was added, and then DMTrCl (5.04 g, 14.870 mmol) solid was added in several portions at 0 ° C., and the reaction was carried out at 25 ° C. for 2 h, and TLC (PE: EtOAc = 1: 1, Rf = 0.69) showed that the reaction was already completed. The reaction solution was treated together with TJN200879-040-P1. The reaction solution was extracted with ethyl acetate (200 mL) and water (200 mL), and the organic phase was concentrated and dried, and then the sample was mixed and purified with a normal phase column (PE: EtOAc was applied to the column, and a peak was obtained at 84%) to obtain a yellow oily compound 7 (12 g).

[0337] [ka] Compound 7 (12 g, 15.389 mmol) was dissolved in EtOAc (140 mL), and wet palladium carbon Pd / C (7 g, 15.389 mmol) was added, and the reaction solution was reacted at 25°C under hydrogen gas (15 Psi) for 2 hours. TLC (PE: EtOAc = 0: 1, Rf = 0.09) showed that the reaction was already completed. The reaction solution was filtered, and the filter cake was washed with ethyl acetate (30 mL) three times, and the filtrate was collected. The filtrate was concentrated and dried, and then 50 mL of dichloromethane and 2 mL of triethylamine were added to mix the sample, and the mixture was purified by normal phase column (DCM: MeOH = 10: 1, column, 0.5% peak appeared), to obtain 9 g (yellow foamy solid), and the obtained racemic compound was separated by SFC to obtain the product target compound 7A (-) (3.9 g) and target compound 7B (+) (3.8 g).

[0338] [ka] Compound 7A(-) (3.30g, 5.40mmol), tetrazolium (190mg, 2.70mmol), 1-methylimidazole (90mg, 1.10mmol), 3A molecular sieve (500mg) were dissolved in 30mL of acetonitrile, and compound 8 (2.50g, 8.10mmol) was added at room temperature and stirred at room temperature for 2h. After the reaction was completed, the molecular sieve was filtered off, DCM (150mL) was added, washed with saturated aqueous sodium bicarbonate (30mL x 3), and further washed with saturated saline (30mL), and the filtrate was concentrated and dried, and then passed through reverse phase preparative HPLC (C18, conditions: 5% to 100% (A: water, B: CH3CN), flow rate: 70mL / min) to obtain 1--6a (2.9g, 66%) after lyophilization. MS m / z:C43H55N7O7P [M+H]+, theoretical: 812.38, measured: 812.5. 1H NMR (400 MHz, acetonitrile-d3)δ 7.56, 7.54(2s, 1H), 7.36-7.27(m, 2H), 7.24-7.21(m, 7H), 6.83-6.80(m, 4H), 4.12-4.10(m, 2H), 3.75-3.68(m, 10H), 3.20-2.80(m, 2H), 2.68-2.54(m, 4H), 1.22-1.04(m, 18H).

[0339] 1.3 Synthesis of Compound 1-7a [ka] Under nitrogen gas protection, compound 1 (5 g, 23.1272 mmol), compound 2 (6.76 g, 46.254 mmol) and triphenylphosphine (7.28 g, 27.753 mmol) were dissolved in 30 mL of dioxane, and DEAD (5.502 mL, 27.753 mmol) was slowly added dropwise at 0 ° C. After the addition was completed, the reaction was gradually heated to 25 ° C. and continued to react for 1 h. The reaction solution was extracted with 100 mL of H2O and 100 mL of EtOAc, the organic phases were combined, dried, filtered and concentrated, and the sample was mixed and applied to a column, and purified by normal phase column (PE: EtOAc = 1: 1 applied to the column) to obtain the target product (4 g).

[0340] [ka] Compound 3 (3.3 g) was dissolved in HOAc (16 mL) and HO (4 mL), heated in an oil bath at 60 °C for 0.5 h, concentrated to dryness, and the residue was purified by normal phase column chromatography (PE: EtOAc = 0:1) to give the target product 4 (3 g).

[0341] [ka] Compound 4 (3 g, 8.873 mmol) was dissolved in 5 mL of pyridine and 10 mL of DMTrCl (3.91 g, 11.535 mmol) was slowly added dropwise at 0° C. under nitrogen gas protection. After the addition was complete, the reaction was warmed to 25° C. and allowed to react for 1 h. The reaction was extracted with 50 mL of water and 100 mL of ethyl acetate. The aqueous phase was further extracted three times with 100 mL of ethyl acetate, and the organic phases were combined, dried, filtered, and concentrated and purified by normal phase column (PE:EtOAc=2:1). The target product 5 (4 g) was obtained.

[0342] [ka] Compound 5 (4 g, 5.769 mmol) was dissolved in methanol (10 mL), and saturated NH3 methanol solution (40 mL) was added and reacted at 0 °C for 6 h. The reaction solution was concentrated to dryness and purified by normal phase column (PE: EtOAc = 0: 1) to obtain 2.4 g of racemic compound, which was separated by SFC to obtain target product 6A (750 mg, 100% purity) and target product 6B (400 mg, 99.16% purity).

[0343] [ka] Compound 6A(-) (700 mg, 1.40 mmol), tetrazolium (50 mg, 0.70 mmol), 1-methylimidazole (23 mg, 0.28 mmol), and 3A molecular sieves (500 mg) were dissolved in 10 mL of acetonitrile, and compound 7 (630 mg, 2.10 mmol) was added at room temperature and stirred at room temperature for 2 h. After the reaction was completed, the molecular sieves were filtered off, DCM (50 mL) was added, and the mixture was washed with saturated aqueous sodium bicarbonate (10 mL x 3), and then with saturated saline (20 mL). The filtrate was concentrated and dried, and then passed through reverse phase preparative HPLC (C18, conditions: 5% to 100% (A: water, B: CH3CN), flow rate: 70 mL / min) and lyophilized to obtain 1-7a (700 mg, 72%). MS m / z: C38H47N4O7PNa[M+Na]+, theoretical: 725.32, observed: 725.5.

[0344] 1.4 Synthesis of Compound 1-8a [ka] Compound 1 (8.5 g, 76.508 mmol) and compound 2 (30.64 g, 91.809 mmol) were dissolved in DMF (150 mL), and CS2CO3 (29.91 g, 91.809 mmol) was added, and the reaction was reacted under nitrogen gas protection at 90 °C for 12 h. The reaction was detected to be complete by LCMS. The reaction solution was filtered, concentrated and dried by oil pump, and purified by normal phase column separation (80 g, DCM / MeOH = 10 / 1 ~ 5 / 1) to obtain the target product 3 (13.5 g, 80% purity).

[0345] [ka] Compound 3 (10.5 g, 35.105 mmol) was dissolved in pyridine (65 mL) and CH3CN (65 mL), and BzCl (4.894 mL, 42.126 mmol) was added dropwise to the solution and reacted at 25 ° C for 2 h. LCMS detected the completion of the reaction of most of the raw materials, and the mixture was quenched by adding H2O (100 mL), extracted with EtOAc (100 mL × 3), concentrated and dried, separated by column (combined with TJN200872-101) and purified (80 g, PE / EtOAc = 10 / 1 to 0 / 1, DCM / MeOH = 10 / 1) to obtain the target product 4 (14 g, 90% purity).

