THROMBOPOIETIN RECEPTOR (Mpl) KNOCKOUT IMMUNODEFICIENT RODENT

Abstract

To provide an immunodeficient rodent in which human platelets or the like differentiate and increase.SOLUTION: An immunodeficient rodent in which a thrombopoietin (TPO) receptor (Mpl) gene is knocked out.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to rodents in which human platelets and the like differentiate and increase. [Background technology]

[0002] The NOG mouse is known as an extremely excellent immunodeficient mouse (Patent Document 1). Humanized NOG mice have been produced by transplanting human cells and tissues into the NOG mouse.

[0003] It has been reported that transplantation of human hematopoietic stem cells into immunodeficient mice (NSGW41 mice) increased human platelets (Non-Patent Document 1).

[0004] The thrombopoietin (TPO) receptor (Mpl) is a single-pass transmembrane receptor expressed in platelets, megakaryocytes, hematopoietic stem cells, etc., and does not have tyrosine kinase activity in its cytoplasmic domain, but transmits TPO signals through tyrosine phosphorylation by JAK2 in the cell.

[0005] It has been reported that when the human TPO gene was knocked in to immunodeficient mice and human hematopoietic stem cells were transplanted, human platelets did not increase but the human hematopoietic stem cells proliferated (Non-Patent Document 2). [Prior art documents] [Patent documents]

[0006] [Patent Document 1] International Publication No. WO2002 / 043477 [Non-patent literature]

[0007] [Non-Patent Document 1] Rahmig et al., Stem Cell reports, 2016 Oct 11;7(4); 591-601 [Non-Patent Document 2] Rongvaux et al., PNAS, february 8, 2011, vol.108, no.6, 2378-2383 Summary of the Invention [Problem to be solved by the invention]

[0008] An object of the present invention is to provide an immunodeficient rodent in which human platelets and the like are differentiated and increased. [Means for solving the problem]

[0009] There have been reports of immunodeficient mice in which human platelets are increased. The present inventors have conducted intensive research into the creation of rodents that can increase human platelets more efficiently. As a result, they have found that by knocking out the thrombopoietin receptor (Mpl) gene of immunodeficient rodents and transplanting human hematopoietic stem cells into the mice, it is possible to create humanized rodents in which human platelets are increased and maintained, and megakaryocytes, granulocytes, erythrocytes, and hematopoietic stem cells are increased, leading to the completion of the present invention.

[0010] That is, the present invention is as follows. [1] Immunodeficient rodents in which the thrombopoietin (TPO) receptor (Mpl) gene has been knocked out. [2] A mouse, an immunodeficient rodent like [1]. [3] The immunodeficient rodents described in [2] are SCID mutant mice, RAG1 knockout mice, RAG2 knockout mice or NOD / SCID mice. [4] NOG mice, whose official strain name is NOD.Cg-Prkdc scid Il2rg tm1Sug Mpl em1 / Jic, a mouse gene knockout of immunodeficient rodents [3]. [5] and the W41 mutant mouse, an immunodeficient rodent [3]. [6] A humanized rodent animal obtained by transplanting human hematopoietic stem cells into any of the rodents [1] to [5], in which human platelets differentiate and increase. [7] Furthermore, transplanted human hematopoietic stem cells have been shown to engraft and grow in humanized rodents [6]. [8] Furthermore, human hematopoietic stem cell engraftment has been improved, and human granulocytes and megakaryocytes have been differentiated, expanded, and maintained in humanized rodents,[6] or [7]. [9] A humanized rodent animal in which human red blood cells differentiate and proliferate, obtained by transplanting human hematopoietic stem cells into any of the rodents listed in [1] to [5].

[10] A method for producing a humanized rodent in which human platelets are differentiated and increased, comprising knocking out the thrombopoietin (TPO) receptor (Mpl) gene of an immunodeficient rodent and then transplanting human hematopoietic stem cells into the rodent.

[11] The method for producing a humanized rodent according to

[10] , wherein the rodent is a mouse.

[12] The mice are NOD mice, and their official strain name is NOD.Cg-Prkdc. scid Il2rg tm1Sug Mpl em1 A method for producing humanized rodents, designated / Jic, in

[11] .

[13] The method for producing a humanized rodent animal of

[11] , wherein the mouse is further a W41 mutant mouse.

[14] A method for increasing human platelets, comprising transplanting human hematopoietic stem cells into any of the rodents described in [1] to [5].

[15] The method of

[14] further comprising administering human thrombopoietin to the rodent.

[16] A method for expanding human red blood cells, comprising transplanting human hematopoietic stem cells into any of the rodents described in [1] to [5].

[17] The method of

[16] further comprising administering human thrombopoietin to the rodent.

[18] Humanized rodents generated by any of the methods described in [6]-[8] and

[10] -

[13] can be used as PDX models of human hematopoietic tumors.

