Methods and compositions for prediction of therapeutic efficacy of cancer treatments and cancer prognosis

Abstract

To address a need to develop a test to measure the eligibility of patients for antibody therapy by providing markers which are associated with favorable and unfavorable outcomes, respectively, in antibody therapy; and to demonstrate that these markers are useful as markers for prognosing clinical outcome for cancer patients, thereby allowing the findings presented herein to be used to select a suitable treatment for a cancer patient and, in particular, to decide whether antibody therapy should be administered to a cancer patient.SOLUTION: The invention generally relates to methods and compositions for the prediction of therapeutic efficacy of cancer treatments and the prognosis of cancer. The invention discloses markers that are associated with favorable and unfavorable outcomes, respectively, in certain cancer treatments and are useful as prognostic markers for cancer. Methods involving these markers are disclosed for predicting cancer therapy benefit and prognosing clinical outcome for cancer patients.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention generally relates to methods and compositions for predicting therapeutic efficacy of cancer treatments and cancer prognosis. The present invention discloses markers that are associated with favorable and unfavorable outcomes, respectively, in certain cancer treatments and are useful as cancer prognostic markers. Methods involving these markers are disclosed for predicting cancer therapy benefit and forecasting clinical outcomes in cancer patients. [Background technology]

[0002] Cancer of the stomach and esophagus (gastroesophageal; GE) is one of the malignancies with the highest unmet medical need. Gastric cancer is the second leading cause of death worldwide. The incidence of esophageal cancer has increased in the last decade, and the 5-year overall survival rate for GE cancer is 20-25%, despite the aggressiveness of established standard treatments with substantial side effects. The medical need of patients suffering from this cancer type is high, and breakthrough drugs are required.

[0003] The tight junction molecule claudin 18 isotype 2 (CLDN18.2) is a cancer-associated splice variant of claudin 18 [Niimi, T. et al., Mol Cell Biol, 2001, 21(21):7380-90; Tureci, O. et al., Gene, 2011, 481(2):83-92]. CLDN18.2 is a 27.8 kDa transmembrane protein that contains four membrane-spanning domains with two small extracellular loops (loop 1 encompassed by hydrophobic regions 1 and 2; loop 2 encompassed by hydrophobic regions 3 and 4). CLDN18.2 is a highly selective gastric lineage antigen that is exclusively expressed on short-lived differentiated gastric epithelial cells and is not detectable in any other normal human tissues. The antigen is ectopically expressed at significant levels in a variety of human cancers, including gastroesophageal and pancreatic cancers. [Sahin, U. et al., Clin Cancer Res, 2008, 14(23):7624-34]. CLDN18.2 protein is frequently detected in lymph node metastases and also in distant metastases of gastric cancer. CLDN18.2 appears to be involved in the proliferation of CLDN18.2-positive tumor cells, since downregulation of the target by siRNA technology inhibits the proliferation of gastric cancer cells.

[0004] IMAB362 is a chimeric monoclonal antibody of IgG1 subtype directed against CLDN18.2. IMAB362 recognizes the first extracellular domain of CLDN18.2 with high affinity and specificity and does not bind to any other claudin family members, including the closely related splice variant 1 of claudin 18 (CLDN18.1).

[0005] In human xenografts expressing CLDN18.2, survival benefit and tumor regression were observed in mice following administration of IMAB362. When administered intravenously in relevant animal species, toxicity in gastric tissue is not observed because the target epitope is not accessible. However, tumor targets become accessible to IMAB362 during malignant transformation. IMAB362 bundles four independent and highly potent mechanisms of action: (i) antibody-dependent cellular cytotoxicity (ADCC), (ii) complement-dependent cytotoxicity (CDC), (iii) induction of apoptosis induced by cross-linking targets at the tumor surface, and (iv) direct inhibition of proliferation.

[0006] A previous Phase I trial evaluated IMAB362 as a single-dose monotherapy in patients with late-stage gastroesophageal cancer. The trial evaluated five doses of IMAB362 (33, 100, 300, 600, and 1000 mg / m 2 ) was applied as monotherapy. As this study failed to detect any relevant differences in the AE profile and other safety parameters between the dose groups, a single dose of this antibody was administered up to 1000 mg / m 2 The best results regarding antitumor activity were obtained at a dose of 300 mg / m 2 and 600 mg / m 2 Group 300 mg / m 2 In two patients in the group, the disease was controlled. Since they had only non-target lesions, they were assessed as non-CR, non-PD (CR = complete response; PD = progressive disease). The duration of non-CR, non-PD was approximately 2 months and 6 weeks, respectively. Tumor marker levels in these three patients remained stable. 2 One patient in the group presented with stable disease (SD), the duration of SD was approximately 2 months.

[0007] Based on IMAB362's highly potent mechanism of action for inducing cell killing, the survival benefit of IMAB362-treated mice bearing CLDN18.2-positive tumors, the absence of any signs of IMAB362-associated toxicity, and the encouraging results of the Phase I trial, a Phase IIa study was initiated. This Phase IIa clinical trial was conducted to determine the safety, tolerability, and antitumor activity of repeated doses of IMAB362 in patients with histologically proven metastatic, refractory, or recurrent disease of advanced adenocarcinoma of the stomach or lower esophagus.

[0008] In this Phase IIa trial, the investigational drug was administered to three sequentially recruited cohorts. The first cohort of three patients received a lower dose level (300 mg / m2 of body surface area). 2 ) received repeated doses of IMAB362. The antibody was given as a 2-hour intravenous infusion. Because no signs of IMAB362-related toxicity were detected in the first cohort, the second cohort (3 patients) received an IMAB362 dose of 600 mg / m2 of body surface area. 2 In the third cohort, 19 patients received the same dose (600 mg / m2 of body surface area). 2 Patients were assigned to receive IMAB362 every 2 weeks at Visits 2, 5, 6, 7, and 8 (5 applications). Patient samples from this cohort were analyzed for several concomitant analytics: ADCC, CDC, immunophenotyping, and genetic immune polymorphism. All patients in all cohorts received repeat doses of IMAB362 every 2 weeks at Visits 2, 5, 6, 7, and 8 (5 applications).

[0009] The discrepancy in responsiveness of antigen-positive tumors (overexpressing the target antigen to a similar extent) to intervention with therapeutic monoclonal antibodies such as IMAB362 suggests that there are additional factors related to therapy outcome, which calls for careful selection of patients who may benefit from antibody therapy. [Prior art documents] [Patent documents]

[0010]

Patent Document 1

Patent document 2

Patent Document 3

Patent document 4

Patent document 5

Patent document 6

Patent document 7

Non-licensed literature

[0011] [Non-licensed document 1] Niimi, T.ら, Mol Cell Biol, 2001, 21(21): 7380~90 pages

Non-licensed Document 2

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

[0012] Thus, there is a need to develop a test to measure patient eligibility for antibody therapy. The present invention addresses this need by providing markers that are associated with favorable and unfavorable outcomes, respectively, in antibody therapy. Furthermore, the present invention demonstrates that these markers are useful as markers for predicting clinical outcomes in cancer patients.

[0013] The findings presented herein can be used to select appropriate treatments for cancer patients, in particular to determine whether or not antibody therapy should be administered to a cancer patient. [Means for solving the problem]

[0014] The present invention provides methods of SNP (single nucleotide polymorphism) genotyping, such as for use in assessing an individual's likelihood of responding to a therapeutic treatment for cancer, selecting a therapeutic or preventative regimen (e.g., determining whether a particular therapeutic agent should be administered to an individual who has cancer or is at increased risk of developing cancer in the future), or assessing an individual's prognosis for disease severity and recovery.

[0015] The present invention is based on the discovery that certain genotypes of SNPs are associated with cancer susceptibility / insensitivity to antibody treatment, such as treatment of CLDN18.2-positive cancer, particularly CLDN18.2-positive gastroesophageal cancer, with IMAB362. The present invention is further based on the discovery that certain genotypes of SNPs are associated with clinical outcome in cancer patients and are therefore useful for predicting cancer.

[0016] In one aspect, the present invention provides a method for producing a method for treating a cancer cell comprising: (i) whether a cancer patient with a tumor antigen-positive tumor is a responder to treatment with an antibody against the tumor antigen, and / or (ii) whether a cancer patient, preferably a cancer patient with a tumor antigen-positive tumor, will experience progression-free survival; The present invention relates to a method for assessing a patient's phenotype, comprising determining the genotype of one or more single nucleotide polymorphisms selected from the group consisting of FCGR2A rs1801274, MUC1 rs4072037, IL-10 rs1800896, DNMT3A rs1550117, SMAD4 rs12456284, EGF rs4444903, CDH1 rs16260, ERCC1 rs11615, and FCGR3A rs396991 in a sample obtained from the patient.

[0017] In one embodiment, the presence of a heterozygous FCGR2A rs1801274[CT] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0018] In one embodiment, the presence of a homozygous FCGR2A rs1801274[TT] genotype and / or a homozygous FCGR2A rs1801274[CC] genotype indicates an increased risk that a cancer patient will not be a responder to treatment with an antibody and / or an increased risk that a cancer patient will not experience progression-free survival.

[0019] In one embodiment, the presence of a homozygous MUC1 rs4072037[AA] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0020] In one embodiment, the presence of a homozygous MUC1 rs4072037[GG] genotype indicates an increased risk that a cancer patient will not be a responder to treatment with an antibody and / or an increased risk that a cancer patient will not experience progression-free survival.

[0021] In one embodiment, the presence of a homozygous IL-10 rs1800896[GG] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0022] In one embodiment, the presence of a heterozygous DNMT3A rs1550117[GA] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0023] In one embodiment, the presence of a heterozygous SMAD4 rs12456284[GA] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0024] In one embodiment, the presence of a homozygous EGF rs4444903[AA] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0025] In one embodiment, the presence of a homozygous CDH1 rs16260[AA] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0026] In one embodiment, the presence of a homozygous ERCC1 rs11615[TT] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0027] In one embodiment, the presence of a heterozygous FCGR3A rs396991[TG] genotype and / or a homozygous FCGR3A rs396991[TT] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0028] In one embodiment, the presence of a homozygous FCGR3A rs396991[GG] genotype indicates an increased risk that a cancer patient will not be a responder to treatment with an antibody and / or an increased risk that a cancer patient will not experience progression-free survival.

[0029] In one embodiment, the tumor antigen is a CLDN18.2 protein.

[0030] In one aspect, the present invention provides a method for producing a method for treating a cancer cell comprising: (i) whether a cancer patient having a CLDN18.2-positive tumor is a responder to treatment with an antibody against the CLDN18.2 protein, and / or (ii) whether cancer patients, preferably cancer patients with CLDN18.2-positive tumors, will experience progression-free survival; The present invention relates to a method for assessing a patient's phenotype, comprising determining the genotype of one or more single nucleotide polymorphisms selected from the group consisting of FCGR2A rs1801274, MUC1 rs4072037, IL-10 rs1800896, DNMT3A rs1550117, SMAD4 rs12456284, EGF rs4444903, CDH1 rs16260, ERCC1 rs11615, and FCGR3A rs396991 in a sample obtained from the patient.

[0031] In one embodiment, the presence of a heterozygous FCGR2A rs1801274[CT] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0032] In one embodiment, the presence of a homozygous FCGR2A rs1801274[TT] genotype and / or a homozygous FCGR2A rs1801274[CC] genotype indicates an increased risk that a cancer patient will not be a responder to treatment with an antibody and / or an increased risk that a cancer patient will not experience progression-free survival.

[0033] In one embodiment, the presence of a homozygous MUC1 rs4072037[AA] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0034] In one embodiment, the presence of a homozygous MUC1 rs4072037[GG] genotype indicates an increased risk that a cancer patient will not be a responder to treatment with an antibody and / or an increased risk that a cancer patient will not experience progression-free survival.

[0035] In one embodiment, the presence of a homozygous IL-10 rs1800896[GG] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0036] In one embodiment, the presence of a heterozygous DNMT3A rs1550117[GA] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0037] In one embodiment, the presence of a heterozygous SMAD4 rs12456284[GA] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0038] In one embodiment, the presence of a homozygous EGF rs4444903[AA] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0039] In one embodiment, the presence of a homozygous CDH1 rs16260[AA] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0040] In one embodiment, the presence of a homozygous ERCC1 rs11615[TT] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0041] In one embodiment, the presence of a heterozygous FCGR3A rs396991[TG] genotype and / or a homozygous FCGR3A rs396991[TT] genotype indicates a reduced risk that a cancer patient will not be a responder to treatment with an antibody and / or a reduced risk that a cancer patient will not experience progression-free survival.

[0042] In one embodiment, the presence of a homozygous FCGR3A rs396991[GG] genotype indicates an increased risk that a cancer patient will not be a responder to treatment with an antibody and / or an increased risk that a cancer patient will not experience progression-free survival.

[0043] In one embodiment of all aspects of the invention, the antibody acts by recruiting the patient's immune system to destroy tumor cells. In one embodiment, the antibody acts by antibody-dependent cell-mediated cytotoxicity (ADCC) and / or complement-dependent cytotoxicity (CDC). In one embodiment, the antibody is a monoclonal antibody. In one embodiment of all aspects of the invention, the antibody comprises a heavy chain comprising an amino acid sequence represented by SEQ ID NO: 17 or 51, or a fragment thereof, and a light chain comprising an amino acid sequence represented by SEQ ID NO: 24, or a fragment thereof.

[0044] In one embodiment of all aspects of the invention, non-responsiveness to treatment with an antibody comprises a relative reduction in one or more of: survival, progression-free survival, recurrence-free survival, distant recurrence-free survival, and stable disease.

[0045] In one aspect, the present invention provides a method of treating a cancer patient, comprising: a. assessing whether a cancer patient is a responder to treatment with an antibody according to the methods of the present invention; b. (i) treating the cancer patient with the antibody if the cancer patient is at reduced risk of being a non-responder to treatment with the antibody, or (ii) not treating the cancer patient with the antibody if the cancer patient is at increased risk of being a non-responder to treatment with the antibody, and / or treating the cancer patient with a therapeutic regimen that includes a treatment different from treatment with the antibody.

[0046] In one embodiment, the therapeutic regimen includes treatment that is not dependent on the patient's immune system. In one embodiment, the therapeutic regimen does not include treatment with antibodies that act by recruiting the patient's immune system to destroy tumor cells. In one embodiment, the therapeutic regimen includes surgery, chemotherapy, and / or radiation. In one embodiment, the therapeutic regimen includes treatment with small molecule inhibitors of tumor antigens and / or antibody-drug conjugates in which the antibodies are directed against tumor antigens. In one embodiment, the antibody-drug conjugate is an antibody coupled to a radioactive, chemotherapeutic, or toxin moiety. In one embodiment, the antibody-drug conjugate is an antibody coupled to a cytostatic or cytotoxic compound.

[0047] In one aspect, the present invention relates to a method of assessing a clinical outcome in a cancer patient, comprising determining the genotype of one or more single nucleotide polymorphisms selected from the group consisting of FCGR2A rs1801274, MUC1 rs4072037, IL-10 rs1800896, DNMT3A rs1550117, SMAD4 rs12456284, EGF rs4444903, CDH1 rs16260, ERCC1 rs11615, and FCGR3A rs396991 in a sample obtained from the patient.

[0048] In one embodiment, the presence of a heterozygous FCGR2A rs1801274[CT] genotype indicates a reduced risk of a poor clinical outcome.

[0049] In one embodiment, the presence of the homozygous FCGR2A rs1801274[TT] genotype and / or the homozygous FCGR2A rs1801274[CC] genotype indicates an increased risk of a poor clinical outcome.

[0050] In one embodiment, the presence of the homozygous MUC1 rs4072037[AA] genotype is indicative of a reduced risk of poor clinical outcome.

[0051] In one embodiment, the presence of the homozygous MUC1 rs4072037[GG] genotype indicates an increased risk of a poor clinical outcome.

[0052] In one embodiment, the presence of the homozygous IL-10 rs1800896[GG] genotype indicates a reduced risk of a poor clinical outcome.

[0053] In one embodiment, the presence of a heterozygous DNMT3A rs1550117[GA] genotype indicates a reduced risk of a poor clinical outcome.

[0054] In one embodiment, the presence of a heterozygous SMAD4 rs12456284[GA] genotype indicates a reduced risk of poor clinical outcome.

[0055] In one embodiment, the presence of the homozygous EGF rs4444903[AA] genotype is indicative of a reduced risk of a poor clinical outcome.

[0056] In one embodiment, the presence of a homozygous CDH1 rs16260[AA] genotype indicates a reduced risk of a poor clinical outcome.

[0057] In one embodiment, the presence of the homozygous ERCC1 rs11615[TT] genotype indicates a reduced risk of a poor clinical outcome.

[0058] In one embodiment, the presence of a heterozygous FCGR3A rs396991[TG] genotype and / or a homozygous FCGR3A rs396991[TT] genotype indicates a reduced risk of a poor clinical outcome.

[0059] In one embodiment, the presence of the homozygous FCGR3A rs396991[GG] genotype indicates an increased risk of a poor clinical outcome.

[0060] In one embodiment, assessing the clinical outcome of the cancer patient comprises predicting the likelihood of one or more of: survival, progression-free survival, recurrence-free survival, distant recurrence-free survival, and stable disease. In one embodiment, poor clinical outcome comprises a relative reduction in one or more of survival, progression-free survival, recurrence-free survival, distant recurrence-free survival, and stable disease.

[0061] In one embodiment, the patient has a tumor antigen positive tumor and is treated with an antibody against the tumor antigen.

[0062] In one embodiment of all aspects of the invention, the sample is a sample containing DNA. In one embodiment, the DNA is extracted from a patient's body sample. In one embodiment, the DNA is extracted from blood.

[0063] In one embodiment of all aspects of the invention, the tumor is a solid tumor. In one embodiment, the tumor is a gastroesophageal tumor. In one embodiment, the tumor is an advanced adenocarcinoma of the stomach or lower esophagus. In one embodiment, the cancer is a gastroesophageal cancer. In one embodiment, the cancer is an advanced adenocarcinoma of the stomach or lower esophagus.

[0064] In a further aspect, the present invention relates to a kit comprising means for determining the genotype of one or more single nucleotide polymorphisms selected from the group consisting of FCGR2A rs1801274, MUC1 rs4072037, IL-10 rs1800896, DNMT3A rs1550117, SMAD4 rs12456284, EGF rs4444903, CDH1 rs16260, ERCC1 rs11615, and FCGR3A rs396991 in a sample obtained from a patient. In one embodiment, the kit is useful for carrying out the method of any aspect of the present invention. In one embodiment, the kit further comprises a data carrier. In a preferred embodiment, the data carrier is an electronic or non-electronic data carrier. In one embodiment, the data carrier comprises instructions on how to carry out the method of any aspect of the present invention.

[0065] Other objects, advantages and features of the present invention will become apparent from the following detailed description when considered in conjunction with the accompanying drawings. [Brief description of the drawings]

[0066] [Figure 1] Figure 1. Single nucleotide polymorphisms with statistically significant genotype frequency shifts between patient and control populations (χ2-test, p<0.05). Assignment of SNP-specific genotypes to bar regions is shown. Pat. Patient population, Co. Control population. [Diagram 2] FIG. 1 shows the relative frequency of homozygous risk genotypes per patient in relation to the number of SNP risk factors investigated per patient. Patients are grouped by the increasing frequency of accumulated homozygous risk factors. [Diagram 3] FIG. 1 shows progression-free survival of PP patients differentiated by rs1801274 (FCGR2A) genotype (Kaplan-Meier curves). [Figure 4] FIG. 1 shows progression-free survival of FAS patients differentiated by rs1801274 (FCGR2A) genotype (Kaplan-Meier curves). [Diagram 5]FIG. 1 shows progression-free survival of PP patients differentiated by rs1800896 (IL-10) genotype (Kaplan-Meier curves). [Figure 6] FIG. 1 shows progression-free survival of FAS patients differentiated by rs1800896 (IL-10) genotype (Kaplan-Meier curves). [Figure 7] FIG. 1 shows progression-free survival of FAS patients differentiated by rs1550117 (DNMT3A) genotype (Kaplan-Meier curves). [Figure 8] FIG. 1 shows progression-free survival of PP patients differentiated by rs12456284 (SMAD4) genotype (Kaplan-Meier curves). [Figure 9] FIG. 1 shows progression-free survival of PP patients differentiated by rs4072037 (MUC1) genotype (Kaplan-Meier curves). [Figure 10] FIG. 1 shows progression-free survival of FAS patients differentiated by rs4072037 (MUC1) genotype (Kaplan-Meier curves). [Figure 11] FIG. 1 shows progression-free survival of FAS patients differentiated by rs4444903 (EGF) genotype (Kaplan-Meier curves). [Figure 12] FIG. 1 shows progression-free survival of FAS patients differentiated by rs16260 (CDH1) genotype (Kaplan-Meier curves). [Figure 13] FIG. 1 shows progression-free survival of PP patients differentiated by rs11615 (ERCC1) genotype (Kaplan-Meier curves). [Figure 14] FIG. 1 shows progression-free survival of PP patients differentiated by rs396991 (FCGR3A) genotype (Kaplan-Meier curves). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0067] The present invention will be described in detail below, but it should be understood that the present invention is not limited to the specific methodology, protocols, and reagents described in the present invention, as they may vary. It should also be understood that the terminology used herein is only for the purpose of describing specific embodiments, and is not intended to limit the scope of the present invention, which will be limited only by the appended claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art.

[0068] In the following, elements of the present invention are described. Although these elements are listed with specific embodiments, it should be understood that they can be combined in any manner and in any number to create additional embodiments. The various described examples and preferred embodiments should not be construed to limit the present invention to only the embodiments explicitly described. The description should be understood to support and encompass embodiments combining the explicitly described embodiments with any number of the disclosed and / or preferred elements. Furthermore, any permutation and combination of all described elements in this application should be considered to be disclosed by the description of this application, unless otherwise indicated by the context.

[0069] Preferably, the terms used herein are defined as set forth in "A multilingual glossary of biotechnological terms: (IUPAC Recommendations)", edited by HGW Leuenberger, B. Nagel, and H. Kolbl, Helvetica Chimica Acta, CH-4010 Basel, Switzerland, (1995).

[0070] The practice of the present invention will employ, unless otherwise indicated, conventional methods of chemistry, biochemistry, cell biology, immunology, and recombinant DNA techniques as described in the art (see, e.g., Molecular Cloning: A Laboratory Manual, 2nd Edition, edited by J. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989).

[0071] Throughout this specification and the claims that follow, unless otherwise required by context, the word "comprise", and variations such as "comprises" and "comprising" imply the inclusion of a stated member, integer, or step, or group of members, integers, or steps, but not the exclusion of any other members, integers, or steps, or group of members, integers, or steps, although it is understood that in some embodiments such other members, integers, or steps, or group of members, integers, or steps may be excluded, i.e., the subject matter is to include a stated member, integer, or step, or group of members, integers, or steps. The terms "a" and "an" and "the" and similar references as used in the context of describing the invention (particularly in the context of the claims) should be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The recitation of ranges of values ​​herein is merely intended to serve as a shorthand method of individually referring to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples or exemplary language (e.g., "etc.") provided herein is intended merely to better illustrate the invention and does not limit the scope of the invention as otherwise claimed. No language in this specification should be construed as indicating any non-claimed element essential to the practice of the invention.

[0072] Several documents are cited throughout the text of this specification. Each of the documents cited herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, is hereby incorporated by reference in its entirety. Nothing herein should be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.

[0073] The present inventors provide tests that measure the eligibility of patients for certain cancer treatments, particularly antibody therapy, and draw conclusions about the prognosis of cancer patients. The results obtained using these tests allow doctors to make decisions about the appropriate treatment for cancer patients, particularly whether antibody therapy should be administered to a particular cancer patient.

[0074] The term "single nucleotide polymorphism" or "SNP" refers to DNA sequence variations that commonly occur in populations where a single nucleotide in a genome (or other shared sequence) differs between members of a species or paired chromosomes. SNPs can occur in the coding sequence of a gene, in non-coding regions of a gene, or in intergenic regions (regions between genes). SNPs in coding sequences may, but do not necessarily, change the amino acid sequence of the protein produced due to the degeneracy of the genetic code. Thus, SNPs in coding regions are of two types, synonymous and non-synonymous SNPs. Synonymous SNPs do not affect the protein sequence, whereas non-synonymous SNPs do change the amino acid sequence of the protein. Non-synonymous SNPs are of two types: missense and nonsense. SNPs that are not in protein coding regions may still affect gene splicing, transcription factor binding, messenger RNA degradation, or the sequence of non-coding RNA. Gene expression affected by this type of SNP is called eSNP (expressed SNP) and can be upstream or downstream of the gene.

[0075] A variety of methods known in the art can be used to genotype SNPs, including, for example, DNA sequencing, capillary electrophoresis, mass spectrometry, single-strand conformation polymorphism (SSCP), electrochemical analysis, denaturing HPLC and gel electrophoresis, restriction fragment length polymorphism, and hybridization analysis, to discover new SNPs and detect known SNPs.

[0076] The process of determining which nucleotide is present at a particular SNP position described herein for either or both alleles may be referred to by phrases such as "determining the genotype of the SNP" or "SNP genotyping." Thus, these phrases can refer to detecting a single allele (nucleotide) at a SNP position, or can encompass detecting both alleles (nucleotides) at a SNP position (such as to determine the homozygous or heterozygous status of a SNP position). Additionally, these phrases may also refer to detecting the amino acid residue encoded by the SNP (such as alternative amino acid residues encoded by different codons created by alternative nucleotides at the SNP position).

