Oligonucleotide combinations for modulating RTEL1 and FUBP1

JP2024546993A5Pending Publication Date: 2025-12-05F HOFFMANN LA ROCHE & CO AG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024536143
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-12-17
Filing Date
2022-12-15
Publication Date
2025-12-05

AI Technical Summary

Technical Problem

Current treatments for chronic hepatitis B virus (HBV) infection, such as nucleos(t)ide analogs and pegylated interferons, fail to target covalently closed circular DNA (cccDNA), leading to incomplete suppression of the virus and potential relapse, necessitating new therapies that can eliminate cccDNA for a cure.

Method used

A combination of inhibitors for Regulator of telomere elongation helicase 1 (RTEL1) and Far Upstream Element-Binding Protein 1 (FUBP1), such as oligonucleotides, is used to synergistically inhibit the expression and activity of these proteins, destabilizing HBV cccDNA.

Benefits of technology

The combination of RTEL1 and FUBP1 inhibitors effectively reduces HBV cccDNA levels, providing a potential cure for chronic HBV infection by targeting the viral reservoir, thereby preventing relapse.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000163_0000
    Figure 00000163_0000
  • Figure 00000163_0001
    Figure 00000163_0001
  • Figure 00000169_0000
    Figure 00000169_0000
Patent Text Reader

Abstract

The present invention relates to a combination of a Regulator of telomere elongation helicase 1 (RTEL1) and a Far Upstream Element-Binding Protein 1 (FUBP1), such as an oligonucleotide (oligomer) that is complementary to RTEL1 and FUBP1, respectively, resulting in the modulation of the expression of RTEL1 and FUBP1 or the modulation of the activity of RTEL1 and FUBP1. The present invention particularly relates to a combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 for use in the treatment and / or prevention of a disease, preferably a Hepatitis B Virus (HBV) infection, in particular a chronic HBV infection. The present invention particularly relates to the use of a combination of a RTEL1 inhibitor and a FUBP1 inhibitor for destabilizing cccDNA, such as HBV cccDNA. Pharmaceutical compositions, kits and their use in the treatment and / or prevention of HBV infection are also included in the present invention.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] FIELD OF THE INVENTION The present invention relates to a combination of a Regulator of telomere elongation helicase 1 (RTEL1) inhibitor and a Far Upstream Element-Binding Protein 1 (FUBP1) inhibitor, such as an oligonucleotide (oligomer) that is complementary to RTEL1 or Far Upstream Element-Binding Protein 1 (FUBP1), respectively, and results in modulation of the expression or activity of RTEL1 and FUBP1. The present invention particularly relates to a combination of an RTEL1 inhibitor and an FUBP1 inhibitor for use in the treatment and / or prevention of disease, preferably hepatitis B virus (HBV) infection, particularly chronic HBV infection. The present invention particularly relates to the use of a combination of an RTEL1 inhibitor and a FUBP1 inhibitor to destabilize cccDNA, such as HBV cccDNA. Pharmaceutical compositions, kits, and their use in the treatment and / or prevention of HBV infection are also encompassed by the present invention. [Background technology]

[0002] background Hepatitis B is an infectious disease caused by the hepatitis B virus (HBV), a small, hepatotropic virus that replicates via reverse transcription. Chronic HBV infection is a significant factor in the development of severe liver diseases such as cirrhosis and hepatocellular carcinoma. Current treatments for chronic HBV infection are based on the administration of pegylated type 1 interferons or nucleoside(t)ide analogs, such as lamivudine, adefovir, entecavir, tenofovir disoproxil, and tenofovir alafenamide, which target the viral polymerase, a multifunctional reverse transcriptase. Successful treatment is usually measured as the disappearance of hepatitis B surface antigen (HBsAg). However, complete HBsAg clearance is rarely achieved because hepatitis B viral DNA persists in the body after infection. HBV persistence is mediated by an episomal form of the HBV genome, which is stably maintained in the nucleus. This episomal form is called "covalently closed circular DNA" (cccDNA). cccDNA serves as a template for all HBV transcripts, including the viral replication intermediate, pregenomic RNA (pgRNA). The presence of several copies of cccDNA may be sufficient to reinitiate late-stage HBV infection. Current treatments for HBV do not target cccDNA. However, elimination of cccDNA may be necessary for the cure of chronic HBV infection (reviewed by Nassal, Gut. 2015 Dec;64(12):1972-84. doi:10.1136 / gutjnl-2015-309809).

[0003] Regulator of telomere elongation helicase 1 (RTEL1) encodes a DNA helicase that functions in telomere stability, protection, and elongation and interacts with proteins in the shelterin complex, which is known to protect telomeres during DNA replication. Mutations in this gene are associated with dyskeratosis congenita and Hoyerall-Hreidarsson syndrome (see, e.g., the review by Vannier et al. 2014 Trends Cell Biol. Vol. 24 p. 416).

[0004] Located in the nucleus, RTEL1 functions as an ATP-dependent DNA helicase involved in telomere length regulation, DNA repair, and maintaining genome stability. RTEL1 controls meiotic recombination and crossover homeostasis by acting as an antirecombinase to counter toxic recombination, restrict crossovers during meiosis, and physically dissociate strand invasion events, thereby promoting meiotic synthesis-dependent strand annealing (SDSA) and noncrossover repair through resolution of D-loop recombination intermediates. Furthermore, RTEL1 prevents telomere fragility by resolving T-loops and antagonizing telomeric G4-DNA structures, ensuring both telomere dynamics and stability.

[0005] RTEL1 has been identified as a stabilizer of HPV episomes in siRNA screening (Edwards et al., 2013, PLoS One Vol. 8, e75406). siRNA targeting RTEL1 has also been used to identify interactors of RTEL1 in Hoyeraal-Hreidarsson syndrome (Schertzer et al., 2015, Nucleic Acid Res. Vol. 43, p. 1834). Additionally, RTEL1 was identified as an HIV host-dependent factor in an siRNA screening against essential host proteins, providing a target for inhibiting HIV infection (WO 2007 / 094818).

[0006] WO 2020 / 011902 relates to RTEL1 inhibitors for use in the treatment of HBV infection, particularly chronic HBV infection.

[0007] Far Upstream Element-Binding Protein 1 (FUBP1 or FBP1) is a single-stranded DNA-binding protein that binds to multiple DNA elements. This protein is also thought to bind RNA and contains 3'-5' helicase activity with in vitro activity toward both DNA-DNA and RNA-RNA duplexes. FUBP1 is known to activate transcription of the proto-oncogene c-myc by binding to the far upstream element (FUSE) located upstream of c-myc in undifferentiated cells. The protein is primarily present in the nucleus of cells. Upregulation of FUBP1 has been observed in many types of cancer. Furthermore, FUBP1 can bind to and mediate the replication of RNA derived from hepatitis C virus and enterovirus (Zhang and Chen 2013 Oncogene vol. 32 pp. 2907-2916).

[0008] FUBP1 has also been identified in hepatocellular carcinoma (HCC) and has been suggested to be involved in HCC tumorigenesis (Ramdzan et al., 2008 Proteomics Vol. 8 p. 5086-5096), and it has been suggested that FUBP1 is required for HCC tumor growth, as exemplified using lentiviral-expressed shRNA targeting FUBP1 (Rabenhorst et al., 2009 Hepatology Vol. 50 p. 1121-1129).

[0009] Knockdown of FUBP1 by lentiviral-expressed shRNA has been demonstrated to enhance treatment response in ovarian cancer (Zhang et al. 2017 Oncology Letters Vol 14 p.5819-5824).

[0010] WO 2004 / 027061 discloses a screening method that includes a step of analyzing whether a test substance inhibits FBP, and a pharmaceutical composition for treating a proliferative disease that contains the substance that inhibits FBP as an active ingredient.

[0011] Several small molecules that inhibit FUBP1 have been identified, all of which are intended to treat cancer (Huth et al. 2004 J Med.Chen Vol 47 p.4851-4857; Hauck et al. 2016 Bioorganic & Medicinal Chemistry Vol 24 p.5717-5729 Hosseini et al. 2017 Biochemical Pharmacology Vol 146 p.53-62 and Xiong et al. 2016 Int J Onc Vol 49 p 623). WO 2004 / 017940 describes lipid-based formulations of SN-38 and claims the treatment of viral infections, particularly HIV, but provides no supporting examples.

[0012] Poly(U)-binding splicing factor 60 (PUF60) is a potential regulator of both transcriptional and post-transcriptional processes of HBV pregenome expression. PUF60 is known to form a complex with FUBP1 in association with c-myc repression. However, FUBP1 is not involved in PUF60-dependent regulation of HBV pregenome expression (Sun et al., 2017 Scientific Reports 7:12874).

[0013] HBV infection remains a major health problem worldwide with an estimated 350 million chronic carriers. Approximately 25% of carriers die from chronic hepatitis, cirrhosis, or liver cancer. Hepatitis B virus is the second most important carcinogen after tobacco, causing 60% to 80% of all primary liver cancers. HBV is 100 times more infectious than HIV.

[0014] WO 2019 / 193165 relates to FUBP1 inhibitors for use in the treatment of HBV infection. Summary of the Invention

[0015] Object of the invention Summary of the Invention The present invention relates to a combination of an inhibitor of RTEL1 and an inhibitor of FUBP1, for example a composition or pharmaceutical composition comprising an inhibitor of RTEL1 and an inhibitor of FUBP1. The inhibitor of RTEL1 is capable of inhibiting the expression and / or activity of RTEL1; the inhibitor of FUBP1 is capable of inhibiting the expression and / or activity of FUBP1. Suitably, the inhibitor of RTEL1 is capable of inhibiting the expression of an RTEL1 nucleic acid. Suitably, the inhibitor of FUBP1 is capable of inhibiting the expression of a FUBP1 nucleic acid. The present invention further relates to said combination, composition or pharmaceutical composition for use in the treatment or prevention of disease.

[0016] The present invention also relates to a kit comprising an inhibitor of RTEL1 and an inhibitor of FUBP1. The inhibitor of RTEL1 is capable of inhibiting the expression and / or activity of RTEL1; the inhibitor of FUBP1 is capable of inhibiting the expression and / or activity of FUBP1. Suitably, the inhibitor of RTEL1 is capable of inhibiting the expression of an RTEL1 nucleic acid. Suitably, the inhibitor of FUBP1 is capable of inhibiting the expression of a FUBP1 nucleic acid. The present invention further relates to said kit for use in the treatment or prevention of a disease.

[0017] The present invention also relates to a method for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of an inhibitor of RTEL1 to a subject suffering from or susceptible to the disease, the method further comprising administering an effective amount of an inhibitor of FUBP1.

[0018] The present invention also relates to a method for treating or preventing a disease, comprising administering to a subject suffering from or susceptible to the disease a therapeutically or prophylactically effective amount of an inhibitor of FUBP1, the method further comprising administering an effective amount of an inhibitor of RTEL1.

[0019] The present invention also relates to a method for treating or preventing a disease, comprising administering to a subject suffering from or susceptible to the disease a combination of a therapeutically or prophylactically effective amount of an inhibitor of RTEL1 and a therapeutically or prophylactically effective amount of an inhibitor of FUBP1.

[0020] The present invention also relates to the use of an inhibitor of FUBP1 and an inhibitor of RTEL1 for preparing a medicament for treating or preventing hepatitis B virus (HBV) and / or cancer.

[0021] The present invention also relates to an in vivo or in vitro method for regulating the expression of RTEL1 and FUBP1 in target cells expressing RTEL1 and FUBP1, comprising administering to the cells effective amounts of an inhibitor of RTEL1 and an inhibitor of FUBP1.

[0022] In certain embodiments, the disease is hepatitis B virus (HBV) infection and / or cancer.

[0023] In certain embodiments, the disease is chronic hepatitis B virus (HBV) infection.

[0024] The present inventors have surprisingly demonstrated that the combination of an RTEL1 inhibitor and a FUBP1 inhibitor provides synergistic inhibition of HBV.

[0025] Sequence Listing The sequence listing submitted with this application is incorporated herein by reference. In the event of any discrepancy between the sequence listing and the specification or drawings, the information disclosed in the specification (including the drawings) shall be presumed to be correct. [Brief explanation of the drawings]

[0026] [Figure 1] Compound 243_1 (SEQ ID NO: 243) conjugated to a trivalent GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 1A]Residue A of compound 243_1 (SEQ ID NO: 243) [Figure 2] Compound 244_1 (SEQ ID NO: 244) conjugated to a trivalent GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 2A] Residue A of compound 244_1 (SEQ ID NO: 244) [Figure 3] Compound 245_1 (SEQ ID NO: 245) conjugated to a trivalent GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 3A] Residue A of compound 245_1 (SEQ ID NO: 245) [Figure 4] Compound 246_1 (SEQ ID NO: 246) conjugated to a trivalent GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 4A] Residue A of compound 246_1 (SEQ ID NO: 246) [Figure 5-1] Figure 5 shows an exemplary GalNAc moiety. The compound in Figure 5L is composed of a monomeric GalNAc phosphoramidite added to an oligonucleotide while it is still on the solid support as part of its synthesis, where X is S or O, Y is S or O, and n=1-3 (see WO 2017 / 178656). Figures 5B and 5D, also referred to herein as GalNAc2 and GN2, are shown without and with the C6 linker, respectively. [Figure 5-2] FIG. 5 shows exemplary GalNAc moieties. [Figure 5-3] FIG. 5 shows exemplary GalNAc moieties. [Figure 5-4] FIG. 5 shows exemplary GalNAc moieties. [Figure 5-5] FIG. 5 shows exemplary GalNAc moieties. [Figure 5-6] FIG. 5 shows exemplary GalNAc moieties. [Figure 5-7] FIG. 5 shows exemplary GalNAc moieties. [Figure 5-8] FIG. 5 shows exemplary GalNAc moieties. [Figure 5-9]FIG. 5 shows exemplary GalNAc moieties. [Figure 6-1] Figures 6A-6L show exemplary antisense oligonucleotide conjugates, where the oligonucleotide is represented by the term "A" above. The compounds in Figures 6A-D contain a dilysine brancher molecule, a PEG3 spacer, and three terminal GalNAc carbohydrate moieties. In the compounds in Figures 6A (Figures 6A-1 and 6A-2 show two different diastereoisomers of the same compound) and 6B (Figures 6B-1 and 6B-2 show two different diastereoisomers of the same compound), the oligonucleotide is directly attached to the asialoglycoprotein receptor-targeting conjugate moiety without an alkyl linker. In the compounds in Figures 6C (Figures 6C-1 and 6C-2 show two different diastereoisomers of the same compound) and 6D (Figures 6D-1 and 6D-2 show two different diastereoisomers of the same compound), the oligonucleotide is attached to the asialoglycoprotein receptor-targeting conjugate moiety via a C6 linker. The compounds in Figures 6E-K contain commercially available trebler brancher molecules and spacers of various lengths and structures, as well as three terminal GalNAc carbohydrate moieties. The compound in Figure 6L is constructed from a monomeric GalNAc phosphoramidite added to an oligonucleotide while it is still on the solid support as part of its synthesis, where X = S or O, independently Y = S or O, and n = 1-3 (see WO 2017 / 178656). [Figure 6-2] 6A-6L: Exemplary antisense oligonucleotide conjugates are shown, where the oligonucleotide is designated by the term "A" above. [Figure 6-3] 6A-6L: Exemplary antisense oligonucleotide conjugates are shown, where the oligonucleotide is designated by the term "A" above. [Figure 6-4] 6A-6L: Exemplary antisense oligonucleotide conjugates are shown, where the oligonucleotide is designated by the term "A" above. [Figure 6-5]6A-6L: Exemplary antisense oligonucleotide conjugates are shown, where the oligonucleotide is designated by the term "A" above. [Figure 6-6] 6A-6L: Exemplary antisense oligonucleotide conjugates are shown, where the oligonucleotide is designated by the term "A" above. [Figure 6-7] 6A-6L: Exemplary antisense oligonucleotide conjugates are shown, where the oligonucleotide is designated by the term "A" above. [Figure 6-8] 6A-6L: Exemplary antisense oligonucleotide conjugates are shown, where the oligonucleotide is designated by the term "A" above. [Figure 7] Oligonucleotides CMP numbers 243_1, 244_1, 245_1 and 246_1 are tested in vitro for concentration-dependent potency and efficacy in the human cell line MDA-MB-231. [Figure 8] Compound 325_1 (SEQ ID NO: 325) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 8A] Residue A of compound 325_1 (SEQ ID NO: 325) [Figure 9] Compound 325_2 (SEQ ID NO: 325) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 9A] Residue A of compound 325_2 (SEQ ID NO: 325) [Figure 10] Compound 326_1 (SEQ ID NO: 326) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 10A] Residue A of compound 326_1 (SEQ ID NO: 326) [Figure 11] Compound 326_2 (SEQ ID NO: 326) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 11A] Residue A of compound 326_2 (SEQ ID NO: 326) [Figure 12] Compound 326_3 (SEQ ID NO: 326) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 12A] Residues of compound 326_3 (SEQ ID NO: 326) [Figure 13] Compound 326_4 (SEQ ID NO: 326) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 13A] Residue A of compound 326_4 (SEQ ID NO: 326) [Figure 14] Compound 327_1 (SEQ ID NO: 327) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 14A] Residue A of compound 327_1 (SEQ ID NO: 327) [Figure 15] Compound 328_1 (SEQ ID NO: 328) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 15A] Residue A of compound 328_1 (SEQ ID NO: 328) [Figure 16] Compound 329_1 (SEQ ID NO: 329) conjugated to a GalNAc moiety via a phosphodiester-linked DNA dinucleotide [Figure 16A] Residue A of compound 329_1 (SEQ ID NO: 329) [Figure 17] 17 shows the results of an analysis of the in vitro efficacy of anti-FUBP1 compounds in Hela cells. FUBP1 mRNA levels were normalized and are shown as % of control. [Figure 18]Target Binding: FUBP1 mRNA. As described in Example 2.3, four antisense oligonucleotide compounds were tested in HBV-infected PHH cells. Each compound was delivered to cells at a concentration of 10 μM once a week for three weeks. One week after the final treatment, FUBP1 mRNA target KD was assessed. Total RNA was extracted from cells using the MagNA Pure robot and the MagNA Pure 96 Cellular RNA Large Volume Kit according to the manufacturer's protocol, and FUBP1 mRNA was quantified by TaqMan qPCR. This figure shows the residual expression of target mRNA compared to a negative control (NDC=1) using oligos tested at 10 μM. Data were normalized to the human GUS B reference gene, and the mean + SD from two biological replicates is reported for each oligo tested. The 50% and 20% FCs are highlighted on the graph. CMP number 326_3 shows the best FUBP1 mRNA KD, with an 80% reduction in mRNA expression at 10 μM. CMP No. 329_1 shows the strongest effect in reducing FUBP1 mRNA compared to prior art oligos (CMP Nos. 276_1 and 291_1) and comparable to the oligonucleotide with CMP No. 326_3, both of which reduce target mRNA expression by approximately 80% at 10 μM compared to NDC. [Figure 19] Southern blot of intrahepatic HBV DNA revealed a reduction in cccDNA and total HBV DNA in the FUBP1 and RTEL1 LNA single-agent treatment arms, which was further enhanced in the FUBP1 + RTEL1 combination arm. Southern blot of total DNA extract from PXB mouse liver using an HBV-specific full genome-length probe for detection. DNA concentration was adjusted by NanoDrop, and 15µg of DNA was loaded per lane. The red box indicates the cccDNA band. [Figure 20] Semiquantification of intrahepatic cccDNA and total HBV DNA levels by qPCR. [Figure 21] Kinetics of baseline-corrected serum HBV DNA levels. [Figure 22]Baseline-corrected serum HBsAg kinetics [Figure 23] Baseline-corrected serum HBeAg kinetics [Figure 24] Intrahepatic target binding and efficacy of RTEL1 and FUBP1 LNA molecules assessed by RT-qPCR [Figure 25] In vitro reduction of intrahepatic HBV pRNA in HBV-infected PHHs using a single FUBP1 ASO (GalNAc-326_3), a single RTEL1 ASO (GalNAc-245_1), two RTEL1 / FUBP1 dual ASOs (Gal-NAc-350_1 and Gal-NAc-351_1), a combination of FUBP1 ASO (GalNAc-326_3) + RTEL1 ASO (GalNAc-245_1), and a negative control (Ga-NAc-352_1) were used for reference. [Figure 26] In vitro reduction of intrahepatic HBV RNA in HBV-infected PHHs using a single FUBP1 ASO (GalNAc-326_3), a single RTEL1 ASO (GalNAc-245_1), two RTEL1 / FUBP1 dual ASOs (Gal-NAc-350_1 and Gal-NAc-351_1), a combination of FUBP1 ASO (GalNAc-326_3) + RTEL1 ASO (GalNAc-245_1), and a negative control (GalNAc-352_1) were used for reference. [Figure 27] Dose-response curves of RTEL1 gene expression and associated EC50 values ​​for conjugated versions of CMP numbers 352_1 (control), 326_3 (FUBP1), 245_1 (RTEL1), 350_1 (dual), 351_1 (dual) and 326_3 (FUBP1) + 245_1 (RTEL1), administered separately (i.e., added as two individual ASOs). [Figure 28] Dose-response curves of FUBP1 gene expression and associated EC50 values ​​for the conjugated versions of CMP numbers 352_1 (control), 326_3 (FUBP1), 245_1 (RTEL1), 350_1 (dual), 351_1 (dual) and 326_3 (FUBP1) + 245_1 (RTEL1), administered separately (i.e., added as two individual ASOs).

[0027] definition 2' sugar-modified nucleosides A 2' sugar modified nucleoside is a nucleoside having a substituent other than H or -OH at the 2' position (2' substituted nucleoside), or a nucleoside containing a 2' linked biradical that can form a bridge between the 2' carbon and a second carbon of the ribose ring, such as an LNA (2'-4' biradical bridge) nucleoside.

[0028] Indeed, much attention has been focused on the development of 2'-sugar-substituted nucleosides, and many 2'-substituted nucleosides have been found to have beneficial properties when incorporated into oligonucleotides. For example, 2'-modified sugars can confer enhanced binding affinity and / or increased nuclease resistance to oligonucleotides. Examples of 2'-substituted modified nucleosides include 2'-O-alkyl-RNA nucleosides, 2'-O-methyl-RNA nucleosides, 2'-alkoxy-RNA nucleosides, 2'-O-methoxyethyl-RNA (MOE) nucleosides, 2'-amino-DNA nucleosides, 2'-fluoro-RNA nucleosides, and 2'-F-ANA nucleosides. For further examples, see, for example, Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213, and Deleavy and Damha, Chemistry and Biology 2012, 19, 937. Below are examples of some 2'-substituted modified nucleosides. [ka]

[0029] In the context of the present invention, 2'-substituted sugar modified nucleosides do not include 2'-bridged nucleosides such as LNA.

[0030] Alternating Flank Gap Mar The flanking regions may contain both LNA and DNA nucleosides and are referred to as "alternating flanks" because they contain an alternating motif of LNA-DNA-LNA nucleosides. Gapmers containing at least one alternating flank are referred to as "alternating flank gapmers." Thus, an "alternating flank gapmer" is an LNA gapmer oligonucleotide in which at least one flank (F or F') contains DNA in addition to LNA nucleoside(s). In some embodiments, at least one of regions F or F', or both regions F and F', contains both LNA and DNA nucleosides. In such embodiments, flanking region F or F', or both F and F', contains at least three nucleosides, and the 5'-most and 3'-most nucleosides of the F and / or F' regions are LNA nucleosides. Alternating flank LNA gapmers are disclosed in WO 2016 / 127002.

[0031] The alternating flanking regions can include up to three consecutive DNA nucleosides, such as one to two, or one, or two, or three consecutive DNA nucleosides.

[0032] The alternating flake region can be annotated as a series of integers, representing a number of LNA nucleosides (L) followed by a number of DNA nucleosides (D), e.g., [L]1-3-[D]1-3-[L]1-3 or [L]1-2-[D]1-2-[L]1-2-[D]1-2-[L]1-2. In oligonucleotide design, these are often represented as numbers such that 2-2-1 represents 5'[L]2-[D]2-[L]3' and 1-1-1-1-1 represents 5'[L]-[D]-[L]-[D]-[L]3'. The length of the flanks (regions F and F') in oligonucleotides with alternating flanks can be, for example, 4 to 8, e.g., 5 to 6 nucleosides, e.g., 4, 5, 6, or 7 modified nucleosides, as described herein above for these regions. It may be advantageous to have at least two LNA nucleosides at the 3' end of the 3' flank (F') to confer additional exonuclease resistance.

[0033] In one embodiment, a gapmer oligonucleotide for use in the present invention can be represented by the following formula: F 4-6 -G 7-11 -F' 2-6、 In the formula, F is [L] 1-3 -[D] 1-3 -[L] 1-3 F' has a design of [L] 1-2 -[D] 1-2 -[L] 2-4、 or [L] 2-6 It has a design. However, the total length of the gapmer region FG-F' is at least 16 nucleotides, for example 17 or 18 nucleotides in length.

[0034] Thus, gapmer oligonucleotides of the present invention can comprise at least one alternating flank. Typically, at least the F region is an alternating flank. In some embodiments, both the F region and the F' region are alternating flanks. In some embodiments, the F region is an alternating flank and the F' region is a uniform flank (i.e., F' is composed of only one type of sugar-modified nucleoside, such as only beta-D-oxy LNA).

[0035] In some embodiments, the design of region F is selected from 3-2-1 (i.e., LLLDDL), 3-1-1 (i.e., LLLDL), 2-1-2 (LLDLL), 2-1-1 (LLDL), and 1-3-1 (i.e., LDDDL) designs.

[0036] In some embodiments, the design of region F' is 1-1-3 (i.e., LDLLL) or 1-1-2 (i.e., LDLL). In some embodiments, the design of region F is LL, LLL, or LLLL.

[0037] antisense oligonucleotides The term "antisense oligonucleotide" or "ASO" as used herein is defined as an oligonucleotide that can regulate the expression of a target gene by hybridizing to a target nucleic acid, particularly a continuous sequence on the target nucleic acid.The antisense oligonucleotide of the present invention is essentially not double-stranded, and therefore is not siRNA or shRNA.Preferably, the antisense oligonucleotide of the present invention is single-stranded.It is understood that the single-stranded oligonucleotide of the present invention can form a hairpin or intermolecular duplex structure (a duplex between two molecules of the same oligonucleotide), as long as the degree of complementarity between itself or itself is less than 50% over the entire length of the oligonucleotide.

[0038] Advantageously, the single-stranded antisense oligonucleotide does not contain RNA nucleosides to reduce nuclease resistance.

[0039] Advantageously, the oligonucleotides of the combinations of the present invention comprise one or more modified nucleosides or nucleotides, such as, for example, 2' sugar-modified nucleosides. Furthermore, it is advantageous for the unmodified nucleosides to be DNA nucleosides.

[0040] cccDNA (covalently closed circular DNA) CccDNA (covalently closed circular DNA) is a special DNA structure that arises during the propagation of some DNA viruses (Polyomaviridae) within the cell nucleus. CccDNA is double-stranded DNA that occurs in a linear form that is covalently linked into a closed circle by DNA ligase. In most cases, transcription of viral DNA can occur only from the circular form. Viral cccDNA is also known as episomal DNA or occasionally as a minichromosome.

[0041] cccDNA is typical of the Caulimoviridae and Hepadnaviridae families, including hepatitis B virus (HBV). The HBV genome forms a stable minichromosome, a covalently closed circular DNA (cccDNA), within the hepatocyte nucleus. cccDNA is formed by the conversion of capsid-bound relaxed circular DNA (rcDNA). HBV cccDNA formation involves a multistep process that requires cellular DNA repair machinery and relies on specific interactions with different cellular components that contribute to the completion of the positive-strand DNA in the rcDNA (Alweiss et al. 2017, Viruses, 9(6):156).

[0042] cccDNA is the viral genetic template present in the nucleus of infected hepatocytes, generates all HBV RNA transcripts required for productive infection, and is involved in viral persistence during the natural history of chronic HBV infection (Locarnini & Zoulim, 2010 Antivir Ther. 15 Suppl 3:3-14. doi:10.3851 / IMP1619). cccDNA acts as a viral reservoir and is the source of viral rebound after treatment cessation, necessitating long-term, sometimes lifelong, treatment. PEG-IFN can only be administered to a small subset of CHB patients due to its various side effects.

[0043] Therefore, there is a great need for novel therapies that can bring about complete cure, defined by the degradation or elimination of HBV cccDNA, in the majority of CHB patients.

[0044] combination The term "combination" is understood as a combination of at least two different active compounds or prodrugs (medicinal compounds or drugs) for treating a disease. A pharmaceutical combination may include compounds that are physically, chemically, or otherwise combined (e.g., in the same vial); compounds that are packaged together (e.g., as two separate entities in the same package (kit-of-parts) for either simultaneous, sequential, or separate administration); or compounds that are provided separately but intended to be used together (e.g., the combination is explicitly stated on the compound label or package insert). Suitably, the pharmaceutical combination consists of a medicinal compound formulated for oral administration and a medicinal compound formulated for subcutaneous injection. Suitably, the RTEL1 inhibitor and the FUBP1 inhibitor of the combination of the present invention may be present in the same or separate compositions. Suitably, the RTEL1 inhibitor and the FUBP1 inhibitor of the combination of the present invention may be administered simultaneously, sequentially, or separately. Suitably, the RTEL1 inhibitor and the FUBP1 inhibitor of the combination of the present invention are linked to each other by a physiologically labile linker as defined herein. Suitable physiologically labile linkers may comprise or consist of DNA dinucleotides having a sequence selected from the group consisting of AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, where there is a phosphodiester bond between the two DNA nucleosides. For example, the linker may be a CA dinucleotide.

[0045] Complementarity The term "complementarity" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). Oligonucleotides may contain nucleosides with modified nucleobases; for example, 5-methylcytosine is often used in place of cytosine; therefore, the term "complementarity" is understood to encompass Watson-Crick base pairing between unmodified and modified nucleobases (see, e.g., Hirao et al. (2012) Accounts of Chemical Research, vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Suppl. 37, 1.4.1).

[0046] The term "% complementary," as used herein, refers to the percentage of nucleotides in a contiguous nucleotide sequence of a nucleic acid molecule (e.g., an oligonucleotide) that are complementary to a reference sequence (e.g., a target sequence or sequence motif) across the contiguous nucleotide sequence. Thus, the percentage of complementarity is calculated by counting the number of aligned nucleobases (from Watson-Crick base pairs) that are complementary between two sequences (aligning the target sequence 5'-3' with the oligonucleotide sequence from 3'-5'), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. In such a comparison, nucleobases / nucleotides that do not align (form base pairs) are referred to as mismatches. Insertions and deletions are not allowed in calculating the % complementarity of a contiguous nucleotide sequence. It will be understood that chemical modifications of nucleobases are disregarded in determining complementarity, so long as the nucleobases retain their functional ability to form Watson-Crick base pairs (e.g., 5'-methylcytosine is considered identical to cytosine for purposes of calculating % identity).

[0047] The term "fully complementary" refers to 100% complementarity.

[0048] Below is an example of an oligonucleotide motif (SEQ ID NO: 38) that is perfectly complementary to a target nucleic acid (SEQ ID NO: 12). 5'-CTTTGACCAGAGTATGTAAAATTCTC-3' (SEQ ID NO: 12) 3'-AAACTGGTCTCATACATTTT-5' (SEQ ID NO: 38)

[0049] compound As used herein, the term "compound" refers to any molecule capable of inhibiting the expression or activity of RTEL1 or FUBP1. A particular compound of the combination of the present invention is a nucleic acid molecule, such as an RNAi molecule or an antisense oligonucleotide, according to the present invention, or any conjugate containing such a nucleic acid molecule. For example, as used herein, the compound may be a nucleic acid molecule, particularly an antisense oligonucleotide or siRNA, that targets RTEL1 or FUBP1.

[0050] Conjugates The term conjugate, as used herein, refers to an oligonucleotide covalently attached to a non-nucleotide moiety (conjugate moiety or region C or third region).

[0051] Conjugation of the oligonucleotide (or nucleic acid molecule) of the combination of the present invention to one or more non-nucleotide moieties can improve the pharmacology of the oligonucleotide, for example, by affecting the activity, cellular distribution, cellular uptake, or stability of the oligonucleotide. In some embodiments, the conjugate moiety modulates or enhances the pharmacokinetic properties of the oligonucleotide by improving the cellular distribution, bioavailability, metabolism, excretion, permeability, and / or cellular uptake of the oligonucleotide. In particular, the conjugate can target the oligonucleotide to a specific organ, tissue, or cell type, thereby increasing the efficacy of the oligonucleotide in that organ, tissue, or cell type. At the same time, the conjugate can serve to reduce the activity of the oligonucleotide in non-target cell types, tissues, or organs (e.g., off-target activity or activity in non-target cell types, tissues, or organs). In the case of siRNA nucleic acid molecules, the conjugate moiety is most commonly covalently attached to the passenger strand of the siRNA, and in the case of shRNA molecules, the conjugate moiety is most commonly attached to the end of the molecule furthest from the continuous nucleotide sequence of the shRNA. In the case of antisense oligonucleotides, the conjugate moiety can be advantageously covalently attached to either terminus using a biocleavable linker such as 2 to 5 phosphodiester-linked DNA nucleosides.

