Compounds and methods for reducing APP expression

Abstract

To provide compounds, methods, and pharmaceutical compositions useful to ameliorate at least one symptom or hallmark of a neurodegenerative disease, for use in reducing an amount or activity of APP RNA in a cell or animal, and in certain instances, reducing the amount of APP protein in a cell or animal.SOLUTION: The present invention provides an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an APP RNA, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified intemucleoside linkage.SELECTED DRAWING: None

Description

[Technical field]

[0001] Sequence Listing This application has been filed with an electronic sequence listing, which is provided as a file entitled BIOL0351WOSEQ_ST25.txt, created on January 22, 2020, and having a size of 580 KB. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

[0002] Compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of APP RNA in a cell or animal, and in some cases, for reducing the amount of APP protein in a cell or animal. Certain such compounds, methods, and pharmaceutical compositions are useful for improving at least one symptom or characteristic of a neurodegenerative disease. Such symptoms and characteristics include cognitive impairment, including memory and language impairment, behavioral and psychological symptoms such as apathy and lack of motivation, gait disturbances and seizures, progressive dementia, and abnormal amyloid deposition. Such neurodegenerative diseases include Alzheimer's disease, Alzheimer's disease in Down's syndrome patients, and cerebral amyloid angiopathy. [Background technology]

[0003] Alzheimer's disease (AD) is the most common cause of age-related dementia, affecting an estimated 5.7 million Americans annually (Alzheimer's Association. 2018 Alzheimer's Disease Facts and Figures. Alzheimer's Dement. 2018;14(3):367-429). AD is characterized by the accumulation of β-amyloid plaques in the brain prior to the appearance of overt clinical symptoms. These include cognitive impairment, including decline in memory and language skills, behavioral and psychological symptoms such as apathy and lack of motivation, gait disturbances and seizures, and progressive dementia.

[0004] Individuals with Down syndrome (DS) can experience early-onset Alzheimer's disease (AD in DS), with many individuals with DS exhibiting amyloid plaque formation by age 40, and more than 50% of individuals with Down syndrome exhibiting Alzheimer's dementia by age 50.

[0005] Cerebral amyloid angiopathy (CAA) is a related disorder characterized by the deposition of β-amyloid in blood vessels of the CNS. CAA is often observed in AD patients at autopsy, but is also associated with aging in the absence of clinical signs of AD.

[0006] AD, AD in DS, and CAA are all characterized by abnormal accumulation of β-amyloid plaques. β-amyloid (Aβ) is derived from the amyloid precursor protein (APP) when APP is processed by α-, β-, and γ-secretases. In addition to the 42 amino acid fragment Aβ, various other fragments of APP are also formed, some of which are thought to contribute to the development of dementia in AD (reviewed in Nhan, et al., “The multifaceted nature of amyloid precursor protein and its proteolytic fragments: friends and foes”, Acta Neuropath., 2015, 129(1):1-19). The increased incidence in AD in DS patients is thought to be directly related to an increased copy number of the APP gene located on chromosome 21.

[0007] Certain RNAi compounds have been described. RNAi compounds induce RNA silencing. They interact with the RISC (Receptor Binding Complex) and ultimately cleave the target nucleic acid. See, e.g., Sharp et al., 2001, Genes Dev. 15:485; Bernstein, et al., 2001, Nature, 409:363; Nykanen, et al., 2001, Cell, 107:309; Elbashir, et al., 2001, Genes Dev. 15:188; Lima et al., (2012) Cell 150:883-894.

[0008] Currently, there is a lack of acceptable options for treating neurodegenerative diseases such as AD, AD in DS, and CAA. Therefore, it is an object of the present invention to provide compounds, methods, and pharmaceutical compositions for treating such diseases. Summary of the Invention

[0009] Compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of APP RNA, and in certain embodiments, the amount of APP protein in a cell or animal. In certain embodiments, the animal suffers from a neurodegenerative disease. In certain embodiments, the animal suffers from Alzheimer's disease (AD). In certain embodiments, the animal suffers from Alzheimer's disease associated with Down's syndrome (AD in DS). In certain embodiments, the animal suffers from cerebral amyloid angiopathy (CAA). In certain embodiments, the compound useful for reducing the expression of APP RNA is an oligomeric compound. In certain embodiments, the compound useful for reducing the expression of APP RNA is a modified oligonucleotide.

[0010] Also provided are methods useful for improving at least one symptom or characteristic of a neurodegenerative disease. In certain embodiments, the neurodegenerative disease is Alzheimer's disease. In certain embodiments, the neurodegenerative disease is Alzheimer's disease in Down's syndrome patients. In certain embodiments, the neurodegenerative disease is cerebral amyloid angiopathy (CAA). In certain embodiments, the symptom or characteristic includes cognitive impairment, including memory and language impairment, behavioral and psychological symptoms such as apathy and lack of motivation, gait disturbance and seizures, progressive dementia, or abnormal amyloid deposition. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] Both the general description and the detailed description below are to be understood as exemplary and explanatory only and not limiting. In this specification, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "including" as well as other forms such as "includes" and "included" is not limiting. Additionally, terms such as "element" or "component" include both elements and components that include one unit and elements and components that include two or more subunits unless expressly stated otherwise.

[0012] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, and papers, are expressly incorporated herein in their entirety by reference to the portions of the documents discussed herein.

[0013] definition Unless specific definitions are given, the terminology used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are understood to be of the ordinary skill in the art. Where permitted, all patents, applications, published applications and other publications, and other data referred to throughout this disclosure are incorporated herein by reference in their entirety.

[0014] Unless otherwise indicated, the following terms have the following meanings.

[0015] definition As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside that includes a 2'-β-D-deoxyribosyl sugar moiety, which has the β-D configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside, or a nucleoside that includes an unmodified 2'-deoxyribosyl sugar moiety, may include a modified nucleobase or may include an RNA nucleobase (uracil).

[0016] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted sugar moiety. As used herein, "2'-substituted" with respect to the sugar moiety means that the sugar moiety includes at least one 2'-substituent group other than H or OH.

[0017] As used herein, "3' target site" refers to the 3'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0018] As used herein, "5' target site" refers to the 5'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0019] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0020] As used herein, "abasic sugar moiety" means the sugar portion of a nucleoside that is not bound to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as "abasic nucleosides."

[0021] As used herein, "administration" or "administering" means providing an agent or composition to an animal.

[0022] As used herein, "animal" means a human or non-human animal.

[0023] As used herein, "antisense activity" refers to any detectable and / or measurable change resulting from hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to the target nucleic acid or protein level in the absence of the antisense compound.

[0024] As used herein, "antisense compound" means an oligomeric compound capable of achieving at least one antisense activity.

[0025] As used herein, an "antisense oligonucleotide" refers to an oligomeric compound that is complementary to a target nucleic acid and is capable of achieving at least one antisense activity. Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0026] As used herein, "improvement" in relation to treatment means that at least one symptom is improved compared to the same symptom in the absence of treatment.In certain embodiments, improvement is a reduction in the severity or frequency of symptoms, or a delay in the onset or progression of the severity or frequency of symptoms.In certain embodiments, the symptom or characteristic is cognitive impairment, including memory and language impairment, behavioral and psychological symptoms such as apathy and lack of motivation, gait disturbance and seizures, progressive dementia, or abnormal amyloid deposition.

[0027] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0028] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that includes two rings, where the second ring is formed via a bridge connecting two of the atoms in the first ring to form a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl moiety.

[0029] As used herein, "blunt" or "blunt-ended" in reference to a duplex formed by two oligonucleotides means that there are no unpaired nucleotides at the ends (i.e., no overhanging nucleotides). One or both ends of a double-stranded RNAi compound may be blunt.

[0030] As used herein, "cleavable moiety" means a bond or group that is cleaved under physiological conditions, eg, inside a cell, animal, or human.

[0031] As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of an oligonucleotide or one or more regions thereof and at least 70% of the nucleobases of another nucleic acid or one or more regions thereof can hydrogen bond with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in opposite directions. Complementary nucleobases means nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that pair with natural nucleobases or other modified nucleobases are known in the art. For example, inosine can pair with adenosine, cytosine, or uracil. Complementary oligonucleotides and / or nucleic acids are not required to have nucleobase complementarity at each nucleoside. Rather, some mismatches are allowed. As used herein, "fully complementary" or "100% complementary" with respect to an oligonucleotide means that the oligonucleotide is complementary to another oligonucleotide or nucleic acid at every nucleoside of the oligonucleotide.

[0032] As used herein, "conjugate group" refers to a group of atoms that is directly attached to an oligonucleotide. Conjugate groups include conjugate moieties and conjugate linkers that attach the conjugate moieties to the oligonucleotide.

[0033] As used herein, "conjugated linker" means a bond or a group of atoms that comprises at least one bond that connects a conjugate moiety to an oligonucleotide.

[0034] As used herein, "conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

[0035] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to one another in a sequence.

[0036] As used herein, "constrained ethyl" or "cEt" or "cEt modified sugar moiety" means a β-D ribosyl bicyclic sugar moiety in which the second ring of the bicyclic sugar is formed via a bridge connecting the 4' and 2' carbons of the β-D ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', and the methyl group of the bridge is in the S configuration.

[0037] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt modified sugar moiety.

[0038] As used herein, "chiral enriched population" refers to a plurality of molecules of the same molecular formula, in which the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules that would be expected to contain the same particular stereochemical configuration at the same particular chiral center in the population if the particular chiral center were stereorandom. A chiral enriched population of molecules with multiple chiral centers in each molecule can contain one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is an oligomeric compound that includes a modified oligonucleotide.

[0039] As used herein, "duplex" refers to a duplex formed by complementary strands of nucleic acid (including, but not limited to, oligonucleotides) hybridized to each other. In certain embodiments, the two strands of a double-stranded region are separate molecules. In certain embodiments, the two strands are regions of the same molecule folded back on itself (e.g., a hairpin structure).

[0040] As used herein, "duplex" or "duplex region" refers to the structure formed by two oligonucleotides or portions thereof that hybridize to one another.

[0041] As used herein, "gapmer" refers to a modified oligonucleotide comprising an internal region having multiple nucleosides that support RNase H cleavage, disposed between external regions having one or more nucleosides, where at least one of the nucleosides comprising the internal region is chemically distinct from at least one nucleoside in each of the external regions. Specifically, the nucleosides defining the boundaries of the internal region and each of the external regions must be chemically distinct. The internal region may be referred to as a "gap" and the external regions may be referred to as "wings." Unless otherwise indicated, "gapmer" refers to a sugar motif. In certain embodiments, the sugar moiety of each nucleoside of the gap is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the gap comprises one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, with the remainder of the nucleosides of the gap being 2'-β-D-deoxynucleosides. Unless otherwise indicated, a gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow the gapmer pattern of sugar modifications. As used herein, the term "mixed gapmer" refers to a gapmer having a gap containing a 2'-β-D-deoxynucleoside and wings containing modified nucleosides with at least two different sugar modifications.

[0042] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is susceptible to reduction in the amount or activity of that target nucleic acid by the intervention of an oligomeric compound.

[0043] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleobases.

[0044] As used herein, "internucleoside bond" refers to the covalent bond between adjacent nucleosides in an oligonucleotide.As used herein, "modified internucleoside bond" refers to any internucleoside bond other than phosphodiester internucleoside bond."Phosphorothioate internucleoside bond" refers to a modified internucleoside bond in which one of the non-bridging oxygen atoms of phosphodiester internucleoside bond is replaced with a sulfur atom.

[0045] As used herein, "inverted nucleoside" means a nucleotide having 3' to 3' and / or 5' to 5' internucleoside linkages as depicted herein.

[0046] As used herein, an "inverted sugar moiety" means a sugar moiety or an abasic sugar moiety of an inverted nucleoside having 3' to 3' and / or 5' to 5' internucleoside linkages.

[0047] As used herein, "linker-nucleoside" refers to a nucleoside that directly or indirectly links an oligonucleotide to a conjugate moiety. The linker-nucleoside is located within the conjugate linker of an oligomeric compound. The linker-nucleoside is not considered to be part of the oligonucleotide moiety of an oligomeric compound, even if it is contiguous with the oligonucleotide.

[0048] "Lipid nanoparticles" or "LNPs" are vesicles that contain a lipid layer that encapsulates a pharma- ceutically active molecule, such as a nucleic acid molecule, e.g., RNAi or a plasmid into which RNAi is transcribed. LNPs are described, for example, in U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are incorporated herein by reference.

[0049] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that contains a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

[0050] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first nucleic acid sequence that is not complementary to a corresponding nucleobase of a second nucleic acid sequence, or target nucleic acid, when the first and second nucleic acid sequences are aligned.

[0051] As used herein, "MOE" means O-methoxyethyl. "2'-MOE" or "2'-MOE modified sugar" means a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of the ribosyl sugar moiety. As used herein, "2'-MOE nucleoside" means a nucleoside containing a 2'-MOE sugar moiety.

[0052] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0053] As used herein, "neurodegenerative disease" refers to a condition characterized by progressive loss of function or structure, including loss of neuronal function and death of neurons. In certain embodiments, the neurodegenerative disease is Alzheimer's disease. In certain embodiments, the neurodegenerative disease is Alzheimer's disease in Down's syndrome patients. In certain embodiments, the neurodegenerative disease is cerebral amyloid angiopathy.

[0054] As used herein, "nucleobase" refers to unmodified or modified nucleobase. Nucleobase is a heterocyclic moiety. As used herein, "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.

[0055] As used herein, "nucleobase sequence" means the order of contiguous nucleobases of a nucleic acid or oligonucleotide regardless of any sugar or internucleoside linkage modifications.

[0056] As used herein, "nucleoside" means a compound or a fragment of a compound that includes a nucleobase and a sugar moiety, each of which, independently, is unmodified or modified.

[0057] As used herein, "nucleoside overhang" refers to unpaired nucleotides at one or both ends of the duplex formed by hybridization of an antisense RNAi oligonucleotide and a sense RNAi oligonucleotide.

[0058] As used herein, "modified nucleoside" means a nucleoside that includes a modified nucleobase and / or a modified sugar moiety.

[0059] As used herein, "linked nucleosides" are nucleosides that are connected in contiguous sequence (ie, there are no additional nucleosides between the linked ones).

[0060] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may be paired with a second oligomeric compound, which may be complementary or unpaired to the first oligomeric compound. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "double-stranded oligomeric compound."

[0061] As used herein, "oligonucleotide" means a polymer of linked nucleosides joined via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. An oligonucleotide may or may not pair with a second oligonucleotide that is complementary to the oligonucleotide. A "single-stranded oligonucleotide" is an oligonucleotide that is unpaired. A "double-stranded oligonucleotide" is an oligonucleotide that is paired with a second oligonucleotide. An "oligonucleotide duplex" refers to a duplex formed by two paired oligonucleotides that have complementary nucleobase sequences. Each oligo in an oligonucleotide duplex is a "double-stranded oligonucleotide" or a "double-stranded oligonucleotide."

[0062] As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside bond is modified.As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside modification or internucleoside modification.Therefore, each nucleoside of unmodified oligonucleotide is a DNA or RNA nucleoside, and each internucleoside bond is a phosphodiester bond.

[0063] As used herein, "pharmaceutical acceptable carrier or diluent" refers to any substance suitable for use in administration to animals. Such specific carriers allow the formulation of pharmaceutical compositions for oral ingestion by subjects, such as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges. In certain embodiments, the pharmaceutical acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0064] As used herein, "pharmaceutically acceptable salt" refers to a physiologically and pharma- ceutically acceptable salt of a compound that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects thereto.

[0065] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in a particular cell line.

[0066] As used herein, "prodrug" refers to a first form of a therapeutic agent that is converted to a second form in an animal or cells thereof. Typically, the conversion of the prodrug in the animal is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or by physiological conditions. In certain embodiments, the first form of the prodrug is less active than the second form.

[0067] As used herein, "reducing or inhibiting the amount or activity" refers to a decrease or blocking of transcriptional expression or activity compared to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate a complete absence of transcriptional expression or activity.

[0068] As used herein, "RNAi compounds" refers to antisense compounds that act, at least in part, through RISC or Ago2 to regulate target nucleic acids and / or proteins encoded by target nucleic acids. RNAi compounds include, but are not limited to, double-stranded siRNAs, single-stranded RNAs (ssRNAs), and microRNAs, including microRNA mimics. RNAi compounds may include conjugate groups and / or terminal groups. In certain embodiments, RNAi compounds regulate the amount, activity, and / or splicing of target nucleic acids. The term RNAi compounds excludes antisense compounds that act through RNase H.

[0069] As used herein, an "RNAi oligonucleotide" refers to an antisense RNA By "sense RNAi oligonucleotides" is meant sense RNAi oligonucleotides or sense RNAi oligonucleotides.

[0070] As used herein, "antisense RNAi oligonucleotide" means an oligonucleotide that is complementary to a target sequence and contains a region that contains at least one chemical modification suitable for RNAi.

[0071] As used herein, "sense RNAi oligonucleotide" refers to an oligonucleotide that comprises a region that is complementary to the region of antisense RNAi oligonucleotide and can form a duplex with such antisense RNAi oligonucleotide.The duplex formed by antisense RNAi oligonucleotide and sense RNAi oligonucleotide is called double-stranded RNAi compound (dsRNAi) or short interfering RNA (siRNA).

[0072] As used herein, "RNase H compound" refers to an antisense compound that acts, at least in part, through RNase H to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. In certain embodiments, the RNase H compound is single-stranded. In certain embodiments, the RNase H compound is double-stranded. The RNase H compound may include a conjugate group and / or a terminal group. In certain embodiments, the RNase H compound modulates the amount or activity of a target nucleic acid. The term RNase H compound excludes antisense compounds that act primarily through RISC / Ago2.

[0073] As used herein, "antisense RNase H oligonucleotide" means an oligonucleotide that is complementary to a target sequence and contains a region containing at least one chemical modification suitable for RNase H mediated nucleic acid reduction.

[0074] As used herein, "self-complementary" with respect to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.

[0075] As used herein, "single-stranded" means a nucleic acid (including, but not limited to, an oligonucleotide) that is unpaired and not part of a duplex. Single-stranded compounds can hybridize with complementary nucleic acids to form duplexes, at which point they are no longer single-stranded.

[0076] As used herein, a "stabilized phosphate group" refers to a 5'-phosphate analog that is more metabolically stable than the 5'-phosphate naturally occurring on DNA or RNA.

[0077] As used herein, "standard cell assay" refers to the assays described in Examples 1 or 5 and reasonable variations thereof.

[0078] As used herein, "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center that has a random stereochemical configuration. For example, in a population of molecules that contain a stereorandom chiral center, the number of molecules that have the stereorandom chiral center's (S) configuration can be, but is not necessarily, the same as the number of molecules that have the stereorandom chiral center's (R) configuration. The stereochemical configuration of a chiral center is considered to be random if it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0079] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, an "unmodified sugar moiety" refers to a 2'-OH sugar moiety such as that found in RNA. By "modified sugar moiety" is meant a 2'-H(H) ribosyl sugar moiety (an "unmodified RNA sugar moiety"), or a 2'-H(H) deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" means a modified furanosyl sugar moiety or sugar surrogate.

[0080] As used herein, "sugar surrogate" means a modified sugar moiety, other than a furanosyl sugar moiety, that can link a nucleobase to another group (e.g., an internucleoside linkage, a conjugate group, or a terminal group of an oligonucleotide). Modified nucleosides, including sugar surrogates, can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or target nucleic acids.

[0081] As used herein, "symptom or characteristic" refers to a physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is evident to the subject or to a medical professional examining or testing the subject. In certain embodiments, the characteristic is evident upon invasive diagnostic testing, including but not limited to post-mortem examination.

[0082] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an antisense compound is designed to affect. Target RNA refers to an RNA transcript, and unless otherwise specified, includes pre-mRNA and mRNA.

[0083] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0084] As used herein, "terminal group" means a chemical group or grouping of atoms that is covalently attached to the end of an oligonucleotide.

[0085] As used herein, a "therapeutically effective amount" refers to an amount of an agent or composition that confers a therapeutic effect on an animal. For example, a therapeutically effective amount ameliorates a symptom of a disease.

[0086] Specific Embodiments The present disclosure provides the following non-limiting numbered embodiments:

[0087] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of an APP RNA, and the modified oligonucleotide comprises at least one modification selected from a modified sugar, a sugar surrogate, and a modified internucleoside linkage.

[0088] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, or 18 nucleobases of any of SEQ ID NOs: 12-501.

[0089] Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleobases of any of SEQ ID NOs:502-516.

[0090] Embodiment 4.1 The oligonucleotide comprises a modified oligonucleotide consisting of 2 to 30 linked nucleosides, an isometric portion of nucleobases 40 to 78 of SEQ ID NO: 1; an isometric portion of nucleobases 69 to 146 of SEQ ID NO: 1; an isometric portion of nucleobases 83 to 129 of SEQ ID NO: 1; an isometric portion of nucleobases 194 to 231 of SEQ ID NO: 1; An isometric portion of nucleobases 194 to 238 of SEQ ID NO: 1; an isometric portion of nucleobases 236 to 268 of SEQ ID NO: 1; An isometric portion of nucleobases 258 to 284 of SEQ ID NO: 1; an isometric portion of nucleobases 285 to 311 of SEQ ID NO: 1; an isometric portion of nucleobases 296 to 321 of SEQ ID NO: 1; an isometric portion of nucleobases 307 to 330 of SEQ ID NO: 1; an isometric portion of nucleobases 339 to 383 of SEQ ID NO: 1; an isometric portion of nucleobases 415 to 439 of SEQ ID NO: 1; An isometric portion of nucleobases 415 to 477 of SEQ ID NO: 1; An isometric portion of nucleobases 477 to 506 of SEQ ID NO: 1; An isometric portion of nucleobases 477 to 523 of SEQ ID NO: 1; An isometric portion of nucleobases 477 to 541 of SEQ ID NO: 1; An isometric portion of nucleobases 530 to 557 of SEQ ID NO: 1; An isometric portion of nucleobases 636 to 661 of SEQ ID NO: 1; An isometric portion of nucleobases 652 to 697 of SEQ ID NO: 1; An isometric portion of nucleic acid bases 920 to 950 of SEQ ID NO: 1; An isometric portion of nucleobases 1152 to 1179 of SEQ ID NO: 1; an isometric portion of nucleobases 1227 to 1265 of SEQ ID NO: 1; an isometric portion of nucleobases 1227 to 1274 of SEQ ID NO: 1; An isometric portion of nucleobases 1518 to 1543 of SEQ ID NO: 1; An isometric portion of nucleobases 1531 to 1593 of SEQ ID NO: 1; An isometric portion of nucleobases 1544 to 1593 of SEQ ID NO: 1; An isometric portion of nucleobases 1635 to 1657 of SEQ ID NO: 1; An isometric portion of nucleobases 1778 to 1800 of SEQ ID NO: 1; an isometric portion of nucleobases 1882 to 1908 of SEQ ID NO: 1; or An oligomeric compound having a nucleobase sequence complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of an equal length portion of nucleobases 2051 to 2074 of SEQ ID NO:1.

[0091] Embodiment 5. The oligomeric compound of any of embodiments 1-4, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nucleobase sequences of SEQ ID NOs: 1-7 when measured across the entire nucleobase sequence of the modified oligonucleotide.

[0092] Embodiment 6. The oligomeric compound according to any one of embodiments 1 to 5, wherein said modified oligonucleotide comprises at least one modified nucleoside.

[0093] Embodiment 7. The oligomeric compound of embodiment 6, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

[0094] Embodiment 8. The oligomeric compound of embodiment 7, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.

[0095] Embodiment 9. The oligomeric compound of embodiment 8, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-.

[0096] Embodiment 10. The oligomeric compound of any of embodiments 5-9, wherein said modified oligonucleotide comprises at least one modified nucleoside that comprises a non-bicyclic modified sugar moiety.

[0097] Embodiment 11. The oligomeric compound of embodiment 7, wherein the modified oligonucleotide comprises at least one nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge and at least one nucleoside comprising a non-bicyclic modified sugar moiety.