[0077] Reagents that specifically detect specific target SNP positions disclosed herein and are preferably specific for a particular nucleotide (allele) at the target SNP position (i.e., the reagents are preferably capable of distinguishing between different alternative nucleotides at the target SNP position, thereby allowing the identity of the nucleotide present at the target SNP position to be determined) can be used for SNP detection. Typically, such detection reagents hybridize to the target SNP-containing nucleic acid molecule by complementary base pairing in a sequence-specific manner and discriminate the target variant sequence from other nucleic acid sequences, such as those known in the art, in a test sample. One example of a detection reagent is a non-naturally occurring nucleic acid primer or probe that hybridizes to a target nucleic acid containing an SNP disclosed herein. In a preferred embodiment, such a primer or probe can distinguish a nucleic acid having a particular nucleotide (allele) at a target SNP position from other nucleic acids having a different nucleotide at the same target SNP position. Furthermore, the detection reagent can hybridize to a specific region 5' and / or 3' of the SNP position. It will be apparent to one of skill in the art that such detection reagents, such as such primers and probes, are useful directly as reagents for genotyping one or more of the SNPs disclosed herein and can be incorporated into any kit format.

[0078] To analyze SNPs, it may be appropriate to use oligonucleotides specific for alternative SNP alleles. Such oligonucleotides that detect single nucleotide variations in a target sequence may be referred to by terms such as "allele-specific oligonucleotides," "allele-specific probes," or "allele-specific primers."

[0079] The SNP detection reagent can be labeled with a reporter, such as a fluorescent reporter dye, that emits a detectable signal. The preferred reporter dye is a fluorescent dye, but any reporter dye that can be attached to a detection reagent, such as an oligonucleotide probe or primer, is suitable according to the present invention. In yet another embodiment, the detection reagent can be further labeled with a quencher dye, especially when the reagent is used as a self-quenching probe, such as a TaqMan probe. The SNP detection reagent disclosed herein can also contain other labels, including, but not limited to, biotin for streptavidin binding, haptens for antibody binding, and oligonucleotides for binding to another complementary oligonucleotide.

[0080] The present invention also contemplates reagents that do not contain (or are not complementary to) the identified SNP nucleotides, but are used to assay one or more SNPs disclosed herein. For example, primers that flank but do not directly hybridize to the target SNP position are useful in primer extension reactions, in which the primers hybridize to a region adjacent to the target SNP position (i.e., within one or more nucleotides from the target SNP site). During the primer extension reaction, the primer typically cannot extend past the target SNP site if a particular nucleotide (allele) is present at the target SNP site, and the primer extension product can be detected to determine which SNP allele is present at the target SNP site. For example, a particular ddNTP is typically used in the primer extension reaction to terminate primer extension when the ddNTP is incorporated into the extension product. Thus, reagents that bind to nucleic acid molecules within a region adjacent to a SNP site and are used to assay the SNP site are also contemplated by the present invention, although the bound sequence does not necessarily include the SNP site itself.

[0081] The term "FCGR2A" relates to the human FCGR2A gene. This gene encodes the low affinity immunoglobulin gamma Fc region receptor II-a (CD32) and is a member of the family of immunoglobulin Fc receptor genes. The protein encoded by this gene is a cell surface receptor found on phagocytes such as macrophages and neutrophils and is involved in the process of phagocytosis and clearing of immune complexes. Alternative splicing results in multiple transcript variants.

[0082] Preferably, the term "FCGR2A" relates to a nucleic acid comprising, preferably consisting of, the nucleic acid sequence of SEQ ID NO: 61 of the sequence listing or a variant of said nucleic acid sequence, and to a protein encoded by this nucleic acid, preferably a protein comprising, preferably consisting of, the amino acid sequence of SEQ ID NO: 62 of the sequence listing or a variant of said amino acid sequence.

[0083] Rsl801274 is a SNP in the FCGR2A gene. Rsl801274 (C) encodes the arginine (R) allele and the (T) allele encodes the variant histidine (H). This SNP is an intragenic transition substitution with the following codon changes: CAT, CGT, resulting in a missense mutation. The SNP is known in the literature by many names, including A519C and R131H. The context sequence is as follows: TGGGATGGAGAAGGTGGATCCAAA[C / T]GGGAGAATTTCTGGGATTTTCCATT

[0084] The term "MUC1" relates to the human MUC1 gene. This gene encodes mucin 1, cell surface associated (MUC1) or polymorphic epithelial mucin (PEM), a member of the mucin family and a membrane-bound glycosylated phosphoprotein. The protein is anchored to the apical surface of many epithelia by a transmembrane domain. Beyond the transmembrane domain is the SEA domain, which contains a cleavage site for releasing the large extracellular domain. The protein serves a protective function by binding to pathogens and also functions in a cell signaling capacity.

[0085] Preferably, the term "MUC1" relates to a nucleic acid comprising, preferably consisting of, the nucleic acid sequence of SEQ ID NO: 63 of the Sequence Listing or a variant of said nucleic acid sequence, and to a protein encoded by this nucleic acid, preferably a protein comprising, preferably consisting of, the amino acid sequence of SEQ ID NO: 64 of the Sequence Listing or a variant of said amino acid sequence.

[0086] rs4072037 is a SNP in the MUC1 gene. This SNP is an intragenic transition substitution with the following codon changes: ACA, ACG, resulting in a silent mutation. The context sequence is as follows: CCCCTAACCCGCAAACAGTTGTTAC[A / G]GGTTCTGGTCATGCAAGCTCTACCC

[0087] The term "IL-10" relates to the human IL-10 gene, which encodes the anti-inflammatory cytokine Interleukin 10 (IL-10), also known as human cytokine synthesis inhibitory factor (CSIF).

[0088] Preferably, the term "IL-10" relates to a nucleic acid comprising, preferably consisting of, the nucleic acid sequence of SEQ ID NO: 65 of the Sequence Listing or a variant of said nucleic acid sequence, and to a protein encoded by this nucleic acid, preferably a protein comprising, preferably consisting of, the amino acid sequence of SEQ ID NO: 66 of the Sequence Listing or a variant of said amino acid sequence.

[0089] rs1800896 is a SNP in the IL-10 gene. This SNP is an intergenic / unknown intragenic transition substitution. The context sequence is as follows: CAACACTACTAAGGCTTCTTTGGGA[A / G]GGGGAAGTAGGGATAGGTAAGAGGA

[0090] The term "DNMT3A" relates to the human DNMT3A gene. This gene codes for DNA (cytosine-5)-methyltransferase 3A. The protein encoded by this gene is an enzyme that catalyzes the transfer of methyl groups to specific CpG structures in DNA.

[0091] Preferably, the term "DNMT3A" relates to a nucleic acid comprising, preferably consisting of, the nucleic acid sequence of SEQ ID NO: 67 of the sequence listing or a variant of said nucleic acid sequence, and to a protein encoded by this nucleic acid, preferably a protein comprising, preferably consisting of, the amino acid sequence of SEQ ID NO: 68 of the sequence listing or a variant of said amino acid sequence.

[0092] rs1550117 is a SNP in the DNMT3A gene. This SNP is an intragenic transition substitution in the DNMT3A promoter region. The context sequence is as follows: AATTCCACCAGCACAGCCACTCACT[A / G]TGTGCTCATCTCACTCCTCCAGCAG

[0093] The term "SMAD4" refers to the human SMAD4 gene. This gene encodes the mother's against decapentaplegic homolog 4. The protein encoded by this gene belongs to the Darfwin family of proteins that are involved in cell signaling and modulate members of the TGFβ protein superfamily. It combines receptor-regulated SMADs such as SMAD1 and SMAD2 to form a complex that binds DNA and functions as a transcription factor. It is the only known mammalian coSMAD.

[0094] Preferably, the term "SMAD4" relates to a nucleic acid comprising, preferably consisting of, the nucleic acid sequence of SEQ ID NO: 69 of the sequence listing or a variant of said nucleic acid sequence, and to a protein encoded by this nucleic acid, preferably a protein comprising, preferably consisting of, the amino acid sequence of SEQ ID NO: 70 of the sequence listing or a variant of said amino acid sequence.

[0095] rs12456284 is a SNP in the SMAD4 gene. This SNP is an intragenic transition substitution in the 3'-UTR. The context sequence is as follows: AGGTCCAGAGCCAGTGTTCTTGTTC[A / G]ACCTGAAAGTAATGGCTCTGGGTTG

[0096] The term "EGF" relates to the human EGF gene. This gene codes for epidermal growth factor. EGF is a growth factor that stimulates cell growth, proliferation and differentiation by binding to its receptor EGFR.

[0097] Preferably, the term "EGF" relates to a nucleic acid comprising, preferably consisting of, the nucleic acid sequence of SEQ ID NO: 71 of the sequence listing or a variant of said nucleic acid sequence, and to a protein encoded by this nucleic acid, preferably a protein comprising, preferably consisting of, the amino acid sequence of SEQ ID NO: 72 of the sequence listing or a variant of said amino acid sequence.

[0098] rs4444903 is a SNP in the EGF gene. This SNP is an intragenic transition substitution in the 5'-UTR. The context sequence is as follows: CTTTCAGCCCCAATCCAAGGGTTGT[A / G]GCTGGAACTTTCCATCAGTTCTTCC

[0099] The term "CDH1" relates to the human CDH1 gene. This gene encodes cadherin-1, also known as CAM120 / 80 or epithelial cadherin (E-cadherin) or uvomorulin. This protein is a classical member of the cadherin superfamily. It is a calcium-dependent cell-cell adhesion glycoprotein composed of five extracellular cadherin repeats, a transmembrane domain, and a highly conserved cytoplasmic tail. Loss of function is thought to contribute to cancer progression by increasing proliferation, invasion, and / or metastasis.

[0100] Preferably, the term "CDH1" relates to a nucleic acid comprising, preferably consisting of, the nucleic acid sequence of SEQ ID NO: 73 of the Sequence Listing or a variant of said nucleic acid sequence, and to a protein encoded by this nucleic acid, preferably a protein comprising, preferably consisting of, the amino acid sequence of SEQ ID NO: 74 of the Sequence Listing or a variant of said amino acid sequence.

[0101] rs16260 is a SNP in the CDH1 gene. This SNP is an intragenic transversion substitution located in the promoter region of the CDH1 gene. The context sequence is as follows: CTAGCAACTCCAGGCTAGAGGGTCA[A / C]CCGGTCTATGCGAGGCCGGGTGGGC

[0102] The term "ERCC1" refers to the human ERCC1 gene. This gene encodes the DNA excision repair protein ERCC-1. The function of the ERCC1 protein is primarily in the nucleotide excision repair of damaged DNA.

[0103] Preferably, the term "ERCC1" relates to a nucleic acid comprising, preferably consisting of, the nucleic acid sequence of SEQ ID NO: 75 of the Sequence Listing or a variant of said nucleic acid sequence, and to a protein encoded by this nucleic acid, preferably a protein comprising, preferably consisting of, the amino acid sequence of SEQ ID NO: 76 of the Sequence Listing or a variant of said amino acid sequence.

[0104] rs11615 is a SNP in the ERCC1 gene. This SNP is a silent intragenic transition substitution. The context sequence is as follows: ATCCCGTACTGAAGTTCGTGCGCAA[C / T]GTGCCCTGGAATTTGGCGACGTAA

[0105] The term "FCGR3A" refers to the human FCGR3A gene. This gene encodes the low affinity immunoglobulin gamma Fc region receptor III-A. The protein encoded by this gene is part of a cluster of differentiated cell surface molecules.

[0106] Preferably, the term "FCGR3A" relates to a nucleic acid comprising, preferably consisting of, the nucleic acid sequence of SEQ ID NO: 77 of the sequence listing or a variant of said nucleic acid sequence, and to a protein encoded by this nucleic acid, preferably a protein comprising, preferably consisting of, the amino acid sequence of SEQ ID NO: 78 of the sequence listing or a variant of said amino acid sequence.

[0107] rs396991 is a SNP in the FCGR3A gene. This SNP is an intragenic transversion substitution with the following codon changes: GTT, TTT, resulting in a missense mutation. rs396991(T) encodes the phenylalanine (F) allele and the (G) allele encodes the variant valine (V). The context sequence is as follows: CGGCTCCTACTTCTGCAGGGGGCTT[G / T]TTGGGAGTAAAAAATGTGTCTTCAGA

[0108] Claudins are a family of proteins that are the most important components of tight junctions, where they establish a paracellular barrier that controls the flow of molecules in the intercellular space between epithelial cells. Claudins are transmembrane proteins that span the membrane four times, with both N- and C-termini located in the cytoplasm. The first extracellular loop or domain consists of an average of 53 amino acids, and the second extracellular loop or domain consists of about 24 amino acids. Cell surface proteins of the claudin family, such as CLDN18.2, are expressed in tumors of various origins and, due to their selective expression (without expression in toxicity-associated normal tissues) and localization to the plasma membrane, are particularly suitable as target structures in the context of antibody-mediated cancer immunotherapy.

[0109] The term "CLDN" as used herein means claudin, including CLDN18.2. Preferably, the claudin is a human claudin.

[0110] The term "CLDN18" refers to claudin 18 and includes any variants, including claudin 18 splice variant 1 (claudin 18.1 (CLDN18.1)) and claudin 18 splice variant 2 (claudin 18.2 (CLDN18.2)).

[0111] The term "CLDN18.2" preferably refers to a protein comprising, and preferably consisting of, human CLDN18.2, in particular the amino acid sequence according to SEQ ID NO: 1 of the Sequence Listing, or a variant of said amino acid sequence. The first extracellular loop or domain of CLDN18.2 preferably comprises amino acids 27 to 81, more preferably amino acids 29 to 78, of the amino acid sequence shown in SEQ ID NO: 1. The second extracellular loop or domain of CLDN18.2 preferably comprises amino acids 140 to 180 of the amino acid sequence shown in SEQ ID NO: 1. The first and second extracellular loops or domains preferably form the extracellular portion of CLDN18.2.

[0112] CLDN18.2 is selectively expressed in normal tissues in differentiated epithelial cells of gastric mucosa. CLDN18.2 is expressed in cancers of various origins, such as pancreatic cancer, esophageal cancer, gastric cancer, bronchial cancer, breast cancer, and ENT tumors. CLDN18.2 is a valuable target for the prevention and / or treatment of primary tumors, such as gastric cancer, esophageal cancer, pancreatic cancer, lung cancer such as non-small cell lung cancer (NSCLC), ovarian cancer, colon cancer, liver cancer, head and neck cancer, and gallbladder cancer, and their metastases, especially gastric cancer metastases such as Krukenberg tumors, peritoneal metastases, and lymph node metastases.

[0113] The term "CLDN18.1" preferably refers to a protein comprising, preferably consisting of, human CLDN18.1, in particular the amino acid sequence according to SEQ ID NO: 2 of the Sequence Listing, or a variant of said amino acid sequence.

[0114] "Prognosis" as used herein refers to prediction of outcome, particularly the probability of progression-free survival (PFS) or disease-free survival (DFS). Survival is usually calculated as the average number of months (or years) that 50% of patients will survive, or the percentage of patients alive after 1, 5, 15, and 20 years. Prognosis is important for treatment decisions, because patients with good prognosis are usually offered less invasive treatments, while patients with poor prognosis are usually offered more aggressive treatments, such as broader chemotherapy drugs.

[0115] "Prediction," as used herein, refers to providing information about the likely response of a disease to a distinct therapeutic treatment.

[0116] The phrase "indicative of risk" refers to a measurement of a particular degree of likelihood or probability. The phrase "indicative of reduced risk" refers to a lower degree of likelihood or probability. The phrase "indicative of increased risk" refers to a particular, higher, or increased degree of likelihood or probability.

[0117] If an event is "indicative of a reduced risk that a cancer patient is a non-responder to treatment with an antibody", then said event is indicative of a cancer patient being a responder to treatment with an antibody, i.e., the patient is more likely to be a responder to treatment with an antibody, optionally, the patient is more likely to be a responder to treatment with an antibody than a patient who is not a responder to treatment with an antibody.

[0118] If an event is "indicative of an increased risk that a cancer patient is a non-responder to treatment with an antibody", then the event is indicative that the cancer patient is a non-responder to treatment with an antibody, i.e., the patient is more likely to be a non-responder to treatment with an antibody, optionally, the patient is more likely to be a non-responder to treatment with an antibody than patients who are responders to treatment with an antibody.

[0119] If an event "indicates a reduced risk of a poor clinical outcome", then the event is indicative of a good clinical outcome, i.e., more likely to result in a good clinical outcome, optionally more likely to result in a good clinical outcome than in a poor clinical outcome.

[0120] If an event "indicates an increased risk of a poor clinical outcome", then the event is indicative of a poor clinical outcome, i.e., is more likely to result in a poor clinical outcome, optionally more likely to result in a poor clinical outcome than in a good clinical outcome.

[0121] An event "indicative of a reduced risk that a cancer patient will not experience progression-free survival" indicates that the event is indicative that a cancer patient will experience progression-free survival, i.e., the patient is more likely to experience progression-free survival, optionally, the patient is more likely to experience progression-free survival than a patient who does not experience progression-free survival.

[0122] An event "indicates an increased risk that a cancer patient will not experience progression-free survival" means that the event indicates that a cancer patient will not experience progression-free survival, i.e., the patient is more likely to not experience progression-free survival, optionally, the patient is more likely to not experience progression-free survival than patients who do experience progression-free survival.

[0123] The term "sample" as used herein refers to any material obtained from a subject and that can be used for analytical purposes, in particular for determining the genotype of one or more single nucleotide polymorphisms. In certain embodiments, the samples described herein can be or can be derived from any tissue, cell, and / or biological fluid, for example, from a mammal or human being to be tested. The sample can be isolated from a patient, for example, from the human body. The sample can be a fractionated and / or purified sample. For example, samples encompassed by the present invention can be or can be derived from a tissue (e.g., a section or explant) sample, a single cell sample, a cell colony sample, a cell culture sample, a blood (e.g., whole blood or a blood fraction, e.g., a blood cell fraction, serum, or plasma) sample, a urine sample, or a sample from other peripheral sources. In a particularly preferred embodiment, the sample is a tissue sample (e.g., a biopsy from a subject having or suspected of having cancerous tissue). For example, the sample can be a tumor biopsy. Samples can be obtained from a patient before the start of therapeutic treatment, during therapeutic treatment, and / or after therapeutic treatment, for example, before, during, or after administration of a cancer therapy.

[0124] The sample material can be used to generate nucleic acid extracts (including DNA and / or RNA), protein, or membrane extracts from any bodily fluid (blood, serum, plasma, urine, saliva, sputum, gastric juices, semen, tears, sweat, etc.), skin, hair, cells (particularly nucleated cells), biopsy, buccal swab or tissue, or tumor specimen.

[0125] The present invention further relates to a kit comprising means such as reagents for genotyping one or more single nucleotide polymorphisms as described herein. In the context of the present invention, the term "kit of parts" is understood to be any combination of at least some of the components identified herein, which are combined and spatially co-located into a functional unit, and may contain further components. For example, the kit may comprise preselected primers or probes specific to the nucleic acid sequence comprising one or more single nucleotide polymorphisms to be genotyped. The kit may also comprise an enzyme suitable for amplifying the nucleic acid (e.g., a polymerase such as Taq), as well as deoxyribonucleotides and buffers required for the reaction mixture for amplification. The kit may also comprise a probe specific to one or more single nucleotide polymorphisms. In certain embodiments, the means is detectably labeled.

[0126] The kit of the invention may comprise (i) a container and / or (ii) a data carrier. The container may be filled with one or more of the above-mentioned means or reagents. The data carrier may be a non-electronic data carrier, for example a graphic data carrier such as an information leaflet, an information sheet, a barcode, or an access code, or an electronic data carrier, for example a floppy disk, a compact disk (CD), a digital versatile disk (DVD), a microchip, or another semiconductor-based electronic data carrier. The access code may allow access to a database, for example an internet database, a centralized or distributed database. The data carrier may contain instructions to allow analysis of the results obtained with the kit, in particular for using the kit in the method of the invention.

[0127] Additionally or alternatively, the kit may contain other materials desirable from a commercial and user standpoint, including buffers, reagents, and / or diluents.

[0128] Based on the results obtained (i.e., based on the genotype of one or more single nucleotide polymorphisms), the physician can select a cancer therapy, particularly an antibody therapy, to which the patient is predicted to be responsive. Preferably, a cancer therapy to which the patient is predicted to be unresponsive is not administered to the patient.

[0129] Based on the predicted outcome that a patient is non-responsive to antibody therapy, particularly antibody therapies that act by recruiting the patient's immune system to destroy tumor cells, a physician may choose to administer a cancer therapy different from antibody therapy, particularly antibody therapies that act by recruiting the patient's immune system to destroy tumor cells. In particular, a physician may choose to administer chemotherapy.

[0130] Based on the predicted outcome that a patient will be responsive to antibody therapy, particularly antibody therapies that act by recruiting the patient's immune system to destroy tumor cells, a physician may choose to administer antibody therapy, particularly antibody therapies that act by recruiting the patient's immune system to destroy tumor cells, optionally in combination with chemotherapy.

[0131] In particular, the term "(therapeutic) treatment" in relation to cancer treatment, as used herein, refers to any treatment aimed at improving the health status and / or extending (increasing) the life span of a patient. The treatment may eliminate cancer, reduce the size or number of tumors in a patient, stop or slow down the development of cancer in a patient, inhibit or slow down the development of new cancers in a patient, reduce the frequency or severity of symptoms in a patient, and / or reduce recurrence in a patient who currently has cancer or has previously had cancer. The (therapeutic) treatment of cancer may be selected from the group consisting of surgery, chemotherapy, radiation therapy, and targeted therapy. One particularly preferred treatment according to the present invention is the treatment of cancer with therapeutic monoclonal antibodies against a tumor antigen, such as CLDN18.2, expressed in target cells.

[0132] Adjuvant therapy is a treatment given in addition to the primary, main, or initial treatment. The surgery and combined treatment regimens used in cancer therapy have led to this term being used primarily to describe adjuvant cancer treatment. One example of adjuvant therapy is the additional treatment usually given after surgery in which all detectable disease has been removed but there remains a statistical risk of recurrent disease due to latent disease.

[0133] Terms such as "responsive" or "responder" refer to the fact that, in a therapeutic setting, a patient has a therapeutic benefit from a given mode of treatment, particularly the observation of a reduction, prevention, or elimination of disease, including a shortening of the duration of disease, a halting or slowing of progression or worsening of disease, an inhibition or slowing of the occurrence of new disease and / or recurrences, a prevention or delay in the onset of disease or its symptoms, a reduction in the frequency or severity of symptoms in patients who currently have or have previously had the disease, and / or an extension of the patient's lifespan. In particular, these refer to the observation of a reduction in tumor mass, or an increase in tumor-free time, recurrence-free time, or overall survival.

[0134] Terms such as "non-responsive" or "non-responder" refer to the fact that in a therapeutic setting, a patient has no therapeutic benefit from a given mode of treatment, particularly no observed reduction, prevention, or elimination of disease, i.e., the patient is resistant to the treatment.

[0135] Complete response is defined as the absence of any residual disease, such as cancer, and is usually assessed by pathological analysis of the tissue sample obtained. In this context, the term "pathological complete response" (pCR) is frequently used. In particular, pCR is defined as the absence of any residual invasive tumor cells in the original tumor bed. However, the definition of pCR may vary between different grading systems. Pathological complete response has been shown to be a prognostic factor for better overall survival, but also for disease-free survival and recurrence-free survival.

[0136] Recurrence-free survival is defined as the time from randomization to first recurrence or recurrent disease, second cancer, or death.

[0137] Progression-free survival (PFS) is a type of survival rate that measures the length of time during and after a drug therapy or treatment that the disease being treated (usually cancer) does not get worse. It is sometimes used as a metric to test the health of people with a disease to try to determine how well a new treatment is working, and it is often used as a clinical endpoint in randomized, controlled trials of cancer therapies.

[0138] According to the present invention, the term "cancer patient experiencing progression-free survival" relates to a cancer patient whose time without disease progression has been extended, in particular when compared to the mean of the patients and / or when compared to patients who are non-responders to a given mode of treatment. Preferably, said extended time is at least 4, preferably at least 5, more preferably at least 6 months, e.g. at least 7 months or at least 8 months, said time starting, for example, from the time of the first administration of treatment.

[0139] The term "clinical outcome" is defined as the clinical result of a disease, especially after treatment, e.g., reduction or amelioration of symptoms.

[0140] The term "recurrence" with respect to cancer includes local events such as the reappearance of tumor cells in the same site and organ of the original disease, distant metastasis, which may appear even many years after the initial diagnosis and therapy of the cancer, or infiltration of tumor cells into regional lymph nodes.

[0141] The terms "individual" and "subject" are used interchangeably herein. They refer to a human, non-human primate, or other mammal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate) that may suffer from or be susceptible to a disease or disorder (e.g., cancer), but may or may not have a disease or disorder. In many embodiments, the individual is a human. Unless otherwise stated, the terms "individual" and "subject" do not denote a particular age, and thus include adults, elderly people, children, and newborns. In a preferred embodiment of the present invention, the "individual" or "subject" is a "patient". The term "patient" refers to the subject of treatment, particularly a diseased subject, according to the present invention.

[0142] In one particularly preferred embodiment, the methods of the invention are performed on a patient who has already been diagnosed with cancer.

[0143] "Target cell" is intended to mean any unwanted cell, such as a cancer cell. In a preferred embodiment, the target cell expresses CLDN18.2.

[0144] In the context of the present invention, terms such as "protect", "prevent" or "prophylactic" refer to the prevention of the appearance and / or spread of disease in a subject, in particular minimizing the likelihood that the subject will develop a disease or delaying the onset of the disease. For example, subjects at risk for cancer are candidates for a therapy to prevent the cancer.

