Preventive and / or therapeutic agent for obesity and / or metabolic syndrome

Abstract

To provide a preventive and / or therapeutic agent for obesity and / or metabolic syndrome containing a component capable of promoting heat generation in adipocytes as an active ingredient.SOLUTION: The present invention provides a preventive and / or therapeutic agent for obesity and / or metabolic syndrome containing a compound represented by the general formula (1) or a pharmaceutically acceptable salt thereof as an active ingredient, wherein R1, R5, and R6 may be the same or different to represent a C1-6 alkyl group; and R2, R3, and R4 may be the same or different to represent a hydrogen atom or acetyl group.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to an agent for the prevention and / or treatment of obesity and / or metabolic syndrome. [Background technology]

[0002] It is well known that the number of patients suffering from obesity and metabolic syndrome is increasing worldwide. However, since the prevention and treatment methods for obesity and metabolic syndrome have not yet been established, research and development of these methods is being actively conducted both domestically and internationally. In recent years, a method of preventing and treating obesity and metabolic syndrome by promoting heat production by adipocytes has attracted attention. Adipocytes are broadly divided into two types: white adipocytes and brown adipocytes. The former have the function of storing surplus energy as fat and releasing the stored fat when energy is required, while the latter have the function of strongly expressing uncoupling protein 1 (UCP1) and breaking down the stored fat to generate heat. Brown fat cells, called beige fat cells because they are present scattered in subcutaneous adipose tissue in human adults, have been shown to regulate the metabolism of the entire body through recent research. For example, it is known that people with many brown fat cells have a high basal metabolic rate and are less likely to gain weight, while those who are more likely to gain weight due to the decline in brown fat cell activity with age. Therefore, if we can promote thermogenesis by enhancing the expression of UCP1 in brown fat cells, it is expected that this will contribute to the prevention and treatment of obesity and metabolic syndrome, and ultimately to the prevention and treatment of various health disorders related to obesity and metabolic syndrome, such as diabetes, dyslipidemia, hypertension, hyperuricemia, coronary artery disease, cerebral infarction, nonalcoholic fatty liver disease, menstrual disorders and infertility, obstructive sleep apnea syndrome, musculoskeletal disease, and obesity-related kidney disease.

[0003] From the above viewpoint, the search for components that can promote thermogenesis by fat cells has already been conducted, and for example, Patent Document 1 reports that succinic acid, gluconic acid, 2-keto-D-gluconic acid, etc. have the effect of promoting thermogenesis by fat cells. However, the search for new components that can promote thermogenesis by fat cells is still in a significant state. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] JP2017-193508A Summary of the Invention [Problem to be solved by the invention]

[0005] Therefore, an object of the present invention is to provide an agent for preventing and / or treating obesity and / or metabolic syndrome, which contains as an active ingredient an ingredient capable of promoting thermogenesis by adipocytes. [Means for solving the problem]

[0006] In light of the above, the inventors have conducted intensive research and have found that a compound represented by the following chemical structural formula has the effect of promoting thermogenesis by adipocytes, for example by inducing expression of UCP1 in brown adipose tissue.

[0007] [ka]

[0008] The preventive and / or therapeutic agent for obesity and / or metabolic syndrome of the present invention, which has been made based on the above findings, contains, as an active ingredient, a compound represented by the following general formula (1) or a pharma- ceutical acceptable salt thereof, as described in claim 1:

[0009] [ka]

[0010] [In the formula, R 1 , R 5 , R 6 R may be the same or different and represents an alkyl group having 1 to 6 carbon atoms. 2 , R 3 , R 4 are the same or different and represent a hydrogen atom or an acetyl group.

[0011] Furthermore, as set forth in claim 2, the UCP1 expression inducer of the present invention comprises a compound represented by the following general formula (1) or a pharma- ceutical acceptable salt thereof as an active ingredient.

[0012] [ka]

[0013] [In the formula, R 1 , R 5 , R 6 R may be the same or different and represents an alkyl group having 1 to 6 carbon atoms. 2 , R 3 , R 4 are the same or different and represent a hydrogen atom or an acetyl group. Effect of the Invention

[0014] According to the present invention, it is possible to provide an agent for preventing and / or treating obesity and / or metabolic syndrome, which contains as an active ingredient an ingredient capable of promoting thermogenesis by adipocytes. [Brief description of the drawings]