[0098] Embodiment 12. The oligomeric compound of embodiment 10 or 11, wherein said non-bicyclic modified sugar moiety is a 2'-MOE or a 2'-OMe modified sugar moiety.

[0099] Embodiment 13. The oligomeric compound of embodiment 11, wherein said bicyclic modified sugar moiety has a 2'-4' bridge, wherein said 2'-4' bridge is selected from -O-CH2 and -O-CH(CH3)-.

[0100] Embodiment 14. The oligomeric compound according to any one of embodiments 1 to 13, wherein said modified oligonucleotide comprises at least one modified nucleoside that comprises a sugar surrogate.

[0101] Embodiment 15. The oligomeric compound of embodiment 14, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA.

[0102] Embodiment 16. The modified oligonucleotide comprises: a 5' region consisting of 1 to 5 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and a 3' region consisting of 1 to 5 linked 3' region nucleosides; 14. The oligomeric compound of any of embodiments 1-13, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0103] Embodiment 17. The modified oligonucleotide comprises: a 5'-region consisting of five linked 5'-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3'-region consisting of five linked 3'-region nucleosides; The oligomeric compound of embodiment 16, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises either a cEt or a 2'-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0104] Embodiment 18. The oligomeric compound according to any one of embodiments 1 to 17, wherein said modified oligonucleotide comprises at least one modified internucleoside linkage.

[0105] Embodiment 19. The oligomeric compound according to embodiment 18, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

[0106] Embodiment 20. The oligomeric compound according to embodiment 18 or 19, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

[0107] Embodiment 21 The oligomeric compound according to embodiment 18 or 20, wherein said modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0108] Embodiment 22. The oligomeric compound of any of embodiments 18, 20, or 21, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0109] Embodiment 23. The oligomeric compound of any one of embodiments 1 to 22, wherein said modified oligonucleotide comprises a modified nucleobase.

[0110] Embodiment 24. The oligomeric compound according to embodiment 23, wherein said modified nucleobase is 5-methylcytosine.

[0111] Embodiment 25. The oligomeric compound according to any one of embodiments 1 to 24, wherein the modified oligonucleotide consists of 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 20, 16 to 18, 18 to 22, or 18 to 20 linked nucleosides.

[0112] Embodiment 26. The oligomeric compound of any one of embodiments 1 to 25, wherein said modified oligonucleotide consists of 18 linked nucleosides.

[0113] Embodiment 27. The oligomeric compound according to any one of embodiments 1 to 25, wherein said modified oligonucleotide consists of 20 linked nucleosides.

[0114] Embodiment 28. An oligomeric compound according to any one of embodiments 1 to 27, which consists of the modified oligonucleotide.

[0115] Embodiment 29. An oligomeric compound according to any one of embodiments 1 to 27, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

[0116] Embodiment 30. The oligomeric compound according to embodiment 29, wherein said conjugated linker consists of a single bond.

[0117] Embodiment 31 The oligomeric compound according to embodiment 29, wherein said conjugated linker is cleavable.

[0118] Embodiment 32. The oligomeric compound of embodiment 29, wherein the conjugated linker comprises 1 to 3 linker-nucleosides.

[0119] Embodiment 33. The oligomeric compound of any of embodiments 29-32, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

[0120] Embodiment 34. The oligomeric compound of any of embodiments 29-32, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0121] Embodiment 35. The olefin copolymer according to any one of embodiments 1 to 27 and 29 to 34, which includes a terminal group. Ligomeric compounds.

[0122] Embodiment 36. The oligomeric compound of any one of embodiments 1 to 35, wherein said oligomeric compound is a single-stranded oligomeric compound.

[0123] Embodiment 37. The oligomeric compound of any of embodiments 1-31 or 33-36, wherein the oligomeric compound does not comprise a linker-nucleoside.

[0124] Embodiment 38. An oligomeric duplex comprising an oligomeric compound according to any one of embodiments 1-27, 29-35, or 37.

[0125] Embodiment 39. An antisense compound comprising or consisting of an oligomeric compound according to any one of embodiments 1 to 37 or an oligomeric duplex according to embodiment 38.

[0126] Embodiment 40. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 37, or an oligomeric duplex according to embodiment 38, and a pharma- ceutically acceptable carrier or diluent.

[0127] Embodiment 41. The pharmaceutical composition of embodiment 40, wherein the pharma- ceutically acceptable diluent is artificial cerebrospinal fluid, sterile saline, or PBS.

[0128] Embodiment 42. The pharmaceutical composition of embodiment 41, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and sterile saline.

[0129] Embodiment 43. A method comprising administering to an animal a pharmaceutical composition according to any one of embodiments 40 to 42.

[0130] Embodiment 44. A method for treating an APP-associated disease, comprising administering to an individual suffering from or at risk of developing an APP-associated disease a therapeutically effective amount of a pharmaceutical composition described in any one of embodiments 40 to 42, thereby treating the APP-associated disease.

[0131] Embodiment 45 The method of embodiment 44, wherein the APP-related disease is Alzheimer's disease, Alzheimer's disease in patients with Down's syndrome, or cerebral amyloid angiopathy.

[0132] Embodiment 46 The method of any of embodiments 43-45, wherein at least one symptom or characteristic of the APP-related disease is ameliorated.

[0133] Embodiment 47. The method of embodiment 46, wherein the symptom or characteristic is cognitive impairment, including decline in memory and language abilities, behavioral and psychological symptoms such as apathy and lack of motivation, gait disturbances and seizures, progressive dementia, and / or abnormal amyloid deposition.

[0134] Embodiment 48. An RNAi compound comprising an antisense RNAi oligonucleotide consisting of 17 to 30 linked nucleosides, wherein the nucleobase sequence of the antisense RNAi oligonucleotide comprises a target region comprising at least 15 contiguous nucleobases, the target region being at least 90% complementary to an equal length portion of an APP RNA, and wherein at least one nucleoside of the antisense RNAi oligonucleotide is a modified nucleoside comprising a modified sugar moiety or sugar surrogate.

[0135] Embodiment 49. The antisense RNAi oligonucleotide is a 18-25 linked The RNAi compound of embodiment 48, which consists of nucleosides.

[0136] Embodiment 50. The RNAi compound of embodiment 48, wherein the antisense RNAi oligonucleotide consists of 20 to 25 linked nucleosides.

[0137] Embodiment 51. The RNAi compound of embodiment 48, wherein the antisense RNAi oligonucleotide consists of 21 to 23 linked nucleosides.

[0138] Embodiment 52 The RNAi compound according to embodiment 48, wherein the antisense RNAi oligonucleotide consists of 21 linked nucleosides.

[0139] Embodiment 53 The RNAi compound of embodiment 48, wherein the antisense RNAi oligonucleotide consists of 23 linked nucleosides.

[0140] Embodiment 54. The RNAi compound of any of embodiments 48 to 53, wherein the target region of the antisense RNAi oligonucleotide is at least 95% complementary to an isometric portion of APP RNA.

[0141] Embodiment 55. The RNAi compound of any of embodiments 48 to 53, wherein the target region of the antisense RNAi oligonucleotide is 100% complementary to an isometric portion of APP RNA.

[0142] Embodiment 56. An RNAi compound according to any one of embodiments 48 to 55, wherein the target region of the antisense RNAi oligonucleotide comprises at least 19 consecutive nucleobases.

[0143] Embodiment 57. An RNAi compound according to any one of embodiments 48 to 55, wherein the target region of the antisense RNAi oligonucleotide comprises at least 21 contiguous nucleobases.

[0144] Embodiment 58. An RNAi compound according to any one of embodiments 48 to 55, wherein the target region of the antisense RNAi oligonucleotide comprises at least 25 contiguous nucleobases.

[0145] Embodiment 59. An RNAi compound according to any one of embodiments 48 to 55, wherein the target region of the antisense RNAi oligonucleotide constitutes the entire nucleic acid base sequence of the antisense RNAi oligonucleotide.

[0146] Embodiment 60. An RNAi compound according to any one of embodiments 48 to 59, wherein the target region of the antisense oligonucleotide is complementary to an equal length portion of SEQ ID NOs: 1 to 7.

[0147] Embodiment 61. The RNAi compound according to any one of embodiments 48 to 60, wherein the APP RNA has the nucleobase sequence of any one of SEQ ID NOs: 1 to 3 or SEQ ID NOs: 4 to 7.

[0148] Embodiment 62. An RNAi compound according to any one of embodiments 48 to 61, wherein the nucleobase sequence of the target region of the antisense RNAi compound is at least 12, 13, 14, 15, 16, 17, 18, 19, 10, 21 nucleobases of any one of SEQ ID NOs: 517 to 665, 815 to 840, or 867 to 888.

[0149] Embodiment 63. At least one nucleotide of the antisense RNAi oligonucleotide 63. The RNAi compound of any of embodiments 48-62, wherein the osides comprise modified sugar moieties selected from 2'-F, 2'-OMe, 2'-NMA, LNA, and cEt, or sugar surrogates selected from GNA and UNA.

[0150] Embodiment 64 The RNAi compound of any of embodiments 48 to 63, wherein each nucleoside of the antisense RNAi oligonucleotide comprises a modified sugar moiety or sugar surrogate.

[0151] Embodiment 65. A compound according to any one of embodiments 48 to 64, wherein at least 80% of the nucleosides of said antisense RNAi oligonucleotide comprise a modified sugar moiety selected from 2'-F and 2'-OMe.

[0152] Embodiment 66 The RNAi compound of any of embodiments 65, wherein at least 90% of the nucleosides of said antisense RNAi oligonucleotide comprise a modified sugar moiety selected from 2'-F and 2'-OMe.

[0153] Embodiment 67. The RNAi compound of embodiment 66, wherein each nucleoside of the antisense RNAi oligonucleotide comprises a modified sugar moiety selected from 2'-F and 2'-OMe.

[0154] Embodiment 68 The RNAi compound of any of embodiments 48 to 67, wherein 1 to 4 nucleosides of the antisense RNAi oligonucleotide contain a 2'-F modified sugar moiety.

[0155] Embodiment 69. The RNAi compound of embodiment 68, wherein at least two of the nucleosides of said antisense RNAi oligonucleotide comprising a 2'-F modified sugar moiety are adjacent to one another.

[0156] Embodiment 70. The RNAi compound of embodiment 69, wherein at least 3 nucleosides of said antisense RNAi oligonucleotide comprising a 2'-F modified sugar moiety are contiguous.

[0157] Embodiment 71. The RNAi compound of any of embodiments 48-66 or 68-70, wherein one nucleoside of the antisense RNAi oligonucleotide comprises a GNA sugar surrogate.

[0158] Embodiment 72. The RNAi compound of embodiment 71, wherein the GNA sugar surrogate is (S)-GNA.

[0159] Embodiment 73. The RNAi compound of embodiment 71 or 72, wherein the nucleoside containing the GNA sugar surrogate is at position 7 of the antisense RNAi oligonucleotide, counting from the 5' end.

[0160] Embodiment 74. The RNAi compound of any one of embodiments 48-66 or 68-73, wherein one nucleoside of the antisense RNAi oligonucleotide is UNA.

[0161] Embodiment 75. The RNAi compound of embodiment 74, wherein the nucleoside containing the UNA sugar surrogate is at position 7 of the antisense RNAi oligonucleotide, counting from the 5' end.

[0162] Embodiment 76. At least one of the antisense RNAi oligonucleotides The RNAi compound of any of embodiments 48-75, wherein the nucleoside comprises a modified nucleobase.

[0163] Embodiment 77 The RNAi compound of embodiment 76, wherein at least one nucleobase of the antisense RNAi oligonucleotide is inosine.

[0164] Embodiment 78 The RNAi compound according to any of embodiments 48 to 77, wherein at least one internucleoside linkage of the antisense RNAi oligonucleotide is a modified internucleoside linkage.

[0165] Embodiment 79 The RNAi compound of embodiment 78, wherein at least one internucleoside linkage of the antisense RNAi oligonucleotide is a phosphorothioate internucleoside linkage.

[0166] Embodiment 80. The RNAi compound according to any of embodiments 48 to 79, wherein each internucleoside linkage of the antisense RNAi oligonucleotide is selected from unmodified phosphodiester internucleoside linkages and phosphorothioate internucleoside linkages.

[0167] Embodiment 81. The RNAi compound of any of embodiments 79-80, wherein one to three internucleoside linkages at each end of the antisense RNAi oligonucleotide are phosphorothioate internucleoside linkages.

[0168] Embodiment 82. The RNAi compound of embodiment 81, wherein one to three internucleoside linkages at each end of the antisense RNAi oligonucleotide are phosphorothioate internucleoside linkages, and all of the remaining internucleoside linkages of the antisense RNAi oligonucleotide are phosphodiester internucleoside linkages.

[0169] Embodiment 83. The RNAi compound according to any one of embodiments 48 to 82, comprising a sense RNAi oligonucleotide consisting of 17 to 30 linked nucleosides, wherein the nucleobase sequence of the sense RNAi oligonucleotide comprises an antisense hybridization region comprising at least 15 consecutive nucleobases, the antisense hybridization region being at least 90% complementary to an equal length portion of the antisense RNAi oligonucleotide, and the sense RNAi oligonucleotide and the antisense RNAi oligonucleotide hybridize to each other to form a duplex.

[0170] Embodiment 84. The RNAi compound of embodiment 83, wherein the sense RNAi oligonucleotide consists of 18 to 25 linked nucleosides.

[0171] Embodiment 85. The RNAi compound of embodiment 83, wherein the sense RNAi oligonucleotide consists of 20 to 25 linked nucleosides.

[0172] Embodiment 86. The RNAi compound of embodiment 83, wherein the sense RNAi oligonucleotide consists of 21 to 23 linked nucleosides.

[0173] Embodiment 87 The RNAi compound of embodiment 83, wherein the sense RNAi oligonucleotide consists of 21 linked nucleosides.

[0174] Embodiment 88 The RNAi compound according to embodiment 83, wherein the sense RNAi oligonucleotide consists of 23 linked nucleosides.

[0175] Embodiment 89. The RNAi compound according to any one of embodiments 83 to 88, wherein the antisense hybridizing region of the sense RNAi oligonucleotide is at least 95% complementary to an equal length portion of the antisense RNAi oligonucleotide.

[0176] Embodiment 90. The RNAi compound of any of embodiments 83 to 88, wherein the antisense hybridizing region of the sense RNAi oligonucleotide is 100% complementary to an equal length portion of the antisense RNAi oligonucleotide.

[0177] Embodiment 91. An RNAi compound according to any one of embodiments 83 to 90, wherein the antisense hybridizing region of the sense RNAi oligonucleotide comprises at least 20 consecutive nucleobases.

[0178] Embodiment 92. An RNAi compound according to any one of embodiments 83 to 90, wherein the antisense hybridizing region of the sense RNAi oligonucleotide comprises at least 21 contiguous nucleobases.

[0179] Embodiment 93. An RNAi compound according to any one of embodiments 83 to 90, wherein the antisense hybridizing region of the sense RNAi oligonucleotide comprises at least 25 consecutive nucleobases.

[0180] Embodiment 94. An RNAi compound according to any one of embodiments 83 to 93, wherein the antisense hybridizing region of the sense RNAi oligonucleotide constitutes the entire nucleic acid base sequence of the sense RNAi oligonucleotide.

[0181] Embodiment 95 The RNAi compound of any of embodiments 83-94, wherein from 1 to 4 of the 3'-most nucleosides of the antisense RNAi oligonucleotide are overhanging nucleosides.

[0182] Embodiment 96 The RNAi compound of any of embodiments 83-95, wherein from 1 to 4 of the 5'-most nucleosides of the antisense RNAi oligonucleotide are overhanging nucleosides.

[0183] Embodiment 97. The RNAi compound of any of embodiments 83 to 96, wherein the 1 to 4 3'-most nucleosides of the sense RNAi oligonucleotide are overhanging nucleosides.

[0184] Embodiment 98. The RNAi compound of any of embodiments 83 to 97, wherein one to four of the 4'-most nucleosides of said sense RNAi oligonucleotide are overhanging nucleosides.

[0185] Embodiment 99. The RNAi compound of any of embodiments 83 to 94, wherein the duplex has a blunt end at the 3' end of the antisense RNAi oligonucleotide.

[0186] Embodiment 100. The RNAi compound of any of embodiments 83-94, or 99, wherein the duplex has a blunt end at the 5' end of the antisense RNAi oligonucleotide.

[0187] Embodiment 101. The RNAi compound according to any one of embodiments 95 to 97, wherein at least one overhanging nucleoside is a deoxyribonucleoside.

[0188] Embodiment 102. The RNAi compound according to any of embodiments 83 to 101, wherein at least one nucleoside of the sense RNAi oligonucleotide is a modified nucleoside.

[0189] Embodiment 103. The RNAi compound of embodiment 102, wherein at least one nucleoside of the sense RNAi oligonucleotide comprises a modified sugar moiety selected from 2'-F, 2'-OMe, LNA, cEt, or a sugar surrogate selected from GNA and UNA.

[0190] Embodiment 104. The RNAi compound according to any of embodiments 83 to 103, wherein each nucleoside of the sense RNAi oligonucleotide comprises a modified sugar moiety or sugar surrogate.

[0191] Embodiment 105. An RNAi compound according to any one of embodiments 83 to 104, wherein at least 80% of the nucleosides of said sense RNAi oligonucleotide comprise a modified sugar moiety selected from 2'-F and 2'-OMe.

[0192] Embodiment 106 The RNAi compound of embodiment 105, wherein each nucleoside of the sense RNAi oligonucleotide comprises a modified sugar moiety selected from 2'-F and 2'-OMe.

[0193] Embodiment 107. The RNAi compound according to any of embodiments 83 to 106, wherein 1 to 4 nucleosides of the sense RNAi oligonucleotide comprise a 2'-F modified sugar moiety.

[0194] Embodiment 108. The RNAi compound according to any of embodiments 83 to 107, wherein at least two nucleosides of said sense RNAi oligonucleotide comprising a 2'-F modified sugar moiety are adjacent to one another.

[0195] Embodiment 109. The RNAi compound of embodiment 108, wherein at least 3 nucleosides of said sense RNAi oligonucleotide comprising a 2'-F modified sugar moiety are contiguous.

[0196] Embodiment 110. The RNAi compound according to any one of embodiments 83 to 105 or 107 to 109, wherein at least one nucleoside of the sense RNAi oligonucleotide is GNA.

[0197] Embodiment 111. The RNAi compound according to any one of embodiments 83 to 105 or 107 to 109, wherein one nucleoside of the sense RNAi oligonucleotide is GNA.

[0198] Embodiment 112. The RNAi compound of embodiment 110 or 111, wherein the GNA sugar surrogate is (S)-GNA.

[0199] Embodiment 113. The RNAi compound according to any one of embodiments 83 to 105 or 107 to 109, wherein at least one nucleoside of the sense RNAi oligonucleotide is UNA.

[0200] Embodiment 114. The RNAi compound according to any one of embodiments 83 to 105 or 107 to 109, wherein one nucleoside of the sense RNAi oligonucleotide is UNA.

[0201] Embodiment 115. The RNAi compound according to any one of embodiments 83 to 114, wherein at least one nucleoside of the sense RNAi oligonucleotide comprises a modified nucleobase.

[0202] Embodiment 116 The RNAi compound of embodiment 115, wherein at least one nucleobase of the sense RNAi oligonucleotide is hypoxanthine.

[0203] Embodiment 117. The RNAi compound according to any of embodiments 83 to 116, wherein at least one internucleoside linkage of said sense RNAi oligonucleotide is a modified internucleoside linkage.

[0204] Embodiment 118 The RNAi compound according to embodiment 117, wherein at least one internucleoside linkage of said sense RNAi oligonucleotide is a phosphorothioate internucleoside linkage.

[0205] Embodiment 119. The RNAi compound according to embodiment 118, wherein each internucleoside linkage of the sense RNAi oligonucleotide is selected from unmodified phosphodiester internucleoside linkages and phosphorothioate internucleoside linkages.

[0206] Embodiment 120. The RNAi compound according to any of embodiments 117 to 119, wherein one to three internucleoside linkages at each end of the sense RNAi oligonucleotide are phosphorothioate internucleoside linkages.

[0207] Embodiment 121. The RNAi compound of embodiment 120, wherein one to three internucleoside linkages at each end of the antisense RNAi oligonucleotide are phosphorothioate internucleoside linkages, and all of the remaining internucleoside linkages of the antisense RNAi oligonucleotide are phosphodiester internucleoside linkages.

[0208] Embodiment 122 The RNAi compound according to any of embodiments 48 to 121, comprising a stabilized phosphate group attached to the 5' position of the 5'-most nucleoside of said antisense RNAi oligonucleotide.

[0209] Embodiment 123. The RNAi compound of embodiment 122, wherein the stabilized phosphate group comprises an (E)-vinyl phosphonate.

[0210] Embodiment 124 The RNAi compound of embodiment 122, wherein the stabilized phosphate group comprises a cyclopropylphosphonate.

[0211] Embodiment 125. The RNAi compound of any of embodiments 48 to 124, wherein the compound comprises 1 to 5 abasic sugar moieties attached to one or both ends of the antisense RNA oligonucleotide.

[0212] Embodiment 126 The RNAi compound of embodiment 125, wherein the compound comprises one abasic sugar moiety attached to one or both ends of the antisense RNA oligonucleotide.

[0213] Embodiment 127 The RNAi compound of embodiment 125 or 126, wherein each abasic sugar moiety is inverted.

[0214] Embodiment 128 The RNAi compound of any of embodiments 125-127, wherein the abasic sugar moiety is attached to the antisense RNA oligonucleotide via a phosphorothioate bond.

[0215] Embodiment 129. The compound is attached to one or both ends of the sense RNA oligonucleotide. The RNAi compound of any of embodiments 48-128, comprising 1 to 5 abasic sugar moieties attached thereto.

[0216] Embodiment 130 The RNAi compound of embodiment 129, wherein the compound comprises one abasic sugar moiety attached to one or both ends of the sense RNA oligonucleotide.

[0217] Embodiment 131 The RNAi compound of embodiment 129 or 130, wherein each abasic sugar moiety is inverted.

[0218] Embodiment 132 The RNAi compound of any of embodiments 129 to 131, wherein the abasic sugar moiety is attached to the sense RNA oligonucleotide via a phosphorothioate bond.

[0219] Embodiment 133. The RNAi compound according to any one of embodiments 48 to 132, wherein the RNAi compound is a prodrug.

[0220] Embodiment 134. An RNAi compound according to any one of embodiments 48 to 132, wherein the compound comprises a conjugate group.

[0221] Embodiment 135. The RNAi compound according to embodiment 134, wherein the conjugate group is conjugated to the antisense RNAi oligonucleotide.

[0222] Embodiment 136 The RNAi compound according to embodiment 135, wherein the conjugate group is conjugated to the 5' end of the antisense RNAi oligonucleotide.

[0223] Embodiment 137 The RNAi compound according to embodiment 135, wherein the conjugate group is conjugated to the 3' end of the antisense RNAi oligonucleotide.

[0224] Embodiment 138 The RNAi compound according to embodiment 134, wherein the conjugate group is conjugated to the sense RNAi oligonucleotide.

[0225] Embodiment 139. The RNAi compound according to embodiment 138, wherein the conjugate group is conjugated to the 5' end of the sense RNAi oligonucleotide.

[0226] Embodiment 140 The RNAi compound according to embodiment 138, wherein the conjugate group is conjugated to the 3' end of the sense RNAi oligonucleotide.

[0227] Embodiment 141 The RNAi compound according to any one of embodiments 138 to 140, wherein the conjugate group is directly attached to the sense RNAi oligonucleotide.

[0228] Embodiment 142. The RNAi compound according to any of embodiments 138 to 141, wherein the conjugate group is attached to the sense RNAi oligonucleotide via 1 to 5 abasic sugar moieties.

[0229] Embodiment 143 The RNAi compound of embodiment 142, wherein the 1 to 5 abasic sugar moieties are inverted.