[0145] "At risk" refers to a subject who is identified as having a higher than normal probability of developing a disease, particularly cancer, compared to the general population.Furthermore, a subject who has had or currently has a disease, particularly cancer, is a subject who is at increased risk of developing the disease, because such a subject may continue to develop the disease.A subject who currently has or has had cancer is also at increased risk of cancer metastasis.

[0146] As used herein, the term "combination" in the context of administering a therapy refers to the use of more than one therapy or therapeutic agent. The use of the term "in combination" does not restrict the order in which the therapy or therapeutic agent is administered to a subject. The therapy or therapeutic agent can be administered before, simultaneously with, or after administering a second therapy or therapeutic agent to a subject. Preferably, the therapy or therapeutic agent is administered to a subject in a sequence, amount, and / or time interval that allows the therapy or therapeutic agent to act together. In certain embodiments, the therapy or therapeutic agent is administered to a subject in a sequence, amount, and / or time interval that allows them to provide an increased benefit than if they were otherwise administered, particularly independently of each other. Preferably, the increased benefit is a synergistic effect.

[0147] The term "disease" refers to an abnormal condition that affects an individual's body. A disease is often interpreted as a medical condition associated with specific symptoms and signs. A disease may be caused by factors that are originally from an external source, such as an infectious disease, or a disease may be caused by a malfunction within the body, such as an autoimmune disease. In humans, "disease" is often used more broadly to refer to any condition that causes pain, dysfunction, suffering, social problems, or death to the individual who suffers from it, or similar problems to those who are in contact with the individual. In this broader sense, disease sometimes includes injuries, physical disabilities, disorders, syndromes, infections, isolated symptoms, deviant behavior, and atypical deformations of structure and function, while in other contexts and for other purposes, these can be considered as distinct categories. Diseases usually affect individuals not only physically but also emotionally, since suffering from and living with many diseases can change one's outlook on life and personality. According to the present invention, the term "disease" includes cancer, particularly the forms of cancer described herein. Any reference herein to cancer or a particular form of cancer also includes cancer metastases thereof. In a preferred embodiment, the disease treated by the present application involves cells expressing a tumor antigen, such as CLDN18.2.

[0148] "Diseases involving cells expressing a tumor antigen" means, according to the present invention, that a tumor antigen, such as CLDN18.2, is expressed in cells of a diseased tissue or organ. In one embodiment, the expression of the tumor antigen in cells of a diseased tissue or organ is increased compared to the situation in a healthy tissue or organ. Increase refers to an increase of at least 10%, in particular at least 20%, at least 50%, at least 100%, at least 200%, at least 500%, at least 1000%, at least 10000%, or even more. In one embodiment, expression is found only in diseased tissue, while expression in the corresponding healthy tissue is suppressed. According to the present invention, diseases involving cells expressing a tumor antigen include cancer diseases. Furthermore, according to the present invention, cancer diseases are preferably those in which cancer cells express the tumor antigen.

[0149] The term "cancer disease" or "cancer" refers to or describes a physiological condition in an individual that is typically characterized by unregulated cell proliferation. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia. More specifically, examples of such cancer include bone cancer, blood cancer, lung cancer, liver cancer, pancreatic cancer, skin cancer, head or neck cancer, cutaneous or intraocular melanoma, uterine cancer, ovarian cancer, rectal cancer, anal cancer, stomach cancer, colon cancer, breast cancer, prostate cancer, uterine cancer, genital and reproductive organ cancer, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal gland cancer, soft tissue sarcoma, bladder cancer, kidney cancer, renal cell carcinoma, renal pelvis cancer, central nervous system (CNS) neoplasm, neuroectodermal cancer, spinal axis tumor, glioma, meningioma, and pituitary adenoma. The term "cancer" according to the present invention also includes cancer metastasis. Preferably, the "cancer disease" is characterized by cells expressing a tumor antigen, such as CLDN18.2, and the cancer cells express such tumor antigen. The cells expressing a tumor antigen, such as CLDN18.2, are preferably cancer cells of a cancer as described herein.

[0150] According to the present invention, the term "tumor" or "tumor disease" refers to the abnormal proliferation of cells (called neoplastic cells, tumorigenous cells, or tumor cells) that preferably form swellings or lesions. By "tumor cells" is meant abnormal cells that grow by rapid, uncontrolled cellular proliferation and continue to grow after the stimulus that initiated the new growth has ceased. Tumors exhibit a partial or complete lack of structural organization and functional coordination with normal tissues and usually form a discrete mass of tissue that may be benign, premalignant, or malignant.

[0151] In one embodiment, the cancer according to the invention involves cancer cells expressing a tumor antigen, such as CLDN18.2. In one embodiment, the cancer is tumor antigen positive, such as CLDN18.2 positive. In one embodiment, the expression of the tumor antigen, such as CLDN18.2, is on the surface of the cells. In one embodiment, at least 50%, preferably 60%, 70%, 80%, or 90% of the cancer cells are tumor antigen positive, such as CLDN18.2 positive, and / or at least 40%, preferably at least 50% of the cancer cells are positive for surface expression of a tumor antigen, such as CLDN18.2. In one embodiment, at least 95% or at least 98% of the cancer cells are tumor antigen positive, such as CLDN18.2 positive. In one embodiment, at least 60%, at least 70%, at least 80%, or at least 90% of the cancer cells are positive for surface expression of a tumor antigen, such as CLDN18.2.

[0152] In one embodiment, the cancer with cancer cells expressing CLDN18.2 or the CLDN18.2-positive cancer is selected from the group consisting of gastric cancer, esophageal cancer, pancreatic cancer, lung cancer such as non-small cell lung cancer (NSCLC), ovarian cancer, colon cancer, liver cancer, head and neck cancer, and gallbladder cancer, and metastases thereof, such as gastric cancer metastases, peritoneal metastases, and lymph node metastases, in particular, such as Krukenberg tumors. In one embodiment, the cancer is an adenocarcinoma, in particular an advanced adenocarcinoma. Particularly preferred cancer diseases are adenocarcinomas of the stomach, esophagus, pancreatic duct, bile duct, lung, and ovary. In one embodiment, the cancer is selected from the group consisting of gastric cancer, esophagus, in particular cancer of the lower esophagus, cancer of the esophagogastric junction, and gastroesophageal cancer. In a particularly preferred embodiment, the cancer is gastroesophageal cancer, such as metastatic, refractory, or recurrent advanced gastroesophageal cancer. In one embodiment, the CLDN18.2-positive tumor is a tumor of the above cancer types.

[0153] Embodiments involving CLDN18.2-positive tumors or cancer cells expressing CLDN18.2 preferably relate to the use of antibodies capable of binding to CLDN18.2. In one embodiment, the antibody capable of binding to CLDN18.2 is a monoclonal, chimeric, or humanized antibody, or a fragment of an antibody.

[0154] According to the present invention, "cancer" is a malignant tumor originating from epithelial cells. This group represents the most common cancers, including common forms of breast, prostate, lung and colon cancer.

[0155] "Adenocarcinoma" is a cancer that originates from glandular tissue. This tissue is also part of a larger tissue category known as epithelial tissue. Epithelial tissue includes skin, glands, and various other tissues that line body cavities and organs. Epithelium is embryologically derived from ectoderm, endoderm, and mesoderm. To be classified as an adenocarcinoma, a cell does not necessarily have to be part of a gland, as long as it has secretory properties. This form of cancer can occur in several higher mammals, including humans. Well-differentiated adenocarcinomas tend to resemble the glandular tissue from which they originate, while poorly differentiated adenocarcinomas may not. By staining the cells from the biopsy, the pathologist determines whether the tumor is an adenocarcinoma or some other type of cancer. Adenocarcinoma can occur in many tissues of the body due to the ubiquitous nature of glands in the body. Although each gland may not secrete the same substances, as long as there is an exocrine function to the cell, it is considered a gland, and therefore its malignant form is called adenocarcinoma. Malignant adenocarcinomas often metastasize if given enough time to invade and spread to other tissues. Ovarian adenocarcinoma is the most common type of ovarian cancer. It includes serous and mucinous adenocarcinoma, clear cell adenocarcinoma, and endometrioid adenocarcinoma.

[0156] "Metastasis" refers to the spread of cancer cells from its original site to another part of the body. The formation of metastasis is a very complex process, depending on the detachment of malignant cells from the primary tumor, invasion of the extracellular matrix, penetration of the endothelial basement membrane to enter the body cavities and blood vessels, and then infiltration of the target organ after being transported by the blood. Finally, the growth of new tumors at the target site depends on angiogenesis. Tumor metastasis often occurs even after the primary tumor is removed, since tumor cells or tumor components may remain and develop metastatic potential. In one embodiment, the term "metastasis" according to the present invention relates to "distant metastasis", which refers to metastasis away from the primary tumor and the regional lymph node system. In one embodiment, the term "metastasis" according to the present invention relates to lymph node metastasis. One particular form of metastasis treatable using the therapy of the present invention is metastasis originating from gastric cancer as the primary site. In a preferred embodiment, such gastric cancer metastasis is Krukenberg tumor, peritoneal metastasis, and / or lymph node metastasis.

[0157] A refractory cancer is a malignancy for which a particular treatment is not effective, either because it is initially unresponsive to the treatment or because it becomes unresponsive over time. The terms "refractory," "unresponsive," or "resistant" are used interchangeably herein.

[0158] Krukenberg tumor is a rare metastatic tumor of the ovary that accounts for 1%-2% of all ovarian tumors. The prognosis of Krukenberg tumor remains very poor and there is no established treatment for Krukenberg tumor. Krukenberg tumor is a metastatic signet ring cell adenocarcinoma of the ovary. The stomach is the primary site in most Krukenberg tumor cases (70%). Cancers of the colon, appendix, and breast (mainly invasive lobular carcinoma) are the next most common primary sites. Rare cases of Krukenberg tumor originating from cancers of the gallbladder, biliary tract, pancreas, small intestine, ampulla of Vater, cervix, and bladder / urachus have been reported.

[0159] The term "surgery" as used herein includes the removal of a tumor in an operation, which is a common treatment for cancer. A surgeon may remove a tumor using local excision.

[0160] The term "chemotherapy" as used herein preferably refers to the use of a chemotherapeutic agent or combination of chemotherapeutic agents to stop the growth of cancer cells by killing them or stopping them from dividing. When chemotherapy is taken by mouth or injected into a vein or muscle, the drug can enter the bloodstream and reach cancer cells throughout the body (systemic chemotherapy). When chemotherapy is placed directly into the cerebrospinal fluid, organs, or body cavities such as the abdomen, the drug mainly affects cancer cells in these areas (local chemotherapy).

[0161] Chemotherapeutic agents according to the present invention include cytostatic and cytotoxic compounds. Conventional chemotherapeutic agents act by killing rapidly dividing cells, which is one of the main properties of most cancer cells. This means that chemotherapy also harms cells that divide rapidly under normal circumstances, such as cells in the bone marrow, digestive tract, and hair follicles. This results in the most common side effects of chemotherapy. According to the present invention, the term "chemotherapy" does not include antibodies that act by targeting abnormally expressed proteins (tumor antigens) in cancer cells and recruiting the patient's immune system to destroy tumor cells. However, antibodies that target abnormally expressed proteins (tumor antigens) in cancer cells and act by a therapeutic moiety or agent conjugated to the antibody can be considered as a form of chemotherapy. However, in the strict sense, the term "chemotherapy" does not include targeted therapy according to the present invention.

[0162] According to the present invention, the term "chemotherapeutic agent" includes taxanes, platinum compounds, nucleoside analogs, camptothecin analogs, anthracyclines, etoposide, bleomycin, vinorelbine, cyclophosphamide, and combinations thereof. According to the present invention, reference to a chemotherapeutic agent includes any prodrug, e.g., derivatives such as esters, salts, or conjugates of the agent. Examples are conjugates of the agent with a carrier substance, e.g., protein-bound paclitaxel, e.g., albumin-bound paclitaxel. Preferably, the salts of the agent are pharmaceutically acceptable.

[0163] Taxanes are a class of diterpene compounds originally derived from natural sources such as plants of the genus Taxus, although some have been artificially synthesized. The primary mechanism of action of the taxane class of drugs is the disruption of microtubule function, thereby inhibiting the process of cell division. Taxanes include docetaxel (Taxotere) and paclitaxel (Taxol).

[0164] According to the present invention, the term "docetaxel" refers to a compound having the following formula:

[0165] [ka]

[0166] In particular, the term "docetaxel" refers to the compound 1,7β,10β-trihydroxy-9-oxo-5β,20-epoxytax-11-ene-2α,4,13α-triyl 4-acetate 2-benzoate 13-{(2R,3S)-3-[(tert-butoxycarbonyl)-amino]-2-hydroxy-3-phenylpropanoate}.

[0167] According to the present invention, the term "paclitaxel" refers to a compound having the following formula:

[0168] [ka]

[0169] In particular, the term "paclitaxel" refers to the compound (2α,4α,5β,7β,10β,13α)-4,10-bis-(acetyloxy)-13-{[(2R,3S)-3-(benzoylamino)-2-hydroxy-3-phenylpropanoyl]oxy}-1,7-dihydroxy-9-oxo-5,20-epoxytax-11-en-2-ylbenzoate.

[0170] According to the present invention, the term "platinum compound" refers to a compound that contains platinum in its structure, such as a platinum complex, and includes compounds such as cisplatin, carboplatin, and oxaliplatin.

[0171] The term "cisplatin" or "cisplatinum" refers to the compound cis-diamminedichloroplatinum(II) (CDDP) of the following formula:

[0172] [ka]

[0173] The term "carboplatin" refers to the compound cis-diammine(1,1-cyclobutanedicarboxylato)platinum(II) of the following formula:

[0174] [ka]

[0175] The term "oxaliplatin" refers to a compound that is a platinum compound complexed to a diaminocyclohexane carrier ligand of the following formula:

[0176] [ka]

[0177] In particular, the term "oxaliplatin" refers to the compound [(1R,2R)-cyclohexane-1,2-diamine](ethanedioato-O,O')platinum(II). Injectable oxaliplatin is also sold under the trade name Eloxatine.

[0178] The term "nucleoside analogs" refers to structural analogs of nucleosides, a category that includes both purine analogs and pyrimidine analogs.

[0179] The term "gemcitabine" refers to a compound that is a nucleotide analogue of the following formula:

[0180] [ka]

[0181] In particular, the term refers to the compound 4-amino-1-(2-deoxy-2,2-difluoro-β-D-erythro-pentofuranosyl)pyrimidin-2(1H)-one or 4-amino-1-[(2R,4R,5R)-3,3-difluoro-4-hydroxy-5-(hydroxymethyl)oxolan-2-yl]-1,2-dihydropyrimidin-2-one.

[0182] The term "nucleoside analogs" includes fluoropyrimidine derivatives, such as fluorouracil and its prodrugs. The term "fluorouracil" or "5-fluorouracil" (5-FU or f5U), sold under the brand names Adrucil, Carac, Efudix, Efudex, and Fluoroplex, is a compound that is a pyrimidine analog of the following formula:

[0183] [ka]

[0184] In particular, the term refers to the compound 5-fluoro-1H-pyrimidine-2,4-dione.

[0185] The term "capecitabine" (Xeloda, Roche) refers to a chemotherapy agent that is a prodrug that is converted to 5-FU in tissues. Capecitabine, which can be administered orally, has the following formula:

[0186] [ka]

[0187] In particular, this term refers to the compound pentyl [1-(3,4-dihydroxy-5-methyltetrahydrofuran-2-yl)-5-fluoro-2-oxo-1H-pyrimidin-4-yl]carbamate.

[0188] The term "folinic acid" or "leucovorin" refers to a compound useful in synergistic combination with the chemotherapeutic agent 5-fluorouracil. Thus, when reference is made herein to the administration of 5-fluorouracil or a prodrug thereof, said administration in one embodiment may include administration in conjunction with folinic acid. Folinic acid has the formula:

[0189] [ka]

[0190] In particular, the term refers to the compound (2S)-2-{[4-[(2-amino-5-formyl-4-oxo-5,6,7,8-tetrahydro-1H-pteridin-6-yl)methylamino]benzoyl]amino}pentanedioic acid.

[0191] According to the present invention, the term "camptothecin analog" refers to a derivative of the compound camptothecin (CPT; (S)-4-ethyl-4-hydroxy-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinoline-3,14-(4H,12H)-dione). Preferably, the term "camptothecin analog" refers to a compound comprising the following structure:

[0192] [ka]

[0193] According to the present invention, preferred camptothecin analogues are inhibitors of the DNA enzyme topoisomerase I (topo I). Preferred camptothecin analogues according to the present invention are irinotecan and topotecan.

[0194] Irinotecan is a drug that prevents DNA from unwinding by inhibition of topoisomerase I. Chemically, it is a semisynthetic analogue of the natural alkaloid camptothecin, which has the following formula:

[0195] [ka]

[0196] In particular, the term "irinotecan" refers to the compound (S)-4,11-diethyl-3,4,12,14-tetrahydro-4-hydroxy-3,14-dioxo 1H-pyrano[3',4':6,7]-indolizino[1,2-b]quinolin-9-yl-[1,4'bipiperidine]-1'-carboxylate.

[0197] Topotecan has the formula:

[0198] [ka]

[0199] It is a topoisomerase inhibitor.

[0200] In particular, the term "topotecan" refers to the compound (S)-10-[(dimethylamino)methyl]-4-ethyl-4,9-dihydroxy-1H-pyrano[3',4':6,7]indolizino[1,2-b]quinoline-3,14(4H,12H)-dione monohydrochloride.

[0201] Anthracyclines are a class of drugs commonly used in cancer chemotherapy that are also antibiotics. Structurally, all anthracyclines share a common tetracyclic 7,8,9,10-tetrahydrotetracene-5,12-quinone structure and usually require glycosylation at specific sites.

[0202] Anthracyclines exert one or more of the following mechanisms of action: 1. Inhibiting DNA and RNA synthesis by intercalating between the base pairs of DNA / RNA strands, thus preventing replication of rapidly proliferating cancer cells, 2. Inhibiting the topoisomerase II enzyme, preventing the relaxation of supercoiled DNA, thus blocking DNA transcription and replication, 3. Creating iron-mediated free oxygen radicals that damage DNA and cell membranes.

[0203] According to the present invention, the term "anthracycline" preferably refers to an agent, preferably an anti-cancer agent, for inducing apoptosis by inhibiting DNA recombination in topoisomerase II.

[0204] Examples of anthracyclines and anthracycline analogs include, but are not limited to, daunorubicin (daunomycin), doxorubicin (adriamycin), epirubicin, idarubicin, rhodomycin, pyrarubicin, valrubicin, N-trifluoro-acetyldoxorubicin-14-valerate, aclacinomycin, morpholinodoxorubicin (morpholino-DOX), cyanomorpholino-doxorubicin (cyanomorpholino-DOX), 2-pyrrolino-doxorubicin (2-PDOX), 5-imino-daunomycin, mitoxantrone, and aclacinomycin A (aclarubicin). Mitoxantrone is a member of the anthracenedione class of compounds, anthracycline analogues that lack the sugar moiety of anthracyclines but retain a planar polycylic aromatic ring structure that allows for intercalation into DNA.

[0205] Particularly contemplated as an anthracycline in the context of the present invention is epirubicin. Epirubicin is an anthracycline drug having the following formula:

[0206] [ka]

[0207] It is sold in the United States under the trade name Ellence, and elsewhere under the trade name Pharmorubicin or Epirubicin Ebewe. In particular, the term "epirubicin" refers to the compound (8R,10S)-10-[(2S,4S,5R,6S)-4-amino-5-hydroxy-6-methyl-oxan-2-yl]oxy-6,11-dihydroxy-8-(2-hydroxyacetyl)-1-methoxy-8-methyl-9,10-dihydro-7H-tetracene-5,12-dione. Epirubicin is preferred in some chemotherapy regimens over doxorubicin, the most popular anthracycline, because it appears to cause fewer side effects.

[0208] The term "etoposide" refers to a semisynthetic derivative of podophyllotoxin that exhibits antitumor activity. Etoposide inhibits DNA synthesis by forming a complex with topoisomerase II and DNA. This complex induces breaks in double-stranded DNA and prevents repair by topoisomerase II binding. Accumulated breaks in DNA prevent entry into the mitotic phase of cell division, leading to cell death. Etoposide has the formula:

[0209] [ka]

[0210] In particular, the term refers to the compound 4'-demethyl-epipodophyllotoxin 9-[4,6-O-(R)-ethylidene-beta-D-glucopyranoside], 4'-(dihydrogen phosphate).

[0211] The term "bleomycin" refers to a glycopeptide antibiotic produced by the bacterium Streptomyces verticillus. When used as an anti-cancer agent, it works by causing breaks in DNA. Bleomycin preferably includes a compound having the following formula:

[0212] [ka]

[0213] The term "vinorelbine" refers to a semisynthetic vinca alkaloid and antimitotic chemotherapy drug given as a treatment for some types of cancer, including breast cancer and non-small cell lung cancer. Vinorelbine preferably includes compounds having the following formula:

[0214] [ka]

[0215] Cyclophosphamide is a nitrogen mustard alkylating agent from the oxazofolin group. Its main use is in conjunction with other chemotherapy agents in the treatment of some forms of cancer. Cyclophosphamide preferably includes compounds having the following formula:

[0216] [ka]

[0217] In the context of this invention, the term "radiation therapy" refers to the use of high-energy x-rays or other types of radiation to kill or prevent cancer cells from growing. There are two types of radiation therapy: external radiation therapy uses a device outside the body to send radiation toward the cancer. Internal radiation therapy uses radioactive material sealed in needles, seeds, wires, or catheters that are placed directly into or near the cancer. The way in which radiation therapy is given depends on the type and stage of the cancer being treated.

[0218] According to the present invention, the term "targeted therapy" relates to any therapy that can be used to preferentially target diseased cells, such as cancer cells, while non-diseased cells are not targeted or are targeted to a lesser extent. Targeting of diseased cells preferably results in killing of diseased cells and / or impairing their proliferation or viability. Such therapies include i) antibodies, antibody fragments, and proteins (e.g., antibodies or antibody conjugates against CLDN18.2 as described herein), either naked or conjugated to a therapeutic moiety that targets a certain cell surface target on diseased cells, such as a tumor antigen, e.g., CLDN18.2, or ii) small molecules that impair the proliferation or viability of diseased cells. In a specific embodiment, the agent binds to an antigen that is expressed at a greater level on diseased cells than on normal stem cells. In a specific embodiment, the agent specifically binds to a tumor antigen. Conventional chemotherapy or radiation therapy is not considered a "targeted therapy" even though it is often directed to tumors. Furthermore, the term "antibody therapy", according to the present invention, does not include therapy with antibodies, fragments or derivatives thereof that are conjugated to a therapeutic moiety, but relates to therapy with antibodies, fragments or derivatives thereof that act solely by recruiting the patient's immune system to destroy tumor cells.

[0219] The term "antigen" relates to an agent that comprises an epitope against which an immune response will be generated and / or directed. The term "antigen" includes in particular proteins, peptides, polysaccharides, nucleic acids, in particular RNA and DNA, as well as nucleotides. The term "antigen" also includes agents that become antigenic and sensitize only by conversion (e.g. by being present intermediately in a molecule or by completing with a body protein). The antigen or its processing product can preferably be recognized by a T or B cell receptor or by an immunoglobulin molecule such as an antibody. In a preferred embodiment, the antigen is a disease-associated antigen, such as a tumor antigen, such as CLDN18.2.

[0220] In the context of the present invention, the term "tumor antigen" or "tumor associated antigen" relates to an antigen present in tumor cells. Preferably, the antigen is present on tumor cells, such as on the surface of the tumor cells. Preferably, the "tumor antigen" is expressed by tumor cells. In one embodiment, the term "tumor antigen" relates to a protein that is aberrantly expressed in tumor cells when compared to normal, i.e., non-neoplastic cells. For example, expression may only be found in tumor cells, but not in normal, i.e., non-neoplastic cells, or the level of expression may be higher in tumor cells compared to normal, i.e., non-neoplastic cells. In one embodiment, the term "tumor antigen" refers to a protein that is specifically expressed under normal conditions, in a limited number of tissues and / or organs, or at a particular developmental stage, expressed in one or more tumor or cancer tissues, or aberrantly expressed. In the context of the present invention, tumor antigens are preferably associated with the cell surface of cancer cells, and preferably not expressed, only rarely expressed, or expressed at low levels in normal tissues and cells. Preferably, according to the invention, the tumor antigen is not expressed intracellularly if the level of expression is below the limit of detection and / or if the level of expression is too low to allow binding to the cells by an added tumor antigen-specific antibody. A particularly preferred tumor antigen according to the invention is CLDN18.2.

[0221] According to the present invention, the term "tumor antigen positive cancer" or "tumor antigen positive tumor" or similar terms refers to a cancer or tumor with cancer or tumor cells, which preferably express a tumor antigen on the surface of said cancer or tumor cells. A tumor antigen is expressed on the surface of a cell if it is located on the surface of said cell and is accessible for binding to the cell by an added tumor antigen-specific antibody.

[0222] In a preferred embodiment of the present invention, the "tumor antigen positive cancer" or "tumor antigen positive tumor" is a "CLDN18.2 positive cancer" or "CLDN18.2 positive tumor". According to the present invention, the term "CLDN18.2 positive cancer" or "CLDN18.2 positive tumor" refers to a cancer or tumor with cancer or tumor cells, which preferably express CLDN18.2 on the surface of said cancer or tumor cells.

[0223] "Cell surface" is used according to its ordinary meaning in the art, and thus includes the outside of a cell that is accessible to binding by proteins and other molecules.

[0224] The term "extracellular portion" in the context of the present invention refers to a part of a molecule, such as a protein, that faces the extracellular space of a cell and is preferably accessible from the outside of said cell, for example by an antigen-binding molecule, such as an antibody, located on the outside of said cell. Preferably, the term refers to one or more extracellular loops or domains or fragments thereof.