[0015] [Figure 1] 1 is a graph showing the body weight gain inhibitory effect of Compound 1 ((5-amino-4-((2-methoxyphenyl)carbamoyl)-3-methylthiophene-2-carboxylate ethyl)) in Experimental Example 1 using diet-induced obesity model mice. [Diagram 2]11 is a graph showing the effect of Compound 1 in reducing the weight of interscapular brown adipose tissue (BAT). [Diagram 3] 14 is a graph showing the liver weight reducing effect of Compound 1. [Figure 4] Same as above, a photograph of HE staining showing the effect of Compound 1 in reducing the amount of lipid droplets in the liver. [Diagram 5] 11 is a graph showing the UCP1 expression-inducing effect of Compound 1 in interscapular brown adipose tissue. [Figure 6] 1 is a graph showing the effect of Compound 1 in increasing the mRNA expression level of the Ucp1 gene in Experimental Example 2 using immortalized white adipocytes. [Figure 7] 13 is a graph showing the effect of Compound 1 in increasing the mRNA expression levels of heat production-related genes other than the Ucp1 gene (Pgc1a gene, Cidea gene, Tmem26 gene, and Cd137 gene). [Figure 8] 13 is a graph showing that SB203580, a p38MAPK inhibitor, prevents Compound 1 from increasing the amount of Ucp1 gene mRNA expression. [Figure 9] 13 is a graph showing that Compound 1 increases the expression levels of Cxcl14 gene, Kcnc2 gene, and Gm5627 gene, and that SB203580 inhibits the increase in the expression levels of these genes caused by Compound 1. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0016] The preventive and / or therapeutic agent for obesity and / or metabolic syndrome of the present invention contains as an active ingredient a compound represented by the following general formula (1) or a pharma- ceutical acceptable salt thereof. In the present invention, obesity is a state in which fat is excessively accumulated in adipose tissue, and is characterized by a body mass index (BMI = [body weight (kg)]÷[height (m) 2 ]) is 25kg / m 2Metabolic syndrome is defined as a waist circumference of 85 cm or more for men and 90 cm or more for women (visceral fat area of ​​100 cm or more). 2 It is understood to be a condition in which a person falls under the above-mentioned criteria (equivalent to blood glucose level of 150 mg / dL or higher) and is also suffering from two or more of the following three conditions: hyperlipidemia (blood triglycerides of 150 mg / dL or higher and / or blood HDL cholesterol of less than 40 mg / dL), hypertension (systolic blood pressure of 130 mmHg or higher and / or diastolic blood pressure of 85 mmHg or higher), and hyperglycemia (fasting blood glucose level of 110 mg / dL or higher), and is known to be at high risk of developing cardiovascular disease.

[0017] [ka]

[0018] [In the formula, R 1 , R 5 , R 6 R may be the same or different and represents an alkyl group having 1 to 6 carbon atoms. 2 , R 3 , R 4 are the same or different and represent a hydrogen atom or an acetyl group.

[0019] Here, the alkyl group having 1 to 6 carbon atoms may be linear or branched, and specific examples thereof include a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a sec-butyl group, a tert-butyl group, an n-pentyl group, an isopentyl group, and an n-hexyl group.

[0020] In addition, examples of pharma- ceutically acceptable salts, when the compound is acidic, include ammonium salts, alkali metal salts such as sodium salts and potassium salts, alkaline earth metal salts such as calcium salts and magnesium salts, amino acid salts such as arginine salts and lysine salts, etc. In cases where the compound is basic, examples of pharma- ceutically acceptable salts include inorganic acid salts (hydrochloride, sulfate, nitrate, phosphate, etc.), organic acid salts (acetate, lactate, citrate, tartrate, maleate, fumarate, oxalate, etc.), etc.

[0021] Specific examples of the compound represented by the above general formula (1) include compounds represented by the following chemical structural formulas.

[0022] [ka]

[0023] The compound represented by the above chemical structural formula (ethyl 5-amino-4-((2-methoxyphenyl)carbamoyl)-3-methylthiophene-2-carboxylate) is a known compound (CAS number: 354561-74-3) that is a white powder. Other compounds included in general formula (1) can be produced by the same production method as this compound, or can be produced by deriving it from this compound.

[0024] The preventive and / or therapeutic agent for obesity and / or metabolic syndrome of the present invention can be formulated into various dosage forms and taken orally as a medicine or health food, or can be mixed with various foods and drinks and taken. The dosage varies depending on the age and weight of the recipient, the severity of symptoms, the form of application, etc., but is not particularly limited. EXAMPLES

[0025] The present invention will be described in detail below with reference to examples, but the present invention should not be construed as being limited to the following description. In these examples, the compound (ethyl 5-amino-4-((2-methoxyphenyl)carbamoyl)-3-methylthiophene-2-carboxylate) represented by the following chemical structural formula is referred to as Compound 1.