[0230] Embodiment 144. The RNAi compound according to any one of embodiments 134 to 143, wherein the conjugate group comprises a pyrrolidine linker.

[0231] Embodiment 145. The RNAi compound according to any one of embodiments 134 to 144, wherein the conjugate group comprises a cell targeting moiety.

[0232] Embodiment 146 The RNAi compound of embodiment 145, wherein the cell targeting moiety is a neurotransmitter receptor ligand.

[0233] Embodiment 147. The RNAi compound according to embodiment 146, wherein the targeting ligand targets the GABA transporter.

[0234] Embodiment 148. A pharmaceutical composition comprising an RNAi compound according to any one of embodiments 48 to 147, and a pharma- ceutically acceptable carrier or diluent.

[0235] Embodiment 149. The pharmaceutical composition of embodiment 148, wherein the pharma- ceutically acceptable diluent is artificial cerebrospinal fluid, sterile saline, or PBS.

[0236] Embodiment 150. The pharmaceutical composition of embodiment 149, wherein the pharmaceutical composition consists essentially of the RNAi compound and sterile saline.

[0237] Embodiment 151. A pharmaceutical composition according to embodiment 148 or 149, comprising a lipid.

[0238] Embodiment 152. A pharmaceutical composition according to embodiment 151, comprising lipid nanoparticles.

[0239] Embodiment 153. A method comprising administering to an animal a pharmaceutical composition according to any one of embodiments 148 to 152.

[0240] Embodiment 154. A method for treating an APP-associated disease, comprising administering to an individual suffering from or at risk of developing an APP-associated disease a therapeutically effective amount of a pharmaceutical composition described in any of embodiments 148 to 152, thereby treating the APP-associated disease.

[0241] Embodiment 155. The method of embodiment 154, wherein the APP-related disease is Alzheimer's disease, Alzheimer's disease in patients with Down's syndrome, or cerebral amyloid angiopathy.

[0242] Embodiment 156 The method of embodiment 155, wherein at least one symptom or characteristic of the APP-related disease is ameliorated.

[0243] Embodiment 157. The method of embodiment 156, wherein the symptom or characteristic is cognitive impairment, including decline in memory and language abilities, behavioral and psychological symptoms such as apathy and lack of motivation, gait disturbances and seizures, progressive dementia, and / or abnormal amyloid deposition.

[0244] An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, the nucleobase sequence of which is APP The oligomeric compound is at least 80% complementary to an isometric portion of an RNA, and the modified oligonucleotide comprises at least one modification selected from a modified sugar, a sugar surrogate, and a modified internucleoside linkage.

[0245] Embodiment 159. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, 13, 14, 15, 16, 17, or 18 nucleobases of any of SEQ ID NOs: 12-501, and wherein the modified oligonucleotide comprises a modified sugar and a modified nucleoside. The oligomeric compound comprises at least one modification selected from an intercidal bond.

[0246] Embodiment 160. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases of any of SEQ ID NOs: 502-516, and the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0247] Embodiment 161. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleobases of any of SEQ ID NOs: 517-665, 815-840, or 867-888, and the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0248] Embodiment 162. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, the nucleobase sequence of the modified oligonucleotide being: an isometric portion of nucleobases 40 to 78 of SEQ ID NO: 1; an isometric portion of nucleobases 69 to 146 of SEQ ID NO: 1; an isometric portion of nucleobases 83 to 129 of SEQ ID NO: 1; an isometric portion of nucleobases 83 to 246 of SEQ ID NO: 1; an isometric portion of nucleobases 94 to 225 of SEQ ID NO: 1; an isometric portion of nucleobases 194 to 231 of SEQ ID NO: 1; An isometric portion of nucleobases 194 to 238 of SEQ ID NO: 1; an isometric portion of nucleobases 236 to 268 of SEQ ID NO: 1; an isometric portion of nucleobases 258 to 288 of SEQ ID NO: 1; an isometric portion of nucleobases 285 to 311 of SEQ ID NO: 1; an isometric portion of nucleobases 296 to 321 of SEQ ID NO: 1; an isometric portion of nucleobases 307 to 330 of SEQ ID NO: 1; an isometric portion of nucleobases 329 to 352 of SEQ ID NO: 1; an isometric portion of nucleobases 330 to 352 of SEQ ID NO: 1; an isometric portion of nucleobases 339 to 383 of SEQ ID NO: 1; an isometric portion of nucleobases 415 to 439 of SEQ ID NO: 1; An isometric portion of nucleobases 413 to 477 of SEQ ID NO: 1; An isometric portion of nucleobases 415 to 477 of SEQ ID NO: 1; An isometric portion of nucleobases 477 to 506 of SEQ ID NO: 1; An isometric portion of nucleobases 477 to 523 of SEQ ID NO: 1; An isometric portion of nucleobases 477 to 541 of SEQ ID NO: 1; An isometric portion of nucleobases 530 to 557 of SEQ ID NO: 1; An isometric portion of nucleobases 581 to 638 of SEQ ID NO: 1; An isometric portion of nucleobases 636 to 661 of SEQ ID NO: 1; An isometric portion of nucleobases 652 to 697 of SEQ ID NO: 1; An isometric portion of nucleobases 728 to 821 of SEQ ID NO: 1; An isometric portion of nucleobases 770 to 821 of SEQ ID NO: 1; An isometric portion of nucleic acid bases 920 to 950 of SEQ ID NO: 1; An isometric portion of nucleobases 1006 to 1049 of SEQ ID NO: 1; An isometric portion of nucleobases 1152 to 1179 of SEQ ID NO: 1; an isometric portion of nucleobases 1227 to 1265 of SEQ ID NO: 1; an isometric portion of nucleobases 1227 to 1274 of SEQ ID NO: 1; An isometric portion of nucleobases 1268 to 1332 of SEQ ID NO: 1; an isometric portion of nucleobases 1268 to 1311 of SEQ ID NO: 1; an isometric portion of nucleobases 1289 to 1332 of SEQ ID NO: 1; An isometric portion of nucleobases 1518 to 1543 of SEQ ID NO: 1; An isometric portion of nucleobases 1531 to 1593 of SEQ ID NO: 1; An isometric portion of nucleobases 1544 to 1593 of SEQ ID NO: 1; An isometric portion of nucleobases 1634 to 1657 of SEQ ID NO: 1; An isometric portion of nucleobases 1778 to 1800 of SEQ ID NO: 1; An isometric portion of nucleobases 1882 to 1908 of SEQ ID NO: 1; An isometric portion of nucleobases 2051 to 2074 of SEQ ID NO: 1; An isometric portion of nucleobases 2360 to 3117 of SEQ ID NO: 1; An isometric portion of nucleobases 2402 to 3117 of SEQ ID NO: 1; An isometric portion of nucleobases 2360 to 2655 of SEQ ID NO: 1; An isometric portion of nucleobases 2402 to 2655 of SEQ ID NO: 1; an isometric portion of nucleobases 2675 to 3054 of SEQ ID NO: 1; or The oligomeric compound is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleobases of an equal length portion of nucleobases 3192 to 3277 of SEQ ID NO: 3, and the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0249] Embodiment 163. The oligomeric compound of any of embodiments 158-162, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nucleobase sequences of SEQ ID NOs: 1-7 when measured across the entire nucleobase sequence of the modified oligonucleotide.

[0250] Embodiment 164. The oligomeric compound according to any of embodiments 158 to 162, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.

[0251] Embodiment 165. The oligomeric compound according to embodiment 164, wherein at least one modified nucleoside of said modified oligonucleotide comprises a modified sugar moiety.

[0252] Embodiment 166 The oligomeric compound according to embodiment 165, wherein at least one modified nucleoside of said modified oligonucleotide comprises a bicyclic sugar moiety.

[0253] Embodiment 167. The oligomeric compound according to embodiment 166, wherein at least one modified nucleoside of the modified oligonucleotide comprises a bicyclic sugar moiety having a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-.

[0254] Embodiment 168. The oligomeric compound according to any of embodiments 162 to 167, wherein at least one modified nucleoside of the modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

[0255] Embodiment 169. The oligomeric compound of embodiment 168, wherein at least one modified nucleoside of the modified oligonucleotide comprises a bicyclic sugar moiety having a 2'-4' bridge and at least one nucleoside of the modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

[0256] Embodiment 170. The non-bicyclic modified sugar moiety is a 2'-MOE modified sugar moiety, a 2'-OMe modified 170. The oligomeric compound according to embodiment 168 or 169, which is a sugar moiety, or a 2'-F modified sugar moiety.

[0257] Embodiment 171. The oligomeric compound according to any of embodiments 158 to 170, wherein at least one modified nucleoside of the modified oligonucleotide comprises a sugar surrogate.

[0258] Embodiment 172. The oligomeric compound according to embodiment 171, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA.

[0259] Embodiment 173. The oligomeric compound according to any of embodiments 158 to 172, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0260] Embodiment 174. The oligomeric compound according to embodiment 173, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

[0261] Embodiment 175. The oligomeric compound according to embodiment 173 or 174, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

[0262] Embodiment 176. The oligomeric compound according to embodiment 173 or 175, wherein said modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0263] Embodiment 177. The oligomeric compound according to any of embodiments 173, 175, or 176, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0264] Embodiment 178. The oligomeric compound according to any of embodiments 158 to 177, wherein the modified oligonucleotide comprises a modified nucleobase.

[0265] Embodiment 179. The oligomeric compound according to embodiment 178, wherein the modified nucleobase is 5-methylcytosine.

[0266] Embodiment 180. The oligomeric compound according to any of embodiments 158 to 179, wherein the modified oligonucleotide consists of 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 20, 16 to 18, 18 to 22, 18 to 25, 18 to 20, 20 to 25, or 21 to 23 linked nucleosides.

[0267] Embodiment 181. The oligomeric compound according to any of embodiments 158 to 180, wherein said modified oligonucleotide consists of 18 linked nucleosides.

[0268] Embodiment 182. The oligomeric compound according to any of embodiments 158 to 180, wherein said modified oligonucleotide consists of 20 linked nucleosides.

[0269] Embodiment 183. The oligomeric compound according to any of embodiments 158 to 180, wherein said modified oligonucleotide consists of 21 linked nucleosides.

[0270] Embodiment 184. The oligomeric compound according to any of embodiments 158 to 180, wherein said modified oligonucleotide consists of 23 linked nucleosides.

[0271] Embodiment 185. The oligomeric compound is an RNase H compound. 185. The oligomeric compound according to any one of claims 1 to 184.

[0272] Embodiment 186. The oligomeric compound according to embodiment 185, wherein the modified oligonucleotide is a gapmer.

[0273] Embodiment 187. The modified oligonucleotide comprises: a 5'-region consisting of 1 to 6 linked 5'-region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and a 3'-region consisting of 1 to 6 linked 3'-region nucleosides; the 3'-most nucleoside of the 5' region and the 5'-most nucleoside of the 3'-region comprise a modified sugar moiety; 187. The oligomeric compound of any one of claims 158 to 186, wherein each of the central region nucleosides is selected from nucleosides that include a 2'-β-D-deoxyribosyl sugar moiety and nucleosides that include a 2'-substituted sugar moiety, and the central region comprises at least six nucleosides that include a 2'-β-D-deoxyribosyl sugar moiety and no more than two nucleosides that include a 2'-substituted sugar moiety.

[0274] Embodiment 188. The modified oligonucleotide comprises: a 5'-region consisting of 1 to 6 linked 5'-region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and a 3'-region consisting of 1 to 6 linked 3'-region nucleosides; The oligomeric compound of any of embodiments 158-183 or 185-187, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0275] Embodiment 189. The modified oligonucleotide comprises: a 5'-region consisting of five linked 5'-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3'-region consisting of five linked 3'-region nucleosides; The oligomeric compound of embodiment 188, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises either a cEt modified sugar moiety or a 2'-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0276] Embodiment 190. The oligomeric compound according to any of embodiments 158 to 184, wherein the oligomeric compound is an RNAi compound.

[0277] Embodiment 191. The oligomeric compound according to any of embodiments 158 to 190, wherein said oligomeric compound comprises an antisense RNAi oligonucleotide comprising a target region comprising at least 15 consecutive nucleobases, said target region being at least 90% complementary to an equal length portion of APP RNA.

[0278] Embodiment 192. The oligomeric compound according to embodiment 191, wherein the target region of said antisense RNAi oligonucleotide is at least 95% complementary, or 100% complementary, to an equal length portion of APP RNA.

[0279] Embodiment 193. The target region of the antisense RNAi oligonucleotide comprises at least 193. The oligomeric compound according to any of embodiments 191-192, comprising at least 19, 20, 21, or 25 consecutive nucleobases.

[0280] Embodiment 194. The oligomeric compound according to any of embodiments 191 to 193, wherein said APP RNA has the nucleobase sequence of any of SEQ ID NOs: 1 to 7.

[0281] Embodiment 195. The oligomeric compound according to any of embodiments 191 to 194, wherein at least one nucleoside of the antisense RNAi oligonucleotide comprises a modified sugar moiety selected from 2'-F, 2'-OMe, 2'-NMA, LNA, and cEt, or a sugar surrogate selected from GNA and UNA.

[0282] Embodiment 196. The oligomeric compound according to any of embodiments 191 to 195, wherein each nucleoside of the antisense RNAi oligonucleotide comprises a modified sugar moiety or sugar surrogate.

[0283] Embodiment 197. The oligomeric compound according to any of embodiments 191 to 196, wherein at least 80%, at least 90%, or 100% of the nucleosides of the antisense RNAi oligonucleotide comprise a modified sugar moiety selected from 2'-F and 2'-OMe.

[0284] Embodiment 198. The oligomeric compound according to any of embodiments 191 to 197, comprising a stabilized phosphate group attached to the 5' position of the 5'-most nucleoside of said antisense RNAi oligonucleotide.

[0285] Embodiment 199. The oligomeric compound according to embodiment 198, wherein the stabilized phosphate group comprises cyclopropylphosphonate or (E)-vinylphosphonate.

[0286] Embodiment 200. The oligomeric compound of any of embodiments 158 to 199, wherein said oligomeric compound is a single-stranded oligomeric compound.

[0287] Embodiment 201. An oligomeric compound according to any of embodiments 158 to 200, consisting of said modified oligonucleotide or said RNAi antisense oligonucleotide.

[0288] Embodiment 202. The oligomeric compound according to any of embodiments 158 to 200, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

[0289] Embodiment 203. The oligomeric compound according to embodiment 202, wherein the conjugated linker consists of a single bond.

[0290] Embodiment 204. The oligomeric compound according to embodiment 202, wherein the conjugated linker is cleavable.

[0291] Embodiment 205. The oligomeric compound according to embodiment 202, wherein the conjugated linker comprises 1 to 3 linker-nucleosides.

[0292] Embodiment 206. The oligomeric compound according to any of embodiments 202 to 205, wherein the conjugate group is attached to the 5' end of the modified oligonucleotide or the antisense RNAi oligonucleotide.

[0293] Embodiment 207. The conjugate group is a compound selected from the group consisting of the modified oligonucleotide and the antisense RNAi. The oligomeric compound according to any of embodiments 202 to 205, which is attached to the 3' end of an oligonucleotide.

[0294] Embodiment 208. The oligomeric compound according to any one of embodiments 158-200 or 202-206, comprising a terminal group.

[0295] Embodiment 209. The oligomeric compound of any of embodiments 158-204 or 206-208, wherein the oligomeric compound does not comprise a linker-nucleoside.

[0296] Embodiment 210. An oligomeric duplex comprising a first oligomeric compound comprising an antisense RNAi oligonucleotide of any of embodiments 188 to 209, and a second oligomeric compound comprising a sense RNAi oligonucleotide consisting of 17 to 30 linked nucleosides, wherein the nucleobase sequence of the sense RNAi oligonucleotide comprises an antisense hybridizing region comprising at least 15 consecutive nucleobases, and the antisense hybridizing region is at least 90% complementary to an equal length portion of the antisense RNAi oligonucleotide.

[0297] Embodiment 211 The oligomeric duplex of embodiment 210, wherein said sense RNAi oligonucleotide consists of 18 to 25, 20 to 25, or 21 to 23 linked nucleosides.

[0298] Embodiment 212 The oligomeric duplex of embodiment 211, wherein said sense RNAi oligonucleotide consists of 21 or 23 linked nucleosides.

[0299] Embodiment 213 The oligomeric duplex of any of embodiments 210-212, wherein from one to four of the 3'-most nucleosides of said antisense or said sense RNAi oligonucleotide are overhanging nucleosides.

[0300] Embodiment 214. The oligomeric duplex of any of embodiments 210-213, wherein the 1 to 4 5'-most nucleosides of said antisense or sense RNAi oligonucleotide are overhanging nucleosides.

[0301] Embodiment 215 The oligomeric duplex of any of embodiments 210 to 214, wherein said duplex has a blunt end at the 3' end of said antisense RNAi oligonucleotide.

[0302] Embodiment 216 The oligomeric duplex of any of embodiments 210 to 214, wherein said duplex has a blunt end at the 5' end of said antisense RNAi oligonucleotide.

[0303] Embodiment 217. The oligomeric duplex of any of embodiments 210 to 216, wherein at least one nucleoside of the sense RNAi oligonucleotide comprises a modified sugar moiety selected from 2'-F, 2'-OMe, LNA, cEt, or a sugar surrogate selected from GNA and UNA.

[0304] Embodiment 218 The oligomeric duplex of embodiment 217, wherein each nucleoside of said sense RNAi oligonucleotide comprises a modified sugar moiety or sugar surrogate.

[0305] Embodiment 219. The oligomeric duplex of embodiment 218, wherein at least 80%, at least 90%, or 100% of the nucleosides of said sense RNAi oligonucleotide comprise a modified sugar moiety selected from 2'-F and 2'-OMe.

[0306] Embodiment 220 The oligomeric duplex of any of embodiments 210 to 219, wherein at least one nucleoside of said sense RNAi oligonucleotide comprises a modified nucleobase.

[0307] Embodiment 221 The oligomeric duplex of any of embodiments 210 to 220, wherein at least one internucleoside linkage of said sense RNAi oligonucleotide is a modified internucleoside linkage.

[0308] Embodiment 222 The oligomeric duplex of embodiment 221, wherein at least one internucleoside linkage of said sense RNAi oligonucleotide is a phosphorothioate internucleoside linkage.

[0309] Embodiment 223. The oligomeric duplex of any of embodiments 210-222, wherein said compound comprises 1-5 abasic sugar moieties attached to one or both ends of said antisense or sense RNA oligonucleotide.

[0310] Embodiment 224. The oligomeric duplex of any of embodiments 210 to 223, consisting of said antisense RNAi oligonucleotide and said sense RNAi oligonucleotide.

[0311] Embodiment 225. The oligomeric duplex of embodiment 210, wherein said second oligomeric compound comprises a conjugate group comprising a conjugate moiety and a conjugate linker.

[0312] Embodiment 226. The oligomeric duplex of embodiment 225, wherein the conjugated linker consists of a single bond.

[0313] Embodiment 227. The oligomeric duplex of embodiment 225, wherein the conjugated linker is cleavable.

[0314] Embodiment 228. The oligomeric duplex of embodiment 225, wherein the conjugated linker comprises 1 to 3 linker-nucleosides.

[0315] Embodiment 229. The oligomeric duplex of any of embodiments 225 to 228, wherein the conjugate group is attached to the 5' end of the sense RNAi oligonucleotide.

[0316] Embodiment 230. The oligomeric compound according to any of embodiments 225 to 225, wherein the conjugate group is attached to the 3' end of the sense RNAi oligonucleotide.

[0317] Embodiment 231. The oligomeric compound according to any of embodiments 225 to 225, wherein the conjugate group is attached via the 2' position of a ribosyl sugar moiety at an internal position within the sense RNAi oligonucleotide.

[0318] Embodiment 232. At least one conjugated group is C 16The oligomeric compound according to any one of embodiments 202-207 or the oligomeric duplex according to any one of embodiments 225-231, comprising an alkyl group.

[0319] Embodiment 233 The oligomeric duplex of embodiment 210, wherein said second oligomeric compound comprises a terminal group.

[0320] Embodiment 234. An oligomeric compound according to any one of embodiments 158 to 209 or A pharmaceutical composition comprising an oligomeric duplex according to any one of embodiments 210 to 233 and a pharma- ceutically acceptable carrier or diluent.

[0321] Embodiment 235. The pharmaceutical composition of embodiment 234, wherein the pharma- ceutically acceptable diluent is artificial cerebrospinal fluid, sterile saline, or PBS.

[0322] Embodiment 236. The pharmaceutical composition of embodiment 234, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and sterile saline.

[0323] Embodiment 237. A method comprising administering to an animal a pharmaceutical composition according to any one of embodiments 234 to 236.

[0324] Embodiment 238. A method for treating an APP-associated disease, comprising administering to an individual suffering from or at risk of developing an APP-associated disease a therapeutically effective amount of a pharmaceutical composition described in any of embodiments 234 to 236, thereby treating the APP-associated disease.

[0325] Embodiment 239. The method of embodiment 238, wherein the APP-related disease is Alzheimer's disease, Alzheimer's disease in patients with Down's syndrome, or cerebral amyloid angiopathy.

[0326] Embodiment 240. The method of any of embodiments 238-239, wherein at least one symptom or characteristic of the APP-related disease is ameliorated.

[0327] Embodiment 241. The method of embodiment 240, wherein the symptom or characteristic is cognitive impairment, including decline in memory and language abilities, behavioral and psychological symptoms such as apathy and lack of motivation, gait disturbances and seizures, progressive dementia, and / or abnormal amyloid deposition.

[0328] I. Specific Oligonucleotides In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides consisting of linked nucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. The modified oligonucleotides comprise at least one modification compared to unmodified RNA or DNA. That is, the modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside bond. In certain embodiments, provided herein are RNAi compounds comprising antisense RNAi oligonucleotides complementary to APP, and optionally sense RNAi oligonucleotides complementary to the antisense RNAi oligonucleotides. The antisense RNAi oligonucleotides and sense RNAi oligonucleotides typically comprise at least one modified nucleoside and / or at least one modified internucleoside bond. Particular modified nucleosides and modified internucleoside bonds suitable for use in modified oligonucleotides are as described below.

[0329] A. Certain Modified Nucleosides Modified nucleosides include modified sugar moieties or modified nucleobases, or both modified sugar moieties and modified nucleobases. In certain embodiments, modified nucleosides containing the following modified sugar moieties and / or the following modified nucleobases may be incorporated into antisense and / or sense RNAi oligonucleotides.

[0330] 1. Specific sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates can contain one or more substitutions that correspond to those of other types of modified sugar moieties.

[0331] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position of the furanosyl, including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents of the non-bicyclic modified sugar moiety are branched. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C2, CN, CF3, O-C3, CF3, O-C1-C2 ... 10 Alkoxy, O-C1~C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1~C 10 Substituted alkyl, S-alkyl, N(R m )-Alkyl, O-Alkenyl, S-Alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ) or OCH2C(=O)-N(R m )(R n ), wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10Alkyl, -O(CH2)2ON(CH3)2 ("DMAOE"), 2'-OCHOCH2N(CH2)2 ("DMAEOE"), and 2'-substituents described in Cook et al., US 6,531,584; Cook et al., US 5,859,221, and Cook et al., US 6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from among hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 3' position. Examples of suitable substituents at the 3' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl). In certain embodiments, the non-bicyclic modified sugar moiety comprises a substituent at the 4' position. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, ethyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties include two or more non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, as well as modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0332] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(Rm )(R n )) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 It is an alkyl.

[0333] In certain embodiments, the 2'-substituted nucleoside non-bicyclic modified nucleoside is selected from the group consisting of F, OCF, OCH, OCHCHOCH, O(CH)SCH, O(CH)O and a sugar moiety containing a non-bridging 2'-substituent selected from N(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 ("DMAOE"), OCH2OCH2N(CH2)2 ("DMAEOE"), and OCH2C(=O)-N(H)CH3 ("NMA").