[19] Human hematopoietic tumor PDXs are generated by transplanting patient-derived hematopoietic tumor cells into humanized rodents produced by any of the methods described in [6]-[8] or

[10] -

[13] . Effect of the Invention

[0011] Transplantation of human hematopoietic stem cells into immunodeficient rodents in which the thrombopoietin (TPO) receptor (Mpl) gene has been knocked out according to the present invention increases and maintains human platelets in the blood, spleen and bone marrow. [Brief description of the drawings]

[0012] [Figure 1] FIG. 1 shows the V831M mutation in the c-kit gene of NOG-W41 mice. [Diagram 2] 1 shows the results of PCR analysis indicating the genotype of NOG-W41 Mpl KO mice.Further DNA sequence analysis revealed a 78 bp deletion in Mpl KO mice (SEQ ID NO: 4). [Diagram 3] FIG. 1 shows the expression of mouse Mpl gene in mouse platelets in the blood of NOG-W41 mice and NOG-W41 Mpl KO mice. [Figure 4] FIG. 13 shows the mouse white blood cell count, hematocrit value, and mouse platelet count in the blood of NOG-W41 mice, NOG-W41 Mpl KO / + mice, and NOG-W41 Mpl KO mice. [Diagram 5] FIG. 1 shows the number of mouse leukocytes and the proportion of mouse megakaryocytes in the bone marrow of NOG-W41 mice, NOG-W41 Mpl KO / + mice, and NOG-W41 Mpl KO mice. [Figure 6] FIG. 1 shows the number of mouse leukocytes and the proportion of mouse megakaryocytes in the spleens of NOG-W41 mice, NOG-W41 Mpl KO / + mice, and NOG-W41 Mpl KO mice. [Figure 7-1] FIG. 1 shows an outline of a method in an example in which human CD34-positive cells were transplanted into NOG-W41 Mpl KO mice. [Figure 7-2] 1 is a graph showing the percentages of human CD45+ cells and human platelets in peripheral blood 4 and 8 weeks after transplantation of human CD34-positive cells into NOG-W41 Mpl KO mice, with each line representing the results for multiple mice. [Figure 8] Figure 1 shows flow cytometry results indicating the percentages of human CD45-positive cells, CD66b-positive granulocytes, CD19-positive B cells, CD33-positive monocytes, CD41-positive human platelets, and GlyA-positive human red blood cells in peripheral blood 8 weeks after transplantation of human CD34-positive hematopoietic stem cells into NOG-W41 Mpl KO mice. NOG and NOG-W41 mice were used as controls. [Figure 9] 1 shows the percentages of human CD45-positive cells, megakaryocytes, granulocytes, erythrocytes, and hematopoietic stem cells in the bone marrow 8 weeks after transplantation of human CD34-positive hematopoietic stem cells into NOG-W41 Mpl KO mice, using NOG-W41 mice as controls. [Figure 10] 1 shows the percentages of human CD45-positive cells, megakaryocytes, and hematopoietic stem cells in the spleen 8 weeks after transplantation of human CD34-positive hematopoietic stem cells into NOG-W41 Mpl KO mice, using NOG-W41 mice as a control. [Figure 11] This figure shows the percentage of human platelets in peripheral blood 4 and 8 weeks after transplantation of human CD34-positive hematopoietic stem cells into NOG-W41 Mpl KO mice and subsequent administration of recombinant human TPO protein. NOG-W41 Mpl KO mice not administered TPO were used as controls. Results are shown with one line for each of multiple mice. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0013] The present invention will be described in detail below.

[0014] 1. Creation of immunodeficient rodents with thrombopoietin (TPO) receptor (Mpl) gene knockout The present invention relates to an immunodeficient rodent in which the thrombopoietin (TPO) receptor (Mpl) gene has been knocked out. When human hematopoietic stem cells are transplanted into the rodent, they differentiate into and increase in human platelets, granulocytes, megakaryocytes, and erythrocytes in the blood, spleen, and bone marrow of the rodent.

[0015] Here, gene knock-out refers to a genetic engineering technique that causes all or part of a gene to be deleted, causing the gene to lose its function. When a gene loses its function, the protein it expresses loses its activity. Thus, an immunodeficient rodent in which the Mpl gene has been knocked out is an immunodeficient rodent in which all or part of the Mpl gene has been deleted, causing the Mpl gene to lose its function.

[0016] Immunodeficient rodents with knockout thrombopoietin (TPO) receptor (Mpl) gene can be generated by crossing rodents with knockout thrombopoietin (TPO) receptor (Mpl) gene with immunodeficient rodents. Immunodeficient rodents with knockout thrombopoietin (TPO) receptor (Mpl) gene can also be generated using genome editing techniques such as Talen and CRISPR / CAS9.

[0017] The thrombopoietin (TPO) receptor (Mpl) is a single-pass transmembrane receptor expressed in platelets, megakaryocytes, hematopoietic stem cells, etc., and does not have tyrosine kinase activity in the cytoplasmic domain, but transmits the TPO signal through tyrosine phosphorylation by JAK2 in the cell. The DNA sequence of exon 1 of the mouse Mpl gene is shown in SEQ ID NO:4.

[0018] In the present invention, rodents are not limited, but examples include mice, rats, guinea pigs, hamsters, rabbits, nutrias, etc., with mice being preferred.

[0019] The humanized rodent used in the present invention, in which the engraftment of human hematopoietic stem cells is improved and which differentiates and increases into human platelets, granulocytes, megakaryocytes, and erythrocytes, is a rodent that does not eliminate human platelets, granulocytes, megakaryocytes, and erythrocytes by immunity, i.e., a rodent in which the immune response to humans is inactivated. Such an animal includes a rodent with a reduced or defective immune function and an inactivated immune response to humans, and for example, an immunodeficient rodent can be used.