[0225] According to the present invention, CLDN18.2 is not substantially expressed in cells when the level of expression is lower compared to expression in gastric cells or gastric tissue. Preferably, the level of expression is less than 10%, preferably less than 5%, 3%, 2%, 1%, 0.5%, 0.1%, or 0.05%, or even lower, of expression in gastric cells or gastric tissue. Preferably, CLDN18.2 is not substantially expressed in cells when the level of expression exceeds the level of expression in non-cancerous tissue other than the stomach by no more than 2-fold, preferably no more than 1.5-fold, preferably not exceeding the level of expression in said non-cancerous tissue. Preferably, CLDN18.2 is not substantially expressed in cells when the level of expression is below detection limits and / or the level of expression is too low to allow binding by a CLDN18.2-specific antibody added to the cells.

[0226] According to the present invention, CLDN18.2 is expressed in cells when the level of expression exceeds the level of expression in non-cancerous tissues other than the stomach by more than 2-fold, preferably more than 10-fold, more than 100-fold, more than 1000-fold, or more than 10000-fold. Preferably, CLDN18.2 is expressed in cells when the level of expression exceeds the detection limit and / or when the level of expression is high enough to allow binding by a CLDN18.2-specific antibody added to the cells. Preferably, CLDN18.2 expressed in cells is expressed or exposed on the surface of the cells.

[0227] The term "epitope" refers to an antigenic determinant within a molecule, i.e., a part of a molecule that is recognized by the immune system, e.g., by an antibody. For example, an epitope is a distinct three-dimensional site on an antigen that is recognized by the immune system. Epitopes usually consist of chemically active surface groups of molecules, such as amino acids or sugar side chains, and usually have specific three-dimensional structural features and specific charge characteristics. Conformational and non-conformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents. An epitope of a protein preferably comprises a continuous or discontinuous portion of said protein and is preferably between 5 and 100, preferably between 5 and 50, more preferably between 8 and 30, most preferably between 10 and 25 amino acids in length, for example an epitope may preferably be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acids in length.

[0228] The term "antibody" includes glycoproteins comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, as well as any molecule comprising an antigen-binding portion of such a glycoprotein. The term "antibody" includes, without limitation, monoclonal antibodies, including single-chain antibodies, e.g., scFv, and antigen-binding antibody fragments, e.g., Fab and Fab' fragments, recombinant antibodies, human antibodies, humanized antibodies, chimeric antibodies, antibody fragments or derivatives, and also includes all recombinant forms of antibodies, e.g., antibodies expressed in prokaryotes, non-glycosylated antibodies, and any antigen-binding antibody fragments and derivatives described herein. Each heavy chain is composed of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. Each light chain is composed of a light chain variable region (abbreviated herein as VL) and a light chain constant region. The VH and VL regions can be further subdivided into regions of hypervariability, called complementarity determining regions (CDRs), interspersed with more conserved regions, called framework regions (FRs). Each VH and VL is composed of three CDRs and four FRs arranged from amino terminus to carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain binding domains that interact with antigens. The constant regions of antibodies can mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.

[0229] The term "monoclonal antibody" as used herein refers to a preparation of antibody molecules of single molecular composition. A monoclonal antibody exhibits a single binding specificity and affinity. In one embodiment, a monoclonal antibody is produced by a hybridoma comprising a B cell obtained from a non-human animal, e.g., a mouse, fused to an immortalized cell.

[0230] The term "recombinant antibody," as used herein, includes all antibodies prepared, expressed, created, or isolated by recombinant means, such as, for example, (a) antibodies isolated from animals (e.g., mice) that are transgenic or transchromosomal for autologous prepared immunoglobulin genes or hybridomas, (b) antibodies isolated from host cells that have been transformed to express the antibody, e.g., from transfectomas, (c) antibodies isolated from recombinant combinatorial antibody libraries, and (d) antibodies prepared, expressed, created, or isolated by any other means of splicing immunoglobulin gene sequences to other DNA sequences.

[0231] The term "human antibody," as used herein, is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. Human antibodies may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo).

[0232] The term "humanized antibody" refers to a molecule having an antigen-binding site substantially derived from an immunoglobulin from a non-human species, with the remaining immunoglobulin structure of the molecule being based on the structure and / or sequence of a human immunoglobulin. The antigen-binding site may comprise a complete variable domain fused onto a constant domain, or may comprise only the complementarity determining regions (CDRs) grafted onto appropriate framework regions in the variable domain. The antigen-binding site may be wild-type or modified by one or more amino acid substitutions, e.g., to more closely resemble human immunoglobulins. Some forms of humanized antibodies preserve all CDR sequences (e.g., a humanized mouse antibody containing all six CDRs from mouse antibodies). Other forms have one or more CDRs altered relative to the original antibody.

[0233] The term "chimeric antibody" refers to an antibody in which one portion of each of the amino acid sequences of the heavy and light chains is homologous to the corresponding sequence in an antibody derived from a particular species or belonging to a particular class, while the remaining segments of the chains are homologous to the corresponding sequence in another. In general, the variable regions of both the light and heavy chains mimic the variable regions of an antibody derived from one species of mammal, while the constant portions are homologous to the sequences of an antibody derived from another species. One obvious advantage of such chimeric forms is that the variable regions can be derived from currently known sources, for example, using readily available B cells or hybridomas from non-human host organisms, conveniently in combination with constant regions derived from human cell samples. The variable regions have the advantage of ease of preparation and the specificity is not affected by the source, but the constant regions that are human are less likely to elicit an immune response from a human subject when the antibody is injected than do constant regions from non-human sources. However, the definition is not limited to this particular example.

[0234] Antibodies may be derived from various species, including, but not limited to, mouse, rat, rabbit, guinea pig, and human.

[0235] Antibodies described herein include IgA, e.g., IgA1 or IgA2, IgG1, IgG2, IgG3, IgG4, IgE, IgM, and IgD antibodies. In various embodiments, the antibody is an IgG1 antibody, more specifically an IgG1, kappa, or IgG1, lambda isotype (i.e., IgG1, κ, λ), an IgG2a antibody (e.g., IgG2a, κ, λ), an IgG2b antibody (e.g., IgG2b, κ, λ), an IgG3 antibody (e.g., IgG3, κ, λ), or an IgG4 antibody (e.g., IgG4, κ, λ).

[0236] As used herein, a "heterologous antibody" is defined with respect to the transgenic organism producing such an antibody. The term refers to an antibody that has an amino acid sequence or a coding nucleic acid sequence that corresponds to one found in an organism other than the transgenic organism, and generally originates from a species other than the transgenic organism.

[0237] As used herein, a "heterohybrid antibody" refers to an antibody having light and heavy chains of different organismal origins. For example, an antibody having a human heavy chain associated with a murine light chain is a heterohybrid antibody.

[0238] The antibodies described herein are preferably isolated. An "isolated antibody", as used herein, is intended to refer to an antibody that is substantially free of other antibodies with different antigen specificities (e.g., an isolated antibody that specifically binds to a tumor antigen is substantially free of antibodies that specifically bind to antigens other than the tumor antigen). However, an isolated antibody that specifically binds to an epitope, isoform, or variant of a human tumor antigen may have cross-reactivity with other related antigens, for example, from other species (e.g., tumor antigen species homologs). Furthermore, an isolated antibody may be substantially free of other cellular material and / or chemicals. In one embodiment of the present invention, an "isolated" monoclonal antibody combination relates to antibodies with different specificities and combined in a particular composition or mixture.

[0239] The term "antigen-binding portion" (or simply "binding portion") of an antibody, or "antigen-binding fragment" (or simply "binding fragment") of an antibody, or similar terms, refers to one or more fragments of an antibody that retain the ability to specifically bind to an antigen. It has been shown that the antigen-binding function of an antibody can be performed by fragments of a full-length antibody. Examples of binding fragments encompassed within the term "antigen-binding portion" of an antibody include: (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL, and CH domains; (ii) an F(ab')2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) an Fd fragment consisting of the VH and CH domains; (iv) an Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment consisting of the VH domain (Ward et al., (1989) Nature, 341:544-546); (vi) an isolated complementarity determining region (CDR), and (vii) a combination of two or more isolated CDRs, optionally joined by a synthetic linker. Furthermore, although the two domains of the Fv fragment, VL and VH, are coded for by separate genes, they can be joined using recombinant methods by a synthetic linker that allows them to be produced as a single protein chain in which the VL and VH regions pair to form a monovalent molecule (known as single-chain Fv (scFv); see, e.g., Bird et al. (1988) Science, 242: 423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA, 85: 5879-5883). Such single-chain antibodies are also intended to be encompassed within the term "antigen-binding fragment" of an antibody. Further examples are binding domain immunoglobulin fusion proteins comprising (i) a binding domain polypeptide fused to an immunoglobulin hinge region polypeptide, (ii) an immunoglobulin heavy chain CH2 constant region fused to the hinge region, and (iii) an immunoglobulin heavy chain CH3 constant region fused to the CH2 constant region. The binding domain polypeptide can be a heavy chain variable region or a light chain variable region. Binding domain immunoglobulin fusion proteins are further disclosed in US2003 / 0118592 and US2003 / 0133939.These antibody fragments are obtained using conventional techniques known to those with skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.

[0240] The term "binding domain" characterizes in the context of the present invention a structure, e.g. of an antibody, which binds to / interacts with a given target structure / antigen / epitope. A binding domain according to the present invention therefore designates an "antigen interaction site".

[0241] For the purposes of the present invention, all antibodies and derivatives of antibodies, such as antibody fragments, described herein are encompassed by the term "antibody." The term "antibody derivative" refers to any modification of an antibody, for example, a conjugate of an antibody and another agent or antibody, or an antibody fragment.

[0242] Naturally occurring antibodies are generally monospecific, i.e., they bind to a single antigen. The present invention includes antibodies that bind to a target cell (by engaging a tumor antigen) and to a second entity, such as a cytotoxic cell (e.g., by engaging a CD3 receptor). The antibodies of the present invention may be bispecific or multispecific, e.g., trispecific, tetraspecific, etc.

[0243] The term "bispecific molecule" is intended to include agents that have two different binding specificities. For example, the molecule can bind to or interact with (a) a cell surface antigen, and (b) a receptor, such as an Fc receptor, on the surface of an effector cell. The term "multispecific molecule" is intended to include agents that have more than two different binding specificities. For example, the molecule can bind to or interact with (a) a cell surface antigen, (b) a receptor, such as an Fc receptor, on the surface of an effector cell, and (c) at least one other component. Thus, the term "antibody against a tumor antigen" includes, but is not limited to, bispecific, trispecific, tetraspecific, and other multispecific molecules that are directed against tumor antigens and other targets, such as Fc receptors on effector cells. The term "bispecific antibody" also includes diabodies. Diabodies are bivalent, bispecific antibodies in which the VH and VL domains are on a single polypeptide chain, but are expressed using a linker that is too short to allow pairing between the two domains on the same chain, thereby forcing these domains to pair with complementary domains on another chain and creating two antigen-binding sites (see, e.g., Holliger, P. et al., (1993) Proc. Natl. Acad. Sci. USA, 90: 6444-6448; Poljak, RJ et al., (1994) Structure, 2: 1121-1123).

[0244] In accordance with the present invention, an antibody can exert its therapeutic effect by recruiting a patient's immune system to destroy tumor cells and / or by a therapeutic moiety or agent coupled to the antibody. For purposes of the present invention, such antibody conjugates can be considered to be encompassed by the term "chemotherapeutic agent," whereas antibodies that exert their therapeutic effect by recruiting a patient's immune system to destroy tumor cells cannot be considered to be encompassed by the term "chemotherapeutic agent."

[0245] In the context of the present invention, the antibody may preferably act by recruiting the patient's immune system to destroy tumor cells, i.e. the antibody, in particular when bound to its target, such as a tumor antigen on a diseased cell, elicits immune effector functions as described herein, preferably directed against cells, such as cancer cells, carrying a tumor antigen, such as CLDN18.2, on their surface.

[0246] The term "immune effector function" in the context of the present invention includes any function mediated by components of the immune system that results in the inhibition of tumor growth and / or the inhibition of tumor development, including, for example, the inhibition of tumor spread and metastasis. Preferably, the immune effector function results in the killing of cancer cells. Such functions include complement-dependent cytotoxicity (CDC), antibody-dependent cell-mediated cytotoxicity (ADCC), antibody-dependent cell-mediated phagocytosis (ADCP), the induction of apoptosis in cells bearing tumor antigens, the cytolysis of cells bearing tumor antigens, and / or the inhibition of the proliferation of cells bearing tumor antigens. The binding agent can also exert an effect by simply binding to a tumor antigen on the surface of a cancer cell. For example, an antibody can block the function of a tumor antigen or induce apoptosis by simply binding to a tumor antigen on the surface of a cancer cell.

[0247] Antibody-dependent cell-mediated cytotoxicity ADCC describes the cell-killing capacity of effector cells, particularly lymphocytes, which preferably involve target cells that have been marked by an antibody.

[0248] ADCC preferably occurs when an antibody binds to an antigen on a tumor cell and the antibody Fc domain engages with an Fc receptor (FcR) on the surface of an immune effector cell. Several families of Fc receptors have been identified, and certain cell populations characteristically express defined Fc receptors. ADCC can be viewed as a mechanism that directly induces immediate tumor destruction to various degrees through antigen presentation and induction of tumor-directed T-cell responses. Preferably, induction of ADCC in vivo leads to tumor-directed T-cell responses and host-derived antibody responses.

[0249] Complement-dependent cytotoxicity CDC is another cell killing method that can be directed by antibodies. IgM is the most effective isotype for complement activation. Both IgG1 and IgG3 are also very effective in directing CDC via the classical complement activation pathway. Preferably, in this cascade, the formation of an antigen-antibody complex leads to the CDC of participating antibody molecules, such as IgG molecules. H This results in the uncloaking of multiple Clq binding sites that are in close proximity on the 2 domain (C1q is one of three subcomponents of complement C1). Preferably, these uncloaked C1q binding sites convert the previously low affinity C1q-IgG interaction to one of high avidity, which triggers a cascade of events involving a series of other complement proteins, resulting in the proteolytic release of the effector chemoattractants / activators C3a and C5a. Preferably, the complement cascade culminates in the formation of a cell membrane attack complex, which creates pores in the cell membrane that facilitate the free passage of water and solutes in and out of the cell.

[0250] To inhibit tumor growth and / or tumorigenesis according to the present invention, the antibody can be conjugated to a therapeutic moiety or agent, such as a cytotoxin, a drug (e.g., an immunosuppressant), or a radioisotope. A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells, and in particular kills cells. Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxyanthracin dione, mitoxantrone, mithramycin, actinomycin D, amanitin, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin, as well as analogs or congeners thereof. Therapeutic agents suitable for forming antibody conjugates include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, fludarabine, 5-fluorouracil, decarbazine), alkylating agents (e.g., mechlorethamine, thioepa, chlorambucil, melphalan, carmustine (BSNU), and lomustine (CCNU), cyclophosphatase (CPS), and cyclophosphatase (CPS). In a preferred embodiment, the therapeutic agent is a cytotoxic or radiotoxic agent. In another embodiment, the therapeutic agent is an immunosuppressant. In yet another embodiment, the therapeutic agent is GM-CSF. In a preferred embodiment, the therapeutic agent is doxorubicin, cisplatin, bleomycin sulfate, carmustine, chlorambucil, cyclophosphamide, or ricin A.

[0251] The antibodies can also be conjugated to radioisotopes, such as iodine-131, yttrium-90, or indium-111, to generate cytotoxic radiopharmaceuticals.

[0252] The antibody conjugates of the present invention can be used to modify a given biological response, and the drug moiety should not be construed as being limited to classical chemical therapeutic agents. For example, the drug moiety can be a protein or polypeptide having a desired biological activity. Such proteins can include, for example, enzymatically active toxins, or active fragments thereof, such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; proteins such as tumor necrosis factor or interferon-γ; or biological response modifiers, such as lymphokines, interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"), granulocyte macrophage colony stimulating factor ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or other growth factors.

[0253] Techniques for conjugating such therapeutic moieties to antibodies are well known and are described, for example, in Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy," in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery," in Controlled Drug Delivery (2nd ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review," in Monoclonal Antibodies '84: Biological And Clinical Applications, Pincheraet et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy," in Monoclonal See Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thorpe et al., "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates," Immunol. Rev., 62: 119-58 (1982).

[0254] The term "antibody against a tumor antigen" or similar terms relates to an antibody which is directed against or capable of binding to a tumor antigen. The term "binding" according to the present invention preferably relates to specific binding.

[0255] According to the present invention, an antibody is capable of binding to a predetermined target if it has significant affinity for said target and binds to said target in a standard assay. "Affinity" or "binding affinity" is defined as the equilibrium dissociation constant (K D ) Preferably, the term "significant affinity" refers to a ratio of 10 -5 M or less, 10 -6 M or less, 10 -7 M or less, 10 -8 M or less, 10 -9 M or less, 10 -10 M or less, 10 -11 M or less, or 10 -12 The dissociation constant (K D ) to bind to a specific target.

[0256] An antibody is incapable of (substantially) binding to a target if it has no significant affinity for the target and does not bind significantly, in particular not detectably, to said target in a standard assay. Preferably, the antibody does not bind detectably to said target when present at a concentration of up to 2, preferably 10, more preferably 20, in particular 50 or 100 μg / ml or more. Preferably, the antibody is incapable of binding to a given target to which it can bind, if it has a K D At least 10 times, 100 times, 10 times 3 Double, 10 4 Double, 10 5 Double or 10 6 Twice as high as K D For example, an antibody that binds to a target to which it can bind has a K D 10 -7 M, the K for binding to a target for which the antibody has no significant affinity D is at least 10 -6 M, 10 -5 M, 10 -4 M, 10 -3 M, 10 -2 M or 10 -1 It's M.

[0257] An antibody is specific for a given target if it can bind to the given target but cannot bind to other targets, i.e. it has no significant affinity for other targets and does not bind significantly to other targets in standard assays. According to the present invention, an antibody is specific for a tumor antigen if it can bind to the tumor antigen but cannot (substantially) bind to other targets. Preferably, an antibody is specific for a tumor antigen if its affinity and binding to such other targets does not significantly exceed its affinity or binding to tumor antigen-unrelated proteins, such as bovine serum albumin (BSA), casein, human serum albumin (HSA), or non-tumor antigen transmembrane proteins such as MHC molecules or transferrin receptors, or any other specified polypeptides. Preferably, an antibody has a K for binding to a target that it is not specific for, and the K for binding to such a target is not significantly greater than the K for binding to such a target. D At least 1 / 10, 1 / 100, 1 / 10 3 1 / 10 4 1 / 10 5 1 / 10 6 K lower by a factor of 1 D For example, an antibody is specific for a given target if it binds to said given target at a K D 10 -7 M, this is the K for binding to a non-specific target D is at least 10 -6 M, 10 -5 M, 10 -4 M, 10 -3 M, 10 -2 M or 10 -1 It should be M.

[0258] The binding of an antibody to a target can be experimentally determined using any suitable method, see, for example, Berzofsky et al., "Antibody-Antigen Interactions," Fundamental Immunology, Paul, WE ed., Raven Press New York, NY (1984), Kuby, Janis Immunology, WH Freeman and Company New York, NY (1992), and the methods described herein. Affinity can be readily determined using routine techniques, such as by equilibrium dialysis; by using a BIAcore 2000 instrument using the general procedures outlined by the manufacturer; by radioimmunoassay using radiolabeled target antigen; or by another method known to those of skill in the art. Affinity data can be analyzed, for example, by the method of Scatchard et al., Ann NY Acad. ScL, 51:660 (1949). The measured affinity of a particular antibody-antigen interaction can vary when measured under different conditions, e.g., salt concentration, pH. Thus, affinity as well as other antigen binding parameters, e.g., K D ,I C 50 The measurements are preferably carried out using standardized solutions of antibody and antigen, and standardized buffers.

[0259] As used herein, "isotype" refers to the antibody class (e.g., IgM or IgG1) that is encoded by heavy chain constant region genes.

[0260] As used herein, "isotype switching" refers to the phenomenon in which the class or isotype of an antibody changes from one Ig class to one of the other Ig classes.

[0261] The term "naturally occurring" as used herein, when applied to an object, refers to the fact that the object can be found in nature. For example, a polypeptide or polynucleotide sequence present in an organism (including a virus) that can be isolated from a natural source and has not been intentionally modified by man in a laboratory is naturally occurring.

[0262] The term "rearranged," as used herein, refers to the configuration of a heavy or light chain immunoglobulin locus in which a V segment is positioned immediately adjacent to a DJ or J segment in a conformation that essentially encodes a complete VH or VL domain, respectively. Rearranged immunoglobulin (antibody) loci can be identified by comparison to germline DNA, and rearranged loci will have at least one recombined heptamer / nonamer homology element.

[0263] The term "unrearranged" or "germline configuration," as used herein with reference to a V segment, refers to a configuration in which the V segment has not been recombined so that it is immediately adjacent to a D segment or a J segment.

[0264] Preferably, the binding of the antibody against the tumor antigen to a cell expressing the tumor antigen induces or mediates the killing of the cell expressing the tumor antigen. The cell expressing the tumor antigen is preferably a cancer cell, in particular a cell of a cancer disease as described herein. Preferably, the antibody induces or mediates the killing of the cell by inducing one or more of complement-dependent cytotoxicity (CDC)-mediated lysis, antibody-dependent cellular cytotoxicity (ADCC)-mediated lysis, apoptosis, and inhibition of proliferation of the cell expressing the tumor antigen. Preferably, the ADCC-mediated lysis of the cell occurs in the presence of an effector cell, which in certain embodiments is selected from the group consisting of monocytes, mononuclear cells, NK cells, and PMNs. The inhibition of proliferation of the cell can be measured in vitro by determining the proliferation of the cell in an assay using bromodeoxyuridine (5-bromo-2'-deoxyuridine, BrdU). BrdU is an analog of thymidine, a synthetic nucleoside that can be incorporated into newly synthesized DNA of replicating cells (during the S phase of the cell cycle) to replace thymidine during DNA replication. Detecting the incorporated chemical using, for example, an antibody specific for BrdU indicates a cell that was actively replicating its own DNA.

[0265] In preferred embodiments, the antibodies described herein may be characterized by one or more of the following properties: a) specificity for tumor antigens; b) a binding affinity to a tumor antigen of about 100 nM or less, preferably about 5 to 10 nM or less, and more preferably about 1 to 3 nM or less; c) the ability to induce or mediate CDC on tumor antigen-positive cells; d) the ability to induce or mediate ADCC on tumor antigen-positive cells; e) the ability to inhibit the proliferation of tumor antigen-positive cells; f) The ability to induce apoptosis of tumor antigen-positive cells.

[0266] In one embodiment, the antibody against the tumor antigen has the ability to bind to an epitope present in the tumor antigen, preferably an epitope located within the extracellular domain of the tumor antigen. Preferably, the antibody against the tumor antigen is specific for the tumor antigen. Preferably, the antibody against the tumor antigen binds to a tumor antigen expressed on the cell surface. In a particular preferred embodiment, the antibody against the tumor antigen binds to a natural epitope of the tumor antigen present on the surface of a living cell.

[0267] According to the present invention, an antibody capable of binding to CLDN18.2 or an antibody against CLDN18.2 is an antibody capable of binding to an epitope present in CLDN18.2, preferably an epitope located in the extracellular domain of CLDN18.2, in particular the first extracellular domain, preferably within amino acids 29 to 78 of CLDN18.2. In certain embodiments, an antibody capable of binding to CLDN18.2 is an antibody capable of binding to (i) an epitope on CLDN18.2 that is not present on CLDN18.1, preferably SEQ ID NO: 3, 4, and 5; (ii) an epitope located on CLDN18.2-loop1, preferably SEQ ID NO: 8; (iii) an epitope located on CLDN18.2-loop2, preferably SEQ ID NO: 10; (iv) an epitope located on CLDN18.2-loop D3, preferably SEQ ID NO: 11; (v) an epitope encompassing CLDN18.2-loop1 and CLDN18.2-loop D3; or (vi) a non-glycosylated epitope located on CLDN18.2-loop D3, preferably SEQ ID NO: 9.

[0268] According to the present invention, the antibody capable of binding to CLDN18.2 is preferably an antibody capable of binding to CLDN18.2 but not to CLDN18.1. Preferably, the antibody capable of binding to CLDN18.2 is specific to CLDN18.2. Preferably, the antibody capable of binding to CLDN18.2 is an antibody capable of binding to CLDN18.2 expressed on the cell surface. In a particular preferred embodiment, the antibody capable of binding to CLDN18.2 binds to a natural epitope of CLDN18.2 present on the surface of a living cell. Preferably, the antibody capable of binding to CLDN18.2 binds to one or more peptides selected from the group consisting of SEQ ID NOs: 1, 3-11, 44, 46, and 48-50. Preferably, the antibody capable of binding to CLDN18.2 is specific to the above-mentioned proteins, peptides, or immunogenic fragments or derivatives thereof. An antibody capable of binding to CLDN18.2 can be obtained by a method comprising the step of immunizing an animal with a protein or peptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3 to 11, 44, 46, and 48 to 50, or a nucleic acid or host cell expressing said protein or peptide. Preferably, the antibody binds to cancer cells, in particular cells of the above-mentioned cancer types, and preferably does not bind to non-cancerous cells.