[0052] WO 93 / 07883 and WO 2013 / 033230 provide suitable conjugate moieties, which are incorporated herein by reference. Further suitable conjugate moieties are those that can bind to asialoglycoprotein receptor (ASGPR). In particular, trivalent N-acetylgalactosamine conjugate moieties are suitable for binding to ASGPR, see, for example, US2009 / 02398, WO 2014 / 076196, WO 2014 / 207232, and WO 2014 / 179620 (incorporated herein by reference). Such conjugates are useful for promoting the uptake of oligonucleotides into the liver while reducing their presence in the kidney, thereby increasing the liver / kidney ratio of conjugated oligonucleotides compared to the unconjugated version of the same oligonucleotide.

[0053] Oligonucleotide conjugates and their synthesis are also reported in comprehensive reviews by Manoharan, Antisense Drug Technology, Principles, Strategies, and Applications, S.T. Crooke, ed., Ch. 16, Marcel Dekker, Inc., 2001, and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, each of which is incorporated herein by reference in its entirety.

[0054] In one embodiment, the non-nucleotide moiety (conjugate moiety) is selected from the group consisting of a carbohydrate, a cell surface receptor ligand, a drug substance, a hormone, a lipophile, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.

[0055] In some embodiments, the conjugate is an antibody or antibody fragment with specific affinity for the transferrin receptor, e.g., as disclosed in WO 2012 / 143379, which is incorporated herein by reference. In some embodiments, the non-nucleotide moiety is an antibody or antibody fragment, e.g., an antibody or antibody fragment that facilitates delivery across the blood-brain barrier, particularly an antibody or antibody fragment that targets the transferrin receptor.

[0056] Contiguous nucleotide sequence The term "contiguous nucleotide sequence" refers to a region of an oligonucleotide that is complementary to a target nucleic acid. This term is used interchangeably herein with the terms "contiguous nucleobase sequence" and "oligonucleotide motif sequence." In some embodiments, all nucleotides of an oligonucleotide constitute a contiguous nucleotide sequence. In some embodiments, the contiguous nucleotide sequence is included in the guide strand of an siRNA molecule. In some embodiments, the contiguous nucleotide sequence is a portion of an shRNA molecule that is 100% complementary to a target nucleic acid. In some embodiments, an oligonucleotide comprises a contiguous nucleotide sequence, such as an FG-F' gapmer region, and may optionally include a nucleotide linker region that can be used to attach additional nucleotide(s), such as a functional group (e.g., a conjugate group for targeting), to the contiguous nucleotide sequence. The nucleotide linker region may or may not be complementary to the target nucleic acid. In some embodiments, the nucleobase sequence of an antisense oligonucleotide constitutes a contiguous nucleotide sequence. In some embodiments, the contiguous nucleotide sequence is at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, for example at least 98% complementary to the target nucleic acid. In some embodiments, the contiguous nucleotide sequence is 100% complementary to the target nucleic acid.

[0057] Gapmar An antisense oligonucleotide or its contiguous nucleotide sequence may be a gapmer, which may also be referred to as a gapmer oligonucleotide or gapmer design. Antisense gapmers are typically used to inhibit target nucleic acids via RNase H-mediated degradation. In one embodiment of the present invention, the oligonucleotide is capable of recruiting RNase H. A gapmer-type oligonucleotide comprises at least three distinct structural regions, a 5'-flank, a gap, and a 3'-flank, FG-F', in the 5'→3' direction. The "gap" region (G) comprises a stretch of contiguous DNA nucleotides that allows the oligonucleotide to recruit RNase H. The gap region is flanked by a 5'-flanking region (F) comprising one or more sugar-modified nucleosides, preferably high-affinity sugar-modified nucleosides, and a 3'-flanking region (F') comprising one or more sugar-modified nucleosides, preferably high-affinity sugar-modified nucleosides. One or more sugar-modified nucleosides of regions F and F' improve the affinity of the oligonucleotide for a target nucleic acid (i.e., are affinity-enhancing sugar-modified nucleosides). In some embodiments, one or more sugar-modified nucleosides of regions F and F' are 2'-sugar-modified nucleosides, such as high-affinity 2'-sugar modifications independently selected from, for example, LNA and 2'-MOE.

[0058] In a gapmer design, the 5'- and 3'-most nucleosides of the gap region are DNA nucleosides, positioned adjacent to sugar-modified nucleosides in the 5' (F) or 3' (F') regions, respectively. Flanks may be further defined by having at least one sugar-modified nucleoside at the end furthest from the gap region, i.e., at the 5'-end of the 5' flank and at the 3'-end of the 3' flank.

[0059] The region FG-F' forms a contiguous nucleotide sequence. An antisense oligonucleotide for use in the present invention, or a contiguous nucleotide sequence thereof, may comprise a gapmer region of the formula FG-F'. In some embodiments, all internucleoside linkages between nucleosides in the gapmer region of the formula FG-F' are phosphorothioate internucleoside linkages.

[0060] The total length of the gapmer design FG-F' can be, for example, 12 to 32 nucleosides, for example, 13 to 24, for example, 14 to 22 nucleosides, for example, 14 to 17, for example, 16 to 18 nucleosides. In some embodiments, the total length is 17 nucleosides. In some embodiments, the total length is 17 nucleosides.

[0061] By way of example, a gapmer oligonucleotide of the invention can be represented by the following formula: F 1-8 -G 5-18 -F' 1-8、 for example F 1-8 -G 5-16 -F' 1-8 , or F 1-8 -G 7-16 -F' 2-8 , or F 4-8 -G 7-12 -F' 2-8 , or F 4-6 -G 7-11 -F' 2-6 However, the total length of the gapmer region FG-F' is at least 12, for example at least 14, nucleotides in length.

[0062] In one aspect of the invention, the antisense oligonucleotide, or its contiguous nucleotide sequence, consists of or comprises a gapmer of the formula 5'-FG-F'-3', where regions F and F' independently comprise 1 to 8 nucleosides, 1 to 4 of which are 2' sugar modified, and define the 5' and 3' ends of the F and F' regions, and G is a region of 6 to 18 nucleosides, e.g., a region of 6 to 16 nucleosides, capable of recruiting RNase H. In some embodiments, the G region consists of DNA nucleosides.

[0063] In some embodiments, all modified nucleosides in regions F and F' are beta-D-oxy LNA nucleosides. Furthermore, regions F or F', or F and F', optionally comprise DNA nucleosides. Optionally, flanking regions F or F', or both flanking regions F and F', can comprise one or more DNA nucleosides (alternating flanks, see the definition of alternating flanks for more details).

[0064] Regions F, G, and F' are further defined below and can be combined into the FG-F' formula. Gapmer region G

[0065] The region G (gap region) of a gapmer is a region of nucleosides, typically DNA nucleosides, that allows the oligonucleotide to recruit RNase H, e.g., human RNase H1. RNase H is a cellular enzyme that recognizes duplexes between DNA and RNA and enzymatically cleaves RNA molecules. Suitably, a gapmer may have a gap region (G) of at least 5 or 6 consecutive DNA nucleosides, e.g., 5 to 18 consecutive DNA nucleosides, 5 to 17 consecutive DNA nucleosides, e.g., 5 to 16 consecutive DNA nucleosides, e.g., 6 to 15 consecutive DNA nucleosides, e.g., 7 to 14 consecutive DNA nucleosides, e.g., 8 to 12 consecutive DNA nucleotides, e.g., 8 to 12 consecutive DNA nucleotides in length. The gap region G may, in some embodiments, consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 consecutive DNA nucleosides. Cytosine (C) DNA in the gap region may in some cases be methylated, and such residues include 5'-methyl-cytosine ( me The gap is annotated with e instead of C or c). Methylation of cytosine DNA in the gap is advantageous when the cg dinucleotide is present in the gap to reduce potential toxicity, and the modification does not significantly affect the efficacy of the oligonucleotide. 5'-substituted DNA nucleosides, such as 5'-methyl DNA nucleosides, have been reported for use in DNA gap regions (European Patent Application Publication No. EP2742136).

[0066] In some embodiments, the gap region G can consist of 12 or fewer consecutive DNA nucleosides, for example, 7, 8, 9, 10, or 11 consecutive DNA nucleosides, for example, 9, 10, or 11 consecutive DNA nucleosides.

[0067] One or more cytosine (C) DNA residues within the gap region may be methylated in some cases (e.g., when DNAc is followed by DNAg). Any such residues may be methylated as 5-methyl-cytosine ( me C) is annotated.

[0068] In some embodiments, the gap region G can consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 consecutive phosphorothioate-linked DNA nucleosides, hi some embodiments, all internucleoside linkages within the gap are phosphorothioate linkages.

[0069] Conventional gapmers have a DNA gap region, and there are many examples of modified nucleosides that, when used within the gap region, enable the recruitment of RNase H. Modified nucleosides that have been reported to be able to recruit RNase H when contained within the gap region include, for example, alpha-L-LNA, C4' alkylated DNA (described in PCT / EP2009 / 050349 and Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) 2296-2300 (both incorporated herein by reference)), arabinose-derived nucleosides such as ANA and 2'F-ANA (Mangos et al. 2003 J. AM. CHEM. SOC. 125, 654-661), and UNA (unlocked nucleic acid) (described in Fluiter et al., Mol. Biosyst., 2009, 10, 1039 (incorporated herein by reference)). UNAs are typically unlocked nucleic acids in which the bond between C2 and C3 of the ribose has been removed to form an unlocked "sugar" residue. The modified nucleosides used in such gapmers may be nucleosides that adopt a 2'-endo (DNA-like) structure when introduced into the gap region (i.e., modifications that allow RNase H recruitment). In some embodiments, the DNA gap region (G) described herein may optionally contain one to three sugar-modified nucleosides that adopt a 2'-endo (DNA-like) structure when introduced into the gap region.

[0070] Gapmer-flanking regions, F and F' Region F is positioned immediately adjacent to the 5' DNA nucleoside of region G. The 3'-most nucleoside of region F is a sugar-modified nucleoside, e.g., a high-affinity sugar-modified nucleoside, e.g., a 2'-substituted nucleoside, e.g., an MOE nucleoside, or an LNA nucleoside.

[0071] Region F' is positioned immediately adjacent to the 3' DNA nucleoside of region G. The 5'-most nucleoside of region F is a sugar-modified nucleoside, e.g., a high-affinity sugar-modified nucleoside, e.g., a 2'-substituted nucleoside, e.g., an MOE nucleoside, or an LNA nucleoside.

[0072] Region F is 1 to 8 contiguous nucleotides long, for example, 2 to 6, for example, 3 to 4 contiguous nucleotides long, or for example, 4 to 6 contiguous nucleotides long. In some embodiments, region F is 4 contiguous nucleotides long. In some embodiments, region F is 5 contiguous nucleotides long. In some embodiments, region F is 6 contiguous nucleotides long. Advantageously, the 5'-most nucleoside of region F is a sugar-modified nucleoside. In some embodiments, the two 5'-most nucleosides of region F are sugar-modified nucleosides. In some embodiments, the 5'-most nucleoside of region F is an LNA nucleoside. In some embodiments, the two 5'-most nucleosides of region F are LNA nucleosides. In some embodiments, the two 5'-most nucleosides of region F are 2'-substituted nucleosides, for example, two 3'MOE nucleosides. In some embodiments, the 5'-most nucleoside of region F is a 2'-substituted nucleoside, such as an MOE nucleoside.

[0073] Region F' is 2 to 8 contiguous nucleotides in length, e.g., 3 to 6, e.g., 4 to 5 contiguous nucleotides in length. In some embodiments, region F' is 2 contiguous nucleotides in length. In some embodiments, region F' is 3 contiguous nucleotides in length. In some embodiments, region F' is 4 contiguous nucleotides in length. In some embodiments, region F' is 5 contiguous nucleotides in length. Advantageously, in some embodiments, the 3'-most nucleoside of region F' is a sugar-modified nucleoside. In some embodiments, the two 3'-most nucleosides of region F' are sugar-modified nucleosides. In some embodiments, the two 3'-most nucleosides of region F' are LNA nucleosides. In some embodiments, the two 3'-most nucleosides of region F' are 2'-substituted nucleosides, e.g., two 3' MOE nucleosides. In some embodiments, the 3'-most nucleoside of region F' is a 2'-substituted nucleoside, such as an MOE nucleoside.

[0074] It should be noted that when the length of region F or F' is 1, it is advantageously an LNA nucleoside.

[0075] In some embodiments, regions F and F' independently consist of or comprise a contiguous sequence of sugar-modified nucleosides. In some embodiments, the sugar-modified nucleosides of region F may be independently selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabinonucleic acid (ANA) units, and 2'-fluoro-ANA units.

[0076] In some embodiments, regions F and F' independently comprise both LNA and 2'-substituted modified nucleosides (mixed wing designs).

[0077] In some embodiments, regions F and F' consist of only one type of sugar-modified nucleoside, for example, only MOE, or only beta-D-oxy LNA, or only ScET. Such a design is also referred to as a uniform flank or uniform gapmer design.

[0078] In some embodiments, regions F or F', or all nucleosides of F and F', are LNA nucleosides, e.g., independently selected from beta-D-oxyLNA, ENA, or ScET nucleosides. In some embodiments, region F consists of 1 to 5, e.g., 2 to 4, e.g., 3 to 4, e.g., 1, 2, 3, 4, or 5 contiguous LNA nucleosides. In some embodiments, all nucleosides of regions F and F' are beta-D-oxyLNA nucleosides.

[0079] In some embodiments, all nucleosides in regions F or F', or F and F', are 2'-substituted nucleosides, e.g., OMe or MOE nucleosides. In some embodiments, region F consists of 1, 2, 3, 4, 5, 6, 7, or 8 consecutive OMe or MOE nucleosides. In some embodiments, only one of the flanking regions can consist of 2'-substituted nucleosides, e.g., OMe or MOE nucleosides. In some embodiments, it is the 5' (F) flanking region that consists of 2'-substituted nucleosides, e.g., OMe or MOE nucleosides, while the 3' (F') flanking region comprises at least one LNA nucleoside, e.g., a beta-D-oxyLNA nucleoside or a cET nucleoside. In some embodiments, it is the 3' (F') flanking region that consists of 2' substituted nucleosides, such as OMe or MOE nucleosides, while the 5' (F) flanking region comprises at least one LNA nucleoside, such as a beta-D-oxyLNA nucleoside or a cET nucleoside.

[0080] In some embodiments, all modified nucleosides in regions F and F' are LNA nucleosides, e.g., independently selected from beta-D-oxy LNA, ENA, or ScET nucleosides, while regions F or F', or F and F', may optionally comprise DNA nucleosides (alternating flanks, see these definitions for more details). In some embodiments, all modified nucleosides in regions F and F' are beta-D-oxy LNA nucleosides, while regions F or F', or F and F', may optionally comprise DNA nucleosides (alternating flanks, see these definitions for more details).

[0081] Further gapmer designs are disclosed in WO 2004 / 046160, WO 2007 / 146511 and WO 2008 / 113832, which are incorporated herein by reference.

[0082] In some embodiments, the 5'-most and 3'-most nucleosides of regions F and F' are LNA nucleosides, such as beta-D-oxyLNA nucleosides or ScET nucleosides.

[0083] In some embodiments, the internucleoside linkage between region F and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkage between region F' and region G is a phosphorothioate internucleoside linkage. In some embodiments, the internucleoside linkage between the nucleosides of regions F or F', F and F' is a phosphorothioate internucleoside linkage.

[0084] HBV infection The terms "hepatitis B virus infection" or "HBV infection" are commonly known in the art and refer to an infectious disease caused by the hepatitis B virus (HBV) and affecting the liver. HBV infection can be an acute infection or a chronic infection.

[0085] Some infected individuals have no symptoms during the initial infection and rapidly develop illness with vomiting, yellowish skin, fatigue, dark urine, and abdominal pain ("Hepatitis B Fact Sheet #204," who.int. July 2014, retrieved November 4, 2014). These symptoms often last for several weeks and can be fatal. Symptoms can take 30 to 180 days to begin. Ninety percent of people infected around birth develop chronic hepatitis B infection, while fewer than 10% of those infected after age 5 develop the disease ("Hepatitis B FAQs for Public Transmission," Centers for Disease Control and Prevention, retrieved November 29, 2011). While the majority of people with chronic disease have no symptoms, cirrhosis and liver cancer can eventually develop (Chang, 2007, Semin Fetal Neonatal Med, 12:160-167). These complications result in 15-25% mortality in those with the chronic disease ("Hepatitis B Fact Sheet No. 204," who.int. July 2014. Retrieved November 4, 2014). As used herein, the term "HBV infection" includes acute and chronic hepatitis B infection. The term "HBV infection" also includes the asymptomatic stage of primary infection, the symptomatic stage, and the asymptomatic chronic stage of HBV infection.

[0086] Chronic hepatitis B virus (CHB) infection is a global disease burden affecting 248 million people worldwide. Approximately 686,000 deaths per year are attributed to HBV-related end-stage liver disease and hepatocellular carcinoma (HCC) (GBD, 2013; Schweitzer et al., 2015). WHO predicts that, without further intervention, the number of people infected with CHB will remain at its current high level for the next 40–50 years, with a cumulative 20 million deaths expected between 2015 and 2030 (WHO, 2016). CHB infection is not a homogeneous disease with distinct clinical manifestations. Infected individuals progress through several stages of CHB-related liver disease over their lifetime. These stages also form the basis for treatment with standard of care (SOC). Current guidelines recommend treating only select individuals infected with CHB based on three criteria: serum ALT level, HBV DNA level, and severity of liver disease (EASL, 2017). This recommendation is due to the fact that SOCs, namely nucleoside analogs (NAs) and pegylated interferon-α (PEG-IFN), are not curative and must be administered for extended periods, thereby increasing safety risks. NAs effectively suppress HBV DNA replication; however, they have very limited or no effect on other viral markers. Two hallmarks of HBV infection, hepatitis B surface antigen (HBsAg) and covalently closed circular DNA (cccDNA), are the primary targets of new drugs aimed at curing HBV. In the plasma of CHB patients, HBsAg subviral (empty) particles outnumber HBV virions by 103-105 times (Ganem & Prince, 2014). Its excess is thought to contribute to the immunopathogenesis of the disease, including the failure of individuals to develop neutralizing anti-HBs antibodies, a serological marker observed after resolution of acute HBV infection.

[0087] High-affinity modified nucleosides High affinity modified nucleosides are modified nucleotides that, when incorporated into an oligonucleotide, e.g., increase the melting temperature (T mThe high affinity modified nucleosides of the present invention preferably provide an increase in melting temperature of +0.5 to +12°C, more preferably +1.5 to +10°C, and most preferably +3 to +8°C per modified nucleoside. Numerous high affinity modified nucleosides are known in the art, including, for example, many 2'-substituted nucleosides (e.g., Ome and MOE) and locked nucleic acids (LNAs) (see, e.g., Freier & Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3(2), 293-213).

[0088] Hybridization The term "hybridize" or "hybridize" as used herein should be understood to mean that two nucleic acid strands (e.g., an oligonucleotide such as an siRNA guide strand and a target nucleic acid) form a duplex by forming hydrogen bonds between base pairs on opposing strands. The affinity of the binding between two nucleic acid strands is the strength of hybridization. This is determined by the melting temperature (T), which is defined as the temperature at which half of the oligonucleotide forms a duplex with the target nucleic acid. m ) is often explained by the following: Under physiological conditions, T m is not strictly proportional to affinity (Mergny and Lacroix (2003) Oligonucleotides 13, 515-537). The standard state Gibbs free energy, ΔG°, more accurately represents binding affinity, ΔG°=-RTln(K d ) to calculate the dissociation constant (K d), where R is the gas constant and T is the absolute temperature. Therefore, a very low ΔG° of the reaction between an oligonucleotide and a target nucleic acid reflects strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction at an aqueous concentration of 1 M, pH 7, and temperature of 37°C. The hybridization of an oligonucleotide to a target nucleic acid is a spontaneous reaction, and in the case of a spontaneous reaction, ΔG° is less than zero. ΔG° can be experimentally measured, for example, by isothermal titration calorimetry (ITC), as described in Hansen et al., 1965, Chem. Comm. 36-38 and Holdgate et al., 2005, Drug Discovery Today. Those skilled in the art will know that commercially available devices are available for measuring ΔG°. ΔG° can also be numerically estimated using the nearest neighbor model described by SantaLucia, 1998, Proc Natl Acad Sci USA. 95:1460-1465, or by using appropriately derived thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34:11211-11216 and McTigue et al., 2004, Biochemistry 43:5388-5405. To ensure the potential for hybridization modulation of their intended nucleic acid targets, oligonucleotides of the present invention hybridize to target nucleic acids with an estimated ΔG° value of less than -10 kcal for oligonucleotides 10-30 nucleotides in length. In some embodiments, the degree or strength of hybridization is measured by the standard-state Gibbs free energy ΔG°. The oligonucleotides may hybridize to the target nucleic acid with an estimated ΔG° value in the range of less than −10 kcal, for example less than −15 kcal, for example less than −20 kcal, and for example less than −25 kcal for oligonucleotides 8 to 30 nucleotides in length. In some embodiments, the oligonucleotides hybridize to the target nucleic acid with an estimated ΔG° value of −10 to −60 kcal, for example −12 to −40, for example −15 to −30 kcal or −16 to −27 kcal, for example −18 to −25 kcal.

[0089] identity As used herein, the term "identity" refers to the proportion (expressed as a percentage) of nucleotides in a contiguous nucleotide sequence within a nucleic acid molecule (e.g., an oligonucleotide) that are identical to a reference sequence (e.g., a sequence motif) across the contiguous nucleotide sequence. Thus, the percentage of identity is calculated by counting the number of identical (matching) aligned nucleobases between two sequences (in the contiguous nucleotide sequence of a compound for use in the present invention and the reference sequence), dividing that number by the total number of nucleotides in the oligonucleotide, and multiplying by 100. Thus, percent identity = (number of matches x 100) / length of aligned region (e.g., contiguous nucleotide sequence). Insertions and deletions are not allowed in calculating the percent identity of a contiguous nucleotide sequence. It is understood that chemical modifications of nucleobases are disregarded in determining identity, so long as the functional ability of the nucleobase to form Watson-Crick base pairs is maintained (e.g., 5-methylcytosine is considered identical to cytosine for purposes of calculating percent identity).

[0090] Inhibition of expression As used herein, the term "inhibition of expression" should be understood as a general term for the ability of an oligonucleotide to inhibit the amount or activity of a target (i.e., RTEL1 or FUBP1) in a target cell. Inhibition of activity can be determined by measuring the level of target pre-mRNA or target mRNA, or by measuring the level of target or target activity in a cell. Thus, inhibition of expression can be determined in vitro or in vivo.

[0091] Typically, inhibition of expression is determined by comparing the inhibition of activity by administering an effective amount of antisense oligonucleotide to target cells and comparing that level to a reference level obtained from target cells that are not administered the antisense oligonucleotide (a control experiment), or to a known reference level (e.g., the expression level before administration of an effective amount of the antisense oligonucleotide, or a predetermined or other known expression level).

[0092] For example, control experiments can be animals or humans, or target cells, treated with a saline composition or a reference oligonucleotide (often a scrambled control).

[0093] The terms "inhibition" or "inhibiting" can also be referred to as downregulating, decreasing, suppressing, reducing, or decreasing the expression of a target.

[0094] Inhibition of expression can occur, for example, by degradation of pre-mRNA or mRNA (eg, using RNase H recruiting oligonucleotides, such as gapmers).

[0095] inhibitors The term "inhibitor" is known in the art and relates to a compound / substance or composition that is able to (a) completely or partially prevent or reduce the physiological function (i.e., activity) of a particular protein(s) (e.g., FUBP1 or RTEL1).

[0096] In the context of the present invention, an "inhibitor" of FUBP1 is capable of preventing or reducing, respectively, the activity / function of FUBP1 by preventing or reducing the expression of the FUBP1 gene product.

[0097] Similarly, in the context of the present invention, an "inhibitor" of RTEL1 can prevent or reduce, respectively, the activity / function of RTEL1 by preventing or reducing the expression of the RTEL1 gene product.

[0098] Thus, an inhibitor of FUBP1 or RTEL1 may result in a reduction in the expression level of FUBP1 or RTEL1, respectively (e.g., a reduction in the level of FUBP1 or RTEL1 mRNA, or FUBP1 or RTEL1 protein, respectively), which is reflected in a reduction in the functionality (i.e., activity) of FUBP1 or RTEL1, including its polyA polymerase function. Thus, in the context of the present invention, an inhibitor of FUBP1 may also encompass a transcriptional repressor of FUBP1 expression that can reduce the level of FUBP1.

[0099] Therefore, in the context of the present invention, an inhibitor of RTEL1 may also include a transcriptional repressor of RTEL1 expression that can reduce the level of RTEL1. The term "inhibitor" also includes pharmaceutically acceptable salts thereof. Preferred inhibitors are nucleic acid molecules.

[0100] Linker A bond or linker is a connection between two atoms that connects one chemical group or segment of interest to another chemical group or segment of interest through one or more covalent bonds. The conjugate moiety can be attached to the oligonucleotide directly or via a linking moiety (e.g., a linker or tether). The linker serves to covalently attach a third region, such as the conjugate moiety (region C), to the first region, such as the oligonucleotide or consecutive nucleotide sequence (region A) that is complementary to the target nucleic acid.

[0101] In some embodiments of the present invention, the combination conjugate or oligonucleotide conjugate of the present invention may optionally comprise a linker region (second region or region B and / or region Y) located between the oligonucleotide or contiguous nucleotide sequence complementary to the target nucleic acid (region A or first region) and the conjugate moiety (region C or third region).

[0102] Region B refers to a biocleavable linker that comprises or consists of a physiologically labile bond that is cleavable under conditions normally encountered or similar to those encountered in a mammalian body. Conditions under which a physiologically labile linker undergoes chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidizing or reducing conditions, or drugs, as well as salt concentrations similar to those found or encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzymatic activities normally present in mammalian cells, such as proteolytic or hydrolytic enzymes or nucleases. In one embodiment, the biocleavable linker is susceptible to S1 nuclease cleavage. In a preferred embodiment, the nuclease-sensitive linker comprises between 1 and 10 nucleosides, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleosides, more preferably between 2 and 6 nucleosides, and most preferably between 2 and 4 linked nucleosides, containing at least two consecutive phosphodiester bonds, e.g., at least three, four, or five consecutive phosphodiester bonds. Preferably, the nucleosides are DNA or RNA. In one embodiment, the linker between the oligonucleotide and the conjugate moiety is a physiologically labile linker composed of 2 to 5 consecutive phosphodiester-linked nucleosides containing at least two consecutive phosphodiester bonds at the 5' or 3' end of the consecutive nucleotide sequence of the antisense oligonucleotide.

[0103] In some embodiments, the physiologically labile linker comprises or consists of a DNA dinucleotide having a sequence selected from the group consisting of AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, wherein there is a phosphodiester bond between the two DNA nucleosides and at least one additional phosphodiester is present at the 5' or 3' end of the dinucleotide that links an oligonucleotide of the nucleic acid molecule to the dinucleotide or that links a conjugate moiety to the dinucleotide. For example, the linker can be a CA dinucleotide. In some embodiments, the physiologically labile linker comprises or consists of a DNA trinucleotide of the sequence AAA, AAT, AAC, AAG, ATA, ATT, ATC, ATG, ACA, ACT, ACC, ACG, AGA, AGT, AGC, AGG, TAA, TAT, TAC, TAG, TTA, TTT, TTC, TAG, TCA, TCT, TCC, TCG, TGA, TGT, TGC, TGG, CAA, CAT, CAC, CAG, CTA, CTG, CTC, CTT, CCA, CCT, CCC, CCG, CGA, CGT, CGC, CGG, GAA, GAT, GAC, CAG, GTA, GTT, GTC, GTG, GCA, GCT, GCC, GCG, GGA, GGT, GGC, or GGG, with a phosphodiester bond between the DNA nucleosides and potentially an additional phosphodiester bond at the 5' or 3' end of the trinucleotide. Biocleavable linkers comprising phosphodiesters are described in more detail in WO2014 / 076195 (herein incorporated by reference). In the conjugate compound having a biocleavable linker, when compared with a standard, at least about 50% of the conjugate moiety is cleaved from the oligonucleotide, for example, at least about 60% is cleaved, for example, at least about 70% is cleaved, for example, at least about 80% is cleaved, for example, at least about 85% is cleaved, for example, at least about 90% is cleaved, for example, at least about 95% of the conjugate moiety is cleaved from the oligonucleotide.

[0104] Region Y refers to a linker that is not necessarily biocleavable but primarily serves to covalently attach the conjugate moiety (region C or third region) to the oligonucleotide (region A or first region). Region Y linkers can comprise chain structures or oligomers of repeating units such as ethylene glycol, amino acid units, or aminoalkyl groups. Oligonucleotide conjugates of the invention can be constructed from the following local elements: AC, ABC, ABYC, AYBC, or AYC. In some embodiments, the linker (region Y) is an aminoalkyl, such as a C2-C36 aminoalkyl group, including a C6-C12 aminoalkyl group. In a preferred embodiment, the linker (region Y) is a C6 aminoalkyl group.

[0105] LNA gapmers An LNA gapmer is a gapmer which comprises or consists of LNA nucleosides in one or both of regions F and F'. A beta-D-oxy gapmer is a gapmer which comprises or consists of beta-D-oxy LNA nucleosides in one or both of regions F and F'.

[0106] In some embodiments, the LNA gapmer has the formula: [LNA] 1-5 -[Area G]-[LNA] 1-5 and region G is as defined in the definition of gapmer region G.

[0107] Locked nucleic acid nucleosides (LNA nucleosides) An "LNA nucleoside" is a 2' sugar-modified nucleoside containing a biradical (also referred to as a "2'-4' bridge") linking the C2' and C4' of the ribose sugar ring of the nucleoside, which restricts or fixes the conformation of the ribose ring. These nucleosides are also referred to in the literature as bridged nucleic acids or bicyclic nucleic acids (BNAs). Fixation of the ribose conformation is associated with improved hybridization affinity (duplex stabilization) when LNA is incorporated into oligonucleotides of complementary RNA or DNA molecules. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary duplex.

[0108] Non-limiting exemplary LNA nucleosides include those described in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729, Morita et al. al., Bioorganic & Med. Chem. Lett. 12, 73-76; Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81; Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238; and Wan and Seth, J. Medical Chemistry 2016, 59, 9645-9667.

[0109] Specific examples of LNA nucleosides are shown in Scheme 1, where B is as defined above. [ka]

[0110] Particular LNA nucleosides are beta-D-oxy-LNA, 6'-methyl-beta-D-oxy-LNA, such as (S)-6'-methyl-beta-D-oxy-LNA (ScET) and ENA. A particularly preferred LNA is beta-D-oxy-LNA.

[0111] Mixed Wing Gappa A mixed-wing gapmer is an LNA gapmer in which one or both of regions F and F' comprise 2'-substituted nucleosides, e.g., MOE nucleosides, independently selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, arabinonucleic acid (ANA) units, and 2'-fluoro-ANA units. In some embodiments in which at least one of regions F and F', or both regions F and F', comprise at least one LNA nucleoside, the remaining nucleosides in regions F and F' are independently selected from the group consisting of MOE and LNA. In some embodiments in which at least one of regions F and F', or both regions F and F', comprise at least two LNA nucleosides, the remaining nucleosides in regions F and F' are independently selected from the group consisting of MOE and LNA. In some mixed wing embodiments, one or both of regions F and F' may further comprise one or more DNA nucleosides.

[0112] Modified internucleoside linkages The term "modified internucleoside linkage" is defined as a linkage other than a phosphodiester (PO) linkage that covalently links two nucleosides to one another, as commonly understood by those skilled in the art. Thus, the oligonucleotides of the combinations of the present invention can contain one or more modified internucleoside linkages, such as one or more phosphorothioate internucleoside linkages or one or more phosphorodithioate internucleoside linkages. In some embodiments, the modified internucleoside linkages increase the nuclease resistance of the oligonucleotide compared to phosphodiester linkages. In naturally occurring oligonucleotides, the internucleoside linkages contain a phosphate group that creates a phosphodiester bond between adjacent nucleosides. Modified internucleoside linkages are particularly useful for stabilizing oligonucleotides for in vivo use and can serve to protect against nuclease cleavage in regions of DNA or RNA nucleosides in the oligonucleotides of the combinations of the present invention, such as in the gap region G of a gapmer oligonucleotide, and in regions F and F' of modified nucleosides.