[0020] Immunodeficient rodents are animals with reduced or deficient immune functions, and are animals that are deficient in some or all of T cells, B cells, NK cells, dendritic cells, and macrophages. Immunodeficient rodents can be produced by whole-body irradiation, or rodents with genetically deficient immune functions can be used.

[0021] Examples of immunodeficient mice include nude mice, NOD / SCID mice, Rag1 knockout mice, Rag2 knockout mice, SCID mice administered with asialoGM1 antibody or TMβ1, and irradiated mice. In addition, knockout animals obtained by crossing NOD / SCID mice, Rag1 knockout mice, or Rag2 knockout mice with IL-2Rγ knockout mice (hereinafter referred to as dKO (double knockout) animals) can also be used. For example, dKO mice (Rag2 KO, IL-2R null ) can be used. In the present invention, a dKO mouse with a Balb / c genetic background is referred to as a Balb / c dKO mouse, and a mouse with a NOD genetic background is referred to as a NOD dKO mouse. The genetic background of the mouse is not limited to these, and it may be C57BL / 6, C3H, DBA2 or IQI strain, or a strain with a SCID mutation and an IL-2Rγ knockout, a Rag1 knockout and an IL-2Rγ knockout, or a Rag2 knockout and an IL-2Rγ knockout mutation. In addition, a deficiency in the Jak3 protein, which is responsible for signal transduction downstream of the common γ chain of the IL-2 receptor, also leads to an IL2Rγ nullSince the phenotype is similar to that of the above, the mouse may be a knockout mouse obtained by crossing a Rag2 knockout mouse with a Jak3 knockout, a knockout mouse obtained by crossing a Rag1 knockout mouse with a Jak3 knockout, or a knockout mouse obtained by crossing a SCID mutation with a Jak3 knockout, or an inbred, non-inbred, or hybrid (F1 hybrid) mouse obtained by crossing these.

[0022] Furthermore, in order to eliminate the influence of immune cells such as NK cells found in the mouse, in addition to the above-mentioned embodiment in which the asialoGM1 antibody is administered to the SCID mouse, another mouse used in the present invention is a genetically modified immunodeficient mouse in which a mutation has been introduced into the IL-2 receptor γ-chain gene, resulting in a deficiency of the IL-2 receptor γ-chain, and in which a SCID mutation in a gene involved in the rearrangement of antigen receptor genes in T cells and B cells is present at both allele loci. One such mouse is the NOG mouse (NOD / SCID / γc), which is derived from a NOD / SCID mouse and in which the common γ-chain of the IL-2 receptor has been knocked out. null (NOD / Shi-scid,IL-2RγKO mice)), NSG mice (NOD / Scid / IL2Rγ null (NOD.Cg-Prkdc scid IL2rg tm1Wjl / SzJ), NCG mice (NOD-Prkdc em26Cd52 IL2rg em26Cd22 Furthermore, NOD / Scid / Jak3 mice (NOD / Scid / Jak3) are genetically modified immunodeficient mice that have a mutation in the Jak3 gene, resulting in a deficiency of Jak3 and that have SCID mutations in genes involved in the rearrangement of antigen receptor genes in T cells and B cells at both allele loci. null (NOD.Cg-Prkdc scid Jak3 tm1card) can also be used. Hereinafter, animals in which the functions of the Prkdc gene and its gene product are defective due to a scid mutation or the like, and in which the normal function of the IL2Rγ gene product has been lost due to a deletion or mutation of the IL2Rγ gene, or a gene downstream of signal transduction and a functional deletion of its product, are referred to as NOG mice ("NOG mouse" is a registered trademark), and can also be used as hosts. Since the presence of lymphocytes is not observed in these mice, NOG mice do not exhibit NK activity and are also defective in dendritic cell function. A method for generating NOG mice is described in WO2002 / 043477. The method for producing NSG mice is described in Ishikawa F. et al., Blood 106:1565-1573, 2005, the method for producing NCG mice is described in Zhou J. et al. Int J Biochem Cell Biol 46:49-55, 2014, and the method for producing NOJ mice is described in Okada S. et al., Int J Hematol 88:476-482, 2008.

[0023] Furthermore, the immunodeficient mouse used in the present invention may be a W41 mutant mouse. The W41 mutant gene is a mouse in which the V831M mutation has been introduced into the c-kit gene (FIG. 1). The method for producing the W41 mutant mouse is disclosed in, for example, patent document US9,668,463.

[0024] Further, the immunodeficient mouse used in the present invention includes a RAG1 knockout mouse and a RAG2 knockout mouse. The method for knocking out the Mpl gene of a rodent is not limited, and can be carried out by, for example, genome editing, homologous recombination, or the like.

[0025] The knockout of the mouse Mpl gene can be achieved by deleting all or a part of the mouse Mpl gene. For example, all or a part of exon 1 of the mouse Mpl gene may be deleted. Specific deletion sites include deletion of several tens of base sequences in exon 1 of the mouse Mpl gene, for example, deletion of a base sequence of 30 to 100 bp, preferably deletion of a base sequence of 80 to 100 bp, and more preferably deletion of a base sequence of 78 bp. The base sequence of exon 1 of the mouse Mpl gene is shown in SEQ ID NO: 1, and the base sequence of exon 1 of the mouse Mpl gene from which the 78 bp site is deleted is shown in SEQ ID NO: 2. By deleting all or a part of the mouse Mpl gene, the function of the thrombopoietin (TPO) receptor (Mpl) is deleted.