[0269] Preferably, the antibody capable of binding to CLDN18.2 binds to a cell expressing CLDN18.2, thereby inducing or mediating the killing of the cell expressing CLDN18.2. The cell expressing CLDN18.2 is preferably a cancer cell, in particular selected from the group consisting of tumorigenic gastric, esophageal, pancreatic, lung, ovarian, colon, liver, head and neck, and gallbladder cancer cells. Preferably, the antibody induces or mediates the killing of the cell by inducing one or more of complement-dependent cytotoxicity (CDC)-mediated lysis, antibody-dependent cellular cytotoxicity (ADCC)-mediated lysis, apoptosis, and inhibition of proliferation of the cell expressing CLDN18.2. Preferably, the ADCC-mediated lysis of the cell occurs in the presence of an effector cell, which in a particular embodiment is selected from the group consisting of monocytes, mononuclear cells, NK cells, and PMNs.

[0270] In a preferred embodiment, an antibody having the ability of binding to CLDN18.2 may be characterized by one or more of the following properties: a) specificity for CLDN18.2; b) a binding affinity to CLDN18.2 of about 100 nM or less, preferably about 5 to 10 nM or less, more preferably about 1 to 3 nM or less; c) the ability to induce or mediate CDC on CLDN18.2-positive cells; d) the ability to induce or mediate ADCC on CLDN18.2 positive cells; e) the ability to inhibit proliferation of CLDN18.2 positive cells; f) Ability to induce apoptosis of CLDN18.2 positive cells.

[0271] In a particularly preferred embodiment, the antibody having the ability of binding to CLDN18.2 is produced by the hybridoma deposited at the DSMZ (Mascheroder Weg 1b, 31824 Braunschweig, Germany; New Address: Inhoffenstr. 7B, 31824 Braunschweig, Germany) and having the following name and accession number: a.182-D1106-055, accession number DSM ACC2737, deposited on October 19, 2005 b.182-D1106-056, accession number DSM ACC2738, deposited on October 19, 2005 c.182-D1106-057, accession number DSM ACC2739, deposited on October 19, 2005 d.182-D1106-058, accession number DSM ACC2740, deposited on October 19, 2005 e.182-D1106-059, accession number DSM ACC2741, deposited on October 19, 2005 f.182-D1106-062, accession number DSM ACC2742, deposited on October 19, 2005; g.182-D1106-067, accession number DSM ACC2743, deposited on October 19, 2005 h.182-D758-035, accession number DSM ACC2745, deposited on November 17, 2005 i.182-D758-036, accession number DSM ACC2746, deposited on November 17, 2005 j.182-D758-040, accession number DSM ACC2747, deposited on November 17, 2005 k.182-D1106-061, accession number DSM ACC2748, deposited on November 17, 2005 l.182-D1106-279, accession number DSM ACC2808, deposited on October 26, 2006 m.182-D1106-294, accession number DSM ACC2809, deposited on October 26, 2006; n.182-D1106-362, accession number DSM ACC2810, deposited on October 26, 2006.

[0272] Preferred antibodies according to the invention are those derived from the above mentioned hybridomas, namely 37G11 for 182-D1106-055, 37H8 for 182-D1106-056, 38G5 for 182-D1106-057, 38H3 for 182-D1106-058, 39F11 for 182-D1106-059, 43A11 for 182-D1106-062, 61C2 for 182-D1106-067, 182-D758-035, 182-D758-036, 182-D758-037, 182-D758-038, 182-D758-039, 182-D758-040, 182-D758-041, 182-D758-042, 182-D758-043, 182-D758-044, 182-D758-045, 182-D758-046, 182-D758-047, 182-D758-048, 182-D758-049, 182-D758-050, 182-D758-061, 182-D758-062, 182-D758-049, 182-D758-051, 182-D758-063, 182-D758-064, 182-D758-065, 182-D758-070, 182-D in the case of 182-D1106-362; 26B5 in the case of 182-D758-036; 26D12 in the case of 182-D758-040; 42E12 in the case of 182-D1106-061; 125E1 in the case of 182-D1106-279; 163E12 in the case of 182-D1106-294; and 175D10 in the case of 182-D1106-362; and chimeric and humanized forms thereof.

[0273] In one embodiment the antibody having the ability of binding to CLDN18.2 is an antibody selected from the group consisting of antibodies produced by and / or obtained from the clone deposited under accession numbers DSM ACC2737, DSM ACC2738, DSM ACC2739, DSM ACC2740, DSM ACC2741, DSM ACC2742, DSM ACC2743, DSM ACC2745, DSM ACC2746, DSM ACC2747, DSM ACC2748, DSM ACC2808, DSM ACC2809 or DSM ACC2810, (ii) antibodies which are chimerized or humanized forms of antibodies belonging to (i), (iii) antibodies which have the specificity of antibodies belonging to (i), and (iv) antibodies which comprise an antigen-binding portion or antigen-binding site, in particular the variable region, of an antibody belonging to (i) and preferably having the specificity of an antibody belonging to (i).

[0274] Suitable chimeric antibodies and their sequences are shown in the table below.

[0275] [Table 1]

[0276] In a preferred embodiment, the antibody, in particular a chimerized form of the antibody according to the invention, comprises an antibody comprising a heavy chain constant region (CH) comprising an amino acid sequence derived from a human heavy chain constant region, such as the amino acid sequence represented by SEQ ID NO: 13 or a fragment thereof. In a further preferred embodiment, the antibody, in particular a chimerized form of the antibody according to the invention, comprises an antibody comprising a light chain constant region (CL) comprising an amino acid sequence derived from a human light chain constant region, such as the amino acid sequence represented by SEQ ID NO: 12 or a fragment thereof. In a particularly preferred embodiment, the antibody, in particular a chimerized form of the antibody according to the invention, comprises an antibody comprising a CH comprising an amino acid sequence derived from a human CH, such as the amino acid sequence represented by SEQ ID NO: 13 or a fragment thereof, and comprising a CL comprising an amino acid sequence derived from a human CL, such as the amino acid sequence represented by SEQ ID NO: 12 or a fragment thereof.

[0277] In one embodiment, the antibody capable of binding to CLDN18.2 is a chimeric mouse / human IgG1 monoclonal antibody comprising a kappa mouse variable light chain, a human kappa light chain constant region allotype Km(3), a mouse heavy chain variable region, and a human IgG1 constant region allotype G1m(3).

[0278] In certain preferred embodiments, chimeric forms of antibodies include antibodies comprising a heavy chain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 14, 15, 16, 17, 18, 19, 51, and fragments thereof, and / or a light chain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 20, 21, 22, 23, 24, 25, 26, 27, 28, and fragments thereof.

[0279] In certain preferred embodiments, chimerized forms of antibodies include antibodies that comprise a heavy and light chain combination selected from the following possibilities (i)-(ix): (i) a heavy chain comprising the amino acid sequence represented by SEQ ID NO: 14 or a fragment thereof, and a light chain comprising the amino acid sequence represented by SEQ ID NO: 21 or a fragment thereof; (ii) a heavy chain comprising the amino acid sequence represented by SEQ ID NO: 15 or a fragment thereof, and a light chain comprising the amino acid sequence represented by SEQ ID NO: 20 or a fragment thereof; (iii) a heavy chain comprising the amino acid sequence represented by SEQ ID NO: 16 or a fragment thereof, and a light chain comprising the amino acid sequence represented by SEQ ID NO: 22 or a fragment thereof; (iv) a heavy chain comprising the amino acid sequence represented by SEQ ID NO: 18 or a fragment thereof, and a light chain comprising the amino acid sequence represented by SEQ ID NO: 25 or a fragment thereof; (v) a heavy chain comprising the amino acid sequence represented by SEQ ID NO: 17 or a fragment thereof, and a light chain comprising the amino acid sequence represented by SEQ ID NO: 24 or a fragment thereof; (vi) a heavy chain comprising the amino acid sequence represented by SEQ ID NO: 19 or a fragment thereof, and a light chain comprising the amino acid sequence represented by SEQ ID NO: 23 or a fragment thereof; (vii) a heavy chain comprising the amino acid sequence represented by SEQ ID NO: 19 or a fragment thereof, and a light chain comprising the amino acid sequence represented by SEQ ID NO: 26 or a fragment thereof; (viii) a heavy chain comprising the amino acid sequence represented by SEQ ID NO: 19 or a fragment thereof, and a light chain comprising the amino acid sequence represented by SEQ ID NO: 27 or a fragment thereof; (ix) a heavy chain comprising the amino acid sequence represented by SEQ ID NO: 19 or a fragment thereof, and a light chain comprising the amino acid sequence represented by SEQ ID NO: 28 or a fragment thereof; and (x) a heavy chain comprising an amino acid sequence represented by SEQ ID NO: 51 or a fragment thereof, and a light chain comprising an amino acid sequence represented by SEQ ID NO: 24 or a fragment thereof.

[0280] Antibodies according to (v) or (x) are particularly preferred.

[0281] "Fragment" or "fragment of an amino acid sequence" as used above refers to a part of an antibody sequence, i.e. an antibody sequence truncated at the N-terminus and / or C-terminus, which when it replaces said antibody sequence in an antibody, retains the binding of said antibody to CLDN18.2 and preferably the function of said antibody as described herein, e.g. CDC-mediated lysis or ADCC-mediated lysis. Preferably, a fragment of an amino acid sequence comprises at least 80%, preferably at least 90%, 95%, 96%, 97%, 98% or 99% of the amino acid residues derived from said amino acid sequence. A fragment of an amino acid sequence selected from the group consisting of SEQ ID NOs: 14, 15, 16, 17, 18, 19, 51, 20, 21, 22, 23, 24, 25, 26, 27 and 28 preferably relates to said sequences with 17, 18, 19, 20, 21, 22 or 23 amino acids at the N-terminus removed.

[0282] In a preferred embodiment, the antibody having the ability of binding to CLDN18.2 comprises a heavy chain variable region (VH) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 29, 30, 31, 32, 33, 34, and fragments thereof.

[0283] In a preferred embodiment, the antibody having the ability of binding to CLDN18.2 comprises a light chain variable region (VL) comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 35, 36, 37, 38, 39, 40, 41, 42, 43, and fragments thereof.

[0284] In certain preferred embodiments, an antibody capable of binding to CLDN18.2 comprises a combination of a heavy chain variable region (VH) and a light chain variable region (VL) selected from the following possibilities (i) to (ix): (i) a VH comprising an amino acid sequence represented by SEQ ID NO: 29 or a fragment thereof, and a VL comprising an amino acid sequence represented by SEQ ID NO: 36 or a fragment thereof; (ii) a VH comprising an amino acid sequence represented by SEQ ID NO: 30 or a fragment thereof, and a VL comprising an amino acid sequence represented by SEQ ID NO: 35 or a fragment thereof; (iii) a VH comprising an amino acid sequence represented by SEQ ID NO: 31 or a fragment thereof, and a VL comprising an amino acid sequence represented by SEQ ID NO: 37 or a fragment thereof; (iv) a VH comprising an amino acid sequence represented by SEQ ID NO: 33 or a fragment thereof, and a VL comprising an amino acid sequence represented by SEQ ID NO: 40 or a fragment thereof; (v) a VH comprising an amino acid sequence represented by SEQ ID NO: 32 or a fragment thereof, and a VL comprising an amino acid sequence represented by SEQ ID NO: 39 or a fragment thereof; (vi) a VH comprising an amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof, and a VL comprising an amino acid sequence represented by SEQ ID NO: 38 or a fragment thereof; (vii) a VH comprising an amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof, and a VL comprising an amino acid sequence represented by SEQ ID NO: 41 or a fragment thereof; (viii) a VH comprising an amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof, and a VL comprising an amino acid sequence represented by SEQ ID NO: 42 or a fragment thereof; (ix) a VH comprising an amino acid sequence represented by SEQ ID NO: 34 or a fragment thereof, and a VL comprising an amino acid sequence represented by SEQ ID NO: 43 or a fragment thereof.

[0285] Antibodies according to (v) are particularly preferred.

[0286] According to the invention, the term "fragment" refers in particular to one or more of the complementarity determining regions (CDRs) of the heavy chain variable region (VH) and / or the light chain variable region (VL), preferably at least the CDR3 variable region. In one embodiment, said one or more of the complementarity determining regions (CDRs) are selected from the set of complementarity determining regions CDR1, CDR2 and CDR3. In a particularly preferred embodiment, the term "fragment" refers to the complementarity determining regions CDR1, CDR2 and CDR3 of the heavy chain variable region (VH) and / or the light chain variable region (VL).

[0287] In a preferred embodiment, the antibody capable of binding to CLDN18.2 comprises a VH comprising a set of complementarity determining regions CDR1, CDR2, and CDR3 selected from the following embodiments (i) to (vi): (i) CDR1: positions 45 to 52 of SEQ ID NO: 14, CDR2: positions 70 to 77 of SEQ ID NO: 14, CDR3: positions 116 to 125 of SEQ ID NO: 14, (ii) CDR1: positions 45 to 52 of SEQ ID NO: 15, CDR2: positions 70 to 77 of SEQ ID NO: 15, CDR3: positions 116 to 126 of SEQ ID NO: 15, (iii) CDR1: positions 45 to 52 of SEQ ID NO: 16, CDR2: positions 70 to 77 of SEQ ID NO: 16, CDR3: positions 116 to 124 of SEQ ID NO: 16, (iv) CDR1: positions 45 to 52 of SEQ ID NO: 17, CDR2: positions 70 to 77 of SEQ ID NO: 17, CDR3: positions 116 to 126 of SEQ ID NO: 17, (v) CDR1: positions 44 to 51 of SEQ ID NO: 18, CDR2: positions 69 to 76 of SEQ ID NO: 18, CDR3: positions 115 to 125 of SEQ ID NO: 18, and (vi) CDR1: positions 45 to 53 of SEQ ID NO:19, CDR2: positions 71 to 78 of SEQ ID NO:19, CDR3: positions 117 to 128 of SEQ ID NO:19.

[0288] In a preferred embodiment, the antibody having the ability of binding to CLDN18.2 comprises a VL comprising a set of complementarity determining regions CDR1, CDR2, and CDR3 selected from the following embodiments (i) to (ix): (i) CDR1: positions 47 to 58 of SEQ ID NO: 20, CDR2: positions 76 to 78 of SEQ ID NO: 20, CDR3: positions 115 to 123 of SEQ ID NO: 20, (ii) CDR1: positions 49 to 53 of SEQ ID NO: 21, CDR2: positions 71 to 73 of SEQ ID NO: 21, CDR3: positions 110 to 118 of SEQ ID NO: 21, (iii) CDR1: positions 47 to 52 of SEQ ID NO: 22, CDR2: positions 70 to 72 of SEQ ID NO: 22, CDR3: positions 109 to 117 of SEQ ID NO: 22, (iv) CDR1: positions 47 to 58 of SEQ ID NO: 23, CDR2: positions 76 to 78 of SEQ ID NO: 23, CDR3: positions 115 to 123 of SEQ ID NO: 23, (v) CDR1: positions 47 to 58 of SEQ ID NO: 24, CDR2: positions 76 to 78 of SEQ ID NO: 24, CDR3: positions 115 to 123 of SEQ ID NO: 24, (vi) CDR1: positions 47 to 58 of SEQ ID NO: 25, CDR2: positions 76 to 78 of SEQ ID NO: 25, CDR3: positions 115 to 122 of SEQ ID NO: 25, (vii) CDR1: positions 47 to 58 of SEQ ID NO: 26, CDR2: positions 76 to 78 of SEQ ID NO: 26, CDR3: positions 115 to 123 of SEQ ID NO: 26, (viii) CDR1: positions 47 to 58 of SEQ ID NO: 27, CDR2: positions 76 to 78 of SEQ ID NO: 27, CDR3: positions 115 to 123 of SEQ ID NO: 27, and (ix) CDR1: positions 47 to 52 of SEQ ID NO:28, CDR2: positions 70 to 72 of SEQ ID NO:28, CDR3: positions 109 to 117 of SEQ ID NO:28.

[0289] In a preferred embodiment, the antibody having the ability of binding to CLDN18.2 comprises a VH and VL combination, each of which comprises a set of complementarity determining regions CDR1, CDR2, and CDR3 selected from the following embodiments (i) to (ix): (i) VH: CDR1: positions 45 to 52 of SEQ ID NO: 14, CDR2: positions 70 to 77 of SEQ ID NO: 14, CDR3: positions 116 to 125 of SEQ ID NO: 14, VL: CDR1: positions 49 to 53 of SEQ ID NO: 21, CDR2: positions 71 to 73 of SEQ ID NO: 21, CDR3: positions 110 to 118 of SEQ ID NO: 21, (ii) VH: CDR1: positions 45 to 52 of SEQ ID NO: 15, CDR2: positions 70 to 77 of SEQ ID NO: 15, CDR3: positions 116 to 126 of SEQ ID NO: 15, VL: CDR1: positions 47 to 58 of SEQ ID NO: 20, CDR2: positions 76 to 78 of SEQ ID NO: 20, CDR3: positions 115 to 123 of SEQ ID NO: 20, (iii) VH: CDR1: positions 45 to 52 of SEQ ID NO: 16, CDR2: positions 70 to 77 of SEQ ID NO: 16, CDR3: positions 116 to 124 of SEQ ID NO: 16, VL: CDR1: positions 47 to 52 of SEQ ID NO: 22, CDR2: positions 70 to 72 of SEQ ID NO: 22, CDR3: positions 109 to 117 of SEQ ID NO: 22, (iv) VH: CDR1: positions 44 to 51 of SEQ ID NO: 18, CDR2: positions 69 to 76 of SEQ ID NO: 18, CDR3: positions 115 to 125 of SEQ ID NO: 18, VL: CDR1: positions 47 to 58 of SEQ ID NO: 25, CDR2: positions 76 to 78 of SEQ ID NO: 25, CDR3: positions 115 to 122 of SEQ ID NO: 25, (v) VH: CDR1: positions 45 to 52 of SEQ ID NO: 17, CDR2: positions 70 to 77 of SEQ ID NO: 17, CDR3: positions 116 to 126 of SEQ ID NO: 17, VL: CDR1: positions 47 to 58 of SEQ ID NO: 24, CDR2: positions 76 to 78 of SEQ ID NO: 24, CDR3: positions 115 to 123 of SEQ ID NO: 24, (vi) VH: CDR1: positions 45 to 53 of SEQ ID NO: 19, CDR2: positions 71 to 78 of SEQ ID NO: 19, CDR3: positions 117 to 128 of SEQ ID NO: 19, VL: CDR1: positions 47 to 58 of SEQ ID NO: 23, CDR2: positions 76 to 78 of SEQ ID NO: 23, CDR3: positions 115 to 123 of SEQ ID NO: 23, (vii) VH: CDR1: positions 45 to 53 of SEQ ID NO: 19, CDR2: positions 71 to 78 of SEQ ID NO: 19, CDR3: positions 117 to 128 of SEQ ID NO: 19, VL: CDR1: positions 47 to 58 of SEQ ID NO: 26, CDR2: positions 76 to 78 of SEQ ID NO: 26, CDR3: positions 115 to 123 of SEQ ID NO: 26, (viii) VH: CDR1: positions 45 to 53 of SEQ ID NO: 19, CDR2: positions 71 to 78 of SEQ ID NO: 19, CDR3: positions 117 to 128 of SEQ ID NO: 19, VL: CDR1: positions 47 to 58 of SEQ ID NO: 27, CDR2: positions 76 to 78 of SEQ ID NO: 27, CDR3: positions 115 to 123 of SEQ ID NO: 27, and (ix) VH: CDR1: positions 45 to 53 of SEQ ID NO: 19, CDR2: positions 71 to 78 of SEQ ID NO: 19, CDR3: positions 117 to 128 of SEQ ID NO: 19; VL: CDR1: positions 47 to 52 of SEQ ID NO: 28, CDR2: positions 70 to 72 of SEQ ID NO: 28, CDR3: positions 109 to 117 of SEQ ID NO: 28.

[0290] In a further preferred embodiment, the antibody capable of binding to CLDN18.2 preferably comprises one or more, preferably at least the CDR3 variable region, of the heavy chain variable region (VH) and / or the light chain variable region (VL) of a monoclonal antibody against CLDN18.2, preferably of a monoclonal antibody against CLDN18.2 as described herein, and preferably comprises one or more, preferably at least the CDR3 variable region, of the heavy chain variable region (VH) and / or the light chain variable region (VL) as described herein. In one embodiment, said one or more of the complementarity determining regions (CDRs) are selected from the set of complementarity determining regions CDR1, CDR2 and CDR3 as described herein. In a particularly preferred embodiment, the antibody capable of binding to CLDN18.2 preferably comprises the complementarity determining regions CDR1, CDR2, and CDR3 of the heavy chain variable region (VH) and / or light chain variable region (VL) of a monoclonal antibody against CLDN18.2, preferably a monoclonal antibody against CLDN18.2 described herein, and preferably comprises the complementarity determining regions CDR1, CDR2, and CDR3 of the heavy chain variable region (VH) and / or light chain variable region (VL) of a monoclonal antibody against CLDN18.2 described herein.

[0291] In one embodiment, an antibody comprising one or more CDRs, a set of CDRs, or a combination of sets of CDRs described herein comprises said CDRs together with their intervening framework regions. Preferably, this portion also comprises at least about 50% of either or both of the first and fourth framework regions, the 50% being the C-terminal 50% of the first framework region and the N-terminal 50% of the fourth framework region. When constructing antibodies made by recombinant DNA techniques, residues N-terminal or C-terminal to the variable region encoded by a linker can be introduced to facilitate cloning or other engineering steps, including the introduction of linkers to join the variable region of the invention to additional protein sequences, including immunoglobulin heavy chains, other variable domains (e.g., in the generation of diabodies), or protein tags.

[0292] In one embodiment, an antibody comprising one or more CDRs, a set of CDRs, or a combination of a set of CDRs described herein comprises said CDRs within a human antibody framework.

[0293] Reference herein to an antibody comprising a particular chain, or a particular region or sequence, in relation to its heavy chain, preferably relates to the situation in which all heavy chains of said antibody comprise said particular chain, region or sequence, and the same is correspondingly true for the light chains of the antibody.

[0294] It should be understood that the antibodies described herein can be delivered to a patient by administering a nucleic acid, such as an RNA, encoding the antibody, and / or by administering a host cell containing a nucleic acid, such as an RNA, encoding the antibody. Thus, the nucleic acid encoding the antibody can be present in a suitable delivery vehicle, such as in naked form, or in the form of a liposome or viral particle, or within a host cell when administered to a patient. The nucleic acid provided can produce antibodies over time in a sustained manner that at least partially mitigates the instability observed with therapeutic antibodies. The nucleic acid delivered to the patient can be produced by recombinant means. If the nucleic acid is administered to a patient without being present within a host cell, it is preferably taken up by the patient's cells to express the antibody encoded by the nucleic acid. If the nucleic acid is administered to a patient while present within a host cell, it is preferably expressed by the host cell in the patient to produce the antibody encoded by the nucleic acid.

[0295] The term "nucleic acid" as used herein is intended to include DNA and RNA, e.g., genomic DNA, cDNA, mRNA, recombinantly produced and chemically synthesized molecules. Nucleic acids can be single-stranded or double-stranded. RNA includes in vitro transcribed RNA (IVT RNA) or synthetic RNA.

[0296] The nucleic acid may be contained within a vector. The term "vector" as used herein includes any vector known to those skilled in the art, including plasmid vectors, cosmid vectors, phage vectors such as lambda phage, viral vectors such as adenovirus vectors or baculovirus vectors, or artificial chromosome vectors, such as bacterial artificial chromosomes (BAC), yeast artificial chromosomes (YAC), or P1 artificial chromosomes (PAC). The vectors include expression vectors and cloning vectors. Expression vectors include plasmids and viral vectors, and generally contain the desired coding sequence and appropriate DNA sequences required for the expression of the operably linked coding sequence in a particular host organism (e.g., bacteria, yeast, plants, insects, or mammals) or in an in vitro expression system. Cloning vectors are generally used to manipulate and amplify a particular desired DNA fragment, and may lack functional sequences required for the expression of the desired DNA fragment.

[0297] In the context of the present invention, the term "RNA" refers to a molecule that comprises, and preferably is entirely or substantially composed of, ribonucleotide residues. "Ribonucleotide" refers to a nucleotide that comprises a hydroxyl group at the 2' position of a β-D-ribofuranosyl group. The term includes double-stranded RNA, single-stranded RNA, isolated RNA, e.g., partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, and modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution, and / or modification of one or more nucleotides. Such modifications may include the addition of non-nucleotide material, such as to the end of the RNA or internally, e.g., at one or more nucleotides of the RNA. Nucleotides within an RNA molecule may also include non-standard nucleotides, e.g., non-naturally occurring nucleotides, or chemically synthesized nucleotides or deoxynucleotides. These modified RNAs may be referred to as analogs or analogs of naturally occurring RNA.

[0298] According to the present invention, the term "RNA" means "messenger RNA" and relates to a "transcript" that can be produced using DNA as a template, including and preferably to an "mRNA" that codes for a peptide or protein. An mRNA typically comprises a 5' untranslated region (5'-UTR), a protein or peptide coding region, and a 3' untranslated region (3'-UTR). An mRNA has a limited half-life in cells and in vitro. Preferably, the mRNA is produced by in vitro transcription using a DNA template. In one embodiment of the present invention, the RNA is obtained by in vitro transcription or chemical synthesis. In vitro transcription methods are known to those skilled in the art. For example, various in vitro transcription kits are commercially available.

[0299] In order to increase the expression and / or stability of the RNA used according to the invention, the RNA can be modified, preferably without altering the sequence of the expressed peptide or protein.

[0300] The term "modification" in the context of the RNA used according to the present invention includes any modification of RNA that does not naturally occur in said RNA. Such modified RNA is encompassed herein by the term "RNA."