[0113] In one embodiment, the oligonucleotide comprises one or more internucleoside linkages modified from natural phosphodiester, e.g., such that the one or more modified internucleoside linkages are more resistant to nuclease attack. Nuclease resistance can be determined by incubating the oligonucleotide in serum or by using a nuclease resistance assay (e.g., snake venom phosphodiesterase (SVPD)), both of which are well known in the art. An internucleoside linkage that can enhance the nuclease resistance of an oligonucleotide is referred to as a nuclease-resistant internucleoside linkage. In some embodiments, at least 50% of the internucleoside linkages of the oligonucleotide or its contiguous nucleotide sequence are modified, e.g., at least 60%, e.g., at least 70%, e.g., at least 75%, e.g., at least 80%, or e.g., at least 90% of the internucleoside linkages of the oligonucleotide or its contiguous nucleotide sequence are modified. In some embodiments, all of the internucleoside linkages of the oligonucleotide or its contiguous nucleotide sequence are modified. It will be appreciated that in some embodiments, the nucleosides linking the oligonucleotides of the combinations of the present invention to non-nucleotide functional groups, e.g., conjugates, can be phosphodiesters. In some embodiments, all of the internucleoside linkages of the oligonucleotide or its contiguous nucleotide sequence are nuclease-resistant internucleoside linkages.

[0114] The oligonucleotides of the combinations of the invention advantageously use phosphorothioate internucleoside linkages.

[0115] Phosphorothioate internucleoside linkages are particularly useful due to their nuclease resistance, favorable pharmacokinetics, and ease of manufacture.In some embodiments, at least 50% of the internucleoside linkages of an oligonucleotide or its consecutive nucleotide sequence are phosphorothioate, and at least 60%, for example at least 70%, for example at least 75%, for example at least 80%, or for example at least 90% of the internucleoside linkages of an oligonucleotide or its consecutive nucleotide sequence are phosphorothioate.In some embodiments, all of the internucleoside linkages of an oligonucleotide or its consecutive nucleotide sequence are phosphorothioate.

[0116] Nuclease-resistant linkages, such as phosphorothioate linkages, are particularly useful in regions of an oligonucleotide that can recruit nucleases when duplexed with a target nucleic acid, e.g., region G of a gapmer. However, phosphorothioate linkages may also be useful in non-nuclease recruiting and / or affinity-enhancing regions, e.g., regions F and F' of a gapmer. A gapmer oligonucleotide may, in some embodiments, contain one or more phosphodiester linkages in region F or F', or in both regions F and F', and all of the internucleoside linkages in region G may be phosphorothioate.

[0117] Advantageously, all internucleoside linkages of the contiguous nucleotide sequence of the oligonucleotide are phosphorothioate or all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.

[0118] Phosphorothioate linkages can exist in various tautomeric forms, for example as shown below. [ka]

[0119] As disclosed in EP 2742135, it is recognized that antisense oligonucleotides may contain other internucleoside linkages (other than phosphodiester and phosphorothioate), such as alkylphosphonate / methylphosphonate internucleoside linkages, which according to EP 2742135 may be tolerated, for example, within the gap region of another DNA phosphorothioate.

[0120] Modified Nucleosides As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside that has been modified relative to an equivalent DNA or RNA nucleoside by the introduction of one or more modifications to the sugar or (nucleic acid) base moiety. In a preferred embodiment, the modified nucleoside comprises a modified sugar moiety. The term modified nucleoside may also be used interchangeably with the terms "nucleoside analog" or modified "unit" or modified "monomer." Nucleosides with unmodified DNA or RNA sugar moieties are referred to herein as DNA or RNA nucleosides. Nucleosides with modifications in the base region of DNA or RNA nucleosides are still generally referred to as DNA or RNA nucleosides if they are capable of Watson-Crick base pairing.

[0121] Modified Oligonucleotides The term "modified oligonucleotide" refers to an oligonucleotide that contains one or more sugar-modified nucleosides and / or modified internucleoside linkages.The term "chimeric" oligonucleotide is used in the literature to describe oligonucleotides that contain modified nucleosides and DNA nucleosides.The antisense oligonucleotide of the combination of the present invention is preferably a chimeric oligonucleotide.

[0122] Regulation of expression The term "modulation of expression," as used herein, should be understood as a general term for the ability of an oligonucleotide to alter the amount of a target (i.e., RTEL1 or FUBP1) compared to the amount of the target before administration of the oligonucleotide. Alternatively, modulation of expression can be determined by reference to a control experiment. A control is generally understood to be an individual or target cells treated with a saline composition or an individual or target cells treated with a non-targeting oligonucleotide (mock).

[0123] One type of modulation is the ability of the oligonucleotide to inhibit, downregulate, reduce, suppress, eliminate, stop, block, prevent, decrease, reduce, avoid, or terminate expression of the target (i.e., RTEL1 or FUBP1), for example, by mRNA degradation or blocking transcription. Another type of modulation is the ability of the oligonucleotide to restore, increase, or enhance expression of the target, for example, by repairing a splice site or preventing splicing, or by removing or blocking an inhibitory mechanism such as microRNA repression.

[0124] MOE Gapmar An MOE gapmer is a gapmer in which regions F and F' consist of MOE nucleosides. In some embodiments, an MOE gapmer has the design [MOE] 1-8 -[Area G]-[MOE] 1-8 , e.g. [MOE] 2-7 -[Area G] 5-16 -[MOE] 2-7 , e.g. [MOE] 3-6 -[Area G]-[MOE] 3-6 and region G is as defined in the gapmer definition. MOE gapmers with a 5-10-5 design (MOE-DNA-MOE) are widely used in the art.

[0125] Naturally occurring variants The term "naturally occurring variant" refers to a variant of a gene or transcript (e.g., RTEL1 or FUBP1) that originates from the same genetic locus as the target nucleic acid but may differ, for example, due to degeneracy of the genetic code, resulting in multiple codons encoding the same amino acid, or alternative splicing of pre-mRNA, or the presence of polymorphisms, such as single nucleotide polymorphisms (SNPs), and allelic variants. Based on the presence of a sufficiently complementary sequence to the oligonucleotide, the oligonucleotides of the combinations of the invention can therefore target the target nucleic acid and its naturally occurring variants.

[0126] In some embodiments, a naturally occurring variant has at least 95%, e.g., at least 98% or at least 99%, homology to a mammalian RTEL1 or FUBP1 target nucleic acid, e.g., to the target nucleic acid of SEQ ID NO: 1 and / or 2 for RTEL1, or SEQ ID NO: 247 and / or 251 for FUBP1. In some embodiments, a naturally occurring variant of RTEL1 has at least 99% homology to the human RTEL1 target nucleic acid of SEQ ID NO: 1. In some embodiments, a naturally occurring variant of FUBP1 has at least 99% homology to the human FUBP1 target nucleic acid of SEQ ID NO: 247. In some embodiments, a naturally occurring variant is a known polymorphism.

[0127] Nuclease-mediated degradation Nuclease-mediated degradation refers to an oligonucleotide that, when duplexed with a complementary nucleotide sequence, is capable of mediating the degradation of such sequence.

[0128] In some embodiments, oligonucleotides may function through nuclease-mediated degradation of target nucleic acids, and the oligonucleotides of the combinations of the invention are capable of recruiting nucleases, particularly endonucleases, preferably endonucleases (such as RNase H), which recognize RNA / DNA hybridization and result in cleavage of the RNA nucleic acid, preferably endoribonucleases (RNases). Examples of oligonucleotide designs that act via a nuclease-mediated mechanism are oligonucleotides that typically contain a region of at least five or six consecutive DNA nucleosides and are flanked on one or both sides by affinity-enhancing nucleosides, such as gapmers, headmers, and tailmers.

[0129] Nucleic Acid Molecules (or "Oligonucleotides") As used herein, the term "nucleic acid molecule" or "therapeutic nucleic acid molecule" or "oligonucleotide" is defined as it is commonly understood by those of skill in the art as a molecule comprising two or more covalently linked nucleosides (i.e., a nucleotide sequence). Such covalently linked nucleosides can also be referred to as a nucleic acid molecule or an oligomer, which can be used interchangeably.

[0130] The nucleic acid molecule(s) referred to in the combination of the present invention are generally therapeutic oligonucleotides less than 50 nucleotides in length. The nucleic acid molecule may be or include a single-stranded antisense oligonucleotide, or may be other oligomeric nucleic acid molecules, such as CRISPR RNA, siRNA, shRNA, aptamers, or ribozymes. Therapeutic nucleic acid molecules are usually produced in laboratories by solid-phase chemical synthesis followed by purification and isolation. However, shRNA is often delivered to cells using lentiviral vectors and then transcribed to generate single-stranded RNA, which will form a stem-loop (hairpin) RNA structure that can interact with the RNA interference machinery (including the RNA-induced silencing complex (RISC)). When referring to the sequence of a nucleic acid molecule, reference is made to the sequence or order of the nucleobase moieties of covalently linked nucleotides or nucleosides, or modifications thereof. The nucleic acid molecules of the combination of the present invention are artificial, chemically synthesized, and typically purified or isolated. In some embodiments, the nucleic acid molecule of the combination of the present invention is not an shRNA that is transcribed from a vector upon entry into a target cell. The nucleic acid molecules of the combinations of the invention may contain one or more modified nucleosides or nucleotides.

[0131] In some embodiments, nucleic acid molecules of the combinations of the present invention comprise or consist of 12 to 60 nucleotides in length, such as 13 to 50, such as 14 to 40, such as 15 to 30, such as 16 to 22, such as 16 to 18, or 15 to 17 contiguous nucleotides in length. Thus, oligonucleotides of the present invention may, in some embodiments, have a length of 12 to 25 nucleotides. Alternatively, oligonucleotides of the present invention may, in some embodiments, have a length of 15 to 22 nucleotides.

[0132] In some embodiments, the nucleic acid molecule, or contiguous nucleotide sequence thereof, comprises or consists of 24 or fewer nucleotides, e.g., 22 or fewer nucleotides, e.g., 20, e.g., 18 or fewer nucleotides, e.g., 14, 15, 16, or 17 nucleotides. Any range provided herein should be understood to include the endpoints of the range. Thus, when a nucleic acid molecule is described as comprising 12 to 30 nucleotides, both 12 nucleotides and 30 nucleotides are included.

[0133] In some embodiments, the contiguous nucleotide sequence comprises or consists of at least 10, e.g., 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, contiguous nucleotides in length.

[0134] The nucleic acid molecule(s) are for modulating expression of a target nucleic acid in a mammal. In some embodiments, nucleic acid molecules such as siRNAs, shRNAs, and antisense oligonucleotides are typically for inhibiting expression of the target nucleic acid(s).

[0135] In one embodiment of the invention, the nucleic acid molecule is selected from an RNAi agent, e.g., an siRNA or an shRNA. In another embodiment, the nucleic acid molecule is a single-stranded antisense oligonucleotide, such as a high-affinity modified antisense oligonucleotide that interacts with RNase H.

[0136] In some embodiments, the nucleic acid molecules of the combinations of the present invention may comprise one or more modified nucleosides or nucleotides, such as, for example, 2' sugar modified nucleosides.

[0137] In some embodiments, the nucleic acid molecule comprises phosphorothioate internucleoside linkages.

[0138] In some embodiments, the nucleic acid molecule may be linked to a non-nucleoside moiety (conjugate moiety).

[0139] A library of nucleic acid molecules should be understood as a collection of variant nucleic acid molecules. The purpose of a library of nucleic acid molecules can vary. In some embodiments, a library of nucleic acid molecules is composed of nucleic acid molecules having overlapping nucleobase sequences that target one or more mammalian target nucleic acids (i.e., RTEL1 or FUBP1) with the goal of identifying the most potent sequences within a library of oligonucleotides. In some embodiments, a library of nucleic acid molecules is a library of nucleic acid molecule design variants (child nucleic acid molecules) of parent or ancestral nucleic acid molecules, where the nucleic acid molecule design variants retain the core nucleobase sequence of the parent nucleic acid molecule.

[0140] Nucleic acid bases The term "nucleobase" includes purine (e.g., adenine and guanine) and pyrimidine (e.g., uracil, thymine, and cytosine) moieties present in nucleosides and nucleotides, which form hydrogen bonds during nucleic acid hybridization. In the context of the present invention, the term "nucleobase" also encompasses modified nucleobases that may differ from naturally occurring nucleobases but function during nucleic acid hybridization. In this context, "nucleobase" refers to both naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012) Accounts of Chemical Research, vol. 45, page 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry, Suppl. 37, 1.4.1.

[0141] In some embodiments, the nucleobase moiety is modified by changing the purine or pyrimidine to a modified purine or pyrimidine, e.g., a substituted purine or substituted pyrimidine, e.g., a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolo-cytosine, 5-propynyl-cytosine, 5-propynyl-uracil, 5-bromouracil 5-thiazolo-uracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine, and 2-chloro-6-aminopurine.

[0142] Nucleobase moieties may be represented by the letter code for each corresponding nucleobase, e.g., A, T, G, C, or U, and each letter may optionally include modified nucleobases of equivalent function. For example, in the exemplary oligonucleotides, the nucleobase moieties are selected from A, T, G, C, and 5-methylcytosine. Optionally, for LNA gapmers, 5-methylcytosine LNA nucleosides may be used.

[0143] Nucleotides and Nucleosides Nucleotides and nucleosides are the building blocks of oligonucleotides and polynucleotides, and for purposes of the present invention, include both naturally occurring and non-naturally occurring nucleotides and nucleosides. Nucleotides, such as DNA and RNA nucleotides, naturally contain a ribose sugar moiety, a nucleobase moiety, and one or more phosphate groups (not present in nucleosides). Nucleosides and nucleotides may also be referred to interchangeably as "units" or "monomers."

[0144] patient For the purposes of the present invention, a "subject" (or "patient") may be a vertebrate. In the context of the present invention, the term "subject" includes both humans and other animals, particularly mammals, and other organisms. Thus, the means and methods provided herein are applicable to both human therapy and veterinary applications. Thus, as used herein, a subject may be an animal such as a mouse, rat, hamster, rabbit, guinea pig, ferret, cat, dog, chicken, sheep, bovine species, horse, camel, or primate. Preferably, the subject is a mammal. More preferably, the subject is a human. In some embodiments, the patient is suffering from a disease referred to herein, such as HBV infection. In some embodiments, the patient is susceptible to the disease.

[0145] Pharmaceutical Composition In a further aspect, the present invention provides a pharmaceutical composition comprising an oligonucleotide for use in the present invention and a pharmaceutically acceptable diluent, carrier, salt, and / or adjuvant. Pharmaceutically acceptable diluents include phosphate buffered saline (PBS) and pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0146] The present invention provides a pharmaceutical composition according to the invention comprising an oligonucleotide useful in the present invention and an aqueous diluent or solvent.

[0147] The invention provides solutions, such as phosphate buffered saline, of the oligonucleotides of the combinations of the invention. Suitably, the solutions, such as phosphate buffered saline, of the invention are sterile solutions.

[0148] WO 2007 / 031091 provides suitable and preferred examples of pharmaceutically acceptable diluents, carriers, and adjuvants (incorporated herein by reference). Suitable doses, formulations, routes of administration, compositions, dosage forms, combinations with other therapeutic agents, and prodrug formulations are also provided in WO 2007 / 031091.

[0149] The oligonucleotides for use in the present invention can be mixed with pharmaceutically acceptable active or inactive substances to prepare pharmaceutical compositions or formulations. The composition and method for preparing pharmaceutical compositions depend on many criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0150] In some embodiments, an oligonucleotide or oligonucleotide conjugate useful in the present invention is a prodrug. Particularly with respect to oligonucleotide conjugates, the conjugate portion of the oligonucleotide is cleaved once the prodrug is delivered to the site of action, e.g., a target cell.

[0151] Pharmaceutically acceptable salts The term "pharmaceutically acceptable salt" refers to a salt that retains the biological effectiveness and properties of the free base or free acid, without being biologically or otherwise undesirable. Salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid, especially hydrochloric acid, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, and N-acetylcysteine. Additionally, these salts can be prepared by adding an inorganic or organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, and polyamine resins.The compound of formula (I) can also exist in the form of zwitterion.Particularly preferred pharmaceutically acceptable salts of the compound of formula (I) are salts of hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and methanesulfonic acid.

[0152] prevention As used herein, the terms "preventing," "prevention," or "preventing" refer to prophylactic treatment, i.e., measures or measures the purpose of which is to prevent rather than cure a disease. Prevention means that the desired pharmacological and / or physiological effect is obtained prophylactically, in terms of completely or partially preventing a disease or its symptoms. Thus, "preventing HBV infection" as used herein includes preventing the occurrence of HBV infection in a subject and preventing the occurrence of symptoms of HBV infection. The present invention particularly contemplates the prevention of HBV infection in children of HBV-infected mothers. It also contemplates preventing acute HBV infection from transforming into chronic HBV infection.

[0153] Region D' or D" in the oligonucleotide The oligonucleotides of the combinations of the invention may, in some embodiments, comprise or consist of a contiguous nucleotide sequence of the oligonucleotide that is complementary to a target nucleic acid, e.g., a gapmer FG-F', and additional 5' and / or 3' nucleosides. The additional 5' and / or 3' nucleosides may or may not be fully complementary to the target nucleic acid. Such additional 5' and / or 3' nucleosides may be referred to herein as regions D' and D".

[0154] The addition of region D' or D" can be used for the purpose of linking a contiguous nucleotide sequence, such as a gapmer, to a conjugate moiety or another functional group. When used for linking, the conjugate moiety carrying the conjugate moiety can serve as a biocleavable linker. Alternatively, it may be used to provide exonuclease protection or to facilitate synthesis or manufacturing.

[0155] Regions D' and D" can be attached to the 5' end of region F or the 3' end of region F', respectively, to generate designs of the following formula: D'-FG-F', FG-F'-D" or D'-FG-F'-D" where FG-F' is the gapmer portion of the oligonucleotide and regions D' or D" constitute separate portions of the oligonucleotide.

[0156] Region D' or D" independently comprises or consists of 1, 2, 3, 4, or 5 additional nucleotides and may or may not be complementary to the target nucleic acid. The nucleotides adjacent to the F or F' region are not sugar-modified nucleotides, such as DNA or RNA, or base-modified versions thereof. The D' or D' region may serve as a nuclease-sensitive biocleavable linker (see definition of linker). In some embodiments, the additional 5' and / or 3' terminal nucleotides are linked by phosphodiester bonds and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as region D' or D" are disclosed in WO 2014 / 076195, including, by way of example, phosphodiester-linked DNA dinucleotides. The use of biocleavable linkers in polyoligonucleotide constructs is disclosed in WO 2015 / 113922, where they have been used to join multiple antisense constructs (e.g., gapmer regions) within a single oligonucleotide.

[0157] In one embodiment, the oligonucleotides of the combination of the invention comprise regions D' and / or D" in addition to the contiguous nucleotide sequence that makes up the gapmer.

[0158] In some embodiments, the oligonucleotides of the invention can be represented by the following formula: FG-F'; especially F 1-8 -G 5-16 -F' 2-8 D'-FG-F', especially D' 1-3 -F 1-8 -G 5-16 -F' 2-8 FG-F'-D”, especially F 1-8 -G 5-16 -F' 2-8 -D” 1-3 D'-FG-F'-D", especially D' 1-3 -F 1-8 -G 5-16 -F'2-8 -D” 1-3

[0159] In some embodiments, the internucleoside linkage between region D' and region F is a phosphodiester bond. In some embodiments, the internucleoside linkage between region F' and region D" is a phosphodiester bond.

[0160] RNAi molecule As used herein, the term "RNA interference (RNAi) molecule" refers to a short, double-stranded RNA-based oligonucleotide that can induce RNA-dependent gene silencing via the RNA-induced silencing complex (RISC) in the cytoplasm of a cell and interacts with the catalytic RISC component Argonaute. RNAi molecules regulate, e.g., inhibit, the expression of a target nucleic acid in a cell, e.g., a cell within a subject, such as a mammalian subject. One type of RNAi molecule is small interfering RNA (siRNA), a double-stranded RNA molecule composed of two complementary oligonucleotides; upon transcription, one strand binds to the complementary mRNA, resulting in its degradation and loss of translation. Small hairpin RNA (shRNA) is a single-stranded RNA-based oligonucleotide that forms a stem-loop (hairpin) structure, which can reduce mRNA via DICER and the RNA reduction silencing complex (RISC). RNAi molecules can be designed based on the sequence of a gene of interest (target nucleic acid). The corresponding RNAi can then be synthesized chemically or by in vitro transcription, or expressed from a vector or PCR product.

[0161] RNase H activity and recruitment RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when duplexed with a complementary RNA molecule. WO 01 / 23613 provides an in vitro method for determining RNase H activity, which can be used to determine the ability to recruit RNase H. Typically, an oligonucleotide is considered to be capable of recruiting RNase H if, when provided with a complementary target nucleic acid sequence, it has an initial rate measured in pmol / l / min that is at least 5%, e.g., at least 10% or more than 20% of the initial rate determined when using an oligonucleotide having the same base sequence as the modified oligonucleotide being tested but containing only DNA monomers with phosphorothioate linkages between all monomers in the oligonucleotide, using the methodology provided in Examples 91-95 of WO 01 / 23613 (incorporated herein by reference). For use in determining RHase H activity, recombinant human RNase H1 is available from Creative Biomart® (recombinant human RNase H1 fused to a His tag expressed in E. coli).

[0162] shRNA Short hairpin RNA or shRNA molecules are generally 40-70 nucleotides in length, e.g., 45-65 nucleotides in length, e.g., 50-60 nucleotides in length, and form a stem-loop (hairpin) RNA structure that interacts with an endonuclease known as Dicer, which is thought to process dsRNA into 19-23 base pair short interfering RNAs with characteristic 2-base 3' overhangs, which are then incorporated into the RNA-induced silencing complex (RISC). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target, inducing silencing. RNAi oligonucleotides may be chemically modified with modified internucleotide linkages and 2' sugar-modified nucleosides, such as 2'-4' bicyclic ribose-modified nucleosides (including LNA and cET or 2' substitution modifications such as 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA).

[0163] In some embodiments, shRNA nucleic acid molecules contain one or more phosphorothioate internucleoside linkages. In RNAi molecules, phosphorothioate internucleoside linkages can reduce nuclease cleavage in RICS, so it is advantageous not to modify all internucleoside linkages in the stem-loop of the shRNA molecule. Phosphorothioate internucleoside linkages may be advantageously placed at the 3' and / or 5' ends of the stem-loop of the shRNA molecule, particularly in portions of the molecule that are not complementary to the target nucleic acid (e.g., the sense strand or passenger strand of an siRNA molecule). However, the region of the shRNA molecule that is complementary to the target nucleic acid may also be modified in the first two to three internucleoside linkages in the portions predicted to be the 3' and / or 5' ends after Dicer cleavage.

[0164] siRNA The term "siRNA" refers to a small interfering ribonucleic acid (RNAi) molecule. It is a type of double-stranded RNA molecule and is also known in the art as short interfering RNA or silencing RNA. siRNA typically comprises a sense strand (also called a passenger strand) and an antisense strand (also called a guide strand), each strand being 17 to 30 nucleotides long, typically 19 to 25 nucleosides long. The antisense strand is complementary, e.g., at least 95% complementary, e.g., fully complementary, to the target nucleic acid (suitably the mature mRNA sequence). The sense strand is complementary to the antisense strand, so that the sense and antisense strands form a duplex or duplex region. The siRNA strands can form a blunt-ended duplex, or advantageously, the 3' ends of the sense and antisense strands can form 3' overhangs of, for example, 1, 2, or 3 nucleosides, similar to the products generated by Dicer to form RISC substrates in vivo. Effective extended forms of Dicer substrates are described in U.S. Patent Nos. 8,349,809 and 8,513,207, which are incorporated herein by reference. In some embodiments, both the sense and antisense strands have a 2-nt 3' overhang. Thus, the duplex region can be, for example, 17-25 nucleotides in length, e.g., 21-23 nucleotides in length.

[0165] Once inside the cell, the antisense strand is incorporated into the RISC complex, which mediates targeted degradation or target inhibition of the target nucleic acid. siRNA typically contains modified nucleosides in addition to RNA nucleosides. In one embodiment, siRNA molecules can also be chemically modified using modified internucleotide linkages and 2' sugar-modified nucleosides, such as 2'-4' bicyclic ribose-modified nucleosides (including LNA and cET or 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), and 2'-fluoro-ANA). In particular, 2' fluoro, 2'-O-methyl, or 2'-O-methoxyethyl can be incorporated into siRNA.

[0166] In some embodiments, all of the nucleotides of the siRNA sense (passenger) strand may be modified with 2' sugar-modified nucleosides, such as LNA (see, e.g., WO 2004 / 083430, WO 2007 / 085485). In some embodiments, the passenger strand of the siRNA may be discontinuous (see, e.g., WO 2007 / 107162). Incorporation of thermolabile nucleotides in the seed region of the antisense strand of the siRNA has been reported to be useful for reducing the off-target activity of the siRNA (see, e.g., WO 2018 / 098328). Suitably, the siRNA comprises a 5' phosphate group or a 5' phosphate mimic at the 5' end of the antisense strand. In some embodiments, the 5' end of the antisense strand is an RNA nucleoside.

[0167] In one embodiment, the siRNA molecule further comprises at least one phosphorothioate or methylphosphonate internucleoside bond. The phosphorothioate or methylphosphonate internucleoside bond can be at the 3'-end of one or both strands (e.g., antisense strand or sense strand), or the phosphorothioate or methylphosphonate internucleoside bond can be at the 5'-end of one or both strands (e.g., antisense strand or sense strand), or the phosphorothioate or methylphosphonate internucleoside bond can be at both the 5'-end and 3'-end of one or both strands (e.g., antisense strand or sense strand). In some embodiments, the remaining internucleoside bond is a phosphodiester bond. In some embodiments, the siRNA molecule comprises one or more phosphorothioate internucleoside bond(s). In siRNA molecules, phosphorothioate internucleoside linkages can reduce nuclease cleavage in RICS, and therefore it is advantageous that not all internucleoside linkages in the antisense strand are modified.

[0168] The siRNA molecule can further comprise a ligand, hi some embodiments, the ligand is conjugated to the 3' end of the sense strand.

[0169] For biodistribution, the siRNA can be conjugated to a targeting ligand and / or formulated in, for example, lipid nanoparticles.

[0170] Other aspects of the invention relate to pharmaceutical compositions comprising these dsRNA, such as siRNA molecules, suitable for therapeutic use, and methods of reducing target gene expression by administering dsRNA, such as siRNA, molecules of the combinations of the invention, for the treatment of various disease conditions, e.g., as disclosed herein.

[0171] sugar modification The oligonucleotides of the combinations of the invention may include one or more nucleosides having modified sugar moieties, ie, modifications in the sugar moiety as compared to the ribose sugar moiety found in DNA and RNA.

[0172] Numerous nucleosides with modifications in the ribose sugar moiety have been created primarily with the goal of improving certain properties of oligonucleotides, such as affinity and / or nuclease resistance.

[0173] Such modifications include, for example, those in which the ribose ring structure has been modified by replacing it with a hexose ring (HNA) or bicyclic ring (typically having a biradical bridge between the C2 and C4 carbons of the ribose ring (LNA)), or an unlinked ribose ring (e.g., UNA), which typically lacks the bond between the C2 and C3 carbons. Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO 2011 / 017521) or tricyclic nucleic acids (WO 2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety has been replaced with a non-sugar moiety, for example, in the case of peptide nucleic acids (PNAs) or morpholino nucleic acids.

[0174] Sugar modifications also include modifications made by changing the substituent on the ribose ring to a group other than hydrogen or to the 2'-OH group that occurs naturally in DNA and RNA nucleosides. Substituents can be introduced, for example, at the 2', 3', 4', or 5' position.

[0175] target cell As used herein, the term "target cell" refers to a cell expressing a target nucleic acid. For therapeutic uses of the present invention, it is advantageous if the target cell is infected with HBV. In some embodiments, the target cell can be in vivo or in vitro. In some embodiments, the target cell is a mammalian cell, e.g., a rodent cell, e.g., a mouse cell or a rat cell, or a woodchuck cell, or a primate cell, e.g., a monkey cell (e.g., a cynomolgus monkey cell), or a human cell.

[0176] In a preferred embodiment, the target cell expresses RTEL1 and / or FUBP1 mRNA, such as pre-mRNA or mature mRNA. Preferably, the target cell expresses both RTEL1 and FUBP1 mRNA, e.g., pre-mRNA or mature mRNA. The polyA tail of RTEL1 and / or FUBP1 mRNA is typically not considered in antisense oligonucleotide targeting.

[0177] Typically, the target cell expresses RTEL1 mRNA, such as RTEL1 pre-mRNA or RTEL1 mature mRNA. For experimental evaluation, a target cell expressing a nucleic acid comprising a target sequence, such as human RTEL1 pre-mRNA, e.g., SEQ ID NO: 1, may be used. The polyA tail of RTEL1 mRNA is typically not considered in antisense oligonucleotide targeting.

[0178] Combinations of the invention are typically capable of inhibiting expression of an RTEL1 target nucleic acid in a cell expressing the RTEL1 target nucleic acid (a target cell), eg, either in vivo or in vitro.

[0179] Typically, the target cell also expresses FUBP1 mRNA, such as FUBP1 pre-mRNA or FUBP1 mature mRNA. For example, the target cell expresses human FUBP1 pre-mRNA, such as SEQ ID NO: 247, or human FUBP1 mature mRNA containing exon 14, such as SEQ ID NO: 249 or 250, or exon 20 of SEQ ID NO: 247. For experimental evaluation, target cells expressing a nucleic acid containing a target sequence can be used. The polyA tail of FUBP1 mRNA is typically not considered in antisense oligonucleotide targeting. The combination of the present invention can typically inhibit the expression of a FUBP1 target nucleic acid in a target cell expressing a FUBP1 target nucleic acid, for example, in vivo or in vitro.

[0180] Furthermore, the target cells may be hepatocytes. In one embodiment, the target cells are primary human hepatocytes infected with HBV, either derived from an HBV-infected individual or from HBV-infected mice with humanized livers (PhoenixBio, PXB mice).

[0181] According to the present invention, the target cell may be infected with HBV. Furthermore, the target cell may contain HBV cccDNA. Therefore, it is preferred that the target cell contains RTEL1 and / or FUBP1 mRNA, such as pre-mRNA or mature mRNA, and HBV cccDNA. More preferably, the target cell contains both RTEL1 and FUBP1 mRNA, such as pre-mRNA or mature mRNA, and HBV cccDNA.

[0182] RTEL1 target nucleic acid According to the present invention, the target nucleic acid is a nucleic acid encoding a mammalian RTEL1, and can be, for example, a gene, RNA, mRNA, and pre-mRNA, mature mRNA, or cDNA sequence. Thus, the target can be referred to as an RTEL1 target nucleic acid.

[0183] Oligonucleotides for use in the present invention can target, for example, exonic regions of mammalian RTEL1 (particularly targeting exonic regions for siRNA and shRNA, but also antisense oligonucleotides), or can target, for example, intronic regions of the RTEL1 pre-mRNA (particularly antisense oligonucleotides targeting intronic regions). The human RTEL1 gene encodes 15 transcripts, of which 7 transcripts encode proteins, and thus are potential nucleic acid targets.

[0184] Table 1 lists the predicted exon and intron regions of seven transcripts located on the human RTEL1 pre-mRNA of SEQ ID NO: 1. It will be understood that oligonucleotides for use in the present invention can target one or more of the mature mRNA sequences of the transcripts listed in Table 1. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5]

[0185] Suitably, the target nucleic acid encodes an RTEL1 protein, in particular a mammalian RTEL1, such as human RTEL1 (see, for example, Tables 2 and 3), which provide pre-mRNA sequences for human and monkey RTEL1.

[0186] In some embodiments, the target nucleic acid is selected from SEQ ID NO: 1 and / or 2, or a naturally occurring variant thereof (eg, a sequence encoding a mammalian RTEL1 protein in Table 1).

[0187] When the combinations of the invention are used for research or diagnostic purposes, the target nucleic acid can be cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0188] For in vivo or in vitro applications, the combinations of the invention are typically capable of inhibiting expression of an RTEL1 target nucleic acid in cells expressing the RTEL1 target nucleic acid. The contiguous sequence of nucleobases of the oligonucleotides of the combinations of the invention is typically complementary to an RTEL1 target nucleic acid, measured over the length of the oligonucleotide, optionally except for one or two mismatches, and optionally except for a nucleotide-based linker region or other non-complementary terminal nucleotides (e.g., region D' or D"), which may attach the oligonucleotide to any functional group, such as a conjugate. The target nucleic acid, in some embodiments, can be RNA or DNA, such as a mature mRNA (e.g., an exon region of a transcript listed in Table 1) or a messenger RNA, such as a pre-mRNA.

[0189] In some embodiments, the target nucleic acid is RNA or DNA encoding a mammalian RTEL1 protein, such as human RTEL1, e.g., the human RTEL1 mRNA sequence as disclosed as SEQ ID NO: 1. Further information regarding exemplary target nucleic acids is provided in Tables 2 and 3. [Table 2] [Table 3] NOTE: SEQ ID NO: 2 contains multiple NNNN regions where sequencing cannot accurately refine the sequence and therefore degenerate sequences are included. For the avoidance of doubt, compounds for use in the present invention are complementary to the actual target sequence and are therefore not degenerate compounds.

[0190] In some embodiments, the target nucleic acid is SEQ ID NO:1.

[0191] In some embodiments, the target nucleic acid is SEQ ID NO:2.

[0192] FUBP1 target nucleic acid According to the present invention, the target nucleic acid is a nucleic acid encoding a mammalian FUBP1, and may be, for example, a gene, RNA, mRNA, pre-mRNA, mature mRNA, or cDNA sequence. Thus, the target may be referred to as a FUBP1 target nucleic acid.

