Compounds and methods for reducing KCNT1 expression

Abstract

To provide compounds, methods, and pharmaceutical compositions infantile encephalopathy and epilepsy.SOLUTION: There are provided, a compound, a method, and a pharmaceutical composition for reducing an amount or activity of KCNT1 RNA in a cell or subject, and in certain instances, reducing an amount of KCNT1 protein in a cell or subject. In one embodiment, the compound is an oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein a nucleobase sequence of the modified oligonucleotide is at least 90% complementary to an equal length portion of a KCNT1 nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.SELECTED DRAWING: None

Description

[Technical field]

[0001] Sequence Listing This application is filed with a sequence listing in electronic format. The sequence listing is provided as a file named BIOL0358WOSEQ_ST25.txt, created on March 9, 2020, and having a size of 716 Kb. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

[0002] Compounds, methods, and pharmaceutical compositions are provided for reducing the amount of potassium sodium activated channel subfamily T member 1 (KCNT1) RNA in a cell or subject, and optionally reducing the amount of KCNT1 protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful for improving at least one symptom or characteristic of a neurological condition. Such symptoms and characteristics include, but are not limited to, encephalopathy, cerebral cortical atrophy, clonus, seizures (epilepsy), and behavioral abnormalities such as aggression, catatonia, psychosis, and other intellectual disabilities. Non-limiting examples of neurological conditions that can be treated with the compounds, methods, and pharmaceutical compositions disclosed herein are early-onset epileptic encephalopathies, including infantile epilepsy with migrating focal seizures (EIMFS), autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE), and West syndrome and Otahara syndrome. [Background technology]

[0003] Epilepsy is a neurological disorder characterized by periodic abnormalities in brain activity. As a non-limiting example, individuals suffering from epilepsy often exhibit abnormal behaviors such as seizures (uncontrollable jerking or twitching of limbs), loss of consciousness, catatonia, confusion, and psychosis. Patients with epilepsy may experience focal or generalized seizures. Partial seizures affect specific areas of the brain. In contrast, generalized seizures affect all areas of the brain. Tragically, the onset of epilepsy can occur within the first few months of life, as seen in patients with EIMFS and early infantile epileptic encephalopathy (EIEE). EIMFS is a severe, drug-resistant form of epilepsy that is associated with a high rate of sudden, unexpected mortality from epilepsy. Onset of seizures in subjects with EIMFS often occurs in the first month of life.

[0004] KCNT1 is a calcium-activated K+ channel (SLACK), Ca Also known as sequence-like 4.1 and Slo2.2, it is a sodium-gated potassium channel subunit that forms tetrameric channels with KCNT2 to mediate sodium-sensitive potassium currents within neurons. Two splice isoforms of KCNT1 mRNA are expressed in humans. These isoforms may generate distinct proteins with different electrophysical properties, similar to the SLACK isoform variants found in rodents.

[0005] Gain of function mutations in KCNT1 can cause several types of epilepsy, including ADNFLE and EIMFS. To date, all KCNT1 mutations found in epilepsy subjects are missense mutations that result in a gain of function of the KCNT1 protein. These missense mutations result in increased potassium channel activity and increased peak potassium currents. Approximately 42-50% of EIMFS cases are due to gain-of-function mutations in KCNT1. Summary of the Invention

[0006] Currently, there is a lack of acceptable options for treating infantile encephalopathy and epilepsy. Thus, these conditions present a high unmet need. Furthermore, there are many cases of drug-resistant epilepsy, leaving patients with few or no treatment options. Therefore, it is an objective of the present invention to provide compounds, methods, and pharmaceutical compositions for treating such diseases. This is the purpose of the specification.

[0007] Provided herein are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of KCNT1 RNA in a cell or subject, and in certain embodiments, for reducing the amount or activity of KCNT1 protein. In certain embodiments, the subject is a human. In certain embodiments, the subject has a neurological condition. In certain embodiments, the neurological condition comprises encephalopathy. In certain embodiments, the neurological condition comprises epilepsy. In certain embodiments, the neurological condition is EIMFS. In certain embodiments, the neurological condition is ADNFLE. In certain embodiments, the compound useful for reducing the amount or activity of KCNT1 RNA is an oligomeric compound. In certain embodiments, the compound useful for reducing the expression of KCNT1 RNA is a modified oligonucleotide.

[0008] Also provided herein is a method useful for improving at least one symptom or characteristic of a neurological condition. In certain embodiments, the neurological condition is EIMFS. In certain embodiments, the neurological condition is ADNFLE. In certain embodiments, the at least one symptom or characteristic is selected from seizures, brain injury, demyelination, hypotonia, microcephaly, depression, anxiety, and cognitive function. In certain embodiments, the method disclosed herein is useful for reducing the occurrence of seizures. In certain embodiments, the method disclosed herein is useful for reducing the severity of seizures. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0009] It should be understood that both the general description above and the detailed description below are exemplary and illustrative only and are not limiting. In this specification, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of "or" means "and / or" unless specifically stated otherwise. Furthermore, the use of the term "including" and other forms such as "includes" and "included" is not limiting. Furthermore, terms such as "element" or "component" include both elements and components that include one unit and elements and components that include more than one subunit, unless specifically stated otherwise.

[0010] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents or portions of documents cited in this application, including but not limited to patents, patent applications, articles, books, and papers, are expressly incorporated herein by reference in their entirety with respect to the portions of the documents discussed herein.

[0011] definition Unless otherwise defined, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, other publications, and other data referenced throughout this disclosure are incorporated herein by reference in their entirety. Unless otherwise indicated, the following terms have the following meanings:

[0012] definition As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside, which includes a 2'-β-D-deoxyribosyl sugar moiety, which is found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, 2'-deoxynucleosides or nucleosides comprising an unmodified 2'-deoxyribosyl sugar moiety may contain a modified nucleobase or may contain an RNA nucleobase (uracil).

[0013] As used herein, "2'-MOE" or "2'-MOE sugar moiety" means a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. "MOE" means methoxyethyl.

[0014] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.

[0015] As used herein, "2'-OMe" or "2'-O-methyl sugar moiety" means a 2'-OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety.

[0016] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0017] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted sugar moiety. As used herein, "2'-substituted" in reference to the sugar moiety means that the sugar moiety includes at least one 2'-substituent group other than H or OH.

[0018] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to the 5' position. 5-methylcytosine is a modified nucleobase.

[0019] As used herein, "administering" means providing a pharmaceutical agent to a subject.

[0020] As used herein, "antisense activity" refers to any detectable and / or measurable change resulting from hybridization of an antisense compound to its target nucleic acid. In some embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of the antisense compound.

[0021] As used herein, "antisense compound" means an oligomeric compound capable of achieving at least one antisense activity.

[0022] As used herein, "ameliorate" in reference to treatment means an improvement in at least one symptom compared to the same symptom in the absence of treatment. In certain embodiments, the improvement is a slowing in the onset or progression of the severity or frequency of a condition.

[0023] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0024] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that contains two rings, where the second ring is formed via a bridge that connects two of the atoms of the first ring, thereby forming a bicyclic structure. In some embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In some embodiments, the bicyclic sugar moiety does not include a furanosyl moiety.

[0025] As used herein, "cleavable moiety" means a bond or group that is cleaved under physiological conditions, such as, for example, inside a cell or a subject.

[0026] As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide or one or more regions thereof and the nucleobases of another nucleic acid or one or more regions thereof can hydrogen bond with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in reverse orientation. As used herein, "complementary nucleobases" means nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are allowed. As used herein, "fully complementary" or "100% complementary" in reference to an oligonucleotide or a portion thereof means that the oligonucleotide or a portion thereof is complementary at each nucleobase of the nucleotide to another oligonucleotide or nucleic acid.

[0027] As used herein, "conjugate group" refers to a group of atoms that is directly or indirectly attached to an oligonucleotide. Conjugate groups include conjugate moieties and conjugate linkers that attach the conjugate moieties to the oligonucleotide.

[0028] As used herein, "conjugate linker" means a bond or a group of atoms that contains at least one bond that attaches a conjugate moiety to an oligonucleotide.

[0029] As used herein, "conjugate moiety" means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

[0030] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" refers to nucleobases that are immediately adjacent to one another in a sequence.

[0031] As used herein, "constrained ethyl" or "cEt" or "cEt modified sugar" means a β-D ribosyl bicyclic sugar moiety in which the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and the 2'-carbon of the β-D ribosyl bicyclic sugar moiety, where the bridge has the formula 4'-CH(CH3)-O-2' and the methyl group of the bridge is in the S configuration.

[0032] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt modified sugar moiety.

[0033] As used herein, "chirally enriched population" refers to a plurality of molecules of the same molecular formula, wherein the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules that would be expected to contain the same particular stereochemical configuration at the same particular chiral center in the population if the particular chiral center were stereorandom. A chirally enriched population of molecules with multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound that includes a modified oligonucleotide.

[0034] As used herein, "gapmer" refers to a modified oligonucleotide that includes an internal region having multiple nucleosides that support RNase H cleavage, located between external regions having one or more nucleosides, where the nucleosides that make up the internal region are chemically distinct from the nucleoside or nucleosides that make up the external regions. The internal region can be referred to as the "gap" and the external regions can be referred to as the "wings." Unless otherwise indicated, "gapmer" refers to a sugar motif. Unless otherwise indicated, the sugar moiety of each nucleoside of the gap is a 2'-β-D-deoxyribosyl sugar moiety. Thus, the term "MOE gapmer" refers to a gapmer having a gap containing a 2'-β-D-deoxynucleoside and wings containing 2'-MOE nucleosides. Unless otherwise indicated, MOE gapmers may include one or more modified internucleoside linkages and / or modified nucleobases, and such modifications do not necessarily follow a gapmer pattern of sugar modifications.