[0026] Genome editing is a method that utilizes site-specific nucleases to modify targeted genes. Genome editing methods, depending on the nuclease used, include the zinc finger nuclease (ZFN) method (Urnov, Fyodor D. et al., Natur, Vol 435, 2 June 2005, pp. 642-651), the tale nuclease (TALEN) method (Mahfouz, Magdy M et al., PNAS February 8, 2011, 108(6), pp. 2623-2628), CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) / Crispr Associated protein 9 (Cas9) (Jinek, Martin, et al., Science, Vol 337, 17 August 2012, pp. 816-821), and methods using CRISPR / Cas systems such as CRISPR / Cas3. These methods include methods using modified nucleases, such as a method using a nickase-modified Cas. Among these, the method using the CRISPR / Cas9 system is preferred. In the CRISPR / Cas9 system, for example, a guide RNA (crRNA, tracrRNA) containing a sequence complementary to the target sequence of the Mpl gene of a rodent to be cut to eliminate its function is injected into a fertilized egg of an immunodeficient rodent. The Mpl gene of the rodent is deleted in the fertilized egg. The base length of the guide RNA is preferably 20 or more. Genome editing using CRISPR / Cas9 can be performed using a commercially available CRISPR / Cas9 tool.

[0027] Homologous recombination is a phenomenon in which two DNA molecules recombine with each other via the same base sequence in a cell, and is a method often used for recombination of organisms with large genomic DNA. A plasmid (called a targeting vector) is constructed by linking other DNA to the sequence of the target gene site in a way that the sequence is split in the middle. In other words, a construct is created in which the DNA of the Mpl gene, which does not function as other DNA, is sandwiched between homologous sequences in the upstream and downstream parts of a specific site of a rodent, and this is inserted into a known vector to create a targeting vector. The construct is introduced into ES cells (embryonic stem cells) of immunodeficient rodents. By homologous recombination, replacement occurs between the DNA of the specific site of the rodent and the same sequence part on the targeting vector, and the sandwiched other DNA is incorporated into the rodent genome. In this way, ES cells in which the Mpl gene is knocked out are established, and the ES cells are injected into rodent embryos or blastocysts, and the chimeric embryos are transplanted into the uterus of pseudopregnant rodents to create chimeric mice. By mating the obtained chimeric mouse with the above-mentioned immunodeficient rodent, it is possible to obtain an individual in which the Mpl gene of the rodent has been knocked out.

[0028] In this case, the vector for preparing the targeting vector can be one that can be expressed in and transformed by ES cells of rodents, and can be an Escherichia coli-derived plasmid, a retrovirus, a lentivirus, an adeno-associated virus, a vaccinia virus, or the like. The introduction of the targeting vector into the ES cells can be carried out by known electroporation, calcium phosphate coprecipitation, lipofection, microinjection, particle gun, or the like. The vector may contain a marker gene for selection, and examples of the marker gene include a hygromycin resistance gene, a neomycin resistance gene, and a puromycin resistance gene. The marker gene may be removed after the selection of the homologous recombinant, and can be removed by using the Cre-loxP system or the Flp-frt system. Stem cells such as iPS cells of rodents can also be used instead of ES cells.

[0029] Knockout rodents include both complete knockout rodents (conventional knockout rodents) and conditional knockout rodents (conditional knockout rodents). Complete knockout rodents can be generated by including homologous recombination and breeding.

[0030] Mpl gene deficiency in rodents can be examined, for example, by isolating leukocytes from the rodent and analyzing the expression of the Mpl gene.

[0031] 2. Characteristics of immunodeficient rodents with thrombopoietin (TPO) receptor (Mpl) gene knockout The immunodeficient rodent in which the thrombopoietin (TPO) receptor (Mpl) gene has been knocked out, as prepared in 1., has the following characteristics:

[0032] In immunodeficient rodents in which the Mpl gene is knocked out, the number of white blood cells, hematocrit value, and platelet count in peripheral blood are reduced. For example, when comparing a NOG mouse with a W41 mutation (NOGW41 mouse) with a NOG mouse with a W41 mutation in which the Mpl gene is knocked out (NOGW41-Mpl KO mouse), the number of white blood cells in peripheral blood is reduced by 60 to 70%, the number of platelets in peripheral blood is reduced by 70 to 90%, and the hematocrit value is reduced by 10 to 30% in the NOGW41-Mpl KO mouse compared to the NOGW41 mouse. In addition, in immunodeficient rodents in which the Mpl gene is knocked out, the number of platelets in the spleen and bone marrow is reduced. For example, in the NOGW41-Mpl KO mouse, the number of platelets in the spleen is reduced by 90 to 98%, and the number of platelets in the bone marrow is reduced by 80 to 90% compared to the NOGW41 mouse.

[0033] When human CD34-positive cells (human hematopoietic stem cells) are transplanted into an immunodeficient rodent in which the Mpl gene has been knocked out without irradiation, enhanced engraftment of human white blood cells (hCD45-positive cells) and human platelets (CD41-positive cells) is observed, and the chimerism rate of human white blood cells (hCD45-positive cells) (ratio of human white blood cells in total white blood cells) 8 weeks after transplantation is 60 to 90%. In immunodeficient rodents in which the Mpl gene has not been knocked out, for example, NOG W41 mice, it is 20% or less. In addition, the chimerism rate of human platelets (CD41-positive cells) (ratio of human platelets in total platelets) is 10 to 80%. In immunodeficient rodents in which the Mpl gene has not been knocked out, for example, NOG W41 mice, it is 5% or less.