[0193] Suitably, the target nucleic acid encodes a FUBP1 protein, in particular a mammalian FUBP1, such as a human FUBP1 gene encoding the pre-mRNA or mRNA sequences provided herein as SEQ ID NO: 247, 249 and / or 250. SEQ ID NO: 247 is the sequence of human FUBP1 pre-mRNA. SEQ ID NOs: 249 and 250 are the sequences of human FUBP1 mRNA.

[0194] The nucleic acid molecule of the combination of the present invention can be, for example, targeted to the exon region of mammalian FUBP1 (particularly siRNA and shRNA, but also antisense oligonucleotide), or can be, for example, targeted to any intron region of FUBP1 pre-mRNA (particularly antisense oligonucleotide).Table 4 lists the predicted exon and intron regions of SEQ ID NO: 247. [Table 4]

[0195] Suitably, the target nucleic acid encodes a FUBP1 protein, in particular mammalian FUBP1, such as human FUBP1 (see, for example, Tables 5 and 6), providing the genomic sequences, mature mRNA and pre-mRNA sequences of human, monkey and mouse FUBP1.

[0196] In some embodiments, the target nucleic acid can be a cynomolgus monkey FUBP1 nucleic acid, such as mRNA or pre-mRNA.

[0197] In some embodiments, the target nucleic acid can be a mouse FUBP1 nucleic acid, such as mRNA or pre-mRNA.

[0198] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NOs: 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, and / or 266, or a naturally occurring variant thereof (e.g., a sequence encoding a mammalian FUBP1).

[0199] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NOs: 247, 251 and / or 255, or naturally occurring variants thereof (eg, sequences encoding mammalian FUBP1).

[0200] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NOs: 247 and 251, or naturally occurring variants thereof (eg, sequences encoding mammalian FUBP1).

[0201] In some embodiments, the target nucleic acid is selected from the group consisting of SEQ ID NOs: 247-254, or a naturally occurring variant thereof (eg, a sequence encoding a mammalian FUBP1).

[0202] In some embodiments, the target nucleic acid is RNA or DNA encoding a mammalian FUBP1 protein, such as human FUBP1, for example, the human FUBP1 mRNA sequence as disclosed as SEQ ID NO: 247. Further information regarding exemplary target nucleic acids is provided in Tables 5 and 6. [Table 5]

[0203] When nucleic acid molecules for use in the present invention are used for research or diagnostic purposes, the target nucleic acid can be cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0204] For in vivo or in vitro applications, the therapeutic nucleic acid molecule is typically capable of inhibiting expression of a FUBP1 target nucleic acid in cells that express the FUBP1 target nucleic acid. The contiguous sequence of nucleobases of the nucleic acid molecule is typically complementary to a conserved region of a FUBP1 target nucleic acid, measured over the length of the oligonucleotide, optionally excluding one or two mismatches, and optionally excluding a nucleotide-based linker region or other non-complementary terminal nucleotide that may link the oligonucleotide to any functional group, such as a conjugate.

[0205] The target nucleic acid can be a messenger RNA, such as a pre-mRNA, encoding a mammalian FUBP1 protein, such as human FUBP1, e.g., a human FUBP1 pre-mRNA sequence such as that disclosed as SEQ ID NO: 247, a cynomolgus monkey FUBP1 pre-mRNA sequence such as that disclosed as SEQ ID NO: 251, or a mouse FUBP1 pre-mRNA sequence such as that disclosed as SEQ ID NO: 255, or a mature FUBP1 mRNA, such as the human mature mRNAs disclosed as SEQ ID NOs: 248, 249, and 250. SEQ ID NOs: 247-266 are DNA sequences. It will be understood that the target RNA sequence has uracil (U) bases in place of thymidine (T) bases.

[0206] Further information regarding exemplary target nucleic acids is provided in Table 6. [Table 6] NOTE: SEQ ID NO: 251 contains multiple NNNN regions where sequencing cannot accurately refine the sequence and therefore degenerate sequences are included. For the avoidance of doubt, the compounds of the combinations of the invention are complementary to the actual target sequences and are therefore not degenerate compounds.

[0207] Target sequence The term "target sequence" as used herein refers to a sequence of nucleotides present in a target nucleic acid, comprising a nucleobase sequence complementary to an oligonucleotide for use in the present invention. In some embodiments, the target sequence consists of a region on the target nucleic acid having a nucleobase sequence complementary to the contiguous nucleotide sequence of an oligonucleotide for use in the present invention. This region of the target nucleic acid can be interchangeably referred to as a target nucleotide sequence, a target sequence, or a target region. In some embodiments, the target sequence can be longer than the complementary sequence of a single oligonucleotide, and can represent a preferred region of the target nucleic acid that can be targeted by, for example, several oligonucleotides.

[0208] RTEL1 target sequence In some embodiments, the target sequence is a sequence selected from the group consisting of human RTEL1 mRNA exons, such as the RTEL1 human mRNA exons selected from the list in Table 1 above.

[0209] In some embodiments, the target sequence is a sequence selected from the group consisting of a human RTEL1 mRNA intron, such as a RTEL1 human mRNA intron selected from the list in Table 1 above.

[0210] Oligonucleotides for use in the present invention comprise a contiguous nucleotide sequence that is complementary to or hybridizes to a target nucleic acid, such as a target sequence described herein.

[0211] The target sequence to which the oligonucleotide is complementary or hybridizes generally comprises a contiguous nucleic acid sequence of at least 10 nucleotides. The contiguous nucleotide sequence is 10 to 35 nucleotides, such as 12 to 30, for example 14 to 20, for example 16 to 20 contiguous nucleotides. In one embodiment of the present invention, the target sequence is selected from the group consisting of SEQ ID NOs: 3 to 26 shown in Table 7. [Table 7]

[0212] In some embodiments, the target sequence is SEQ ID NO:5.

[0213] In some embodiments, the target sequence is SEQ ID NO:13.

[0214] In some embodiments, the target sequence is SEQ ID NO:14.

[0215] In some embodiments, the target sequence is SEQ ID NO:15.

[0216] In some embodiments, the target sequence is SEQ ID NO:16.

[0217] SEQ ID NO: 5: GAGATTCAAGTTATAATAAAG SEQ ID NO: 13: TTTGACCAGAGTATGTAAAATT SEQ ID NO: 14: TTTGACCAGAGTATGTAA SEQ ID NO: 15: GACCAGAGTATGTAAAATT SEQ ID NO: 16: ACCAGAGTATGTAAAATT

[0218] SEQ ID NOs: 3 to 26 are DNA sequences. It will be understood that the target RNA sequences have uracil (U) bases in place of thymidine (T) bases.

[0219] The target sequences shown in SEQ ID NOs: 13 to 16 can be found in intron 8 of human RTEL1. The target sequence shown in SEQ ID NO: 5 can be found in intron 7 of human RTEL1.

[0220] In some embodiments, the target sequence is the region from nucleotides 11753 to 11774 of SEQ ID NO:1.

[0221] In some embodiments, the target sequence is the region from nucleotides 11757 to 11774 of SEQ ID NO:1.

[0222] In some embodiments, the target sequence is the region from nucleotides 11756 to 11774 of SEQ ID NO:1.

[0223] In some embodiments, the target sequence is the region from nucleotides 11753 to 11770 of SEQ ID NO:1.

[0224] In some embodiments, the target sequence is the region from nucleotides 8681 to 8701 of SEQ ID NO:1.

[0225] In some embodiments, the target sequence is selected from the regions shown in Table 8A or Table 8B. [Table 8A-1] [Table 8A-2] [Table 8A-3] [Table 8A-4] [Table 8A-5] [Table 8A-6] [Table 8A-7] [Table 8A-8] [Table 8A-9] [Table 8A-10] [Table 8B]

[0226] FUBP1 target sequence In some embodiments, the target sequence is a sequence selected from the group consisting of human FUBP1 mRNA exons, such as FUBP1 human mRNA exons selected from the group consisting of e1, e2, e3, e4, e5, e6, e7, e8, e9, e10, e11, e12, 13, e14, e15, e16, e17, e18, e19 and e20 (see, e.g., Table 4 above).

[0227] In one embodiment, the target sequence is a sequence selected from the group consisting of one or more of the human FUBP1 mRNA exons selected from the group consisting of exons 9, 10, 12, 14 and 20.

[0228] In some embodiments, the target sequence is a sequence selected from the group consisting of a human FUBP1 mRNA intron, e.g., a FUBP1 human mRNA intron selected from the group consisting of i1, i2, i3, i4, i5, i6, i7, i9, i10, i11, i12, 13, i14, i15, i16, i17, i18, and i19 (see, e.g., Table 4 above).

[0229] The nucleic acid molecules of the combinations of the present invention comprise a contiguous nucleotide sequence that is complementary to or hybridizes to a region on a target nucleic acid, eg, a target sequence described herein.

[0230] In one embodiment, the target sequence is exon 14 of the human FUBP1 mRNA (see Table 4 above).

[0231] In another embodiment, the target sequence is exon 20 of the human FUBP1 mRNA (see Table 4 above).

[0232] The antisense oligonucleotides of the combinations of the present invention comprise a contiguous nucleotide sequence that is complementary to or hybridizes to a region on a target nucleic acid, eg, a target sequence described herein.

[0233] Target sequences defined by regions of the human FUBP1 pre-mRNA (using SEQ ID NO: 247 as reference) that can be targeted by the oligonucleotides of the combinations of the present invention are provided herein below.

[0234] The oligonucleotides of the combinations of the present invention comprise a contiguous nucleotide sequence that is complementary to or hybridizes with a target nucleic acid, such as a subsequence of a target nucleic acid, such as a target sequence described herein.

[0235] The target nucleic acid sequence to which the therapeutic nucleic acid molecule is complementary or hybridizes generally comprises a stretch of contiguous nucleobases of at least 10 nucleotides. The contiguous nucleotide sequence (and thus the target sequence) comprises at least 12 contiguous nucleotides, such as 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 nucleotides, such as 14-20, for example 14-18 contiguous nucleotides.

[0236] The present inventors have identified particularly effective sequences of FUBP1 target nucleic acids that can be targeted by the oligonucleotides of the combinations of the present invention.

[0237] In some embodiments, the target sequence is SEQ ID NO:267.

[0238] In some embodiments, the target sequence is SEQ ID NO:268.

[0239] In some embodiments, the target sequence is SEQ ID NO:269.

[0240] In some embodiments, the target sequence is SEQ ID NO:270.

[0241] In some embodiments, the target sequence is SEQ ID NO:347.

[0242] SEQ ID NO: 267: GTGAAAACCATAAAAAGCATAAG SEQ ID NO: 268: AACCATAAAAAGCATAAG SEQ ID NO: 269: GTGAAAACCATAAAAAGCATA SEQ ID NO: 270: GTAGAAATGAAAATTGGT SEQ ID NO: 347: GACTATGGTTATGGGG

[0243] SEQ ID NOs: 267, 268 269, 270 and 347 are DNA sequences. It will be understood that the target RNA sequences have uracil (U) bases in place of thymidine (T) bases.

[0244] The present invention provides antisense oligonucleotides comprising a contiguous nucleotide sequence complementary, eg, perfectly complementary, to a region from nucleotides 16184 to 16205 of human FUBP1 pre-mRNA (set forth in SEQ ID NO: 247).

[0245] The present invention provides antisense oligonucleotides comprising a contiguous nucleotide sequence complementary, eg, perfectly complementary, to a region from nucleotides 16188 to 16205 of human FUBP1 pre-mRNA (set forth in SEQ ID NO: 247).

[0246] The present invention provides antisense oligonucleotides comprising a contiguous nucleotide sequence complementary, eg, perfectly complementary, to a region from nucleotides 16184 to 16203 of human FUBP1 pre-mRNA (set forth in SEQ ID NO: 247).

[0247] The present invention also provides an antisense oligonucleotide comprising a contiguous nucleotide sequence complementary, for example completely complementary, to a region of nucleotides 30536 to 30553 of human FUBP1 pre-mRNA (shown in SEQ ID NO: 247).

[0248] The present invention also provides an antisense oligonucleotide comprising a contiguous nucleotide sequence complementary, for example, completely complementary, to a region from nucleotides 9141 to 9156 of human FUBP1 pre-mRNA (set forth in SEQ ID NO: 247).

[0249] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is complementary, eg, completely complementary, to the region from nucleotide 16184 to 16200 of SEQ ID NO:247.

[0250] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is complementary, eg, completely complementary, to the region from nucleotide 16186 to 16203 of SEQ ID NO:247.

[0251] In some embodiments, the antisense oligonucleotide or contiguous nucleotide sequence is complementary, eg, completely complementary, to the region from nucleotide 16189 to 16205 of SEQ ID NO:247.

[0252] In some embodiments, the target sequence is the region from nucleotide 16184 to 16200 of SEQ ID NO:247.

[0253] In some embodiments, the target sequence is the region from nucleotide 16186 to 16203 of SEQ ID NO:247.

[0254] In some embodiments, the target sequence is the region from nucleotides 16188 to 16205 of SEQ ID NO:247.

[0255] In some embodiments, the target sequence is the region from nucleotides 16189 to 16205 of SEQ ID NO:247.

[0256] target As used herein, the term "target" may refer to the mammalian protein RTEL1 ("Regulator of telomere elongation helicase 1"), also known as "KIAA1088" or "C20ORF41" or "regulator of telomere length" or "telomere length regulator" or "chromosome 20 open reading frame 41." The Homo sapiens RTEL1 gene is located on chromosome 20, complement 63,657,810 to 63,696,253 (Homo sapiens Updated Annotation, Release 109.20200228, GRCh38.p13). The RTEL1 protein is an ATP-dependent DNA helicase involved in telomere length regulation, DNA repair, and maintaining genome stability. The amino acid sequence of human RTEL1 is known in the art and can be assessed by UniProt, see UniProt entry Q9NZ71 for human RTEL1 (hereby incorporated by reference).

[0257] The term "target" can also be used to refer to the mammalian protein "Far Upstream Element-Binding Protein 1," also known as "FUBP1" or "FBP" or "FUBP" or "hDH V." The Homo sapiens FUBP1 gene is located on chromosome 1, 77944055..77979435, complement (NC_000001.11, gene number 1462). The FUBP1 gene encodes a ssDNA-binding protein that activates the far upstream element of c-myc and stimulates c-myc expression in undifferentiated cells. Regulation of FUSE by FUBP occurs through single-stranded binding of FUBP to the non-coding strand. The FUBP1 protein has ATP-dependent DNA helicase activity. The amino acid sequence of human FUBP1 is known in the art and can be assessed by UniProt, see, for example, UniProt entry Q96AE4 for human FUBP1 (hereby incorporated by reference).

[0258] Therapeutically effective dose The term "therapeutically effective amount" refers to an amount of a compound or pharmaceutical combination of the present invention that, when administered to a subject, (i) treats or prevents a particular disease, condition, or disorder, (ii) reduces, ameliorate, or eliminates one or more symptoms of a particular disease, condition, or disorder, or (iii) prevents or delays the onset of one or more symptoms of a particular disease, condition, or disorder described herein. A therapeutically effective amount may vary depending on the compound, the disease state being treated, the severity of the disease being treated, the age and relative health of the subject, the route and form of administration, the judgment of the attending physician or veterinarian, and other factors.

[0259] treatment As used herein, the term "treatment" refers to both the treatment of an existing disease (e.g., a disease or disorder referred to herein) or the prevention of disease, i.e., prophylaxis. Accordingly, it will be recognized that the treatment referred to herein may, in some embodiments, be prophylactic. Prevention may be understood as preventing HBV infection from converting to chronic HBV infection, or preventing serious liver diseases, such as cirrhosis and hepatocellular carcinoma, due to chronic HBV infection. DETAILED DESCRIPTION OF THE INVENTION

[0260] Detailed Description of the Invention HBV cccDNA in infected hepatocytes is involved in persistent chronic infection and reactivation, serving as the template for all viral subgenomic transcripts and pregenomic RNA (pgRNA), ensuring both newly synthesized viral progeny and cccDNA pool replenishment via intracellular nucleocapsid recycling. In the context of the present invention, RTEL1 has been shown for the first time to be associated with cccDNA stability. This knowledge provides an opportunity to destabilize cccDNA in HBV-infected subjects, potentially opening up the possibility of a complete cure for chronically infected HBV patients.

[0261] Overexpression and mutation of FUBP1 have long been known to be associated with cancer. In particular, strong overexpression of FUBP1 in human hepatocellular carcinoma (HCC) supports tumor growth and correlates with poor patient prognosis. HBV cccDNA in infected hepatocytes is involved in persistent chronic infection and reactivation, serving as a template for all viral subgenomic transcripts and pregenomic RNA (pgRNA), ensuring both newly synthesized viral progeny and cccDNA pool replenishment via intracellular nucleocapsid recycling. In the context of the present invention, FUBP1 has been shown for the first time to be associated with cccDNA stability. This knowledge opens up opportunities to destabilize cccDNA in HBV-infected subjects and potentially achieve a complete cure for chronically infected HBV patients. The roles of FUBP1 in HCC and cccDNA stability are expected to be distinct and independent.

[0262] The present invention relates to the combination of two categories of compounds: i) inhibitors of RTEL1 and ii) inhibitors of FUBP1 or pharmaceutically acceptable salts thereof. Suitably, each compound is provided with a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0263] Suitably, the combination according to the invention is for use in the treatment of hepatitis B virus infection and / or cancer, particularly in the treatment of patients with chronic HBV infection.

[0264] In one embodiment, the combination of the present invention is a composition, pharmaceutical composition, or kit comprising compounds i) an inhibitor of RTEL1 and ii) an inhibitor of FUBP1, or pharmaceutically acceptable salts thereof. Suitably, each compound is provided with a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0265] The present invention also relates to a method for treating or preventing a disease comprising administering a combination according to the present invention.

[0266] The present invention also relates to the use of a combination according to the invention for the preparation of a medicament.

[0267] The present invention also relates to an in vivo or in vitro method for modulating the expression of RTEL1 and FUBP1 in target cells expressing RTEL1 and FUBP1, which method comprises administering a combination according to the present invention.

[0268] Each category of compounds in the combination will be described separately below. However, it should be understood that at least one compound from each category is present in the combination. The compounds can be administered simultaneously or separately. The compounds in each category can be administered parenterally (e.g., intravenously, subcutaneously, or intramuscularly) or enterally (e.g., orally or via the digestive tract).

[0269] RTEL1 inhibitors In one embodiment, the first category of compounds in the combination of the present invention is an inhibitor that targets RTEL1. Such an inhibitor can be, for example, selected from the group consisting of a small molecule, a single-stranded antisense oligonucleotide; an siRNA molecule; or an shRNA molecule.

[0270] In this section, the term "oligonucleotide" should be understood as "an oligonucleotide that targets RTEL1."

[0271] Therapeutic oligonucleotides are potentially good RTEL1 inhibitors because they can target the RTEL1 transcript and promote its degradation either through the RNA interference pathway or RNase H cleavage. Alternatively, aptamer-like oligonucleotides can also act as inhibitors of RTEL1 protein interactions.

[0272] In one embodiment, the first category of compounds in the combination of the present invention is an inhibitor that targets RTEL1. Such inhibitors may be selected from the group of oligonucleotides consisting of single-stranded antisense oligonucleotides, siRNA molecules, or shRNA molecules.

[0273] This section describes oligonucleotides or conjugates thereof of the combinations of the invention; which are suitable for use in the treatment and / or prevention of Hepatitis B Virus (HBV) infection (e.g., chronic HBV infection) or in the treatment of cancer.

[0274] The oligonucleotides of the combinations of the invention are capable of inhibiting the expression of RTEL1 in vitro and in vivo. Inhibition is achieved by hybridizing the oligonucleotide to a target nucleic acid encoding RTEL1 or involved in the regulation of RTEL1. The target nucleic acid can be a mammalian RTEL1 sequence, such as the sequences of SEQ ID NOs: 1 and / or 2.

[0275] In some embodiments of the invention, the oligonucleotides are capable of reducing cccDNA in infected cells.

[0276] In some embodiments, the oligonucleotides of the combinations of the present invention can modulate the expression of a target by inhibiting or downregulating it. Preferably, such modulation results in at least 20% inhibition compared to the target's normal expression level, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% inhibition compared to the target's normal expression level. In some embodiments, the oligonucleotides may be capable of inhibiting RTEL1 mRNA expression levels by at least 60% or 70% in vitro using 10 μM in PXB-PHH cells. In some embodiments of the present invention, the oligonucleotides can inhibit RTEL1 protein expression levels by at least 50% in vitro using 10 μM PXB-PHH cells; this range of target reduction is advantageous in that it allows for the selection of nucleic acid molecules that correlate well with cccDNA reduction. Appropriately, the Examples provide assays that can be used to measure RTEL1 RNA or protein inhibition (e.g., Example 1). Target inhibition is caused by hybridization between the consecutive nucleotide sequence of the oligonucleotide and the target nucleic acid. In some embodiments, the oligonucleotide contains a mismatch between the oligonucleotide and the target nucleic acid. Despite the mismatch, hybridization to the target nucleic acid may still be sufficient to exhibit the desired inhibition of RTEL1 expression. The decrease in binding affinity resulting from the mismatch may be advantageously compensated for by increasing the number of nucleotides in the oligonucleotide and / or by increasing the number of modified nucleosides, such as LNA-containing 2' sugar-modified nucleosides, present in the oligonucleotide sequence, which can increase binding affinity to the target.

[0277] One aspect of the present invention relates to oligonucleotides, 12-60 nucleotides in length, comprising a contiguous nucleotide sequence at least 10 nucleotides in length, e.g., at least 12-30 nucleotides in length, that are at least 95% complementary, e.g., fully complementary, to a mammalian RTEL1 target nucleic acid, particularly a human RTEL1 nucleic acid, that are capable of inhibiting the expression of RTEL1.

[0278] One aspect of the present invention relates to an oligonucleotide having a length of 12 to 30 nucleotides, comprising a contiguous nucleotide sequence of at least 10 nucleotides, e.g., 10 to 30 nucleotides, that is at least 90% complementary, e.g., completely complementary, to a mammalian RTEL1.

[0279] A further aspect of the invention relates to an oligonucleotide comprising a contiguous nucleotide sequence of 12 to 20, such as 15 to 22 nucleotides in length, which has at least 90% complementarity, such as being fully complementary, to a target nucleic acid of SEQ ID NO:1.

[0280] In some embodiments, the oligonucleotide comprises a contiguous sequence of 10-30 nucleotides in length that is at least 90% complementary to a region of the target nucleic acid or target sequence, such as at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, or 100% complementary.

[0281] It is advantageous if the oligonucleotide or its contiguous nucleotide sequence for use in the present invention is perfectly complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments, may contain one or two mismatches between the oligonucleotide and the target nucleic acid.

[0282] In some embodiments, the antisense oligonucleotide sequence is 100% complementary to the corresponding target nucleic acid region of SEQ ID NO:1.

[0283] In some embodiments of the invention, the oligonucleotides or contiguous nucleotide sequences of the combinations of the invention are at least 95% complementary, such as completely (or 100%) complementary, to the target nucleic acids of SEQ ID NO:1 and SEQ ID NO:2.

[0284] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence 15-22 nucleotides in length that is at least 90% complementary, e.g., 100% complementary, to a corresponding target sequence present in SEQ ID NO: 1, wherein the target sequence is selected from the group consisting of SEQ ID NOs: 3-26 (Table 7) or regions 1A-959A of Table 8A. Table 8A: Regions of SEQ ID NO: 1 that can be targeted using oligonucleotides of the combination of the invention

[0285] In some embodiments, the oligonucleotide comprises a contiguous nucleotide sequence of 16-20, e.g., 15-22 nucleotides in length that is at least 90% complementary, e.g., 100% complementary, to a corresponding target sequence present in SEQ ID NO: 1, wherein the target sequence is selected from the group consisting of SEQ ID NOs: 3-26 (Table 7) or regions B1-B28 of Table 8B.

[0286] In some embodiments of the invention, the oligonucleotide comprises or consists of 12 to 60 nucleotides in length, such as 13 to 50, such as 14 to 35, such as 15 to 30, such as 16 to 20 contiguous nucleotides in length, hi preferred embodiments, the oligonucleotide comprises or consists of 15, 16, 17, 18, 19, or 20 nucleotides in length.

[0287] In some embodiments, the contiguous nucleotide sequence of the oligonucleotide that is complementary to the target nucleic acid comprises or consists of a length of 12 to 30, such as 13 to 25, such as 15 to 23, such as 16 to 22 contiguous nucleotides.

[0288] In some embodiments, the contiguous nucleotide sequence of the siRNA or shRNA that is complementary to the target nucleic acid comprises or consists of a length of 18 to 28, such as 19 to 26, such as 20 to 24, such as 21 to 23 contiguous nucleotides.

[0289] In some embodiments, the contiguous nucleotide sequence of a single-stranded antisense oligonucleotide complementary to a target nucleic acid comprises or consists of a length of 12 to 22, such as 14 to 20, for example 16 to 20, for example 15 to 21, for example 15 to 18, for example 16 to 18, for example 16 to 17 contiguous nucleotides.

[0290] In some embodiments, the oligonucleotide or contiguous nucleotide sequence comprises or consists of a sequence selected from the group consisting of the sequences listed in Table 9A.

[0291] In some embodiments, the oligonucleotide or contiguous nucleotide sequence comprises or consists of 10-30 nucleotides in length having at least 90%, preferably 100%, identity to a sequence selected from the group consisting of SEQ ID NOs: 27-246 (see motif sequences listed in Table 9A). In particular embodiments, the oligonucleotide or contiguous nucleotide sequence is selected from SEQ ID NOs: 27; 28; 29; 30; 31; 32; 33; 34; 37; 40; 41; 42; 43; 44; 45; 46; 47; 48; 51; 54; 88; 114; 135; 208; 237; 243; 244; 245, and 246.

[0292] In certain embodiments, the oligonucleotide or contiguous nucleotide sequence is selected from SEQ ID NO:243.

[0293] In certain embodiments, the oligonucleotide or contiguous nucleotide sequence is selected from SEQ ID NO:244.

[0294] In certain embodiments, the oligonucleotide or contiguous nucleotide sequence is selected from SEQ ID NO:245.

[0295] In certain embodiments, the oligonucleotide or contiguous nucleotide sequence is selected from SEQ ID NO:246.

[0296] It is understood that the contiguous oligonucleotide sequence (motif sequence) can be modified, for example, to increase nuclease resistance and / or binding affinity to the target nucleic acid.

[0297] The pattern in which modified nucleosides (such as high affinity modified nucleosides) are incorporated into an oligonucleotide sequence is commonly referred to as the oligonucleotide design.

[0298] Oligonucleotides can be designed using modified nucleosides and RNA nucleosides (particularly siRNA and shRNA molecules) or DNA nucleosides (particularly single-stranded antisense oligonucleotides). It is advantageous to use high-affinity modified nucleosides.

[0299] In one embodiment, the oligonucleotide comprises at least one modified nucleoside, e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 modified nucleosides. In one embodiment, the oligonucleotide comprises 1 to 10 modified nucleosides, e.g., 2 to 9 modified nucleosides, e.g., 3 to 8 modified nucleosides, e.g., 4 to 7 modified nucleosides, e.g., 6 or 7 modified nucleosides. Suitable modifications are described in the "Definitions" sections of "Modified Nucleosides," "High Affinity Modified Nucleosides," "Sugar Modifications," "2' Sugar Modifications," and Locked Nucleic Acid (LNA).

[0300] In one embodiment, the oligonucleotide comprises one or more sugar-modified nucleosides, such as 2'-sugar-modified nucleosides. Preferably, the oligonucleotide comprises one or more 2'-sugar-modified nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides. It is advantageous if one or more of the modified nucleosides is / are locked nucleic acid (LNA).

[0301] In further embodiments, the oligonucleotide comprises at least one modified internucleoside linkage. Suitable internucleoside modifications are described in the "Definitions" section under "Modified Internucleoside Linkages." It is advantageous if at least 2-3 internucleoside linkages at the 5'-end or 3'-end of the oligonucleotide are phosphorothioate internucleoside linkages. For single-stranded antisense oligonucleotides, it is advantageous if at least 75%, e.g., all, of the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate linkages. In some embodiments, all internucleoside linkages within the contiguous sequence of a single-stranded antisense oligonucleotide are phosphorothioate linkages.

[0302] In some embodiments of the present invention, the oligonucleotide comprises at least one LNA nucleoside, for example, 1, 2, 3, 4, 5, 6, 7, or 8 LNA nucleosides, for example, 2 to 6 LNA nucleosides, for example, 3 to 7 LNA nucleosides, 4 to 8 LNA nucleosides, or 3, 4, 5, 6, 7, or 8 LNA nucleosides. In some embodiments, at least 75% of the modified nucleosides of the oligonucleotide are LNA nucleosides, for example, 80%, for example, 85%, for example, 90% of the modified nucleosides. In yet further embodiments, all of the modified nucleosides of the oligonucleotide are LNA nucleosides. In further embodiments, the oligonucleotide may comprise both beta-D-oxy-LNA and one or more of the following LNA nucleosides: thio-LNA in either the beta-D or alpha-L configuration, amino-LNA, oxy-LNA, ScET, and / or ENA, or a combination thereof. In further embodiments, all LNA cytosine units are 5-methyl-cytosine. For nuclease stability of an oligonucleotide or a contiguous nucleotide sequence, it is advantageous to have at least one LNA nucleoside at the 5'-end and at least two LNA nucleosides at the 3'-end of the nucleotide sequence.

[0303] In one embodiment of the present invention, the oligonucleotide is capable of recruiting RNase H.

[0304] In the present invention, advantageous structural designs are those described in the "Definitions" section, for example, "Gapmer," "LNA Gapmer," and "MOE Gapmer." In the present invention, it is advantageous if the antisense oligonucleotide is a gapmer of FG-F' design. In some embodiments, the gapmer is an LNA gapmer with uniform flanks.

[0305] In a classical gapmer design, i.e., a gapmer with uniform flanks (e.g., 4-12-2), all nucleotides in the flanks (F and F') are composed of the same type of 2'-sugar-modified nucleoside, e.g., LNA, cET, or MOE, and a central stretch of DNA forms the gap (G). In a gapmer with an alternating flank design, the flanks of the oligonucleotide are annotated as a series of integers, representing the number of beta-D-oxy LNA nucleosides (L) followed by the number of DNA nucleosides (D). For example, flank F' with a 1-2-1-1-3 motif represents LDDLDLLL (CMP No. 246_1; see Table 9A or 9B). Both flanks have beta-D-oxy LNA nucleosides at the 5' and 3' ends. The gap region (G) is composed of several DNA nucleosides located between the flanks.

[0306] In some embodiments of the invention, the LNA gapmer is selected from the following flank designs: 2-12-3, 4-14-2, 3-10-3, 3-9-3, 2-15-2, 2-12-4, 1-13-2, 3-13-2, 4-13-2, 2-12-2, 3-12-2, 3-15-2, 3-14-2, 3-13-3, 2 -14-4, 3-12-3, 1-14-3, 3-14-3, 2-14-3, 2-15-3, 3-11-3, 1-12-3, 1-11-4, 1-13-2, 2-13-2, 2-16-2, 1-14-2, 1-17-3, 1-18-2, 4-12-2, 2-13-4, 2-11-1-2-1-1-3, and 2-17-4. [Table 9A-1] [Table 9A-2] [Table 9A-3] [Table 9A-4] [Table 9A-5] [Table 9A-6] [Table 9A-7] [Table 9A-8]

[0307] Design refers to gapmer design FG-F', where each number represents the number of consecutive modified nucleosides, e.g., a 2'-modified nucleoside (first number = 5' flank), followed by the number of DNA nucleosides (second number = gap region), followed by the number of modified nucleosides, e.g., a 2'-modified nucleoside (third number = 3' flank), optionally preceded or followed by additional repeated regions of DNA and LNA that need not be part of the contiguous sequence complementary to the target nucleic acid.

[0308] The oligonucleotide compounds represent specific designs of motif sequences, where uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, all LNA C's are 5-methylcytosines, 5-methyl DNA cytosines are represented by "e", and all internucleoside linkages are phosphorothioate internucleoside linkages.

[0309] In all cases, the FG-F' design may further comprise regions D' and / or D" as described in the "Definitions" section under "Region D' or D" in an Oligonucleotide." In some embodiments of the invention, the oligonucleotide has one, two, or three phosphodiester-linked nucleoside units, e.g., DNA units, at the 5' or 3' end of the gapmer region. In some embodiments, the oligonucleotide consists of two 5' phosphodiester-linked DNA nucleosides followed by an FG-F' gapmer region as defined in the "Definitions" section. Oligonucleotides comprising phosphodiester-linked DNA units at the 5' or 3' end are suitable for conjugation and may further comprise a conjugate moiety as described herein. For delivery to the liver, an ASGPR targeting moiety is particularly advantageous as a conjugate moiety.