[0035] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is susceptible to oligomeric compound-mediated reduction in the amount or activity of the target nucleic acid.

[0036] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding, which can be Watson-Crick hydrogen bonding, Hoogsteen hydrogen bonding, or reversed Hoogsteen hydrogen bonding between complementary nucleobases.

[0037] As used herein, "internucleoside bond" refers to the covalent bond between successive nucleosides in an oligonucleotide.As used herein, "modified internucleoside bond" refers to any internucleoside bond other than phosphodiester internucleoside bond."Phosphorothioate internucleoside bond" is a modified internucleoside bond in which one of the non-bridging oxygen atoms of phosphodiester internucleoside bond is replaced with a sulfur atom.

[0038] As used herein, "linker nucleoside" refers to a nucleoside that directly or indirectly links an oligonucleotide to a conjugate moiety. The linker nucleoside is located within the conjugate linker of an oligomeric compound. The linker nucleoside is not considered to be part of the oligonucleotide moiety of an oligomeric compound, even if they are contiguous with the oligonucleotide.

[0039] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that contains a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

[0040] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first oligonucleotide that is not complementary to a second nucleobase or the corresponding nucleobase of a target nucleic acid when the first and second oligonucleotides are aligned.

[0041] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0042] As used herein, "neurological condition" refers to a condition of the brain, central nervous system, peripheral nervous system, or a combination thereof. A neurological condition may be characterized by at least one of nerve dysfunction, nerve damage, and nerve death. A neurological condition may be characterized by a decline in motor function. The neurological condition may include decreased motor control.

[0043] As used herein, "nucleobase" refers to unmodified or modified nucleobase. As used herein, "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, "nucleobase sequence" refers to the order of consecutive nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0044] As used herein, "nucleoside" refers to a compound containing a nucleobase and a sugar moiety. The nucleobase and sugar moieties are each independently unmodified or modified. As used herein, "modified nucleoside" refers to a nucleoside that includes a modified nucleobase moiety and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides that lack a nucleobase. "Linked nucleosides" are nucleosides linked in a contiguous sequence (i.e., there are no additional nucleosides between them that are linked).

[0045] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, additional features such as one or more conjugate groups or terminal groups. An oligomeric compound can be paired with a second oligomeric compound, which may be complementary to the first oligomeric compound or may not be paired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" refers to a double strand formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be called a "double-stranded oligomeric compound".

[0046] As used herein, "oligonucleotide" refers to a chain of linked nucleosides linked via internucleoside linkages, each nucleoside and internucleoside linkage may or may not be modified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modification.

[0047] As used herein, "pharmaceutical acceptable carrier or diluent" means any substance suitable for use in administering to a subject. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutical acceptable carrier or diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0048] As used herein, "pharmaceutically acceptable salts" refers to physiologically and pharma- ceutically acceptable salts of a compound that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0049] As used herein, a "pharmaceutical composition" refers to a substance suitable for administration to a subject. For example, the pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0050] As used herein, "prodrug" refers to an exogenous form of a therapeutic agent that is converted to a different form within a subject or its cells. Typically, conversion of the prodrug within the subject is facilitated by the activity of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or by physiological conditions.

[0051] As used herein, "reducing or inhibiting the amount or activity" refers to a decrease or blocking of transcriptional expression or activity compared to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate a complete elimination of transcriptional expression or activity.

[0052] As used herein, "RNA" means RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0053] As used herein, "RNAi compound" refers to an antisense compound that acts at least in part through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics. In certain embodiments, RNAi compounds regulate the amount, activity, and / or splicing of a target nucleic acid. The term RNAi compound excludes antisense compounds that act through RNaseH.

[0054] As used herein, "self-complementary" with respect to an oligonucleotide means an oligonucleotide that hybridizes at least partially with itself.

[0055] As used herein, "standard cell assay" refers to the assay described in Example 1 and reasonable variations thereof.

[0056] As used herein, "stereorandom" in the context of a population of molecules of the same molecular formula refers to a chiral center that has a random stereochemical configuration. For example, in a population of molecules that contain a stereorandom chiral center, the number of molecules that have the stereorandom chiral center's (S) configuration can be, but is not necessarily, the same as the number of molecules that have the stereorandom chiral center's (R) configuration. The stereochemical configuration of a chiral center is considered to be random if it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0057] As used herein, "subject" means a human or non-human animal. In certain embodiments, the subject is a human.

[0058] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H) ribosyl moiety as found in RNA (an "unmodified RNA sugar moiety") or a 2'-H(H) deoxyribosyl moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety, or sugar surrogate.

[0059] As used herein, "sugar surrogate" refers to a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group, within an oligonucleotide. Modified nucleosides that contain sugar surrogates can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or nucleic acids.

[0060] As used herein, "symptom or characteristic" means any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is evident to the subject or a medical professional examining or testing said subject. In certain embodiments, the characteristic is evident upon invasive diagnostic testing, including but not limited to post-mortem examination.

[0061] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an antisense compound is designed to affect.

[0062] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0063] As used herein, "terminal group" means a chemical group or group of atoms that is covalently attached to an oligonucleotide terminus.

[0064] As used herein, a "therapeutically effective amount" refers to an amount of a pharmaceutical agent that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount ameliorates a symptom or characteristic of a disease.

[0065] Specific Embodiments The present disclosure provides the following non-limiting numbered embodiments:

[0066] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified nucleotides is at least 90% complementary to an equal length portion of a KCNT1 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0067] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, the oligomeric compound comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases of any of SEQ ID NOs: 21-2939.

[0068] Embodiment 3. A modified oligonucleotide comprising 12 to 50 linked nucleosides, An equal length portion of nucleobases 24523 to 24561 of SEQ ID NO: 2; An equal length portion of nucleobases 27568 to 27603 of SEQ ID NO: 2; An equal length portion of nucleobases 30772 to 30811 of SEQ ID NO: 2; An equal length portion of nucleobases 54372 to 54428 of SEQ ID NO: 2; An equal length portion of nucleobases 55785 to 55818 of SEQ ID NO: 2; An equal length portion of nucleobases 56048 to 56073 of SEQ ID NO: 2; An equal length portion of nucleobases 56319 to 56349 of SEQ ID NO: 2; An equal length portion of nucleobases 57683 to 57710 of SEQ ID NO: 2; An equal length portion of nucleobases 61117 to 61153 of SEQ ID NO: 2; An equal length portion of nucleobases 71033 to 71060 of SEQ ID NO: 2; An equal length portion of nucleobases 87135 to 87174 of SEQ ID NO: 2; An equal length portion of nucleobases 92109 to 92149 of SEQ ID NO: 2; An equal length portion of nucleobases 94221 to 94280 of SEQ ID NO: 2; An equal length portion of nucleobases 94352 to 94380 of SEQ ID NO: 2; an equal length portion of nucleobases 94993 to 95036 of SEQ ID NO:2; or An equal length portion of nucleobases 95074 to 95144 of SEQ ID NO: 2; said oligomeric compound having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases that are complementary to

[0069] 4. A modified oligonucleotide consisting of 12 to 50 linked nucleosides according to embodiment 4.1, An equal length portion of nucleobases 16586 to 16649 of SEQ ID NO: 2; An equal length portion of nucleobases 16586 to 17823 of SEQ ID NO: 2; An equal length portion of nucleobases 16586 to 18663 of SEQ ID NO: 2; An equal length portion of nucleobases 19220 to 20568 of SEQ ID NO: 2; An equal length portion of nucleobases 23003 to 25391 of SEQ ID NO: 2; An equal length portion of nucleobases 27095 to 29908 of SEQ ID NO: 2; An equal length portion of nucleobases 30452 to 30891 of SEQ ID NO: 2; An equal length portion of nucleobases 31773 to 34427 of SEQ ID NO: 2; An equal length portion of nucleobases 38458 to 47003 of SEQ ID NO: 2; An equal length portion of nucleobases 40432 to 42873 of SEQ ID NO: 2; An equal length portion of nucleobases 44414 to 45718 of SEQ ID NO: 2; An equal length portion of nucleobases 52096 to 52153 of SEQ ID NO: 2; An equal length portion of nucleobases 52096 to 58525 of SEQ ID NO: 2; An equal length portion of nucleobases 59308 to 61697 of SEQ ID NO: 2; An equal length portion of nucleobases 60111 to 61697 of SEQ ID NO: 2; An equal length portion of nucleobases 65270 to 67169 of SEQ ID NO: 2; A portion of equal length from nucleobases 65270 to 67150 of SEQ ID NO: 2; An equal length portion of nucleobases 67026 to 67065 of SEQ ID NO: 2; An equal length portion of nucleobases 67026 to 67087 of SEQ ID NO: 2; An equal length portion of nucleobases 67648 to 68527 of SEQ ID NO: 2; An equal length portion of nucleobases 67955 to 67998 of SEQ ID NO: 2; An equal length portion of nucleobases 68515 to 68583 of SEQ ID NO: 2; An equal length portion of nucleobases 68538 to 68592 of SEQ ID NO: 2; An equal length portion of nucleobases 68571 to 70874 of SEQ ID NO: 2; An equal length portion of nucleobases 71037 to 71313 of SEQ ID NO: 2; An equal length portion of nucleobases 71037 to 71184 of SEQ ID NO: 2; An equal length portion of nucleobases 72851 to 72887 of SEQ ID NO: 2; An equal length portion of nucleobases 79368 to 79483 of SEQ ID NO: 2; An equal length portion of nucleobases 86554 to 90150 of SEQ ID NO: 2; An equal length portion of nucleobases 88332 to 88448 of SEQ ID NO: 2; An equal length portion of nucleobases 91686 to 95485 of SEQ ID NO: 2; a portion of equal length from nucleobases 91686 to 94431 of SEQ ID NO:2; or An equal length portion of nucleobases 94219 to 94275 of SEQ ID NO: 2; at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive The oligomeric compound having a nucleobase sequence comprising nucleobases.