[0034] When human CD34 positive cells (human hematopoietic stem cells) are transplanted into an immunodeficient rodent in which the Mpl gene has been knocked out without irradiation, the number of human granulocytes (CD66a positive cells) further increases. For example, the percentage of human granulocytes in the total granulocytes 8 weeks after transplantation of CD34 positive cells (human hematopoietic stem cells) in the peripheral blood of a NOG mouse (NOGW41-Mpl KO mouse) having a W41 mutation in which the Mpl gene has been knocked out is 3 to 5%. In addition, the percentage of human erythrocytes in the total erythrocytes of a NOG mouse (NOGW41-Mpl KO mouse) having a W41 mutation in which the Mpl gene has been knocked out also increases, and the percentage of human erythrocytes in the total erythrocytes is 0.005 to 0.01%, preferably 0.007 to 0.01%.

[0035] Furthermore, when human CD34-positive cells (human hematopoietic stem cells) are transplanted into immunodeficient rodents in which the Mpl gene has been knocked out without irradiation, the chimerism rate of human white blood cells (hCD45-positive cells) increases in the spleen and bone marrow, and platelets increase. Furthermore, granulocytes, red blood cells, and hematopoietic stem cells also increase. For example, in NOG mice with the W41 mutation in which the Mpl gene has been knocked out (NOGW41-Mpl KO mice), the proportion of human white blood cells among all white blood cells in the bone marrow 8 weeks after transplantation of human CD34-positive cells (human hematopoietic stem cells) is 70-100%, the proportion of human megakaryocytes among all megakaryocytes is 55-80%, the proportion of human granulocytes among all granulocytes is 15-30%, the proportion of human red blood cells among all red blood cells is 10-20%, and the proportion of human hematopoietic stem cells among all hematopoietic stem cells is 3-6%. Furthermore, in NOG mice carrying the W41 mutation in which the Mpl gene has been knocked out (NOGW41-Mpl KO mice), the proportion of human leukocytes among all leukocytes in the spleen 8 weeks after transplantation of human CD34-positive cells (human hematopoietic stem cells) was 70-100%, the proportion of human megakaryocytes among all megakaryocytes was 35-50%, and the proportion of human hematopoietic stem cells among all hematopoietic stem cells was 1-3%.

[0036] By transplanting human hematopoietic stem cells into an immunodeficient rodent in which the Mpl gene of the present invention has been knocked out, a humanized rodent can be obtained in which the human hematopoietic stem cells have taken root in the rodent, human leukocytes have differentiated, and the cells have proliferated and been maintained in the peripheral blood. In particular, a humanized rodent can be obtained in which human platelets, human granulocytes, and human megakaryocytes have differentiated, and the cells have proliferated and been maintained in the peripheral blood. Furthermore, by transplanting human hematopoietic stem cells into an immunodeficient rodent in which the Mpl gene of the present invention has been knocked out, a humanized rodent can be obtained in which human erythrocytes have differentiated, and the cells have proliferated and been maintained in the peripheral blood.

[0037] It is preferable to irradiate the immunodeficient rodent in which the Mpl gene has been knocked out prior to transplantation with radiation, preferably at 0.5 to 1.5 Gy, more preferably 0.8 to 1.3 Gy, and even more preferably 1 Gy.

[0038] The transplantation of human hematopoietic stem cells (CD34 positive cells) is preferably performed via a vein, for example, via the tail vein. The amount of human hematopoietic stem cells to be transplanted depends on the weight of the rodent. For example, in the case of mice, the amount of human hematopoietic stem cells to be transplanted is about 10 3 ~10 6 pcs, preferably 10 4 ~10 5 pcs, more preferably 4 to 5 × 10 4 After the transplantation, a humanized rodent in which one, two, three or four types of human platelets, granulocytes, megakaryocytes and erythrocytes, particularly platelets, circulate in the periphery can be obtained in 2 to 20 weeks, preferably 3 to 16 weeks, more preferably 4 to 12 weeks, more preferably 8 to 12 weeks, and even more preferably 8 weeks.

[0039] When thrombopoietin is administered to immunodeficient rodents in which the Mpl gene has been knocked out, human platelets and the like further increase.

[0040] As the thrombopoietin, preferably human thrombopoietin, more preferably recombinant human thrombopoietin is used.

[0041] The amount of thrombopoietin to be administered is 0.1 to 100 μg, preferably 0.5 to 10 μg, more preferably 0.5 to 2 μg, and more preferably 1 μg. Preferably, the concentration of thrombopoietin is 1 μg / 10 to 500 μl, preferably 1 μg / 50 to 200 μl, and more preferably 1 μg / 100 μl, and may be prepared with physiological saline or the like. The preferred administration method is via the tail vein, and administration is started 1 to 6 weeks, preferably 3 to 5 weeks, and more preferably 4 weeks after human hematopoietic stem cell transplantation, and administration is continued 1 to 5 times, preferably 3 times, per week until 7 to 10 weeks, preferably 8 weeks.