[0346] [ka] Compound 4 (14g, 36.694mmol) was dissolved in HOAc (56mL, 314.796mmol) and HO (14mL) and reacted at 60℃ for 2h, LCMS showed the reaction was complete. It was concentrated by oil pump and separated by normal phase column (40g, DCM / MeOH=1 / 0~5 / 1) to give the target product 5 (8.4g, 90% purity & 2.4g, 80% purity).

[0347] [ka] Compound 5 (7.4g, 21.957mmol), DMAP (0.54g, 4.391mmol), molecular sieve 4A (11.1g, 2.967mmol) were dissolved in pyridine (60mL), stirred in ice bath for 10min, then DMTrCl (8.93g, 26.348mmol) was added and reacted with stirring for 1.8h, LCMS showed that about 19% of the raw material remained and about 60% of the target was detected by MS. (TJN200872-105&106) and purified together. The reaction mixture was added with HO (50 mL), extracted with DCM (50 mL × 3), dried, concentrated to dryness, and separated by column (120 g, PE / (EA:DCM:TEA = 1:1:0.05) = 1 / 0 to 0 / 1 to DCM / MeOH = 10 / 1) to obtain yellow solid compound 6 (11 g, 89% purity, TJN200872-105 & 106 & 107), and the raw material (3.0 g, 70% purity) was recovered.

[0348] [ka] Compound 6 (15 g, 22.041 mmol) was separated by SFC (DAICEL CHIRALPAK AD (250 mm × 50 mm, 10 μm), 0.1% NH3HO EtOH, B: 45% to 45%, 200 mL / min) to give target product 6A (5.33 g, 94.29% purity), target product 6B (6.14 g, 97.91% purity), and 1.0 g of compound 6 was recovered.

[0349] [ka] Compound 6B(-) (5.4g, 8.92mmol), tetrazolium (312mg, 4.46mmol), 1-methylimidazole (146mg, 1.78mmol), 3A molecular sieve (500mg) were dissolved in 40mL of acetonitrile, and compound 7 (4g, 13.4mmol) was added at room temperature and stirred at room temperature for 2h. After the reaction was completed, the molecular sieve was filtered off, DCM (200mL) was added, washed with saturated aqueous sodium bicarbonate (30mL x 3), and further washed with saturated saline (50mL), and the filtrate was concentrated and dried, and then passed through reverse phase preparative HPLC (C18, conditions: 5% to 100% (A: water, B: CH3CN), flow rate: 70mL / min) to obtain 1-8a (5.8g, 80%) after lyophilization. MS m / z: C45H51N5O7P, [M+H]+, theoretical: 804.36, measured: 804.4.

[0350] Example 2. Synthesis of siRNA The synthesis of siRNA is the same as that of the conventional phosphoramidite solid-phase synthesis method. When synthesizing the 7-position modified nucleotide of the AS chain 5', the parent sequence original nucleotide was replaced with the above synthesized phosphoramidite monomer. The synthesis process is briefly described below. Starting with the general-purpose CPG vector, nucleoside phosphoramidite monomers were linked one by one by the synthesis program in the Dr. Oligo48 synthesizer (Biolytic). Except for the 7-position nucleoside phosphoramidite monomer of the AS chain 5' described above, other nucleoside monomer raw materials such as 2'-F RNA and 2'-O-methyl RNA were purchased from Shanghai Jiaowei or Suzhou Jima. 5-Ethylthio-1H-tetrazole (ETT) was employed as the activating agent (0.6 M in acetonitrile), a 0.22 M solution of PADS in a 1:1 volume ratio of acetonitrile and trimethylpyridine (Suzhou Cortex) was used as the sulfurizing reagent, and an iodopyridine / water solution (Cortex) was used as the oxidizing agent.

[0351] After the solid-phase synthesis was completed, the oligoribonucleotides were dissolved from the solid support and soaked in a 3:1 solution of 28% aqueous ammonia and ethanol at 50°C for 16 hours. After centrifugation, the supernatant was transferred to another centrifuge tube, concentrated and evaporated to dryness, and then purified by C18 reversed-phase chromatography using a mobile phase of 0.1M TEAA and acetonitrile, and 3% trifluoroacetic acid solution to remove DMTr. The target oligonucleotides were collected and lyophilized, and identified as the target products by LC-MS and quantified by UV (260 nm).

[0352] The resulting single-stranded oligonucleotides were complementarily paired and annealed in an equimolar ratio, and the resulting double-stranded siRNA was dissolved in 1×PBS and adjusted to the concentration required for the experiment for use.

[0353] Example 3. psiCHECK Activity Screening Experiments The synthesis of siRNA samples was as described above, and the plasmids were from Shanghai Biotechnology Co., Ltd. The psiCHECK experimental consumables are shown in Table 1.

[0354] [Table 1]

[0355] [Table 2]

[0356] According to Table 3, the working solution was diluted to different concentrations according to the needs of different experiments and prepared immediately before use. After 24 h transfection, the detection was performed according to the experimental procedure of the Dual-Glo® Luciferase Assay System detection reagent kit.

[0357] Calculate the relative value Ratio = Ren / Fir (Renillus / Firefly ratio) Suppression rate 1-(Ratio+siRNA / reporter gene only)×100%=suppression rate (%) In the present disclosure, excess activity % (also referred to as mRNA excess expression amount % or mRNA excess expression ratio) = 100% - inhibition rate (%).

[0358] [Table 3]

[0359] Example 4. Characterization of chemical modifications The compound of Example 1 was used to synthesize siRNA according to the method of Example 2, and the on-target activity and off-target activity of each siRNA were verified according to the method of Example 3, in which each siRNA adopted the same sense strand, and the 7th position of the 5' end of the antisense strand was the following modified nucleotide / chemical modification: [ka] Among them, the nucleotide synthesized using 2-hydroxymethyl-1,3-propanediol as the starting material is defined as hmpNA. (+)hmpNA(A) is obtained by solid-phase synthesis from the nucleoside phosphoramidite monomer 1-1b in Example 1.1, and has the absolute configuration (S)-hmpNA(A); (-)hmpNA(A) is obtained by solid-phase synthesis from the nucleoside phosphoramidite monomer 1-1a in Example 1.1, and has the absolute configuration (R)-hmpNA(A); Similarly, the base types of hmpNA were substituted and the following structures were obtained by solid phase synthesis and the absolute configurations were confirmed: (+)hmpNA(G) has the absolute configuration of (S)-hmpNA(G), (-)hmpNA(G) has the absolute configuration of (R)-hmpNA(G); (+)hmpNA(C) has the absolute configuration of (S)-hmpNA(C); (-)hmpNA(C) has the absolute configuration of (R)-hmpNA(C); (+)hmpNA(U) has the absolute configuration of (R)-hmpNA(U), (-)hmpNA(U) has the absolute configuration of (S)-hmpNA(U).

[0360] The absolute configurations of (S)-hmpNA(G), (R)-hmpNA(G), (S)-hmpNA(C), (R)-hmpNA(C), (S)-hmpNA(U) and (R)-hmpNA(U) were confirmed by X-Ray diffraction from their intermediates or derivatives.