[0310] For some embodiments of the invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having CMP numbers 27_1; 28_1; 29_1; 30_1; 31_1; 32_1; 33_1; 34_1; 35_1; 36_1; 37_1; 38_1; 39_1; 40_1; 41_1; 42_1; 43_1; 44_1; 45_1; 46_1; 47_1; 47_2; 47_3; 48_1; 48_2; 49_1; 50_1; 51_1; 52_1; 53_1; 54_1; 135_1; 114_1; 88_1; 208_1; 237_1; 243_1; 244_1; 245_1, 246_1 and 246_2 (see Tables 9A and 9B).

[0311] In a preferred embodiment of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds 243_1; 242_1; 245_1, 246_1 and 246_2 (see Tables 9A and 9B).

[0312] In a preferred embodiment of the invention, the oligonucleotide is compound number 243_1 (see Tables 9A and 9B).

[0313] In a preferred embodiment of the invention, the oligonucleotide is compound number 244_1 (see Tables 9A and 9B).

[0314] In a preferred embodiment of the invention, the oligonucleotide is compound number 245_1 (see Tables 9A and 9B).

[0315] In a preferred embodiment of the invention, the oligonucleotide is compound number 246_1 (see Tables 9A and 9B).

[0316] In a preferred embodiment of the invention, the oligonucleotide is compound number 246_2 (see Tables 9A and 9B).

[0317] In some embodiments of the invention, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 12 to 22 nucleotides, e.g., 15 to 20 nucleotides, that is at least 90% complementary, e.g., completely complementary, to the target nucleic acid of SEQ ID NO: 13.

[0318] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 18 nucleotides, e.g., 17 or 18 nucleotides, that is at least 90% complementary, e.g., fully complementary, to a target nucleic acid of SEQ ID NO: 16.

[0319] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 19 nucleotides, e.g., 18 or 19 nucleotides, that is at least 90% complementary, e.g., completely complementary, to the target nucleic acid of SEQ ID NO: 15.

[0320] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 18 nucleotides, e.g., 17 or 18 nucleotides, that is at least 90% complementary, e.g., completely complementary, to the target nucleic acid of SEQ ID NO: 14.

[0321] In some embodiments of the invention, the antisense oligonucleotides of the combinations of the invention comprise a contiguous nucleotide sequence of 12 to 22 nucleotides, e.g., 17 to 22 nucleotides, that has at least 90% complementarity, e.g., is fully complementary, to the target nucleic acid of SEQ ID NO:5.

[0322] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 22 nucleotides, e.g., 15 to 18 nucleotides, e.g., 17 or 18 nucleotides, that has at least 90% complementarity, e.g., is fully complementary, to a target nucleic acid selected from the following regions of SEQ ID NO:1: 8681-8701 of SEQ ID NO:1; 8681-8701, 11753-11774 of SEQ ID NO:1; e.g., nucleotides 11757-11774, 11756-11774, or 11753-11770 of SEQ ID NO:1.

[0323] In some embodiments, the contiguous nucleotide sequence comprises a sequence of nucleobases selected from the group consisting of SEQ ID NOs: 243, 244, 245 and 246, or at least 14 contiguous nucleotides thereof.

[0324] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises or consists of a length of 10 to 30 nucleotides, such as 12 to 25, such as 11 to 22, such as 12 to 20, such as 14 to 18 or 14 to 16 contiguous nucleotides.

[0325] In some embodiments, the antisense oligonucleotide, or its contiguous nucleotide sequence, comprises or consists of 22 or fewer nucleotides, e.g., 20 or fewer nucleotides, e.g., 18 or fewer nucleotides, e.g., 14, 15, 16, or 17 nucleotides. Any range provided herein should be understood to include the endpoints of the range. Thus, when an oligonucleotide is described as comprising 10 to 30 nucleotides, both 10 nucleotides and 30 nucleotides are included.

[0326] In some embodiments, the contiguous nucleotide sequence comprises or consists of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides in length.

[0327] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ ID NOs: 243, 244, 245, and 246.

[0328] The antisense oligonucleotide is, for example, an antisense oligonucleotide having a length of 12 to 24 nucleotides, for example, 12 to 18 nucleotides, and the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, for example, at least 13, for example, at least 14, for example, at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 13.

[0329] Antisense oligonucleotides useful in the present invention are, for example, antisense oligonucleotides 12 to 24 nucleotides in length, e.g., 12 to 18 nucleotides in length, and the antisense oligonucleotides comprise a contiguous nucleotide sequence comprising at least 12, e.g., at least 13, e.g., at least 14, e.g., at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 16.

[0330] Antisense oligonucleotides useful in the present invention are, for example, antisense oligonucleotides 12 to 24 nucleotides in length, e.g., 12 to 18 nucleotides in length, and the antisense oligonucleotides comprise a contiguous nucleotide sequence comprising at least 12, e.g., at least 13, e.g., at least 14, e.g., at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 15.

[0331] Antisense oligonucleotides useful in the present invention are, for example, antisense oligonucleotides 12 to 24 nucleotides in length, e.g., 12 to 18 nucleotides in length, and the antisense oligonucleotides comprise a contiguous nucleotide sequence comprising at least 12, e.g., at least 13, e.g., at least 14, e.g., at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO: 14.

[0332] Antisense oligonucleotides useful in the present invention are, for example, antisense oligonucleotides 12 to 24 nucleotides in length, e.g., 12 to 18 nucleotides in length, and the antisense oligonucleotides comprise a contiguous nucleotide sequence comprising at least 12, e.g., at least 13, e.g., at least 14, e.g., at least 15 or at least 16 contiguous nucleotides present in SEQ ID NO:5.

[0333] In an advantageous embodiment, the antisense oligonucleotide comprises one or more sugar-modified nucleosides, such as one or more 2'-sugar-modified nucleosides, for example, one or more 2'-sugar-modified nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides. It is advantageous if one or more of the modified nucleosides is / are locked nucleic acid (LNA).

[0334] In some embodiments, the contiguous nucleotide sequence comprises LNA nucleosides.

[0335] In some embodiments of the oligonucleotide, all LNA nucleosides are beta-D-oxy LNA nucleosides.

[0336] In some embodiments, the contiguous nucleotide sequence comprises LNA nucleosides and DNA nucleosides.

[0337] In some embodiments, the contiguous nucleotide sequence comprises 2'-O-methoxyethyl (2'MOE) nucleosides.

[0338] In some embodiments, the contiguous nucleotide sequence comprises 2'-O-methoxyethyl (2'MOE) nucleosides and DNA nucleosides.

[0339] Advantageously, the 3'-most nucleoside of the antisense oligonucleotide, or of the contiguous nucleotide sequence thereof, is a 2'-sugar modified nucleoside.

[0340] Advantageously, the oligonucleotide contains at least one modified internucleoside linkage, such as phosphorothioate or phosphorodithioate.

[0341] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorothioate internucleoside linkage.

[0342] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorodithioate internucleoside linkage.

[0343] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphodiester internucleoside linkage.

[0344] In some embodiments, all internucleoside linkages within a contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0345] In some embodiments, at least 75% of the internucleoside linkages within the antisense oligonucleotide, or the contiguous nucleotide sequence thereof, are phosphorothioate internucleoside linkages.

[0346] In some embodiments, all of the internucleoside linkages within the antisense oligonucleotide, or the contiguous nucleotide sequence thereof, are phosphorothioate internucleoside linkages.

[0347] In advantageous embodiments of the invention, the antisense oligonucleotide is capable of recruiting RNase H, such as RNase H1. In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence is a gapmer.

[0348] In some embodiments, the antisense oligonucleotide, or the contiguous nucleotide sequence thereof, consists of or comprises a gapmer of the formula 5'-FG-F'-3'.

[0349] In some embodiments, region G consists of 6 to 16 DNA nucleosides, for example, 11 to 16 DNA nucleosides. In some embodiments, region F comprises 2 to 4 DNA nucleosides and / or region F' comprises 2 to 6 DNA nucleosides.

[0350] In some embodiments, regions F and F' each comprise at least one LNA nucleoside.

[0351] In some embodiments, the oligonucleotides of the invention are LNA gapmers with uniform flanks. For example, the LNA gapmers with uniform flanks can have a design selected from the following designs: 1-12-3, 4-12-2, 2-17-4, 2-13-4, and 2-12-4. Table 9B lists preferred designs for each motif sequence.

[0352] In some embodiments of the invention, the LNA gapmer is an alternating flank LNA gapmer. In some embodiments, the alternating flank LNA gapmer comprises at least one alternating flank (such as flank F'). In some embodiments, the alternating flank LNA gapmer comprises one alternating flank (such as flank F') and one uniform flank (such as flank F). For example, an LNA gapmer with one alternating F' flank may have the following design: 2-11-1-2-1-3. The present invention provides the following oligonucleotide compounds (Tables 9B and 10): [Table 9B] [Table 10] Helm annotation keys: [LR](G) is a beta-D-oxy-LNA guanine nucleoside; [LR](T) is beta-D-oxy-LNA thymine nucleoside; [LR](A) is a beta-D-oxy-LNA adenine nucleoside; [LR] ([5meC]) is beta-D-oxy-LNA 5-methylcytosine nucleoside; [dR](G) is a DNA guanine nucleoside; [dR](T) is a DNA thymine nucleoside; [dR](A) is a DNA adenine nucleoside; [dR](C) is a DNA cytosine nucleoside; [sP] is a phosphorothioate internucleoside linkage; P is a phosphodiester internucleoside linkage.

[0353] The heading "Oligonucleotide Compound" in Tables 9A and 9B refers to the specific design of the motif sequence. Capital letters are beta-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages. The heading "Design" refers to the gapmer design, FG-F'. In a classic gapmer design, i.e., a gapmer with uniform flanks (e.g., 4-12-2), all nucleotides in the flanks (F and F') are composed of the same type of 2' sugar-modified nucleoside, e.g., LNA, cET, or MOE, and a central stretch of DNA forming the gap (G). In a gapmer with an alternating flank design, the flanks of the oligonucleotide are annotated as a series of integers, representing the number of beta-D-oxy LNA nucleosides (L) followed by the number of DNA nucleosides (D). For example, flank F', which has a 1-2-1-1-3 motif, represents LDDLDLLL (see CMP No. 325_1). Both flanks have beta-D-oxy LNA nucleosides at the 5' and 3' ends. A gap region (G) is made up of several DNA nucleosides located between the flanks.

[0354] In some embodiments of the invention, the oligonucleotide is selected from the group of oligonucleotide compounds consisting of CMP numbers 243_1, 244_1, 245_1, 246_1 and 246_2 (see Table 9B).

[0355] In all cases, the FG-F' design may further comprise regions D' and / or D" as described in the "Definitions" section of "Region D' or D" in an Oligonucleotide." In some embodiments of the invention, the oligonucleotide has one, two, or three phosphodiester-linked nucleoside units, e.g., DNA units, at the 5'- or 3'-end, e.g., the 5'-end, of the gapmer region. In some embodiments of the invention, the oligonucleotide consists of two 5' phosphodiester-linked DNA nucleosides followed by an FG-F' gapmer region as defined above. Oligonucleotides comprising phosphodiester-linked DNA units at the 5'- or 3'-end are suitable for conjugation and may further comprise a conjugate moiety as described herein. For delivery to the liver, an ASGPR targeting moiety is particularly advantageous as the conjugate moiety. See conjugate moiety for further details.

[0356] FUBP1 inhibitors In one embodiment, the second category of compounds in the combination of the present invention is an inhibitor that targets FUBP1. Such an inhibitor can be, for example, selected from the group consisting of a small molecule, a single-stranded antisense oligonucleotide; an siRNA molecule; or an shRNA molecule.

[0357] Without being bound by theory, it is believed that FUBP1 is involved in stabilizing cccDNA in the cell nucleus, and that by preventing FUBP1 binding to DNA (particularly cccDNA), the cccDNA is destabilized and becomes more susceptible to degradation. Thus, one embodiment of the present invention includes a FUBP1 inhibitor that interacts with the DNA-binding domain of the FUBP1 protein and prevents or reduces binding to cccDNA.

[0358] Small molecules that inhibit FUBP1 Small molecules that inhibit FUBP1 have been identified in relation to the role of FUBP1 in cancer, and these small molecules inhibit the DNA binding activity of FUBP1, particularly the binding to FUSE elements on single-stranded DNA.In the present invention, it is assumed that FUBP1 inhibitors are useful for treating HBV.In particular, targeting such small molecule compounds to the liver, for example by conjugation or formulation, can be beneficial for treating HBV.

[0359] Huth et al. (2004) J Med. Chem Vol. 47 p. 4851-4857 discloses a series of benzoylanthranilic acid compounds that can bind to the four tandem K-homology (KH) repeats of FUBP1. All compounds disclosed in Huth et al. (2004) are incorporated herein by reference. In particular, compounds of formula I, II, or III shown below have been found to be effective in inhibiting FUBP1 DNA binding activity. [ka]

[0360] One embodiment of the present invention includes a compound of Formula I, II or III for use in the treatment and / or prevention of Hepatitis B virus (HBV) infection.

[0361] Hauck et al. 2016 Bioorganic & Medicinal Chemistry Vol. 24 p.5717-5729 describes a series of additional compounds with high FUBP1 inhibitory potency (see Table 2, incorporated herein by reference). In particular, the following compound of formula IV was effective in inhibiting FUBP1 activity: [ka] In the formula, R1 is [ka] is selected from R2 is [ka] is selected from.

[0362] Specifically, compounds of formula V, VI and VII were shown to have IC50 values ​​of less than 15 μM. [ka] 2-(5-Bromothiophen-2-yl)-5-(3,4-dimethoxyphenyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidine [ka] 2-(5-chlorothiophen-2-yl)-5-(3,4-dimethoxyphenyl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidine [ka] 5-(3,4-Dimethoxyphenyl)-2-(thiophen-2-yl)-7-(trifluoromethyl)pyrazolo[1,5-a]pyrimidine

[0363] One embodiment of the present invention includes a compound of formula IV for use in the treatment and / or prevention of Hepatitis B virus (HBV) infection.

[0364] One embodiment of the present invention includes a compound of Formula V, VI or VI for use in the treatment and / or prevention of Hepatitis B virus (HBV) infection.

[0365] The S-adenosyl-L-methionine (SAM)-competitive inhibitor GSK343 ​​(Formula VIII) is currently in preclinical development for osteosarcoma. GSK343 ​​has been shown to inhibit FUBP1 expression in osteosarcoma cells (Xiong et al. 2016 Int J Onc 49 623). [ka]

[0366] One embodiment of the present invention includes a compound of Formula VII for use in the treatment and / or prevention of Hepatitis B virus (HBV) infection.

[0367] The FDA-approved cancer drugs camptothecin (CPT, Formula IX) and its derivative SN-38 (7-ethyl-10-hydroxycamptothecin, Formula X), which are topoisomerase I (TOP1) inhibitors, were recently shown to also inhibit FUBP1 activity by preventing the FUBP1 / FUSE interaction (Hosseini et al. 2017 Biochemical Pharmacology Vol 146 p.53-62). [ka]

[0368] Camptothecin ((+)-4(S)-ethyl-4-hydroxy-3,4,12,14-tetrahydro-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinoline-3,14dione). [ka]

[0369] SN-38 (4(S),11-diethyl-4,9-dihydroxy-3,4,12,14-tetrahydro-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinoline-3,14-dione 7-ethyl-10-hydroxycamptothecin).

[0370] One embodiment of the present invention includes a compound of Formula IX or X for use in the treatment and / or prevention of Hepatitis B virus (HBV) infection.

[0371] Tringali et al. 2012 Journal of Pharmacy and Pharmacology Vol 64, p. 360-365 described the pharmacokinetic profile of SN-38 conjugated to hyaluronic acid (HA-SN-38, Formula XI), which showed increased distribution to the liver. [ka]

[0372] One embodiment of the present invention includes a compound of formula XI for use in the treatment and / or prevention of Hepatitis B virus (HBV) infection.

[0373] Various lipid conjugates of SN-38 also exist in the literature. For example, WO2006 / 082053 describes a molecule of formula XII: [ka]

[0374] CN105777770 describes the palmitic acid conjugate SN-38, shown in Formula XIII below. [ka]

[0375] One embodiment of the present invention includes a compound of Formula XII or XIII for use in the treatment and / or prevention of Hepatitis B virus (HBV) infection.

[0376] In a further aspect of the invention, FUBP1 inhibitors, e.g., for use in the treatment and / or prevention of hepatitis B virus (HBV) infection, can be targeted directly to the liver by covalently linking them to a conjugate moiety, e.g., a bivalent or trivalent GalNAc cluster, capable of binding to the asialoglycoprotein receptor (ASGPr).

[0377] siRNA targeting FUBP1 [Table 11] A pool of siRNA (ON-TARGETplus SMART pool siRNA catalog number L-011548-00-0005, Dharmacon) is available containing the four individual siRNA molecules listed in Table 11.

[0378] Oligonucleotides targeting FUBP1 In this section, the term "oligonucleotide" should be understood as "an oligonucleotide targeting FUBP1".

[0379] Nucleic acid molecules (or oligonucleotides) are potentially excellent inhibitors of FUBP1 because they can target the FUBP1 transcript and promote its degradation either via the RNA interference pathway or RNase H cleavage. Alternatively, nucleic acid molecules such as aptamers can also act as inhibitors of the DNA binding site of FUBP1, in line with the small molecules described above.

[0380] In one embodiment of the present invention, the combination comprises a nucleic acid molecule for use in the treatment and / or prevention of Hepatitis B virus (HBV) infection. Such a nucleic acid molecule may be selected from the group consisting of a single-stranded antisense oligonucleotide; an siRNA molecule; or an shRNA molecule.

[0381] Nucleic acid molecules useful in the present invention are capable of inhibiting the expression of FUBP1 in vitro and in vivo. Inhibition is achieved by hybridizing an oligonucleotide to a target nucleic acid encoding FUBP1.

[0382] The target nucleic acid can be a mammalian FUBP1 sequence, such as a sequence selected from the group consisting of SEQ ID NOs: 247 to 266. It is advantageous if the mammalian FUBP1 sequence is selected from the group consisting of SEQ ID NOs: 247, 248, 249, 250, 251, 252, 253, and 254.

[0383] In some embodiments, nucleic acid molecules useful in the present invention can modulate FUBP1 expression by inhibiting or downregulating it. Preferably, such modulation results in at least 40% inhibition of expression compared to the target's normal expression level, more preferably at least 50%, 60%, 70%, 80%, 90%, 95%, or 98% inhibition compared to the target's normal expression level. In some embodiments, nucleic acid molecules useful in the present invention can inhibit FUBP1 mRNA expression levels by at least 65% to 98%, e.g., 70% to 95%, in vitro using HepG2-NTCP cells or HBV-infected primary human hepatocytes. This range of target reduction is advantageous in selecting nucleic acid molecules that correlate well with cccDNA reduction. In some embodiments, oligonucleotides useful in the present invention can inhibit FUBP1 protein expression levels by at least 50% in vitro using HepG2-NTCP cells or HBV-infected primary human hepatocytes. The Materials and Methods section and Examples herein provide assays that can be used to measure target RNA inhibition and cccDNA in HepG2-NTCP cells or HBV-infected primary human hepatocytes. Target modulation is triggered by hybridization between a contiguous nucleotide sequence of an oligonucleotide, such as the guide strand of an siRNA or the gapmer region of an antisense oligonucleotide, and a target nucleic acid. In some embodiments, oligonucleotides useful in the present invention contain mismatches between the oligonucleotide or contiguous nucleotide sequence and one or both of the target nucleic acid. Despite mismatches, hybridization to the target nucleic acid may still be sufficient to demonstrate the desired modulation of FUBP1 expression. The decrease in binding affinity resulting from mismatches can be advantageously compensated for by increasing the length of the oligonucleotide and / or the number of modified nucleosides within the oligonucleotide sequence, which can increase binding affinity to the target. Advantageously, oligonucleotides useful in the present invention contain modified nucleosides, such as 2' sugar-modified nucleosides, including LNA, which can increase binding affinity.

[0384] One aspect of the present invention relates to a combination comprising a contiguous nucleotide sequence of 12 to 60 nucleotides in length, including a nucleic acid molecule of 12 to 30 nucleotides in length, capable of inhibiting the expression of FUBP1.

[0385] In some embodiments, the nucleic acid molecule comprises a contiguous sequence that is at least 90% complementary to a region of a target nucleic acid or target sequence, such as at least 91%, for example at least 92%, for example at least 93%, such as at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, or 100% complementary.

[0386] In one embodiment, the nucleic acid molecule or its contiguous nucleotide sequence of the combination of the present invention is fully complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments, may contain one or two mismatches between the oligonucleotide and the target nucleic acid.

[0387] In some embodiments, the nucleic acid molecule comprises a contiguous nucleotide sequence 12-30 nucleotides in length that is at least 95% complementary, e.g., fully (or 100%) complementary, to a target nucleic acid region present in SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, and / or SEQ ID NO:250.

[0388] In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence is at least 93% complementary, e.g., fully (or 100%) complementary, to the target nucleic acid of SEQ ID NO:247, SEQ ID NO:248, SEQ ID NO:249, SEQ ID NO:250, SEQ ID NO:251, SEQ ID NO:252, SEQ ID NO:253 and / or SEQ ID NO:254.

[0389] In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence is at least 95% complementary, eg, completely (or 100%) complementary, to the target nucleic acids of SEQ ID NO:247 and SEQ ID NO:251.

[0390] In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence is at least 95% complementary, eg, completely (or 100%) complementary, to the target nucleic acids of SEQ ID NO:247, SEQ ID NO:251 and SEQ ID NO:255.

[0391] In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence is 100% complementary to positions 14200 to 14218 of SEQ ID NO:247.

[0392] In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence is 100% complementary to positions 14413 to 14431 of SEQ ID NO:247.

[0393] In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence is 100% complementary to positions 14966 to 14984 of SEQ ID NO:247.

[0394] In some embodiments, the nucleic acid molecule or contiguous nucleotide sequence is 100% complementary to positions 30344 to 30362 of SEQ ID NO:247.

[0395] In some embodiments the nucleic acid molecule comprises or consists of a length of 12 to 60 nucleotides, such as 13 to 50, such as 14 to 35, such as 15 to 30, such as 16 to 22 nucleotides.

[0396] In some embodiments, the contiguous nucleotide sequence of the nucleic acid molecule that is complementary to the target nucleic acid comprises or consists of a length of 12 to 30, such as 14 to 25, such as 16 to 23, such as 18 to 22 contiguous nucleotides.

[0397] In some embodiments, the contiguous nucleotide sequence of the siRNA or shRNA that is complementary to the target nucleic acid comprises or consists of a length of 18 to 28, such as 19 to 26, such as 20 to 24, such as 21 to 23 contiguous nucleotides.

[0398] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide complementary to the target nucleic acid comprises or consists of a length of 12 to 22, such as 14 to 20, for example 16 to 20, for example 15 to 18, for example 16 to 18, for example 16 to 17 contiguous nucleotides.

[0399] In some embodiments, the oligonucleotide or contiguous nucleotide sequence comprises or consists of 10-30 nucleotides in length having at least 90%, preferably 100%, identity to a sequence selected from the group consisting of SEQ ID NOs: 275-330 (see motif sequences listed in Table 12A). In particular embodiments, the oligonucleotide or contiguous nucleotide sequence is selected from SEQ ID NOs: 325; 326; 327; 328; 329 and 330. [Table 12A-1] [Table 12A-2] [Table 12A-3]

[0400] It is understood that the consecutive nucleobase sequence (motif sequence) can be modified, for example, to increase nuclease resistance and / or binding affinity to the target nucleic acid.

[0401] The pattern that modified nucleosides (such as high affinity modified nucleosides) are incorporated into oligonucleotide sequence is generally referred to as oligonucleotide design.The oligonucleotide of the combination of the present invention is designed using modified nucleosides and RNA nucleosides (particularly siRNA and shRNA molecules) or DNA nucleosides (particularly single-stranded antisense oligonucleotides).It is advantageous to use high affinity modified nucleosides.

[0402] In one embodiment, the oligonucleotide comprises at least one modified nucleoside, e.g., at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight modified nucleosides. In one embodiment, the oligonucleotide comprises 1 to 8 modified nucleosides, e.g., 2 to 7 modified nucleosides, e.g., 3 to 6 modified nucleosides, e.g., 4 to 6 modified nucleosides, e.g., 4 or 5 modified nucleosides. Suitable modifications are described in the "Definitions" sections of "Modified Nucleosides," "High-Affinity Modified Nucleosides," "Sugar Modifications," "2' Sugar Modifications," and Locked Nucleic Acid (LNA).

[0403] In one embodiment, the oligonucleotide comprises one or more sugar-modified nucleosides, such as 2'-sugar-modified nucleosides. Preferably, the oligonucleotide useful in the present invention comprises one or more 2'-sugar-modified nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides. It is advantageous if one or more of the modified nucleosides is / are locked nucleic acid (LNA). Frequently used LNA nucleosides are oxy-LNA or cET.

[0404] In a further embodiment, the oligonucleotide comprises at least one modified internucleoside linkage. Suitable internucleoside modifications are described in the "Definitions" section under "Modified Internucleoside Linkages." It is advantageous if at least 2-3 internucleoside linkages at the 5'-end or 3'-end of the oligonucleotide are phosphorothioate internucleoside linkages. For single-stranded antisense oligonucleotides, it is advantageous if at least 75%, e.g., all, of the internucleoside linkages within the contiguous nucleotide sequence are phosphorothioate linkages.

[0405] In a further aspect of the invention, nucleic acid molecules such as antisense oligonucleotides, siRNAs or shRNAs useful in the invention can be targeted directly to the liver by covalently linking them to a conjugate moiety, such as a bivalent or trivalent GalNAc cluster, that is capable of binding to the asialoglycoprotein receptor (ASGPr).

[0406] Enhanced antisense oligonucleotides or conjugates thereof useful in the present invention are also provided, which are potentially superior FUBP1 inhibitors because they can target FUBP1 transcripts and promote their degradation via RNase H cleavage.

[0407] In some embodiments of the present invention, the enhanced antisense oligonucleotide or its conjugate can modulate by inhibiting or downregulating the expression of the target. Preferably, such modulation results in at least 20% inhibition compared to the normal expression level of the target, more preferably at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% inhibition compared to the normal expression level of the target. In some embodiments, the antisense oligonucleotide or its conjugate of the combination of the present invention may be able to inhibit the expression level of FUBP1 mRNA by at least 50% or 60% in vitro in PXB-PHH cells at 25 μM. In some embodiments of the present invention, the antisense oligonucleotide or its conjugate can inhibit the expression level of FUBP1 protein by at least 50% in vitro in PXB-PHH cells at 25 μM. This range of target reduction is advantageous in selecting antisense oligonucleotides that have a good correlation with cccDNA reduction. Appropriately, the Examples provide assays that can be used to measure FUBP1 RNA inhibition (e.g., Examples 1 or 2). Target inhibition is caused by hybridization between the consecutive nucleotide sequence of the antisense oligonucleotide and the target nucleic acid. In some embodiments, the antisense oligonucleotide of the combination of the present invention contains a mismatch between the antisense oligonucleotide and the target nucleic acid. Despite the mismatch, hybridization to the target nucleic acid may still be sufficient to exhibit the desired inhibition of FUBP1 expression. The decrease in binding affinity resulting from the mismatch can be advantageously compensated for by increasing the number of nucleotides in the oligonucleotide and / or the number of modified nucleosides, such as 2' sugar-modified nucleosides containing LNA, present in the antisense oligonucleotide sequence, which can increase the binding affinity to the target.

[0408] The antisense oligonucleotides of the combinations of the invention are typically 12 to 30, such as 12 to 22, for example 16 to 20 nucleotides in length and comprise a contiguous nucleotide sequence of at least 12 nucleotides, such as 13, 14, 15, 16, 17 or 18 nucleotides, that are complementary, e.g., fully complementary, to a region of human FUBP1 pre-mRNA (set forth in SEQ ID NO:247) selected from a region derived from nucleotides 9141-9156, 16184-16205, 16184-16200, 16186-16203, 16188-16205, and 16189-16205 and 30536-30553 of SEQ ID NO:247.

[0409] In some embodiments of the invention, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 12 to 22 nucleotides, e.g., 15 to 20 nucleotides, that is at least 90% complementary, e.g., fully complementary, to the target nucleic acid of SEQ ID NO: 256.

[0410] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 18 nucleotides, e.g., 17 or 18 nucleotides, that is at least 90% complementary, e.g., fully complementary, to the target nucleic acid of SEQ ID NO: 257.

[0411] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15 to 22 nucleotides, such as 18 to 22 nucleotides, or such as 15 to 18 nucleotides, such as 17 or 18 nucleotides, having at least 90% complementarity, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, e.g., fully complementary, to a target nucleic acid selected from the following regions of SEQ ID NO:247: 9141-9156, 16184-16205, 16184-16200, 16186-16203, 16188-16205, 16189-16205, and 30536-30553 of SEQ ID NO:247. In some embodiments, the antisense oligonucleotide comprises a contiguous sequence of 12 to 30 nucleotides in length that is at least 90% complementary to a region of a target nucleic acid or target sequence, such as at least 91%, for example at least 92%, for example at least 93%, for example at least 94%, for example at least 95%, for example at least 96%, for example at least 97%, for example at least 98%, or 100% complementary.

[0412] The antisense oligonucleotides or their contiguous nucleotide sequences of the combinations of the present invention are advantageous if they are perfectly complementary (100% complementary) to a region of the target nucleic acid, or in some embodiments, may contain one or two mismatches between the oligonucleotide and the target nucleic acid.

[0413] In some embodiments, the antisense oligonucleotide sequence is 100% complementary to the corresponding target nucleic acid region of SEQ ID NO:247.

[0414] In some embodiments, the antisense oligonucleotides of the combination of the present invention, or their contiguous nucleotide sequences, are at least 95% complementary, eg, completely (or 100%) complementary, to the target nucleic acids of SEQ ID NO:247 and SEQ ID NO:250.

[0415] In some embodiments, the antisense oligonucleotide comprises a contiguous nucleotide sequence of 15-22 nucleotides in length that is at least 90% complementary, e.g., 100% complementary, to a corresponding target sequence present in SEQ ID NO:247, wherein the target sequence is selected from nucleotides 9141-9156, 16184-16205, 16184-16200, 16186-16203, 16188-16205, 16189-16205, and 30536-30553 of SEQ ID NO:247.

[0416] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, and advantageously 100% complementary, to the target site sequence of SEQ ID NO:256.

[0417] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, and advantageously 100% complementary, to the target site sequence of SEQ ID NO:257.

[0418] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, and advantageously 100% complementary, to the target site sequence of SEQ ID NO:261.

[0419] In some embodiments, the contiguous nucleotide sequence of the antisense oligonucleotide is at least 90% complementary, and advantageously 100% complementary, to the target site sequence of SEQ ID NO:270.

[0420] In some embodiments, the contiguous nucleotide sequence comprises a sequence of nucleobases selected from the group consisting of SEQ ID NOs: 325, 326, 327, 328, 329, and 330, or at least 14 contiguous nucleotides thereof, for example 17 or 18 contiguous nucleotides thereof.

[0421] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence of the combination of the invention comprises or consists of a length of 10 to 30 nucleotides, such as 12 to 25, such as 11 to 22, such as 12 to 20, such as 14 to 18 or 16 to 18 contiguous nucleotides.

[0422] In some embodiments, the antisense oligonucleotide, or its contiguous nucleotide sequence, comprises or consists of 22 or fewer nucleotides, e.g., 20 or fewer, or 18 or fewer nucleotides. For example, the antisense oligonucleotide, or its contiguous nucleotide sequence, can comprise 14, 15, 16, or 17 nucleotides. Any range provided herein should be understood to include the endpoints of the range. Thus, when an oligonucleotide is described as comprising 10 to 30 nucleotides, both 10 nucleotides and 30 nucleotides are included.

[0423] The present invention provides antisense oligonucleotides, such as antisense oligonucleotides 12 to 24 nucleotides in length, for example 12 to 18 nucleotides in length, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, for example at least 13, for example at least 14, for example at least 15, or at least 16 contiguous nucleotides present in SEQ ID NO: 325.

[0424] The present invention provides antisense oligonucleotides, such as antisense oligonucleotides 12 to 24 nucleotides in length, for example 12 to 18 nucleotides in length, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, for example at least 13, for example at least 14, for example at least 15, or at least 16 contiguous nucleotides present in SEQ ID NO: 326.

[0425] The present invention provides antisense oligonucleotides, such as antisense oligonucleotides 12 to 24 nucleotides in length, for example 12 to 18 nucleotides in length, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, for example at least 13, for example at least 14, for example at least 15, or at least 16 contiguous nucleotides present in SEQ ID NO: 327.

[0426] The present invention provides antisense oligonucleotides, such as antisense oligonucleotides 12 to 24 nucleotides in length, for example 12 to 18 nucleotides in length, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, for example at least 13, for example at least 14, for example at least 15, or at least 16 contiguous nucleotides present in SEQ ID NO: 328.

[0427] The present invention provides antisense oligonucleotides, such as antisense oligonucleotides 12 to 24 nucleotides in length, for example 12 to 18 nucleotides in length, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, for example at least 13, for example at least 14, for example at least 15, or at least 16 contiguous nucleotides present in SEQ ID NO: 329.