[0042] 3. Use of immunodeficient rodents in which the thrombopoietin (TPO) receptor (Mpl) gene has been knocked out An immunodeficient rodent in which the thrombopoietin (TPO) receptor (Mpl) gene has been knocked out can be used as a humanized model rodent having a human hematopoietic system. In addition, since human platelets increase when human hematopoietic stem cells are transplanted, the rodent can be used to evaluate and screen drugs that increase human platelets. Furthermore, the rodent can be used to produce human platelets. Furthermore, since human red blood cells proliferate when human hematopoietic stem cells are transplanted into an immunodeficient rodent in which the thrombopoietin (TPO) receptor (Mpl) gene of the present invention has been knocked out, the rodent can be used to produce human red blood cells. Since the engraftment and maintenance ability of human hematopoietic stem cells in bone marrow are enhanced, the rodent can be used to explore the mechanisms of in vivo maintenance, differentiation, or aging of human hematopoietic stem cells. In addition, the engraftment of not only normal hematopoietic cells but also patient-derived hematopoietic tumor cells is considered to be facilitated, the rodent can be used as a PDX model (Patient-derived xenograft; patient tumor transplant model) of hematopoietic tumors. Here, examples of hematopoietic tumors include leukemia, malignant lymphoma, and multiple myeloma. The PDX model can be prepared by transplanting hematopoietic tumor cells collected from a patient with hematopoietic tumor into the immunodeficient rodent of the present invention. The number of tumor cells to be transplanted is 0.5 to 10 × 10 6 pcs, preferably 1 x 10 6 The PDXs are transplanted into the bone marrow or into the tail vein. Approximately one month after transplantation, the chimerism rate of the PDX in the bone marrow is analyzed by flow cytometry, and a chimerism rate of 20% or more can be used as a PDX model. In the PDX model, tumor cells grow in the living rodent animal, and tumors similar to those grown in the cancer patient's body can be reproduced. For example, it is possible to predict the effect of anticancer drugs in cancer patients from whom tumors have been taken. EXAMPLES

[0043] The present invention will be specifically described with reference to the following examples, but the present invention is not limited to these examples.

[0044] [Example 1] Generation of NOG-W41 Mpl KO mice (1) Method for generating NOG-W41 mice Mice used in the present invention can be severely immunodeficient mice that have been irradiated or treated with busulfan. In this study, W41 mice were used, which can be humanized without irradiation or busulfan treatment. A method for producing W41 mutant mice is disclosed in, for example, patent document US9,668,463. Gene knock-in can be achieved by using gene modification techniques or by crossbreeding. Gene modification techniques that can be used include homologous recombination using ES cells, ZFN, Talen, and CRISPR / Cas9. In this study, Talen was used as follows.

[0045] NOG-W41 mice were generated by microinjecting a 100bp single-stranded oligo DNA (CTTCATTAGCTGCTTGAATTTGCTGTGTTCCGTTCTAGGCACGACTGCCCATGAAGTGGATGGCACCAGAGAGCATTTTCAGCTGCGTGTACACATTTGA) (SEQ ID NO:1) containing a single base substitution mutation in the c-kit gene and a TALEN mRNA pair (Forward; 5'-gtgttccgttctaggcac-3' (SEQ ID NO:2), and Reverse; 5'-atgctctctggtgccatc-3' (SEQ ID NO:3)) into NOG mouse pronuclear stage eggs, causing homologous recombination with the genome. The KI mice generated had a mutation at amino acid 831 from valine (V) to methionine (M) (Figure 1).

[0046] (2) Generation of NOG-W41 Mpl KO mice The mice used can be severely immunodeficient mice whose hematopoietic function has been destroyed by irradiation or busulfan, resulting in a decrease in platelets. In this study, mice lacking the Mpl gene, which is the receptor for TPO, a platelet production factor (Mpl KO), were used. Mpl KO mice can be produced by using genetic modification techniques or by crossbreeding. Genetic modification techniques that can be used include homologous recombination using ES cells, CRISPR / CAS9, TALEN, and ZFN. In this study, CRISPR / Cas9 was used as follows. NOG-W41 Mpl KO mice were produced by microinjecting crisprRNA, tracrRNA, and CAS9 protein targeting exon1 of the Mpl gene into NOG-W41 mouse pronuclear stage eggs.

[0047] In the KO mice, gene deletion was confirmed by PCR analysis (FIG. 2), and a 78-bp deletion was confirmed by sequence analysis (SEQ ID NO: 4). Mpl gene exon 1 sequence (sequence deleted in this KO mouse: sequence shown in bold and underlined) TIFF2025008768000001.tif35170

[0048] [Example 2] White blood cells were isolated from the peripheral blood of NOG-W41 mice and NOG-W41 Mpl KO mice, and the expression of the Mpl gene was analyzed. That is, blood was collected from both mice, stained with an antibody against platelets (anti-mouse CD41 antibody) and an anti-mouse Mpl antibody, and the expression of Mpl in mouse platelets was analyzed by flow cytometry. The results are shown in Figure 3. As shown in Figure 3, the deficiency of the Mpl gene was confirmed in NOG-W41 Mpl KO mice. The flow cytometer used was an LSR Fortessa X-20 (BD Biosciences) (same below).