[0334] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2' substituent selected from F, OCH3, and OCH2CH2OCH3.

[0335] In naturally occurring nucleic acids, sugars are linked to each other at 3' and 5'.In certain embodiments, oligonucleotides contain one or more nucleosides or sugar moieties linked at alternative positions, such as 2' or linked back from 5' to 3'.For example, when linkage is at 2' position, 2'-substituent can be at 3' position instead.

[0336] Certain modified sugar moieties include a substituent that bridges two atoms of the furanosyl ring to form a second ring resulting in a bicyclic sugar moiety. Nucleosides that include such bicyclic sugar moieties are referred to as bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRNs). Certain such compounds are described in U.S. Patent Publication No. 2013 / 0190383 and PCT Publication No. WO2013 / 036868. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring. Such 4' to 2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt" when in the S configuration), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (e.g., Seth et al., US 7,399,845, Bhat et al., US 7,569,686, Swayze et al., US 7,571,821, and others). al., US 7,741,457, and Swayze et al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US 8,278,283). al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345 and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., US 8,278,426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', where each R, R a , and R b are independently H, a protecting group, or C1-C 12 Alkyl (e.g., Imanishi et al., US 7,427,672).

[0337] In certain embodiments, such 4' and 2' bridges comprise from 1 to 4 linking groups independently selected from -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]nO-, C(Ra)=C(Rb)-, C(Ra)=N-, C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and N(Ra)-; During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; Each Ra and Rb is independently H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl , CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and each J1 and J2 is independently H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.

[0338] Freier et al., Nucleic Acids Research,1997,25(22),4429-4443,Albaek et al.,J.Org.Chem.,2006,71,7731-7740,Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Wahlestedt et al.,Proc.Natl.Acad.Sci.USA,2000,97,5633-5638;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,219-222; al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al.,J.Am.Chem.Soc.,2007,129,8362-8379;Elayadi et al.,Curr.Opinion Invens.Drugs,2001,258-51;Braasch et al.; al.,Chem.Biol.,2001,8,1-7;Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243;Wengel et al.,US7,053,207,Imanishi et al.,US6,268,490,Imanishi et al al.US6,770,748,Imanishi et al.,USRE44,779;Wengel et al.,US6,794,499,Wengel et al.,US6,670,461;Wengel et al.,US7,034,133,Wengel et al.,US8,080,644;Wengel et al. al.,US8,034,909;Wengel et al.,US8,153,365;Wengel et al.,US7,572,582;and Ramasamy et al.,US6,525,191,Torsten et al.,WO 2004 / 106356,Wengel et al.,WO 1999 / 014226;Seth et al.,WO 2007 / 134181;Seth et See, e.g., US7,547,684; Seth et al., US7,666,854; Seth et al., US8,088,746; Seth et al., US7,750,131; Seth et al., US8,030,467; Seth et al., US8,268,980; Seth et al., US8,546,556; Seth et al., US8,530,640; Migawa et al., US9,012,421; Seth et al., US8,501,805; Allerson et al., US2008 / 0039618; and Migawa et al., US2015 / 0191727. In certain embodiments, the bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA Nucleosides (as described herein) may be in the α-L or β-D configuration.

[0339] [ka]

[0340] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have demonstrated antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase the stability of siRNAs in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mal Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. Where positions of particular bicyclic nucleosides (eg, LNA or cEt) are specified in exemplary embodiments herein, they are in the β-D configuration unless otherwise specified.

[0341] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, a 5'-substituent and a 4'-2' bridging sugar).

[0342] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and substitutions at the 2' position (see, e.g., Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or 5' position.

[0343] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA:

[0344] [ka]

[0345] ("F-HNA", see, e.g., Swayze et al., US8,088,904; Swayze et al., US8,440,803; Swayze et al., US8,796,437; and Swayze et al., US9,005,906; F-HNA can also be referred to as F-THP or 3'-fluorotetrahydropyran), and nucleosides that include additional modified THP compounds having the formula:

[0346] [ka]

[0347] wherein, for each of the modified THP nucleosides above, independently Bx is a nucleobase moiety, T3 and T4 are each independently an internucleoside linking group linking a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group linking a modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linking conjugate group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[0348] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, and in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0349] In certain embodiments, the sugar surrogate comprises a ring having more than 5 atoms and 2 or more heteroatoms. For example, nucleosides containing morpholino sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US5,698,685; Summerton et al., US5,166,315; Summerton et al., US5,185,444; and Summerton et al., US5,034,506). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure:

[0350] [ka]

[0351] In certain embodiments, morpholinos may be modified from the morpholino structure above, for example, by adding or modifying various substituents. Such sugar surrogates are referred to herein as "modified morpholinos."

[0352] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that contain such acyclic sugar surrogates include peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and Manoharan et al. al., WO2011 / 133876. In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that include such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, for example, Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., US2013 / 130378. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262. Additional PNA compounds suitable for use in the RNAi oligonucleotides of the present invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0353] In certain embodiments, the sugar surrogate is an "unlocked" sugar structure of a UNA (unlocked nucleic acid) nucleoside. A UNA is an unlocked acyclic nucleic acid in which any of the sugar linkages have been removed to form an unlocked sugar surrogate. Representative U.S. publications that teach the preparation of UNAs include, but are not limited to, U.S. Patent No. 8,314,227, and U.S. Patent Publication Nos. 2013 / 0096289, 2013 / 0011922, and 2011 / 0313020, the entire contents of which are incorporated herein by reference. INCORPORATED INTO THE SPECIFICATION.

[0354] In certain embodiments, the sugar surrogate is glycerol, as found in GNA (glycol nucleic acid) nucleosides, as shown below; (S)-GNA

[0355] [ka]

[0356] In the formula, Bx represents any nucleic acid base.

[0357] Many other bicyclic and tricyclic sugars and sugar surrogates are known in the art and can be used in the modified nucleosides.

[0358] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotides comprise one or more nucleosides that comprise unmodified nucleobases.In certain embodiments, modified oligonucleotides comprise one or more nucleosides that comprise modified nucleobases.In certain embodiments, modified oligonucleotides comprise one or more nucleosides that do not comprise nucleobases, referred to as abasic nucleosides.In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides that comprise hypoxanthine nucleobases).

[0359] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, the modified nucleobase is selected from 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyuracil ... and 5-N-benzoyl uracil, 8-aza and other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases can also include those in which the purine or pyrimidine base is replaced by other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., US 3,687,808; The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0360] Publications teaching the preparation of some of the above and other modified nucleobases include Manohara et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al., US5,459,255, Froehler et al. al.,US5,484,908, Matteucci et al.,US5,502,177, Hawkins et al.,US5,525,711, Haralambidis et al.,US5,552,540, Cook et al.,US5,587,469, Froehler et al.,US5,594,121, Switzer et al. al.,US5,596,091, Cook et al.,US5,614,617, Froehler et al.,US5,645,985, Cook et al.,US5,681,941, Cook et al.,US5,811,534, Cook et al.,US5,750,692, Cook et al. al., US5,948,903, Cook et al., US5,587,470, Cook et al., US5,457,191, Matteucci et al., US5,763,588; Froehler et al., US5,830,653; Cook et al., US5,808,027; Cook et al., US6,166,199; and Matteucci et al., US6,005,096.

[0361] 3. Specific modified internucleoside linkages The naturally occurring internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. In certain embodiments, the nucleosides of a modified oligonucleotide may be linked together using one or more modified internucleoside linkages. Two major classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphates (also referred to as unmodified or naturally occurring linkages) containing a phosphodiester bond ("P=O"); These include photoriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P=S"), and phosphorodithioates ("HS-P=S"). Representative non-phosphate-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiesters, thionocarbamates (-OC(=O)(NH)-S-), siloxanes (-O-SiH2-O-), and N,N'-dimethylhydrazines (-CH2-N(CH3)-N(CH3)-). Compared to natural phosphate linkages, modified internucleoside linkages can be used to alter (usually increase) the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages with chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those of skill in the art.

[0362] Representative internucleoside linkages with chiral centers include, but are not limited to, alkyl phosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages and as a population of modified oligonucleotides containing phosphorothioate linkages with specific stereochemical configurations. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and each phosphorothioate internucleoside linkage is stereorandom. Such modified oligonucleotides can be made using synthetic methods in which the stereochemical configuration of each phosphorothioate linkage is randomly selected. Nevertheless, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, the specific phosphorothioate bond of a particular configuration is present in at least 65% of the molecules in the population. In certain embodiments, the specific phosphorothioate bond of a particular configuration is present in at least 70% of the molecules in the population. In certain embodiments, the specific phosphorothioate bond of a particular configuration is present in at least 80% of the molecules in the population. In certain embodiments, the specific phosphorothioate bond of a particular configuration is present in at least 90% of the molecules in the population. In certain embodiments, the specific phosphorothioate bond of a particular configuration is present in at least 99% of the molecules in the population. Such chiral enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, such as those described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO2017 / 015555.In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides having at least one designated phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising (Rp) phosphorothioates and / or (Sp) phosphorothioates each comprise one or more of the following formulae:

[0363] [ka]

[0364] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or of a specific stereochemical configuration.

[0365] Neutral internucleoside linkages include, without limitation, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylates, carboxamides, sulfides, sulfonates, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages containing a mixture of N, O, S, and CH2 moieties.

[0366] In certain embodiments, modified oligonucleotides (such as antisense RNAi oligonucleotides and / or sense RNAi oligonucleotides) contain one or more inverted nucleosides, as shown below:

[0367] [ka]

[0368] In the formula, each Bx independently represents any nucleobase.

[0369] In certain embodiments, the inverted nucleoside is terminal (i.e., the last nucleoside at one end of an oligonucleotide) and therefore only one internucleoside linkage as shown above is present. In certain such embodiments, additional features (such as conjugate groups) may be attached to the inverted nucleoside. Such terminal inverted nucleosides may be attached to one or both ends of an oligonucleotide.

[0370] In certain embodiments, such groups lack a nucleobase and are referred to herein as inverted sugar moieties. In certain embodiments, the inverted sugar moiety is terminal (i.e., attached to the last nucleoside at one end of the oligonucleotide), and thus, only one such internucleoside linkage is present. In certain such embodiments, additional features (such as conjugated groups) may be attached to the inverted sugar moiety. Such terminal inverted sugar moieties may be attached to one or both ends of the oligonucleotide.

[0371] In certain embodiments, the nucleic acids may be 2' to 5' linked rather than the standard 3' to 5' linkage. Such linkages are shown below.

[0372] [ka]

[0373] In the formula, each Bx represents any nucleobase.

[0374] B. Specific motifs In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified sugar moieties. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified nucleobases. In certain embodiments, modified oligonucleotides include one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of each other. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif refers to modifications to nucleobases that are not related to the sequence of the nucleobases).

[0375] 1. Specific glyco-motifs In certain embodiments, an oligonucleotide comprises one or more modified sugar and / or unmodified sugar moieties arranged along the oligonucleotide or a region thereof in a defined pattern or sugar motif, in certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0376] Uniformly modified oligonucleotides In certain embodiments, the modified oligonucleotide comprises or consists of a region with a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified region of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises or consists of a region with a fully modified sugar motif, where each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, the fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of the uniformly modified nucleotide comprises the same 2' modification.

[0377] Gapmer Oligonucleotides In certain embodiments, the modified oligonucleotide comprises two external regions, i.e., A gapmer motif comprises or consists of a region having a gapmer motif, defined by a 5' wing, a gap, and a central or internal region, or "gap". The three regions of a gapmer motif (the 5' wing, the gap, and the 3' wing) form a contiguous sequence of nucleosides, with at least some of the sugar moieties of the nucleosides of each wing being different from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) are different from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are identical to one another. In certain embodiments, the gap comprises one or more nucleosides having sugar moieties that are different from the sugar moieties of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmers).

[0378] In certain embodiments, the wings of a gapmer comprise between 1 and 6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprise a modified sugar moiety.

[0379] In certain embodiments, the gapmer gap comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety.

[0380] In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, a nucleoside on the gap side of each wing / gap junction comprises a 2'-deoxyribosyl sugar moiety, and a nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In certain embodiments, each nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a 2'-OMe sugar moiety.

[0381] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [number of nucleosides in the 5'-wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3'-wing]. Thus, a 3-10-3 gapmer consists of three linked nucleosides in each wing and 10 linked nucleosides in the gap. When such terms are accompanied by a specific modification, the modification is of each sugar moiety of each wing, with the gap nucleosides including a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of five linked 2'-MOE nucleosides in the 5'-wing, 10 linked 2'-β-D-deoxynucleosides in the gap, and five linked 2'-MOE nucleosides in the 3'-wing. A 3-10-3 cEt gapmer consists of three linked cEt nucleosides in the 5' wing, ten linked 2'-β-D-deoxynucleosides in the gap, and three linked cEt nucleosides in the 3' wing. A 5-8-5 gapmer consists of five linked nucleosides with modified sugar moieties in the 5' wing and eight linked 2'-β-D-deoxynucleosides in the gap. A 5-8-5 mixed gapmer is comprised of five linked nucleosides that contain a modified sugar moiety in the 5'- and / or 3'-wing.

[0382] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 BNA gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 LNA gapmer.

[0383] In certain embodiments, the modified oligonucleotide is a 5-8-5 mixed gapmer consisting of five linked 2'-MOE nucleosides in the 5' wing, eight linked 2'-β-D-deoxynucleosides in the gap, and a mixture of cEt and 2'-MOE nucleosides in the 3' wing. In certain embodiments, the modified nucleosides have a sugar motif of eeeeeddddddddkkeee, where each "e" represents a nucleoside that includes a 2'-MOE modified sugar moiety, each "d" represents a nucleoside that includes a 2'-β-D-deoxyribosyl sugar moiety, and each "k" represents a nucleoside that includes a cEt modified sugar moiety. In certain embodiments, the modified nucleoside has a sugar motif of eeeeeddddddddkeeee, where each "e" represents a nucleoside that includes a 2'-MOE modified sugar moiety, each "d" represents a nucleoside that includes a 2'-β-D-deoxyribosyl sugar moiety, and each "k" represents a nucleoside that includes a cEt modified sugar moiety.

[0384] Antisense RNAi Oligonucleotides In certain embodiments, the sugar moiety of at least one nucleoside of the antisense RNAi oligonucleotide is a modified sugar moiety.

[0385] In certain such embodiments, at least one nucleoside comprises a 2'-OMe modified sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least five nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least eight nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least ten nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least twelve nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least fourteen nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least fifteen nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least seventeen nucleosides comprise a 2'-OMe modified sugar moiety. In certain such embodiments, at least 18 nucleosides comprise a 2'-OMe modified sugar moiety. In certain such embodiments, at least 20 nucleosides comprise a 2'-OMe modified sugar moiety. In certain such embodiments, at least 21 nucleosides comprise a 2'-OMe modified sugar moiety.

[0386] In certain embodiments, at least one nucleoside comprises a 2'-F modified sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, at least three nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, at least four nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, one but not more than one nucleoside comprises a 2'-F modified sugar. In certain embodiments, one or two nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, one to three nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, at least one to four nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, the antisense RNAi oligonucleotide comprises two to four contiguous 2'-F modified nucleosides. In certain embodiments, the 4 nucleosides of the antisense RNAi oligonucleotide are 2'-F modified nucleosides, and 3 of these 2'-F modified nucleosides are consecutive.In certain such embodiments, the remaining nucleosides are 2'OMe modified.

[0387] Sense RNAi oligonucleotides In certain embodiments, the sugar moiety of at least one nucleoside of the sense RNAi oligonucleotide is a modified sugar moiety.

[0388] In certain such embodiments, at least one nucleoside comprises a 2'-OMe modified sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least five nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least eight nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least ten nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least twelve nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least fourteen nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least fifteen nucleosides comprise a 2'-OMe modified sugar moiety. In certain embodiments, at least seventeen nucleosides comprise a 2'-OMe modified sugar moiety. In certain such embodiments, at least 18 nucleosides comprise a 2'-OMe modified sugar moiety. In certain such embodiments, at least 20 nucleosides comprise a 2'-OMe modified sugar moiety. In certain such embodiments, at least 21 nucleosides comprise a 2'-OMe modified sugar moiety.

[0389] In certain embodiments, at least one nucleoside comprises a 2'-F modified sugar moiety. In certain embodiments, at least two nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, at least three nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, at least four nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, one but not more than one nucleoside comprises a 2'-F modified sugar moiety. In certain embodiments, one or two nucleosides comprise a 2'-F modified sugar. In certain embodiments, one to three nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, at least one to four nucleosides comprise a 2'-F modified sugar moiety. In certain embodiments, the sense RNAi oligonucleotide has a block of two to four contiguous 2'-F modified nucleosides. In certain embodiments, four nucleosides of the sense RNAi oligonucleotide are 2'-F modified nucleosides, and three of these 2'-F modified nucleosides are consecutive. In certain such embodiments, the remainder of the nucleosides are 2'OMe modified.

[0390] 2. Specific nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases of the modified oligonucleotide are 5-methylcytosines. In certain embodiments, all cytosine nucleobases are 5-methylcytosines and all other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0391] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleotides of the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleotides of the 5' end of the oligonucleotide.

[0392] Gapmer Oligonucleotides In certain embodiments, the oligonucleotide having a gapmer motif comprises a nucleoside that comprises a modified nucleobase. In certain such embodiments, one nucleoside that comprises a modified nucleobase is in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0393] Antisense RNAi Oligonucleotides In certain embodiments, one nucleoside of the antisense RNAi oligonucleotide is UNA. In certain embodiments, one nucleoside of the antisense RNAi oligonucleotide is GNA. In certain embodiments, 1 to 4 nucleosides of the antisense RNAi oligonucleotide are DNA. In certain such embodiments, the 1 to 4 DNA nucleosides are at one or both ends of the antisense RNAi oligonucleotide.

[0394] Sense RNAi oligonucleotides In certain embodiments, one nucleoside of the sense RNAi oligonucleotide is UNA.

[0395] In certain embodiments, one nucleoside of the sense RNAi oligonucleotide is GNA.

[0396] In certain embodiments, 1 to 4 nucleosides of the sense RNAi oligonucleotide are DNA. In certain such embodiments, the 1 to 4 DNA nucleosides are at one or both ends of the sense RNAi oligonucleotide.

[0397] 3. Specific internucleoside linkage motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or a region thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate (Sp) phosphorothioate, and (Rp) phosphorothioate.

[0398] Gapmer Oligonucleotides In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer and all of the internucleoside linkages within the gap are modified. Some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all phosphorothioate linkages are stereorandom. In certain embodiments, all phosphorothioate linkages in the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that comprise such internucleoside linkage motifs.

[0399] In certain embodiments, the modified nucleotide has an internucleoside linkage motif of sosossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphate internucleoside linkage. In certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooossssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphate internucleoside linkage. In certain embodiments, the modified nucleotide has an internucleoside linkage motif of sooosssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphate internucleoside linkage.

[0400] Antisense RNAi Oligonucleotides In certain embodiments, at least one bond of antisense RNAi oligonucleotide is a modified bond. In certain embodiments, the 5'-most bond (i.e., the first nucleoside from the 5'-end is linked to the second nucleoside from the 5'-end) is modified. In certain embodiments, the two 5'-most bonds are modified. In certain embodiments, the first one or two bonds from the 3'-end are modified. In certain such embodiments, the modified bond is a phosphorothioate bond. In certain embodiments, the remaining bonds are all unmodified phosphodiester bonds.

[0401] In certain embodiments, at least one bond of the antisense RNAi oligonucleotide is an inverted bond.

[0402] Sense RNAi oligonucleotides In certain embodiments, at least one bond of the sense RNAi oligonucleotide is a modified bond. In certain embodiments, the 5'-most bond (i.e., the first nucleoside from the 5'-end is linked to the second nucleoside from the 5'-end) is modified. In certain embodiments, the two 5'-most bonds are modified. In certain embodiments, the first one or two bonds from the 3'-end are modified. In certain such embodiments, the modified bond is a phosphorothioate bond. In certain embodiments, the remaining bonds are all unmodified phosphodiester bonds.

[0403] In certain embodiments, at least one bond of the sense RNAi oligonucleotide is an inverted bond.

[0404] C. Specific length It is possible to increase or decrease the length of an oligonucleotide without losing activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested a series of oligonucleotides ranging from 13 to 25 nucleobases in length for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases long with 8 or 11 mismatched bases near the ends of the oligonucleotide were able to direct specific cleavage of the target RNA, although not as well as oligonucleotides with no mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with one or three mismatches.

[0405] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of length ranges. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, with X≦Y. For example, in certain embodiments, the oligonucleotides may be 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13~17 pieces, 13~18 pieces, 13~19 pieces, 13~20 pieces, 13~21 pieces, 13~22 pieces, 13~23 pieces, 13~24 pieces, 13~25 pieces, 13~26 pieces, 13~27 pieces, 13~28 pieces, 13 ~29 pieces, 13~30 pieces, 14~15 pieces, 14~16 pieces, 14~17 pieces, 14~18 pieces, 14~19 pieces, 14~20 pieces, 14~21 pieces, 14~22 pieces, 14~23 pieces, 14~24 pieces, 14~25 pieces, 14~26 pieces, 14~27 pieces, 14~28 pieces, 14~29 pieces, 14~30 pieces, 15~16 pieces, 15~17 pieces, 15~18 pieces, 15~19 pieces, 15~20 pieces, 15~21 pieces, 15~22 pieces, 15~23 pieces, 15~24 pieces, 15~25 pieces, 15~26 pieces, 15~27 pieces, 15~28 pieces, 15~29 pieces, 15~30 pieces, 16~17 pieces, 16~18 pieces, 16~19 pieces, 16~20 pieces, 16 ~21 pieces, 16~22 pieces, 16~23 pieces, 16~24 pieces, 16~25 pieces, 16~26 pieces, 16~27 pieces, 16~28 pieces, 16~29 pieces, 16~30 pieces, 17~18 pieces, 17~19 pieces, 17~2 0 pieces, 17~21 pieces, 17~22 pieces, 17~23 pieces, 17~24 pieces, 17~25 pieces, 17~26 pieces, 17~27 pieces, 17~28 pieces, 17~29 pieces, 17~30 pieces, 18~19 pieces, 18~20 pieces,18~21 pieces, 18~22 pieces, 18~23 pieces, 18~24 pieces, 18~25 pieces, 18~26 pieces, 18~27 pieces, 18~28 pieces, 18~29 pieces, 18~30 pieces pieces, 19~20 pieces, 19~21 pieces, 19~22 pieces, 19~23 pieces, 19~24 pieces, 19~25 pieces, 19~26 pieces, 19~29 pieces, 19~28 pieces, 19~2 9 pieces, 19~30 pieces, 20~21 pieces, 20~22 pieces, 20~23 pieces, 20~24 pieces, 20~25 pieces, 20~26 pieces, 20~27 pieces, 20~28 pieces, 20 ~29 pieces, 20~30 pieces, 21~22 pieces, 21~23 pieces, 21~24 pieces, 21~25 pieces, 21~26 pieces, 21~27 pieces, 21~28 pieces, 21~29 pieces, 2 1~30 pieces, 22~23 pieces, 22~24 pieces, 22~25 pieces, 22~26 pieces, 22~27 pieces, 22~28 pieces, 22~29 pieces, 22~30 pieces, 23~24 pieces , 23~25 pieces, 23~26 pieces, 23~27 pieces, 23~28 pieces, 23~29 pieces, 23~30 pieces, 24~25 pieces, 24~26 pieces, 24~27 pieces, 24~28 , 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.

[0406] Antisense RNAi Oligonucleotides In certain embodiments, the antisense RNAi oligonucleotide consists of 17-30 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 17-25 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 17-25 linked nucleosides. The antisense RNAi oligonucleotide comprises 17-23 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide comprises 17-21 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide comprises 18-30 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide comprises 20-30 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide comprises 21-30 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide comprises 23-30 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide comprises 18-25 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide comprises 20-22 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide comprises 21-23 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide comprises 23-24 linked nucleosides. In certain embodiments, the antisense RNAi oligonucleotide consists of 20 linked nucleosides.In certain embodiments, the antisense RNAi oligonucleotide consists of 21 linked nucleosides.In certain embodiments, the antisense RNAi oligonucleotide consists of 22 linked nucleosides.In certain embodiments, the antisense RNAi oligonucleotide consists of 23 linked nucleosides.