[0070] Embodiment 5. The oligomeric compound of any one of embodiments 1-4, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to an equal length portion of a nucleobase sequence selected from SEQ ID NOs: 1-3 when measured across the entire nucleobase sequence of the modified oligonucleotide.

[0071] Embodiment 6. The oligomeric compound of any one of embodiments 1-5, wherein at least one modified nucleoside comprises a modified sugar moiety.

[0072] Embodiment 7. The oligomeric compound of embodiment 6, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0073] Embodiment 8. The oligomeric compound of embodiment 7, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2-, and -O-CH(CH3)-.

[0074] Embodiment 9 The oligomeric compound of embodiment 6, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.

[0075] Embodiment 10. The oligomeric compound of embodiment 9, wherein said non-bicyclic modified sugar moiety comprises a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.

[0076] Embodiment 11. The oligomeric compound of any one of embodiments 1-5, wherein said at least one modified nucleoside comprises a sugar surrogate.

[0077] Embodiment 12. The oligomeric compound of embodiment 11, wherein the sugar surrogate is selected from morpholino and PNA.

[0078] Embodiment 13. The modified oligonucleotide comprises: a 5' region consisting of 1 to 5 linked 5' region nucleosides; a central region consisting of 6-10 linked central region nucleosides; having a sugar motif comprising a 3' region consisting of 1 to 5 linked 3' region nucleosides; 13. The oligomeric compound of any of embodiments 1-12, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises an unmodified 2'-deoxyribosyl sugar moiety.

[0079] Embodiment 14. The oligomeric compound of any one of embodiments 1 to 13, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0080] Embodiment 15. The oligomeric compound of embodiment 14, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

[0081] Embodiment 16. The oligomeric compound of embodiment 14 or 15, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0082] Embodiment 17. The oligomeric compound of embodiment 14 or 16, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0083] Embodiment 18. The oligomeric compound of any of embodiments 14, 16, or 17, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0084] Embodiment 19. The oligomeric compound of any one of embodiments 1 to 18, wherein the modified oligonucleotide comprises at least one modified nucleobase.

[0085] Embodiment 20. The oligomeric compound of embodiment 19, wherein the modified nucleobase is 5-methylcytosine.

[0086] Embodiment 21. The oligomeric compound of any one of embodiments 1-20, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-20, 15-25, 16-20, 18-22, or 18-20 linked nucleosides.

[0087] Embodiment 22. The compound of any one of embodiments 1-21, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0088] Embodiment 23. The oligomeric compound of embodiment 22, wherein the modified oligonucleotide has internucleoside linkages sooooosssssssssssooss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage.

[0089] Embodiment 24. The oligomeric compound according to any one of embodiments 1 to 23, comprising said modified oligonucleotide.

[0090] Embodiment 25. The oligomeric compound of any one of embodiments 1 to 23, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

[0091] Embodiment 26 The oligomeric compound of embodiment 25, wherein the conjugate group comprises a GalNAc cluster comprising 1 to 3 GalNAc ligands.

[0092] Embodiment 27. The oligomeric compound of embodiment 25 or 26, wherein the conjugate linker consists of a single bond.

[0093] Embodiment 28 The oligomeric compound of embodiment 25, wherein the conjugate linker is cleavable.

[0094] Embodiment 29. The oligomeric compound of embodiment 28, wherein the conjugate linker comprises 1 to 3 linker nucleosides.

[0095] Embodiment 30. The oligomeric compound of any of embodiments 25-29, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

[0096] Embodiment 31. The oligomeric compound of any of embodiments 25-29, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0097] Embodiment 32. The oligomeric compound of any one of embodiments 1 to 31, comprising a terminal group.

[0098] Embodiment 33. The oligomeric compound of any one of embodiments 1 to 32, wherein the oligomeric compound is a single-stranded oligomeric compound.

[0099] Embodiment 34. The oligomeric compound of any one of embodiments 1-28 or 30-31, wherein the oligomeric compound does not comprise a linker nucleoside.

[0100] Embodiment 35. The oligomeric compound of any one of embodiments 1 to 34, wherein said modified oligonucleotide of said oligomeric compound is a salt, said salt being a sodium salt or a potassium salt.

[0101] Embodiment 36. An oligomeric duplex comprising an oligomeric compound according to any one of embodiments 1-32, 34, or 35.

[0102] Embodiment 37. An antisense compound comprising or consisting of an oligomeric compound according to any one of embodiments 1 to 35 or an oligomeric duplex according to embodiment 36.

[0103] Embodiment 38. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1-35 or an oligomeric duplex according to embodiment 36, and a pharma- ceutically acceptable carrier or diluent.

[0104] Embodiment 39. The pharmaceutical composition of embodiment 38, wherein the pharma- ceutical acceptable diluent is artificial cerebrospinal fluid or PBS.

[0105] Embodiment 40. The pharmaceutical composition of embodiment 39, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid.

[0106] Embodiment 41. A method comprising administering to a subject the pharmaceutical composition of any one of embodiments 38 to 40.

[0107] Embodiment 42. A method for treating a neurological condition, comprising administering to an individual having or at risk of developing said neurological condition a therapeutically effective amount of a pharmaceutical composition of any of embodiments 38-40, thereby treating said neurological condition.

[0108] Embodiment 43. A method for reducing KCNT1 RNA or KCNT1 protein in the central nervous system of an individual having or at risk of developing a neurological condition, comprising administering a therapeutically effective amount of a pharmaceutical composition described in any of embodiments 38 to 40, thereby reducing KCNT1 RNA or KCNT1 protein in the central nervous system.

[0109] Embodiment 44 The method of embodiment 42 or 43, wherein the neurological condition comprises encephalopathy.

[0110] Embodiment 45 The method of embodiment 42 or 43, wherein the neurological condition comprises epilepsy.

[0111] Embodiment 46 The method of embodiment 42 or 43, wherein the neurological condition comprises infantile epilepsy.

[0112] Embodiment 47 The method of embodiment 46, wherein the infantile epilepsy is infantile epilepsy with migrating focal seizures (EIMFS).

[0113] Embodiment 48 The method of embodiment 42 or 43, wherein the neurological condition is autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE).

[0114] Embodiment 49. The method of any one of embodiments 42-48, wherein the administering is by intrathecal administration.

[0115] Embodiment 50 The method of any one of embodiments 42-49, wherein at least one symptom or characteristic of the neurological condition is ameliorated.

[0116] Embodiment 51. The method of embodiment 50, wherein the symptom or characteristic is selected from seizures, brain injury, demyelination, hypotonia, microcephaly, depression, anxiety, and cognitive function.

[0117] Embodiment 52 The method of any one of embodiments 42-51, wherein the method prevents or delays regression of a disease.

[0118] Embodiment 53. A method for reducing KCNT1 RNA in a cell, comprising contacting the cell with an oligomeric compound described in any one of embodiments 1 to 35, an oligomeric duplex described in embodiment 36, or an antisense compound described in embodiment 37, thereby reducing KCNT1 RNA in the cell.

[0119] Embodiment 4. A method for reducing KCNT1 protein in a cell, comprising contacting the cell with an oligomeric compound according to any one of embodiments 1 to 35, an oligomeric duplex according to embodiment 36, or an antisense compound according to embodiment 37, thereby reducing KCNT1 protein in the cell.

[0120] I. Specific Oligonucleotides In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides consisting of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification compared to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage. A. Certain Modified Nucleosides A modified nucleoside contains a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0121] 1. Specific sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions that correspond to the substitutions of other types of modified sugar moieties.

[0122] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety that includes a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position of the furanosyl, including, but not limited to, substituents at the 2', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents of a non-bicyclic modified sugar moiety is branched. Examples of suitable 2'-substituents for a non-bicyclic modified sugar moiety include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1-C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-Alkyl, O-Alkenyl, S-Alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ), [Each R in the formula m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10and 2'-substituents described in Cook et al., US 6,531,584; Cook et al., US 5,859,221; and Cook et al., US 6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to: 5'-meryl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties include one or more non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, and modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0123] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C-C 10 It is an alkyl.

[0124] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0125] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from: F, OCH3, and OCH2CH2OCH3.

[0126] Certain modified sugar moieties include a substituent that bridges two atoms of the furanosyl ring that form a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4'-furanose ring atom and the 2'-furanose ring atom. Examples of such 4' to 2' bridged sugar substitutions include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2' ... '-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogues thereof (see, e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,741,457; and Swayze et al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogues thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogues thereof (see, e.g., Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 8,278,425), al., US 7,696,345, and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., US 8,278,426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', where each R, R a , and R b are independently H, a protecting group, or C1-C 12 Alkyl (e.g., Imanishi et al. al., US Pat. No. 7,427,672).

[0127] In certain embodiments, such 4' to 2' bridges independently comprise from 1 to 4 linking groups independently selected from the following: -[C(R a )(R b )] n -,-[C(R a )(R b )] n-O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-; During the ceremony: x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkynyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, Substituted C5-C 20 is aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, Substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.