[0026] [ka]

[0027] Experimental example 1: Experiment using diet-induced obesity model mice (1) Compound 1’s effect of suppressing weight gain C57BL / 6J male mice (Japan SLC, hereafter) were raised at room temperature (22°C) with a 12-hour light / dark cycle. The mice were fed standard feed (CE-2, Japan CLEA, hereafter) ad libitum until the age of 7 weeks, and then fed 60% high fat feed (HFD-60, Oriental Yeast Co., Ltd.) ad libitum for 18 weeks from the age of 7 weeks. Water was also given ad libitum. From the age of 16 weeks, Compound 1 (Enamine, hereafter) dissolved in DMSO was orally administered at 10 mg / kg or DMSO alone as a control every day for 9 weeks. Figure 1 shows the progress of weight gain in Compound 1-administered mice and DMSO-only-administered mice from the age of 7 weeks. As is clear from Figure 1, the extent of weight gain in Compound 1-administered mice was significantly smaller than that in DMSO-only-administered mice (Vehicle, hereafter) (n=7, p<0.001). No difference in food intake was observed between mice administered Compound 1 and mice administered DMSO alone. These results indicate that Compound 1 has the effect of suppressing weight gain in diet-induced obese mice.

[0028] (2) Effect of Compound 1 on reducing interscapular brown adipose tissue weight Interscapular brown adipose tissue and inguinal subcutaneous adipose tissue were excised from Compound 1-administered mice and DMSO-only-administered mice, and their weights were measured. The results are shown in Figure 2 (the weights of interscapular brown adipose tissue and inguinal subcutaneous adipose tissue from Compound 1-administered mice are shown as relative values, with the weights of interscapular brown adipose tissue and inguinal subcutaneous adipose tissue from DMSO-only-administered mice taken as 100). As is clear from Figure 2, there was no difference in the weight of inguinal subcutaneous adipose tissue (IngWAT) between Compound 1-administered mice and DMSO-only-administered mice, but the weight of interscapular brown adipose tissue (BAT) was significantly less in Compound 1-administered mice than in DMSO-only-administered mice (n=7, **p<0.01). In addition, histological analysis by HE staining (performed by preparing 4 μm-thick slices from tissue blocks fixed in 10% neutral buffered formalin, same below) showed that the amount of lipid droplets in the interscapular brown adipose tissue was smaller in mice administered Compound 1 than in mice administered DMSO alone (figure omitted). These results suggest that Compound 1 effectively acts on interscapular brown adipose tissue to promote heat production, promote the consumption of lipid droplets, and reduce the weight of interscapular brown adipose tissue.

[0029] (3) Compound 1’s effect on improving fatty liver The livers were excised from the mice administered Compound 1 and the mice administered only DMSO, and the weights were measured. The results are shown in Figure 3 (the liver weights of the mice administered Compound 1 are shown as relative values, with the liver weights of the mice administered only DMSO taken as 100). As is clear from Figure 3, the liver weights of the mice administered Compound 1 were significantly lower than those of the mice administered only DMSO (n=7, * p<0.05). Histological analysis using HE staining also showed that the amount of lipid droplets in the liver was less in mice administered Compound 1 than in mice administered DMSO alone (Figure 4, Scale bar: 200 μm). These results indicate that Compound 1 has an effect of improving fatty liver, and therefore Compound 1 has been found to have preventive and therapeutic effects against nonalcoholic fatty liver disease (NAFLD), one of the health disorders associated with obesity and metabolic syndrome.

[0030] (4) Compound 1 induces UCP1 expression in interscapular brown adipose tissue Interscapular brown adipose tissues from Compound1-treated and DMSO-treated mice were homogenized using RIPA Lysis Buffer System (Santa Cruz) containing a protease inhibitor cocktail to prepare tissue extracts, and subjected to SDS-PAGE using 4-20% precast polyacrylamide gels (Bio-Rad). The gels were transferred to PVDF membranes (Bio-Rad) and blocked with 5% skim milk / TBS-T or 5% BSA / TBS-T. UCP1 was detected using rabbit polyclonal anti-mouse UCP1 antibody (Abcam) as the primary antibody, HRP-labeled anti-rabbit IgG (Cell Signaling Technology) as the secondary antibody, and chemiluminescent HRP substrate (Thermo Fisher Scientific). The image data was processed with ImageJ 1.53k software to quantify the results. The relative intensity of the UCP1 signal to the signal intensity of α-tubulin used as a loading control in the Compound 1-administered mice is shown in Figure 5 as a relative value, with the relative intensity of the UCP1 signal to the signal intensity of α-tubulin in the DMSO-only-administered mice set at 1. As is clear from Figure 5, the expression level of UCP1 in the interscapular brown adipose tissue was significantly higher in the Compound 1-administered mice than in the DMSO-only-administered mice (n = 7, ** p<0.01).