[0428] The present invention provides antisense oligonucleotides, such as antisense oligonucleotides 12 to 24 nucleotides in length, for example 12 to 18 nucleotides in length, wherein the antisense oligonucleotide comprises a contiguous nucleotide sequence comprising at least 12, for example at least 13, for example at least 14, for example at least 15, or at least 16 contiguous nucleotides present in SEQ ID NO: 330.

[0429] In some embodiments, the contiguous nucleotide sequence comprises or consists of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 contiguous nucleotides in length, for example 16, 17, or 18 contiguous nucleotides.

[0430] In some embodiments, the antisense oligonucleotide or its contiguous nucleotide sequence comprises or consists of a sequence selected from SEQ ID NOs: 325, 326, 327, 328, 329, and 330.

[0431] In an advantageous embodiment, the antisense oligonucleotide comprises one or more sugar-modified nucleosides, such as one or more 2'-sugar-modified nucleosides, for example, one or more 2'-sugar-modified nucleosides independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides. It is advantageous if one or more of the modified nucleosides is / are locked nucleic acid (LNA).

[0432] In some embodiments, the contiguous nucleotide sequence comprises LNA nucleosides.

[0433] In some embodiments, the contiguous nucleotide sequence comprises LNA nucleosides and DNA nucleosides.

[0434] In some embodiments, the contiguous nucleotide sequence comprises 2'-O-methoxyethyl (2'MOE) nucleosides.

[0435] In some embodiments, the contiguous nucleotide sequence comprises 2'-O-methoxyethyl (2'MOE) nucleosides and DNA nucleosides.

[0436] Advantageously, the 3'-most nucleoside of the antisense oligonucleotide, or of the contiguous nucleotide sequence thereof, is a 2'-sugar modified nucleoside.

[0437] Advantageously, the oligonucleotide contains at least one modified internucleoside linkage, such as phosphorothioate or phosphorodithioate.

[0438] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorothioate internucleoside linkage.

[0439] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphorodithioate internucleoside linkage.

[0440] In some embodiments, at least one internucleoside linkage in the contiguous nucleotide sequence is a phosphodiester internucleoside linkage.

[0441] In some embodiments, all internucleoside linkages within a contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0442] In some embodiments, at least 75% of the internucleoside linkages within the antisense oligonucleotide, or the contiguous nucleotide sequence thereof, are phosphorothioate internucleoside linkages.

[0443] In some embodiments, all of the internucleoside linkages within the antisense oligonucleotide, or the contiguous nucleotide sequence thereof, are phosphorothioate internucleoside linkages.

[0444] In advantageous embodiments of the invention, the antisense oligonucleotides of the combination of the invention are capable of recruiting RNase H, such as RNase H1. In some embodiments of the invention, the antisense oligonucleotides of the combination of the invention, or the contiguous nucleotide sequences thereof, are gapmers.

[0445] In some embodiments, the antisense oligonucleotide, or the contiguous nucleotide sequence thereof, consists of or comprises a gapmer of the formula 5'-FG-F'-3'.

[0446] In some embodiments, region G consists of 6 to 16 DNA nucleosides, e.g., 7 to 12 DNA nucleosides. In some embodiments, region F comprises 4 to 6 nucleosides and / or region F' comprises 2 to 6 nucleosides.

[0447] In some embodiments, regions F and F' each comprise at least one LNA nucleoside.

[0448] In some embodiments of the oligonucleotides of the present invention, all LNA nucleosides are beta-D-oxy LNA nucleosides.

[0449] In some embodiments, the oligonucleotides of the invention are LNA gapmers with uniform flanks.

[0450] In some embodiments of the invention, the LNA gapmer is an alternating flank LNA gapmer. In some embodiments, the alternating flank LNA gapmer comprises at least one alternating flank (such as flank F). In some embodiments, the alternating flank LNA gapmer comprises one alternating flank (such as flank F) and one uniform flank (such as flank F'). In some embodiments, the alternating flank LNA gapmer comprises two alternating flanks. For example, the LNA gapmer can have a design selected from the following designs: 1-12-3, 3-2-1-9-2, 3-1-1-10-2, 2-1-2-10-3, 2-1-1-11-3, 2-1-1-10-1-1-2, 2-1-1-10-4, 1-3-1-7-1-1-3, 3-2-1-9-3, and 1-1-3-9-1-1-2. Table 12B lists the preferred designs for each motif sequence.

[0451] The present invention provides the following oligonucleotide compounds (Table 12B): [Table 12B]

[0452] The heading "Oligonucleotide Compound" in Tables 12A and 12B refers to the specific design of the motif sequence. Capital letters are beta-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages. The heading "Design" refers to the gapmer design, FG-F'. In gapmers with alternating flank designs, the flanks of the oligonucleotide are annotated as a series of integers, representing the number of beta-D-oxy LNA nucleosides (L) followed by the number of DNA nucleosides (D). For example, a flank with a 2-2-1 motif represents LLDDL. Both flanks have beta-D-oxy LNA nucleosides at the 5' and 3' ends. The gap region (G) is composed of several DNA nucleosides located between the flanks.

[0453] For some embodiments of the present invention, the oligonucleotide is selected from the group consisting of oligonucleotide compounds having CMP numbers 325_1, 325_2, 326_1, 326_2, 326_3, 326_4, 327_1, 328_1, 329_1 and 330_1 (see Table 12B).

[0454] In a particular embodiment, the compound of the combination of the invention is the compound having CMP number 325_1 (see Table 12B).

[0455] In a particular embodiment, the compound of the combination of the invention is the compound having CMP number 325_2 (see Table 12B).

[0456] In a particular embodiment, the compound of the combination of the invention is the compound having CMP number 326_1 (see Table 12B).

[0457] In a particular embodiment, the compound of the combination of the invention is the compound having CMP number 326_2 (see Table 12B).

[0458] In a particular embodiment, the compound of the combination of the invention is the compound having CMP number 326_3 (see Table 12B).

[0459] In a particular embodiment, the compound of the combination of the invention is the compound having CMP number 326_4 (see Table 12B).

[0460] In a particular embodiment, the compound of the combination of the invention is the compound having CMP number 327_1 (see Table 12B).

[0461] In a particular embodiment, the compound of the combination of the invention is the compound having CMP number 328_1 (see Table 12B).

[0462] In a particular embodiment, the compound of the combination of the invention is the compound having CMP number 329_1 (see Table 12B).

[0463] In a particular embodiment, the compound of the combination of the invention is the compound having CMP number 330_1 (see Table 12B).

[0464] The antisense oligonucleotide may be selected from the group listed in Table 13, or a pharmaceutically acceptable salt thereof. [Table 13] Helm annotation keys: [LR](G) is a beta-D-oxy-LNA guanine nucleoside; [LR](T) is beta-D-oxy-LNA thymine nucleoside; [LR](A) is a beta-D-oxy-LNA adenine nucleoside; [LR] ([5meC] is beta-D-oxy-LNA 5-methylcytosine nucleoside, [dR](G) is a DNA guanine nucleoside; [dR](T) is a DNA thymine nucleoside; [dR](A) is a DNA adenine nucleoside; [dR] ([C] is a DNA cytosine nucleoside, [sP] is a phosphorothioate internucleoside linkage; P is a phosphodiester internucleoside linkage.

[0465] Thus, the present invention provides an antisense oligonucleotide selected from the group consisting of compound numbers 325_1, 325_2, 326_1, 326_2, 326_3, 326_4, 327_1, 328_1, 329_1 and 330_1.

[0466] In all cases, the FG-F' design may further comprise regions D' and / or D" as described in the "Definitions" section of "Region D' or D" in an Oligonucleotide." In some embodiments, the oligonucleotides of the combinations of the invention have one, two, or three phosphodiester-linked nucleoside units, e.g., DNA units, at the 5' or 3' end of the gapmer region, e.g., the 5' end. In some embodiments, the oligonucleotides of the combinations of the invention consist of two 5' phosphodiester-linked DNA nucleosides followed by an FG-F' gapmer region as defined above. Oligonucleotides comprising phosphodiester-linked DNA units at the 5' or 3' end are suitable for conjugation and may further comprise a conjugate moiety as described herein. For delivery to the liver, an ASGPR targeting moiety is particularly advantageous as the conjugate moiety. See conjugate moieties for further details.

[0467] combination In one embodiment, a third category of compounds in the combination of the present invention are oligonucleotides targeting RTEL1 attached by a linker to oligonucleotides targeting FUBP1.

[0468] In one embodiment, the linker is composed of DNA dinucleotides having a sequence selected from the group consisting of AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, with a phosphodiester bond between the two DNA nucleosides. Preferably, the linker is a CA DNA dinucleotide.

[0469] In one embodiment, the bond at the 5' end of the dinucleotide (linking the dinucleotide to one of the oligonucleotides targeting RTEL1 or FUBP1) is a phosphodiester or phosphorothioate bond; the bond at the 3' end of the dinucleotide (linking the dinucleotide to another oligonucleotide targeting RTEL1 or FUBP1) is a phosphodiester or phosphorothioate bond.

[0470] In one embodiment, an oligonucleotide targeting RTEL1 is linked at its 3' end to the 5' end of an oligonucleotide targeting FUBP1 via a CA DNA dinucleotide, wherein the bond between the 3' end of the oligonucleotide targeting RTEL1 and the 5' end of the dinucleotide is a phosphodiester bond; and the bond between the 3' end of the dinucleotide and the 5' end of the oligonucleotide targeting FUBP1 is a phosphodiester bond.

[0471] In one embodiment, the oligonucleotide targeting FUBP1 is linked at its 3' end to the 5' end of the oligonucleotide targeting RTEL1 via a CA DNA dinucleotide, and the bond between the 3' end of the oligonucleotide targeting FUBP1 and the 5' end of the dinucleotide is a phosphodiester bond; and the bond between the 3' end of the dinucleotide and the 5' end of the oligonucleotide targeting RTEL1 is a phosphodiester bond.

[0472] In one embodiment, an oligonucleotide targeting RTEL1 is linked at its 3' end to the 5' end of an oligonucleotide targeting FUBP1 via a CA DNA dinucleotide, the bond between the 3' end of the oligonucleotide targeting RTEL1 and the 5' end of the dinucleotide is a phosphorothioate bond; and the bond between the 3' end of the dinucleotide and the 5' end of the oligonucleotide targeting FUBP1 is a phosphodiester bond.

[0473] In one embodiment, an oligonucleotide targeting FUBP1 is linked at its 3' end to the 5' end of an oligonucleotide targeting RTEL1 via a CA DNA dinucleotide, the bond between the 3' end of the oligonucleotide targeting FUBP1 and the 5' end of the dinucleotide is a phosphorothioate bond; and the bond between the 3' end of the dinucleotide and the 5' end of the oligonucleotide targeting RTEL1 is a phosphodiester bond.

[0474] In one embodiment, the 5'-most oligonucleotide of a combination consisting of an oligonucleotide targeting RTEL1 joined by a linker to an oligonucleotide targeting FUBP1 is further joined by a linker to a conjugate moiety.

[0475] In one embodiment, the conjugate moiety is attached to the 5'-most oligonucleotide by a linker consisting of a DNA dinucleotide having a sequence selected from the group consisting of AA, AT, AC, AG, TA, TT, TC, TG, CA, CT, CC, CG, GA, GT, GC, or GG, and wherein there is a phosphodiester bond between the two DNA nucleosides. Preferably, the linker is a CA DNA dinucleotide.

[0476] In one embodiment, the linkage at the 5' end of the dinucleotide (linking the dinucleotide to the conjugate moiety) is a phosphodiester or phosphorothioate linkage; the linkage at the 3' end of the dinucleotide (linking the dinucleotide to the 5' end of the 5'-most oligonucleotide) is a phosphodiester or phosphorothioate linkage.

[0477] In one embodiment, the 5'-most oligonucleotide is an oligonucleotide targeting RTEL1 linked at its 5'-end to a conjugate moiety via a CA DNA dinucleotide, wherein the bond between the 5'-end of the oligonucleotide targeting RTEL1 and the 3'-end of the dinucleotide is a phosphodiester bond; and the bond between the 5'-end of the dinucleotide and the conjugate moiety is a phosphodiester bond.

[0478] In one embodiment, the 5'-most oligonucleotide is a FUBP1-targeting oligonucleotide linked at its 5'-end to a conjugate moiety via a CA DNA dinucleotide, wherein the bond between the 5'-end of the FUBP1-targeting oligonucleotide and the 3'-end of the dinucleotide is a phosphodiester bond; and the bond between the 5'-end of the dinucleotide and the conjugate moiety is a phosphodiester bond.

[0479] In one embodiment, the oligonucleotide targeting RTEL1 is CMP No. 245_1 (SEQ ID NO: 245) or CMP No. 246_2 (SEQ ID NO: 246).

[0480] In one embodiment, the oligonucleotide targeting FUBP1 is CMP No. 326_3 (SEQ ID NO: 326) or CMP No. 330_1 (SEQ ID NO: 330). [Table 13-1] [Table 13-2]

[0481] Conjugates Because HBV infection primarily affects hepatocytes in the liver, it is advantageous to conjugate the RTEL1 and / or FUBP1 inhibitor(s) useful in the present invention to increase delivery of the inhibitor to the liver compared to the unconjugated inhibitor. In one embodiment, the liver-targeting moiety is selected from a moiety containing cholesterol or other lipids, or a conjugate moiety capable of binding to the asialoglycoprotein receptor (ASGPR).

[0482] In some embodiments of the invention, the conjugate comprises an antisense oligonucleotide covalently attached to a conjugate moiety.

[0483] The asialoglycoprotein receptor (ASGPR) conjugate moiety comprises one or more carbohydrate moieties capable of binding to the asialoglycoprotein receptor (ASPGR targeting moiety) with an affinity equal to or greater than that of galactose. The affinity of numerous galactose derivatives for the asialoglycoprotein receptor has been studied (see, e.g., Jobst, ST and Drickamer, K. JB.C. 1996, 271, 6686) or is readily determined using methods typical in the art.

[0484] In one embodiment, the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalactosamine. Advantageously, the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).

[0485] To generate an ASGPR conjugate moiety, an ASPGR targeting moiety (preferably, GalNAc) can be attached to the conjugate scaffold. Generally, the ASPGR targeting moieties can be at the same end of the scaffold. In one embodiment, the conjugate moiety consists of two to four terminal GalNAc moieties attached to a spacer that connects each GalNAc moiety to a brancher molecule that can be attached to an antisense oligonucleotide.

[0486] In further embodiments, the conjugate moiety is monovalent, bivalent, trivalent, or tetravalent with respect to the asialoglycoprotein receptor targeting moiety. Advantageously, the asialoglycoprotein receptor targeting moiety comprises an N-acetylgalactosamine (GalNAc) moiety.

[0487] GalNAc conjugate moieties can include, for example, those described in WO 2014 / 179620 and WO 2016 / 055601 and PCT / EP2017 / 059080 (incorporated herein by reference), as well as small peptides with GalNAc moieties attached, such as Tyr-Glu-Glu-(aminohexylGalNAc)3 (YEE(ahGalNAc)3); glycotripeptides that bind to the asialoglycoprotein receptor on hepatocytes, e.g., Duff, et al., Methods Enzymol, 2000, 313, 297; lysine-based galactose clusters (e.g., L3G4; Biessen, et al., Cardovasc. Med., 1999, 214); and cholan-based galactose clusters (e.g., carbohydrate recognition motifs for the asialoglycoprotein receptor).

[0488] The ASGPR-conjugate moiety, particularly the trivalent GalNAc-conjugate moiety, can be attached to the 3' or 5' end of the oligonucleotide using methods known in the art. In one embodiment, the ASGPR-conjugate moiety is attached to the 5' end of the oligonucleotide.

[0489] In one embodiment, the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5. In one embodiment, the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) of Figure 5A-1 or 5A-2, or a mixture of both. In one embodiment, the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) of Figure 5B-1 or 5B-2, or a mixture of both. In one embodiment, the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) of Figure 5C-1 or 5C-2, or a mixture of both. In one embodiment, the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) of Figure 5D-1 or 5D-2, or a mixture of both.

[0490] RTEL1-targeting conjugate In some embodiments, the conjugate that targets RTEL1 comprises: 5'-GN2-C6 o [X]A s A s T s T s t s t s a s c s a s t s a s c s t s c s t s g s G s T s , 5'-GN2-C6 o [X]A s A s t s t s t s t s a s c s a s t s a s c s t s c s t s G s Gs T s m C s 、 5’-GN2-C6 o [X]T s T s a s c s a s t s a s c s t s c s t s g s g s t<00​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​s a s T s m C s T s m C s . where uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, each LNA cytosine is a 5-methylcytosine, the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc), such as those shown in Figure 5, such as the trivalent N-acetylgalactosamine (GalNAc) of Figure 5D-1 or Figure 5D-2, or a mixture of both, and [X] is, as previously described, o a o Represents, is selected from the group consisting of:

[0491] In some embodiments, the conjugate that targets RTEL1 is selected from the group of conjugates listed in Table 14 or a pharmaceutically acceptable salt thereof. [Table 14] Helm annotation keys: [LR](G) is a beta-D-oxy-LNA guanine nucleoside; [LR](T) is beta-D-oxy-LNA thymine nucleoside; [LR](A) is a beta-D-oxy-LNA adenine nucleoside; [LR] ([5meC]) is beta-D-oxy-LNA 5-methylcytosine nucleoside; [dR](G) is a DNA guanine nucleoside; [dR](T) is a DNA thymine nucleoside; [dR](A) is a DNA adenine nucleoside; [dR](C) is a DNA cytosine nucleoside; [sP] is a phosphorothioate internucleoside linkage; P is a phosphodiester internucleoside linkage.

[0492] 5gn2c6 is either the trivalent N-acetylgalactosamine (GalNAc) of Figure 5D-1 or Figure 5D-2, or a mixture of both.

[0493] In some embodiments, 5gn2c6 is a GalNAc residue, R, having the formula: [ka]

[0494] It should be understood that R shown in the above diagram is a mixture of the two stereoisomers shown in Figures 5D1 and 5D2.

[0495] According to a further aspect of the invention, R shown in the above diagram is the stereoisomer shown in Figure 5D1.

[0496] According to a further aspect of the invention, R shown in the above figures is the stereoisomer shown in Figure 5D2. The structures of the conjugates provided in Table 14 are shown in Figures 1-4.

[0497] The inhibitor may include the conjugate of Figure 1 or a pharmaceutically acceptable salt thereof. The inhibitor may include the antisense oligonucleotide of compound number 243_1 or a pharmaceutically acceptable salt thereof.

[0498] The inhibitor may include the conjugate of Figure 2 or a pharmaceutically acceptable salt thereof. The inhibitor may include the antisense oligonucleotide of compound number 244_1 or a pharmaceutically acceptable salt thereof.

[0499] The inhibitor may include the conjugate of Figure 3 or a pharmaceutically acceptable salt thereof. The inhibitor may include the antisense oligonucleotide of compound number 245_1 or a pharmaceutically acceptable salt thereof.

[0500] The inhibitor may include the conjugate of Figure 4 or a pharmaceutically acceptable salt thereof. The inhibitor may include the antisense oligonucleotide of compound number 246_1 or a pharmaceutically acceptable salt thereof.

[0501] Chemical diagrams representing some of the conjugates of the combinations of the present invention are shown in Figures 1-4.

[0502] In some embodiments, the conjugate is the conjugate shown in FIG.

[0503] In some embodiments, the conjugate is the conjugate shown in FIG.

[0504] In some embodiments, the conjugate is the conjugate shown in FIG.

[0505] In some embodiments, the conjugate is the conjugate shown in FIG.

[0506] The compounds shown in Figures 1-4 are shown in protonated form. The S atom on the phosphorothioate linkage is protonated. It will be understood that the presence of a proton will vary depending on the acidity of the molecule's environment and the presence of alternative cations (e.g., when the oligonucleotide is in salt form). Protonated phosphorothioates exist in tautomeric forms.

[0507] FUBP1-targeting conjugates In some embodiments, the FUBP1-targeting conjugate comprises: 5'-GN2-C6 o [X] m C s T s T s a s t s G s c s t s t s t s t s ts a s t s g s G s T、 5’-GN2-C6 o [X] m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T、 5’-GN2-C6 o [X] m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T、 5’-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s g s G s T s T、 5’-GN2-C6 o [X] m C s Ts t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T、 5’-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T、 5’-GN2-C6 o [X]G s c s t s t s T s t s t s a s t s g s g s t s T s t s m C s A s m C、 5’-GN2-C6 o [X]T s A s T s g s c s T s t s t s t s t s a s ts g s g s t s T s T s m C. 5'-GN2-C6 o [X]A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C, and 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C s wherein capital letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, each LNA cytosine is a 5-methylcytosine, the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5D, e.g., a trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5D-1 or Figure 5D2, or a mixture of both, preferably linked via a phosphodiester bond at the 5' end of the oligonucleotide. Chemical diagrams representing some of the molecules are shown in Figures 8-16, where [X] is, as previously mentioned, o a o Represents.

[0508] In some embodiments, the conjugate that targets FUBP1 is selected from the group of conjugates listed in Table 15 or a pharmaceutically acceptable salt thereof. [Table 15A]

[0509] In the above table, [5gn2c6] is a GalNAc residue R having the formula: [ka]

[0510] It should be understood that R as shown in the figures above and used in the tables above is a mixture of the two stereoisomers shown in Figures 5D1 and 5D2.

[0511] According to a further aspect of the invention, R as shown in the figures above and used in the tables above is the stereoisomer shown in Figure 5D1.

[0512] According to a further aspect of the invention, R shown in the figures above and used in the tables above is the stereoisomer shown in Figure 5D1. The structures of the conjugates provided in Table 15 are shown in Figures 8-16.

[0513] The present invention provides the conjugate of Figure 8 or a pharmaceutically acceptable salt thereof.

[0514] The present invention provides an antisense oligonucleotide of Compound No. 325_1 or a pharmaceutically acceptable salt thereof.

[0515] The present invention provides the conjugate of Figure 9 or a pharmaceutically acceptable salt thereof.

[0516] The present invention provides an antisense oligonucleotide of compound No. 325_2 or a pharmaceutically acceptable salt thereof.

[0517] The present invention provides the conjugate of Figure 10 or a pharmaceutically acceptable salt thereof.

[0518] The present invention provides an antisense oligonucleotide of Compound No. 326_1 or a pharmaceutically acceptable salt thereof.

[0519] The present invention provides the conjugate of Figure 11 or a pharmaceutically acceptable salt thereof.

[0520] The present invention provides an antisense oligonucleotide of compound No. 326_2 or a pharmaceutically acceptable salt thereof.

[0521] The present invention provides the conjugate of Figure 12 or a pharmaceutically acceptable salt thereof.

[0522] The present invention provides an antisense oligonucleotide of compound No. 326_3 or a pharmaceutically acceptable salt thereof.

[0523] The present invention provides the conjugate of Figure 13 or a pharmaceutically acceptable salt thereof.

[0524] The present invention provides an antisense oligonucleotide of compound No. 326_4 or a pharmaceutically acceptable salt thereof.

[0525] The present invention provides the conjugate of Figure 14 or a pharmaceutically acceptable salt thereof.

[0526] The present invention provides an antisense oligonucleotide of Compound No. 327_1 or a pharmaceutically acceptable salt thereof.

[0527] The present invention provides the conjugate of Figure 15 or a pharmaceutically acceptable salt thereof.

[0528] The present invention provides an antisense oligonucleotide of Compound No. 328_1 or a pharmaceutically acceptable salt thereof.

[0529] The present invention provides the conjugate of Figure 16 or a pharmaceutically acceptable salt thereof.

[0530] The present invention provides an antisense oligonucleotide of Compound No. 329_1 or a pharmaceutically acceptable salt thereof.

[0531] The present invention provides an antisense oligonucleotide of Compound No. 330_1 or a pharmaceutically acceptable salt thereof.

[0532] In some embodiments, the conjugate is the conjugate shown in FIG.

[0533] In some embodiments, the conjugate is the conjugate shown in FIG.

[0534] In some embodiments, the conjugate is the conjugate shown in FIG.

[0535] In some embodiments, the conjugate is the conjugate shown in FIG.

[0536] In some embodiments, the conjugate is the conjugate shown in FIG.

[0537] In some embodiments, the conjugate is the conjugate shown in FIG.

[0538] In some embodiments, the conjugate is the conjugate shown in FIG.

[0539] In some embodiments, the conjugate is the conjugate shown in FIG.

[0540] In some embodiments, the conjugate is the conjugate shown in FIG.

[0541] The compounds shown in Figures 8-16 are shown in protonated form. The S atom on the phosphorothioate linkage is protonated. It will be understood that the presence of a proton will vary depending on the acidity of the molecule's environment and the presence of alternative cations (e.g., when the oligonucleotide is in salt form). Protonated phosphorothioates exist in tautomeric forms.

[0542] Combinatorial Targeting Conjugates In some embodiments, the conjugate of the combination of compounds targeting RTEL1 and FUBP1 is 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T o c o a o T s T s a s c s a s t s a s c s t s c s t s g s g s t s m C s A s A s A s (CMP No. 350_1), and 5'-GN2-C6 o [X]Ts T s a s c s a s t s a s c s t s c s t s g s g s t s m C s A s A s A o c o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T(CMP number 351_1) where uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, each LNA cytosine is a 5-methylcytosine, the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, GN2-C6 is a trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5D, e.g., a trivalent N-acetylgalactosamine (GalNAc) as shown in Figure 5D-1 or Figure 5D-2, or a mixture of both, preferably linked via a phosphodiester bond at the 5'-end of the 5'-most oligonucleotide, and [X] is a c, as previously described. o a o Represents, is selected from the group consisting of:

[0543] [Table 15B]

[0544] Manufacturing method In a further aspect, there is provided a method for preparing an oligonucleotide of the combination of the present invention, comprising reacting nucleotide units to form covalently linked consecutive nucleotide units comprising the oligonucleotide. Preferably, the method uses phosphoramidite chemistry (see, e.g., Caruthers et al. (1987) Methods in Enzymology, vol. 154, pp. 287-313). In a further embodiment, the method further comprises reacting the consecutive nucleotide sequence with a conjugate moiety (ligand) to covalently attach the conjugate moiety to the oligonucleotide. In a further aspect, there is provided a method for preparing a composition of the combination of the present invention, comprising mixing an oligonucleotide of the combination of the present invention or a conjugated oligonucleotide with a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.

[0545] Pharmaceutical salts The compounds according to the present invention may exist in the form of their pharmaceutically acceptable salts. The term "pharmaceutical salt" or "pharmaceutically acceptable salt" refers to conventional acid or base addition salts that retain the biological effectiveness and properties of the compounds of the present invention and are formed from suitable non-toxic organic or inorganic acids or organic or inorganic bases. Acid addition salts include, for example, those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, sulfamic acid, phosphoric acid, and nitric acid, as well as those derived from organic acids such as p-toluenesulfonic acid, salicylic acid, methanesulfonic acid, oxalic acid, succinic acid, citric acid, malic acid, lactic acid, and fumaric acid. Base addition salts include those derived from ammonium, potassium, sodium, and quaternary ammonium hydroxides, such as tetramethylammonium hydroxide. Chemical modification of pharmaceutical compounds into salts is a technique well known to medicinal chemists to improve the physical and chemical stability, hygroscopicity, flowability, and solubility of the compounds. This is described, for example, in Bastin, Organic Process Research & Development 2000, 4, 427-435 or in Ansel, In: Pharmaceutical Dosage Forms and Drug Delivery Systems, 6th ed. (1995), pp. 196 and 1456-1457. For example, a pharmaceutically acceptable salt of the compound provided herein can be a sodium salt.

[0546] In a further aspect, the present invention relates to a pharmaceutically acceptable salt, such as a pharmaceutically acceptable sodium salt, ammonium salt, or potassium salt, of one or more antisense oligonucleotides or conjugates thereof.

[0547] Pharmaceutical Combinations and Kits One aspect of the present invention pertains to a pharmaceutical combination of an inhibitor targeting RTEL1 described herein and an inhibitor of FUBP1, each formulated in a pharmaceutically acceptable carrier.

[0548] The pharmaceutical combinations of the present invention can be used to treat HBV infection more effectively than the included therapeutic inhibitors, such as oligonucleotides, taken alone. In one embodiment, the pharmaceutical combinations of the present invention can be used to inhibit HBV more rapidly, for a longer duration, and / or with greater efficacy than the included therapeutic inhibitors, such as oligonucleotides, taken alone. These effects can be measured by the reduction of cccDNA in infected cells. In one embodiment, the pharmaceutical combinations of the present invention cause a more rapid reduction of cccDNA in infected cells than the included therapeutic inhibitors, such as oligonucleotides, taken alone. In one embodiment, the pharmaceutical combinations of the present invention cause a longer-lasting reduction of cccDNA than the included therapeutic oligonucleotides or TLR7 agonists alone. In one embodiment, the pharmaceutical combinations of the present invention cause a greater reduction in cccDNA titer than the included therapeutic oligonucleotides or TLR7 agonists alone.

[0549] In a preferred embodiment of the invention, the pharmaceutical combination comprises or consists of an RTEL1-targeting oligonucleotide and a FUBP1-targeting oligonucleotide, or a conjugate thereof.

[0550] In a preferred embodiment of the present invention, the pharmaceutical combination comprises or consists of a single-stranded antisense oligonucleotide targeted to RTEL1 and a single-stranded antisense oligonucleotide targeted to FUBP1, or a conjugate thereof.

[0551] The RTEL1-targeted single-stranded antisense oligonucleotide may be any of the RTEL1-targeted single-stranded antisense oligonucleotides described herein.The FUBP1-targeted single-stranded antisense oligonucleotides may be any of the FUBP1-targeted single-stranded antisense oligonucleotides described herein.

[0552] Purpose The pharmaceutical combination of the present invention is for use in the treatment of hepatitis B virus infection and / or cancer, particularly in the treatment of patients with chronic HBV.

[0553] The pharmaceutical combination of the present invention can be used as a research reagent or for diagnosis, therapy and prophylaxis.

[0554] The pharmaceutical combination of the present invention can be used in combination with hepatitis B virus targeted therapy and immunotherapy.

[0555] In research, such combinations can be used to specifically modulate the synthesis of RTEL1 protein in cells (e.g., in vitro cell cultures) and experimental animals, thereby facilitating functional analysis of the target or evaluation of its usefulness as a target for therapeutic intervention. Typically, target modulation is achieved by degrading or inhibiting the mRNA that produces the protein, thereby preventing protein formation, or by degrading or inhibiting a modulator of the gene or mRNA that produces the protein.

[0556] When the combinations of the invention are used for research or diagnostic purposes, the target nucleic acid can be cDNA or a synthetic nucleic acid derived from DNA or RNA.

[0557] The present invention also encompasses an in vivo or in vitro method for modulating RTEL1 expression in a target cell expressing RTEL1, comprising administering to the cell an effective amount of a combination of the present invention.

[0558] In some embodiments, the target cells are mammalian cells, particularly human cells. The target cells may be in vitro cell cultures or in vivo cells that form part of a mammalian tissue. In a preferred embodiment, the target cells are present in the liver. The target cells may be hepatocytes.

[0559] One aspect of the present invention relates to a combination of the present invention for use as a medicament.

[0560] In one aspect of the invention, the combination of the invention is capable of reducing cccDNA levels in infected cells and thus inhibiting HBV infection. In particular, the combination is capable of affecting one or more of the following parameters in infected cells: (i) reduction of cccDNA, and / or (ii) reduction of pgRNA, and / or (iii) reduction of HBV DNA, and / or (iv) reduction of HBV viral antigens.

[0561] For example, a combination that inhibits HBV infection can (i) reduce cccDNA levels in infected cells by at least 40%, e.g., 50%, 60%, 70%, 80%, or 90%, compared to a control, or (ii) reduce pgRNA levels by at least 40%, e.g., 50%, 60%, 70%, 80%, or 90%, compared to a control. The control can be untreated cells or animals, or cells or animals treated with an appropriate control.

[0562] Inhibition of HBV infection can be measured in vitro using HBV-infected primary human hepatocytes or in vivo using the humanized hepatocyte PXB mouse model (available from PhoenixBio; see also Kakuni et al. 2014 Int. J. Mol. Sci. 15:58-74). Inhibition of HBsAg and / or HBeAg secretion can be measured by ELISA, for example, using a CLIA ELISA kit (Autobio Diagnostic), according to the manufacturer's instructions. Reduction of intracellular cccDNA or HBV mRNA and pgRNA can be measured by qPCR, for example, as described in the Materials and Methods section. Another method for assessing whether a test compound inhibits HBV infection is to measure HBV DNA secretion by qPCR, for example, as described in WO 2015 / 173208, or using Northern blot, in situ hybridization, or immunofluorescence.

[0563] Due to the reduction in RTEL1 levels, the combinations of the present invention can be used to inhibit the onset of or in the treatment of HBV infection. In particular, the destabilization and reduction of cccDNA (combinations of the present invention) more efficiently inhibits or treats the onset of chronic HBV infection compared to compounds that only reduce HBsAg secretion.

[0564] Thus, one aspect of the present invention relates to the use of the combination of the present invention for reducing cccDNA and / or pgRNA in HBV-infected individuals.