[0407] Sense RNAi oligonucleotides In certain embodiments, the sense RNAi oligonucleotide comprises 17-30 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide comprises 17-25 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide comprises 17-23 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide comprises 17-21 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide comprises 18-30 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide comprises 20-30 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide comprises 21-30 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide comprises 23-30 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide comprises 18-25 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide comprises 20-22 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 21-23 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 23-24 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 20 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 21 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 22 linked nucleosides. In certain embodiments, the sense RNAi oligonucleotide consists of 23 linked nucleosides.

[0408] D. Certain Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, each such parameter is independent of the other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages in the wing regions of a sugar gapmer may be identical or different from each other, and may be identical or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases, regardless of the gapmer pattern of sugar modification. Unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages in the wing regions of a sugar gapmer may be identical or different from each other, and may be identical or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases, regardless of the gapmer pattern of sugar modification. Except where indicated, all modifications are independent of the nucleobase sequence.

[0409] E. Specific Populations of Modified Oligonucleotides A population of modified oligonucleotides, where all of the modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chiral enriched population. All of the chiral centers of the modified oligonucleotides are stereorandom in the stereorandom population. In a chiral enriched population, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of the chiral enriched population are enriched in β-D ribosyl sugar moieties and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of the chiral enriched population are enriched in both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkages in a specific stereochemical configuration.

[0410] F. Nucleic acid sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequences. In certain embodiments, oligonucleotides have nucleobase sequences that are complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain such embodiments, a region of an oligonucleotide has a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain embodiments, a region or full length of an oligonucleotide has a nucleobase sequence that is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a nucleic acid, such as a second oligonucleotide or a target nucleic acid.

[0411] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds consisting of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. A conjugate group may be attached to one or both termini of the oligonucleotide and / or at any internal position. In certain embodiments, a conjugate group is attached to the 2' position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to one or both termini of the oligonucleotide is a terminal group. In certain such embodiments, a conjugate group or terminal group is attached to the 3' and / or 5' termini of the oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 3' terminus of the oligonucleotide. In certain embodiments, a conjugate group is attached near the 3' terminus of the oligonucleotide. In certain embodiments, a conjugate group (or terminal group) is attached near the 5' terminus of the oligonucleotide. In certain embodiments, a conjugate group is attached near the 5' terminus of the oligonucleotide.

[0412] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.

[0413] A. Specific RNAi Compounds The RNAi compound includes an antisense RNAi oligonucleotide and optionally a sense RNAi oligonucleotide. The RNAi compound may also include a terminal group and / or a conjugate group that may be attached to the antisense RNAi oligonucleotide or the sense RNAi oligonucleotide (if present).

[0414] Double strand The RNAi compound comprising antisense RNAi oligonucleotide and sense RNAi oligonucleotide forms a double strand because the sense RNAi oligonucleotide comprises the antisense hybridization region that is complementary to the antisense RNAi oligonucleotide.In certain embodiments, the nucleic acid bases of the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide are complementary to each other.In certain embodiments, the two RNAi oligonucleotides have at least one mismatch relative to each other.

[0415] In certain embodiments, the antisense hybridization region constitutes the entire length of the sense RNAi oligonucleotide and the antisense RNAi oligonucleotide.In certain embodiments, one or both of the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide contain additional nucleosides (overhang nucleosides) at one or both ends that do not hybridize.In certain embodiments, the overhang nucleosides are DNA.In certain embodiments, the overhang nucleosides are linked to each other (if there are more than one) and to the first non-overhang nucleoside with phosphorothioate bond.

[0416] B. Specific conjugated groups In certain embodiments, the oligonucleotide is covalently linked to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the linked oligonucleotide, including, but not limited to, pharmacodynamic properties, pharmacokinetic properties, stability properties, binding properties, absorption properties, tissue distribution properties, cellular distribution properties, cellular uptake properties, charge properties, and clearance properties.

[0417] In certain embodiments, conjugation of one or more carbohydrate moieties to a modified oligonucleotide can optimize one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced with another moiety, e.g., a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. A ribonucleotide subunit in which the ribose sugar of the subunit is so replaced is referred to herein as a modified sugar moiety, ribose-replaced modified subunit (RRMS). The cyclic carrier can be a carbon ring system, i.e., one or more ring atoms can be heteroatoms, e.g., nitrogen, oxygen, sulfur. The cyclic carrier can be a monocyclic ring system or can include two or more rings, e.g., fused rings. The cyclic carrier can be a fully saturated ring system, or it can include one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the modified oligonucleotide is a sense RNAi oligonucleotide.

[0418] In certain embodiments, the conjugate group confers new properties to the bound oligonucleotide, such as a fluorophore or reporter group that allows detection of the oligonucleotide. Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids, 1999, 10, 102-104), and the like. Res., 1992, 20, 533-538), aliphatic chains, such as dodecanediol or undecyl residues (Saison-Behmoaras e t al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids, e.g. dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamines or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantaneacetic acid, a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014 / 179620).

[0419] In certain embodiments, the conjugate group may be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0420] In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0421] 1. Conjugated part Conjugated moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, sugars (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0422] In certain embodiments, the conjugate moiety includes an active ingredient, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazine, chlorothiazide, diazepines, indo-methicin, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial agents, or antibiotics.

[0423] 2. Conjugated Linker The conjugated moiety is linked to the oligonucleotide via a conjugated linker. In certain oligomeric compounds, the conjugated linker is a single bond (i.e., the conjugated moiety is directly linked to the oligonucleotide via a single bond). In certain embodiments, the conjugated linker comprises a chain structure such as a hydrocarbyl chain or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.

[0424] In certain embodiments, the conjugated linker comprises pyrrolidine.

[0425] In certain embodiments, the conjugated linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugated linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugated linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugated linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugated linker comprises at least one phosphorus moiety. In certain embodiments, the conjugated linker comprises at least one phosphate group. In certain embodiments, the conjugated linker comprises at least one neutral linking group.

[0426] In certain embodiments, the conjugate linkers, including those conjugate linkers described above, are bifunctional linking moieties, known in the art to be useful as conjugate groups for binding to compounds, such as oligonucleotides provided herein. In general, bifunctional linking moieties include at least two functional groups. One of the functional groups is selected to bind to a specific site of the compound, and the other is selected to bind to the conjugate group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophilic groups for reacting with nucleophilic groups, and nucleophilic groups for reacting with electrophilic groups. In certain embodiments, the bifunctional linking moieties include one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0427] Examples of conjugated linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugated linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 A non-limiting list of preferred substituents includes, but is not limited to, alkynyl, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0428] In certain embodiments, the conjugated linker comprises 1-10 linker-nucleosides. In certain embodiments, the conjugated linker comprises 2-5 linker-nucleosides. In certain embodiments, the conjugated linker comprises exactly 3 linker-nucleosides. In certain embodiments, the conjugated linker comprises a TCA motif. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments, such linker-nucleosides comprise modified sugar moieties. In certain embodiments, the linker-nucleosides are unmodified. In certain embodiments, the linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is generally desirable for the linker-nucleosides to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker-nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0429] In the present specification, linker-nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising a linker-nucleoside, these linker-nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is 30 or less. Unless otherwise specified, the conjugated linker comprises 10 or less linker-nucleosides. In certain embodiments, the conjugated linker comprises 5 or less linker-nucleosides. In certain embodiments, the conjugated linker comprises 3 or less linker-nucleosides. In certain embodiments, the conjugated linker comprises 2 or less linker-nucleosides. In certain embodiments, the conjugated linker comprises 1 or less linker-nucleoside.

[0430] In certain embodiments, it is desirable for the conjugated group to be cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds containing certain conjugated moieties are better taken up by certain cell types, but it is desirable for the conjugated group to be cleaved to release the unconjugated or parent oligonucleotide once the oligomeric compound is taken up. Thus, certain conjugated linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or five or more cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside the cell or in an intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0431] In certain embodiments, the cleavable bond is selected from among an amide bond, an ester bond, an ether bond, an ester bond of one or both phosphodiesters, a phosphate ester bond, a carbamate bond, or a disulfide bond. In certain embodiments, the cleavable bond is an ester of one or both phosphodiesters. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0432] In certain embodiments, the cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is attached to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently attached to the remainder of the conjugated linker or conjugated moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0433] 3. Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula:

[0434] [ka]

[0435] In the formula, n is 1 to about 3, when n is 1, m is 0, when n is 2 or more, m is 1, j is 1 or 0, and k is 1 or 0.

[0436] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0437] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently attached to the branching group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently attached to the branching group.

[0438] In certain embodiments, each ligand of the cell targeting moiety has affinity for at least one receptor type on the target cell. In certain embodiments, each ligand has affinity for at least one receptor type on the surface of mammalian liver cells. In certain embodiments, each ligand has affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate.

[0439] In certain embodiments, the cell targeting moiety targets neurons. In certain embodiments, the cell targeting moiety targets neurotransmitter receptors. In certain embodiments, the cell targeting moiety targets neurotransmitter transporters. In certain embodiments, the cell targeting moiety targets GABA transporters. See, for example, WO2011 / 131693, WO2014 / 064257.

[0440] C. Specific End Groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the modified oligonucleotide comprises a phosphorus-containing group at the 5'-end of the modified oligonucleotide. In certain embodiments, the phosphorus-containing group is at the 5'-end of the antisense RNAi oligonucleotide and / or the sense RNAi oligonucleotide. In certain embodiments, the terminal group is a phosphate-stabilized phosphate group. The 5'-terminal phosphorus-containing group is a 5'-terminal phosphorus-containing group. The 5'-terminal phosphorus-containing group may be 5'-amino-, ... See, e.g., Prakash et al., Nucleic Acids Res., 43(6):2993-3011, 2015; Elkayam, et al., Nucleic Acids Res., 45(6):3528-3536, 2017; Parmar, et al. ChemBioChem, 17(11)985-989; 2016; Harastzi, et al., Nucleic Acids Res., 45(13):7581-7592, 2017. In certain embodiments, the phosphate stabilizing group is 5'-cyclopropylphosphonate. See, e.g., WO / 2018 / 027106.

[0441] In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides.

[0442] D. Specific RNAi Motifs RNAi compounds can be described by a motif or a specific function.

[0443] In certain embodiments, the RNAi compounds described herein include (a) a sense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) a conjugate attached to the 3' terminus, and (iii) 2'-F modifications at positions 1, 3, 5, 7, 9-11, 13, 17, 19, and 21, and 2'-OMe modifications at positions 2, 4, 6, 8, 12, 14-16, 18, and 20 (counting from the 5' end); And, (b) an antisense RNAi oligonucleotide having: (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3, 5, 9, 11-13, 15, 17, 19, 21, and 23, and 2'F modifications at positions 2, 4, 6-8, 10, 14, 16, 18, 20, and 22 (counting from the 5' end); and (iii) containing phosphorothioate internucleoside linkages between the 21st and 22nd nucleosides and between the 22nd and 23rd nucleosides (counting from the 5' end); The two nucleotides at the 3' end of the antisense RNAi oligonucleotide are overhanging nucleosides, and the ends of the RNAi compound duplex constituting the 5' end of the antisense RNAi oligonucleotide and the 3' end of the sense RNAi oligonucleotide have blunt ends (i.e., neither oligonucleotide has an overhanging nucleoside at its end, and instead the hybridizing region of the sense RNAi oligonucleotide includes the 3'-most nucleoside of the sense RNAi oligonucleotide, which hybridizes to the 5'-most nucleoside of the antisense oligonucleotide).

[0444] In certain embodiments, the RNAi compounds described herein include (a) a sense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) a conjugated portion attached to the 3' end; (iii) 2'-F modifications at positions 1, 3, 5, 7, 9-11, 13, 17, 19, and 21, and 2'-OMe modifications at positions 2, 4, 6, 8, 12, 14, 16, 18, and 20 (counting from the 5' end); and (iv) phosphorothioate internucleoside linkages between the 1- and 2-position nucleosides and between the 2- and 3-position nucleosides (counting from the 5'-end); And, (b) an antisense RNAi oligonucleotide having: (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3, 5, 7, 9, 11-13, 15, 17, 19, and 21-23, and 2'F modifications at positions 2, 4, 6, 8, 10, 14, 16, 18, and 20 (counting from the 5' end); and (iii) containing phosphorothioate internucleoside linkages (counting from the 5' end) between the 1st and 2nd nucleosides, between the 2nd and 3rd nucleosides, between the 21st and 22nd nucleosides, and between the 22nd and 23rd nucleosides; The RNAi duplex comprises a two nucleotide overhang at the 3' end of the antisense RNAi oligonucleotide and a blunt end at the 5' end of the antisense RNAi oligonucleotide.

[0445] In certain embodiments, the RNAi compounds described herein include (a) a sense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) a conjugated portion attached to the 3' end; (iii) 2'-OMe modifications at positions 1 to 6, 8, 10, and 12 to 21, and 2'-F modifications at positions 7 and 9, and a deoxynucleotide at position 11 (counting from the 5' end); and (iv) phosphorothioate internucleoside linkages between the 1- and 2-position nucleosides and between the 2- and 3-position nucleosides (counting from the 5' end); And, (b) an antisense RNAi oligonucleotide having: (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3, 7, 9, 11, 13, 15, 17, and 19-23, and 2'F modifications at positions 2, 4-6, 8, 10, 12, 14, 16, and 18 (counting from the 5' end); and (iii) containing phosphorothioate internucleoside linkages (counting from the 5' end) between the 1st and 2nd nucleosides, between the 2nd and 3rd nucleosides, between the 21st and 22nd nucleosides, and between the 22nd and 23rd nucleosides; The RNAi duplex has a two nucleotide overhang at the 3' end of the antisense RNAi oligonucleotide and a blunt end at the 5' end of the antisense RNAi oligonucleotide.

[0446] In certain embodiments, the RNAi compounds described herein include (a) a sense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) a conjugated portion attached to the 3' end; (iii) 2'-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2'-F modifications at positions 7, and 9 to 11, and (iv) phosphorothioate between nucleosides at positions 1 and 2 and between nucleosides at positions 2 and 3 internucleoside bond (counting from the 5' end), And, (b) an antisense RNAi oligonucleotide having: (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3-5, 7, 8, 10-13, 15, and 17-23, and 2'F modifications at positions 2, 6, 9, 14, and 16 (counting from the 5' end); and (iii) containing phosphorothioate internucleoside linkages (counting from the 5' end) between the 1st and 2nd nucleosides, between the 2nd and 3rd nucleosides, between the 21st and 22nd nucleosides, and between the 22nd and 23rd nucleosides; The RNAi duplex has a two nucleotide overhang at the 3' end of the antisense RNAi oligonucleotide and a blunt end at the 5' end of the antisense RNAi oligonucleotide.

[0447] In certain embodiments, the RNAi compounds described herein include (a) a sense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) a conjugated portion attached to the 3' end; (iii) 2'-OMe modifications at positions 1 to 6, 8, and 12 to 21, and 2'-F modifications at positions 7, and 9 to 11, and (iv) phosphorothioate internucleoside linkages between the 1- and 2-position nucleosides and between the 2- and 3-position nucleosides (counting from the 5' end); And, (b) an antisense RNAi oligonucleotide having: (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3-5, 7, 10-13, 15, and 17-23, and 2'F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5' end); and (iii) containing phosphorothioate internucleoside linkages (counting from the 5' end) between the 1st and 2nd nucleosides, between the 2nd and 3rd nucleosides, between the 21st and 22nd nucleosides, and between the 22nd and 23rd nucleosides; The RNAi duplex has a two nucleotide overhang at the 3' end of the antisense RNAi oligonucleotide and a blunt end at the 5' end of the antisense RNAi oligonucleotide.

[0448] In certain embodiments, the RNAi compounds described herein include (a) a sense RNAi oligonucleotide having: (i) a length of 19 nucleotides; (ii) a conjugated portion attached to the 3' end; (iii) 2'-OMe modifications at positions 1-4, 6, and 10-19, and 2'-F modifications at positions 5, and 7-9, and (iv) phosphorothioate internucleoside linkages between the 1- and 2-position nucleosides and between the 2- and 3-position nucleosides (counting from the 5' end); And, (b) an antisense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) 2'-OMe modifications at positions 1, 3-5, 7, 10-13, 15, and 17-21, and 2'F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5' end); and (iii) between nucleosides at positions 1 and 2, between nucleosides at positions 2 and 3, between nucleosides at positions 19 and 20 phosphorothioate internucleoside linkages between the 20th and 21st nucleosides (counting from the 5' end); The RNAi duplex has a two nucleotide overhang at the 3' end of the antisense RNAi oligonucleotide and a blunt end at the 5' end of the antisense RNAi oligonucleotide.

[0449] In certain embodiments, the RNAi compounds described herein include (a) a sense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) a conjugate attached at position 6 (counting from the 5' end); (iii) 2'-F modifications at positions 7 and 9-11, and 2'-OMe modifications at positions 1-5, 8, and 12-21 (counting from the 5' end); and (iv) phosphorothioate internucleoside linkages between nucleosides at positions 1 and 2, between nucleosides at positions 2 and 3, between nucleosides at positions 19 and 20, and between nucleosides at positions 20 and 21 (counting from the 5' end); And, (b) an antisense RNAi oligonucleotide having: (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3-5, 7, 10-13, 15, and 17-23, and 2'F modifications at positions 2, 6, 8, 9, 14, and 16 (counting from the 5' end); (iii) phosphorothioate internucleoside linkages (counting from the 5' end) between nucleosides at positions 1 and 2, between nucleosides at positions 2 and 3, between nucleosides at positions 21 and 22, and between nucleosides at positions 22 and 23, and (iv) comprises a stabilizing phosphate group attached to the 5' position of the 5'-most nucleoside; The RNAi duplex comprises a two nucleotide overhang at the 3' end of the antisense RNAi oligonucleotide and a blunt end at the 5' end of the antisense RNAi oligonucleotide.

[0450] In certain embodiments, the RNAi compounds described herein include (a) a sense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) a conjugated portion attached to the 3' end; (iii) 2'-F modifications at positions 7 and 9-11, and 2'-OMe modifications at positions 1-6, 8, and 12-21 (counting from the 5' end); (iv) phosphorothioate internucleoside linkages between the 1- and 2-position nucleosides and between the 2- and 3-position nucleosides (counting from the 5' end); And, (b) an antisense RNAi oligonucleotide having: (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3-5, 7-13, 15, and 17-23, an (S)-GNA modification at position 6, and 2'F modifications at positions 2, 14, and 16 (counting from the 5' end); and (iii) containing phosphorothioate internucleoside linkages (counting from the 5' end) between the 1st and 2nd nucleosides, between the 2nd and 3rd nucleosides, between the 21st and 22nd nucleosides, and between the 22nd and 23rd nucleosides; The RNAi duplex comprises a two nucleotide overhang at the 3' end of the antisense RNAi oligonucleotide and a blunt end at the 5' end of the antisense RNAi oligonucleotide.

[0451] In certain embodiments, the RNAi compounds described herein include (a) a sense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) a conjugated portion attached to the 3' end; (iii) 2'-F modifications at positions 7 and 9-11, and 2'-OMe modifications at positions 1-6, 8, and 12-21 (counting from the 5' end); (iv) phosphorothioate internucleoside linkages between the 1- and 2-position nucleosides and between the 2- and 3-position nucleosides (counting from the 5' end); And, (b) an antisense RNAi oligonucleotide having: (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3-6, 8-13, 15, and 17-23, an (S)-GNA modification at position 7, and 2'F modifications at positions 2, 14, and 16 (counting from the 5' end); and (iii) containing phosphorothioate internucleoside linkages (counting from the 5' end) between the 1st and 2nd nucleosides, between the 2nd and 3rd nucleosides, between the 21st and 22nd nucleosides, and between the 22nd and 23rd nucleosides; The RNAi duplex comprises a two nucleotide overhang at the 3' end of the antisense RNAi oligonucleotide and a blunt end at the 5' end of the antisense RNAi oligonucleotide.

[0452] In certain embodiments, the RNAi compounds described herein include (a) a sense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) a conjugate attached at position 6 (counting from the 5' end); and (iii) 2'-F modifications at positions 7 and 9-11, and 2'-OMe modifications at positions 1-5, 8, and 12-21 (counting from the 5' end); (iv) phosphorothioate internucleoside linkages between nucleosides at positions 1 and 2, between nucleosides at positions 2 and 3, between nucleosides at positions 19 and 20, and between nucleosides at positions 20 and 21 (counting from the 5' end); And, (b) an antisense RNAi oligonucleotide having: (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3-5, 7-13, 15, and 17-23, an (S)-GNA modification at position 6, and 2'F modifications at positions 2, 14, and 16 (counting from the 5' end); (iii) phosphorothioate internucleoside linkages (counting from the 5' end) between nucleosides at positions 1 and 2, between nucleosides at positions 2 and 3, between nucleosides at positions 21 and 22, and between nucleosides at positions 22 and 23, and (iv) comprises a stabilizing phosphate group attached to the 5' position of the 5'-most nucleoside; The RNAi duplex comprises a two nucleotide overhang at the 3' end of the antisense RNAi oligonucleotide and a blunt end at the 5' end of the antisense RNAi oligonucleotide.

[0453] In certain embodiments, the RNAi compounds described herein include (a) a sense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) a conjugate attached at position 6 (counting from the 5' end); (iii) 2'-F modifications at positions 7 and 9-11, and 2'-OMe modifications at positions 1-5, 8, and 12-21 (counting from the 5' end); and (iv) between nucleosides at positions 1 and 2, between nucleosides at positions 2 and 3, between nucleosides at positions 19 and 20 phosphorothioate internucleoside linkages between nucleosides and between nucleosides at positions 20 and 21 (counting from the 5' end); And, (b) an antisense RNAi oligonucleotide having: (i) 23 nucleotides in length; (ii) 2'-OMe modifications at positions 1, 3-6, 8-13, 15, and 17-23, an (S)-GNA modification at position 7, and 2'F modifications at positions 2, 14, and 16 (counting from the 5' end); (iii) phosphorothioate internucleoside linkages (counting from the 5' end) between nucleosides at positions 1 and 2, between nucleosides at positions 2 and 3, between nucleosides at positions 21 and 22, and between nucleosides at positions 22 and 23, and (iv) comprises a stabilizing phosphate group attached to the 5' position of the 5'-most nucleoside; The two nucleotides at the 3' end of the antisense RNAi oligonucleotide are overhanging nucleosides, and the ends of the RNAi compound duplex constituting the 5' end of the antisense RNAi oligonucleotide and the 3' end of the sense RNAi oligonucleotide have blunt ends (i.e., neither oligonucleotide has an overhanging nucleoside at its end, and instead the hybridizing region of the sense RNAi oligonucleotide includes the 3'-most nucleoside of the sense RNAi oligonucleotide, which hybridizes to the 5'-most nucleoside of the antisense oligonucleotide).

[0454] In certain embodiments, the RNAi compounds described herein include (a) a sense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) a conjugated portion attached to the 5' end; (iii) 2'-OMe modifications at positions 1 to 8, and 12 to 21, and 2'-F modifications at positions 9 to 11, and (iv) an inverted abasic sugar moiety linked to both the 5'-most nucleoside and the 3'-most nucleoside; And, (b) an antisense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) 2'-OMe modifications at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21, and 2'F modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5' end); and (iii) containing phosphorothioate internucleoside linkages (counting from the 5' end) between nucleosides at positions 1 and 2, between nucleosides at positions 2 and 3, between nucleosides at positions 3 and 4, and between nucleosides at positions 20 and 21.