[0031] Experimental Example 2: Experiment using immortalized white adipocytes (1) Compound 1 increases the mRNA expression of Ucp1 gene The effect of Compound 1 on increasing the mRNA expression of the Ucp1 gene was evaluated using immortalized white adipocytes established from wild-type mice. Specifically, immortalized white preadipocytes were established from the stromal vascular cell fraction extracted from the subcutaneous adipose tissue of the inguinal region of 7-week-old C57BL / 6J male mice fed standard chow and water ad libitum, and cultured in DMEM containing 10% FBS, 1% L-glutamine, 1% amphotericin B, and 1% penicillin-streptomycin. Immortalized white preadipocytes at 95-100% confluence were cultured in DMEM containing 10% FBS, 5 μg / mL insulin, 1 nM triiodothyronine, 0.125 mM indomethacin, 2 μg / mL dexamethasone, and 0.125 mM 3-isobutyl-1-methylxanthine for 2 days to induce differentiation into adipocytes. After that, various concentrations of Compound 1 dissolved in DMSO were added to DMEM containing 10% FBS, 5 μg / mL insulin, and 1 nM triiodothyronine and cultured. On the 6th day after differentiation induction, total RNA was isolated from the immortalized white adipocytes using TRIzol RNA Isolation Reagents (Thermo Fisher Scientific), reverse transcribed using iScript Reverse Transcription Supermix (Bio-Rad), and quantitative real-time PCR was performed using SsoFast EvaGreen Supermix (Bio-Rad) and the LightCycler 96 Instrument machine (Roche). Using the TATA binding protein gene and 36b4 gene as endogenous control genes, the relative expression level of the Ucp1 gene was determined by the ΔΔCt method. The relative expression level of the Ucp1 gene when various concentrations of Compound 1 dissolved in DMSO were added is shown in Figure 6 as a relative value, with the relative expression level of the Ucp1 gene when only DMSO was added as a control being set at 1. As is clear from Figure 6, Compound 1 was found to increase the mRNA expression level of the Ucp1 gene in immortalized white adipocytes in a concentration-dependent manner (n = 4, **p<0.01). It was also confirmed that Compound 1 increases the mRNA expression level of the Ucp1 gene in immortalized black adipocytes in a concentration-dependent manner. The primers used for quantitative real-time PCR were as follows: (Ucp1 gene) Forward:AGGCTTCCAGTACCATTAGGT (SEQ ID NO: 1) Reverse:CTGAGTGAGGCAAAGCTGATTT (SEQ ID NO:2) (TATA binding protein gene) Forward:AGAACAATCCAGACTAGCAGCA (SEQ ID NO:3) Reverse:GGGAACTTCACATCACAGCTC (SEQ ID NO:4) (36b4 gene) Forward:AGATTCGGGATATGCTGTTGGC (SEQ ID NO:5) Reverse:TCGGGTCCTAGACCAGTGTTC (SEQ ID NO:6)

[0032] (2) Compound 1 increases the mRNA expression of genes related to heat production other than Ucp1 In the quantitative real-time PCR performed in (1), the relative expression levels of thermogenesis-related genes other than the Ucp1 gene were also determined. The relative expression levels of the Pgc1a gene, Cidea gene, Tmem26 gene, and Cd137 gene when 10 μM Compound 1 dissolved in DMSO was added are shown in Figure 7 as relative values, with the relative expression level of each heat production-related gene when only DMSO was added as a control being set to 1. As is clear from Figure 7, Compound 1 was found to significantly increase the mRNA expression levels of the Pgc1a gene, Cidea gene, and Tmem26 gene in immortalized white adipocytes (n = 4, ** p<0.01). The primers used for quantitative real-time PCR were as follows: (Pgc1a gene) Forward: TATGGAGTGACATAGAGTGTGCT (SEQ ID NO: 7) Reverse: CCACTTCAATCCACCCAGAAAG (SEQ ID NO: 8) (Cidea gene) Forward:ATCACAACTGGCCTGGTTACG (SEQ ID NO: 9) Reverse:TACTACCCGGTGTCCATTTCT (SEQ ID NO: 10) (Tmem26 gene) Forward:TTCCTGTTGCATTCCCTGGTC (SEQ ID NO: 11) Reverse:GCCGGAGAAAGCCATTTGT (SEQ ID NO: 12) (Cd137 gene) Forward:CCTTGCAGGTCCTTACCTTGT (SEQ ID NO: 13) Reverse: GTTGCTTGAATATGTGGGGGA (SEQ ID NO: 14)