[0565] A further aspect of the invention relates to the use of the combination to inhibit or treat the development of chronic HBV infection.

[0566] A further aspect of the invention relates to the use of the combination of the invention to reduce infectivity in an HBV-infected individual. In a particular aspect of the invention, the combination of the invention inhibits the development of chronic HBV infection.

[0567] The subject to be treated with the combination of the present invention (or receive the composition of the present invention prophylactically) is preferably a human, more preferably an HBsAg-positive and / or HBeAg-positive human patient, more preferably an HBsAg-positive and HBeAg-positive human patient.

[0568] Thus, the present invention relates to a method for treating HBV infection, which comprises administering an effective amount of a combination of the present invention. The present invention further relates to a method for preventing cirrhosis and hepatocellular carcinoma resulting from chronic HBV infection.

[0569] The present invention also provides the use of a combination of the invention for the manufacture of a medicament, in particular a medicament for use in the treatment of HBV infection or chronic HBV infection or in reducing the infectivity of HBV-infected individuals, in a preferred embodiment the medicament is prepared in a dosage form for subcutaneous administration.

[0570] The present invention also provides the use of a combination of the present invention for the manufacture of a medicament, wherein the medicament is in a dosage form for intravenous administration.

[0571] The combination of the present invention can be used in combination therapy. For example, the combination of the present invention can be used in combination with other anti-HBV agents such as interferon alpha-2b, interferon alpha-2a, and interferon alfacon-1 (pegylated and non-pegylated), ribavirin, lamivudine (3TC), entecavir, tenofovir, telbivudine (LdT), adefovir, or other anti-HBV agents for the treatment and / or prevention of HBV. It may also be combined with other anti-HBV agents such as RNA replication inhibitors, HBsAg secretion inhibitors, HBV capsid inhibitors, antisense oligomers (e.g., as described in WO 2012 / 145697, WO 2014 / 179629, and WO 2017 / 216390), siRNA (e.g., as described in WO 2005 / 014806, WO 2012 / 024170, WO 2012 / 2055362, WO 2013 / 003520, WO 2013 / 159109, WO 2017 / 027350, and WO 2017 / 015175), HBV therapeutic vaccines, HBV prophylactic vaccines, HBV antibody therapy (monoclonal or polyclonal), or TLR2, 3, 7, 8, or 9 agonists. Embodiments of the present invention

[0572] The following embodiments of the present invention may be used in combination with any other embodiment described herein.

[0573] 1. A composition comprising an inhibitor of RTEL1 and an inhibitor of FUBP1.

[0574] 2. A pharmaceutical composition comprising an inhibitor of RTEL1 and an inhibitor of FUBP1 or pharmaceutically acceptable salts thereof, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0575] 3. A kit comprising an inhibitor of RTEL1 and an inhibitor of FUBP1.

[0576] 4. The composition according to item 1 or 2 or the kit according to item 3, wherein the inhibitor of RTEL1 is capable of reducing cccDNA in infected cells.

[0577] 5. The composition or kit according to any one of items 1 to 4, wherein the RTEL1 inhibitor is a nucleic acid molecule of 12 to 60 nucleotides in length, preferably 12 to 30 nucleotides in length, more preferably 12 to 25 nucleotides in length, and even more preferably 15 to 21 nucleotides in length, comprising a contiguous nucleotide sequence of at least 10 nucleotides that is at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95% complementary to a mammalian RTEL1 target nucleic acid, particularly a human RTEL1 target nucleic acid, and wherein the nucleic acid molecule is capable of reducing the expression of RTEL1.

[0578] 6. The composition or kit according to item 5, wherein the mammalian RTEL1 target nucleic acid is selected from SEQ ID NO: 1 or 2.

[0579] 7. The composition or kit according to item 5 or 6, wherein the contiguous nucleotide sequence is at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% complementary to SEQ ID NO: 1 and / or 2, preferably SEQ ID NO: 1.

[0580] 8. The composition or kit according to any of items 5 to 7, wherein the contiguous nucleotide sequence is at least 98% complementary to the target nucleic acid of SEQ ID NO: 1 and / or SEQ ID NO: 2, preferably SEQ ID NO: 1.

[0581] 9. The composition or kit according to any of items 5 to 8, wherein the contiguous nucleotide sequence is 100% complementary to the target nucleic acid of SEQ ID NO: 1 and / or SEQ ID NO: 2, preferably SEQ ID NO: 1.

[0582] 10. The composition or kit according to any of items 5 to 9, wherein the contiguous nucleotide sequence is at least 80%, such as at least 85%, for example at least 90%, such as at least 95%, for example at least 98, such as 100% complementary to a target sequence selected from SEQ ID NOs: 3 to 26, preferably 100% complementary to a target sequence selected from SEQ ID NOs: 5, 13, 14, 15, 16; more preferably 100% complementary to a target sequence selected from SEQ ID NOs: 14 and 16.

[0583] 11. The composition or kit according to any one of items 1 to 10, wherein the RTEL1 inhibitor is selected from a single-stranded antisense oligonucleotide, an siRNA or an shRNA molecule.

[0584] 12. A composition or kit according to any one of items 1 to 11, wherein the RTEL1 inhibitor is a single-stranded antisense oligonucleotide.

[0585] 13. A composition or kit according to any of items 1 to 12, wherein the RTLE1 inhibitor is a single-stranded antisense oligonucleotide of 12 to 30 nucleotides in length comprising a contiguous nucleotide sequence of at least 10 nucleotides complementary to a mammalian RTEL1 target nucleic acid such as an RTEL1 pre-mRNA such as the RTEL1 pre-mRNA of SEQ ID NO: 1 or 2, in particular a human RTEL1 target nucleic acid such as the human RTEL1 pre-mRNA of SEQ ID NO: 1, and wherein the oligonucleotide is capable of reducing the expression of RTEL1.

[0586] 14. The composition or kit according to item 13, wherein the contiguous nucleotide sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.

[0587] 15. The composition or kit according to item 13 or 14, wherein the contiguous nucleotide sequence is 12 to 25, in particular 15 to 21, nucleotides in length.

[0588] 16. The composition or kit according to items 12 to 15, wherein the antisense oligonucleotide comprises a sequence selected from the group consisting of SEQ ID NOs: 27 to 246.

[0589] 17. The composition or kit according to any one of items 12 to 16, wherein the antisense oligonucleotide comprises one or more 2' sugar-modified nucleosides.

[0590] 18. The composition or kit of item 17, wherein the one or more 2' sugar-modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides.

[0591] 19. The composition or kit according to item 17 or 18, wherein one or more 2' sugar-modified nucleosides are LNA nucleosides.

[0592] 20. The composition or kit according to any of items 12 to 19, wherein the antisense oligonucleotide comprises at least one phosphorothioate internucleoside linkage.

[0593] 21. The composition or kit according to any of items 12 to 20, wherein all internucleoside linkages in the consecutive nucleotide sequence are phosphorothioate internucleoside linkages.

[0594] 22. The composition or kit according to any of items 12 to 21, wherein the oligonucleotide is capable of recruiting RNase H.

[0595] 23. The composition or kit according to any of items 12 to 22, wherein the antisense oligonucleotide or its consecutive nucleotide sequence consists of or comprises a gapmer of the formula 5'-FG-F'-3', wherein regions F and F' independently comprise 1 to 4 2' sugar-modified nucleosides, and G is a region of 6 to 16 nucleosides capable of recruiting RNase H, for example a region comprising 6 to 18 DNA nucleosides.

[0596] 24. Antisense oligonucleotides capable of reducing the expression of RTEL1 AATTttacatactctgGT (SEQ ID NO: 243), AAttttacatactctGGTC (SEQ ID NO: 244), TTacatactctggtCAAA (SEQ ID NO: 245), CTttattataactTgaAtCTC (SEQ ID NO: 246), and CTttattataacttgaaTCTC (SEQ ID NO: 246); Preferably, TTacatactctggtCAAA (SEQ ID NO: 245); or CTttattataacttgaaTCTC (SEQ ID NO: 246); where uppercase letters are beta-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages. 24. The composition or kit according to any one of items 12 to 23, wherein the antisense oligonucleotide is selected from the group of antisense oligonucleotides comprising or consisting of:

[0597] 25. The composition or kit according to item 11, wherein the RTEL1 inhibitor is an shRNA.

[0598] 26. The composition or kit according to item 11, wherein the RTEL1 inhibitor is an siRNA.

[0599] 27. A composition or kit according to any of items 1 to 26, wherein the RTEL1 inhibitor is covalently bound to at least one conjugate moiety.

[0600] 28. The composition or kit according to item 27, wherein the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalactosamine.

[0601] 29. The composition or kit according to item 28, wherein the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).

[0602] 30. The composition or kit of item 27 or 28, wherein the conjugate moiety is monovalent, bivalent, trivalent, or tetravalent with respect to the asialoglycoprotein receptor targeting moiety.

[0603] 31. The composition or kit according to item 30, wherein the conjugate moiety consists of two to four terminal GalNAc moieties and a spacer linking each GalNAc moiety to a brancher molecule that can be conjugated to an antisense compound.

[0604] 32. The composition or kit according to item 31, wherein the spacer is a PEG spacer.

[0605] 33. The composition or kit according to any of items 28 to 32, wherein the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) moiety.

[0606] 34. The composition or kit according to any of items 28 to 33, wherein the conjugate moiety is selected from one of the trivalent GalNAc moieties in Figure 5.

[0607] 35. The composition or kit according to item 34, wherein the conjugate moiety is a trivalent GalNAc moiety of Figure 5, such as a trivalent GalNAc moiety of Figure 5D-1 or Figure 5D-2, or a mixture of both.

[0608] 36. The composition or kit according to any one of items 28 to 35, comprising a linker located between the antisense oligonucleotide and the conjugate moiety, preferably the linker being a CA DNA dinucleotide.

[0609] 37. The conjugate is 5'-GN2-C6 o [X]A s A s T s T s t s t s a s c s a s t s a s c s t s c s t s g s G s T, 5'-GN2-C6 o [X]A s A s t s t s t s t s a s c s a s t s a s c s t s c s t s G s G s T s m C. 5'-GN2-C6 o [X]T s T s a s c s a s t s a s cs t s c s t s g s g s t s <​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​s c s t s c s t s g s g s t s m C s A s A s A, or 5'-GN2-C6 o [X] m C s T s t s t s a s t s t s a s t s a s a s c s t s t s g s a s a s T s m C s T s m C; where uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, and each LNA cytosine is a 5-methylcytosine; m c is 5-methylcytosine DNA, subscript s represents a phosphorothioate internucleoside linkage, subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 are residues of the formula: [ka] Residues GN2-C6 are attached to the 5' end of the oligonucleotide via a phosphodiester bond, and / or GN2-C6 are trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2, or a mixture of both, more preferably GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2, and [X] is, as described above, o a o Represents, 37. The composition or kit according to any one of items 28 to 36, selected from the group consisting of:

[0610] 38. The composition or kit according to any one of items 28 to 37, wherein the conjugate is the conjugate shown in Figure 1.

[0611] 39. The composition or kit according to any one of items 28 to 37, wherein the conjugate is the conjugate shown in Figure 2.

[0612] 40. The composition or kit according to any one of items 28 to 37, wherein the conjugate is the conjugate shown in Figure 3.

[0613] 41. The composition or kit according to any one of items 28 to 37, wherein the conjugate is the conjugate shown in Figure 4.

[0614] 42. A composition or kit according to any of items 1 to 41, wherein the RTEL1 inhibitor is in the form of a pharmaceutically acceptable salt.

[0615] 43. The composition or kit according to item 28, wherein the salt is a sodium salt, a potassium salt, or an ammonium salt.

[0616] 44. The composition or kit according to any of items 1 to 43, wherein the composition comprises an aqueous diluent or solvent, such as phosphate buffered saline.

[0617] 45. The composition or kit according to any of items 1 to 44, wherein the inhibitor of FUBP1 is capable of reducing cccDNA and / or pgRNA in infected cells.

[0618] 46. ​​The composition or kit according to any of items 1 to 45, wherein the FUBP1 inhibitor is a nucleic acid molecule of 12 to 60 nucleotides in length, preferably 12 to 30 nucleotides in length, more preferably 12 to 25 nucleotides in length, even more preferably 15 to 21 nucleotides in length, comprising or consisting of a contiguous nucleotide sequence of 10 to 30 nucleotides in length, preferably 12 to 25 nucleotides in length, particularly 15 to 21 nucleotides in length, wherein the contiguous nucleotide sequence is at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% complementary to a mammalian FUBP1 target nucleic acid, particularly a human FUBP1 target nucleic acid, and wherein the nucleic acid molecule is capable of inhibiting expression of FUBP1.

[0619] 47. The composition or kit according to item 46, wherein the mammalian FUBP1 target nucleic acid is selected from SEQ ID NOs: 247 to 254.

[0620] 48. The composition or kit according to item 46 or 47, wherein the contiguous nucleotide sequence is at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% complementary to SEQ ID NO: 247 and / or 251, preferably SEQ ID NO: 247.

[0621] 49. The composition or kit according to any of items 46 to 48, wherein the contiguous nucleotide sequence is at least 98% complementary to the target nucleic acid of SEQ ID NO: 247 and / or SEQ ID NO: 251, preferably SEQ ID NO: 247.

[0622] 50. The composition or kit according to any of items 46 to 49, wherein the contiguous nucleotide sequence is 100% complementary to the target nucleic acid of SEQ ID NO: 247 and / or SEQ ID NO: 251, preferably SEQ ID NO: 247.

[0623] 51. The composition or kit according to any of items 46 to 50, wherein the contiguous nucleotide sequence is at least 90% complementary to a region within exon 14 or exon 20 of human FUBP1 (see Table 4).

[0624] 52. The composition or kit according to any of items 46 to 51, wherein the contiguous nucleotide sequence is 100% complementary to a region within exon 14 or exon 20 of human FUBP1 (see Table 4).

[0625] 53. The composition or kit according to any of items 46 to 50, wherein the contiguous nucleotide sequence is at least 80%, preferably at least 85%, more preferably at least 90%, and even more preferably at least 95% complementary to a target sequence selected from the group consisting of 9141 to 9156, 16184 to 16205, 16188 to 16205, 16184 to 16203, 16184 to 16200, 16186 to 16203, 16189 to 16205, or 30536 to 30553 of SEQ ID NO: 247.

[0626] 54. The composition or kit according to any of items 46 to 53, wherein the contiguous nucleotide sequence is 100% complementary to a target sequence selected from the group consisting of 9141 to 9156, 16184 to 16205, 16188 to 16205, 16184 to 16203, 16184 to 16200, 16186 to 16203, 16189 to 16205, or 30536 to 30553 of SEQ ID NO: 247.

[0627] 55. The composition or kit according to any of items 1 to 54, wherein the FUBP1 inhibitor is selected from a single-stranded antisense oligonucleotide, an siRNA or an shRNA molecule.

[0628] 56. The composition or kit according to any of items 1 to 55, wherein the FUBP1 inhibitor is a single-stranded antisense oligonucleotide.

[0629] 57. The composition or kit according to any of items 1 to 56, wherein the FUBP1 inhibitor is a single-stranded antisense oligonucleotide of 12 to 30 nucleotides in length comprising a contiguous nucleotide sequence of at least 10 nucleotides complementary to mammalian FUBP1, in particular human FUBP1, and the oligonucleotide is capable of inhibiting the expression of FUBP1.

[0630] 58. The composition or kit according to item 57, wherein the contiguous nucleotide sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.

[0631] 59. The composition or kit according to item 57 or 58, wherein the contiguous nucleotide sequence is 12 to 25, in particular 15 to 21, nucleotides in length.

[0632] 60. The composition or kit according to items 56 to 59, wherein the single-stranded antisense oligonucleotide comprises or consists of a sequence selected from the group consisting of SEQ ID NOs: 275 to 330.

[0633] 61. The composition or kit according to any of items 56 to 60, wherein the antisense oligonucleotide comprises one or more 2' sugar-modified nucleosides.

[0634] 62. The composition or kit of item 61, wherein the one or more 2' sugar-modified nucleosides are independently selected from the group consisting of 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabinonucleic acid (ANA), 2'-fluoro-ANA, and LNA nucleosides.

[0635] 63. The composition or kit according to item 61 or 62, wherein one or more 2' sugar-modified nucleosides are LNA nucleosides.

[0636] 64. The composition or kit according to any of items 56 to 63, wherein the antisense oligonucleotide comprises at least one phosphorothioate internucleoside linkage.

[0637] 65. The composition or kit according to any of items 56 to 64, wherein all internucleoside linkages in the contiguous nucleotide sequence are phosphorothioate internucleoside linkages.

[0638] 66. The composition or kit according to any of items 56 to 65, wherein the oligonucleotide is capable of recruiting RNase H.

[0639] 67. The composition or kit according to any of items 56 to 66, wherein the antisense oligonucleotide or its consecutive nucleotide sequence consists of or comprises a gapmer of the formula 5'-FG-F'-3', in which regions F and F' independently comprise 1 to 4 2' sugar-modified nucleosides, and G is a region of 6 to 16 nucleosides capable of recruiting RNase H, for example a region comprising 6 to 18 DNA nucleosides.

[0640] 68. A single-stranded antisense oligonucleotide capable of inhibiting the expression of FUBP1 is CTTatGctttttatgGT (SEQ ID NO: 325), CTTaTgctttttatgGT (SEQ ID NO: 325), CTtATgctttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatGgTT (SEQ ID NO: 326), CTtAtgctttttatGGTT (SEQ ID NO: 326), GcttTttatggtTtCAC (SEQ ID NO: 327), TATgcTttttatggtTTC (SEQ ID NO: 328), AcCAAttttcatttCtAC (SEQ ID NO: 329), and CcccataaccataGTC (SEQ ID NO: 330); Preferably, CTtAtgctttttatGgTT (SEQ ID NO: 326); or CcccataaccataGTC (SEQ ID NO: 330); where uppercase letters are beta-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages. 68. The composition or kit according to item 56 or 67, wherein the antisense oligonucleotide is selected from the group of antisense oligonucleotides comprising or consisting of:

[0641] 69. The composition or kit according to item 55, wherein the FUBP1 inhibitor is an shRNA.

[0642] 70. The composition or kit according to item 55, wherein the FUBP1 inhibitor is an siRNA.

[0643] 71. The composition or kit according to any of items 1 to 70, wherein the FUBP1 inhibitor is covalently bound to at least one conjugate moiety.

[0644] 72. The composition or kit of item 71, wherein the conjugate moiety comprises at least one asialoglycoprotein receptor targeting moiety selected from the group consisting of galactose, galactosamine, N-formyl-galactosamine, N-acetylgalactosamine, N-propionyl-galactosamine, Nn-butanoyl-galactosamine, and N-isobutanoylgalactosamine.

[0645] 73. The composition or kit according to item 72, wherein the asialoglycoprotein receptor targeting moiety is N-acetylgalactosamine (GalNAc).

[0646] 74. The composition or kit according to item 71 or 72, wherein the conjugate moiety is monovalent, bivalent, trivalent, or tetravalent with respect to the asialoglycoprotein receptor targeting moiety.

[0647] 75. The composition or kit according to item 74, wherein the conjugate moiety consists of two to four terminal GalNAc moieties and a spacer linking each GalNAc moiety to a brancher molecule that can be conjugated to an antisense compound.

[0648] 76. The composition or kit according to item 75, wherein the spacer is a PEG spacer.

[0649] 77. The composition or kit according to any of items 71 to 76, wherein the conjugate moiety is a trivalent N-acetylgalactosamine (GalNAc) moiety.

[0650] 78. The composition or kit according to any of items 71 to 77, wherein the conjugate moiety is selected from one of the trivalent GalNAc moieties in Figure 5.

[0651] 79. The composition or kit according to item 71, wherein the conjugate moiety is a trivalent GalNAc moiety of Figure 5, such as a trivalent GalNAc moiety of Figure 5D-1 or Figure 5D-2, or a mixture of both.

[0652] 80. The composition or kit according to any one of items 71 to 79, comprising a linker located between the antisense oligonucleotide and the conjugate moiety, preferably the linker being a CA DNA dinucleotide.

[0653] 81. Conjugates are 5'-GN2-C6 o [X] m C s T s T s a s t s G s c s t s t s t s t s t s a s t s g s G s T, 5’-GN2-C6 o [X] m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T、 5’-GN2-C6 o [X] m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T、 5’-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s g s G s T s T、 5’-GN2-C6 o [X] m C s T s t s A s t s g s c s ts t s t s t s t s a s t s G s g s T s T、 5’-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T、 5’-GN2-C6 o [X]G s c s t s t s T s t s t s a s t s g s g s t s T s t s m C s A s m C、 5’-GN2-C6 o [X]T s A s T s g s c s T s t s t s t s t s a s t s g s g s t s T s T sm C, 5’-GN2-C6 o [X]A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C, and 5’-GN2-C6 o [X] m C s c s c s c s a<000​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​s a s t s a s a s c s c s a s t s a s G s T s m C s ; where uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, and each LNA cytosine is a 5-methylcytosine; m C is 5-methylcytosine DNA, the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 are residues of the formula: [ka] Residues GN2-C6 are attached to the 5' end of the oligonucleotide via a phosphodiester bond, and / or GN2-C6 are trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2, or a mixture of both, more preferably GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2, and [X] is, as described above, o a o Represents, 81. The composition or kit according to any one of items 71 to 80, selected from the group consisting of:

[0654] 82. The composition or kit according to any one of items 71 to 81, wherein the conjugate is the conjugate shown in Figure 8.

[0655] 83. The composition or kit according to any one of items 71 to 81, wherein the conjugate is the conjugate shown in Figure 9.

[0656] 84. The composition or kit according to any one of items 71 to 81, wherein the conjugate is the conjugate shown in Figure 10.

[0657] 85. The composition or kit according to any one of items 71 to 81, wherein the conjugate is the conjugate shown in Figure 11.

[0658] 86. The composition or kit according to any one of items 71 to 81, wherein the conjugate is the conjugate shown in Figure 12.

[0659] 87. The composition or kit according to any one of items 71 to 81, wherein the conjugate is the conjugate shown in Figure 13.

[0660] 88. The composition or kit according to any one of items 71 to 81, wherein the conjugate is the conjugate shown in Figure 14.

[0661] 89. The composition or kit according to any one of items 71 to 81, wherein the conjugate is the conjugate shown in Figure 15.

[0662] 90. The composition or kit according to any one of items 71 to 81, wherein the conjugate is the conjugate shown in Figure 16.

[0663] 91. The composition or kit according to any of items 1 to 90, wherein the FUBP1 inhibitor is in the form of a pharmaceutically acceptable salt.

[0664] 92. The composition or kit according to item 91, wherein the salt is a sodium salt, a potassium salt, or an ammonium salt.

[0665] 93. The composition or kit according to any one of items 1 to 92, wherein the composition comprises an aqueous diluent or solvent such as phosphate buffered saline.

[0666] 94. A composition or kit according to any one of claims 1 to 44, wherein the FUBP1 inhibitor is selected from compounds of formula VII, IX or X. [ka] 95. The inhibitor of RTEL1 is a single-stranded antisense oligonucleotide capable of inhibiting the expression of RTEL1, comprising or consisting of AATTttacatactctgGT (SEQ ID NO: 243); The inhibitor of FUBP1 is a single-stranded antisense oligonucleotide that can reduce the expression of FUBP1. CTTatGctttttatgGT (SEQ ID NO: 325), CTTaTgctttttatgGT (SEQ ID NO: 325), CTtATgctttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatGgTT (SEQ ID NO: 326), CTtAtgctttttatGGTT (SEQ ID NO: 326), GcttTttatggtTtCAC (SEQ ID NO: 327), TATgcTttttatggtTTC (SEQ ID NO: 328), AcCAAttttcatttCtAC (SEQ ID NO: 329), and CcccataaccataGTC (SEQ ID NO: 330); where uppercase letters are beta-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages. 95. The composition or kit according to any of items 1 to 94, wherein the antisense oligonucleotide is selected from the group of antisense oligonucleotides comprising or consisting of:

[0667] 96. RTEL1 inhibitor: 5'-GN2-C6 o [X]A s A s Ts T s t s t s a s c s a s t s a s c s t s c s t s g s G s T, (shown in Figure 1), and FUBP1 inhibitors 5'-GN2-C6 o [X] m C s T s T s a s t s G s c s t s t s t s t s t s a s t s g s G s T (shown in Figure 8 ), 5'-GN2-C6 o [X] m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T (shown in Figure 9 ), 5'-GN2-C6 o [X] m C s T s t s A s T s g s c s t s ts t s t s t s a s t s g s G s T s T (shown in Figure 10), 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s g s G s T s T (shown in Figure 11), 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T (shown in Figure 12), 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s Gs T s T (shown in Figure 13), 5'-GN2-C6 o [X]G s c s t s t s T s t s t s a s t s g s g s t s T s t s m C s A s m C (shown in Figure 14), 5'-GN2-C6 o [X]T s A s T s g s c s T s t s t s t s t s a s t s g s g s t s T s T s m C (shown in Figure 15), 5'-GN2-C6 o [X]A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C (shown in Figure 16), and 5'-GN2-C6 o [X]m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C s ; where uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, and each LNA cytosine is a 5-methylcytosine; m C is 5-methylcytosine DNA, the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 are residues of the formula: [ka] Residues GN2-C6 are attached to the 5' end of the oligonucleotide via a phosphodiester bond, and / or GN2-C6 are trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2, or a mixture of both, more preferably GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2, and [X] is, as described above, o a o Represents, 96. The composition or kit according to item 95, wherein the conjugate is selected from the group consisting of:

[0668] 97. The inhibitor of RTEL1 is a single-stranded antisense oligonucleotide capable of inhibiting the expression of RTEL1, comprising or consisting of AAttttacatactctGGTC (SEQ ID NO: 244); The inhibitor of FUBP1 is a single-stranded antisense oligonucleotide that can reduce the expression of FUBP1. CTTatGctttttatgGT (SEQ ID NO: 325), CTTaTgctttttatgGT (SEQ ID NO: 325), CTtATgctttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatGgTT (SEQ ID NO: 326), CTtAtgctttttatGGTT (SEQ ID NO: 326), GcttTttatggtTtCAC (SEQ ID NO: 327), TATgcTttttatggtTTC (SEQ ID NO: 328), AcCAAttttcatttCtAC (SEQ ID NO: 329) and CcccataaccataGTC (SEQ ID NO: 330); where uppercase letters are beta-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages. 97. The composition or kit according to items 1 to 96, wherein the antisense oligonucleotide is selected from the group of antisense oligonucleotides comprising or consisting of:

[0669] 98.RTEL1 inhibitor: 5'-GN2-C6 o [X]A s A s t s t s t s t s a s c s a s t s a s c s t s c s t s G s G s T s m C s (shown in Figure 2), FUBP1 inhibitors 5'-GN2-C6 o [X] m C s T s T s a s t s G s c s t s t s t s t s t s a s t s g s G s T (shown in Figure 8 ), 5'-GN2-C6 o [X] m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T (shown in Figure 9 ), 5'-GN2-C6 o [X] m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T (shown in Figure 10), 5'-GN2-C6 o [X] m C s T s t s A s t s g s cs t s t s t s t s t s a s t s g s G s T s T (shown in Figure 11), 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T (shown in Figure 12), 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T (shown in Figure 13), 5'-GN2-C6 o [X]G s c s t s t s T s t s t s a s t s g s g s t s T s t sm C s A s m C (shown in Figure 14), 5'-GN2-C6 o [X]T s A s T s g s c s T s t s t s t s t s a s t s g s g s t s T s T s m C (shown in Figure 15), 5'-GN2-C6 o [X]A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C (shown in Figure 16), and 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C s ; where uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, and each LNA cytosine is a 5-methylcytosine; m C is 5-methylcytosine DNA, the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 are residues of the formula: [ka] Residues GN2-C6 are attached to the 5' end of the oligonucleotide via a phosphodiester bond, and / or GN2-C6 are trivalent N-acetylgalactosamine (GalNAc) residues of Figure 5D1 or Figure 5D2, or a mixture of both, more preferably GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2; 98. The composition or kit according to item 97, wherein the conjugate is selected from the group consisting of:

[0670] 99. The inhibitor of RTEL1 is a single-stranded antisense oligonucleotide capable of inhibiting the expression of RTEL1, comprising or consisting of TTacatactctggtCAAA (SEQ ID NO: 245); The inhibitor of FUBP1 is a single-stranded antisense oligonucleotide capable of inhibiting the expression of FUBP1, and is selected from the group of antisense oligonucleotides comprising or consisting of: CTTatGctttttatgGT (SEQ ID NO: 325), CTTaTgctttttatgGT (SEQ ID NO: 325), CTtATgctttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatGgTT (SEQ ID NO: 326), CTtAtgctttttatGGTT (SEQ ID NO: 326), GcttTttatggtTtCAC (SEQ ID NO: 327), TATgcTttttatggtTTC (SEQ ID NO: 328), AcCAAttttcatttCtAC (SEQ ID NO: 329) and CcccataaccataGTC (SEQ ID NO: 330); Preferably, CTtAtgctttttatGgTT (SEQ ID NO: 326); where uppercase letters are beta-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages. 99. The composition or kit according to any of items 1 to 98, wherein the antisense oligonucleotide is selected from the group of antisense oligonucleotides comprising or consisting of:

[0671] 100.RTEL1 inhibitor: 5'-GN2-C6 o [X]T s T s a s c s a s t s a s c s t s c s t s g s g s t s m C s A s A s A s (shown in Figure 3), FUBP1 inhibitors 5'-GN2-C6 o [X] m C s T s T s a s t s G s c s t s t s t s t s t s a s t s g sG s T (shown in Figure 8 ), 5'-GN2-C6 o [X] m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T (shown in Figure 9 ), 5'-GN2-C6 o [X] m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T (shown in Figure 10), 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s g s G s T s T (shown in Figure 11), 5'-GN2-C6 o [X] m C s T s ts A s t s g s c s t s t s t s t s t s a s t s G s g s T s T (shown in Figure 12), 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T (shown in Figure 13), 5'-GN2-C6 o [X]G s c s t s t s T s t s t s a s t s g s g s t s T s t s m C s A s m C (shown in Figure 14), 5'-GN2-C6 o [X]T s A s T s g s c s T s t s t s t s t s as t s g s g s t s T s T s m C (shown in Figure 15), 5'-GN2-C6 o [X]A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C (shown in Figure 16), and 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C s ; Preferably, 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s gs T s T (shown in Figure 12 ); where uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, and each LNA cytosine is a 5-methylcytosine; m C is 5-methylcytosine DNA, the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 are residues of the formula: [ka] Residues GN2-C6 are attached to the 5' end of the oligonucleotide via a phosphodiester bond, and / or GN2-C6 are trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2, or a mixture of both, more preferably GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2, and [X] is, as described above, o a o Represents, 99. The composition or kit according to item 99, wherein the conjugate is selected from the group consisting of:

[0672] 101. The inhibitor of RTEL1 is a single-stranded antisense oligonucleotide capable of inhibiting the expression of RTEL1, comprising or consisting of CTttattataactTgaAtCTC (SEQ ID NO: 246); The inhibitor of FUBP1 is a single-stranded antisense oligonucleotide capable of inhibiting the expression of FUBP1, and is selected from the group of antisense oligonucleotides comprising or consisting of: CTTatGctttttatgGT (SEQ ID NO: 325), CTTaTgctttttatgGT (SEQ ID NO: 325), CTtATgctttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatGgTT (SEQ ID NO: 326), CTtAtgctttttatGGTT (SEQ ID NO: 326), GcttTttatggtTtCAC (SEQ ID NO: 327), TATgcTttttatggtTTC (SEQ ID NO: 328), AcCAAttttcatttCtAC (SEQ ID NO: 329) and CcccataaccataGTC (SEQ ID NO: 330); where uppercase letters are beta-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages. 101. The composition or kit according to any of items 1 to 100, wherein the antisense oligonucleotide is selected from the group of antisense oligonucleotides comprising or consisting of:

[0673] 102. The inhibitor of RTEL1 is 5'-GN2-C6 o [X] m C s T s t s t s a s t s t s a s t s a s a s c s t s T s g s a s A s t s m C s T s m C s (shown in Figure 4), and FUBP1 inhibitors 5'-GN2-C6 o [X] m C s T s T s a s ts G s c s t s t s t s t s t s a s t s g s G s T (shown in Figure 8 ), 5'-GN2-C6 o [X] m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T (shown in Figure 9 ), 5'-GN2-C6 o [X] m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T (shown in Figure 10), 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s ts g s G s T s T (shown in Figure 11), 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T (shown in Figure 12), 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T (shown in Figure 13), 5'-GN2-C6 o [X]G s c s t s t s T s t s t s a s t s g s g s t s T s t s m C s A s m C (shown in Figure 14), 5'-GN2-C6 o[X]T s A s T s g s c s T s t s t s t s t s a s t s g s g s t s T s T s m C (shown in Figure 15), 5'-GN2-C6 o [X]A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C (shown in Figure 16), and 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C s ; where uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, and each LNA cytosine is a 5-methylcytosine; mC is 5-methylcytosine DNA, the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 are residues of the formula: [ka] Residues GN2-C6 are attached to the 5' end of the oligonucleotide via a phosphodiester bond, and / or GN2-C6 are trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2, or a mixture of both, more preferably GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2, and [X] is, as described above, o a o Represents, 102. The composition or kit according to item 101, wherein the conjugate is selected from the group consisting of:

[0674] 103. The inhibitor of RTEL1 is a single-stranded antisense oligonucleotide capable of inhibiting the expression of RTEL1, comprising or consisting of CTttattataacttgaaTCTC (SEQ ID NO: 246); The inhibitor of FUBP1 is a single-stranded antisense oligonucleotide capable of inhibiting the expression of FUBP1, and is selected from the group of antisense oligonucleotides comprising or consisting of: CTTatGctttttatgGT (SEQ ID NO: 325), CTTaTgctttttatgGT (SEQ ID NO: 325), CTtATgctttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatGgTT (SEQ ID NO: 326), CTtAtgctttttatGGTT (SEQ ID NO: 326), GcttTttatggtTtCAC (SEQ ID NO: 327), TATgcTttttatggtTTC (SEQ ID NO: 328), AcCAAttttcatttCtAC (SEQ ID NO: 329) and CcccataaccataGTC (SEQ ID NO: 330); Preferably, CcccataaccataGTC (SEQ ID NO: 330); where uppercase letters are beta-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA C's are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages. 103. The composition or kit according to any of items 1 to 102, wherein the antisense oligonucleotide is selected from the group of antisense oligonucleotides comprising or consisting of:

[0675] 104.RTEL1 inhibitor: 5'-GN2-C6 o [X] m C s T s t s t s a s t s t s a s t s a s a s c s t s t s g s a s a s T s m C s T s m C s and FUBP1 inhibitors 5'-GN2-C6 o [X] m C s T s T s a s t s G s c s t s t s t s t s t s a st s g s G s T (shown in Figure 8 ), 5'-GN2-C6 o [X] m C s T s T s a s T s g s c s t s t s t s t s t s a s t s g s G s T (shown in Figure 9 ), 5'-GN2-C6 o [X] m C s T s t s A s T s g s c s t s t s t s t s t s a s t s g s G s T s T (shown in Figure 10), 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s g s G s T s T (shown in Figure 11), 5'-GN2-C6 o [X] m Cs T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T (shown in Figure 12), 5'-GN2-C6 o [X] m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s G s T s T (shown in Figure 13), 5'-GN2-C6 o [X]G s c s t s t s T s t s t s a s t s g s g s t s T s t s m C s A s m C (shown in Figure 14), 5'-GN2-C6 o [X]T s A s T s g s c s T s t s t s ts t s a s t s g s g s t s T s T s m C (shown in Figure 15), 5'-GN2-C6 o [X]A S c S m C S A S A S t S t S t S t S c S a S t S t S t S m C S tA S m C (shown in Figure 16), and 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C s ; Preferably, 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s Gs T s m C s where uppercase letters represent beta-D-oxy LNA nucleosides, lowercase letters represent DNA nucleosides, and each LNA cytosine is a 5-methylcytosine; m C is 5-methylcytosine DNA, the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 are residues of the formula: [ka] Residues GN2-C6 are attached to the 5' end of the oligonucleotide via a phosphodiester bond, and / or GN2-C6 are trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2, or a mixture of both, more preferably GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2, and [X] is, as described above, o a o Represents, Item 104. The composition or kit according to item 103, wherein the conjugate is selected from the group consisting of:

[0676] 105. A composition or kit according to any of items 1 to 104 for use in the treatment or prevention of a disease.