[0455] In certain embodiments, the RNAi compounds described herein include (a) a sense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) a conjugated portion attached to the 5' end; (iii) 2'-OMe modifications at positions 1 to 8 and 12 to 21, and 2'-F modifications at positions 9 to 11; (iv) a phosphorothioate internucleoside linkage between the 1- and 2-position nucleosides (counting from the 5' end), and (v) an inverted abasic sugar moiety linked to the 3'-most nucleoside; And, (b) an antisense RNAi oligonucleotide having: (i) a length of 21 nucleotides; (ii) 2'-OMe modifications at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21, and 2'F modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5' end); and (iii) containing phosphorothioate internucleoside linkages (counting from the 5' end) between nucleosides at positions 1 and 2, between nucleosides at positions 2 and 3, between nucleosides at positions 3 and 4, and between nucleosides at positions 20 and 21.

[0456] In certain embodiments, the RNAi compounds described herein include (a) a sense RNAi oligonucleotide having: (i) a length of 19 nucleotides; (ii) a conjugated portion attached to the 5' end; (iii) 2'-OMe modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20, and 2'F modifications at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21 (counting from the 5' end); and (iv) phosphorothioate internucleoside linkages between nucleosides at positions 17 and 18, and between nucleosides at positions 18 and 19 (counting from the 5' end); And, (b) an antisense RNAi oligonucleotide having: (i) a length of 19 nucleotides; (ii) 2'-OMe modifications at positions 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21, and 2'F modifications at positions 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 (counting from the 5' end); and (iii) containing phosphorothioate internucleoside linkages (counting from the 5' end) between nucleosides at positions 1 and 2, between nucleosides at positions 2 and 3, between nucleosides at positions 17 and 18, and between nucleosides at positions 18 and 19.

[0457] In any of the above embodiments, the conjugate at the 3' end of the sense RNAi oligonucleotide can include a targeting moiety.In certain such embodiments, the targeting moiety targets a neurotransmitter receptor.In certain embodiments, the cell targeting moiety targets a neurotransmitter transporter.In certain embodiments, the cell targeting moiety targets a GABA transporter.See, for example, WO2011 / 131693, WO2014 / 064257.

[0458] In certain embodiments, the RNAi compound comprises a 21-nucleotide sense RNAi oligonucleotide and a 23-nucleotide antisense RNAi oligonucleotide, wherein the sense RNAi oligonucleotide comprises at least one motif of three consecutive 2'-F modified nucleosides at positions 9, 10, and 11 from the 5' end, and the antisense RNAi oligonucleotide comprises at least one motif of three 2'-O-methyl modified nucleosides at positions 11, 12, and 13 from the 5' end, and one end of the RNAi compound has a blunt end and the other end comprises a two-nucleotide overhang.Preferably, the two-nucleotide overhang is at the 3' end of the antisense RNAi oligonucleotide.

[0459] In certain embodiments, when a two nucleotide overhang is at the 3' end of the antisense RNAi oligonucleotide, there may be two phosphorothioate internucleoside linkages between the terminal three nucleotides, two of which are overhanging nucleotides, and the third nucleotide is the paired nucleotide next to the overhanging nucleotide. In certain embodiments, the RNAi compound is at the 5' end of the sense RNAi oligonucleotide and the 5' end of the antisense RNAi oligonucleotide. Both further have two phosphorothioate internucleoside bonds between the terminal three nucleotides. In certain embodiments, all nucleotides of the sense RNAi oligonucleotide and the antisense RNAi oligonucleotide of the RNAi compound are modified nucleotides. In certain embodiments, each nucleotide is independently modified with 2'-O-methyl or 3'-fluoro, for example in an alternating motif. Optionally, the RNAi compound comprises a conjugate portion.

[0460] In certain embodiments, all nucleotides in the sense and antisense RNAi oligonucleotides of an RNAi compound, including nucleotides that are part of a motif, can be modified.Each nucleotide can be modified with the same or different modifications, which can include one or more changes to one or both of the non-linked phosphate oxygens, changes to the moiety of the ribose sugar, e.g., the 2' hydroxyl on the ribose sugar, large-scale replacement of the phosphate moiety with a "dephosphorylated" linker, modification or replacement of naturally occurring bases, and replacement or modification of the ribose-phosphate backbone.

[0461] In certain embodiments, each nucleoside of the sense RNAi oligonucleotide and the antisense RNAi oligonucleotide is independently modified with LNA, cEt, UNA, HNA, CeNA, 2'-MOE, 2'-OMe, 2'-O-allyl, 2'-C-allyl, 2'-deoxy, 2'-hydroxyl, or 2'-fluoro. The RNAi compound can contain two or more modifications. In one embodiment, each nucleoside of the sense RNAi oligonucleotide and the antisense RNAi oligonucleotide is independently modified with 2'-O-methyl or 2'-F. In certain embodiments, the modification is a 2'-NMA modification.

[0462] The term "alternating motif" as used herein refers to a motif having one or more modifications, each modification occurring on alternating nucleotides of an RNAi oligonucleotide. Alternating nucleotides can refer to every other nucleotide, or every third nucleotide, or a similar pattern. For example, where A, B, and C each represent one type of modification to a nucleotide, the alternating motif can be "ABABABABABAB...", "AABBAABBAABB...", "AABAABAABAAB...", "AAABAAABAAAB...", "AAABBBAAABBB...", or "ABCABCABCABC...", etc.

[0463] The types of modifications included in the alternating motif can be the same or different. For example, if A, B, C, and D each represent one type of modification of a nucleotide, the alternating pattern, i.e., the modification of every other nucleotide, can be the same, but each of the sense or antisense RNAi oligonucleotides can be selected from several possibilities of modifications within the alternating motif, such as "ABABAB...", "ACACAC...", "BDBDBD...", or "CDCDCD...".

[0464] In certain embodiments, the modification pattern of the alternating motif on the sense RNAi oligonucleotide is shifted compared to the modification pattern of the alternating motif on the antisense RNAi oligonucleotide. This shift can be such that the group of modified nucleotides of the sense RNAi oligonucleotide corresponds to the group of differently modified nucleotides of the antisense RNAi oligonucleotide, and vice versa. For example, when the sense RNAi oligonucleotide is paired with the antisense RNAi oligonucleotide in the RNAi duplex, the alternating motif of the sense RNAi oligonucleotide can start with "ABABAB" from 5'-3' of the RNAi oligonucleotide, and the alternating motif of the antisense RNAi oligonucleotide can start with "BABABA" from 5'-3' of the RNAi oligonucleotide in the duplex region. As another example, the alternating motif of the sense RNAi oligonucleotide can be "ABABAB" from 5'-3' of the RNAi oligonucleotide in the duplex region. The alternating motif of the sense RNAi oligonucleotide may begin with "AABBAABB" from 5'-3' of the RNAi oligonucleotide and the alternating motif of the antisense RNAi oligonucleotide may begin with "BBAABBAA" from 5'-3' of the RNAi oligonucleotide within the duplex region, resulting in a complete or partial shift in the 10 modification pattern between the sense and antisense RNAi oligonucleotides.

[0465] In certain embodiments, the RNAi compound comprising the pattern of alternating motifs of 2'-O-methyl and 2'-F modifications of the sense RNAi oligonucleotide has a shift compared to the pattern of alternating motifs of 2'-O-methyl and 2'-F modifications of the antisense RNAi oligonucleotide, i.e., the 2'-O-methyl modified nucleotides of the sense RNAi oligonucleotide base pair with the 2'-F modified nucleotides of the antisense RNAi oligonucleotide, and vice versa. Position 1 of the sense RNAi oligonucleotide may start with a 2'-F modification, and position 1 of the antisense RNAi oligonucleotide may start with a 2'-O-methyl modification.

[0466] The introduction of one or more motifs of three identical modifications on three consecutive nucleotides into the sense and / or antisense RNAi oligonucleotides interrupts the initial modification pattern present in the sense and / or antisense RNAi oligonucleotides. This interruption of the modification pattern of the sense and / or antisense RNAi oligonucleotides by introducing one or more motifs of three identical modifications on three consecutive nucleotides into the sense and / or antisense RNAi oligonucleotides surprisingly enhances the gene silencing activity against the target gene. In one embodiment, when a motif of three identical modifications on three consecutive 25 nucleotides is introduced into any of the RNAi oligonucleotides, the modification of the nucleotide next to the motif is a modification different from the modification of the motif. For example, the portion of the sequence containing the motif is "...NaYYYNb...", where "Y" represents the modification of the motif of three identical modifications on three consecutive nucleotides, "Na" and "Nb" represent the modification of the nucleotide next to the motif "YYY" that is different from the modification of Y, and Na and Nb can be the same modification or different modifications. Alternatively, when wing modifications are present, Na and / or Nb may or may not be present.

[0467] In certain embodiments, the sense RNAi oligonucleotide may be represented by formula (I): 5'n p -N a -(XXX)iN b -YYY -N b -(ZZZ) r N a -n q 3'(I) During the ceremony, i and j are each independently 0 or 1; p and q each independently represent 0 to 6; each N a represents, independently, 0 to 25 linked nucleosides that include at least two different modified nucleosides; each N b independently represent 0 to 10 linked nucleosides; each n p and n q independently represents an overhanging nucleoside, In the formula, N b and Y do not have the same modification, XXX, YYY, and ZZZ each independently represent a modified nucleoside, where each X nucleoside has the same modification, each Y nucleoside has the same modification, and each Z nucleoside has the same modification. In certain embodiments, each Y includes a 2'-F modification.

[0468] In certain embodiments, N a and N b includes alternating pattern modifications.

[0469] In certain embodiments, the YYY motif is present at or near the cleavage site of the target nucleic acid.For example, when the RNAi compound has a duplex region of 17-23 nucleotides in length, the YYY motif can be present at or near the cleavage site of the sense RNAi oligonucleotide (e.g., at 6, 7, 8; 7, 8, 9; 8, 9, 10; 9, 10, 11; 10, 11, 12; or 11, 12, 13 positions), counting from the first nucleotide from the 5' end, or optionally, from the first paired nucleotide in the duplex region from the 5' end.

[0470] In certain embodiments, the antisense RNAi oligonucleotide of the RNAi may be represented by the following formula: 5'n q -N a '-(Z'Z'Z') k -N b '-Y'Y'Y'-N b '-(X'X'X') l -N' a -n p 3'(II) During the ceremony, k and l each independently represent 0 or 1; p' and q' each independently represent 0 to 6; each N a ' independently represents 0 to 25 linked nucleotides comprising at least 2 differentially modified nucleotides; each N b ' independently represents 0 to 10 linked nucleotides; each n p ' and n q ' independently represents an overhanging nucleoside; In the formula, N b ' and Y' do not have the same modification, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent a modified nucleoside, where each X' nucleoside has the same modification, each Y' nucleoside has the same modification, and each Z' nucleoside has the same modification. In certain embodiments, each Y' includes a 2'-F modification. In certain embodiments, each Y' includes a 2'-OMe modification.

[0471] In certain embodiments, N a ' and / or N b ' includes alternating pattern modifications.

[0472] In certain embodiments, the Y'Y'Y' motif is present at or near the cleavage site of the target nucleic acid. For example, when the RNAi compound has a duplex region of 17-23 nucleotides in length, the Y'Y'Y' motif can be present at positions 9, 10, 11; 10, 11, 12; 11, 12, 13; 12, 13, 14; or 13, 14, 15 of the antisense RNAi oligonucleotide, counting from the first nucleotide from the 5' end or, as appropriate, from the first paired nucleotide in the duplex region from the 5' end. Preferably, the Y'Y'Y' motif is present at positions 11, 12, 13.

[0473] In certain embodiments, k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 1.

[0474] Thus, the antisense RNAi oligonucleotide can be represented by the formula: 5'n q '-N a '-Z'Z'Z'-N b '-Y'Y'Y'-N a '-n p '3'(IIb); 5'n q '-N a '-Y'Y'Y'-N b '-X'X'X'-n p '3' (IIc) or 5'n q '-N a '-Z'Z'Z'-Nb '-Y'Y'Y'-N b '-X'X'X'-N a '-n p '3'(IId).

[0475] When the antisense RNAi oligonucleotide is represented by formula IIb, N b ' represents 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides. a ' independently represent 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0476] When the antisense RNAi oligonucleotide is represented by formula IIc, N b ' represents 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides. a ' independently represent 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0477] When the antisense RNAi oligonucleotide is represented by formula IId, N b ' represents 0-10, 0-7, 0-5, 0-4, 0-2, or 0 linked nucleosides. a Each N' independently represents 2 to 20, 2 to 15, or 2 to 10 linked nucleosides. b ' is 0, 1, 2, 3, 4, 5, or 6.

[0478] In certain embodiments, k is 0 and 1 is 0, and the antisense RNAi oligonucleotide can be represented by the formula: 5'n p '-Na'-Y'Y'Y'-N a '-n q '3'(Ia).

[0479] When the antisense RNAi oligonucleotide is represented by Formula IIa, each N a ' independently represent 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0480] Each X', Y', and Z' may be the same or different from each other.

[0481] Each nucleotide of sense RNAi oligonucleotide and antisense RNAi oligonucleotide can be independently modified with LNA, UNA, cEt, HNA, CeNA, 2'-methoxyethyl, 2'-O-methyl, 2'-O-allyl, 2'-C-allyl, 2'-hydroxyl or 2'-fluoro.For example, each nucleotide of sense RNAi oligonucleotide and antisense RNAi oligonucleotide is independently modified with 2'-O-methyl or 2'-fluoro.In particular, each X, Y, Z, X', Y' and Z' can represent 2'-O-methyl modification or 2'-fluoro modification.In certain embodiments, the modification is 2'-NMA modification.

[0482] In certain embodiments, the sense RNAi oligonucleotide of the RNAi compound may contain a YYY motif present at positions 9, 10, and 11 of the RNAi oligonucleotide, where the duplex region is 21 nucleotides, counting from the first nucleotide from the 5' end or counting from the first paired nucleotide in the duplex region, optionally from the 5' end, and Y represents a 2'-F modification. The sense RNAi oligonucleotide may further contain a XXX motif or a ZZZ motif as a wing modification at the opposite end of the duplex region, where XXX and ZZZ each independently represent a 2'-O-methyl modification or a 2'-fluoro modification.

[0483] In certain embodiments, the antisense RNAi oligonucleotide may comprise a Y'Y'Y' motif present at positions 11, 12, 13 of the RNAi oligonucleotide, counting from the first nucleotide from the 5' end or counting from the first paired nucleotide in the duplex region, optionally from the 5' end, where Y represents a 2'-O-methyl modification. The antisense RNAi oligonucleotide may further comprise a X'X'X' motif or a Z'Z'Z' motif as a wing modification at the opposite end of the duplex region, where X'X'X' or Z'Z'Z' each independently represent a 2'-O-methyl or 2'-fluoro modification.

[0484] A sense RNAi oligonucleotide represented by any one of the above formulas Ia, Ib, Ic, and Id forms a duplex with an antisense RNAi oligonucleotide represented by any one of formulas IIa, IIb, IIc, and IId, respectively.

[0485] Thus, the RNAi compounds described herein are intended to be useful as sense RNAi oligonucleotides. and antisense RNAi oligonucleotides, each RNAi oligonucleotide having 14 to 30 nucleotides, the RNAi duplex being represented by formula (III): Sense: 5'n p -N a -(XXX) i -N b -YYY-N b -(ZZZ) j -N a -n q 3' Antisense: 3'n p '-N a '-(X'X'X') k -N b '-Y'Y'Y'-N b '-(Z'Z'Z') l -N a '-n q '5' During the ceremony, i, j, k, and l are each independently 0 or 1; p, p', q, and q' each independently represents 0 to 6; each N a and N a ' independently represent 0 to 25 linked nucleosides, each sequence containing at least two differentially modified nucleotides; each N b and N b ' independently represents 0 to 10 linked nucleosides; where each n may or may not be present. p ',n p , n q ', and n q independently represent an overhanging nucleotide, XXX, YYY, X'X'X', Y'Y'Y', and Z'Z'Z' each independently represent one motif of three identical modifications on three consecutive nucleotides.

[0486] In certain embodiments, i is 0 and j is 0, or i is 1 and j is 0, or i is 0 and j is 1, or both i and j are 0, or both i and j are 1. In other embodiments, k is 0 and l is 0, or k is 1 and l is 0, or k is 0 and l is 1, or both k and l are 0, or both k and l are 1.

[0487] Exemplary combinations of sense and antisense RNAi oligonucleotides that form an RNAi duplex include the following formulas: 5'n p -N a -YYYN a -n q 3' 3'np'-N a '-Y'Y'Y'-N a 'n q '5' (IIIa) 5'n p -N a -YYYN b -ZZ ZN a -nq 3' 3'n p '-N a '-Y'Y'Y'-Nb'-Z'Z'Z'-N a 'n q '5' (IIIb) 5'np-N a -XX XN b -YYYN a -n q 3' 3'np'-N a '-X'X'X'-N b '-Y'Y'Y'-N a '-n q '5' (IIIc) 5'np-N a -XX XN b -YYYN b -ZZ ZN a -n q 3' 3'np'-N a '-X'X'X'-N b '-Y'Y'Y'-N b '-Z'Z'Z'-N a -n q '5' (Illd)

[0488] When the RNAi compound has the formula IIIa, each N a independently represent 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0489] When the RNAi compound is represented by formula IIIb, each N b Each N independently represents 1 to 10, 1 to 7, 1 to 5, or 1 to 4 linked nucleosides. a independently represent 2 to 20, 2 to 15, or 2 to 10 linked nucleosides.

[0490] When the RNAi compound is represented by formula IIIc, each N b , N bEach N' independently represents 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 linked nucleosides. a independently 2 to 20, 2 to 15, or 2 to 10 linked nucleosides represent.

[0491] When the RNAi compound is represented by formula IIId, each N b , N b Each N' independently represents 0 to 10, 0 to 7, 0 to 10, 0 to 7, 0 to 5, 0 to 4, 0 to 2, or 0 linked nucleosides. a , N a Each N' is independently 2 to 20, 2 to 15, or 2 to 10 linked nucleosides. a , N a ', N b , N b ' independently includes alternating pattern modifications.

[0492] Each of X, Y, and Z in formulas III, IIIa, IIIb, IIIc, and IIId can be the same or different from one another.

[0493] When the RNAi compound is represented by formula III, IIIa, IIIb, IIIc, and / or IIId, at least one of the Y nucleotides can be base-paired to one of the Y' nucleotides, alternatively, at least two of the Y nucleotides can be base-paired to a corresponding Y' nucleotide, or all three Y nucleotides can be base-paired to a corresponding Y' nucleotide.

[0494] When the RNAi compound is represented by formula IIIb or IIId, at least one of the Z nucleotides can be base-paired with one of the Z' nucleotides. Alternatively, at least two of the Z nucleotides can be base-paired with the corresponding Z' nucleotide, or all three of the Z nucleotides can be base-paired with the corresponding Z' nucleotide.

[0495] When the RNAi compound is represented by formula IIIc or IIId, at least one of the X nucleotides can be base-paired with one of the X' nucleotides, alternatively, at least two of the X nucleotides can be base-paired with the corresponding X' nucleotide, or all three of the X nucleotides can be base-paired with the corresponding X' nucleotide.

[0496] In certain embodiments, the modification of a Y nucleotide is different from the modification of a Y' nucleotide, the modification of a Z nucleotide is different from the modification of a Z' nucleotide, and / or the modification of an X nucleotide is different from the modification of an X' nucleotide.

[0497] In certain embodiments, when the RNAi compound is represented by formula IIId, N a The modification is a 2'-O-methyl or a 2'-fluoro modification. In another embodiment, when the RNAi compound is represented by formula IIId, N a The modification is 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p In another embodiment, when the RNAi compound has the formula IIId, N' is linked to the adjacent nucleotide via a phosphorothioate bond. a The modification is 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p In certain embodiments, when the RNAi compound is represented by formula IIId, N a The modification is 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p' is linked to adjacent nucleotides via phosphorothioate linkages, the sense RNAi oligonucleotide comprises at least one phosphorothioate linkage, and the sense RNAi oligonucleotide is conjugated to one or more cell targeting groups attached through a divalent or trivalent branched linker.

[0498] In certain embodiments, when the RNAi compound has formula IIIa, N a The modification is 2'-O-methyl or 2'-fluoro modification, p '>0 and at least one n p ' is linked to adjacent nucleotides via phosphorothioate linkages, the sense RNAi oligonucleotide comprises at least one phosphorothioate linkage, and the sense RNAi oligonucleotide is conjugated to one or more cell targeting groups attached through a divalent or trivalent branched linker.

[0499] In certain embodiments, the modification is a 2'-NMA modification.

[0500] In certain embodiments, the antisense strand may comprise a stabilized phosphate group attached to the 5' position of the 5'-most nucleoside. In certain embodiments, the stabilized phosphate group comprises an (E)-vinyl phosphonate. In certain embodiments, the stabilized phosphate group comprises a cyclopropyl phosphonate.

[0501] In certain embodiments, the antisense strand may include a seed pairing destabilizing modification. In certain embodiments, the seed pairing destabilizing modification is located at position 6 (counting from the 5' end). In certain embodiments, the seed pairing destabilizing modification is located at position 7 (counting from the 5' end). In certain embodiments, the seed pairing destabilizing modification is a GNA sugar surrogate. In certain embodiments, the seed pairing destabilizing modification is (S)-GNA. In certain embodiments, the seed pairing destabilizing modification is UNA. In certain embodiments, the seed pairing destabilizing modification is a morpholino.

[0502] In certain embodiments, a sense strand can include an inverted abasic sugar moiety linked to the 5'-most nucleoside. In certain embodiments, a sense strand can include an inverted abasic sugar moiety linked to the 3'-most nucleoside. In certain embodiments, a sense strand can include an inverted abasic sugar moiety linked to both the 5'-most and the 3'-most nucleoside.

[0503] In certain embodiments, the sense strand may include a conjugate attached to the 6-position (counting from the 5' end). In certain embodiments, the conjugate is attached to the 2'-position of the nucleoside. In certain embodiments, the conjugate is 16 In certain embodiments, the modified nucleoside at position 6 of the sense strand has a 2'-O-hexadecyl modified sugar moiety.

[0504] IV. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to target nucleic acids and produce at least one antisense activity, and such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity if they reduce or inhibit the amount or activity of target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acids. Such antisense compounds include nucleobase sequences that hybridize to one or more target nucleic acids to produce one or more desired antisense activities and do not hybridize to one or more non-target nucleic acids or do not hybridize to one or more non-target nucleic acids in such a way that they produce significant undesired antisense activity.

[0505] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA of such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, antisense compounds are described herein that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gapmer gap are tolerated.

[0506] In certain antisense activities, antisense compounds or parts of antisense compounds are loaded into RNA-induced silencing complex (RISC), which ultimately leads to the cleavage of target nucleic acid.For example, certain antisense compounds lead to the cleavage of target nucleic acid by Argonaute.The antisense compounds loaded into RISC are RNAi compounds.RNAi compounds can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).

[0507] In certain embodiments, the hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in a change in the splicing of the target nucleic acid. In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in the inhibition of the binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in a change in the translation of the target nucleic acid.

[0508] Antisense activity may be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity includes observing or detecting a change in the amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a change in the phenotype of a cell or animal.

[0509] V. Specific Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA, including introns, exons, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is an RNA transcript of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain embodiments, the target non-coding RNA is selected from long non-coding RNA, short non-coding RNA, and intronic RNA molecules.

[0510] A. Complementarity / Mismatch to Target Nucleic Acid and Duplex Complementarity In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and includes a region that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the region of full complementarity is 6-20, 10-18, or 18-20 nucleobases in length.

[0511] Gapmer Oligonucleotides It is possible to introduce mismatched bases without losing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) reported that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA was in They demonstrated that the oligonucleotides could reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Moreover, the oligonucleotides showed strong antitumor activity in vivo. Maher and Dolnick (Nuc.Acid.Res.16:3341-3358,1988) tested a series of tandem 14 nucleobase oligonucleotides, as well as 28 and 42 nucleobase oligonucleotides composed of sequences of two or three of the tandem oligonucleotides, respectively, for their ability to stop the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, although to a lower level than the 28 or 42 nucleobase oligonucleotides.