[0361] The structure of the intermediate or derivative is as follows:

[0362] [ka] TJ-NA067: The detected crystal is a colorless block (0.30 mm3 × 0.10 mm3 × 0.04 mm3) belonging to the monoclinic P21 space group. Cell parameters a = 16.0496(5) Å, b = 4.86260(10) Å, c = 16.4686(5) Å, α = 90°, β = 118.015(4)°, γ = 90°, V = 1134.65(7) Å3, Z = 4. Calculated density Dc = 1.389 g / cm3, number of electrons in the unit cell F(000) = 504.0, linear absorption coefficient of the unit cell μ(Cu Kα) = 0.840 mm-1, diffraction experiment temperature T = 150.00(11) K.

[0363] [ka] 6A(+): The detected crystal is a colorless block (0.30 mm3 × 0.20 mm3 × 0.10 mm3) belonging to the monoclinic P21 space group. Cell parameters a = 22.6688(7) Å, b = 8.5595(2) Å, c = 23.3578(5) Å, α = 90°, β = 113.876(3)°, γ = 90°, V = 4144.3(2) Å3, Z = 2. Calculated density Dc = 0.999 g / cm3, number of electrons in the unit cell F(000) = 1318.0, linear absorption coefficient of the unit cell μ(Cu Kα) = 0.570 mm-1, diffraction experiment temperature T = 100.01(18) K.

[0364] [ka] TJ-NA048: The detected crystal is colorless and needle-like (0.30 mm3 × 0.04 mm3 × 0.04 mm3) and belongs to the monoclinic P1 space group. Cell parameters a = 7.6165(4) Å, b = 11.3423(5) Å, c = 17.3991(8) Å, α = 85.007(4)°, β = 88.052(4)°, γ = 70.532(4)°, V = 1411.75(12) Å3, Z = 2. Calculated density Dc = 1.366 g / cm3, number of electrons in the unit cell F(000) = 620.0, linear absorption coefficient of the unit cell μ(Cu Kα) = 0.856 mm-1, diffraction experiment temperature T = 150.00(13) K.

[0365] [ka] TJ-NA092: The detected crystal is colorless and prismatic (0.30 mm3 × 0.10 mm3 × 0.10 mm3) and belongs to the monoclinic P1 space group. Cell parameters a = 5.17960(10) Å, b = 8.0667(2) Å, c = 12.4077(2) Å, α = 93.146(2)°, β = 101.266(2)°, γ = 96.134(2)°, V = 503.993(18) Å3, Z = 2. Calculated density Dc = 1.412 g / cm3, number of electrons in the unit cell F(000) = 228.0, linear absorption coefficient of the unit cell μ(Cu Kα) = 0.945 mm-1, diffraction experiment temperature T = 100.00(10) K.

[0366] Example 5. Sequence-dependent experiments of siRNAs containing different chemical modifications The experimental compounds of the present disclosure were tested in several different sequences. Using siRNAs targeting different gene mRNAs, (+)hmpNA(A), (-)hmpNA(A) and GNA(A) compounds as control were used to modify the 5'-end 7th position of AS chain (sequences are shown in Table 4-1 and Table 4-2).

[0367] [Table 4]

[0368] [Table 5] The results of the on-target activity experiments are shown in Table 5. (A) shows obvious sequence dependency, and the on-target activity of different sequences is obviously different. The experimental compounds according to the present disclosure do not show obvious sequence dependency, and have stronger general applicability.

[0369] [Table 6]

[0370] The results of the off-target activity experiments are shown in Table 6 and demonstrate that the experimental compounds of the present disclosure clearly reduce the off-target activity of siRNAs compared to the parent sequences.

[0371] [Table 7]

[0372] Example 6. Evaluation of different modifications at positions 9 and 10 of the AS chain This experiment examined the suppression efficiency of siRNA complexes modified with 2'-fluoro at different sites of the present disclosure on target gene mRNA expression levels in vivo.

[0373] Male 6-8 week old C57BL / 6 mice were randomly divided into groups, 6 mice per group, 3 mice per time point, and mice in each group were administered with the test complex (2 pieces, TRD007047 and TRD006870), the comparative complex (TRD002218) and PBS, respectively. All animals were administered a single dose by subcutaneous injection, with the dosage calculated according to body weight, the siRNA complex dosage (in terms of siRNA amount) was 1mgmg / kg, and the administration volume was 5mL / kg. Seven days after administration, the mice were sacrificed, the livers were collected and preserved with RNA later (Sigma Aldrich), and then the liver tissue was homogenized with a tissue homogenizer, and the liver tissue total RNA was extracted and obtained with a tissue RNA extraction reagent kit (Fanzhi Medical Technology, FG0412) according to the operation steps described in the instruction manual. The total RNA was reverse transcribed into cDNA, and the expression level of TTR mRNA in the liver tissue was detected by real-time fluorescent quantitative PCR method. In the fluorescent quantitative PCR method, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used as an internal reference gene, and the mRNA expression levels of TTR and GAPDH were detected by Taqman probe primers for TTR and GAPDH, respectively. Compound information is shown in Table 7, grouping information of experimental compounds in mice is shown in Table 8, and primers are shown in Table 9.

[0374] Unless otherwise specified, all sequences listed in the tables below and elsewhere in the specification are in the 5' to 3' orientation.

[0375] [Table 8]

[0376] The NAG1 structure is [ka] It was.

[0377] Compound NAG1 was prepared according to the method described in patent WO2021254360A1.

[0378] The L96 structure is [ka] It was.

[0379] The control compound L96 was prepared according to the method described in patent WO2014025805A1.

[0380] [Table 9]

[0381] [Table 10]

[0382] After 28 days of administration, the suppression efficiency of the siRNA complexes modified with fluoro at different sites of the present disclosure on the expression level of target gene mRNA in vivo is shown in Table 10. With reference to the positive control TRD002218, the siRNA complexes modified with fluoro at different sites had a higher suppression efficiency on TTR mRNA expression after 28 days of administration than the reference positive control, and both of the two modification methods showed high suppression efficiency and no significant difference, suggesting that the two modification methods at positions 9 and 10 of the AS chain can mediate more efficient suppression efficiency.

[0383] [Table 11]

[0384] The expression level of TTR mRNA was calculated according to the following equation. TTR mRNA expression level = [(TTR mRNA expression level in test group / GAPDH mRNA expression level in test group) / (TTR mRNA expression level in control group / GAPDH mRNA expression level in control group)] × 100%

[0385] Part 2. Targeting Ligands Example 7. Preparation of NAG0052, L96 Compounds NAG0024 and NAG0026 were purchased from Tianjin Yaoming Kangde New Drug Development Co., Ltd. Unless otherwise stated, all reagents used in the following examples are commercially available products.

[0386] (1) Synthesis of compound NAG0052 The starting material, compound 1, was purchased from Jiangsu Power Pharmaceutical Technology Co., Ltd.