[0128] It is possible to generate a large amount of nucleic acids in a stable manner, as described in Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443,Albaek et al.,J. Org. Chem.,2006,71,7731-7740,Singh et al.,Chem. Commun.,1998,4,455-456;Koshkin et al.,Tetrahedron,1998,54,3607-3630;Kumar et al.,Bioorg. Med. Chem. Lett.,1998,8,2219-2222;Singh et al.,J. Org. Chem.,1998,63,10035-10039;Srivastava et al.,J. Am. Chem. So c.,2007,129,8362-8379;Wengel et al.,US7,053,207;Imanishi et al.,US6,268,490;Imanishi et al.US6,770,748;Imanishi et al.,USRE44,779;Wengel et al.,US6,794,499; al.,US6,670,461;Wengel et al.,US7,034,133;Wengel et al.,US8,080,644;Wengel et al.,US8,034,909;Wengel et al.,US8,153,365;Wengel et al.,US7,572,582; al.,US6,525,191;Torsten et al.,WO2004 / 106356;Wengel et al., WO1999 / 014226; Seth et al., WO2007 / 134181; Seth et al., US7,547,684; Seth et al., US7,666,854; Seth et al., US8,088,746; Seth et al., US7,750,131; Seth et al., US8,030,467; Seth et al., US8,268,980; Seth et al., US8,546,556; Seth et al., US8,530,640; Migawa et al., US9,012,421; Seth et al., US8,501,805; and published U.S. patent applications Allerson et al., US2008 / 0039618 and Migawa et al. See al., US2015 / 0191727.

[0129] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration.

[0130] [ka]

[0131] The bicyclic nucleoside of α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA has been incorporated into oligonucleotides that exhibit antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleoside includes both isomeric configurations. When the position of a specific bicyclic nucleoside (e.g. LNA or cEt) is identified in the exemplary embodiment herein, they are in β-D configuration unless otherwise specified.

[0132] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2' bridging sugars).

[0133] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, an oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties can be crosslinked and / or uncrosslinked, as described above. Bridge substitutions are also included. For example, certain sugar surrogates include substitutions at the 4'-sulfur atom as well as at the 2' position (see, e.g., Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or the 5' position.

[0134] In certain embodiments, the sugar surrogate comprises a ring having more than 5 atoms. For example, in certain embodiments, the sugar surrogate comprises a 6-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include hexitol nucleic acid (HNA), anitol nucleic acid (ANA), mannitol nucleic acid (MNA) (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002,10,841-854), fluoroHNA:

[0135] [ka]

[0136] ("F-HNA", see, e.g., Swayze et al., US8,088,904; Swayze et al., US8,440,803; Swayze et al., US8,796,437; and Swayze et al., US9,005,906; F-HNA can also be referred to as F-THP or 3'-fluorotetrahydropyran), as well as nucleosides that include additional modified THP compounds having the formula:

[0137] [ka]

[0138] wherein, independently for each modified THP nucleoside: Bx is a nucleobase moiety; T3 and T4 are each independently an internucleoside linking group linking a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group linking a modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linking conjugate group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C 2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each of J1, J2, and J3 is independently H, or C1-C6 alkyl.

[0139] In certain embodiments, modified THP nucleosides are provided, wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided, wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H. In certain embodiments, R1 is methoxy and R2 is H. In certain embodiments, R1 is methoxyethoxy and R2 is H.

[0140] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms and more than one heteroatom. For example, nucleosides containing morpholino sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510, and Summerton et al., US 5,698,685; Summerton et al., US 5,166,315; Summerton et al., US 5,185,444; and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a nucleoside having the following formula:

[0141] [ka]

[0142] means a sugar substitute having the formula:

[0143] In certain embodiments, for example, morpholinos may be modified from the morpholino structures described above, for example, by adding or modifying various substituents. Such sugar surrogates are referred to herein as "modified morpholinos."

[0144] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that contain such acyclic sugar surrogates include peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and Manoharan et al. al., WO2011 / 133876.

[0145] Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art and can be used in the modified nucleosides.

[0146] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that comprise unmodified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that comprise modified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not comprise nucleobase, which is called abasic nucleoside.

[0147] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-alapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases are 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5 -halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-ones, 1,3-diazaphenothiazin-2-ones, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-ones (G-clamps).Modified nucleobases can also include bases in which the purine or pyrimidine base is replaced by other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288; and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0148] Publications teaching the preparation of some of the above and other modified nucleobases include, but are not limited to, Manoharan et al., US2003 / 0158403; Manoharan et al., US2003 / 0175906; Dinh et al., US4,845,205; Spielvogel et al., US5,130,302; Rogers et al., US5,134,066; Bischofberger et al., US5,175,273; Urdea et al., US5,367,066; Benner et al., US5,432,272; Matteucci et al., US5,434,257; Gmeiner et al., US5,457,187; Cook et al., US5,459,255; Froehler et al., US5,459,255; al.,US5,484,908;Matteucci et al.,US5,502,177;Hawkins e t al., U.S. 5,525,711; Haralambidis et al., U.S. 5,552,540; Cook et al., U.S. 5,587,469; Froehler et al., U.S. 5,594,121; Switzer et al., U.S. 5,596,091; Cook et al., U.S. 5,614,617; Froehler et al., U.S. 5,645,985; Cook et al., U.S. 5,681,941; Cook et al., U.S. 5,811,534; Cook et al., U.S. 5,750,692; Cook et al., U.S. 5,948,903; Cook et al., U.S. 5,587,470; Cook et al., U.S. 5,457,191; Matteucci et al., U.S. 5,763,588; Froehler et al., U.S. 5,830,653; Cook et al., U.S. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. 6,005,096.

[0149] 3. Specific modified nucleoside linkages In certain embodiments, the nucleosides of modified oligonucleotides can be linked together using any internucleoside linkage. Two major classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester linkages (phosphates containing "P=O" (also called unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P=S"), and dithiophosphates ("HS-P=S"). Representative non-phosphorus-containing internucleoside linking groups include methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiesters, thionocarbamate (-OC(=O)(NH)-S-), cyclohexyl esters, and cyclohexyl esters. Modified internucleoside linkages, as compared to naturally occurring phosphate linkages, can alter, typically increase, the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as racemic mixtures or as separate enantiomers. Methods for the preparation of phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those of skill in the art.

[0150] Representative internucleoside linkages with chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages in which all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. Nevertheless, as is well understood by those skilled in the art, each individual phosphorothioate of an individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, a particular configuration of phosphorothioate linkages is present in at least 65% of the molecules in the population. In certain embodiments, a particular configuration of phosphorothioate linkages is present in at least 70% of the molecules in the population. In certain embodiments, a particular configuration of phosphorothioate linkages is present in at least 80% of the molecules in the population. In certain embodiments, a particular configuration of phosphorothioate linkages is present in at least 9 ... A given configuration is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, such as those described in Oka et al., JACS 125,8307 (2003), Wan et al. Nuc. Acid. Res. 42,13456 (2014), and WO 2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase:

[0151] [ka]

[0152] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or of a specific stereochemical configuration.

[0153] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl, and thioformacetal (3'-S-CH2-O-5'). Additionally, neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylates, carboxamides, sulfides, sulfonates, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65.) Additionally, neutral internucleoside linkages include non-ionic linkages containing mixed N, O, S, and CH2 constituent moieties.

[0154] B. Specific Motifs In certain embodiments, modified oligonucleotides comprise one or more nucleosides comprising modified sugar moieties. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified nucleobases. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of the modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and nucleobases define a pattern or motif. The internucleoside linkage patterns are each independent of one another. Thus, a modified oligonucleotide can be described by its sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, a nucleobase motif describes a modification to a nucleobase independent of the sequence of the nucleobase).

[0155] 1. Specific glyco-motifs In certain embodiments, oligonucleotides contain one or more modified and / or unmodified sugar moieties arranged along the oligonucleotide or regions thereof in a defined pattern or sugar motif, which in certain cases includes, but is not limited to, any of the sugar modifications discussed herein.

[0156] In certain embodiments, the modified oligonucleotide comprises or consists of a region having a gapmer motif defined by two external regions or "wings" and a central or internal region or "gap". The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides, with at least a portion of the sugar moiety of each nucleoside of the wing being different from at least a portion of the sugar moiety of the nucleoside of the gap. Specifically, at least the sugar moiety of the nucleoside of each wing that is closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleoside, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are identical to one another. In certain embodiments, the gap comprises one or more nucleosides having a sugar moiety that is different from the sugar moieties of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are identical to each other (symmetric sugar gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric sugar gapmers).

[0157] In certain embodiments, the wings of the gapmer comprise 1-5 nucleosides. In certain embodiments, each nucleoside in each wing of the gapmer is a modified nucleoside. In certain embodiments, at least one nucleoside in each wing of the gapmer is a modified nucleoside. In certain embodiments, at least two nucleosides in each wing of the gapmer are modified nucleosides. In certain embodiments, at least three nucleosides in each wing of the gapmer are modified nucleosides. In certain embodiments, at least four nucleosides in each wing of the gapmer are modified nucleosides.

[0158] In certain embodiments, the gapmer gap comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap is an unmodified 2'-deoxynucleoside. In certain embodiments, at least one nucleoside of the gapmer gap is a modified nucleoside.

[0159] In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, the nucleosides on the gap side of each wing / gap junction are unmodified 2'-deoxynucleosides and the wing side of each wing / gap junction are modified nucleosides. In certain embodiments, each nucleoside of the gap is an unmodified 2'-deoxynucleoside. In certain embodiments, each nucleoside of each wing of the gapmer is a modified nucleoside.