[0512] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases with respect to the target nucleic acid. In certain embodiments, the antisense activity against the target is reduced by such mismatches, while the activity against the non-target is reduced by a larger amount. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatches are specifically located within the oligonucleotide having a gapmer motif. In certain embodiments, the mismatches are at positions 1, 2, 3, 4, 5, 6, 7, or 8 from the 5' end of the gap region. In certain embodiments, the mismatches are at positions 9, 8, 7, 6, 5, 4, 3, 2, or 1 from the 3' end of the gap region. In certain embodiments, the mismatches are at positions 1, 2, 3, or 4 from the 5' end of the wing region. In certain embodiments, the mismatches are at positions 4, 3, 2, or 1 from the 3' end of the wing region.

[0513] Antisense RNAi Oligonucleotides In certain embodiments, antisense RNAi oligonucleotide comprises one or more mismatched nucleobases with target nucleic acid.In certain embodiments, the RNAi activity of target is reduced by such mismatch, but the activity of non-target is reduced by a larger amount.Therefore, in certain embodiments, the selectivity of antisense RNAi oligonucleotide is improved.

[0514] In certain embodiments, the antisense RNAi oligonucleotide comprises a target region that is complementary to the target nucleic acid. In certain embodiments, the target region comprises or consists of at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 25, or at least 25 consecutive nucleotides. In certain embodiments, the target region comprises 70%, 80%, 85%, 90%, 95% of the nucleosides of the antisense RNAi oligonucleotide. In certain embodiments, the target region comprises all the nucleosides of the antisense RNAi oligonucleotide. In certain embodiments, the target region of the antisense RNAi oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the target region of the antisense RNAi oligonucleotide is 100% complementary to the target nucleic acid.

[0515] Sense RNAi oligonucleotides In certain embodiments, the RNAi compound comprises a sense RNAi oligonucleotide.In such embodiments, the sense RNAi oligonucleotide comprises an antisense hybridization region that is complementary to the antisense RNAi oligonucleotide.In certain embodiments, the antisense hybridization region is at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 2 The antisense hybridization region comprises or consists of 0, at least 21, at least 22, at least 23, at least 25, or at least 25 consecutive nucleotides. In certain embodiments, the antisense hybridization region comprises 70%, 80%, 85%, 90%, 95% of the nucleosides of the sense RNAi oligonucleotide. In certain embodiments, the antisense hybridization region comprises all the nucleosides of the sense RNAi oligonucleotide. In certain embodiments, the antisense hybridization region of the sense RNAi oligonucleotide is at least 99%, 95%, 90%, 85%, or 80% complementary to the antisense RNAi oligonucleotide. In certain embodiments, the antisense hybridization region of the sense RNAi oligonucleotide is 100% complementary to the antisense RNAi oligonucleotide.

[0516] The hybridization region of the sense RNAi oligonucleotide hybridizes with the antisense RNAi oligonucleotide to form a duplex region. In certain embodiments, such a duplex region is composed of 7 hybridized pairs of nucleosides (one of each pair is on the antisense RNAi oligonucleotide, and the other of each pair is on the sense RNAi oligonucleotide). In certain embodiments, the duplex region comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 25, or at least 25 consecutive hybridized pairs. In certain embodiments, each nucleoside of the antisense RNAi oligonucleotide is paired in the duplex region (i.e., the antisense RNAi oligonucleotide does not have an overhanging nucleoside). In certain embodiments, the antisense RNAi oligonucleotide comprises unpaired nucleosides (overhang nucleosides) at the 3'-end and / or 5'-end. In certain embodiments, each nucleoside of the sense RNAi oligonucleotide is paired in the duplex region (i.e., the sense RNAi oligonucleotide does not have an overhang nucleoside). In certain embodiments, the sense RNAi oligonucleotide comprises unpaired nucleosides (overhang nucleosides) at the 3'-end and / or 5'-end. In certain embodiments, the duplex formed by the antisense RNAi oligonucleotide and the sense RNAi oligonucleotide does not include an overhang at one or both ends. Such ends without an overhang are called blunt ends. In certain embodiments, the antisense RNAi oligonucleotide has an overhang nucleoside, one or more of the overhang nucleosides are complementary to the target nucleic acid. In certain embodiments in which the antisense RNAi oligonucleotide has overhanging nucleosides, one or more of those overhanging nucleosides are not complementary to the target nucleic acid.

[0517] B.APP In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, the target nucleic acid being APP. In certain embodiments, the APP nucleic acid has the sequence set forth in SEQ ID NO: 1 (cDNA of Ensembl transcript ENST00000346798.7) or the complement of SEQ ID NO: 2 (GENBANK Accession No. NC_00021.9 truncated from nucleotides 25878001 to 26174000). In certain embodiments, the APP nucleic acid has a sequence set forth in any of the known splice variants of APP, including, but not limited to, SEQ ID NO:3 (cDNA of Ensembl transcript ENST00000357903.7), SEQ ID NO:4 (cDNA of Ensembl transcript ENST00000348990.9), SEQ ID NO:5 (cDNA of Ensembl transcript ENST00000440126.7), SEQ ID NO:6 (cDNA of Ensembl transcript ENST00000354192.7), and / or SEQ ID NO:7 (cDNA of Ensembl transcript ENST00000358918.7). In embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7 reduces the amount of APP RNA, and in certain embodiments, reduces the amount of APP protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, or SEQ ID NO:7 results in a reduction in the aggregation of β-amyloid. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugation group.

[0518] C. Specific target nucleic acids in specific tissues In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide that comprises a region complementary to a target nucleic acid, which is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is a cell or tissue that constitutes the central nervous system. Such tissues include the cortex, spinal cord, and hippocampus.

[0519] VI. Certain Pharmaceutical Compositions In certain embodiments, pharmaceutical compositions comprising one or more oligomeric compounds are described herein. In certain embodiments, each of the one or more oligomeric compounds consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition includes a pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0520] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0521] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients, in certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0522] In certain embodiments, the oligomeric compounds may be mixed with pharma- ceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The methods for formulating the compositions and pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0523] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharma- ceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds provide (directly or indirectly) biologically active metabolites or residues thereof upon administration to an animal, including a human. The oligomeric compounds include one or more oligonucleotides that can be used for the synthesis of the oligomeric compounds. Thus, for example, the present disclosure is directed to pharma- ceutically acceptable salts of the oligomeric compounds, prodrugs, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrugs include one or more conjugated groups attached to the oligonucleotide, which are cleaved by endogenous nucleases in the body.

[0524] Lipid moieties have been used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids, such as oligomeric compounds, are introduced into preformed liposomes or lipoplexes made from a mixture of cationic and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed without the presence of neutral lipids. In certain embodiments, the lipid moieties are selected to increase the distribution of pharmaceuticals to specific cells or tissues. In certain embodiments, the lipid moieties are selected to increase the distribution of pharmaceuticals to adipose tissue. In certain embodiments, the lipid moieties are selected to increase the distribution of pharmaceuticals to muscle tissue.

[0525] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for the preparation of certain pharmaceutical compositions, including pharmaceutical compositions that comprise hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.

[0526] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more agents of the invention to a particular tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0527] In certain embodiments, the pharmaceutical composition includes a co-solvent system. Some such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3 w / v% benzyl alcohol, 8 w / v% of the non-polar surfactant Polysorbate 80™, and 65 w / v% polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems can be varied significantly without significantly changing their solubility and toxicity properties. Furthermore, the identity of the co-solvent components can be changed, for example, other surfactants can be used in place of Polysorbate 80™, the fraction size of the polyethylene glycol can be changed, other biocompatible polymers can replace the polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides can replace dextrose.

[0528] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that aid in solubility or act as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Certain pharmaceutical compositions for injection are provided in unit dosage form, for example, in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulating agents such as suspending agents, stabilizing agents, and / or dispersing agents. Particular solvents suitable for use in pharmaceutical compositions for injection include lipophilic solvents and fatty oils, for example, sesame oil, synthetic fatty acid esters, e.g. Examples include, but are not limited to, ethyl oleate or triglycerides, and liposomes.

[0529] Under certain conditions, certain compounds disclosed herein act as acids. Such compounds may be depicted or described in protonated (free acid) form or in ionized and cationic (salt) form, but aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphate bond of an oligonucleotide in aqueous solution exists in equilibrium between free acid, anionic, and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such bonds, each of which is in equilibrium. Thus, oligonucleotides in solution exist as a collection of forms in multiple positions that are all in equilibrium. The term "oligonucleotide" is intended to include all such forms. The depicted structures necessarily represent a single form. Nevertheless, unless otherwise indicated, such drawings are intended to include the corresponding forms as well. In this specification, structures showing the free acid of a compound followed by the term "or a salt thereof" expressly include all such forms, which may be fully or partially protonated / deprotonated / associated with a cation. In certain cases, one or more specific cations are identified.

[0530] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0531] In this specification, a certain dose is described. The dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of a modified oligonucleotide or oligomeric compound in milligrams refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As mentioned above, in an aqueous solution, the free acid is in equilibrium with the anionic form and the salt form. However, for the purpose of calculating the dose, the modified oligonucleotide or oligomeric compound is assumed to exist as a solvent-free, sodium acetate-free, anhydrous, free acid. For example, when the modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with Na+ ions. However, the mass of the protons is still counted in the weight of the dose, and the mass of the Na+ ions is not counted in the weight of the dose. Thus, for example, a dose or dosage unit of 10 mg of some fully protonated molecules is measured as 10 mg. This corresponds to 10.58 mg of neat, sodium acetate free, anhydrous sodiated Compound No. 699467, or 10.65 mg of neat, sodium acetate free, anhydrous sodiated Compound No. 1381709. If an oligomeric compound contains a conjugated group, the mass of the conjugated group is included in the calculation of the dosage of such oligomeric compound. If the conjugated group also contains an acid, the conjugated group is similarly assumed to be fully protonated for purposes of calculating dosage.

[0532] VII. Specific Hotspot Areas 1. Nucleic acid bases 3192 to 9277 of SEQ ID NO:3 In certain embodiments, nucleobases 3192-3277 of SEQ ID NO: 3 comprise a hotspot region. In certain embodiments, an oligomeric compound or oligomeric duplex comprises a modified oligonucleotide that is complementary within nucleobases 3192-3277 of SEQ ID NO: 3. In certain embodiments, the modified oligonucleotide is 23 nucleobases in length. In certain embodiments, the modified oligonucleotide is an antisense RNAi oligonucleotide. In certain embodiments, the antisense RNAi oligonucleotide has the following sugar motif (5' to 3'): mfmfmfmfmfmfmfmfmfmmm, where "m" represents a 2'-O methyl ribosyl sugar, "f" represents a 2'-fluoro ribosyl sugar, and a linkage motif (5' to 3') of ssooooooooooooooooooooss, where "o" represents a phosphodiester internucleoside linkage, and "s" represents a phosphorothioate internucleoside linkage.

[0533] The nucleobase sequences of SEQ ID NOs:821-824 are complementary within nucleobases 3192-3277 of SEQ ID NO:3.

[0534] RNAi compounds 1382120, 1382123, 1382124, and 1382128 comprise antisense RNAi oligonucleotides that are complementary within nucleobases 3192 to 3277 of SEQ ID NO:3.

[0535] In certain embodiments, modified oligonucleotides complementary within nucleobases 5635-5677 of SEQ ID NO:3 achieve at least a 92% reduction in APP RNA in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary within nucleobases 5635-5677 of SEQ ID NO:3 achieve an average of 94% reduction in APP RNA in vitro in a standard cell assay.

[0536] 2. Additional hotspot areas In certain embodiments, the ranges set forth in the table below include hotspot regions. Each hotspot region begins at a nucleobase of SEQ ID NO:1 identified as the "START SITE SEQ ID NO:1" column and ends at a nucleobase of SEQ ID NO:1 identified as the "STOP SITE SEQ ID NO:1" column. In certain embodiments, an oligomeric compound or oligomeric duplex comprises a modified oligonucleotide that is complementary within any of hotspot regions 1-47, as defined in the table below. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, the modified oligonucleotide is 20 nucleobases in length. In certain embodiments, the modified oligonucleotide is 23 nucleobases in length. In certain embodiments, both an RNAseH-based antisense oligonucleotide and a RISC-based RNAi oligomeric duplex are active within a given hotspot region, as shown in the table below.

[0537] In certain embodiments, the oligomeric compound comprises a modified oligonucleotide that is a gapmer. In certain embodiments, the modified oligonucleotide has the sugar motif eeeeeddddddddkkeee, where each "e" is a nucleoside that includes a 2'-MOE sugar moiety, each "k" is a nucleoside that includes a cEt sugar moiety, and each "d" is a nucleoside that includes a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has the sugar motif eeeeeddddddddkeeee, where each "e" is a nucleoside that includes a 2'-MOE sugar moiety, each "k" is a nucleoside that includes a cEt sugar moiety, and each "d" is a nucleoside that includes a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer.

[0538] In certain embodiments, the oligomeric duplex comprises an antisense RNAi oligonucleotide and a sense RNAi oligonucleotide, where the antisense RNAi oligonucleotide is complementary within a given hotspot region. In certain embodiments, the antisense RNAi oligonucleotide is 23 nucleosides in length and contains the following sugar motif (from the 5' to

[0046] The present invention has a linkage motif (5' to 3'): mfmfmfmfmfmfmfmfmfmfmmm, "m" represents a 2'-O-methyl ribosyl sugar, "f" represents a 2'-fluoro ribosyl sugar, and has a linkage motif (5' to 3') of ssooooooooooooooooooooss, "o" represents a phosphodiester internucleoside linkage, and "s" represents a phosphorothioate internucleoside linkage. In each case, the sense RNAi oligonucleotides were 21 nucleosides in length and had the following sugar motif (5' to 3'): fmfmfmfmfmfmfmfmfmf, where "m" represents a 2'-O methyl ribosyl sugar, "f" represents a 2'-fluoro ribosyl sugar, and a linkage motif (5' to 3') of ssooooooooooooooooooss, where "o" represents a phosphodiester internucleoside linkage, and "s" represents a phosphorothioate internucleoside linkage.

[0539] The nucleobase sequences of the gapmer antisense oligonucleotides listed in the "Gapmer Antisense Oligonucleotides" / "Compound ID in Range" column of the table below are complementary to SEQ ID NO: 1 within the designated hotspot regions. The nucleobase sequences of the gapmer antisense oligonucleotides listed in the "Gapmer Antisense Oligonucleotides" / "SEQ ID NO: in Range" column of the table below are complementary to the target sequence, SEQ ID NO: 1, within the designated hotspot regions.

[0540] The nucleobase sequences of the antisense RNAi oligonucleotides corresponding to the RNAi compound IDs listed in the "RNAi Compound" / "RNAi Compound ID in Range" column of the table below are complementary to SEQ ID NO: 1 within the designated hotspot region. The nucleobase sequences of the antisense RNAi oligonucleotides listed in the "RNAi Compound" / "SEQ ID NO: in Range" column are complementary to the target sequence, number 1, within the designated hotspot region.

[0541] In certain embodiments, gapmers complementary to nucleobases within the hotspot regions achieve at least the "gapmer antisense oligonucleotide" / "minimum % reduction" (minimum % reduction compared to untreated control cells) of APP RNA in vitro in a standard cell assay as shown in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve the average of the "gapmer antisense oligonucleotide" / "average % reduction" (average % reduction compared to untreated control cells) of APP RNA in vitro in a standard cell assay as shown in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions achieve the maximum of the "gapmer antisense oligonucleotide" / "maximum % reduction" (maximum % reduction compared to untreated control cells) of APP RNA in vitro in a standard cell assay as shown in the table below.

[0542] In certain embodiments, RNAi oligomer duplexes having antisense RNAi oligonucleotides complementary to nucleobases within the hotspot regions achieve at least "RNAi compound" / "RNAi min % reduction" (minimum % reduction compared to untreated control cells) of APP RNA in vitro in a standard cell assay as shown in the table below. In certain embodiments, RNAi oligomer duplexes having antisense RNAi oligonucleotides complementary to nucleobases within the hotspot regions achieve the average of "RNAi compound" / "average % reduction" (average % reduction compared to untreated control cells) of APP RNA in vitro in a standard cell assay as shown in the table below. In certain embodiments, RNAi oligomer duplexes having antisense RNAi oligonucleotides complementary to nucleobases within the hotspot regions achieve at least "RNAi compound" / "RNAi max % reduction" (maximum reduction compared to untreated control cells) of APP RNA in vitro in a standard cell assay as shown in the table below. Achieve the maximum of (%).

[0543] [Table 1a-1]

[0544] [Table 1a-2]

[0545] [Table 1b-1]

[0546] [Table 1b-2]

[0547] [Table 1b-3]

[0548] [Table 1b-4]

[0549] [Table 1b-5]

[0550] [Table 1b-6]

[0551] [Table 1b-7]

[0552] [Table 1b-8]

[0553] Non-Limiting Disclosure and Incorporation by Reference Each of the references and patent publications cited herein is incorporated by reference in its entirety.

[0554] While certain compounds, compositions and methods described herein have been described with specificity according to certain embodiments, the following examples serve only to illustrate, and are not intended to limit, the compounds described herein. Each of the references, GenBank Accession Numbers, ENSEMBL Identification Numbers, etc. cited in this application is incorporated herein by reference. It is incorporated herein in its entirety.

[0555] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, in practice, the sequences may be modified with any combination of chemical modifications. Those skilled in the art will readily recognize that such designations of "RNA" or "DNA" to describe modified oligonucleotides are optional in certain instances. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base may be described as a DNA with a modified sugar (2'-OH instead of one 2'-H of DNA) or an RNA with a modified base (thymine (methylated uracil) instead of uracil of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids with modified nucleobases. As a further example and not by way of limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG", whether modified or unmodified, can be used with an RNA base, for example, an oligomeric compound having the sequence "AUCGAUCG", as well as oligomeric compounds having some DNA bases and some RNA bases, such as "AUCGATCG", as well as oligomeric compounds having some DNA bases and some RNA bases, such as "AT m The present invention encompasses any oligomeric compound having such a nucleobase sequence, including, but not limited to, such compounds including oligomeric compounds having other modified nucleobases such as "AACGAUCG", wherein: m C denotes a cytosine base containing a methyl group at the 5-position.

[0556] Certain compounds described herein (e.g., modified oligonucleotides) contain one or more asymmetric centers, thus giving rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), α or β, such as in the case of sugar anomers, or (D) or (L), such as in the case of amino acids. Compounds provided herein that are depicted or described as having a particular stereoisomeric configuration include only the indicated compound. Compounds provided herein that are depicted or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optionally pure forms, unless otherwise specified. Similarly, tautomeric forms of the compounds described herein are also included, unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include the corresponding salt forms.

[0557] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds described herein that contain hydrogen atoms include 1 Isotopic substitutions encompassed by the compounds described herein include all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O. 17 O or 18 O, and 32 Instead of S. 33 S, 34 S, 35 S, or 36In certain embodiments, non-radioactive isotope substitution can provide oligomeric compounds with new properties that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitution can make the compounds suitable for research or diagnostic purposes, such as imaging. EXAMPLES

[0558] The following examples are illustrative of the specific embodiments of the present disclosure, but are not limiting.Furthermore, when specific embodiments are provided, the inventors intend the general application of these specific embodiments.For example, the disclosure of an oligonucleotide having a specific motif provides rational support for further oligonucleotides having this motif or similar motifs.Similarly, for example, when a specific high affinity modification appears at a specific position, other high affinity modifications at the same position are considered to be suitable, unless otherwise indicated.

[0559] Example 1: Effect of mixed wing and mixed backbone modified oligonucleotides on a single dose of human APP RNA in vitro Modified oligonucleotides complementary to human APP nucleic acid were tested for their effect on APP RNA levels in vitro.

[0560] In the table below, the modified oligonucleotide is 18 nucleosides long and has the sugar motif eeeeeddddddddkkeee, where each "e" is a nucleoside containing a 2'-MOE sugar moiety, each "k" is a nucleoside containing a cEt sugar moiety, and each "d" is a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety. The internucleoside linkage motif is sooosssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines.

[0561] "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence. "Stop site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (cDNA of Ensembl transcript ENST00000346798.7), the complement of SEQ ID NO:2 (GENBANK accession number NC_00021.9 truncated at nucleotides 25878001-26174000), SEQ ID NO:3 (cDNA of Ensembl transcript ENST00000357903.7), SEQ ID NO:4 (cDNA of Ensembl transcript ENST00000348990.9), SEQ ID NO:5 (cDNA of Ensembl transcript ENST00000440126.7), SEQ ID NO:6 (cDNA of Ensembl transcript ENST00000354192.7), and / or SEQ ID NO:7 (cDNA of Ensembl transcript ENST00000358918.7). If a modified oligonucleotide is 100% complementary to SEQ ID NO:1 and / or SEQ ID NO:2, it may also be 100% complementary to any of SEQ ID NOs:3-7, but this information is not displayed in the table below. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular gene sequence.

[0562] SH-SY5Y cells cultured at a density of 20,000 cells per well were treated with 7,000 nM of modified oligonucleotides by electroporation. After a treatment period of about 24 hours, total RNA was isolated from the cells and APP RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured using human APP primer probe set HTS96 (forward sequence CCTTCCCGTGAATGGAGAGTT, herein designated SEQ ID NO: 910; reverse sequence CACAGAGTCAGCCCCAAAAGA, herein designated SEQ ID NO: 911; probe sequence CCTGGACGATCTCCAGCCGTGG, herein designated SEQ ID NO: 912). APP RNA levels were adjusted according to total RNA content measured with RIBOGREEN®. Results are shown in the table below as APP RNA levels (%) compared to untreated control cells.

[0563] [Table 2-1]

[0564] [Table 2-2]

[0565] [Table 2-3]

[0566] [Table 2-4]

[0567] [Table 3-1]

[0568] [Table 3-2]

[0569]

Table 3-3

[0570]

Table 3-4

[0571]

Table 4-1

[0572]

Table 4-2

[0573]

Table 5-1

[0574]

Table 5-2

[0575]

Table 6-1

[0576]

Table 6-2

[0577]

Table 6-3

[0578]

Table 7-1

[0579] [Table 7-2]

[0580] [Table 7-3]

[0581] [Table 7-4]

[0582] [Table 8]

[0583] [Table 9]

[0584] Example 2: Effect of modified oligonucleotides on multiple doses of human APP in vitro Modified oligonucleotides selected from the above examples were tested at various doses in SH-S5Y cells. Cells plated at a density of 20,000 cells per well were treated with various modified oligonucleotides by electroporation as shown in the table below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and APP RNA levels were measured by quantitative real-time PCR. RNA levels were measured using the human APP primer probe set HTS96 described herein above. APP RNA levels were normalized to GADPH. Results are shown in the table below as APP RNA levels (%) compared to untreated control cells. The half maximal inhibitory concentration (IC) of each modified oligonucleotide was 0.01 to 0.01. 50 ) is also shown. 50were calculated using linear regression on a log / linear plot of the data in excel. "ND" ("not data") indicates that the % inhibition was not determined for that particular modified oligonucleotide in that particular experiment. "NC" ("not calculated") indicates that the range of concentrations tested was below IC 50 This shows that the exact calculation of

[0585] [Table 10]

[0586] [Table 11]

[0587] Example 3: Effect of mixed wing and mixed backbone or MOE and mixed backbone modified oligonucleotides on a single dose of human APP RNA in vitro Modified oligonucleotides complementary to human APP were synthesized with the chemical modification patterns shown in the table below. The modified oligonucleotides in the table below are gapmers. Gapmers have a central gap segment comprising 2'-deoxynucleosides flanked by wing segments on both the 5' and 3' ends comprising cEt nucleosides and / or 2'-MOE nucleosides. All cytosine residues throughout each gapmer are 5-methylcytosines. The internucleoside linkages are mixed phosphodiester and phosphorothioate internucleoside linkages.