[0387] [ka] [ka] The specific preparation process of NAG0052 is as follows: compound 2 At 0°C and nitrogen gas protection, NaH (12.2g, 304mmol, 60% purity) was added in portions to a solution of compound 1 (12.3mL, 101mmol) in THF (300mL). The mixture was stirred at 20°C for 1 hour, then cooled to 0°C again, and benzyl bromide (36.3mL, 304mmol) was added dropwise to the system, and stirred at 20°C for 12 hours. The reaction solution was quenched with H2O (100mL) and extracted with EtOAc (200mL x 2). The combined organic phase was washed with saturated brine (100mL), dried over Na2SO4, filtered, and concentrated to obtain a residue that was separated by silica gel column chromatography to obtain the target compound 2 (20.0g, 51.8mmol, 51% yield). LCMS: t R = 2.615 and 2.820 min in 30-90AB_7 min_220&254_Shimadzu.lcm (Xtimate C18, 3um, 2.1*30mm), MS (ESI) m / z = 351.2 [M+Na] + . 1 H NMR: (400 MHz, CDCl3) δ ppm 7.35-7.12 (m, 10H), 5.06-4.95 (m, 1H), 4.51-4.39 (m, 4H), 4.24-3.87 (m, 2H), 3.50-3.40 (m, 2H), 3.38-3.20 (m, 3H), 2.20-1.91 (m, 2H).

[0388] Compound 3 and Compound 4 At 20°C and nitrogen gas protection, TMSCN (13.5mL, 101mmol) was added at once to a solution of compound 2 (13.0g, 33.6mmol) in DCM (300mL), and then a solution of TMSOTf (9.14mL, 50.5mmol) in DCM (30mL) was added dropwise. The reaction solution was stirred at 20°C for 15 hours. After the reaction was completed, the system was quenched with saturated aqueous NaHCO3 (80mL) and extracted with DCM (150mL x 2). The combined organic phase was washed with saturated brine (80mL), dried over Na2SO4, filtered and concentrated, and separated by silica gel column chromatography to obtain the target compound 3 (3.30g, 9.18mmol, 27% yield) and pale yellow oily liquid compound 4 (8.50g, 9.18mmol, 70% yield).

[0389] compound 3 1 H NMR: (400 MHz, CDCl3) δ ppm 7.42-7.29 (m, 10H), 4.81 (t, J = 7.8 Hz, 1H), 4.65-4.49 (m, 4H), 4.30-4.21 (m, 2H), 3.65-3.57 (m, 1H), 3.57-3.49 (m, 1H), 2.49-2.40 (m, 2H).

[0390] compound 4 1 H NMR: (400 MHz, CDCl3) δ ppm 7.42-7.26 (m, 10H), 4.93-4.87 (m, 1H), 4.65-4.48 (m, 4H), 4.43-4.38 (m, 1H), 4.21-4.17 (m, 1H), 3.79-3.70 (m, 1H), 3.54 (d, J = 4.0 Hz, 1H), 2.45-2.37 (m, 2H).

[0391] compound 5 At 0°C and nitrogen gas protection, a solution of compound 4 (3.00 g, 9.28 mmol) in THF (15 mL) was added dropwise to a solution of LiAlH4 (0.79 g, 20.9 mmol) in THF (15 mL), and after the addition was completed, the system was reacted at 0°C for 1 h. The complete disappearance of the raw material was monitored by TLC (PE: EtOAc = 3: 1). Sodium sulfate decahydrate was gradually added to the reaction solution until no foaming occurred. The reaction solution was then filtered, and the filter cake was washed three times with dichloromethane (60 mL), after which the filtrate was collected and concentrated to dryness to obtain the target compound 5 (3.00 g, 90% yield). 1 H NMR: (400 MHz, DMSO-d6) δ ppm 7.40-7.14 (m, 10H), 4.54-4.38 (m, 4H), 4.06-3.99 (m, 2H), 3.91 (q, J = 6.4 Hz, 1H), 3.48-3.37 (m, 2H), 2.67-2.52 (m, 2H), 2.21-2.18 (m, 1H), 1.77-1.73 (m, 1H).

[0392] compound 6 Under nitrogen gas protection, compound 5 (3.00 g, 8.25 mmol) was dissolved in DCM (30 mL), TEA (3.44 mL, 24.7 mmol) and CbzCl (1.76 mL, 12.4 mmol) were added, and the mixture was reacted at 20° C. for 2 h. LCMS showed the reaction was complete. The reaction mixture was extracted with dichloromethane (30 mL) and water (60 mL). The organic phase was washed three times with water (60 mL×3), dried over anhydrous sodium sulfate, concentrated, and purified by normal phase column (PE:EtOAc=1:1) to give the target compound 6 (2.5 g, 90% yield). LCMS: t R = 0.810 min in 5-95AB_1min, MS (ESI) m / z =462.2 [M+H] + . 1H NMR: (400 MHz, CDCl3) δ ppm 7.39-7.29 (m, 15H), 5.35 (s, 1H), 5.15-5.01 (m, 2H), 4.72 (d, J = 6.0 Hz, 1H), 4.54-4.40 (m, 3H), 4.26 (s, 1H), 4.23-4.18 (m, 1H), 4.11-4.04 (m, 1H), 3.54-3.41 (m, 3H), 3.37-3.25 (m, 1H), 2.34-2.23 (m, 1H), 1.85-1.79 (m, 1H).

[0393] compound 7 Under nitrogen gas protection, compound 6 (2.00 g, 3.90 mmol) was dissolved in DCM (5 mL), and a solution of BCl3 in THF (1 M, 27.3 mL) was added at -78 °C and reacted for 1 h. The complete disappearance of the raw material was monitored by TLC (DCM:MeOH = 10:1). The reaction solution was quenched by adding methanol (20 mL) at -78 °C, concentrated, and purified by normal phase column (DCM:MeOH = 10:1) to obtain the target compound 7 (2.00 g, 60% yield). 1 H NMR: (400 MHz, CD3OD) δ ppm 7.41-7.23 (m, 5H), 5.08 (s, 2H), 4.25-4.07 (m, 2H), 3.85-3.75 (m, 1H), 3.63-3.56 (m, 1H), 3.54-3.48 (m, 1H), 3.30-3.27 (m, 2H), 2.34-2.21 (m, 1H), 1.71-1.64 (m, 1H).

[0394] compound 8 Under nitrogen gas protection, compound 7 (0.50 g, 1.78 mmol) was dissolved in pyridine (5 mL), and 4A molecular sieves (500 mg) and DMTrCl (0.66 mL, 2.13 mmol) were added at 0 ° C., and then the temperature was raised to 20 ° C. and reacted for 1.5 hours. The complete disappearance of the raw material was monitored by TLC (PE: EtOAc = 2: 1). The reaction solution was extracted by adding ethyl acetate (60 mL) and water (60 mL), and the organic phase was washed three times with water (60 mL × 3), dried over anhydrous sodium sulfate, concentrated, and purified by normal phase column (PE: EtOAc = 1: 1) to obtain the target compound 8 (800 mg, yield 90%). 1 H NMR: (400 MHz, CDCl3) δ ppm 7.44 (d, J = 7.6 Hz, 2H), 7.37-7.23 (m, 11H), 7.22-7.15 (m, 1H), 6.84 (d, J = 8.8 Hz, 4H), 5.09 (s, 2H), 4.31-4.17 (m, 2H), 4.02-3.91 (m, 1H), 3.84-3.73 (m, 6H), 3.33 (s, 1H), 3.28 (s, 1H), 3.19-3.01 (m, 2H), 2.34-2.25 (m, 1H), 1.70-1.62 (m, 1H).