[0301] For example, the RNA according to the present invention may have naturally occurring or synthetic ribonucleotides modified to increase its stability and / or decrease its cytotoxicity.For example, in one embodiment, 5-methylcytidine is partially or completely, preferably completely, substituted for cytidine in the RNA used according to the present invention.Alternatively or additionally, in one embodiment, pseudouridine is partially or completely, preferably completely, substituted for uridine in the RNA used according to the present invention.

[0302] In one embodiment, the term "modification" relates to providing an RNA with a 5'-cap or a 5'-cap analog. The term "5'-cap" refers to the cap structure found at the 5' end of an mRNA molecule, generally consisting of a guanosine nucleotide attached to the mRNA via an uncommon 5'-5' triphosphate linkage. In one embodiment, this guanosine is methylated at the 7 position. The term "conventional 5'-cap" refers to a naturally occurring RNA 5'-cap, preferably the 7-methylguanosine cap (m7G). In the context of the present invention, the term "5'-cap" includes 5'-cap analogs, which are modified to resemble the RNA cap structure and have the ability to stabilize the RNA when attached to the RNA, preferably in vivo and / or in a cell.

[0303] Preferably, the RNA expresses the protein or peptide that it encodes when delivered to a cell, particularly a cell present in vivo, ie, when transfected into the cell.

[0304] The term "transfection" refers to the introduction of a nucleic acid, particularly RNA, into a cell. For the purposes of the present invention, the term "transfection" also includes the introduction of a nucleic acid into a cell or the uptake of a nucleic acid by such a cell, which may be present in a subject, e.g., a patient. Thus, according to the present invention, the cells for transfecting the nucleic acids described herein may be present in vitro or in vivo, e.g., the cells may form part of an organ, tissue, and / or organism of a patient. According to the present invention, the transfection may be transient or stable. For some applications of transfection, it is sufficient if the transfected genetic material is only expressed transiently. Since the nucleic acid introduced in the transfection process is not usually integrated into the nuclear genome, the heterologous nucleic acid will be diluted or degraded by mitosis. Cells that allow episomal amplification of the nucleic acid greatly reduce the dilution rate. If it is desired that the transfected nucleic acid actually remains in the genome of the cell and its daughter cells, stable transfection must be performed. The RNA can be transfected into cells to transiently express its encoded protein.

[0305] The term "stability" of an RNA relates to the "half-life" of the RNA. "Half-life" relates to the time required to eliminate half of the activity, amount, or number of a molecule. In the context of the present invention, the half-life of an RNA indicates the stability of said RNA. The half-life of an RNA may affect the "duration of expression" of the RNA. An RNA with a long half-life may be expected to be expressed for a long period of time.

[0306] In the context of the present invention, the term "transcription" refers to the process in which the genetic code in a DNA sequence is transcribed into RNA. The RNA can subsequently be translated into protein. According to the present invention, the term "transcription" includes "in vitro transcription", which refers to the process in which RNA, in particular mRNA, is synthesized in vitro in a cell-free system, preferably using a suitable cell extract. Preferably, a cloning vector is applied to generate the transcript. These cloning vectors are generally called transcription vectors, and according to the present invention are encompassed by the term "vector".

[0307] The term "translation", according to the present invention, relates to the process within a cell's ribosomes in which a chain of messenger RNA directs the assembly of a sequence of amino acids to make a peptide or protein.

[0308] The term "expression" is used according to the present invention in its most general sense and includes, for example, the production of RNA and / or peptides or proteins by transcription and / or translation. With respect to RNA, the terms "expression" or "translation" particularly relate to the production of peptides or proteins. This also includes partial expression of a nucleic acid. Furthermore, expression may be transient or stable. According to the present invention, the term expression also includes "ectopic expression" or "abnormal expression".

[0309] "Ectopic expression" or "abnormal expression" means according to the present invention that expression is altered, preferably increased, compared to a reference, e.g., the state in a subject that does not have a disease associated with ectopic or aberrant expression of a certain protein, e.g., a tumor antigen. Increased expression refers to an increase of at least 10%, in particular at least 20%, at least 50%, or at least 100%, or more. In one embodiment, expression is found only in diseased tissue, while expression in healthy tissue is suppressed.

[0310] The term "specifically expressed" means that a protein is expressed essentially only in a particular tissue or organ. For example, a tumor antigen specifically expressed in the gastric mucosa means that the protein is primarily expressed in the gastric mucosa and not expressed in other tissues or not expressed to a significant extent in other tissues or organ types. Thus, a protein that is exclusively expressed in the cells of the gastric mucosa and is expressed to a significantly lesser extent in any other tissue, such as the testis, is specifically expressed in the cells of the gastric mucosa. In some embodiments, a tumor antigen may also be specifically expressed under normal conditions in more than one tissue type or organ, such as in two or three tissue types or organs, but preferably in no more than three different tissue or organ types. In this case, the tumor antigen is then specifically expressed in these organs. For example, if a tumor antigen is expressed under normal conditions, preferably to an approximately equal extent, in the lung and the stomach, the tumor antigen is specifically expressed in the lung and the stomach.

[0311] According to the present invention, the term "encoding RNA" means that the RNA, when present in the appropriate environment, preferably in a cell, can be expressed to produce the protein or peptide that it encodes.

[0312] Some aspects of the invention utilize adoptive transfer of host cells that are transfected in vitro with a nucleic acid, such as an RNA, encoding an antibody described herein, and preferably expanded ex vivo from a low precursor frequency to a clinically relevant cell number, and then transferred to a recipient, such as a patient. Host cells used for treatment according to the invention can be autologous, allogeneic, or syngeneic to the recipient being treated.

[0313] The term "autologous" is used to describe something that is derived from the same subject. For example, "autologous transplant" refers to the transplantation of tissue or organs that are derived from the same subject. Such procedures are advantageous because they overcome immunological barriers that would otherwise result in rejection.

[0314] The term "allogeneic" is used to describe something that is derived from different individuals of the same species. Two or more individuals are said to be allogeneic to one another if their genes at one or more loci are not identical.

[0315] The term "syngeneic" is used to describe individuals or tissues that have the same genotype, ie, derived from identical twins or the same inbred strain of animals, or tissues thereof.

[0316] The term "xenogeneic" is used to describe something that is made up of multiple different elements. As an example, the transfer of bone marrow from one individual to a different individual constitutes a xenogeneic transplant. A xenogeneic gene is a gene that originates from a source other than the subject.

[0317] The term "peptide", according to the present invention, includes oligo- and polypeptides, and refers to a substance comprising 2 or more, preferably 3 or more, preferably 4 or more, preferably 6 or more, preferably 8 or more, preferably 9 or more, preferably 10 or more, preferably 13 or more, preferably 16 or more, preferably 21 or more, preferably up to 8, 10, 20, 30, 40 or 50, in particular 100, amino acids covalently joined by peptide bonds. The term "protein" refers to large peptides, preferably peptides having more than 100 amino acid residues, although in general the terms "peptide" and "protein" are synonymous and are used interchangeably herein.

[0318] The teachings given herein with respect to specific amino acid sequences, e.g. those set out in the sequence listing, should also be construed as relating to sequences which are functionally equivalent to the specific sequences, e.g. variants of the specific sequences which result in amino acid sequences exhibiting the same or similar properties as the specific amino acid sequences.

[0319] One important property is to retain the ability of the antibody to bind to its target or to maintain the effector function of the antibody. Preferably, a sequence that is variant with respect to a specific sequence, when it replaces the specific sequence in the antibody, retains the ability of said antibody to bind to its target and preferably the function of said antibody as described herein, such as CDC-mediated lysis or ADCC-mediated lysis.

[0320] It will be appreciated by those skilled in the art that the sequences of the CDRs, hypervariable regions and variable regions in particular can be modified without losing the ability of the antibody to bind its target. For example, the CDR regions will be identical or highly homologous to regions of the antibodies specified herein. By "highly homologous" it is contemplated that 1-5, preferably 1-4, such as 1-3 or 1 or 2 substitutions can be made in the CDRs. Furthermore, the hypervariable and variable regions can be modified such that they exhibit substantial homology to regions of the antibodies specifically disclosed herein.

[0321] The term "variant" according to the present invention refers in particular to mutants, splice variants, conformations, isoforms, allelic variants, species variants, and species homologs, especially those that occur naturally. Allelic variants refer to changes in the normal sequence of a gene, the significance of which is often unclear. Complete gene sequencing often identifies multiple allelic variants for a given gene. Species homologs are nucleic acid or amino acid sequences for a species of origin that differ from that of a given nucleic acid or amino acid sequence. The term "variant" is intended to encompass any post-translationally modified variants and conformational variants.

[0322] For the purposes of the present invention, "variants" of an amino acid sequence include amino acid insertion variants, amino acid addition variants, amino acid deletion variants, and / or amino acid substitution variants. Amino acid deletion variants, including deletions at the N-terminus and / or C-terminus of a protein, are also referred to as N-terminal and / or C-terminal truncation variants.

[0323] Amino acid insertion variants include the insertion of a single or two or more amino acids into a particular amino acid sequence. In the case of amino acid sequence variants with insertions, one or more amino acid residues are inserted into a particular site in the amino acid sequence, but can also be inserted randomly with appropriate screening of the resulting products.

[0324] Amino acid addition variants include amino and / or carboxy terminal fusions of one or more amino acids, such as 1, 2, 3, 5, 10, 20, 30, 50, or more amino acids.

[0325] Amino acid deletion variants are characterized by the removal of one or more amino acids from the sequence, such as the removal of 1, 2, 3, 5, 10, 20, 30, 50 or more amino acids. The deletions can be in any position in the protein.

[0326] Amino acid substitution variants are characterized by the removal of at least one residue in the sequence and the insertion of another in its place. Modifications in positions in the amino acid sequence that are not conserved between homologous proteins or peptides and / or replacement of amino acids with other amino acids with similar properties are preferred. Preferably, the amino acid changes in the protein variants are conservative amino acid changes, i.e., substitutions of similarly charged or uncharged amino acids. Conservative amino acid changes involve the substitution of one of a family of amino acids that are related to their side chains. Naturally occurring amino acids are generally classified into four families of amino acids: acidic (aspartic acid, glutamic acid), basic (lysine, arginine, histidine), non-polar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine) amino acids. Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids.

[0327] The degree of similarity, preferably identity, between a given amino acid sequence and an amino acid sequence that is a variant of said given amino acid sequence will be at least about 60%, 65%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The degree of similarity or identity is preferably given for an amino acid region that is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the entire length of the reference amino acid sequence. For example, if the reference amino acid sequence consists of 200 amino acids, the degree of similarity or identity is preferably given for at least about 20, at least about 40, at least about 60, at least about 80, at least about 100, at least about 120, at least about 140, at least about 160, at least about 180, or about 200 amino acids, preferably consecutive amino acids. In a preferred embodiment, the degree of similarity or identity is given for the entire length of the reference amino acid sequence. Alignment for determining sequence similarity, preferably sequence identity, can be performed using tools known in the art, preferably using best sequence alignment, for example using Align with standard settings, preferably EMBOSS::needle, Matrix: Blosum62, Gap Open 10.0, Gap Extend 0.5.

[0328] "Sequence similarity" indicates the percentage of amino acids that are identical or represent conservative amino acid substitutions. "Sequence identity" between two amino acid sequences indicates the percentage of amino acids that are identical between the sequences.

[0329] The term "percentage identity" is intended to express the percentage of identical amino acid residues between the two sequences compared, obtained after the best alignment, and this percentage is purely statistical, the differences between the two sequences being distributed randomly and over their entire length. Sequence comparison between two amino acid sequences is conventionally performed by comparing these sequences after optimal alignment, said comparison being performed by segments or "windows of comparison" to identify and compare local regions of sequence similarity. Optimal alignment of sequences for comparison can be generated manually or by the local homology algorithm of Smith and Waterman, 1981, Ads App. Math., 2, 482, by the local homology algorithm of Neddleman and Wunsch, 1970, J. Mol. Biol., 48, 443, by the similarity search method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA, 85, 2444, or by computer programs that use these algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, Inc., 575 Science Drive, Madison, Wis.).

[0330] The percentage identity is calculated by determining the number of identical positions between the two sequences being compared, dividing this number by the number of positions compared, and multiplying the result by 100, resulting in the percentage identity between the two sequences.

[0331] The term "cell" or "host cell" preferably relates to an intact cell, i.e. a cell with an intact membrane that has not released its normal intracellular components, such as enzymes, organelles, or genetic material. An intact cell is preferably a viable cell, i.e. a living cell capable of carrying out its normal metabolic functions. Preferably, the term relates according to the invention to any cell that can be transfected with an exogenous nucleic acid. Preferably, the cell, when transfected with an exogenous nucleic acid and transferred to a recipient, is capable of expressing the nucleic acid in the recipient. The term "cell" includes bacterial cells, other useful cells are yeast cells, fungal cells, or mammalian cells. Suitable bacterial cells include cells derived from gram-negative strains such as strains of Escherichia coli, Proteus, and Pseudomonas, and gram-positive strains such as strains of Bacillus, Streptomyces, Staphylococcus, and Lactococcus. Suitable fungal cells include cells derived from species of Trichoderma, Neurospora, and Aspergillus. Suitable yeast cells include cells from species of Saccharomyces (e.g., Saccharomyces cerevisiae), Schizosaccharomyces (e.g., Schizosaccharomyces pombe), Pichia (e.g., Pichia pastoris and Pichia methanolicd), and Hansenula. Suitable mammalian cells include, for example, CHO cells, BHK cells, HeLa cells, COS cells, 293 HEK, and the like. However, amphibian cells, insect cells, plant cells, and any other cells used in the art for the expression of heterologous proteins can be used as well.Mammalian cells, such as cells from humans, mice, hamsters, pigs, goats, and primates, are particularly suitable for adoptive transfer. Cells can be derived from a number of tissue types, including primary cells and cell lines such as cells of the immune system, in particular antigen-presenting cells, such as dendritic cells and T cells, stem cells, such as hematopoietic stem cells and mesenchymal stem cells, as well as other cell types. Antigen-presenting cells are cells that display antigens on their surface in the context of major histocompatibility complexes. T cells can recognize this complex using their T cell receptors (TCRs).

[0332] The term "transgenic animal" refers to an animal having a genome that includes one or more transgenes, preferably heavy and / or light chain transgenes, or transchromosomes (integrated or not integrated into the animal's native genomic DNA), and preferably capable of expressing the transgenes. For example, a transgenic mouse can have a human light chain transgene and a human heavy chain transgene or human heavy chain transchromosome, such that the mouse produces human anti-tumor antigen antibodies when immunized with tumor antigens and / or cells expressing tumor antigens. The human heavy chain transgene can be integrated into the chromosomal DNA of the mouse, as in the case of transgenic mice, e.g., HuMAb mice, e.g., HCo7 mice or HCol2 mice, or the human heavy chain transgene can be maintained extrachromosomally, as in the case of transchromosomal (e.g., KM) mice described in WO02 / 43478. Such transgenic and transchromosomal mice can produce multiple isotypes of human monoclonal antibodies (e.g., IgG, IgA, and / or IgE) against tumor antigens by undergoing VDJ recombination and isotype switching.

[0333] "Reduce", "reduce" or "inhibit" as used herein means an overall decrease or ability to cause an overall decrease in levels, e.g., levels of expression or levels of cell proliferation, preferably by 5% or more, 10% or more, 20% or more, more preferably 50% or more, and most preferably 75% or more.

[0334] Terms such as "increase" or "enhance" preferably relate to an increase or enhancement of about at least 10%, preferably at least 20%, preferably at least 30%, more preferably at least 40%, more preferably at least 50%, even more preferably at least 80%, and most preferably at least 100%, at least 200%, at least 500%, at least 1000%, at least 10000%, or even more.

[0335] The antibodies described herein can be produced by a variety of techniques, including conventional monoclonal antibody methods, e.g., the standard somatic cell hybridization technique of Kohler and Milstein, Nature, 256: 495 (1975). Although somatic cell hybridization procedures are preferred, in principle other techniques for producing monoclonal antibodies can also be used, e.g., viral transformation or oncogenesis of B-lymphocytes, or phage display techniques using libraries of antibody genes.

[0336] The preferred animal system for preparing hybridomas secreting monoclonal antibodies is the murine system. Hybridoma production in mice is a very well-established procedure. Immunization protocols and techniques for isolating immunized splenocytes for fusion are known in the art. Fusion partners (e.g., murine myeloma cells) and fusion procedures are also known.

[0337] Other suitable animal systems for preparing hybridomas secreting monoclonal antibodies are the rat and rabbit systems (described, for example, in Spieker-Polet et al., Proc. Natl. Acad. Sci. USA, 92:9348 (1995); see also Rossi et al., Am. J. Clin. Pathol., 124: 295 (2005)).

[0338] In yet another preferred embodiment, human monoclonal antibodies can be produced using transgenic or transchromosomal mice carrying parts of the human immune system rather than the mouse system. These transgenic and transchromosomal mice include mice known as HuMAb mice and KM mice, respectively, and are collectively referred to herein as "transgenic mice." The production of human antibodies in such transgenic mice can be performed as described in detail for CD20 in WO2004 035607.

[0339] Yet another strategy for generating monoclonal antibodies is to directly isolate the antibody-encoding genes from lymphocytes producing antibodies of defined specificities, see e.g. Babcock et al., 1996; A novel strategy for generating monoclonal antibodies from single, isolated lymphocytes producing antibodies of defined specificities. For details of recombinant antibody engineering, see also Welschof and Kraus, Recombinant antibodies for cancer therapy, ISBN-0-89603-918-8, and Benny KC Lo, Antibody Engineering, ISBN 1-58829-092-1.

[0340] To generate antibodies, mice can be immunized with carrier-conjugated peptides derived from the antigen sequence, i.e., the sequence against which the antibody is directed, concentrated preparations of recombinantly expressed antigen or fragments thereof, and / or cells expressing the antigen, as described above. Alternatively, mice can be immunized with DNA encoding the antigen or fragments thereof. If immunization with a purified or concentrated preparation of the antigen does not result in antibodies, mice can also be immunized with cells expressing the antigen, e.g., cell lines, to promote an immune response.

[0341] The immune response can be monitored over the course of the immunization protocol with plasma and serum samples being obtained by tail vein or retroorbital bleeds. Mice with sufficient titers of immunoglobulin can be used for fusions. To increase the proportion of specific antibody-secreting hybridomas, mice can be boosted intraperitoneally or intravenously with antigen-expressing cells 3 days before sacrifice and removal of the spleen.

[0342] To generate hybridomas that produce monoclonal antibodies, splenocytes and lymph node cells from immunized mice can be isolated and fused to a suitable immortalized cell line, such as a mouse myeloma cell line. The resulting hybridomas can then be screened for production of antigen-specific antibodies. Individual wells can then be screened by ELISA for antibody-secreting hybridomas. Antibodies with specificity for the antigen can be identified by immunofluorescence and FACS analysis using antigen-expressing cells. Antibody-secreting hybridomas can be replated and screened again, and if still positive for monoclonal antibodies, can be subcloned by limiting dilution. Stable subclones can then be cultured in vitro to generate antibodies in tissue culture medium and characterized.

[0343] Antibodies can also be produced in host cell transfectomas using a combination of recombinant DNA technology and gene transfection techniques, as is well known in the art (Morrison, S. (1985) Science, 229: 1202).

[0344] For example, in one embodiment, the gene(s) of interest, e.g., antibody genes, can be ligated into an expression vector, such as a eukaryotic expression plasmid, such as those used by the GS gene expression system disclosed in WO87 / 04462, WO89 / 01036, and EP338841, or other expression systems known in the art. The purified plasmid containing the cloned antibody genes can be introduced into eukaryotic host cells, such as CHO cells, NS / 0 cells, HEK293T cells, or HEK293 cells, or alternatively other eukaryotic-like plant-derived cells, fungal cells, or yeast cells. The method used to introduce these genes can be a method described in the art, e.g., electroporation, lipofectine, lipofectamine, etc. After introducing these antibody genes into the host cells, cells expressing the antibody can be identified and selected. These cells represent transfectomas, which can then be amplified for their expression levels and upscaled to produce antibodies. Recombinant antibodies can be isolated and purified from these culture supernatants and / or cells.

[0345] Alternatively, cloned antibody genes can be expressed in other expression systems, including prokaryotic cells such as microorganisms, e.g., E. coli. Furthermore, antibodies can be produced in transgenic non-human animals, e.g., in milk from sheep and rabbits, in eggs from hens, or in transgenic plants. See, e.g., Verma, R. et al., (1998) J. Immunol. Meth., 216: 165-181; Pollock et al., (1999) J. Immunol. Meth., 231: 147-157; and Fischer, R. et al., (1999) Biol. Chem., 380: 825-839.

[0346] Chimerization Mouse antibodies are highly immunogenic in humans when applied repeatedly, reducing therapeutic efficacy. The main immunogenicity is mediated by the heavy chain constant region. The immunogenicity of mouse antibodies in humans can be reduced or completely avoided if the respective antibodies are chimerized or humanized. Chimeric antibodies are antibodies in which different portions originate from different animal species, such as those with a variable region derived from a mouse antibody and a human immunoglobulin constant region. Antibody chimerization is achieved by joining the variable regions of mouse antibody heavy and light chains with human heavy and light chain constant regions (e.g., as described by Kraus et al., Methods in Molecular Biology series, Recombinant antibodies for cancer therapy, ISBN-0-89603-918-8). In a preferred embodiment, chimeric antibodies are produced by joining a human kappa-light chain constant region to a mouse light chain variable region. Also in a preferred embodiment, chimeric antibodies can be produced by joining a human lambda-light chain constant region to a mouse light chain variable region. Preferred heavy chain constant regions for generating chimeric antibodies are IgG1, IgG3, and IgG4. Other preferred heavy chain constant regions for generating chimeric antibodies are IgG2, IgA, IgD, and IgM.

[0347] Humanization Antibodies interact with target antigens primarily through amino acid residues located within the six heavy and light chain complementarity determining regions (CDRs). For this reason, the amino acid sequences within the CDRs are more diverse between individual antibodies than sequences outside the CDRs. Because the CDR sequences are involved in most antibody-antigen interactions, it is possible to express recombinant antibodies that mimic the properties of a particular naturally occurring antibody by constructing expression vectors that contain CDR sequences from a particular naturally occurring antibody grafted onto framework sequences from a different antibody with different properties (see, for example, Riechmann, L. et al., (1998) Nature, 332: 323-327; Jones, P. et al., (1986) Nature, 321: 522-525; and Queen, C. et al., (1989) Proc. Natl. Acad. Sci. USA, 86: 10029-10033). Such framework sequences can be obtained from public DNA databases that contain germline antibody gene sequences. These germline sequences will differ from mature antibody gene sequences because they do not contain the fully assembled variable genes formed by V(D)J joining during B cell maturation. Germline gene sequences will also differ from the sequences of high affinity secondary repertoire antibodies at individual locations evenly across the variable regions.

[0348] The ability of the antibody to bind the antigen can be determined using standard binding assays (eg, ELISA, Western blot, immunofluorescence, and flow cytometric analysis).

[0349] To purify the antibodies, selected hybridomas can be grown in 2-liter spinner flasks for monoclonal antibody purification. Alternatively, the antibodies can be produced in dialysis-based bioreactors. The supernatant can be filtered and concentrated if necessary before affinity chromatography with protein G-sepharose or protein A-sepharose. The eluted IgG can be checked by gel electrophoresis and high performance liquid chromatography to ensure purity. The buffer can be exchanged into PBS and the concentration can be determined by OD280 using an extinction coefficient of 1.43. The monoclonal antibodies can be aliquoted and stored at -80°C.

[0350] To determine whether a selected monoclonal antibody binds to a unique epitope, site-directed or multi-site directed mutagenesis can be used.

[0351] To determine the antibody isotype, an isotype ELISA can be performed using various commercially available kits (e.g., Zymed, Roche Diagnostics). The wells of a microtiter plate can be coated with anti-mouse Ig. After blocking, the plate is reacted with monoclonal antibodies or purified isotype controls for 2 hours at ambient temperature. The wells can then be reacted with mouse IgG1, IgG2a, IgG2b, or IgG3, IgA, or mouse IgM specific peroxidase-conjugated probes. After washing, the plate can be developed with ABTS substrate (1 mg / ml) and analyzed at an OD of 405-650. Alternatively, the IsoStrip Mouse Monoclonal Antibody Isotyping Kit (Roche, Cat. No. 1493027) can be used as described by the manufacturer.

[0352] Flow cytometry can be used to demonstrate the presence of antibodies in the serum of immunized mice, or the binding of monoclonal antibodies to live cells expressing the antigen. Cell lines expressing the antigen naturally or after transfection, and negative controls lacking antigen expression (grown under standard growth conditions), can be mixed with various concentrations of monoclonal antibodies in hybridoma supernatants or in PBS containing 1% FBS and incubated for 30 minutes at 4°C. After washing, APC or Alexa 647-labeled anti-IgG antibodies can be bound to the antigen-bound monoclonal antibodies under the same conditions as the primary antibody staining. Samples can be analyzed by flow cytometry with a FACS instrument, using optical and side scatter properties to gate single live cells. To distinguish antigen-specific monoclonal antibodies from non-specific binders in a single measurement, a method of co-transfection can be used. Cells transiently transfected with plasmids encoding the antigen, and a fluorescent marker can be stained as described above. Transfected cells can be detected in a different fluorescent channel than antibody-stained cells. Since the majority of transfected cells express both transgenes, the antigen-specific monoclonal antibody will preferentially bind to the fluorescent marker expressing cells, while the non-specific antibody will bind to non-transfected cells in equal proportions. In addition to or instead of the flow cytometry assay, an alternative assay using fluorescent microscopy may be used. Cells can be stained exactly as described above and examined by fluorescent microscopy.