[0677] 106. The composition or kit according to any of items 1 to 105 for use in the treatment or prevention of hepatitis B virus (HBV) infection.

[0678] 107. An inhibitor of RTEL1 for use in the treatment or prevention of a disease, wherein the treatment or prevention further comprises the administration of an inhibitor of FUBP1.

[0679] 108. An inhibitor of RTEL1 for use in the treatment or prevention of hepatitis B virus (HBV) infection and / or cancer, preferably in a subject at risk of developing, having developed, or previously having developed HBV-associated hepatocellular carcinoma (HCC), wherein the treatment or prevention further comprises administration of an inhibitor of FUBP1.

[0680] 109. An inhibitor of RTEL1 for use according to any of items 107 or 108, wherein the inhibitor of RTEL1 is an inhibitor as defined in any of items 4 to 44.

[0681] 110. An inhibitor of FUBP1 for use in the treatment or prevention of a disease, wherein the treatment or prevention further comprises the administration of an inhibitor of RTEL1.

[0682] 111. An inhibitor of FUBP1 for use in the treatment or prevention of hepatitis B virus (HBV) infection and / or cancer, preferably in a subject at risk of developing, having developed, or previously having developed HBV-associated hepatocellular carcinoma (HCC), wherein the treatment or prevention further comprises administration of an inhibitor of RTEL1.

[0683] 112. An inhibitor of FUBP1 for use according to any of items 110 or 111, wherein the inhibitor of FUBP1 is an inhibitor as defined in any of items 45 to 94.

[0684] 113. A combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 for use in the treatment or prevention of disease.

[0685] 114. A combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 for use in the treatment or prevention of a disease; wherein the RTEL1 inhibitor is an inhibitor according to any of items 4 to 44.

[0686] 115. A combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 according to item 113 or 114, wherein the FUBP1 inhibitor is an inhibitor according to any one of items 45 to 94.

[0687] 116. A combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 for use in the treatment or prevention of hepatitis B virus (HBV) infection and / or cancer, preferably in a subject at risk of developing, having developed, or previously having developed HBV-associated hepatocellular carcinoma (HCC).

[0688] 117. A combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 for use according to item 116; wherein the RTEL1 inhibitor is an inhibitor according to any one of items 4 to 44.

[0689] 118. A combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 for use according to item 116 or 117; wherein the FUBP1 inhibitor is an inhibitor according to any of items 45 to 94.

[0690] 119. A composition or kit for use according to item 105 or 106, wherein the HBV infection is a chronic HBV infection; an inhibitor of RTEL1 for use according to any of items 107 to 109; an inhibitor of FUBP1 for use according to any of items 110 to 112; or a combination for use according to any of items 113 to 118.

[0691] 120. A composition or kit for use according to item 105 or 106, wherein the RTEL1 inhibitor is capable of reducing cccDNA in infected cells; an inhibitor of RTEL1 for use according to any of items 107 to 109; an inhibitor of FUBP1 for use according to any of items 110 to 112; or a combination for use according to any of items 113 to 118.

[0692] 121. A composition or kit for use, in which cccDNA in HBV-infected cells is reduced by at least 60% compared to a control; an inhibitor of RTEL1 for use; an inhibitor of FUBP1 for use; or a combination for use according to item 120.

[0693] 122. A method for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of an inhibitor of RTEL1 to a subject suffering from or susceptible to the disease, wherein the method further comprises administering an effective amount of an inhibitor of FUBP1.

[0694] 123. A method for treating or preventing a disease, comprising administering a therapeutically or prophylactically effective amount of an inhibitor of FUBP1 to a subject suffering from or susceptible to the disease, wherein the method further comprises administering an effective amount of an inhibitor of RTEL1.

[0695] 124. A method for treating or preventing a disease, comprising administering to a subject suffering from or susceptible to the disease a combination of a therapeutically or prophylactically effective amount of an inhibitor of RTEL1 and a therapeutically or prophylactically effective amount of an inhibitor of FUBP1.

[0696] 125. Use of an inhibitor of FUBP1 and an inhibitor of RTEL1 for the preparation of a medicament for treating or preventing hepatitis B virus (HBV) and / or cancer.

[0697] 126. The method or use according to any one of items 122 to 125, wherein the disease is hepatitis B virus (HBV) infection and / or cancer.

[0698] 127. The method or use according to any one of items 122 to 126, wherein the disease is chronic hepatitis B virus (HBV) infection.

[0699] 128. An in vivo or in vitro method for regulating the expression of RTEL1 and FUBP1 in a target cell expressing RTEL1 and FUBP1, comprising administering to the cell an inhibitor of RTEL1 and an inhibitor of FUBP1 in effective amounts.

[0700] 129. The method or use according to any one of items 122 to 128, wherein the inhibitor of RTEL1 is an inhibitor as defined in any one of items 4 to 44, or a pharmaceutical composition according to item 2.

[0701] 130. The method or use according to any one of items 122 to 129, wherein the inhibitor of FUBP1 is an inhibitor as defined in any one of items 45 to 94, or a pharmaceutical composition according to item 2.

[0702] 131. A compound comprising or consisting of an antisense oligonucleotide capable of reducing the expression of RTEL1 and FUBP1, wherein the antisense oligonucleotide is CCCCATAACCATAGTCCACTTTATTATAACTTGAATCTC (SEQ ID NO: 348); CTTTATTATAACTTGAATCTCCACCCCATAACCATAGTC (SEQ ID NO: 349); CTTATGCTTTTTATGGTTCATTACATACTCTGGTCAAA (SEQ ID NO: 350); or TTACATACTCTGGTCAAACACTTATGCTTTTTATGGTT (SEQ ID NO: 351); Preferably, CTTATGCTTTTTATGGTTCATTACATACTCTGGTCAAA (SEQ ID NO: 350); or TTACATACTCTGGTCAAACACTTATGCTTTTTATGGTT (SEQ ID NO: 351) A compound selected from the group of antisense oligonucleotides having a nucleotide sequence comprising or consisting of:

[0703] 132. A compound comprising or consisting of an antisense oligonucleotide capable of reducing the expression of RTEL1 and FUBP1, wherein the antisense oligonucleotide is m C s c s c sc s a s t s a s a s c s c s a s t s a s G s T s m C o c o a o m C s T s t s t s a s t s t s a s t s a s a s c s t s t s g s a s a s T s m C s T s m C; m C s T s t s t s a s t s t s a s t s a s a s c s t s t s g s a s a s T s m C s T s m C o c o a o m C s c s c s c s a st s a s a s c s c s a s t s a s G s T s m C; m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T o c o a o T s T s a s c s a s t s a s c s ​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​o a o m C s T s t s A s t s g s c s t s t s t s t s t s a s t s G s g s T s T; where uppercase letters represent beta-D-oxy LNA nucleosides and lowercase letters represent DNA nucleosides, m C is 5-methylcytosine LNA, the subscript s represents a phosphorothioate internucleoside linkage, and the subscript o represents a phosphodiester internucleoside linkage; A compound selected from the group of antisense oligonucleotides comprising or consisting of:

[0704] 133. A compound comprising or consisting of an antisense oligonucleotide capable of reducing the expression of RTEL1 and FUBP1, wherein the antisense oligonucleotide is 5'-GN2-C6 o [X] m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C o c o a o m C s T s t s t sa s t s t s a s t s a s a s c s t s t s g s a s a s T s m C s T s m C; 5’-GN2-C6 o [X] m C s T s t s t s a s t s t s a s t s a s a s c s t s t s g s a s a s T s m C s T s m C o c o a o m C s c s c s c s a s t s a s a s c s c s a s t s a s G s T s m C; 5’-GN2-C6 o [X] m C s T s t s As t s g s c s t s t s t s t s t s a s t s G s g s T s T o c o a o T s T s a s c s a s t s a s c s t s c s t s g s g s t s m C s A s A s A, or 5’-GN2-C6 o [X]T s T s a s c<000222​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​a s t s G s g s T s T; where uppercase letters represent beta-D-oxy LNA nucleosides and lowercase letters represent DNA nucleosides, m C is 5-methylcytosine LNA, the subscript s represents a phosphorothioate internucleoside linkage, the subscript o represents a phosphodiester internucleoside linkage, and GN2-C6 are residues of the formula: [ka] Residues GN2-C6 are attached to the 5' end of the oligonucleotide via a phosphodiester bond, and / or GN2-C6 are trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2, or a mixture of both, more preferably GN2-C6 is a mixture of trivalent N-acetylgalactosamine (GalNAc) residues as shown in Figure 5D1 or Figure 5D2, and [X] is, as described above, o a o Represents, A compound selected from the group of antisense oligonucleotides comprising or consisting of:

[0705] 134. A compound comprising or consisting of an antisense oligonucleotide capable of reducing the expression of RTEL1 and FUBP1, wherein the antisense oligonucleotide is selected from the group of antisense oligonucleotides having a sequence comprising or consisting of any of the HELM sequences shown in Table 12D or Table 15B.

[0706] 135. A compound according to any of items 131 to 134 for use in the treatment or prevention of a disease, preferably a hepatitis B virus (HBV) infection.

[0707] 136. A compound according to any of items 131 to 134 for use in the treatment or prevention of hepatitis B virus (HBV) infection and / or cancer, preferably in a subject at risk of developing, having developed or having previously developed HBV-associated hepatocellular carcinoma (HCC).

[0708] 137. A method for treating or preventing a disease, preferably hepatitis B virus (HBV) infection and / or cancer, more preferably in a subject at risk of developing, having developed, or previously having developed HBV-associated hepatocellular carcinoma (HCC), comprising administering a therapeutically or prophylactically effective amount of a compound according to any of items 131 to 134.

[0709] 138. Use of a compound according to any of items 13 to 134 for preparing a medicament for treating or preventing hepatitis B virus (HBV) and / or cancer.

[0710] 139. An in vivo or in vitro method for modulating the expression of RTEL1 and FUBP1 in target cells expressing RTEL1 and FUBP1, comprising administering to the cells an effective amount of a compound according to any of items 131 to 134. [Example]

[0711] Example 1 - Antisense oligonucleotides targeting RTEL1 Materials and Methods Oligonucleotide synthesis Oligonucleotide synthesis is generally known in the art. Below are applicable protocols. The oligonucleotides of the present invention may be produced by methods that differ slightly in terms of the equipment, supports, and concentrations used.

[0712] Oligonucleotides are synthesized on a uridine universal support using the phosphoramidite approach of Oligomaker48 on a 1 μmol scale. At the end of synthesis, the oligonucleotides are cleaved from the solid support using aqueous ammonia at 60 °C for 5–16 h. The oligonucleotides are purified by reverse-phase HPLC (RP-HPLC) or solid-phase extraction, characterized by UPLC, and their molecular weights are further confirmed by ESI-MS.

[0713] Coupling of β-cyanoethyl phosphoramidites (DNA-A(Bz), DNA-G(ibu), DNA-C(Bz), DNA-T, LNA-5-methyl-C(Bz), LNA-A(Bz), LNA-G(dmf), or LNA-T) is carried out using 0.1 M of the 5'-O-DMT-protected amidite in acetonitrile and a solution of DCI (4,5-dicyanoimidazole) in acetonitrile (0.25 M) as the activator. In the final cycle, a phosphoramidite bearing the desired modification, such as a C6 linker for attaching a conjugate group, or such a conjugate group, can be used. Thiolation to introduce a phosphorothioate bond is carried out using xanthan gum (0.01 M in acetonitrile / pyridine 9:1). Phosphodiester bonds can be introduced using 0.02 M iodine in THF / pyridine / water 7:2:1. The remaining reagents are those commonly used in oligonucleotide synthesis.

[0714] For post-solid-phase synthesis conjugation, commercially available C6 amino linker phosphoramidites can be used in the final cycle of solid-phase synthesis, and after deprotection and cleavage from the solid support, the amino-linked deprotected oligonucleotide is isolated. The conjugate is introduced by activation of functional groups using standard synthetic methods.

[0715] The crude compound is purified by preparative RP-HPLC on a Phenomenex Jupiter® C18 10μ 150x10mm column. 0.1M ammonium acetate pH 8 and acetonitrile are used as buffers at a flow rate of 5mL / min. The collected fractions are lyophilized to give the purified compound, typically as a white solid.

[0716] Abbreviation: DCI: 4,5-dicyanoimidazole DCM: dichloromethane DMF: dimethylformamide DMT: 4,4'-dimethoxytrityl THF: tetrahydrofuran Bz: benzoyl Ibu: Isobutyryl RP-HPLC: reversed-phase high-performance liquid chromatography Primary human hepatocytes (PXB-PHH) Humanized mice (uPA / SCID

[0717] Fresh primary human hepatocytes (PXB-PHH) harvested from 10-well mice (referred to herein as PHH) were obtained in a 96-well format from PhoenixBio Co., Ltd. (Japan) and cultured in modified hepatocyte clonal growth medium (dHCGM), a DMEM medium containing 100 U / ml penicillin, 100 μg / ml streptomycin, 20 mM Hepes, 44 mM NaHCO, 15 μg / ml L-proline, 0.25 μg / ml insulin, 50 nM dexamethasone, 5 ng / ml EGF, 0.1 mM Asc-2P, 2% DMSO, and 10% FBS (Ishida et al., 2015).

[0718] Cells were cultured at 37°C in a humidified atmosphere containing 5% CO. Culture medium was changed every 2 days, except on weekends, until harvest.

[0719] HBV infection and oligonucleotide treatment (RTEL1) PHHs were incubated for 24 hours with HBV (purified from an individual with chronic hepatitis B (CHB)) with 4% PEG at a multiplicity of infection (MOI) of 40. The next day, the virus inoculum was removed, and cells were washed three times with PBS before adding fresh medium.

[0720] Treatment with cccDNA-establishing compounds in PHHs began on day 3 post-HBV infection. Cells were dosed in a 1:10 serial dilution dose-response format starting at 10 μM. On days 3, 5, and 7 post-HBV infection, cells were dosed with oligonucleotide compounds in a final volume of 100 μL / well of dHCGM medium. Treatment with 10 nM entecavir (ETV) began on day 5 post-infection to ensure accurate cccDNA measurement by qPCR, and medium containing 10 nM ETV was changed every two days (except on weekends) until cells were harvested on day 16 post-HBV infection. Experiments were performed in biological triplicate.

[0721] HBV infection and oligonucleotide treatment (FUBP1) Upon arrival, PHH cells were infected at an MOI of 110 using purified inoculum (genotype C) from a chronic patient by incubating PHH cells with HBV in 4% (v / v) PEG in PHH medium for 16 hours. Cells were then washed three times with PBS and cultured in fresh PHH medium in a humidified atmosphere of 5% CO2. Four days after infection, cells were treated in duplicate with FUBP1 LNA (see Table 11) at a final concentration of 10 μM or with PBS as a no-drug control (NDC). On the day of treatment, the old medium was removed from the cells and replaced with 400 μl / well of fresh PHH medium. Per well, 100 μL of 50 μM of each FUBP1 LNA or PBS as an NDC was added to 400 μL of PHH medium. The same treatment was repeated three times on days 4, 11, and 18 postinfection. The cell culture medium was replaced with fresh medium every three days on days 7, 14, and 21 postinfection.

[0722] Real-time PCR of intracellular RTEL1 RNA Following the manufacturer's protocol, the Qiagen BioRobot Universal System and RNeasy 96-well extraction plates (RNeasy 96 BioRobot 8000 Kit (12) / Catalog No. II D:967152) were used. Total mRNA was extracted from cells using a PCR kit. mRNA expression levels were analyzed using real-time PCR on an ABI QuantStudio™ 12k Flex. β-Actin (ACT B) was quantified in technical replicates by qPCR using TaqMan Fast Advanced Master Mix (Life Technologies, catalog number 4444558). qPCR for the RTEL1 gene was performed using Fast SYBR™ Green Master Mix (Life Technologies, catalog number 4385612). Results were normalized to the human ACT B endogenous control. mRNA expression was analyzed using the comparative cycle threshold 2-ΔΔCt method normalized to the reference gene ACT B and untreated cells. Primers used for quantification of ACTB RNA and RTEL1 RNA are listed in Table 16. [Table 16]

[0723] HBV cccDNA quantification DNA was extracted from HBV-infected primary human hepatocytes using SDS lysis buffer (50 mM Tris pH 8, 5 mM EDTA, 1% SDS). Cells were lysed with 80 μl of SDS lysis buffer, and then samples were frozen at -80°C for a minimum of 2 hours. Samples were thawed at 37°C, and 1 μl of proteinase K (Ambion Biosciences, catalog no. AM25448, 20 mg / mL stock) was added to each well of a 96-well plate. The samples were then incubated at 56°C for 30 minutes. After incubation, three volumes of ChIP DNA binding buffer from the ZYMO Research Genomic DNA Clean & Concentrator Kit (ZymoResearch, catalog no. D4067) were added, and DNA was purified according to the manufacturer's protocol. DNA was eluted with 20 μl of DNA elution buffer, and qPCR was performed using 2 μl of DNA.

[0724] cccDNA expression levels were quantified in technical replicates using the comparative cycle threshold 2-ΔΔCt method. Quantitative real-time polymerase chain reaction measurements were performed using a QuantStudio 12K Flex PCR System (Applied Biosystems). Normalization was performed using mitochondrial DNA (mitoDNA) and untreated cells as an endogenous control using Fast SYBR™ Green Master Mix (Life Technologies, Cat. No. 4385612). The cycler settings were adjusted to 95°C for 5 minutes, followed by 45 cycles of incubation at 95°C for 1 second and 60°C for 35 seconds. The primers used are listed in Table 17 below (all probes in the table are SYBR Green): [Table 17]

[0725] Example 1.1 - Effect of antisense oligonucleotides targeting RTEL1 on RTEL1 RNA and cccDNA in HBV-infected PHH cells. The effect of RTEL1 knockdown on RTEL1 RNA and cccDNA was tested using the oligonucleotide compounds in Table 6. PHH were cultured as described in the Materials and Methods section. HBV-infected PHH cells were treated with the compounds in Table 6 above. After 16 days of treatment, RTEL1 mRNA and cccDNA were measured by qPCR as described above. Results are shown in Table 18 as % of the mean no-drug control (NDC) sample (i.e., the lower the value, the greater the inhibition / reduction). [Table 18]

[0726] Example 1.2 - Testing the in vitro efficacy of antisense oligonucleotides targeting RTEL1 mRNA in the human MDA-MB-231 cell line at different concentrations for a dose-response curve. The human MDA-MB-231 cell line was purchased from ATCC and maintained in a humidified incubator at 37°C and 5% CO2 as recommended by the supplier. For the assay, 3500 cells / well were seeded into 96-multiwell plates in culture medium. Cells were incubated for 24 hours before the addition of oligonucleotides dissolved in PBS. The highest screening concentration of oligonucleotide was 50 μM, followed by eight 1:1 dilutions. Cells were harvested three days after addition of the oligonucleotides. RNA was extracted using the PureLink™ Pro 96 RNA Purification Kit (Thermo Fisher Scientific) according to the manufacturer's instructions and eluted in 50 μl of water. The RNA was then diluted 10-fold with DNase / RNase-free water (Gibco) and heated at 90°C for 1 minute.

[0727] For gene expression analysis, One Step RT-qPCR was performed using qScript™ XLT One-Step RT-qPCR ToughMix®, Low ROX™ (Quantabio) in a duplex setup. The following TaqMan primer assays were used for qPCR: RTEL1_Hs00249668_m1 [FAM-MGB] and endogenous control GUSB_Hs99999908_m1 [VIC-MGB]. All primer sets were purchased from ThermoFisher Scientific. IC50 determinations were performed in GraphPad Prism 7.04 from n=2 biological replicates. Relative RTEL1 mRNA levels upon treatment with 50 μM oligonucleotides as a percentage of the control (PBS-treated sample) are shown in Table 19. [Table 19]

[0728] The compounds exhibit very good efficacy and potency for knockdown of human RTEL1 mRNA, as shown by the concentration response curves in the human cell line MDA-MB-231 provided in FIG.

[0729] Example 2 - Antisense oligonucleotides targeting FUBP1 Introduction Overexpression and mutation of FUBP1 have long been known to be associated with cancer. In particular, strong overexpression of FUBP1 in human hepatocellular carcinoma (HCC) supports tumor growth and correlates with poor patient prognosis.

[0730] HBV cccDNA in infected hepatocytes is involved in persistent chronic infection and reactivation and serves as the template for all viral subgenomic transcripts and pregenomic RNAs (pgRNAs), ensuring both newly synthesized viral progeny and cccDNA pool replenishment via intracellular nucleocapsid recycling.

[0731] WO 2019 / 193165 showed that FUBP1 is involved in cccDNA stability. This knowledge provides an opportunity to destabilize cccDNA in HBV-infected subjects, opening up the opportunity for a complete cure for chronically infected HBV patients.

[0732] In this study, we screened 2,300 antisense oligonucleotides targeting human FUBP1. This screen identified compounds that were particularly potent and effective at targeting human FUBP1. Specifically, we identified nine alternating flank gapmer LNA oligonucleotides that targeted a region within exon 14 of human FUBP1 and conferred strong downregulation of human FUBP1 in vitro. Additionally, we identified one alternating flank gapmer LNA oligonucleotide that targeted a region within exon 20 of human FUBP1 and also conferred strong downregulation of human FUBP1. A summary of the nine identified compounds is shown in Table 12B above.

[0733] The target sequences of the identified compounds overlap with those of CMP Nos. 294_1 and 295_1 disclosed in WO 2019 / 193165. These two compounds inhibit FUBP1 in HeLa cells by approximately 70% at 5 μM. However, nine identified compounds are clearly more effective, inhibiting FUBP1 in HeLa cells by approximately 25%-35% at 3.3 μM or by approximately 27% at 5 μM (CMP No. 329_1). In addition, they are more efficient in targeting FUBP1 in HeLa cells than CMP No. 291_1, the best compound in WO 2019 / 193165 (see Example 2.1).

[0734] A summary of prior art compounds 276_1, 291_1, 294_1, 295_1, 319_1, and 320_1 from WO 2019 / 193165 is provided in Table 20 below. The compounds are gapmers with uniform flanks. CMP No. 291_1 was the best compound in PHH cells, and CMP No. 276_1 was the best compound in HeLa cells. CMP Nos. 294_1 and 295_1 are closest to CMP Nos. 325_1, 325_2, 326_1, 326_2, 326_3, 326_4; 327_1, and 328_1. CMP Nos. 319_1 and 320_1 are closest to CMP No. 329_1. [Table 20]

[0735] Example 2.1 - Testing the in vitro efficacy of antisense oligonucleotides targeting human FUBP1 mRNA in Hela cells. Antisense oligonucleotides targeted to FUBP1 were tested for their ability to reduce FUBP1 mRNA expression in human Hela cells obtained from ECACC (catalog no. 93021013).

[0736] Hela cells were grown in cell culture medium (EMEM [Sigma, catalog no. M2279] supplemented with 10% fetal bovine serum [Sigma, catalog no. F7524], 2 mM glutamine [Sigma, catalog no. G7513], 0.1 mM NEAA [Sigma, catalog no. M7145], and 0.025 mg / ml gentamicin [Sigma, catalog no. G1397]. Cells were washed with phosphate-buffered saline (PBS) [Sigma, cat. no. 14190-094] and then trypsinized every 5 days by adding 0.25% trypsin-EDTA solution (Sigma, T3924), incubating at 37°C for 2–3 min, and triturating.

[0737] For experiments, 2500 cells were seeded per well in 190 μL of growth medium in a 96-well plate (Nunc catalog number 167008). Approximately 24 hours after seeding, ASOs dissolved in PBS were added to reach the final custom concentration. Cells were incubated for 3 days without changing the medium.

[0738] After incubation, cells were harvested by removing the medium followed by the addition of 125 μL of RLT Lysis buffer (Qiagen 79216) and 125 μL of 70% ethanol. RNA was purified according to the manufacturer's instructions (Qiagen RNeasy 96 kit) and eluted in a final volume of 200 μL of DNase / RNase-free water (Gibco).

[0739] The RNA was heat shocked at 90 °C for 40 seconds to melt the RNA:LNA duplex, transferred directly to ice, and spun down before use. For one-step qPCR reactions, qPCR-mix (qScript (商標) XLE 1-Step RT-qPCR TOUGHMIX (登録商標) A master mix was generated by mixing Low ROX (QauntaBio, catalog number 95134-500) with two IDT probes (final concentration 1X). Taqman probes were obtained from IDT:FUBP1:Hs.PT.58.26883775 (primer-to-probe ratio 2, FAM) or ThermoFisher Scientific:GUSB:4326320E. The master mix (6 μL) and RNA (4 μL, 1–2 ng / μL) were then transferred to a quantitative PCR plate (MICROAMP). (登録商標) After seeding, the plate was given a quick spin at 1000g for 1 minute at RT and transferred to a Viia™ 7 system (Applied Biosystems, Thermo) using the following PCR conditions: 50°C for 15 minutes; 95°C for 3 minutes; 40 cycles of: 95°C for 5 seconds, followed by a temperature reduction of 1.6°C / second, followed by 60°C for 45 seconds. QuantStudio (商標)Data were analyzed using Real_time PCR software.

[0740] qPCR data were captured and quality control of raw data was performed with Quantstudio 7 software.

[0741] The data was then imported into E-Workbook and the BioBook template was used to capture and analyze the data. The following steps were used to analyze the data: 1. Calculate the amount using the delta-delta Ct method (amount = 2^(-Ct)*1000000000) 2. Normalize ...

Claims

1. A composition comprising an inhibitor of RTEL1 and an inhibitor of FUBP1.

2. A pharmaceutical composition comprising an inhibitor of RTEL1 and an inhibitor of FUBP1 or pharmaceutically acceptable salts thereof, and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

3. A kit comprising an inhibitor of RTEL1 and an inhibitor of FUBP1.

4. The composition of claim 1 or 2 or the kit of claim 3, wherein the inhibitor of RTEL1 is capable of reducing cccDNA in infected cells.

5. The composition or kit according to any one of claims 1 to 3, wherein the RTEL1 inhibitor is a nucleic acid molecule of 12 to 60 nucleotides in length, preferably 12 to 30 nucleotides in length, more preferably 12 to 25 nucleotides in length, even more preferably 15 to 21 nucleotides in length, comprising a contiguous nucleotide sequence of at least 10 nucleotides in length that is at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% complementary to a mammalian RTEL1 target nucleic acid, in particular a human RTEL1 target nucleic acid, and wherein the nucleic acid molecule is capable of reducing the expression of RTEL1.

6. The composition or kit of claim 5, wherein the mammalian RTEL1 target nucleic acid is selected from SEQ ID NO: 1 or 2, preferably SEQ ID NO:

1.

7. The antisense oligonucleotide capable of reducing the expression of RTEL1 is AATTttacatactctgGT (SEQ ID NO: 243), AAttttacatactctGGTC (SEQ ID NO: 244), TTacatactctggtCAAA (SEQ ID NO: 245), CTttattataactTgaAtCTC (SEQ ID NO: 246), and CTttattataacttgaaTCTC (SEQ ID NO: 246) where uppercase letters are beta-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

7. The composition or kit of claim 6, wherein the antisense oligonucleotide is selected from the group of antisense oligonucleotides comprising or consisting of:

8. The composition or kit according to any one of claims 1 to 3, wherein the inhibitor of FUBP1 is capable of reducing cccDNA and / or pgRNA in infected cells.

9. The composition or kit according to any one of claims 1 to 3, wherein the FUBP1 inhibitor is a nucleic acid molecule of 12 to 60 nucleotides in length, preferably 12 to 30 nucleotides in length, more preferably 12 to 25 nucleotides in length, even more preferably 15 to 21 nucleotides in length, comprising or consisting of a contiguous nucleotide sequence of 10 to 30 nucleotides in length, preferably 12 to 25 nucleotides in length, particularly 15 to 21 nucleotides in length, wherein the contiguous nucleotide sequence is at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95% complementary to a mammalian FUBP1 target nucleic acid, particularly a human FUBP1 target nucleic acid, and wherein the nucleic acid molecule is capable of inhibiting expression of FUBP1.

10. The composition or kit of claim 9, wherein the mammalian FUBP1 target nucleic acid is selected from SEQ ID NOs: 247 to 254, preferably SEQ ID NO:

247.

11. The single-stranded antisense oligonucleotide capable of inhibiting the expression of FUBP1 is CTTatGctttttatgGT (SEQ ID NO: 325), CTTaTgctttttatgGT (SEQ ID NO: 325), CTtATgcttttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatgGTT (SEQ ID NO: 326), CTtAtgctttttatGgTT (SEQ ID NO: 326), CTtAtgctttttatGGTT (SEQ ID NO: 326), GcttTttatggtTtCAC (SEQ ID NO: 327), TATgcTtttttatggtTTC (SEQ ID NO: 328), AcCAAttttcatttCtAC (SEQ ID NO: 329), and CcccataaccataGTC (SEQ ID NO: 330) where uppercase letters are beta-D-oxy LNA nucleosides, lowercase letters are DNA nucleosides, all LNA Cs are 5-methylcytosine, and all internucleoside linkages are phosphorothioate internucleoside linkages.

11. The composition or kit of claim 10, wherein the antisense oligonucleotide is selected from the group of antisense oligonucleotides comprising or consisting of:

12. A composition or kit according to any one of claims 1 to 3 for use in the treatment or prevention of a disease, preferably a Hepatitis B Virus (HBV) infection.

13. 1. An inhibitor of RTEL1 for use in the treatment or prevention of a disease, wherein said treatment or prevention further comprises the administration of an inhibitor of FUBP1.

14. 1. An inhibitor of FUBP1 for use in the treatment or prevention of a disease, wherein said treatment or prevention further comprises the administration of an inhibitor of RTEL1.

15. A combination of an inhibitor of RTEL1 and an inhibitor of FUBP1 for use in the treatment or prevention of disease.