[0049] [Example 3] The white blood cell count, hematocrit value, and platelet count in the blood of NOG-W41 mice (+ / +), NOG-W41 Mpl KO / + mice (KO / +), and NOG-W41 Mpl KO mice (KO / KO) were measured using a hemocytometer. The results are shown in Figure 4. A Microsemi hemocytometer (LC662; HORIBA) was used as the hemocytometer (hereinafter the same). Figures 4A, B, and C show the white blood cell count (WBC), hematocrit value (HCT), and platelet count (PLT), respectively. As shown in the figures, a decrease in all values ​​was observed in the NOG-W41 Mpl KO mice.

[0050] [Example 4] The white blood cell count and platelet ratio (CD41 positive cell ratio) in the spleen of NOG-W41 mice (+ / +), NOG-W41 Mpl KO / + mice (KO / +), and NOG-W41 Mpl KO mice (KO / KO) were measured using a hemocytometer and flow cytometry. The results are shown in Figure 5. Figures 5A and B show the white blood cell count and platelet ratio, respectively. As shown in the figure, a significant decrease in platelets was observed in NOG-W41 Mpl KO mice.

[0051] [Example 5] The white blood cell count and platelet percentage (proportion of CD41 positive cells) in the bone marrow of NOG-W41 mice (+ / +), NOG-W41 Mpl KO / + mice (KO / +), and NOG-W41 Mpl KO mice (KO / KO) were measured using a hemocytometer and flow cytometry. The results are shown in Figure 6. Figures 6A and B show the white blood cell count and platelet percentage, respectively. As shown in the figure, a significant decrease in platelets was observed in NOG-W41 Mpl KO mice.

[0052] [Example 6] Human CD34 positive cells were transplanted into NOG-W41 Mpl KO mice, and the percentage of human CD45 positive cells and human platelets (proportion of CD41 positive cells) in the peripheral blood after 4 and 8 weeks was measured by flow cytometry. NOG-W41 mice were used as controls. Human CD34 positive cells were purchased frozen from StemExpress. After thawing, 20,000-30,000 CD34 positive cells were transplanted into the tail vein of each mouse (without pretreatment with radiation). Blood was collected 4 and 8 weeks after transplantation and stained with antibodies against human and mouse platelets (anti-human CD41 antibody, anti-mouse CD41 antibody), and the percentage of each type of platelet was measured by flow cytometry. The percentage of human platelets (hCD41) in total platelets (hCD41+mCD41) was calculated as the chimeric rate of human platelets. For human leukocytes, the collected blood was treated with erythrocyte hemolysis buffer to remove erythrocytes, and then stained with antibodies against human and mouse leukocytes (anti-human CD45 antibody, anti-mouse CD45 antibody). The proportion of each type of leukocyte was measured by flow cytometry, and the proportion of human leukocytes (hCD45) among all leukocytes (hCD45+mCD45) was calculated as the chimerism rate of human leukocytes.

[0053] An overview of the method is shown in Figure 7-1. The measurement results are shown in Figure 7-2. Figures 7-2A and 7-2B show the percentages of CD45-positive cells and human platelets, respectively. As shown in Figure 7-2, a significant increase in engraftment of human CD45-positive cells and human platelets was observed in the NOG-W41 Mpl KO mice, especially at 8 weeks after transplantation. This indicates that the human leukocyte chimerism rate in the blood of the NOG-W41 Mpl KO mice was significantly increased, and the number of platelets also increased.

[0054] [Example 7] Human CD34 positive cells were transplanted into NOG-W41 Mpl KO mice, and flow cytometry analysis of human cells in peripheral blood 8 weeks later was performed to calculate the percentages of human CD45+ cells, CD66b positive granulocytes, CD19 positive B cells, CD33 positive monocytes, CD41 positive human platelets, and GlyA positive human red blood cells in peripheral blood 8 weeks later. The results are shown in Figure 8. Figures 8A, B, and C show the results of NOG mice, NOG-W41 mice, and NOG-W41 Mpl KO mice (KO / KO), respectively. As shown in the figures, in the NOG-W41 Mpl KO mice, platelets (CD41 positive) were particularly increased, but granulocytes (CD66a positive) also increased, and a small amount of red blood cells (GlyA positive) was also observed. That is, in the NOG-W41 Mpl KO mice, in addition to the remarkable enhancement of engraftment of human CD45 positive cells, granulocytes, and human platelets, differentiation of human red blood cells was also confirmed.

[0055] [Example 8] Human CD34-positive hematopoietic stem cells were transplanted into NOG-W41 mice and NOG-W41 Mpl KO mice, and human cells in the bone marrow 8 weeks later were analyzed by flow cytometry. The results are shown in Figure 9. Figure 9A, B, C, D, and E show the percentages of hCD45-positive cells, megakaryocytes, granulocytes, erythrocytes, and hematopoietic stem cells, respectively. As shown in the figures, enhanced engraftment of CD45+ cells, megakaryocytes, granulocytes, erythrocytes, and hematopoietic stem cells was observed in NOG-W41 Mpl KO mice.

[0056] [Example 9] Human CD34-positive hematopoietic stem cells were transplanted into NOG-W41 mice and NOG-W41 Mpl KO mice, and human cells in the spleen 8 weeks later were analyzed by flow cytometry. The results are shown in Figure 10. Figures 10A, B, and C show the results for CD45-positive cells, megakaryocytes, and hematopoietic stem cells, respectively. As shown in the figures, enhanced engraftment of CD45-positive cells, megakaryocytes, and hematopoietic stem cells was observed in NOG-W41 Mpl KO mice.