[0160] In certain embodiments, the modified oligonucleotide comprises or consists of a region having a fully modified sugar motif. Each nucleoside of the modified region comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the modified oligonucleotide comprises or consists of a region having a fully modified sugar motif, where each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, the fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of the uniform modification comprises the same 2'-modification.

[0161] Here, the lengths (number of nucleosides) of the three regions of the gapmer may be provided using the notation [number of nucleosides in the 5'-wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3'-wing]. Thus, a 5-10-5 gapmer consists of five linked nucleosides in each wing and 10 linked nucleosides in the gap. When such nomenclature is followed by a specific modification, the modification is a modification of each sugar moiety in each wing, with the gap nucleosides containing an unmodified deoxynucleoside sugar. Thus, a 5-10-5 MOE gapmer consists of five linked MOE modified nucleosides in the 5' wing, 10 linked deoxynucleosides in the gap, and five linked MOE nucleosides in the 3' wing.

[0162] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 BNA gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 LNA gapmer.

[0163] 2. Specific Nucleobase Motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or regions thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all cytosine nucleobases are 5-methylcytosine and all other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0164] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within three nucleosides of the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within three nucleosides of the 5' end of the oligonucleotide.

[0165] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is present in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2'-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0166] 3. Specific internucleoside linkage motifs In certain embodiments, the oligonucleotides contain modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or regions thereof in a defined pattern or motif. In certain embodiments, each internucleoside linking group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linking group of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linking group of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereo-random phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all of the internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all phosphorothioate linkages are stereorandom. In certain embodiments, all phosphorothioate linkages in the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that comprise such internucleoside linkage motifs.

[0167] C. Specific length The length of the oligonucleotide can be increased or decreased without eliminating activity. See, e.g., Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309,1992), a series of oligonucleotides ranging from 13 to 25 nucleobases in length were tested in an oocyte injection model for their ability to induce cleavage of target RNA. Oligonucleotides 25 nucleobases in length containing 8 or 11 mismatched bases near the ends of the oligonucleotide were able to induce specific cleavage of the target mRNA, although this was inferior to oligonucleotides containing no mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides (including those with one or three mismatches).

[0168] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of length ranges. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, with the proviso that X≦Y. For example, in certain embodiments, the oligonucleotide is selected from the group consisting of 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13~24, 13~25, 13~26, 13~27, 13~28, 13~29, 13~30, 14~15, 14~16, 14~17, 14~18, 14~19, 14~20, 14~21, 14~22, 14~23, 14~24, 14~25, 14~26, 14~27, 14~28, 14~29, 14~30, 15~16, 15~17, 15~18, 15~19, 15~20, 15~21, 15~22, 15~23, 15~24, 15~25, 15~26, 15~27, 15~28, 15~ 29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16-29, 16-30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26, 18~27, 18~28, 18~29, 18~30, 19~20, 19~21, 19~22, 19~23, 19~24, 19~25, 19~26, 19~29, 19~28, 19~29, 19~30, 20~21, 20~22, 20~23, 20~24, 20~25, 20~26, 20~27, 20~28, 20~29, 20~30, 21~22, 21~23, 21~24, 21~25, 21~26, 21~27, 21~28, 21~29, 21~30, 22~23, 22~24, 22~ 25, 22-26, 22-27, 22-28, 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.

[0169] D. Certain Modified Oligonucleotides In certain embodiments, the above-mentioned modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, each such parameter is independent of the other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages in the wing region of the sugar gapmer may be identical to each other or different, and may be identical to or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases independent of the gapmer pattern of sugar modification. Unless otherwise indicated, all modifications are independent of the nucleobase sequence.

[0170] E. Specific Populations of Modified Oligonucleotides A population of modified oligonucleotides, where all modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chiral enriched population. All chiral centers of all modified oligonucleotides are stereorandom in a stereorandom population. In a chiral enriched population, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of the chiral enriched population are enriched in β-D ribosyl sugar moieties and all phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of the chiral enriched population are enriched for both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.

[0171] F. Nucleotide Sequence In certain embodiments, the oligonucleotide (unmodified or modified oligonucleotide) is , further described by their nucleobase sequences. In certain embodiments, the oligonucleotide has a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain such embodiments, a region of the oligonucleotide has a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid.

[0172] I. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds consisting of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. The conjugate group can be attached to either or both termini of the oligonucleotide and / or at any internal position. In certain embodiments, the conjugate group is attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, the conjugate group attached to either or both termini of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is attached to the 3' and / or 5' termini of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is attached to the 3' terminus of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached near the 3' terminus of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached to the 5' terminus of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3' terminus of the oligonucleotide.

[0173] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.

[0174] A. Specific Conjugation Groups In certain embodiments, oligonucleotides are covalently linked to one or more conjugate groups.In certain embodiments, the conjugate group modulates one or more properties of the linked oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.In certain embodiments, the conjugate group provides the linked oligonucleotide with novel properties, such as fluorophores or reporter groups that allow detection of the oligonucleotide. Specific conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), choline acids (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterols (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains, e.g., dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimi e, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0175] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0176] In certain embodiments, the conjugate group includes an active drug substance, such as, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepines, indomethicin, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial drugs, or antibiotics.

[0177] 2. Conjugate Linker The conjugate moiety is linked to the oligonucleotide via a conjugate linker.In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly linked to the oligonucleotide via a single bond).In certain embodiments, the conjugate linker comprises a chain structure such as a hydrocarbyl chain or an oligomer of repeating units of ethylene glycol, nucleoside, or amino acid units.

[0178] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0179] In certain embodiments, the conjugate linker, including the conjugate linker described above, is known in the art to be useful for attaching a bifunctional linking moiety, such as a conjugate group, to a parent compound, such as an oligonucleotide provided herein. In general, the bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, electrophiles that react with nucleophilic groups and nucleophiles that react with electrophilic groups. In certain embodiments, the bifunctional linking moiety comprises one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0180] Examples of conjugate linkers include, but are not limited to, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl or substituted or unsubstituted C2-C 10 For alkynyl, a non-limiting list of preferred substituents includes, but is not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0181] In certain embodiments, the conjugate linker comprises 1-10 linker nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is typically desired for the linker nucleoside to be cleaved from the oligomeric compound after the oligomeric compound reaches the target site. Thus, the linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0182] As used herein, linker nucleosides are not considered to be part of an oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugated linker that comprises linker nucleosides, those linker nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides, and (2) a conjugate group comprising 1-10 linker nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. In such an oligomeric compound, The total number of consecutively linked nucleosides does not exceed 30. Unless otherwise indicated, a conjugate linker comprises 10 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 5 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 3 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 2 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 1 or fewer linker nucleosides.

[0183] In certain embodiments, it is desirable that the conjugate group is cleaved from the oligonucleotide. For example, in some situations, oligomeric compounds that contain certain conjugate moieties are better taken up into certain cell types, but it is desirable that the conjugate group is cleaved to release the unconjugated oligonucleotide or parent oligonucleotide once the oligomeric compound is taken up. Thus, certain conjugate linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has 1, 2, 3, 4, or more than 4 cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside the cell or in an intracellular compartment, such as lysosomes. In certain embodiments, the cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

[0184] In certain embodiments, the cleavable bond is selected from among amide, ester, ether, one or both esters of a phosphodiester, phosphate ester, carbamate, or disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between an oligonucleotide and a conjugate moiety or a conjugate group.

[0185] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside that is linked to either the 3' or 5' end nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the conjugate anchor or the remainder of the conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0186] B. Specific End Groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphates, including, but not limited to, 5'-vinylphosphonates. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides.

[0187] III. Oligomeric Duplexes In certain embodiments, the oligomeric compounds described herein comprise an oligonucleotide having a nucleobase sequence complementary to a nucleobase sequence of a target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a region complementary to a target nucleic acid, and a second oligomeric compound having a region complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. Either or both oligomeric compounds of the oligomeric duplex may comprise a conjugate group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may comprise a non-complementary overhanging nucleoside.

[0188] IV. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to target nucleic acid and produce at least one antisense activity. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity if they reduce or inhibit the amount or activity of target nucleic acid by 25% or more in standard cell assays. In certain embodiments, antisense compounds specifically hybridize to one or more target nucleic acids. Such antisense compounds include nucleic acid sequences that hybridize to one or more target nucleic acids to produce one or more desired antisense activities, and do not hybridize to one or more non-target nucleic acids or do not hybridize to one or more non-target nucleic acids in such a manner that produces significant undesired antisense activity.

[0189] In certain antisense activities, hybridization of antisense compounds to target nucleic acids results in the recruitment of proteins that cleave the target nucleic acid. For example, certain antisense compounds result in cleavage of target nucleic acids via RNaseH. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA of such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gap of a gapmer are tolerated.

[0190] In certain antisense activity, antisense compound or part of antisense compound is loaded into RNA-induced silencing complex (RISC), and finally target nucleic acid is cleaved.For example, certain antisense compound causes cleavage of target nucleic acid by Argonaute.The antisense compound loaded into RISC is RNAi compound.RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).

[0191] In certain embodiments, the hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in a change in the splicing of the target nucleic acid. In some embodiments, the hybridization of an antisense compound to a target nucleic acid results in the inhibition of the binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in a change in the translation of the target nucleic acid.

[0192] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity comprises observing or detecting a change in the amount of a target nucleic acid or a nucleic acid encoded by such a target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a phenotypic change in a cell or subject.

[0193] V. Specific Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA, including introns, exons, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is an RNA transcript of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is selected from long non-coding RNA, short non-coding RNA, and intronic RNA molecules.