[0353] Immunofluorescence microscopy analysis can be used to demonstrate the presence of antibodies in the serum of immunized mice or the binding of monoclonal antibodies to live cells expressing the antigen. For example, cell lines expressing the antigen spontaneously or after transfection, and negative controls lacking antigen expression, are grown in chamber slides under standard growth conditions in DMEM / F12 medium supplemented with 10% fetal calf serum (FCS), 2 mM L-glutamine, 100 IU / ml penicillin, and 100 μg / ml streptomycin. The cells can then be fixed with methanol or paraformaldehyde or left untreated. The cells can then be reacted with monoclonal antibodies against the antigen for 30 minutes at 25° C. After washing, the cells can be reacted with Alexa 555-labeled anti-mouse IgG secondary antibody (Molecular Probes) under the same conditions. The cells can then be examined by fluorescence microscopy.

[0354] Cell extracts can be prepared from cells expressing the antigen and appropriate negative controls and subjected to sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis. After electrophoresis, the separated antigens are transferred to nitrocellulose membranes, blocked, and probed with the monoclonal antibodies to be tested. IgG binding can be detected using anti-mouse IgG peroxidase and developed with ECL substrate.

[0355] The antibodies can be further tested for reactivity with the antigen by immunohistochemistry in a manner well known to those skilled in the art, for example, using paraformaldehyde or acetone fixed frozen sections or paraformaldehyde fixed paraffin embedded tissue sections from non-cancerous or cancerous tissue samples obtained from patients during routine surgery or from mice bearing xenograft tumors inoculated spontaneously or after transfection with a cell line expressing the antigen. For immunostaining, antibodies reactive against the antigen can be incubated according to the supplier's instructions, followed by horseradish peroxidase conjugated goat anti-mouse or goat anti-rabbit antibodies (DAKO).

[0356] Antibodies can be tested for their ability to mediate phagocytosis and killing of cells expressing tumor antigens. Testing monoclonal antibody activity in vitro provides an initial screen before testing in in vivo models.

[0357] Antibody-dependent cell-mediated cytotoxicity (ADCC): Briefly, polymorphonuclear cells (PMN), NK cells, monocytes, mononuclear cells, or other effector cells from healthy donors can be purified by Ficoll-Hypaque density centrifugation followed by lysis of contaminating red blood cells. Washed effector cells are suspended in RPMI supplemented with 10% heat-inactivated fetal bovine serum, or alternatively 5% heat-inactivated human serum, and various ratios of effector cells to target cells expressing tumor antigens are cultured. 51 The target cells may be mixed with Cr-labeled target cells. Alternatively, the target cells may be labeled with a fluorescence enhancing ligand (BATDA). Highly fluorescent chelates of europium containing enhancing ligands released from dead cells can be measured by fluorometer. Another alternative technique may utilize transfection of target cells with luciferase. Lucifer Yellow is then added and allowed to be oxidized only by viable cells. Purified anti-tumor antigen IgG can then be added at various concentrations. Irrelevant human IgG can be used as a negative control. The assay can be performed at 37°C for 4-20 hours depending on the effector cell type used. In the culture supernatant, 51 Samples can be assayed for cell lysis by measuring Cr release or the presence of the EuTDA chelate. Alternatively, fluorescence resulting from the oxidation of Lucifer Yellow can be a measure of viable cells.

[0358] Anti-tumor antigen monoclonal antibodies can also be tested in various combinations to determine whether cytolysis is enhanced with multiple monoclonal antibodies.

[0359] Complement-dependent cytotoxicity (CDC): Monoclonal anti-tumor antigen antibodies can be tested for their ability to mediate CDC using various known techniques. For example, serum for complement can be obtained from blood in a manner known to those skilled in the art. Various methods can be used to determine the CDC activity of mAbs. 51 Cr release can be measured, for example, and increased membrane permeability can be assessed using a propidium iodide (PI) exclusion assay. Briefly, target cells were washed and 5×10 5 1000 cells / ml can be incubated with various concentrations of mAb for 10-30 min at room temperature or 37°C. Serum or plasma can then be added to a final concentration of 20% (v / v) and the cells can be incubated for 20-30 min at 37°C. All cells from each sample can be added to the PI solution in a FACS tube. The mixture can then be immediately analyzed by flow cytometric analysis using a FACSArray.

[0360] In an alternative assay, induction of CDC can be determined in adherent cells. In one embodiment of this assay, 3×10 4 Cells are seeded 24 hours prior to the assay at a density of 10000 cells / well. The next day, growth medium is removed and cells are incubated with the antibodies in triplicate. Control cells are incubated with growth medium or growth medium containing 0.2% saponin to determine background and maximum lysis, respectively. After 20 minutes of incubation at room temperature, the supernatant is removed and 20% (v / v) human plasma or serum in DMEM (pre-warmed to 37° C.) is added to the cells and incubated for another 20 minutes at 37° C. All cells from each sample are added to a propidium iodide solution (10 μg / ml). The supernatant is then replaced with PBS containing 2.5 μg / ml ethidium bromide and the fluorescence emission upon excitation at 520 nm is measured at 600 nm using a Tecan Safire. The percentage specific lysis is calculated as follows: % specific lysis=(sample fluorescence−background fluorescence) / (maximum lysis fluorescence−background fluorescence)×100.

[0361] Induction of apoptosis and inhibition of cell proliferation by monoclonal antibodies. To test the ability to initiate apoptosis, monoclonal anti-tumor antigen antibodies can be incubated with, for example, tumor antigen-positive tumor cells or tumor antigen-transfected tumor cells for about 20 hours at 37°C. Cells can be harvested, washed in Annexin-V binding buffer (BD biosciences), and incubated with Annexin V conjugated with FITC or APC (BD biosciences) for 15 minutes in the dark. All cells from each sample can be added to PI solution (10 μg / ml in PBS) in a FACS tube and immediately evaluated by flow cytometry (as described above). Alternatively, general inhibition of cell proliferation by monoclonal antibodies can be detected with a commercially available kit. The DELFIA Cell Proliferation Kit (Perkin-Elmer, Cat. No. AD0200) is a nonisotopic immunoassay based on the measurement of 5-bromo-2'-deoxyuridine (BrdU) incorporation during DNA synthesis of growing cells in microplates. Incorporated BrdU is detected using a europium-labeled monoclonal antibody. To allow antibody detection, cells are fixed and the DNA is denatured using Fix solution. Unbound antibody is washed away and DELFIA inducer is added to dissociate europium ions from the labeled antibody into solution, where they form highly fluorescent chelates with components of the DELFIA inducer. Detection utilizes time-resolved fluorometry and the fluorescence measured is proportional to DNA synthesis in the cells of each well.

[0362] Preclinical trials The antibodies described herein can also be tested in in vivo models (e.g., in immune-deficient mice bearing xenograft tumors inoculated with a cell line expressing the tumor antigen) to determine their efficacy in controlling the growth of tumor antigen-expressing tumor cells.

[0363] In vivo testing after xenografting of tumor antigen-expressing tumor cells into immunodeficient mice or other animals can be performed using the antibodies described herein. Antibodies can be administered to tumor-free mice, followed by injection of tumor cells, to measure the efficacy of the antibodies in preventing tumor formation or tumor-related symptoms. Antibodies can be administered to tumor-bearing mice to determine the therapeutic efficacy of each antibody in reducing tumor growth, metastasis, or tumor-related symptoms. Antibody application can be combined with the application of other substances, such as cystostatic drugs, growth factor inhibitors, cell cycle blockers, angiogenesis inhibitors, or other antibodies, to determine the synergistic efficacy and potential toxicity of the combination. To analyze toxic side effects mediated by the antibody, animals can be inoculated with the antibody or a control reagent to thoroughly investigate symptoms possibly related to tumor antigen antibody therapy. Potential side effects of in vivo application of tumor antigen antibodies include toxicity, particularly in tumor antigen-expressing tissues. Antibodies that recognize tumor antigens in humans and in other species, such as mice, are particularly useful for predicting potential side effects mediated by the application of monoclonal tumor antigen antibodies in humans.

[0364] Mapping of epitopes recognized by antibodies can be performed as described in detail in "Epitope Mapping Protocols" (Methods in Molecular Biology), Glenn E. Morris, ISBN-089603-375-9, and in "Epitope Mapping: A Practical Approach" Practical Approach Series, 248, Olwyn MR Westwood, Frank C. Hay.

[0365] The compounds and agents described herein may be administered in the form of any suitable pharmaceutical composition.

[0366] The pharmaceutical compositions are preferably sterile and contain an effective amount of the antibodies described herein and optionally further agents discussed herein to produce the desired reaction or desired effect.

[0367] The pharmaceutical compositions are usually provided in uniform dosage form and may be prepared in a manner known per se The pharmaceutical composition may, for example, be in the form of a solution or a suspension.

[0368] Pharmaceutical compositions can include salts, buffer substances, preservatives, carriers, diluents, and / or excipients, all of which are preferably pharma- ceutically acceptable. The term "pharmaceutical acceptable" refers to the non-toxicity of materials that do not interact with the action of the active ingredients of the pharmaceutical composition.

[0369] Pharmaceutically unacceptable salts may be used to prepare pharma-ceutically acceptable salts and are included in the present invention. Pharmaceutically acceptable salts of this type include, in a non-limiting manner, those prepared from the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, etc. Pharmaceutically acceptable salts can also be prepared as alkali metal salts or alkaline earth metal salts, such as sodium salts, potassium salts, or calcium salts.

[0370] Suitable buffering substances for use in the pharmaceutical compositions include acetic acid in a salt, citric acid in a salt, boric acid in a salt, and phosphoric acid in a salt.

[0371] Suitable preservatives for use in pharmaceutical compositions include benzalkonium chloride, chlorobutanol, parabens, and thimerosal.

[0372] Injectable formulations may contain pharma- ceutically acceptable excipients such as Ringer's lactate.

[0373] The term "carrier" refers to an organic or inorganic component of natural or synthetic nature with which the active ingredient is combined to facilitate, enhance or enable application. According to the present invention, the term "carrier" also includes one or more compatible solid or liquid fillers, diluents or encapsulating substances suitable for administration to a patient.

[0374] Possible carrier materials for parenteral administration are, for example, sterile water, Ringer's, Ringer's lactate, sterile sodium chloride solution, polyalkylene glycols, hydrogenated naphthalenes, and especially biocompatible lactide polymers, lactide / glycolide copolymers, or polyoxyethylene / polyoxypropylene copolymers.

[0375] The term "excipient" as used herein is intended to indicate any substance that may be present in a pharmaceutical composition and which is not an active ingredient, such as, for example, carriers, binders, lubricants, thickeners, surface active agents, preservatives, emulsifiers, buffers, flavoring agents, or coloring agents, etc.

[0376] The agents and compositions described herein may be administered via any conventional route, such as parenteral administration, including by injection or infusion. Administration is preferably parenteral, e.g., intravenous, intraarterial, subcutaneous, intradermal, or intramuscular.

[0377] Compositions suitable for parenteral administration usually include sterile aqueous or non-aqueous preparations of the active compound, preferably isotonic with the blood of the recipient. Examples of compatible carriers and solvents are Ringer's solution and isotonic sodium chloride solution. In addition, sterile fixed oils are usually used as a solution or suspension medium.

[0378] The agents and compositions described herein are administered in an effective amount. An "effective amount" refers to an amount that achieves the desired response or the desired effect, either alone or together with further doses. In the case of the treatment of a particular disease or a particular condition, the desired response preferably relates to the inhibition of the disease process. This includes the slowing down of the progression of the disease, and in particular the halting or reversal of the progression of the disease. The desired response in the treatment of a disease or condition can also be the delay of the onset or the prevention of the onset of said disease or said condition. In particular, the term "effective amount" refers to an amount of therapy that is sufficient to cause the occurrence, recurrence, or prevention of the onset of cancer and one or more symptoms thereof, reduce the severity, duration of cancer, ameliorate one or more symptoms of cancer, prevent the progression of cancer, cause the regression of cancer, and / or prevent cancer metastasis. In one embodiment of the present invention, the amount of therapy is effective to achieve the stabilization, reduction, or elimination of the cancer stem cell population and / or the eradication, removal, or control of the primary cancer, metastatic cancer, and / or recurrent cancer.

[0379] The effective amount of the agent or composition described herein will depend on the condition to be treated, the severity of the disease, the individual parameters of the patient, including age, physiological condition, size and weight, duration of treatment, type of concomitant therapy (if any), specific route of administration, and similar factors. Thus, the dose of the agent described herein to be administered may depend on several such parameters. If the patient's response is inadequate at the initial dose, a higher dose (or an effectively higher dose achieved by a different, more localized route of administration) can be used.

[0380] The agents and compositions provided herein can be used alone or in combination with conventional treatment regimens, such as surgery, radiation, chemotherapy, and / or bone marrow transplantation (autologous, syngeneic, allogeneic, or unrelated).

[0381] Cancer treatment represents a field in which combination strategies are particularly desirable, since the combined action of two, three, four, or even more cancer drugs / therapies often produces synergistic effects that are considerably stronger than the effects of monotherapy approaches. Thus, in another embodiment of the present invention, cancer treatment can be effectively combined with a variety of other drugs. Among these are, for example, combinations with conventional tumor therapy, multi-epitope strategies, additional immunotherapy, and treatment approaches that target angiogenesis or apoptosis (for a review, see, for example, Andersen et al., 2008: Cancer treatment: the combination of vaccination with other therapies, Cancer Immunology Immunotherapy, 57(11):1735-1743). Sequential administration of different agents can inhibit cancer cell proliferation at different checkpoints, while other agents can inhibit, for example, neovascularization, malignant cell survival, or metastasis, potentially transforming cancer into a chronic disease.

[0382] The present invention is further illustrated by the following examples, which should not be construed as limiting the scope of the invention. EXAMPLES

[0383] Example 1 Descriptive analysis of genetic immune polymorphisms Individual patterns of single nucleotide polymorphisms (SNPs) in the patient genome may be predictive for response rate to the therapeutic antibody IMAB 362. To investigate such SNP patterns, all patients were genotyped for several SNPs with known or putative roles in immune response and gastric cancer susceptibility.

[0384] In detail, the following questions were addressed: a. Every patient's SNP genotype for the polymorphism being tested. b. Frequency of SNP genotypes in the patient population. c. Identification of patients with polymorphisms that may directly interfere with IMAB362 mechanism of action (Fc receptor and complement system polymorphisms). d. Accumulation of SNP genotypes per patient described as risk factors for gastric cancer susceptibility, cancer progression, or cancer treatment. e. Correlation of SNP genotypes with clinical outcomes. f. Correlation of SNP genotype with progression-free survival (PFS).

[0385] All patients in cohorts 1, 2, and 3 were analyzed for genetic polymorphisms. Patient blood samples were collected on day 1 (V2a, pre-infusion).

[0386] Whole blood samples (9 ml, EDTA-Monovette) were collected from all patients. EDTA blood was stored in 1 ml aliquots immediately after sample collection at the testing center at -20°C. EDTA blood samples were shipped on dry ice (-70°C) and stored at -20°C. Upon arrival, blood samples were immediately stored at -20°C until DNA isolation.

[0387] The SNPs of interest were selected by literature search, focusing on SNPs known to affect immune system function, in particular SNPs described to affect the mechanism of action of therapeutic antibodies, such as Fc receptor and complement system polymorphisms. SNPs described to affect survival of gastric cancer patients, susceptibility to (gastric) cancer, or progression of gastric cancer were also selected and tested.

[0388] Genetic polymorphisms were analyzed by SNP genotyping TaqMan™ assays (46 standard, 5 tailored; Life Technologies) on the Fluidigm Biomark™ real-time PCR analysis platform. DNA isolation was performed according to standard protocols for isolating genomic DNA from whole blood. The Fluidigm Biomark™ real-time PCR analysis platform allows genotyping up to 96 patient samples with 96 SNPs in one measurement, because the patient samples and specific SNP primers are applied to a lab chip with 96 channels for patient DNA samples and 96 orthogonal channels for SNP assays. Patient genomic DNA was pre-amplified by specific target amplification (STA). The pre-amplified DNA was subjected to TaqMan™ real-time PCR analysis under standard conditions on the Fluidigm Biomark™ real-time PCR analysis platform. Allele calling of SNPs was performed for each patient and each assay using the proprietary Fluidigm software and the statistical analysis software "R". When Fluidigm results were equivocal, a subset of SNPs were confirmed by classical Sanger sequencing.

[0389] Genetic polymorphisms of 51 single nucleotide polymorphisms (SNPs) were determined in 53 patients. Blood samples from one patient did not allow DNA extraction in sufficient quantities to analyze SNPs. Six SNPs were genotyped in a subset of 20 patients only. Genotypes of MDM2 SNP rs2279744 were not determined in nine patients due to technical challenges. The PTGS2 rs20417 genotyping results of one patient were equivocal and were not investigated further.

[0390] Determination of the matrix of SNP genotypes of the tested patients allows statistical testing of the patient population for frequency shifts of genotypes compared to genotype frequencies in the Caucasian control population. The SNP genotype frequencies in the Caucasian control population are based on data collected by the International SNP Genotyping Project (HapMap-CEU, PGA-EUROPEAN-PANEL, CAUC1, pilot_1_CEU_low_coverage_panel, CEU_GENO_PANEL, PDR-90) deposited in the public database dbSNP (National Center for Biotechnology Information, Bethesda, MD, USA). The number of patients per genotype for a given SNP was compared with the number of patients per genotype in the Caucasian control population. The number of patients per genotype in the control population was calculated by multiplying the provided relative SNP genotype frequencies in the population by the reported number of samples tested. This allowed a direct chi-square test to identify statistically significant differences between the patient population and the corresponding control population.

[0391] Chi-square tests were performed for 48 of the 51 tested SNPs. SNP genotype frequency data for SNPs C1QA (rs1044378), FCGR2C (Q57X(C->T)), and MDM2 (rs2279744) have not yet been deposited in a public database. SNPs with statistically significant shifts in genotype frequency between patient and control populations (5 of 48 SNPs, p<0.05) are shown in Figure 1.

[0392] Four of these five SNPs have been shown to play a role in cancer / gastric cancer susceptibility, and all four cancer / gastric cancer susceptibility SNPs indeed show an over-representation of the respective cancer-associated genotype in the patient population, as expected for gastric cancer patients (Table 1).

[0393] One of these five SNPs, rs12146727 (C1S), has not been shown to be a risk / susceptibility factor for cancer or gastric cancer so far, and this SNP has only previously been described as a putative risk factor for cardiovascular disease.

[0394] [Table 2]

[0395] 49 of the 51 tested SNPs in the patient population show variant allele patterns in the tested patient population. This allows the examination of SNP allele frequency shift between patient subpopulations, which ideally can help identify putative responder populations. Only two SNPs, C1QA (rs1044378) and FCGR2C (AHN1ME8), show invariant SNP genotypes in all patients, and therefore do not allow any kind of differential analysis. For five SNPs, statistically significant allele frequency shifts can be determined in this study compared to the control population, providing proof of principle that SNP allele frequency depends on the composition of a given population. Therefore, the tested SNP selection is highly suitable for future identification of SNP biomarker candidates.

[0396] Fc receptor and complement system polymorphisms may directly interfere with IMAB362 mechanism of action. Patients were genotyped for SNP alleles in genes that may affect the efficacy of antibody-based therapy, such as FCGR3A (F176V[T→G], rs396991), FCGR2A (H131R[T→C], rs1801274), and C1QA ([276A→G], rs172378) (Table 2).

[0397] Patients were further genotyped for published SNP alleles of the FCGR2C gene (Q57X[C→T], no rs number) and of complement system factors C1S (R119H[G→A], rs12146727) and C1QA (rs292001, rs1044378). These SNPs have not yet been demonstrated to affect antibody therapy but were included as candidate SNPs of interest.

[0398] [Table 3]

[0399] A total of 23 patients exhibited at least one of the well-documented Fc receptor and complement system polymorphisms. Four patients (100411, 101120, 200336, and 400109) were homozygous for the FCGR3A allele (F176V[T→G]), which has been reported to increase response rates and progression-free survival in antibody therapy. Twelve patients were homozygous for the FCGR2A allele (H131R[T→C]), and an additional 10 patients were homozygous for the C1QA allele ([276A→G]). Both of these SNPs have been demonstrated to negatively affect antibody therapy. In total, 21 patients are homozygous for the FCGR2A allele (H131R[T→C]) or the C1QA allele ([276A→G] (patient 100511 is homozygous for both SNP alleles).

[0400] Correlation of the above findings with patient disease progression may provide insight into the role of Fc receptor and complement system polymorphisms in relation to IMAB362 treatment.

[0401] The progression of disease in patients and the efficacy of antibody treatment may be influenced by the accumulation of SNPs described as risk factors for gastric cancer susceptibility, cancer progression, or cancer treatment. Among the 51 SNPs investigated, up to 43 SNPs allow classification of each SNP genotype as a "risk" versus "non-risk" genotype. The number of homozygous SNP risk factor genotypes per patient was counted because these are commonly described as the most associated risk alleles. The relative frequency of the number of homozygous risk genotypes per patient with respect to the number of investigated SNP risk factors per patient is presented in Figure 2.

[0402] An accumulation of 14–46% of the investigated risk genotypes per patient is observed. This wide distribution allows us to investigate whether the accumulation of SNP risk genotypes per patient correlates with the patient's clinical outcome.

[0403] In summary, 53 of 54 patients are successfully genotyped for 51 SNPs. 49 of 51 SNPs show variant SNP allele patterns, allowing analysis of patient subpopulations for significant shifts in SNP genotype frequencies. Homozygous Fc receptor and complement system polymorphisms described as regulators of antibody therapy are found in 23 of 53 patients. An accumulation of 14-46% of investigated risk genotypes per patient is observed.

[0404] Example 2 Correlation of SNP genotyping with clinical outcome The goal of correlating clinical outcomes with genetic polymorphism genotypes is to identify putative SNP biomarker candidates that predict patient clinical outcomes. The putative biomarker candidates identified in this analysis will be validated in subsequent Phase IIb and Phase III studies. Validation of the putative biomarker candidates in Phase IIb allows for differentiation between putative prognostic and predictive SNP candidates.

[0405] Correlation analyses for each SNP with clinical outcomes were performed independently on two defined Phase IIa clinical trial patient populations: the "Full Analysis Set" population (FAS) with 40 patients and the "Per Protocol Set" population with 21 patients.

[0406] The absolute frequency of the genotypes of each SNP for each clinical outcome group ("responders", "non-responders") of the patient population was quantified by SAS Enterprise Guide 6.1. The absolute genotype frequencies were organized in contingency tables (3x2 or 2x2) structured by clinical outcome and SNP genotype. The standard statistical test used was the Pearson Chi-square test. When the numerical structure of the data set did not allow the use of the Pearson Chi-square test, the Fisher's exact test was applied in some cases for 2x2 contingency tables. The level of statistical significance applied was p<0.05. Correlation analysis was realized with the statistical analysis software SAS Enterprise Guide 6.1.

[0407] To investigate the effect of SNP genotypes on progression-free survival, Kaplan-Meier curves were calculated for each group and then formally compared using the statistical log-rank test. The level of statistical significance applied was p<0.05. The log-rank statistic was realized with the statistical analysis software SAS Enterprise Guide 6.1.

[0408] Correlation of clinical outcomes with SNP genotyping is performed to identify putative predictive or prognostic SNP biomarker candidates. Correlations were tested in two patient populations, the FAS population and the PP population.

[0409] The FAS cohort includes 40 patients, 12 patients confirmed as "responders" (clinical outcome "partial remission" or "stable disease") and 28 patients as "non-responders" (clinical outcome "progression of disease"). One patient sample from the FAS cohort (100801, non-responder) was unavailable for the SNP analysis described above, thus reducing the maximum number of FAS patients analyzed for correlation to 39. The PP cohort includes 21 patients, 10 responder patients and 11 non-responder patients.

[0410] The number of patients investigated per SNP varied between 20 and 39 (in the FAS cohort) and 20-21 (in the PP cohort).

[0411] Correlation analysis was performed as described above. In total, of the 51 SNPs tested, two show a statistically significant correlation with clinical outcome in the FAS and PP populations.

[0412] The two SNPs showing statistical correlation between clinical outcome and the respective SNP genotype in both populations were FCGR2A rs1801274 (p=0.0004[PP]; p=0.008[FAS]) and IL-10 rs1800896 (p=0.042[PP], p=0.022[FAS]) (Table 3). The number of statistically tested patients per SNP was 21 (PP) and 39 (FAS) for these two SNPs, respectively.

[0413] [Table 4]

[0414] Five SNPs show a correlation with clinical outcome in one patient population (FAS or PP) as can be shown for DNMT3A rs1550117 [PP, p=0.035], SMAD4 rs12456284 [FAS, p=0.02], MUC1 rs4072037 (FAS, p=0.03), EGF rs4444903 [FAS, p=0.049], and CDH1 rs16260 [FAS, p=0.049] (Table 4).

[0415] [Table 5]

[0416] Examining the over- or under-representation of SNP genotypes in responder / non-responder patients may make it possible to provide a scientific explanation for statistically significant frequency differences.

[0417] Genotypes of two SNPs, rs11615 (ERCC1) and rs396991 (FCGR3A), correlate with long progression-free survival (PFS) in the PP population (Table 5).

[0418] [Table 6]

[0419] The number of statistically tested patients per SNP was 21 (PP) and 39 (FAS) for each of the 9 SNPs listed.

[0420] FCGR2A rs1801274[C / T]: In PP, all patients carrying the heterozygous rs1801274[CT] genotype were indeed responders (8), which is reflected in the highly significant p-value of the statistical test (0.0004). All PR patients (4 out of 4) display this genotype. Most non-responders (73%, 8 out of 11) show the homozygous [TT] genotype (Table 6). This genotype distribution pattern can be found in the FAS population as well, but is less clear than in the PP population (Table 7). Some non-responder patients in the FAS population also carried the [CT] genotype (30%), which leads to a less pronounced but still highly statistically significant p-value.