[0395] compound 9 Compound 8 (800 mg, 1.234 mmol) was dissolved in EtOAc (5 mL), Pd / C 10% (800 mg, 7.517 mmol) was added, and the reaction was run under H2 conditions (15 Psi) at 20°C for 1 h. LCMS showed that the reaction was already complete. The reaction was filtered, and the filter cake was washed with dichloromethane (100 mL) and methanol (100 mL) three times, concentrated, and separated through a reverse phase column to give compound 9 (300 mg, 54%). LCMS: t R = 2.586 min in 10-80CD_3min MS (ESI) m / z = 450.2 [M+H] + .

[0396] compound 11 Compound 10 (435 mg, 1.780 mmol) was dissolved in DCM (10 mL), DIEA (0.441 mL, 2.67 mmol) and HATU (677 mg, 1.78 mmol) were added, and compound 9 (400 mg, 0.890 mmol) was further added and reacted at 20 ° C for 1 hour. The reaction was monitored to be complete by TLC (DCM: MeOH = 10: 1). The reaction solution was extracted with dichloromethane (60 mL) and water (60 mL), and the organic phase was washed three times with water (60 mL × 3), dried over anhydrous sodium sulfate, concentrated, and purified by normal phase column (PE: EtOAc = 0: 1 was applied to the column, and the product peak appeared at 100%) to obtain the target compound 11 (600 mg, yield 90%). LCMS: t R = 2.745 min in 30-90CD_3min, MS (ESI) m / z =698.4 [M+Na] + . 1 H NMR: (400 MHz, CD3OD) δ ppm 7.46-7.38 (m, 2H), 7.35-7.24 (m, 6H), 7.22-7.16 (m, 1H), 6.90-6.78 (m, 4H), 4.29-4.21 (m, 2H), 4.02-3.95 (m, 1H), 3.77 (s, 6H), 3.66-3.62 (m, 3H), 3.41 (s, 1H), 3.18-3.04 (m, 2H), 2.36-2.17 (m, 5H), 1.71-1.50 (m, 5H), 1.39-1.25 (m, 14H).

[0397] compound 12 Compound 11 (600 mg, 0.799 mmol) was dissolved in THF (3 mL) and HO (1 mL), LiOH.HO (134 mg, 3.20 mmol) was added, and the mixture was reacted at 20° C. for 12 h. TLC (DCM:MeOH=10:1) showed the reaction was complete. The reaction solution was concentrated to dryness, dissolved in water (5 mL) and methanol (5 mL), and purified by reverse phase column (HO:CHCN=1:1, peak at about 35%) to obtain the target compound 12 (460 mg, 100% yield, lithium salt). LCMS: tR = 1.346 min in 10-80CD_3min, MS (ESI) m / z =684.3 [M+Na] + . HPLC: R = 1.879 min in 10-80CD_6min. 1 H NMR: (400 MHz, CD3OD) δ ppm 7.47-7.39 (m, 2H), 7.35-7.24 (m, 6H), 7.22-7.15 (m, 1H), 6.91-6.79 (m, 4H), 4.31-4.18 (m, 2H), 4.02-3.95 (m, 1H), 3.78 (s, 6H), 3.44-3.33 (m, 2H), 3.18-3.04 (m, 2H), 2.35-2.27 (m, 1H), 2.24-2.10 (m, 4H), 1.70-1.51 (m, 5H), 1.31-1.23 (m, 12H).

[0398] compound 13 At room temperature and under nitrogen gas protection, compound NAG0024 (271 mg, 0.151 mmol) was dissolved in anhydrous THF (2 mL) and anhydrous DMF (4 mL), 3A molecular sieves were added, and compound 12 (100 mg, 0.151 mmol), HOBt (25 mg, 0.181 mmol), DCC (38 mg, 0.181 mmol) and DIEA (39 mg, 0.302 mmol) were added in sequence. The reaction solution was reacted at 45 ° C for 16 h, and after LC-MS showed that the reaction was complete, it was quenched by adding water and filtered. The filtrate was concentrated and then purified through a C18 reverse phase column (H2O / MeCN) to obtain compound 13 (210 mg, 57% yield).

[0399] Compound NAG0052 Compound 13 (230 mg, 0.094 mmol) was dissolved in pyridine (5 mL) at room temperature, molecular sieves were added, and DMAP (12 mg, 0.283 mmol) and succinic anhydride (28 mg, 0.283 mmol) were added. The mixture was stirred at 50°C for 16 hours under nitrogen gas protection. The reaction was detected to be complete by LCMS, filtered, and concentrated to dryness. After purification by C18 reverse phase column, secondary purification was performed by preparative HPLC to obtain the target compound NAG0052 (123 mg, 0.048 mmol, 51% yield). MS(ESI)m / z=2535.3[M-1] - . Theory:2536.2. 1 H NMR (400 MHz, acetonitrile-d3) δ 7.48-7.43 (m, 2H), 7.37-7.12 (m, 11H), 7.00-6.85 (m, 10H), 6.66 (s, 1H), 5.31 (dd, J = 3.4, 1.1 Hz, 3H), 5.20-5.13 (m, 1H), 5.05 (dd, J = 11.3, 3.4 Hz, 3H), 4.56 (d, J = 8.5 Hz, 3H), 4.30 (dd, J = 7.7, 5.3 Hz, 1H), 4.18-3.93 (m, 14H), 3.79 (s, 10H), 3.65 (q, J = 4.7, 3.6 Hz, 13H), 3.56-3.07 (m, 24H), 2.56 (s, 6H), 2.37 (t, J = 5.8 Hz, 10H), 2.17 (t, J = 7.5 Hz, 9H), 2.02-1.96 (m, 20H), 1.88 (s, 8H), 1.82-1.73 (m, 2H), 1.60 (dt, J = 15.0, 7.3 Hz, 16H), 1.27 (s, 13H).

[0400] Example 8. Synthesis of siRNA Complexes 1. Homemade vector-conjugated resin The compound NAG0052 (157 mg, 0.062 mmol) containing a carboxylic acid group was dissolved in anhydrous DMF (3 mL). After the substrate was completely dissolved, anhydrous acetonitrile (4 mL), DIEA (0.03 mL, 0.154 mmol, 2.5 eq) and HBTU (35 mg, 0.093 mmol, 1.5 eq) were added in sequence. After the reaction solution was mixed uniformly, macroporous aminomethyl resin (476 mg, blank loading 0.41 mmol / g, target loading 0.1 mmol / g) was further added. The reaction solution was placed in a shaker (temperature: 25° C., rotation speed: 200 rpm) and shaken overnight. The reaction solution was filtered, and the filter cake was washed with DCM and anhydrous acetonitrile in sequence, respectively, and the solid was collected and dried in vacuum overnight.

[0401] The solid from the previous step was dispersed in anhydrous acetonitrile (5 mL), and pyridine (0.18 mL), DMAP (3 mg), NMI (0.12 mL), and CapB1 (2.68 mL) were added in that order. The reaction solution was placed in a shaker (temperature: 25 °C, rotation speed: 200 rpm) and shaken for 2 h. The reaction solution was filtered, the filter cake was washed with anhydrous acetonitrile, and the solid was collected and dried in vacuum overnight to obtain the vector-attached resin. The loading was measured to be 0.1 mmol / g.