[0194] A. Complementarity / Mismatch to Target Nucleic Acid Mismatch bases can be introduced without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA was active in reducing the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide also showed strong antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides and 28 and 42 nucleobase oligonucleotides composed of sequences of two or three tandem oligonucleotides, respectively, for their ability to stop the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase antisense oligonucleotides alone was able to inhibit translation, although to a lower level than either the 28 nucleobase or the 42 nucleobase antisense oligonucleotides.

[0195] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and includes a region that is 100% or fully complementary to the target nucleic acid. In certain such embodiments, the region of full complementarity is 6-20, 10-18, or 18-20 nucleobases in length.

[0196] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases compared to the target nucleic acid. In certain embodiments, the antisense activity against the target is reduced by such mismatches, but the activity against the non-target is reduced to a greater extent. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatch is specifically located within the oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is located at 1, 2, 3, 4, 5, 6, 7, or 8 positions from the 5' end of the gap region. In certain embodiments, the mismatch is located at 9, 8, 7, 6, 5, 4, 3, 2, or 1 positions from the 3' end of the gap region. In certain embodiments, the mismatch is located at 1, 2, 3, or 4 positions from the 5' end of the wing region. In certain embodiments, the mismatch is located at 4, 3, 2, or 1 positions from the 3' end of the wing region.

[0197] B. KCNT1 In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a KCNT1 nucleic acid. In certain embodiments, the KCNT1 nucleic acid has a sequence as set forth in SEQ ID NO: 1 (GENBANK Accession No.: NM_020822.2). In certain embodiments, the KCNT1 nucleic acid has a sequence as set forth in SEQ ID NO: 2 (GENBANK Accession No.: NC_000009.12, with nucleotides 135698001-135796000 truncated). In certain embodiments, the KCNT1 nucleic acid has a sequence as set forth in SEQ ID NO: 3 (GENBANK Accession No.: NM_020822.3), which is a splice variant of SEQ ID NO: 1.

[0198] In certain embodiments, an oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3 can reduce KCNT1 RNA in a cell. In certain embodiments, an oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3 can reduce KCNT1 protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound is comprised of a modified oligonucleotide. In certain embodiments, an oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3 can improve one or more symptoms or characteristics of a neurological condition when it is introduced into a cell in a subject. In certain embodiments, the neurological condition is epilepsy. In certain embodiments, the one or more symptoms or characteristics are selected from seizures, brain injury, demyelination, hypotonia, microcephaly, depression, anxiety, and cognitive impairment, and combinations thereof.

[0199] In certain embodiments, the oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3 can reduce the detectable amount of KCNT1 RNA in the CSF of a subject when the oligomeric compound is administered to the CSF of the subject. The detectable amount of KCNT1 RNA can be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, the oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3 can reduce the detectable amount of KCNT1 protein in the CSF of a subject when the oligomeric compound is administered to the CSF of a subject. The detectable amount of KCNT1 protein can be reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0200] C. Specific target nucleic acids in specific tissues In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide that comprises a region that is complementary to a target nucleic acid, and the target nucleic acid is expressed in pharmacologically relevant tissue.In certain embodiments, the pharmacologically relevant tissue is the cells and tissues that constitute the central nervous system (CNS).Such tissues include brain tissues such as cortex, substantia nigra, striatum, midbrain, brainstem, and spinal cord.

[0201] VI. Certain Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of a sterile saline solution and one or more antisense compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0202] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0203] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients, hi certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0204] In certain embodiments, the oligomeric compounds may be mixed with pharma- ceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The methods for formulating the compositions and pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0205] In certain embodiments, the pharmaceutical composition comprising the oligomeric compound comprises any pharma- ceutically acceptable salt of the oligomeric compound, an ester of the oligomeric compound, or a salt of such an ester. In certain embodiments, the pharmaceutical composition comprising the oligomeric compound comprises one or more oligonucleotides that can provide (directly or indirectly) a biologically active metabolite or residue thereof upon administration to a subject, including a human. Thus, for example, the present disclosure is directed to pharma- ceutically acceptable salts of the oligomeric compound, prodrugs, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrug comprises one or more conjugate groups attached to the oligonucleotide, the conjugate groups being cleaved by endogenous nucleases in the body.

[0206] Lipid moieties have been used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids, such as oligomeric compounds, are introduced into preformed liposomes or lipoplexes made from a mixture of cationic and neutral lipids. In certain methods, DNA complexes with monocationic or polycationic lipids are formed without the presence of neutral lipids. In certain embodiments, the lipid moieties are selected to increase the distribution of pharmaceuticals to specific cells or tissues. In certain embodiments, the lipid moieties are selected to increase the distribution of pharmaceuticals to adipose tissue. In certain embodiments, the lipid moieties are selected to increase the distribution of pharmaceuticals to muscle tissue.

[0207] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those that include hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.

[0208] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents of the present invention to a particular tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0209] In certain embodiments, the pharmaceutical composition comprises a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3 w / v% benzyl alcohol, 8 w / v% of the non-polar surfactant Polysorbate 80™, and 65 w / v% polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems may vary significantly without significantly changing their solubility and toxicity characteristics. Furthermore, the identity of the co-solvent components may be changed, for example, other surfactants may be used in place of Polysorbate 80™, the fraction size of the polyethylene glycol may be changed, other biocompatible polymers may replace the polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides may replace dextrose.

[0210] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or saline buffer. In certain embodiments, other ingredients (e.g., ingredients that aid solubility or serve as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Certain pharmaceutical compositions for injection are provided in unit dosage form, for example, in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may include formulatory agents such as suspending agents, stabilizing agents, and / or dispersing agents. Particular solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0211] Under certain conditions, certain compounds disclosed herein act as acids. Such compounds may be drawn or described in relation to a protonated (free acid) form, or an ionized, cationic (salt) form, but aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphate linkages of an oligonucleotide in aqueous solution exist in equilibrium between the free acid, anionic, and salt forms. Unless otherwise indicated, the compounds described herein are intended to include all such forms. Moreover, a particular oligonucleotide may have several such linkages, each of which is in equilibrium. Thus, an oligonucleotide in solution exists as a collection of forms in multiple positions that are all in equilibrium. The term "oligonucleotide" is intended to include all such forms. Drawn structures necessarily represent a single form. Nevertheless, unless otherwise indicated, such drawings are intended to include the corresponding forms as well. In this specification, a structure showing the free acid of a compound followed by the term "or a salt thereof" explicitly includes all such forms that may be fully or partially protonated / deprotonated / associated with a cation. In certain instances, one or more specific cations are identified.

[0212] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0213] Certain specific doses are described herein. The doses may be in the form of dosage units. For clarity, a dose (or dosage unit) of a modified oligonucleotide or oligomeric compound in milligrams refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As mentioned above, in an aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for purposes of calculating the dose, the modified oligonucleotide or oligomeric compound is assumed to exist as a solvent-free, sodium acetate-free, anhydrous, free acid. For example, when the modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or fully deprotonated and associated with Na+ ions. However, the mass of the Na+ ions is not counted in the weight of the dose, even though the mass of the protons is counted in the weight of the dose. Thus, for example, an 80 mg dose or dosage unit of Compound No. 1080855 is equal to the number of fully protonated molecules weighing 80 mg. This corresponds to 85 mg of solvent-free, sodium acetate-free, anhydrous sodium Compound No. 1080855. When an oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dosage of such an oligomeric compound. When the conjugate group also contains an acid, the conjugate group is also assumed to be fully protonated for the purposes of calculating the dosage.

[0214] Non-Limiting Disclosure and Incorporation by Reference Each literature and patent publication cited herein is incorporated herein by reference in its entirety.

[0215] While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit them. Each of the references, GenBank accession numbers, etc. listed in this application is incorporated herein by reference in its entirety.

[0216] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" where appropriate, in practice, the sequences may be modified with any combination of chemical modifications. Those skilled in the art will readily recognize that such designations of "RNA" or "DNA" to describe modified oligonucleotides are optional in certain cases. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base may be described as a DNA with a modified sugar (2'-OH instead of one 2'-H of DNA) or as an RNA with a modified base (thymine (methylated uracil) instead of uracil of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids with modified nucleobases. As a further example and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG", whether modified or unmodified, can be used with such compounds which contain RNA bases, e.g., those having the sequence "AUCGAUCG", as well as those having some DNA bases and some RNA bases, such as "AUCGATCG", and those having the sequence "AT m CGAUCG" in which m C encompasses any oligomeric compound having such a nucleobase sequence, including, but not limited to, those containing oligomeric compounds having other modified nucleobases, such as those exhibiting a cytosine base containing a methyl group at the 5-position.

[0217] Certain compounds described herein (e.g., modified oligonucleotides) contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), α or β, such as in the case of sugar anomers, or (D) or (L), such as in the case of amino acids. Compounds provided herein that are depicted or described as having stereoisomeric configurations include only the compounds depicted. Compounds provided herein that are depicted or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless otherwise indicated. Similarly, tautomeric forms of the compounds herein are also included, unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include the corresponding salt forms.

[0218] The compounds described herein include modifications in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds herein containing hydrogen atoms include 1 Isotopic substitutions encompassed in the compounds herein are: 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36 Non-radioactive isotope substitutions include, but are not limited to, S. In certain embodiments, non-radioactive isotope substitutions may provide novel properties to the oligomeric compounds that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitutions may make the compounds suitable for research or diagnostic purposes, such as imaging. EXAMPLES

[0219] The following examples are illustrative of the specific embodiments of the present disclosure, but are not limiting.Furthermore, when specific embodiments are provided, the inventors intend the general application of those specific embodiments.For example, the disclosure of an oligonucleotide having a specific motif provides rational support for other oligonucleotides having that motif or similar motifs.Similarly, for example, when a specific high affinity modification appears at a specific position, other high affinity modifications at the same position are considered to be suitable, unless otherwise indicated.