[0421] [Table 7]

[0422] [Table 8]

[0423] Survival analysis FCGR2A rs1801274[C / T]: The highly significant over-representation of rs1801274 genotype [CT] in the responder population is also expected to be reflected in the correlation with long progression-free survival (PFS) time. Indeed, in both populations PP (Figure 3) and FAS (Figure 4), the [CT] genotype is similarly highly significantly correlated with long PFS (PP p=0.0007, FAS p=0.03). However, it is interesting to note that during the first 60 treatment days, FAS patients with the [TT] genotype tend to have a higher PFS rate than those with the [CC] or [CT] genotype. Thus, the survival analysis confirms rs1801274 (FCGR2A) as a highly interesting putative biomarker candidate for predictive or prognostic traits.

[0424] In IL-10 rs1800896[A / G]:PP, none of the non-responder patients carried the homozygous rs1800896[GG] genotype (Table 8). This genotype is found at elevated frequency (40%) in responder patients (4 out of 10). Only 1 out of 10 responders (10%) exhibits the [AA] genotype, the remaining responders exhibiting the heterozygous [GA] genotype. In FAS, a comparable genotype frequency distribution can be observed (Table 9), but the [GG] genotype can be observed at low frequency (11%, 3 out of 27) in non-responder patients in this population.

[0425] [Table 9]

[0426] [Table 10]

[0427] Survival analysis rs1800896 (IL-10) [A / G]: rs1800896 [GG] genotype is significantly over-represented in responder patients. Statistical correlation of [GG] genotype with PFS shows that in PP and FAS populations, [GG] genotype is not significantly correlated with PFS (PP p=0.27 (Figure 5); FAS p=0.08 (Figure 6)). However, the p-value of FAS survival correlation borders on significance, which may be an indication that significance may be well reached in a larger population with reduced statistical noise. Overall, rs1800896 (IL-10) is an interesting putative biomarker candidate.

[0428] In DNMT3A rs1550117[G / A]:PP, 4 responders (40%) showed the [GA] genotype, whereas all non-responders showed the [GG] genotype (p=0.03, Table 10).

[0429] [Table 11]

[0430] Survival analysis rs1550117 (DNMT3A) [G / A]: The rs1550117 [GA] genotype is significantly over-represented in responder patients in the PP population. In the FAS population, the difference in PFS between [GA] and [GG] carriers was of borderline significance (FAS p=0.058) (Figure 7).

[0431] In the FAS population, only one patient is a carrier of the [AA] genotype.

[0432] SMAD4 rs12456284[G / A]: In the FAS, a statistically significant over-representation of the [GA] genotype over the [AA] and [GG] genotypes (7 out of 12 patients, 58%) can be found in the responder population (p=0.023, Table 11). In the FAS non-responder population, the frequency of the [GA] genotype can be found with a frequency of 19% (5 out of 27 non-responders). In the PP population, this association is shown by a significant trend (p=0.081, data not shown).

[0433] [Table 12]

[0434] Survival analysis rs12456284 (SMAD4) [G / A]: The rs12456284 [GA] genotype is significantly over-represented in FAS responder patients and shows the same trend in PP responders. Statistical correlation of rs12456284 genotype with PFS shows that in the PP population, the [GA] genotype is significantly correlated with PFS using the Gehan-Breslow-Wilcoxon test (PP p=0.048) (Figure 8), while the significance using the log-rank test is p=0.35. The Gehan-Breslow-Wilcoxon test gives more weight to PFS events at earlier time points than the log-rank test, and indeed the difference between [GA] and [AA] carriers is most pronounced during the first 100 days of each of this phase IIa clinical trial. In the FAS population, the [GA] genotype is not significantly correlated with PFS (p=0.20 (log-rank), p=0.23 (Gehan-Breslow-Wilcoxon)), but visual inspection suggests a trend toward longer PFS in [GA] carriers.

[0435] MUC1 rs4072037[A / G]: In the FAS, the rs4072037 genotype found with the highest frequency of 67% in the responder population is [AA] (8 out of 12), while non-responders display this genotype in only 26% of patients (7 out of 27). None of the responder patients showed the homozygous [GG] genotype (Table 12), while non-responders display the [GG] genotype in 22% of cases (6 out of 27). This differential genotype distribution in responder and non-responder FAS patients is statistically significant (p=0.03). A comparable genotype distribution pattern was found in the PP population (data not shown), where responders show almost the same relative [AA] genotype frequency of 70% as in the FAS population (significance of trend p=0.11).

[0436] [Table 13]

[0437] Survival analysis rs4072037(MUC1)[A / G]: The significant over-representation of rs4072037 genotype [AA] in responder patients may indicate a correlation of this genotype with PFS. Statistical tests reveal that the [AA] genotype is significantly correlated with PFS in the PP and FAS populations (PP p=0.001 (Figure 9); FAS p=0.02 (Figure 10)). This survival analysis confirms rs4072037(MUC1) as a very interesting putative predictive or prognostic biomarker candidate.

[0438] EGF rs4444903[G / A]: In the FAS, the rs4444903 genotype [AA] is significantly over-represented in the responder population (5 of 12; 42%) compared to the non-responder population (3 of 27; 11%) (p=0.049) (Table 13). In the PP population, this asymmetric distribution is not statistically significant (p=0.32, data not shown).

[0439] [Table 14]

[0440] Survival analysis rs4444903(EGF)[G / A]: The correlation of rs4444903[AA] genotype with PFS in PP or FAS populations was not statistically significant (FAS p=0.1; PP p=0.16). However, a trend towards longer PFS could be observed in both PP and FAS populations (Figure 11).

[0441] CDH1 rs16260[C / A]: In FAS, the rs16260 genotype [AA] is found significantly more frequently in responders (5 of 12; 42%) than in the non-responder population (3 of 27; 11%) (p=0.049, Table 14). In PP, this asymmetric distribution between both patient groups is not significant (p=0.72, data not shown).

[0442] [Table 15]

[0443] Survival Analysis rs16260 (CDH1) [C / A]: The rs16260 (CDH1) genotype [AA] correlation with PFS borders on statistical significance in the FAS population (log-rank test p=0.065, Gehan-Breslow-Wilcoxon test p=0.032) (Figure 12).

[0444] ERCC1 rs11615[C / T]: In PP, a trend towards a higher frequency of the rs11615 genotype [TT] in the responder population (3 out of 10; 30%) is found (p=0.068; non-responder population (0%)). Conversely, the homozygous [CC] genotype is found only in the non-responder population (2 patients) (Table 15).

[0445] [Table 16]

[0446] Survival analysis rs11615 (ERCC1) [C / T]: rs11615 [TT] genotype is found exclusively in the responder group in the PP population. The statistical correlation of rs11615 genotype with PFS shows that rs11615 genotype in PP is highly significantly correlated with PFS, and [CT] and [TT] carriers show longer survival time compared with [CC] carriers (PP p=0.0001) (Figure 13). Despite this significant value, it should be noted that there are only two patients with [CC] genotype and three patients with [TT] genotype in PP. However, the same effect can be observed as a trend in the FAS population (FAS p=0.13, data not shown), suggesting that the effect is also valid for a larger patient population.

[0447] Survival analysis FCGR3A rs396991 [T / G]: In neither PP nor FAS, the genotype of SNP rs396991 is correlated with clinical outcome (FAS p=0.49; PP p=0.29, data not shown). However, survival analysis in the PP population shows with high statistical significance that patients with genotypes [TG] and [TT] show improved PFS compared to [GG] (p=0.0007, Figure 14). This effect can also be observed in the FAS population (p=0.25; data not shown). It should be noted that despite the significant value received for the PP population, only three PP patients are [GG] carriers.

[0448] Example 3 Concomitant immunological polymorphism analysis considerations The primary objective of this clinical Phase IIa trial was to evaluate the safety and efficacy of the therapeutic anti-CLDN18.2 mononuclear antibody IMAB362 in patients with gastroesophageal adenocarcinoma. In addition, concomitant analysis of genetic immune response polymorphisms was performed to evaluate parameters that may serve as potential predictive or prognostic biomarkers in correlation with IMAB362 therapy.

[0449] Consideration of explanatory immune polymorphism analysis Genetic polymorphisms in a patient's genome have been shown to alter response rates to therapeutic antibodies. To investigate the impact of individual genetic variations on response rates, 51 single nucleotide polymorphisms (SNPs) with known or putative roles in immune responses and gastric cancer susceptibility or progression were genotyped in patients.

[0450] In this study, 51 SNPs were successfully genotyped in 53 of the 54 patients tested. A statistically significant shift in genotype frequency in the patient population compared to the control population could be detected for five SNPs. Four of these SNPs have previously been shown to be associated with cancer / gastric cancer susceptibility. The cancer / gastric cancer-associated genotypes of each of these four SNPs are over-represented in the study population, as would be expected in a patient population with advanced GC. The over-representation of the respective homozygous genotypes may indicate a recessive mechanism of action affecting impaired gene function as opposed to enhanced gene activity. This is highlighted by published data, for example, where it has been reported that the gastric cancer-associated AA genotype of SNP rs16260 in CDH1 causes downregulation of CDH1 expression due to its location in the promoter of CDH1 at -160.

[0451] Polymorphisms in genes involved in immune signaling were investigated, even if these polymorphisms had not been previously described as gastric cancer risk factors. Genetic polymorphisms in genes encoding immune signaling factors have been shown to significantly modulate the risk of developing gastric cancer. Thus, the response rate of antibody-based cancer therapy may be similarly influenced by these SNPs.

[0452] The over-represented IL-2 genotype GG (SNP rs2069762) in patient populations is associated with an increased risk of gastric atrophy induced by H. pylori infection and may predispose to gastric cancer. CTLA4 SNP rs231775 and rs2274223 (PLCE1) genotypes have been described as GC susceptibility risk factors. However, published studies on rs231775 are conflicting regarding the genotype sequence, so no conclusions can be drawn here.

[0453] Fcγ receptor and complement system polymorphisms were investigated in this study. The possibly beneficial FCGR3A genotype encoding Val / Val[GG] was detected in 4 APT patients, and the potentially negative FCGR2A genotype (Arg / Arg)[CC] could be detected in 12 APT patients.

[0454] CDC as a second effector mechanism has been demonstrated to be influenced by SNP polymorphisms as well: allele carriers of a polymorphism in complement component C1qA ([276A->G], rs172378) show a prolonged response after rituximab therapy in follicular lymphoma. Complement system polymorphisms in C1QA with the genotype "GG" were detected in 10 patients, possibly negatively influencing the response. However, the SNP polymorphism rs12146727 in complement component C1S has so far only been described in screening not related to antibody therapy or cancer.

[0455] Identification of significant genotype frequency shifts between patient and control populations demonstrates that SNP genotype frequency shifts can serve as predictive and prognostic markers in clinical trials.

[0456] Accumulation of SNP risk alleles may also have an impact on the clinical outcome of patients.To allow such analysis, the number of homozygous SNP risk genotypes is counted per patient.The correlation of these numbers with therapy response may provide insight into the role of SNP risk factor accumulation.

[0457] Correlation of SNP genotyping with clinical outcomes FCGR2A rs1801274: Examination of over- or under-represented FCGR2A genotypes reveals that in the PP population, all patients with the heterozygous rs1801274 genotype [CT] are responder patients, and patients with partial response (PR) exclusively carry this genotype. The homozygous genotype over-represented in the non-responder population is [TT]. The mere observation of these frequency distributions does not allow the conclusion that the [CT] genotype is beneficial or not, or that [TT] is disadvantageous or not. In most studies investigating the effect of SNP genotypes, each homozygous genotype shows the strongest biological effect, often indicating a recessive mechanism of action reflecting impaired gene function of both alleles as opposed to enhanced gene activity. In cases where SNP alleles increase genetic activity, a graded effect of biological effect can often be observed: one allele (i.e., heterozygous) increases gene activity, and two alleles (i.e., homozygous) increase gene activity even more. In both cases, gain of function or loss of function, the strongest biological / clinical effect is usually observed in patients with homozygous genotypes. Under this assumption, over-representation of homozygous [TT] genotypes in the non-responder population in the PP and FAS populations causes adverse effects.

[0458] However, this is unexpected, because the rs1801274 FCGR2A[TT] genotype has been described in several clinical trials as a factor with a prolonged effect on PFS. In our Phase IIa clinical trial, closer examination of the association between genotype and PFS in FAS non-responder patients shows that FAS PD patients with [TT] genotype do indeed show a trend towards longer PFS time during the first 60 days of therapy, in contrast to FAS PD patients with [CT] genotype (compare Table 7 and Figure 4). The interpretation of this observation consistent with the under-representation of [TT] in responders with long-term PFS may be the overlap of two different molecular mechanisms: first, the rs1801274[CT] genotype may be a marker for responder patients. This is a new observation not described in the literature so far, which may suggest that this genotype is a predictive marker for treatment with IMAB362. The molecular mechanism underlying this new observation remains to be elucidated.

[0459] The second observation, already described in the literature for other therapeutic anticancer antibodies, is the prolonged PFS of patients carrying the FCGR2A[TT] genotype. In our phase IIa study, this effect is due to the superposition of the first hypothesized mechanism, which is only observable as a trend in non-responder patients. Mechanistically, the second observation can be explained by the increased binding affinity of IgG1 antibodies to the FCGR2A 131 His / His receptor allele (encoded by the [TT] genotype), in contrast to the weaker binding affinity of IgG1 antibodies to the homozygous FCGR2A 131 Arg / Arg receptor allele (encoded by the [CC] genotype): in a study systematically investigating the influence of Fcγ receptor polymorphisms, it was recently shown that antibodies of IgG1 isotype indeed bind with different affinities to the two allelic forms of Fcγ receptor IIA, H131, with higher affinity than R131. It is commonly hypothesized that the differential affinity of IgG antibodies to FCGR2A receptor alleles affects the rate of triggering of effector mechanisms and therefore the long-term PFS in patients carrying high-affinity receptor alleles. Data supporting this hypothesis are provided by reports showing that Fcγ receptor polymorphisms FCGR2A H131R and FCGR3A F176V (Phe>Val, rs396991) may have an impact on the clinical efficacy of trastuzumab-based IgG1 antibody therapy in patients with metastatic breast cancer. Patients with the genotypes FCGR3A 176 Val / Val and FCGR2A 131 His / His showed significantly better response rates and progression-free survival. The same polymorphisms are also associated with the response rates of rituximab (IgG1)-treated patients with B-cell lymphoma. In another study, the long-term PFS after cetuximab (IgG1) therapy could be associated with the FCGR3A 176 Val / Val genotype.

[0460] As is often discussed, there are recent well-powered studies that report no association between Fcγ receptor polymorphisms and survival, response rate, or progression-free survival for the discussed antibodies. In the Breast Cancer International Research Group (BCIRG) BCIRG-006 trial, 1218 patients were treated in a randomized study with two trastuzumab-containing arms and a non-trastuzumab control arm. The above reported association between Fcγ receptor polymorphisms and trastuzumab efficacy could not be confirmed. A long-term study in 460 patients using rituximab in combination with chemotherapy in follicular lymphoma reported no association of Fcγ receptor polymorphisms with progression-free survival. In the REACH trial in 419 patients in which patients received fludarabine and cyclophosphamide (FC), or rituximab + FC, FCGR2A and FCGR3A polymorphisms did not significantly affect outcome. A recent cetuximab trial also produced inconsistent findings and did not recommend Fcγ receptor polymorphisms as useful biomarkers, which may reflect intrinsic population factors or differences in concomitant chemotherapy regimens.

[0461] MUC1 rs4072037: MUC1 is a transmembrane glycoprotein of the mucin family. Mucins are high molecular weight proteins that are extensively O-glycosylated in the N-terminal extracellular domain with oligosaccharides and n-glycan chains. Mucins are expressed on the apical surface of epithelia lining the airways and gastrointestinal tract as well as ducts in the liver, pancreas, and kidney. Transmembrane mucins span the membrane with one α-helix, providing these glycans with a protective lining to the extracellular space. Mucins secreted into the extracellular space constitute the mucus gel layer, which serves as an additional physical protection for the epithelium.

[0462] Transmembrane MUC1 and secreted mucins MUC5C and MUC6 are the main mucins expressed in the stomach. MUC1 is translated as a single polypeptide chain that is susceptible to autocleavage. The N-terminal extracellular domain (MUC1-N) remains initially non-covalently connected to the transmembrane / cytoplasmic domain (MUC1-C). This cytoplasmic domain serves as a signaling domain that can enter the nucleus and associate with several transcription factors to directly activate gene expression. Cellular stress can cause the MUC1-N and MUC1-C domains to be proteolytically cleaved through a second proteolytic site. This can also be observed in cancer cells, where MUC1 is no longer expressed in an ordered manner at the apical membrane of the cell, but may be found overexpressed and localized throughout the cell. The result is the shedding of the extracellular domain (also known as CA15-3) into the extracellular space and the intracellular localization of MUC1-C. The cytoplasmic signaling domain acts as an oncogene, for example, by activating Wnt / β-catenin signaling and blocking apoptotic pathways.

[0463] However, the extracellular domain of MUC1 is not only a static structural component but also plays an important role during signaling events in the cell membrane. It has been demonstrated that the glycosylation and expression status of the MUC1 extracellular domain regulates the interaction of membrane signaling molecules with the extracellular matrix. It has been reported that underglycosylated MUC1-N in tumor cells increases the signaling between membrane molecules such as ICAM-1 or E-selectin and the MUC1 core protein. Furthermore, mucin expression and glycosylation status seem to shield membrane-associated molecules. In cancer cells, shielding of HER2 protein by mucin expression has been described as a possible resistance mechanism to trastuzumab therapy.

[0464] The MUC1 polymorphism rs4072037 "A" allele has been described as a risk factor for gastric cancer susceptibility. This polymorphism is a G->A exchange in exon 2, which results in alternative splicing of MUC1 precisely at the predicted signal peptide cleavage site of MUC1. Insufficient cleavage of the signal peptide may lead to aberrant MUC1 protein localization or glycosylation patterns and therefore defective protein function.

[0465] In this Phase IIa clinical trial, the rs4072037[AA] genotype was found to be statistically associated with the responder population. It can be speculated that the underglycosylated or low-expressed [AA] allelic form of MUC1 may allow better access of IMAB362 to the membrane target molecule CLDN18.2 expressed on cancer cells, thus promoting therapeutic efficacy. This should make rs4072037 a predictive biomarker.

[0466] IL-10 rs1800896: IL-10 is a key regulator of the immune system with pleiotropic functions. It is known to act as an anti-inflammatory, immunosuppressive cytokine by inhibiting macrophage-dependent antigen-specific T cell proliferation and macrophage-dependent production of cytokines by T cells. However, IL-10 has also been described as an immunostimulatory cytokine that enhances B cell, granulocyte, and mast cell differentiation and proliferation, as well as NK cell and CD8+ T cell activation. The pleiotropic potential of IL-10 is also reflected by its widespread expression in many immune cell types, including Th2 cells, Treg cells, Th3 cells, NK T cells, B cells, macrophages, and dendritic cells. This dual role of IL-10 is reflected in its tumor-promoting and tumor-inhibiting capabilities: IL-10 secreted by tumor cells or tumor-infiltrating immune cells as macrophages allows tumor cells to escape immunological surveillance by mechanisms that are only partially revealed. One described mechanism involves Treg cells contributing to the induction of peripheral tolerance through the expression of immunoregulatory cytokines such as IL-10. Another reported mechanism is the inhibition of cross-presentation of tumor-associated antigens by dendritic cells, thus preventing T cells from mounting an effective immune response against tumor cells. On the other hand, exposure of malignant tumor cells to IL-10 downregulates HLA class I proteins and increases their susceptibility to NK cell cytotoxicity.

[0467] The IL-10 promoter polymorphism rs1800896 at position (-1082) is interesting because the "G" allele has been reported as a risk factor for gastric and renal cancer. The "G" allele of this polymorphism has been reported to be associated in vitro with reduced IL-10 expression compared to the "A" allele. In responder patients of this Phase IIa clinical trial, the [GG] genotype of rs1800896 is over-represented and likely shows a lower relative expression level of IL-10. It can be speculated that patients carrying the [GG] genotype have a lower IL-10 expression, which in turn may make it more difficult for tumor cells to escape immunological surveillance by one of the mechanisms mentioned above. Indeed, none of the 12 FAS responder patients show elevated IL-10 serum levels in contrast to 22% of FAS non-responder patients (6 out of 27 measured). However, other authors state that the "A" allele is associated with reduced IL-10 expression.

[0468] It should also be noted that IL-10 signals through the intracellular mediator Stat3, and Stat3 activation is dependent on MUC1-C. Therefore, the functional interaction of MUC1 with IL-10 may be the reason why both of these molecules proved to be statistically significant biomarker candidates in this Phase IIa clinical trial. Finally, FCGR2A is expressed on macrophages, which are often the main source of IL-10 in the tumor microenvironment. If these putative biomarker candidates become prevalent in ongoing and future trials, the investigation of the functional interactions of these factors may be of great interest.

[0469] rs1550117 (DNMT3A): rs1550117 is a SNP in the DNMT3A gene that encodes the enzyme DNA (cytosine-5)-methyltransferase 3A, which catalyzes the transfer of methyl groups to specific CpG structures in DNA, inducing epigenetic modifications. The genotype [AA] has been shown to increase the risk of gastric cancer compared with [GG] or [GA]. In this study, [AA] could be found in only one patient in the FAS population and none in the PP population. This may indicate that [AA] also confers a survival risk and prevents third and fourth line treatment of [AA] carriers in this phase IIa clinical trial. The finding that [GA] significantly correlates with clinical outcomes in PP suggests that this marker holds potential as a predictive biomarker for IMAB362 treatment.

[0470] rs12456284 (SMAD4): rs12456284 is a SNP in the SMAD4 gene that encodes the intracellular TGFβ / BMP signaling co-transducer "mother's against decapentaplegic homolog 4". It has been published that the [GG] genotype significantly reduced the risk of gastric cancer. The statistically significant over-representation of the heterozygous [GA] genotype over the [AA] genotype in the FAS responder population suggests that this genotype may serve as a predictive biomarker. The long PFS of patients in the PP population carrying [GA] is a supporting fact.

[0471] rs4444903 (EGF): The functional polymorphism rs4444903 in the promoter region of the EGF gene was observed to modulate EGF protein levels, and higher amounts of EGF factor were detected in the serum of [GG] carriers. The G allele of this polymorphism and the [GG] genotype showed a significant correlation with an increased risk of gastrointestinal cancer in a meta-analysis.

[0472] In this phase IIa clinical trial, the genotype [AA] was significantly over-represented in FAS responders, and patients with this genotype showed a trend towards longer PFS in the FAS and PP populations, which may indicate that the rs4444903 [AA] genotype is a predictive or prognostic biomarker.

[0473] rs16260 (CDH1): The cell adhesion protein cadherin-1 (E-cadherin) is a member of the calcium-dependent cadherin superfamily. Loss of function has been implicated in cancer progression. The rs16260[A] allele in the CDH1 promoter has been demonstrated to reduce the transcriptional efficiency of cadherin-1. Furthermore, the -160A allele of CDH1 has been described as a susceptibility factor for the development of gastric cancer.

[0474] In this study, rs16260[AA] genotype carriers were statistically over-represented in FAS responders, which may suggest that the [AA] genotype is a putative predictive biomarker.

[0475] rs11615(ERCC1) and rs396991(FCGR3A): Two SNPs, rs11615 (ERCC1, DNA repair protein "excision repair cross-complementing group 1") and rs396991 (FCGR3A, low affinity immunoglobulin gamma Fc domain receptor III-A), both show a correlation of genotype (ERCC1 [TT], FCGR3A [TG], and [TT]) with long-term PFS, which may suggest that these SNPs are predictive or prognostic biomarkers.

[0476] [Table 17]

[0477] New International Patent Applications Ganymed Pharmaceuticals AG et al. "Methods and compositions for predicting therapeutic efficacy of cancer treatment and cancer prognosis" Our reference: 342-85 PCT Additional sheets for biological materials Further deposit identification: 1) Name and address of the depository institution for the deposited materials (DSM ACC2738, DSM ACC2739, DSM ACC2740, DSM ACC2741, DSM ACC2742, DSM ACC2743, DSM ACC-2745, DSM ACC2746, DSM ACC2747, DSM ACC2748): DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH Mascheroder Weg 1b 38124 Braunschweig DE 2) Name and address of the depository institution for the deposited materials (DSM ACC2808, DSM ACC2809, DSM ACC2810): DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH Inhoffenstr. 7 B 38124 Braunschweig DE

[0478] [Table 18]

[0479] Additional notice for all above mentioned deposits: - Mouse (Mus musculus) myeloma P3X63Ag8U.1 fused to mouse (Mus musculus) splenocytes - Hybridoma secreting antibody against human claudin-18A2 3) Depositor: All of the above mentioned deposits were made by: Ganymed Pharmaceuticals AG Freiligrathstrasse 12 55131 Mainz DE

Claims

[Claim 1] (i) whether a cancer patient with a tumor antigen-positive tumor is a responder to treatment with an antibody against the tumor antigen, and / or (ii) whether a cancer patient, preferably a cancer patient with a tumor antigen-positive tumor, will experience progression-free survival; 1. A method for assessing a patient's genotype comprising determining the genotype of one or more single nucleotide polymorphisms selected from the group consisting of FCGR2A rs1801274, MUC1 rs4072037, IL-10 rs1800896, DNMT3A rs1550117, SMAD4 rs12456284, EGF rs4444903, CDH1 rs16260, ERCC1 rs11615, and FCGR3A rs396991 in a sample obtained from the patient.

Images