[0402] 2. For NAG0052 already linked to a resin, starting from the resin, nucleoside monomers were linked one by one from the 3'-5' direction according to the nucleotide sequence order. Linking with one nucleoside monomer involves four steps of deprotection, coupling, capping, and oxidation or sulfurization, and the procedures are common in the field. Compound NAG0052 was linked to the sequence by solid-phase synthesis, and further subjected to aminolysis, after which some functional groups were removed from the structure of NAG0052 to become NAG0052'.

[0403] The siRNA complexes prepared had the sense and antisense strands shown in Tables 11 and 12.

[0404] [Table 12]

[0405] [Table 13]

[0406] [Table 14] Among them, complex TRD002218 was taken as the reference positive compound, and Z represented siRNA.

[0407] Example 9. Suppression of target gene mRNA expression in vivo by siRNA complex This experiment investigated the efficiency of siRNA complexes of the present disclosure complexed with different structures to suppress target gene mRNA expression in vivo.

[0408] Male 6-8 week old C57BL / 6 mice were randomly assigned to groups, with a total of 6 mice per group, 3 mice per time point, and mice in each group were administered the conjugate TRD007205 of the present disclosure, the reference positive nucleic acid ligand conjugate TRD002218, and PBS, respectively.

[0409] All animals were administered a single dose by subcutaneous injection, with the dosage calculated according to body weight, the siRNA complex dosage (in terms of siRNA amount) was 1 mg / kg, and the administration volume was 5 mL / kg. 7 and 28 days after administration, the mice were sacrificed, the livers were collected and preserved with RNA later (Sigma Aldrich), and then the liver tissue was homogenized with a tissue homogenizer, and total liver tissue RNA was extracted using a tissue RNA extraction reagent kit (Fanzhi Medical Technology, FG0412) according to the operation steps described in the instruction manual. The total RNA was reverse transcribed into cDNA, and the expression level of TTR mRNA in the liver tissue was detected by real-time fluorescent quantitative PCR. In the fluorescent quantitative PCR, the glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used as an internal reference gene, and the mRNA expression levels of TTR and GAPDH were detected by Taqman probe primers for TTR and GAPDH, respectively. The sequences of the detection primers were the same as those in Table 9.

[0410] [Table 15]

[0411] The expression level of TTR mRNA was calculated according to the following equation.

[0412] TTR mRNA expression level = [(TTR mRNA expression level in test group / GAPDH mRNA expression level in test group) / (TTR mRNA expression level in control group / GAPDH mRNA expression level in control group)] × 100%.

[0413] The suppression efficiency of the siRNA complexes of the present disclosure complexed with different structures on the target gene mRNA expression level in vivo after 7 and 28 days of administration is shown in Figures 1 and 2, respectively.

[0414] As can be seen from the results in Figure 1, after 7 days of administration, the complex TRD007205 had good effects on suppressing TTR mRNA expression, indicating that it could mediate more efficient delivery. As can be seen from Figure 2, after 28 days of administration, the inhibitory effect of TRD007205 on the expression level of target gene mRNA was superior to that of TRD002218.

[0415] Part 3. Screening and activity verification of siRNA and siRNA complexes targeting LPA Example 10. Design and synthesis of human LPA siRNA 1) siRNA was designed to target human LPA (NM_005577.3) and to satisfy the general rules for active siRNA. The sequences of the unmodified sense and antisense strands are shown in Tables 15 and 16.

[0416] When synthesizing the 7-position modified nucleotide of the 5' AS strand, the phosphoramidite monomer or the phosphoramide monomer modified with a 2'-methoxy group synthesized in Example 1 replaced the original nucleotide of the parent sequence. The sequence of the antisense strand modified with the 7-position of the 5' AS strand is shown in detail in Table 15, in which W' is a nucleotide modified with a 2'-methoxy group or [ka] or a tautomeric modification thereof, In which, M is O or S, and in which, in SEQ ID NO:5, W' is [ka] When B is selected from A, in SEQ ID NO: 6, W' is [ka] If B is chosen from G, then B is chosen from G.

[0417] [Table 16]

[0418] [Table 17]

[0419] The sequences of the sense and antisense strands of LPA siRNA modified with 2'-fluoro, 2'-methoxy groups, etc. are shown in detail in Tables 17 and 20, the changes in optical activity due to modification at position 7 of the antisense strand are shown in detail in Table 18, and the sequences of the modified sense and antisense strands of the LPA siRNA complex are shown in detail in Tables 19 and 21.

[0420] [Table 18]

[0421] [Table 19]

[0422] [Table 20]

[0423] [Table 21]

[0424] [Table 22]

[0425] In Tables 17 to 21, the nucleotide synthesized using 2-hydroxymethyl-1,3-propanediol as a starting material is defined as hmpNA, and hmpNA has a racemic structure. (-)hmpNA(A) is obtained by solid-phase synthesis from the nucleoside phosphoramidite monomer 1-1a in Example 1.1, and (+)hmpNA(A) is an optical isomer. A lowercase letter m indicates that one nucleotide adjacent to the left of the letter m is modified with a 2'-methoxy group, and a lowercase letter f indicates that one nucleotide adjacent to the left of the letter f is modified with a 2'-fluoro group; A lowercase s between uppercase letters indicates that the linkage between the two nucleotides adjacent to the s is a thiophosphate linkage; When the lowercase letter s is at the first position of the 3' end, it indicates that the terminal of one nucleotide adjacent to the left of the letter s is a thiophosphate group.

[0426] The structure of NAG0052' is [ka] It was.

[0427] Example 11. On-target activity at 5 siRNA psiCHECK concentration points HEK293A cells were cultured in DMEM high glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2. 24 h before transfection, HEK293A cells were seeded into 96-well plates at a seeding density of 8 × 10 3 cells / well with 100 μL of medium in each well.

[0428] Cells were co-transfected with siRNA and the corresponding plasmid using Lipofectamine2000 (ThermoFisher, 11668019) according to the instruction manual, and 0.3 μL of Lipofectamine2000 was used for each well. The transfection amount of plasmid was 40 ng / well. For the on-target plasmid, siRNA was set up with a total of 5 concentration points, with the final concentration of the highest concentration point being 10 nM, and diluted 10-fold (10 nM, 1 nM, 0.1 nM, 0.01 nM, 0.001 nM). 24 h after transfection, on-target activity was detected by Dual-Luciferase Reporter Assay System (Promega, E2940). The results were as shown in Table 22. The results showed that siRNA TRD001307 had significant activity.

[0429] [Table 23]

[0430] Example 12. psiCHECK On-target activity of 9 concentration points of siRNA / siRNA complexes We performed in vitro molecular level simulations and on-target activity screening of siRNA / siRNA complexes using nine concentration gradients in HEK293A cells.

[0431] HEK293A cells were cultured in DMEM high glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2. 24 h before transfection, HEK293A cells were seeded into 96-well plates at a seeding density of 8 × 10 3 cells / well with 100 μL of medium in each well.