[0588] SH-SY5Y cells cultured at a density of 20,000 cells per well were treated with 4,000 nM of modified oligonucleotides by electroporation. After a treatment period of about 24 hours, total RNA was isolated from the cells and APP RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured using human APP primer probe set RTS35571 (forward sequence CCCACTTTGTGATTCCCTACC, herein designated SEQ ID NO: 913; reverse sequence ATCCATCCTCTCCTGGTGTAA, herein designated SEQ ID NO: 914; probe sequence TGATGCCCTTCTCGTTCCTGACAA, herein designated SEQ ID NO: 915). APP RNA levels were adjusted according to total RNA content measured with RIBOGREEN®. Results are shown in the table below as APP RNA levels (%) compared to untreated control cells.

[0589] The modified oligonucleotides in Table 12 below are 18 nucleosides in length and contain the sugar motif ee The gapmer has the structure eeeddddddddkeeee, where each "e" is a nucleoside containing a 2'-MOE sugar moiety, each "k" is a nucleoside containing a cEt sugar moiety, and each "d" is a nucleoside containing a 2'-β-D-deoxyribosyl sugar moiety. The internucleoside linkage motif is sosossssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. "Start site" indicates the 5'-most nucleoside to which the gapmer is complementary in a human nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the gapmer is complementary in a human nucleic acid sequence.

[0590] [Table 12-1]

[0591] [Table 12-2]

[0592] The modified oligonucleotides in Table 13 below are 20 nucleosides long and are 5-10-5 MOE gapmers. The internucleoside linkage motif is sosossssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines. "Start site" indicates the 5'-most nucleoside to which the gapmer is complementary in a human nucleic acid sequence. "Stop site" indicates the 3'-most nucleoside to which the gapmer is complementary in a human nucleic acid sequence.

[0593] [Table 13]

[0594] Example 4: Design of RNAi compounds having antisense RNAi oligonucleotides complementary to human APP nucleic acid An RNAi compound comprising an antisense RNAi oligonucleotide complementary to a human APP nucleic acid and a sense RNAi oligonucleotide complementary to the antisense RNAi oligonucleotide was designed as follows.

[0595] The RNAi compounds in the table below consist of antisense RNAi oligonucleotides and sense RNAi oligonucleotides, in each case the antisense RNAi oligonucleotides are 23 nucleosides in length and have the following sugar motif (5' to 3'): mfmfmfmfmfmfmfmfmfmfmmmm, where "m" represents a 2'-O methyl ribosyl sugar, "f" represents a 2'-fluoro ribosyl sugar, and a linkage motif (5' to 3') of ssooooooooooooooooooooss, where "o" represents a phosphodiester internucleoside linkage, and "s" represents a phosphorothioate internucleoside linkage. In each case, the sense RNAi oligonucleotides are 21 nucleosides long and have the following sugar motif (5' to 3'): fmfmfmfmfmfmfmfmfmf, where "m" represents a 2'-O methyl ribosyl sugar, "f" represents a 2'-fluoro ribosyl sugar, and a linkage motif (5' to 3') of ssooooooooooooooooooss, where "o" represents a phosphodiester internucleoside linkage, and "s" represents a phosphorothioate internucleoside linkage. Each antisense RNAi oligonucleotide is complementary to the target nucleic acid (APP), and each sense RNAi oligonucleotide is complementary to the first of the 21 nucleosides (5' to 3') of the antisense RNAi oligonucleotide, with the last two 3'-nucleosides of the antisense RNAi oligonucleotide not paired with the sense RNAi oligonucleotide (they are overhanging nucleosides).

[0596] "Start site" indicates the 5'-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. "Stop site" indicates the 3'-most nucleoside to which the antisense RNAi oligonucleotide is complementary in the human gene sequence. Each modified antisense RNAi oligonucleoside listed in the table below is 100% complementary to either SEQ ID NO: 1 (described herein), SEQ ID NO: 2 (described herein), or SEQ ID NO: 3 (described herein), as shown in the table below.

[0597]

Table 14-1

[0598]

Table 14-2

[0599]

Table 14-3

[0600]

Table 14-4

[0601]

Table 14-5

[0602]

Table 14-6

[0603]

Table 14-7

[0604]

Table 14-8

[0605]

Table 15-1

[0606]

Table 15-2

[0607]

Table 16-1

[0608] [Table 16-2]

[0609] Example 5: Effect of RNAi compounds on a single dose of human APP RNA in vitro The above double-stranded RNAi compounds were tested in a series of experiments under the same culture conditions, and the results of each experiment are shown in the individual tables below.

[0610] HeLa cells cultured at a density of 6000 cells per well were transfected using RNAiMAX containing 20 nM of double-stranded RNAi. After a treatment period of approximately 24 hours, RNA was isolated from the cells and APP RNA levels were measured by quantitative real-time RTPCR. RNA levels were measured using human primer probe set RTS35571 (described hereinabove). APP RNA levels were normalized to total RNA content measured with RIBOGREEN®. Results are expressed as percent change in APP RNA compared to PBS control. The symbol "

[0611] [ka]

[0612] " indicates that the modified oligonucleotide is complementary to the target transcript within the amplicon region of the primer-probe set, and therefore the associated data is unreliable. In such cases, additional assays using alternative primer-probes must be performed to accurately assess the potency and efficacy of such modified oligonucleotides.

[0613] [Table 17-1]

[0614] [Table 17-2]

[0615] [Table 17-3]

[0616] [Table 18-1]

[0617] [Table 18-2]

[0618] [Table 18-3]

[0619] [Table 19-1]

[0620] [Table 19-2]

[0621] Example 6: Activity of modified oligonucleotides complementary to human APP in transgenic mice The compounds are tested in the Tc1 transgenic mouse model, which contains a nearly complete, freely segregating Hsa21 gene that contains 92% of all known human chromosome 21 (Hsa21) genes, including APP (O'Doherty et al., Science 2005 309(5743):2033-2037). The compounds are also tested in the R1.40 YAC transgenic mouse model, which contains the entire human APP gene, including the Swedish mutations (K670N / M671L), as described in Lamb et al., Human Mol Genetics 1997,6(9):1535-41. Groups of 2-3 mice were injected ICV with 300 μg of ASO or PBS control and sacrificed 2 weeks after dosing. Various CNS tissues were collected. APP RNA was measured by RT-PCR, as described in Example 1 above.

Claims

1. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of said modified oligonucleotide is at least 80% complementary to an equal length portion of an APP RNA, and said modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

2. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of said modified oligonucleotide comprises at least 12, 13, 14, 15, 16, 17, or 18 nucleobases of any of SEQ ID NOs: 12-501, and said modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

3. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of said modified oligonucleotide comprises at least 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases of any of SEQ ID NOs:502-516, and said modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

4. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of said modified oligonucleotide comprises at least 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleobases of any of SEQ ID NOs: 517-665, 814-840, or 867-888, and said modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

5. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, the nucleobase sequence of said modified oligonucleotide being: an isometric portion of nucleobases 40 to 78 of SEQ ID NO:1; an isometric portion of nucleobases 69 to 146 of SEQ ID NO:1; an isometric portion of nucleobases 83 to 129 of SEQ ID NO:1; an isometric portion of nucleobases 83 to 246 of SEQ ID NO:1; an isometric portion of nucleobases 94 to 225 of SEQ ID NO:1; an isometric portion of nucleobases 194 to 231 of SEQ ID NO:1; an isometric portion of nucleobases 194 to 238 of SEQ ID NO:1; an isometric portion of nucleobases 236 to 268 of SEQ ID NO:1; an isometric portion of nucleobases 258 to 288 of SEQ ID NO:1; an isometric portion of nucleobases 285 to 311 of SEQ ID NO:1; an isometric portion of nucleobases 296 to 321 of SEQ ID NO:1; an isometric portion of nucleobases 307 to 330 of SEQ ID NO:1; an isometric portion of nucleobases 329 to 352 of SEQ ID NO:1; an isometric portion of nucleobases 330 to 352 of SEQ ID NO:1; an isometric portion of nucleobases 339 to 383 of SEQ ID NO:1; an isometric portion of nucleobases 415 to 439 of SEQ ID NO:1; an isometric portion of nucleobases 413 to 477 of SEQ ID NO:1; an isometric portion of nucleobases 415 to 477 of SEQ ID NO:1; an isometric portion of nucleobases 477 to 506 of SEQ ID NO:1; an isometric portion of nucleobases 477 to 523 of SEQ ID NO:1; an isometric portion of nucleobases 477 to 541 of SEQ ID NO:1; an isometric portion of nucleobases 530 to 557 of SEQ ID NO:1; an isometric portion of nucleobases 581 to 638 of SEQ ID NO:1; an isometric portion of nucleobases 636 to 661 of SEQ ID NO:1; an isometric portion of nucleobases 652 to 697 of SEQ ID NO:1; an isometric portion of nucleobases 728 to 821 of SEQ ID NO:1; an isometric portion of nucleobases 770 to 821 of SEQ ID NO:1; an isometric portion of nucleobases 920 to 950 of SEQ ID NO:1; an isometric portion of nucleobases 1006 to 1049 of SEQ ID NO:1; an isometric portion of nucleobases 1152 to 1179 of SEQ ID NO:1; an isometric portion of nucleobases 1227 to 1265 of SEQ ID NO:1; an isometric portion of nucleobases 1227 to 1274 of SEQ ID NO:1; an isometric portion of nucleobases 1268 to 1332 of SEQ ID NO:1; an isometric portion of nucleobases 1268 to 1311 of SEQ ID NO:1; an isometric portion of nucleobases 1289 to 1332 of SEQ ID NO:1; an isometric portion of nucleobases 1518 to 1543 of SEQ ID NO:1; an isometric portion of nucleobases 1531 to 1593 of SEQ ID NO:1; an isometric portion of nucleobases 1544 to 1593 of SEQ ID NO:1; an isometric portion of nucleobases 1634 to 1657 of SEQ ID NO:1; an isometric portion of nucleobases 1778 to 1800 of SEQ ID NO:1; an isometric portion of nucleobases 1882 to 1908 of SEQ ID NO:1; an isometric portion of nucleobases 2051 to 2074 of SEQ ID NO:1; an isometric portion of nucleobases 2360 to 3117 of SEQ ID NO:1; an isometric portion of nucleobases 2402 to 3117 of SEQ ID NO:1; an isometric portion of nucleobases 2360 to 2655 of SEQ ID NO:1; an isometric portion of nucleobases 2402 to 2655 of SEQ ID NO:1; an isometric portion of nucleobases 2675 to 3054 of SEQ ID NO:1; or is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 consecutive nucleobases of an equal length portion of nucleobases 3192 to 3277 of SEQ ID NO:3; The oligomeric compound, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified internucleoside linkage.

6. 6. The oligomeric compound of any of claims 1 to 5, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, 85%, 90%, 95%, or 100% complementary to any of the nucleobase sequences of SEQ ID NOs: 1 to 7 when measured across the entire nucleobase sequence of the modified oligonucleotide.

7. The oligomeric compound according to any one of claims 1 to 6, wherein at least one nucleoside of said modified oligonucleotide is a modified nucleoside.

8. The oligomeric compound of claim 7 , wherein at least one nucleoside of the modified oligonucleotide contains a modified sugar moiety.

9. The oligomeric compound of claim 8 , wherein at least one modified nucleoside of the modified oligonucleotide comprises a bicyclic sugar moiety.

10. At least one modified nucleoside of the modified oligonucleotide comprises a bicyclic sugar moiety having a 2'-4' bridge, the 2'-4' bridge being -O-CH ２ - and -O-CH(CH ３ 10. The oligomeric compound of claim 9, wherein said oligomeric compound is selected from the group consisting of:

11. The oligomeric compound of any one of claims 5 to 10, wherein at least one modified nucleoside of said modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

12. The oligomeric compound of claim 11, wherein at least one modified nucleoside of said modified oligonucleotide comprises a bicyclic sugar moiety having a 2'-4' bridge and at least one nucleoside comprises a non-bicyclic modified sugar moiety.

13. 13. The oligomeric compound of claim 11 or 12, wherein the non-bicyclic modified sugar moiety is a 2'-MOE, 2'-OMe, or 2'-F modified sugar moiety.

14. The oligomeric compound according to any one of claims 1 to 13, wherein the modified oligonucleotide comprises at least one modified nucleoside that comprises a sugar surrogate.

15. 15. The oligomeric compound of claim 14, wherein at least one modified nucleoside of the modified oligonucleotide comprises a sugar surrogate selected from morpholino and PNA.

16. The oligomeric compound according to any one of claims 1 to 15, wherein said modified oligonucleotide comprises at least one modified internucleoside linkage.

17. 17. The oligomeric compound of claim 16, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

18. 19. The oligomeric compound of claim 17 or 18, wherein at least one internucleoside linkage is a phosphorothioate internucleoside linkage.

19. 19. The oligomeric compound of claim 16 or 18, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

20. 20. The oligomeric compound of any of claims 16, 18, or 19, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

21. The oligomeric compound according to any one of claims 1 to 20, wherein the modified oligonucleotide comprises a modified nucleobase.

22. 22. The oligomeric compound of claim 21, wherein said modified nucleobase is 5-methylcytosine.

23. 23. The oligomeric compound of any of claims 1-22, wherein the modified oligonucleotide consists of 12-22, 12-20, 14-18, 14-20, 15-17, 15-25, 16-20, 16-18, 18-22, 18-25, 18-20, 20-25, or 21-23 linked nucleosides.

24. The oligomeric compound according to any one of claims 1 to 23, wherein said modified oligonucleotide consists of 18 linked nucleosides.

25. The oligomeric compound according to any one of claims 1 to 23, wherein said modified oligonucleotide consists of 20 linked nucleosides.

26. The oligomeric compound according to any one of claims 1 to 23, wherein said modified oligonucleotide consists of 21 linked nucleosides.

27. The oligomeric compound according to any one of claims 1 to 23, wherein said modified oligonucleotide consists of 23 linked nucleosides.

28. 28. The oligomeric compound according to any one of claims 1 to 27, wherein said oligomeric compound is an RNase H compound.

29. 30. The oligomeric compound of claim 28, wherein the modified oligonucleotide is a gapmer.

30. the modified oligonucleotide comprising: a 5'-region consisting of 1 to 6 linked 5'-region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and a 3'-region consisting of 1 to 6 linked 3'-region nucleosides; the 3'-most nucleoside of the 5'-region and the 5'-most nucleoside of the 3'-region comprise a modified sugar moiety; 30. The oligomeric compound of any of claims 1-29, wherein each of said central region nucleosides is selected from nucleosides that include a 2'-β-D-deoxyribosyl sugar moiety and nucleosides that include a 2'-substituted sugar moiety, and said central region comprises at least six nucleosides that include a 2'-β-D-deoxyribosyl sugar moiety and no more than two nucleosides that include a 2'-substituted sugar moiety.

31. the modified oligonucleotide comprising: a 5'-region consisting of 1 to 6 linked 5'-region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; and a 3'-region consisting of 1 to 6 linked 3'-region nucleosides; 30. The oligomeric compound of any of claims 1-26 or 28-29, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

32. the modified oligonucleotide comprising: a 5'-region consisting of five linked 5'-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3'-region consisting of five linked 3'-region nucleosides; 32. The oligomeric compound of claim 31, wherein each of the 5'-region nucleosides and each of the 3'-region nucleosides comprises either a cEt or a 2'-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

33. The oligomeric compound according to any one of claims 1 to 27, wherein the oligomeric compound is an RNAi compound.

34. The oligomeric compound according to any one of claims 1 to 33, wherein the oligomeric compound comprises an antisense RNAi oligonucleotide comprising a target region comprising at least 15 consecutive nucleobases, the target region being at least 90% complementary to an equal length portion of APP RNA. Compound.

35. 35. The oligomeric compound of claim 34, wherein the target region of said antisense RNAi oligonucleotide is at least 95% complementary, or 100% complementary, to a lengthwise portion of an APP RNA.

36. The oligomeric compound of any of claims 34-35, wherein the target region of the antisense RNAi oligonucleotide comprises at least 19, 20, 21, or 25 contiguous nucleobases.

37. The oligomeric compound according to any one of claims 34 to 36, wherein the APP RNA has the nucleobase sequence of any one of SEQ ID NOs: 1 to 7.

38. The oligomeric compound of any of claims 34 to 37, wherein at least one nucleoside of the antisense RNAi oligonucleotide comprises a modified sugar moiety selected from 2'-F, 2'-OMe, 2'-NMA, LNA, and cEt, or a sugar surrogate selected from GNA and UNA.

39. The oligomeric compound of any of claims 34-35, wherein each nucleoside of the antisense RNAi oligonucleotide comprises a modified sugar moiety or sugar surrogate.

40. The oligomeric compound of any of claims 34-39, wherein at least 80%, at least 90%, or 100% of the nucleosides of said antisense RNAi oligonucleotide comprise a modified sugar moiety selected from 2'-F and 2'-OMe.

41. The oligomeric compound of any of claims 34 to 40, comprising a stabilized phosphate group attached to the 5' position of the 5'-most nucleoside of said antisense RNAi oligonucleotide.

42. 42. The oligomeric compound of claim 41, wherein said stabilized phosphate group comprises cyclopropylphosphonate or (E)-vinylphosphonate.

43. The oligomeric compound according to any one of claims 1 to 42, wherein said oligomeric compound is a single-stranded oligomeric compound.

44. 44. The oligomeric compound according to any one of claims 1 to 43, consisting of said modified oligonucleotide or said RNAi antisense oligonucleotide.

45. 45. The oligomeric compound of any one of claims 1 to 44, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

46. 46. ​​The oligomeric compound of claim 45, wherein said conjugated linker consists of a single bond.

47. 46. ​​The oligomeric compound of claim 45, wherein said conjugated linker is cleavable.

48. 46. ​​The oligomeric compound of claim 45, wherein said conjugated linker comprises from 1 to 3 linker-nucleosides.

49. The oligomerization method according to any one of claims 45 to 48, wherein the conjugate group is attached to the 5' end of the modified oligonucleotide or the antisense RNAi oligonucleotide. Compound.

50. The oligomeric compound according to any one of claims 45 to 48, wherein the conjugate group is attached to the 3' end of the modified oligonucleotide or the antisense RNAi oligonucleotide.

51. 51. The oligomeric compound of any one of claims 1 to 50, comprising a terminal group.

52. 52. The oligomeric compound of any of claims 1-47 or 49-51, wherein said oligomeric compound does not comprise a linker-nucleoside.

53. 53. An oligomeric duplex comprising a first oligomeric compound comprising an antisense RNAi oligonucleotide according to any one of claims 34 to 52, and a second oligomeric compound comprising a sense RNAi oligonucleotide consisting of 17 to 30 linked nucleosides, wherein the nucleobase sequence of the sense RNAi oligonucleotide comprises an antisense hybridizing region comprising at least 15 contiguous nucleobases, and wherein the antisense hybridizing region is at least 90% complementary to an equal length portion of the antisense RNAi oligonucleotide.

54. The oligomeric duplex of claim 53, wherein the sense RNAi oligonucleotide consists of 18-25, 20-25, or 21-23 linked nucleosides.

55. 54. The oligomeric duplex of claim 53, wherein the sense RNAi oligonucleotide consists of 21 or 23 linked nucleosides.

56. 56. The oligomeric duplex of any of claims 53-55, wherein the one to four 3' most nucleosides of said antisense or said sense RNAi oligonucleotide are overhanging nucleosides.

57. 57. The oligomeric duplex of any of claims 53-56, wherein the one to four 5' most nucleosides of said antisense or sense RNAi oligonucleotide are overhanging nucleosides.

58. The oligomeric duplex of any of claims 53-55, wherein said duplex has a blunt end at the 3' end of said antisense RNAi oligonucleotide.

59. The oligomeric duplex of any of claims 53-55, wherein said duplex has a blunt end at the 5' end of said antisense RNAi oligonucleotide.

60. 60. The oligomeric duplex of any of claims 53-59, wherein at least one nucleoside of the sense RNAi oligonucleotide comprises a modified sugar moiety selected from 2'-F, 2'-OMe, LNA, cEt, or a sugar surrogate selected from GNA and UNA.

61. The oligomeric duplex of claim 60, wherein each nucleoside of the sense RNAi oligonucleotide comprises a modified sugar moiety or sugar surrogate.

62. 62. The oligomeric duplex of claim 61, wherein at least 80%, at least 90%, or 100% of the nucleosides of said sense RNAi oligonucleotide comprise a modified sugar moiety selected from 2'-F and 2'-OMe.

63. The oligomeric duplex of any of claims 53-62, wherein at least one nucleoside of the sense RNAi oligonucleotide comprises a modified nucleobase.

64. The oligomeric duplex of any of claims 53-63, wherein at least one internucleoside linkage of said sense RNAi oligonucleotide is a modified internucleoside linkage.

65. 65. The oligomeric duplex of claim 64, wherein at least one internucleoside linkage of said sense RNAi oligonucleotide is a phosphorothioate internucleoside linkage.

66. 66. The oligomeric duplex of any of claims 53-65, wherein said compound comprises 1 to 5 abasic sugar moieties attached to one or both ends of said antisense or sense RNA oligonucleotide.

67. 67. The oligomeric duplex of any one of claims 53 to 66, consisting of said antisense RNAi oligonucleotide and said sense RNAi oligonucleotide.

68. 67. The oligomeric duplex of any of claims 53-66, wherein the second oligomeric compound comprises a conjugate group comprising a conjugate moiety and a conjugate linker.

69. 69. The oligomeric duplex of claim 68, wherein said conjugated linker consists of a single bond.

70. 70. The oligomeric duplex of claim 69, wherein said conjugated linker is cleavable.

71. 70. The oligomeric duplex of claim 69, wherein said conjugated linker comprises from 1 to 3 linker-nucleosides.

72. The oligomeric duplex of any one of claims 69 to 71, wherein the conjugate group is attached to the 5' end of the sense RNAi oligonucleotide.

73. The oligomeric duplex of any one of claims 69 to 71, wherein the conjugate group is attached to the 3' end of the sense RNAi oligonucleotide.

74. The oligomeric duplex of any of claims 69-71, wherein the conjugate group is attached via the 2' position of a ribosyl sugar moiety at an internal position of the sense RNAi oligonucleotide.

75. At least one conjugated group is C １６ 75. The oligomeric compound of any one of claims 45-50 or the oligomeric duplex of any one of claims 68-74, comprising an alkyl group.

76. 54. The oligomeric duplex of claim 53, wherein said second oligomeric compound comprises a terminal group.

77. A pharmaceutical composition comprising an oligomeric compound according to any one of claims 1 to 52, or an oligomeric duplex according to claims 53 to 76, and a pharma- ceutically acceptable carrier or diluent.

78. 78. The pharmaceutical composition of claim 77, wherein the pharma- ceutically acceptable diluent is artificial cerebrospinal fluid, sterile saline, or PBS.

79. 79. The pharmaceutical composition of claim 78, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and sterile saline.

80. A method comprising administering to an animal a pharmaceutical composition according to any one of claims 77 to 79.

81. A method for treating an APP-associated disease, comprising administering to an individual suffering from or at risk of developing an APP-associated disease a therapeutically effective amount of a pharmaceutical composition according to any one of claims 77 to 79, thereby treating said APP-associated disease.

82. 82. The method of claim 81, wherein the APP-related disease is Alzheimer's disease, Alzheimer's disease in Down's syndrome patients, or cerebral amyloid angiopathy.

83. The method of any of claims 80-82, wherein at least one symptom or characteristic of the APP-related disease is ameliorated.

84. 84. The method of claim 83, wherein the symptom or characteristic is cognitive impairment, including decline in memory and language abilities, behavioral and psychological symptoms such as apathy and lack of motivation, gait disturbances and seizures, progressive dementia, and / or abnormal amyloid deposition.

Images