[0220] Example 1: Effect of 5-10-5 MOE gapmer-modified oligonucleotides on human KCNT1 RNA in vitro by single dose administration Modified oligonucleotides complementary to human KCNT1 nucleic acid were tested for their effect on KCNT1 RNA levels in vitro. The modified oligonucleotides in the table below are 5-10-5 MOE gapmers with mixed internucleoside linkages. The gapmers are 20 nucleosides in length with a central gap segment consisting of 10 2'-β-D-deoxynucleosides and the 3' and 5' wings consisting of 5 2'-MOE nucleosides each. The gapmer motif is (from 5' to 3'): eeeeeddddddddddeeeee; where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. The gapmer internucleoside linkage motif is (from 5' to 3'): sooooosssssssssss; where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5 methyl-cytosines.

[0221] "Start Site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence. "End Site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (GENBANK Accession No. NM_020822.2) or SEQ ID NO:2 (GENBANK Accession No.: NC_000009.12, truncated from nucleotides 135698001 to 135796000). "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular gene sequence.

[0222] SH-SY5Y cells (a neuroblastoma cell line) cultured at a density of 20,000 cells per well were treated with 4,000 nM of modified oligonucleotides by electroporation. After a treatment period of approximately 24 h, total RNA was isolated from the cells and KCNT1 RNA levels were measured by quantitative real-time RT-PCR. Human KCNT1 primer probe set RTS39508 (forward sequence GTCAACGTGCAGACCATGT, herein designated as SEQ ID NO: 11; reverse sequence TCGCTCCCTCTTTTCTAGTTTG, herein designated as SEQ ID NO: 12; probe sequence AGCTCACCCACCCTTCCAACATG, herein designated as SEQ ID NO: 13) was used to measure the RNA levels shown in Tables 1-6, and human KCNT1 primer probe set RTS39496 (forward sequence CAGGTGGAGTTCTACGTCAA, herein designated as SEQ ID NO: 14; reverse sequence GAGAAGTTGAACAGCCGGAT, herein designated as SEQ ID NO: 15; probe sequence TGATGAAGAACAGCTTGAGCCGCT, herein designated as SEQ ID NO: 16) was used to measure the RNA levels shown in Tables 7-38. KCNT1 RNA levels were normalized to total RNA content measured by RIBOGREEN®. The reduction of KCNT1 RNA is shown in Tables 1-6 below as a percentage of KCNT1 RNA levels compared to untreated control (UTC) cells. Each table represents the results of an individual assay plate. "ND" indicates that due to experimental error, %UTC was not defined for that particular modified oligonucleotide in that particular experiment. However, the activity of selected modified oligonucleotides, including those not defined in Example 1, is successfully demonstrated in Example 2.

[0223] [Table 1-1]

[0224] [Table 1-2]

[0225]

Table 1-3

[0226]

Table 2-1

[0227]

Table 2-2

[0228]

Table 2-3

[0229]

Table 3-1

[0230]

Table 3-2

[0231]

Table 3-3

[0232]

Table 4-1

[0233]

Table 4-2

[0234]

Table 4-3

[0235]

Table 5-1

[0236]

Table 5-2

[0237]

Table 5-3

[0238]

Table 6-1

[0239]

Table 6-2

[0240]

Table 6-3

[0241]

Table 7-1

[0242]

Table 7-2

[0243]

Table 7-3

[0244]

Table 8-1

[0245]

Table 8-2

[0246]

Table 8-3

[0247]

Table 9-1

[0248]

Table 9-2

[0249]

Table 9-3

[0250]

Table 10-1

[0251]

Table 10-2

[0252]

Table 10-3

[0253]

Table 11-1

[0254]

Table 11-2

[0255]

Table 11-3

[0256]

Table 12-1

[0257]

Table 12-2

[0258]

Table 12-3

[0259]

Table 13-1

[0260]

Table 13-2

[0261]

Table 13-3

[0262]

Table 14-1

[0263]

Table 14-2

[0264]

Table 14-3

[0265]

Table 15-1

[0266]

Table 15-2

[0267]

Table 15-3

[0268]

Table 16-1

[0269]

Table 16-2

[0270]

Table 16-3

[0271]

Table 17-1

[0272]

Table 17-2

[0273]

Table 17-3

[0274]

Table 18-1

[0275]

Table 18-2

[0276]

Table 18-3

[0277]

Table 19-1

[0278]

Table 19-2

[0279]

Table 19-3

[0280]

Table 20-1

[0281]

Table 20-2

[0282]

Table 20-3

[0283]

Table 21-1

[0284]

Table 21-2

[0285]

Table 21-3

[0286]

Table 22-1

[0287]

Table 22-2

[0288]

Table 22-3

[0289]

Table 23-1

[0290]

Table 23-2

[0291]

Table 23-3

[0292]

Table 24-1

[0293]

Table 24-2

[0294]

Table 24-3

[0295]

Table 25-1

[0296]

Table 25-2

[0297]

Table 25-3

[0298]

Table 26-1

[0299]

Table 26-2

[0300]

Table 26-3

[0301]

Table 27-1

[0302]

Table 27-2

[0303]

Table 27-3

[0304]

Table 28-1

[0305]

Table 28-2

[0306]

Table 28-3

[0307]

Table 29-1

[0308]

Table 29-2

[0309]

Table 29-3

[0310]

Table 30-1

[0311]

Table 30-2

[0312]

Table 30-3

[0313]

Table 31-1

[0314]

Table 31-2

[0315]

Table 31-3

[0316]

Table 32-1

[0317]

Table 32-2

[0318]

Table 32-3

[0319]

Table 33-1

[0320]

Table 33-2

[0321]

Table 33-3

[0322]

Table 34-1

[0323]

Table 34-2

[0324]

Table 34-3

[0325]

Table 35-1

[0326]

Table 35-2

[0327]

Table 35-3

[0328]

Table 36-1

[0329]

Table 36-2

[0330]

Table 36-3

[0331]

Table 37-1

[0332]

Table 37-2

[0333]

Table 37-3

[0334]

Table 38-1

[0335]

Table 38-2

[0336]

Table 38-3

[0337] Example 2: Effect of modified oligonucleotides on human KCNT1 RNA in vitro with multiple administration Modified oligonucleotides selected from the above examples were tested at various doses in SH-SY5Y cells. SH-SY5Y cells cultured at a density of 20,000 cells per well were treated with various doses of modified oligonucleotides by electroporation as specified in the table below. After a treatment period of about 24 hours, total RNA was isolated from the cells and the RNA levels of KCNT1 were measured by quantitative real-time RTPCR. The RNA levels shown in Tables 39-42 were measured using human KCNT1 primer probe set RTS39508 (forward sequence GTCAACGTGCAGACCATGT, designated as SEQ ID NO: 11; reverse sequence TCGCTCCCTCTTTTCTAGTTTG, designated as SEQ ID NO: 12; probe sequence AGCTCACCCACCCTTCCAACATG, designated as SEQ ID NO: 13), and the RNA levels shown in Tables 43-60 were measured using human KCNT1 primer probe set RTS39496 (forward sequence CAGGTGGAGTTCTACGTCAA, designated as SEQ ID NO: 14; reverse sequence GAGAAGTTGAACAGCCGGAT, designated as SEQ ID NO: 15; probe sequence TGATGAAGAACAGCTTGAGCCGCT, designated as SEQ ID NO: 16). Each table represents the results of an individual assay plate. KCNT1 RNA levels were adjusted for total RNA content measured by RIBOGREEN®. The results are shown in the following table as a percentage reduction in the amount of KCNT1 RNA compared to untreated controls. The half-maximal inhibitory concentration (IC 50 ) is also shown. 50 was calculated using linear regression of a log / linear plot of the data in Excel. IC 50 If it cannot be calculated reliably, NC (not calculated) may be displayed.

[0338]

Table 39

[0339]

Table 40

[0340]

Table 41

[0341]

Table 42

[0342]

Table 43

[0343]

Table 44

[0344]

Table 45

[0345]

Table 46

[0346]

Table 47

[0347]

Table 48

[0348]

Table 49

[0349]

Table 50

[0350]

Table 51

[0351]

Table 52

[0352]

Table 53

[0353]

Table 54

[0354]

Table 55

[0355]

Table 56

[0356]

Table 57

[0357]

Table 58

[0358]

Table 59

[0359]

Table 60

Claims

1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified nucleotides is at least 90% complementary to an equal length portion of a KCNT1 nucleic acid, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and comprising at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases of any of SEQ ID NOs:21-2939.

3. comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, Equal length portions of nucleobases 24523 to 24561 of SEQ ID NO:2; an equal length portion of nucleobases 27568 to 27603 of SEQ ID NO:2; an equal length portion of nucleobases 30772 to 30811 of SEQ ID NO:2; Equal length portions of nucleobases 54372 to 54428 of SEQ ID NO:2; an equal length portion of nucleobases 55785 to 55818 of SEQ ID NO:2; an equal length portion of nucleobases 56048 to 56073 of SEQ ID NO:2; Equal length portions of nucleobases 56319 to 56349 of SEQ ID NO:2; an equal length portion of nucleobases 57683 to 57710 of SEQ ID NO:2; an equal length portion of nucleobases 61117 to 61153 of SEQ ID NO:2; an equal length portion of nucleobases 71033 to 71060 of SEQ ID NO:2; an equal length portion of nucleobases 87135 to 87174 of SEQ ID NO:2; an equal length portion of nucleobases 92109 to 92149 of SEQ ID NO:2; an equal length portion of nucleobases 94221 to 94280 of SEQ ID NO:2; an equal length portion of nucleobases 94352 to 94380 of SEQ ID NO:2; an equal length portion of nucleobases 94993 to 95036 of SEQ ID NO:2; or an equal length portion of nucleobases 95074 to 95144 of SEQ ID NO:2; In some embodiments, the oligomeric compound has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases that are complementary to:

4. comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, Equal length portions of nucleobases 16586 to 16649 of SEQ ID NO:2; Equal length portions of nucleobases 16586 to 17823 of SEQ ID NO:2; Equal length portions of nucleobases 16586 to 18663 of SEQ ID NO:2; Equal length portions of nucleobases 19220 to 20568 of SEQ ID NO:2; Equal length portions of nucleobases 23003 to 25391 of SEQ ID NO:2; Equal length portions of nucleobases 27095 to 29908 of SEQ ID NO:2; Equal length portions of nucleobases 30452 to 30891 of SEQ ID NO:2; Equal length portions of nucleobases 31773 to 34427 of SEQ ID NO:2; Equal length portions of nucleobases 38458 to 47003 of SEQ ID NO:2; an equal length portion of nucleobases 40432 to 42873 of SEQ ID NO:2; an equal length portion of nucleobases 44414 to 45718 of SEQ ID NO:2; Equal length portions of nucleobases 52096 to 52153 of SEQ ID NO:2; Equal length portions of nucleobases 52096 to 58525 of SEQ ID NO:2; Equal length portions of nucleobases 59308 to 61697 of SEQ ID NO:2; Equal length portions of nucleobases 60111 to 61697 of SEQ ID NO:2; Equal length portions of nucleobases 65270 to 67169 of SEQ ID NO:2; Equal length portions of nucleobases 65270 to 67150 of SEQ ID NO:2; an equal length portion of nucleobases 67026 to 67065 of SEQ ID NO:2; an equal length portion of nucleobases 67026 to 67087 of SEQ ID NO:2; Equal length portions of nucleobases 67648 to 68527 of SEQ ID NO:2; an equal length portion of nucleobases 67955 to 67998 of SEQ ID NO:2; Equal length portions of nucleobases 68515 to 68583 of SEQ ID NO:2; an equal length portion of nucleobases 68538 to 68592 of SEQ ID NO:2; Equal length portions of nucleobases 68571 to 70874 of SEQ ID NO:2; an equal length portion of nucleobases 71037 to 71313 of SEQ ID NO:2; an equal length portion of nucleobases 71037 to 71184 of SEQ ID NO:2; Equal length portions of nucleobases 72851 to 72887 of SEQ ID NO:2; an equal length portion of nucleobases 79368 to 79483 of SEQ ID NO:2; Equal length portions of nucleobases 86554 to 90150 of SEQ ID NO:2; an equal length portion of nucleobases 88332 to 88448 of SEQ ID NO:2; Equal length portions of nucleobases 91686 to 95485 of SEQ ID NO:2; an equal length portion of nucleobases 91686 to 94431 of SEQ ID NO:2; or an equal length portion of nucleobases 94219 to 94275 of SEQ ID NO:2; said oligomeric compound having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases that are complementary to

5. 5. The oligomeric compound of any one of claims 1 to 4, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to a nucleobase sequence selected from SEQ ID NOs: 1-3 when measured over the entire nucleobase sequence of the modified oligonucleotide.

6. The oligomeric compound of any one of claims 1 to 5, wherein at least one modified nucleoside comprises a modified sugar moiety.

7. The oligomeric compound of claim 6 , wherein the modified sugar moiety comprises a bicyclic sugar moiety.

8. The bicyclic sugar moiety is -O-CH ２ -, and -O-CH(CH ３ 8. The oligomeric compound of claim 7, comprising a 2'-4' bridge selected from:

9. The oligomeric compound of claim 6 , wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.

10. 10. The oligomeric compound of claim 9, wherein said non-bicyclic modified sugar moiety comprises a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.

11. The oligomeric compound according to any one of claims 1 to 5, wherein said at least one modified nucleoside comprises a sugar surrogate.

12. 12. The oligomeric compound of claim 11, wherein the sugar surrogate is selected from morpholino and PNA.

13. the modified oligonucleotide comprising: a 5' region consisting of 1 to 5 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 5 linked 3' region nucleosides; 13. The oligomeric compound of any of claims 1 to 12, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises an unmodified 2'-deoxyribosyl sugar moiety.

14. The oligomeric compound according to any one of claims 1 to 13, wherein said modified oligonucleotide comprises at least one modified internucleoside linkage.

15. 15. The oligomeric compound of claim 14, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

16. 16. The oligomeric compound of claim 14 or 15, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

17. 17. The oligomeric compound of claim 14 or 16, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

18. 18. The oligomeric compound of any of claims 14, 16, or 17, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

19. The oligomeric compound according to any one of claims 1 to 18, wherein said modified oligonucleotide comprises at least one modified nucleobase.

20. 20. The oligomeric compound of claim 19, wherein said modified nucleobase is 5-methylcytosine.

21. 21. The oligomeric compound of any of claims 1-20, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20, 14-20, 15-25, 16-20, 18-22, or 18-20 linked nucleosides.

22. The oligomeric compound according to any one of claims 1 to 21, wherein said modified oligonucleotide consists of 20 linked nucleosides.

23. 23. The oligomeric compound of claim 22, wherein said modified oligonucleotide has internucleoside linkages sooooossssssssssss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage.

24. The oligomeric compound according to any one of claims 1 to 23, which consists of a modified oligonucleotide.

25. 24. An oligomeric compound according to any preceding claim, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

26. 26. The oligomeric compound of claim 25, wherein said conjugate group comprises a GalNAc cluster comprising from 1 to 3 GalNAc ligands.

27. 27. The oligomeric compound of claim 25 or 26, wherein the conjugate linker consists of a single bond.

28. 26. The oligomeric compound of claim 25, wherein the conjugate linker is cleavable.

29. 29. The oligomeric compound of claim 28, wherein said conjugate linker comprises from 1 to 3 linker nucleosides.

30. The oligomeric compound according to any of claims 25 to 29, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

31. The oligomeric compound according to any of claims 25 to 29, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

32. 32. The oligomeric compound of any one of claims 1 to 31, comprising a terminal group.

33. The oligomeric compound according to any one of claims 1 to 32, wherein said oligomeric compound is a single-stranded oligomeric compound.

34. 32. The oligomeric compound of any of claims 1-28 or 30-31, wherein said oligomeric compound does not contain a linker nucleoside.

35. The oligomeric compound according to any one of claims 1 to 34, wherein said modified oligonucleotide of said oligomeric compound is a salt, said salt being a sodium salt or a potassium salt.

36. An oligomeric duplex comprising an oligomeric compound according to any one of claims 1 to 32 and 34 to 35.

37. 37. An antisense compound comprising or consisting of an oligomeric compound according to any one of claims 1 to 35 or an oligomeric duplex according to claim 36.

38. A pharmaceutical composition comprising an oligomeric compound according to any one of claims 1 to 35 or an oligomeric duplex according to claim 36, and a pharma- ceutically acceptable carrier or diluent.

39. 39. The pharmaceutical composition of claim 38, wherein the pharma- cerebrospinal fluid is artificial cerebrospinal fluid or PBS.

40. 40. The pharmaceutical composition of claim 39, wherein said pharmaceutical composition consists essentially of said modified oligonucleotide and artificial cerebrospinal fluid.

41. A method comprising administering to a subject a pharmaceutical composition according to any one of claims 38 to 40.

42. 41. A method of treating a neurological condition, comprising administering to an individual having or at risk of developing said neurological condition a therapeutically effective amount of a pharmaceutical composition according to any of claims 38-40, thereby treating said neurological condition.

43. A method for reducing KCNT1 RNA or KCNT1 protein in the central nervous system of an individual having or at risk of developing a neurological condition, comprising administering a therapeutically effective amount of a pharmaceutical composition according to any one of claims 38 to 40, thereby reducing KCNT1 RNA or KCNT1 protein in the central nervous system.

44. 44. The method of claim 42 or 43, wherein the neurological condition comprises encephalopathy.

45. 44. The method of claim 42 or 43, wherein the neurological condition comprises epilepsy.

46. 44. The method of claim 42 or 43, wherein the neurological condition comprises infantile epilepsy.

47. 47. The method of claim 46, wherein the infantile epilepsy is epilepsy of infancy with migrating focal seizures (EIMFS).

48. 44. The method of claim 42 or 43, wherein the neurological condition is autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE).

49. The method of any of claims 41-48, wherein the administering is by intrathecal administration.

50. 50. The method of any of claims 42-49, wherein at least one symptom or characteristic of the neurological condition is ameliorated.

51. 51. The method of claim 50, wherein the symptom or characteristic is selected from seizures, brain injury, demyelination, hypotonia, microcephaly, depression, anxiety, and cognitive function.

52. The method of any of claims 42 to 51, wherein the method prevents or delays regression of the disease.

53. 38. A method of reducing KCNT1 RNA in a cell, comprising contacting the cell with an oligomeric compound of any one of claims 1-35, an oligomeric duplex of claim 36, or an antisense compound of claim 37, thereby reducing KCNT1 RNA in the cell.

54. 38. A method of reducing KCNT1 protein in a cell, comprising contacting the cell with an oligomeric compound of any one of claims 1-35, an oligomeric duplex of claim 36, or an antisense compound of claim 37, thereby reducing KCNT1 protein in the cell.

Images