[0432] The cells were co-transfected with the siRNA / siRNA complex and the corresponding plasmid using Lipofectamine2000 (ThermoFisher, 11668019) according to the instruction manual, and 0.3 μL of Lipofectamine2000 was used for each well. The transfection amount of the plasmid was 40 ng / well. For the on-target sequence plasmid, the siRNA / siRNA complex was set up at a total of 9 concentration points, with the final concentration of the highest concentration point being 20 nM, and was diluted 3-fold to 20 nM, 6.666666667 nM, 2.222222222 nM, 0.740740741 nM, 0.24691358 nM, 0.082304527 nM, 0.027434842 nM, 0.009144947 nM, and 0.003048316 nM. 24 h after transfection, on-target levels were detected by the Dual-Luciferase Reporter Assay System (Promega, E2940).

[0433] In this example, tests were performed using TJR00366 (comprising a sense strand shown in SEQ ID NO:2 and an antisense strand shown in SEQ ID NO:4) and TJR00373 (comprising a sense strand shown in SEQ ID NO:1 and an antisense strand shown in SEQ ID NO:3), neither of which are modified in their sense or antisense strands, as well as TJR100391 (comprising a sense strand shown in SEQ ID NO:53 and an antisense strand shown in SEQ ID NO:46) and TJR100392 (comprising a sense strand shown in SEQ ID NO:54 and an antisense strand shown in SEQ ID NO:47), which contain modified sense and antisense strands and are conjugated to NAG0052'.

[0434] The results showed that the unmodified siRNAs (naked sequences) TJR100366 and TJR100373 both had significant activity compared to their respective similar unmodified siRNA sequences (TJR100367-TJR100372 and TJR100374-TJR100380, respectively), and that the naked sequence modified TJR100391 and TJR100392 also had significant activity compared to their respective similar siRNA complexes (TJR100390 and TJR100394, respectively).

[0435] [Table 24-1] [Table 24-2]

[0436] Example 13. Inhibition of human LPA by siRNA in human primary hepatocytes (PHH) - Inhibitory activity at seven concentration points siRNA sequences were screened for activity in primary human hepatocytes (PHHs) using a seven concentration gradient. The initial final transfection concentration of each siRNA sample was 20 nM, with a five-fold gradient dilution, resulting in seven concentration points.

[0437] PHHs were cryopreserved in liquid nitrogen, and 24 h prior to transfection, primary human hepatocytes (PHHs) were resuscitated and then seeded into 96-well plates at a seeding density of 3 × 10 4 cells / well with 80 μL of medium in each well.

[0438] According to the product instruction manual, siRNA was transfected by Lipofectamine RNAi MAX (ThermoFisher, 13778150), and the gradient final concentration of siRNA transfection was 20nM, 4nM, 0.8nM, 0.16nM, 0.032nM, 0.0064nM and 0.00128nM. After 24 hours of treatment, total cellular RNA was extracted by high-throughput cellular RNA extraction reagent kit, RNA reverse transcription experiment and quantitative real-time PCR detection were performed to measure the mRNA level of human LPA, and the mRNA level of human LPA was corrected by the level of GAPDH internal reference gene.

[0439] Among them, for quantitative real-time PCR detection, probe Q-PCR detection experiments were used, and the primer information is shown in Tables 24 and 25.

[0440] After the Taqman probe Q-PCR detection experiment is completed, the corresponding Ct value is obtained according to the threshold automatically set by the system, and the expression of a certain gene can be relatively quantified by comparing the Ct values: the Ct comparison is to calculate the difference in gene expression by the difference value with the internal reference gene Ct value, and the difference is calculated by the difference value. -△△Ct Also called △△Ct = [(Ct experimental group target gene - Ct experimental group internal standard) - (Ct control group target gene - Ct control group internal standard)]. Inhibition rate (%) = (1 - excess target gene expression) x 100%.

[0441] The results are shown as the excess percentage of human LPA mRNA expression in cells treated with control siRNA. The IC50 results of the inhibition rate are shown in Table 26.

[0442] The results showed that TJR100373 had significantly superior activity.

[0443] [Table 25]

[0444]

Table 26

[0445]

Table 27

Claims

1. An siRNA targeting LPA, comprising a sense strand and an antisense strand forming a double-stranded region, the sense strand comprises at least 15 consecutive nucleotides and differs by no more than 3 nucleotides from the nucleotide sequence of any one of SEQ ID NO: 1 or SEQ ID NO: 2; and The antisense strand comprises at least 15 consecutive nucleotides and differs from the nucleotide sequence of any one of SEQ ID NO: 3 or SEQ ID NO: 4 by no more than 3 nucleotides. siRNA.

2. Group 1: the sense strand shown in SEQ ID NO: 1 and the antisense strand shown in SEQ ID NO: 3) Group 2: the sense strand shown in SEQ ID NO: 2 and the antisense strand shown in SEQ ID NO: 4); or selected from the nucleotide sequence set forth in any one of the groups: The siRNA described in claim 1.

3. At least one nucleotide of the sense strand and / or the antisense strand is a modified nucleotide. The siRNA described in claim 1.

4. At least one nucleotide at positions 2 to 8 of the 5' end of the antisense strand is a modified nucleotide, - the modified nucleotide is a nucleotide modified with a 2'-methoxy group, or The modified nucleotide comprises a chemical modification according to formula (I) or a tautomeric modification thereof, wherein the chemical modification according to formula (I) is 【Chemistry 1】 Selected from B's are independently selected from bases corresponding to positions 2 to 8 of the 5' end of the antisense strand; The siRNA described in claim 1.

5. The nucleotide at position 5, 6, or 7 of the 5' end of the antisense strand is - a nucleotide modified with a 2'-methoxy group, or - a chemical modification according to formula (I) or a tautomeric modification thereof, said chemical modification according to formula (I) being 【Chemistry 2】 Selected from B's are independently selected from bases corresponding to positions 2 to 8 of the 5' end of the antisense strand, When the chemical modification shown in formula (I) or its tautomer modification is at the 5-position of the 5'-end, B is a base at the 5-position of the 5'-end of the antisense strand; When the chemical modification shown in formula (I) or its tautomer modification is at the 6-position of the 5'-end, B is a base at the 6-position of the 5'-end of the antisense strand; When the chemical modification shown in formula (I) or its tautomer modification is at the 7-position of the 5'-end, B is the base at the 7-position of the 5'-end of the antisense strand; The siRNA described in claim 1.

6. three consecutive nucleotides of the sense strand are 2'-fluoro modified nucleotides; and / or the nucleotides at positions 2, 4, 6, 9, 12, 14, 16, and 18 of the antisense strand in the 5' to 3' direction are each independently 2'-fluoro modified nucleotides; or In the 5' to 3' direction, the nucleotides at positions 2, 4, 6, 10, 12, 14, 16, and 18 of the antisense strand are each independently 2'-fluoro-modified nucleotides. The siRNA described in claim 1.

7. The sense strand is 5'-N a N a N a N a N a N a N b N b N b N a N a N a N a N a N a N a N a N a N a -3', or, 5'-N a N a N a N a N b N a N b N b N b N a N a N a N a N a N a N a N a N a N a -3', Among them, N a is a nucleotide modified with a 2'-methoxy group, and N b is a 2'-fluoro modified nucleotide, The siRNA described in claim 1.