[0033] (3) Examination of the mechanism of heat production in adipocytes by Compound 1 Immortalized white adipocytes were cultured in DMEM containing 10% FBS, 5 μg / mL insulin, and 1 nM triiodothyronine, with the addition of 10 μM Compound 1 dissolved in DMSO and / or 10 μM SB203580 (p38 MAPK inhibitor, Fujifilm Wako Pure Chemical Industries, Ltd.). After 4 hours, total RNA was isolated from the immortalized white adipocytes in the same manner as in (1), reverse transcribed, and quantitative real-time PCR was performed to determine the relative expression level of the Ucp1 gene. The results are shown in Figure 8 (the relative expression level of the Ucp1 gene when only DMSO was added as a control is shown as a relative value of 1). As is clear from Figure 8, the p38 MAPK inhibitor SB203580 significantly inhibited the increase in mRNA expression level of the Ucp1 gene caused by Compound 1 (n=4, **p<0.01). Compound 1 significantly increased the expression levels of the Cxcl14, Kcnc2, and Gm5627 genes, and SB203580 inhibited the increase in the expression levels of these genes by Compound 1 (Figure 9, the relative expression levels of each gene when only DMSO was added as a control were expressed as 1, n=4, * p<0.05, ** p<0.01, primers used for quantitative real-time PCR are as follows.) These results indicate that the mechanism of thermogenic activity of Compound 1 in adipocytes is a newly discovered mechanism of thermogenic activity in adipocytes, which induces the expression of UCP1 via the PKA-p38MAPK pathway and further via signal transduction from p38MAPK to CXCL14, KCNC2, and Gm5627. (Cxcl14 gene) Forward:GAAGATGGTTATCGTCACCACC (SEQ ID NO: 15) Reverse: CGTTCCAGGCATTGTACCACT (SEQ ID NO: 16) (Kcnc2 gene) Forward:TCGCCACCCAGGAGTATTC (SEQ ID NO: 17) Reverse:CTCCACGTCGGTCTCATCG (SEQ ID NO:18) (Gm5627 gene) Forward:TGTCTTCCACACCAGCCTTC (SEQ ID NO: 19) Reverse:GGAAGGCAGAGGCCAATTCT (SEQ ID NO:20)

[0034] Experimental Example 3: Cytotoxicity of Compound 1 The cytotoxicity of Compound 1 was examined by MTT assay using the immortalized white preadipocytes established in Experimental Example 2 (1) (Compound 1 was dissolved in DMSO), and it was found that Compound 1 was not cytotoxic up to a concentration of at least 10 μM. Therefore, Compound 1 was found to be a compound with low cytotoxicity.

[0035] Formulation Example 1: Tablets Tablets for preventing and / or treating obesity and / or metabolic syndrome having the following composition were produced by a method known per se. Compound1 1 lactose 80 Magnesium stearate 19 (unit: weight %)

[0036] Formulation example 2: Biscuits Biscuits for preventing and / or treating obesity and / or metabolic syndrome having the following ingredient composition were produced by a method known per se. Compound1 1 32g plain flour Whole eggs 16 Butter 16 Sugar 24 water 10 Baking powder 1 (unit: weight %) [Industrial Applicability]

[0037] The present invention has industrial applicability in that it can provide an agent for the prevention and / or treatment of obesity and / or metabolic syndrome, which contains as an active ingredient an ingredient that can promote thermogenesis by adipocytes.

Claims

1. An agent for preventing and / or treating obesity and / or metabolic syndrome, comprising a compound represented by the following general formula (1) or a pharma- ceutical acceptable salt thereof as an active ingredient: 【Chemistry 1】 [In the formula, R １ , R ５ , R ６ R may be the same or different and represents an alkyl group having 1 to 6 carbon atoms. ２ , R ３ , R ４ are the same or different and represent a hydrogen atom or an acetyl group.

2. An inducer of uncoupling protein 1 expression, comprising as an active ingredient a compound represented by the following general formula (1) or a pharma- ceutical acceptable salt thereof: 【Chemistry 2】 [In the formula, R １ , R ５ , R ６ R may be the same or different and represents an alkyl group having 1 to 6 carbon atoms. ２ , R ３ , R ４ are the same or different and represent a hydrogen atom or an acetyl group.

Images