[0057] The results of Examples 8 and 9 show that in both the bone marrow and the spleen, the chimerism rate and platelets in particular increased, and the numbers of granulocytes, erythrocytes and hematopoietic stem cells increased.

[0058] [Example 10] Human CD34-positive hematopoietic stem cells were transplanted into NOG-W41 mice and NOG-W41 Mpl KO mice, and recombinant human thrombopoietin (TPO; Peprotech) protein was administered. The percentage of human platelets in the peripheral blood was analyzed 4 and 8 weeks after transplantation. The amount of thrombopoietin administered was 1 μg / 100 μl, and the administration method was via the tail vein, starting 4 weeks after human hematopoietic stem cell transplantation and continuing 3 times a week until 8 weeks. The results are shown in Figure 11. As shown in the figure, a significant increase in human platelets was observed at 8 weeks after TPO administration. These results suggest that the action of human TPO protein in humanized NOG-W41 Mpl KO mice is expected to further improve the engraftment rate of human platelets, and that human TPO gene transgenic mice and knock-in mice are useful.

[0059] [Example 11] Preparation of PDX model Tumor cells collected from patients with hematopoietic tumors such as leukemia, malignant lymphoma, and multiple myeloma are transplanted into NOG-W41 Mpl KO mice. Hematopoietic tumor cells grow in the mouse blood, allowing the creation of PDX models.

[0060] The transplantation method is preferably 0.5 to 10 × 10 6 tumor cells, more preferably 1×10 6 Tumor cells are transplanted into the bone marrow or tail vein. From about one month after transplantation, bone marrow puncture is performed to collect cerebrospinal fluid, and the PDX chimerism rate in the bone marrow is analyzed by flow cytometry. If the engraftment rate is 20% or more, it can be used as a model.

[0061] [Example 12] Generation of Mpl KO rodents Mpl KO rodents will be generated in the same manner as in mice, and similar results can be obtained by conducting the same studies as in mice. [Industrial Applicability]

[0062] Immunodeficient rodents in which the thrombopoietin (TPO) receptor (Mpl) gene has been knocked out can be transplanted with human hematopoietic stem cells to increase human platelets and can be used as model animals capable of reproducing the human hematopoietic system, and for evaluating pharmaceuticals that increase human platelets, etc. Another use of the immunodeficient rodents in which the thrombopoietin (TPO) receptor (Mpl) gene has been knocked out according to the present invention can be as a PDX model of hematopoietic tumors or a human thrombosis model.

Claims

1. An immunodeficient rodent in which the thrombopoietin (TPO) receptor (Mpl) gene has been knocked out.

2. 2. The immunodeficient rodent of claim 1 which is a mouse.

3. The immunodeficient rodent of claim 2, which is a SCID mutant mouse, a RAG1 knockout mouse, a RAG2 knockout mouse or a NOD / SCID mouse.

4. NOG mouse, official strain name is NOD.Cg-Prkdc scid Il2rg tm1Sug Mpl em1 The mouse Mpl gene knockout immunodeficient rodent of claim 3, designated / Jic.

5. The immunodeficient rodent of claim 3, further comprising a W41 mutant mouse.

6. A humanized rodent in which human platelets are differentiated and increased, obtained by transplanting human hematopoietic stem cells into the rodent according to any one of claims 1 to 5.

7. The humanized rodent according to claim 6, further comprising transplanted human hematopoietic stem cells which engraft and grow.

8. The humanized rodent of claim 6, further comprising: differentiated, increased and maintained human granulocytes and human megakaryocytes.

9. A humanized rodent in which human red blood cells differentiate and proliferate, obtained by transplanting human hematopoietic stem cells into the rodent according to any one of claims 1 to 5.

10. A method for producing a humanized rodent in which human platelets are differentiated and increased, comprising knocking out the thrombopoietin (TPO) receptor (Mpl) gene of an immunodeficient rodent and further transplanting human hematopoietic stem cells into the rodent.

11. The method for producing a humanized rodent according to claim 10, wherein the rodent is a mouse.

12. The mouse is a NOG mouse, and its official strain name is NOD.Cg-Prkdc scid Il2rg tm1Sug Mpl em1 The method for producing a humanized rodent animal according to claim 11, wherein the humanized rodent animal is represented as / Jic.

13. The method for producing a humanized rodent animal according to claim 11, wherein the mouse is further a W41 mutant mouse.

14. A method for increasing human platelets, comprising transplanting human hematopoietic stem cells into the rodent according to any one of claims 1 to 5.

15. 15. The method of claim 14, further comprising administering to the rodent human thrombopoietin.

16. A method for expanding human red blood cells, comprising transplanting human hematopoietic stem cells into the rodent according to any one of claims 1 to 5.

17. 17. The method of claim 16, further comprising administering to the rodent human thrombopoietin.

18. Use of the humanized rodent of claim 6 as a human hematopoietic tumor PDX model.

19. Use of a humanized rodent produced by the method according to any one of claims 10 to 13 as a human hematopoietic tumor PDX model.

20. A human hematopoietic tumor PDX model produced by transplanting patient-derived hematopoietic tumor cells into the humanized rodent of claim 6.

21. A human hematopoietic tumor PDX model produced by transplanting patient-derived hematopoietic tumor cells into a humanized rodent produced by the method according to any one of claims 10 to 13.

Images