8. The antisense strand is 5'-N a 'N b 'N a 'N b 'N a 'N b 'W'N a 'N a 'N b 'N a 'N b 'N a 'N b 'N a 'N b 'N a 'N b 'N a 'N a 'N a '-3', or, 5'-N a 'N b 'N a 'N b 'N a 'N b 'W'N a 'N b 'N a 'N a 'N b 'N a 'N b 'N a 'N b 'N a 'N b 'N a 'N a 'N a '-3', Among them, N a ' is a nucleotide modified with a 2'-methoxy group, N b ' is a 2'-fluoro modified nucleotide, W' is a nucleotide modified with a 2'-methoxy group, or W' is a nucleotide containing a chemical modification represented by formula (I) or a tautomer modification thereof, wherein the chemical modification represented by formula (I) is 【Transformation 3】 Selected from B's are independently selected from bases corresponding to positions 2 to 8 of the 5' end of the antisense strand; The siRNA described in claim 1.

9. W' is 【Chemistry 4】 B is selected from nucleotides containing a modification, wherein B is a base, and preferably B is selected from the base at the position corresponding to position 7 of the 5' end of the antisense strand; The siRNA described in claim 8.

10. W' is selected from nucleotides modified with a 2'-methoxy group; The siRNA described in claim 8.

11. At least one phosphate group in the sense strand and / or the antisense strand is a phosphate group having a modifying group, preferably a thiophosphate group. The siRNA described in claim 1.

12. the sense strand comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 39 to 43; the antisense strand comprises a nucleotide sequence set forth in any one of SEQ ID NOs: 44 to 52; Preferably, the siRNA comprises: Group 1: the sense strand shown in SEQ ID NO: 42 and the antisense strand shown in SEQ ID NO: 49); Group 2), the sense strand shown in SEQ ID NO: 43 and the antisense strand shown in SEQ ID NO: 50 Group 3), the sense strand shown in SEQ ID NO: 42 and the antisense strand shown in SEQ ID NO: 50 Group 4), the sense strand shown in SEQ ID NO: 43 and the antisense strand shown in SEQ ID NO: 49 Group 5), the sense strand shown in SEQ ID NO: 39 and the antisense strand shown in SEQ ID NO: 44 Group 6), the sense strand shown in SEQ ID NO: 40 and the antisense strand shown in SEQ ID NO: 45 Group 7), the sense strand shown in SEQ ID NO: 39 and the antisense strand shown in SEQ ID NO: 46 Group 8), the sense strand shown in SEQ ID NO: 40 and the antisense strand shown in SEQ ID NO: 47 Group 9), the sense strand shown in SEQ ID NO: 41 and the antisense strand shown in SEQ ID NO: 48 The sense strand and the antisense strand of any one of the groups The siRNA described in claim 1.

13. 10. A method for producing a nucleotide sequence comprising the siRNA of claim 1 and a targeting ligand linked to an end of the siRNA, Preferably, the targeting ligand is linked to the 3' end of the sense strand of the siRNA. siRNA complex.

14. the targeting ligand comprises at least one targeting moiety; the targeting moieties are each independently selected from galactose, galactosamine, N-formyl-galactosamine, N-acetyl-galactosamine, N-propionyl-galactosamine, N-n-butyryl-galactosamine, and N-isobutyryl-galactosamine; Preferably, the targeting moiety is N-acetyl-galactosamine; More preferably, the targeting ligand comprises three identical or different targeting moieties. The siRNA complex of claim 13.

15. The targeting ligand is a compound represented by formula (II) or a pharmaceutically acceptable salt thereof, wherein the formula (II) is 【Transformation 5】 That is, The siRNA complex of claim 14.

16. 1. An siRNA complex comprising a sense strand and an antisense strand forming a double-stranded region, the sense strand comprises any one of SEQ ID NOs: 53 to 57; the antisense strand comprises any one of SEQ ID NOs: 49 to 52 and SEQ ID NOs: 58 to 60; Preferably, the siRNA complex comprises: Group 1: the sense strand shown in SEQ ID NO: 56 and the antisense strand shown in SEQ ID NO: 49); Group 2), the sense strand shown in SEQ ID NO: 57 and the antisense strand shown in SEQ ID NO: 50 Group 3), the sense strand shown in SEQ ID NO: 56 and the antisense strand shown in SEQ ID NO: 50 Group 4), the sense strand shown in SEQ ID NO: 57 and the antisense strand shown in SEQ ID NO: 49 Group 5), the sense strand shown in SEQ ID NO: 53 and the antisense strand shown in SEQ ID NO: 46 Group 6), the sense strand shown in SEQ ID NO: 54 and the antisense strand shown in SEQ ID NO: 47 Group 7), the sense strand shown in SEQ ID NO: 55 and the antisense strand shown in SEQ ID NO: 48 The sense strand and the antisense strand of any one of the groups siRNA complex.

17. A complex comprising the siRNA according to any one of claims 1 to 12 or the siRNA complex according to any one of claims 13 to 16, and a pharmaceutically acceptable vector. Pharmaceutical compositions.

18. The siRNA according to any one of claims 1 to 12, cell.

19. The siRNA complex according to any one of claims 1 to 12 or the siRNA complex according to any one of claims 13 to 16, kit.

20. A method for inhibiting LPA expression, comprising: Administering an effective amount or dose of the siRNA of any one of claims 1 to 12 or the siRNA complex of any one of claims 13 to 16 to a subject. method.

21. 1. A method for treating and / or preventing a disease associated with elevated levels of lipoprotein(a) and / or apolipoprotein(a) in a subject, comprising: The method comprises administering to a subject an effective amount or effective dose of the siRNA according to any one of claims 1 to 12 or the siRNA complex according to any one of claims 13 to 16, wherein preferably the disease associated with elevated levels of lipoprotein (a) and / or apolipoprotein (a) is selected from cardiovascular diseases, more preferably the cardiovascular disease is selected from ischemic stroke, atherosclerosis, thrombus formation, coronary heart disease, lower limb arterial disease or aortic valve stenosis, myocardial infarction, coronary artery stenosis, carotid artery stenosis, femoral artery stenosis, and heart failure; method.

22. 1. A method for treating and / or preventing a disease, comprising:

17. A method for treating a subject comprising administering an effective amount or an effective dose of the siRNA according to any one of claims 1 to 12 or the siRNA complex according to any one of claims 13 to 16 to a subject, wherein the disease is selected from cardiovascular diseases, preferably the cardiovascular diseases are selected from ischemic stroke, atherosclerosis, thrombosis, coronary heart disease, lower limb arterial disease or aortic valve stenosis, myocardial infarction, coronary artery stenosis, carotid artery stenosis, femoral artery stenosis, and heart failure. method.

23. 1. A method for reducing lipoprotein(a) and / or apolipoprotein(a) levels, comprising: Administering an effective amount or dose of the siRNA of any one of claims 1 to 12 or the siRNA complex of any one of claims 13 to 16 to a subject. method.

24. A method for delivering siRNA to the liver that suppresses expression and / or replication of LPA in the body, comprising: Administering the siRNA according to any one of claims 1 to 12 or the siRNA complex according to any one of claims 13 to 16 to a subject. method.

25. 1. A method for preparing an siRNA or an siRNA complex, comprising: The method comprises synthesizing the siRNA according to any one of claims 1 to 12 or the siRNA complex according to any one of claims 13 to 16, method.

26. The siRNA according to any one of claims 1 to 12, vector.